#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB7	22	genome.wustl.edu	37	X	74296459	74296459	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:74296459T>C	ENST00000373394.3	-	5	491	c.484A>G	c.(484-486)Aaa>Gaa	p.K162E	ABCB7_ENST00000534570.1_5'Flank|ABCB7_ENST00000339447.4_Missense_Mutation_p.K122E|ABCB7_ENST00000253577.3_Missense_Mutation_p.K163E			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	162	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						ACAGCATATTTAAACATGAAG	0.363																																						dbGAP											0													117.0	91.0	100.0					X																	74296459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.484A>G	X.37:g.74296459T>C	ENSP00000362492:p.Lys162Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.K163E	ENST00000373394.3	37	c.487		X	.	.	.	.	.	.	.	.	.	.	T	26.8	4.775313	0.90108	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949;ENST00000534524	D;D;D;D;D	0.92397	-2.55;-2.55;-2.55;-2.55;-3.03	5.48	5.48	0.80851	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.97576	0.9206	H	0.98178	4.165	0.80722	D	1	D;D;D;D;D	0.89917	0.997;1.0;1.0;0.998;1.0	D;D;D;D;D	0.83275	0.972;0.992;0.996;0.983;0.992	D	0.98698	1.0699	10	0.87932	D	0	-0.0297	13.6888	0.62533	0.0:0.0:0.0:1.0	.	136;122;163;162;163	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	E	136;163;122;162;136;107	ENSP00000253577:K163E;ENSP00000343849:K122E;ENSP00000362492:K162E;ENSP00000436586:K136E;ENSP00000435521:K107E	ENSP00000253577:K163E	K	-	1	0	ABCB7	74213184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.689000	0.84165	1.828000	0.53243	0.441000	0.28932	AAA	ABCB7	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000131269		0.363	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	168	0.00	0	T	NM_004299		74296459	74296459	-1	no_errors	ENST00000253577	ensembl	human	known	69_37n	missense	80	34.43	42	SNP	1.000	C
ABCC1	4363	genome.wustl.edu	37	16	16218677	16218677	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:16218677A>G	ENST00000399410.3	+	25	3797	c.3622A>G	c.(3622-3624)Aac>Gac	p.N1208D	ABCC1_ENST00000346370.5_Missense_Mutation_p.N1152D|ABCC1_ENST00000349029.5_Missense_Mutation_p.N1093D|ABCC1_ENST00000345148.5_Missense_Mutation_p.N1208D|ABCC1_ENST00000399408.2_Missense_Mutation_p.N1218D|ABCC1_ENST00000351154.5_Missense_Mutation_p.N1149D	NM_004996.3	NP_004987.2	P33527	MRP1_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 1	1208	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				arachidonic acid metabolic process (GO:0019369)|ATP catabolic process (GO:0006200)|cobalamin metabolic process (GO:0009235)|leukotriene metabolic process (GO:0006691)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			breast(3)|endometrium(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(5)|prostate(1)|skin(3)	56					Abiraterone(DB05812)|Aminohippurate(DB00345)|Amprenavir(DB00701)|Atazanavir(DB01072)|Atorvastatin(DB01076)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Diclofenac(DB00586)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Epirubicin(DB00445)|Erythromycin(DB00199)|Etoposide(DB00773)|Fluorescein(DB00693)|Glutathione(DB00143)|Glyburide(DB01016)|Ibuprofen(DB01050)|Idarubicin(DB01177)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Methotrexate(DB00563)|Mifepristone(DB00834)|Mitoxantrone(DB01204)|Ofloxacin(DB01165)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Probenecid(DB01032)|Progesterone(DB00396)|Rifampicin(DB01045)|Ritonavir(DB00503)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|Saxagliptin(DB06335)|Sulfinpyrazone(DB01138)|Vandetanib(DB05294)|Vemurafenib(DB08881)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Zoledronate(DB00399)	GTGTGTGGGCAACTGCATCGT	0.572																																						dbGAP											0													99.0	109.0	105.0					16																	16218677		2163	4269	6432	-	-	-	SO:0001583	missense	0			L05628	CCDS42122.1	16p13.1	2012-03-14			ENSG00000103222	ENSG00000103222		"""ATP binding cassette transporters / subfamily C"""	51	protein-coding gene	gene with protein product		158343	"""multidrug resistance associated protein 1"""	MRP, MRP1		8098549, 1360704	Standard	NM_004996		Approved	GS-X	uc010bvi.3	P33527	OTTHUMG00000048267	ENST00000399410.3:c.3622A>G	16.37:g.16218677A>G	ENSP00000382342:p.Asn1208Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A3RJX2|C9JPJ4|O14819|O43333|P78419|Q59GI9|Q9UQ97|Q9UQ99|Q9UQA0	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.N1218D	ENST00000399410.3	37	c.3652	CCDS42122.1	16	.	.	.	.	.	.	.	.	.	.	A	24.4	4.522044	0.85600	.	.	ENSG00000103222	ENST00000399410;ENST00000399408;ENST00000346370;ENST00000351154;ENST00000345148;ENST00000349029;ENST00000536381	D;D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59;-1.59	5.04	5.04	0.67666	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.90242	0.6949	M	0.75884	2.315	0.44241	D	0.997089	D;D;D;D;D;D	0.89917	0.998;1.0;0.998;0.999;0.999;1.0	D;D;D;D;D;D	0.91635	0.982;0.999;0.998;0.996;0.999;0.999	D	0.91260	0.5036	10	0.66056	D	0.02	-37.7833	14.0397	0.64667	1.0:0.0:0.0:0.0	.	1093;1208;1152;1149;1208;1218	P33527-5;P33527-4;P33527-3;P33527-2;P33527;P33527-9	.;.;.;.;MRP1_HUMAN;.	D	1208;1218;1152;1149;1208;1093;892	ENSP00000382342:N1208D;ENSP00000382340:N1218D;ENSP00000263019:N1152D;ENSP00000263017:N1149D;ENSP00000263014:N1208D;ENSP00000263016:N1093D	ENSP00000263014:N1208D	N	+	1	0	ABCC1	16126178	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	7.545000	0.82128	1.917000	0.55516	0.529000	0.55759	AAC	ABCC1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000103222		0.572	ABCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC1	HGNC	protein_coding	OTTHUMT00000109701.1	86	0.00	0	A	NM_004996		16218677	16218677	+1	no_errors	ENST00000399408	ensembl	human	known	69_37n	missense	118	13.14	18	SNP	1.000	G
CTSF	8722	genome.wustl.edu	37	11	66328165	66328165	+	IGR	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:66328165C>A	ENST00000310325.5	-	0	2035				CTD-3074O7.2_ENST00000504911.1_lincRNA|ACTN3_ENST00000513398.1_RNA|ACTN3_ENST00000502692.1_RNA	NM_003793.3	NP_003784.2	Q9UBX1	CATF_HUMAN	cathepsin F						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|proteolysis (GO:0006508)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|lysosome (GO:0005764)|vesicle (GO:0031982)	cysteine-type endopeptidase activity (GO:0004197)			endometrium(1)|large_intestine(7)|lung(8)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	19						GGGCTGCGGCCCTGCTCCACC	0.607																																						dbGAP											0													130.0	141.0	137.0					11																	66328165		2177	4252	6429	-	-	-	SO:0001628	intergenic_variant	0			AF071749	CCDS8144.1	11q13.2	2012-02-29			ENSG00000174080	ENSG00000174080		"""Cathepsins"""	2531	protein-coding gene	gene with protein product		603539				9822672, 10318784	Standard	NM_003793		Approved	CATSF, CLN13	uc001oip.3	Q9UBX1	OTTHUMG00000167090		11.37:g.66328165C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R964|O95240|Q9NSU4|Q9UKQ5	Missense_Mutation	SNP	NULL	p.P643H	ENST00000310325.5	37	c.1928	CCDS8144.1	11																																																																																			ACTN3	-	NULL	ENSG00000248746		0.607	CTSF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN3	HGNC	protein_coding	OTTHUMT00000393047.1	71	0.00	0	C	NM_003793		66328165	66328165	+1	pseudogene	ENST00000502692	ensembl	human	known	69_37n	missense	62	22.50	18	SNP	0.974	A
ADAM29	11086	genome.wustl.edu	37	4	175897313	175897313	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:175897313C>T	ENST00000359240.3	+	5	1307	c.637C>T	c.(637-639)Cgt>Tgt	p.R213C	ADAM29_ENST00000445694.1_Missense_Mutation_p.R213C|ADAM29_ENST00000514159.1_Missense_Mutation_p.R213C|ADAM29_ENST00000404450.4_Missense_Mutation_p.R213C|RP13-577H12.2_ENST00000507525.1_RNA	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	213	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.R213C(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		TCTGTACATTCGTTATGAAAG	0.338																																					Ovarian(140;1727 1835 21805 25838 41440)	dbGAP											1	Substitution - Missense(1)	large_intestine(1)											84.0	84.0	84.0					4																	175897313		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.637C>T	4.37:g.175897313C>T	ENSP00000352177:p.Arg213Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.R213C	ENST00000359240.3	37	c.637	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	C	13.93	2.383641	0.42308	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000404450;ENST00000514159	T;T;T;T	0.64618	-0.11;-0.11;-0.11;-0.11	3.74	2.87	0.33458	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.473650	0.15190	U	0.275633	T	0.71962	0.3402	M	0.71036	2.16	0.09310	N	1	D	0.71674	0.998	P	0.61592	0.891	T	0.59862	-0.7374	9	.	.	.	.	8.4958	0.33127	0.2313:0.7687:0.0:0.0	.	213	Q9UKF5	ADA29_HUMAN	C	213	ENSP00000352177:R213C;ENSP00000414544:R213C;ENSP00000384229:R213C;ENSP00000423517:R213C	.	R	+	1	0	ADAM29	176133888	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.302000	0.08221	1.102000	0.41551	0.643000	0.83706	CGT	ADAM29	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000168594		0.338	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		239	0.00	0	C			175897313	175897313	+1	no_errors	ENST00000359240	ensembl	human	known	69_37n	missense	137	35.38	75	SNP	0.001	T
ADAMTS16	170690	genome.wustl.edu	37	5	5242243	5242243	+	Silent	SNP	T	T	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:5242243T>A	ENST00000274181.7	+	17	2739	c.2601T>A	c.(2599-2601)ccT>ccA	p.P867P		NM_139056.2	NP_620687.2	Q8TE57	ATS16_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 16	867	Spacer.				branching involved in ureteric bud morphogenesis (GO:0001658)	proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(72)|ovary(4)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	107						AGCAGCCCCCTGCCCAGCCCA	0.602																																						dbGAP											0													47.0	53.0	51.0					5																	5242243		2019	4175	6194	-	-	-	SO:0001819	synonymous_variant	0			AJ315734	CCDS43299.1	5p15	2008-07-18	2005-08-19		ENSG00000145536	ENSG00000145536		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17108	protein-coding gene	gene with protein product		607510	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 16"""			11867212	Standard	NM_139056		Approved	ADAMTS16s	uc003jdl.3	Q8TE57	OTTHUMG00000161663	ENST00000274181.7:c.2601T>A	5.37:g.5242243T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C6G490|Q8IVE2	Silent	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P867	ENST00000274181.7	37	c.2601	CCDS43299.1	5																																																																																			ADAMTS16	-	NULL	ENSG00000145536		0.602	ADAMTS16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS16	HGNC	protein_coding	OTTHUMT00000365657.1	74	0.00	0	T	NM_139056		5242243	5242243	+1	no_errors	ENST00000274181	ensembl	human	known	69_37n	silent	54	43.88	43	SNP	0.000	A
ADAMTSL1	92949	genome.wustl.edu	37	9	18775842	18775842	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:18775842G>A	ENST00000380548.4	+	18	2838	c.2499G>A	c.(2497-2499)ccG>ccA	p.P833P		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	833	TSP type-1 7. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCCTGTGCCCGCCCCTGCCTT	0.567																																						dbGAP											0													38.0	44.0	42.0					9																	18775842		1956	4138	6094	-	-	-	SO:0001819	synonymous_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.2499G>A	9.37:g.18775842G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Silent	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.P833	ENST00000380548.4	37	c.2499	CCDS47954.1	9																																																																																			ADAMTSL1	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.567	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	141	0.00	0	G			18775842	18775842	+1	no_errors	ENST00000380548	ensembl	human	novel	69_37n	silent	82	36.23	50	SNP	0.013	A
AZIN2	113451	genome.wustl.edu	37	1	33562360	33562360	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:33562360G>A	ENST00000294517.6	+	9	1393	c.806G>A	c.(805-807)gGc>gAc	p.G269D	ADC_ENST00000373440.1_Missense_Mutation_p.G111D|ADC_ENST00000398167.1_Missense_Mutation_p.G269D|ADC_ENST00000484656.1_3'UTR|ADC_ENST00000373441.1_Missense_Mutation_p.G269D|ADC_ENST00000358680.3_Missense_Mutation_p.G111D|ADC_ENST00000373443.3_Missense_Mutation_p.G269D	NM_052998.2	NP_443724.1	Q96A70	AZIN2_HUMAN		269					agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)			NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	GAGGGCTGTGGCGTGGACATC	0.537																																						dbGAP											0													163.0	135.0	145.0					1																	33562360		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000294517.6:c.806G>A	1.37:g.33562360G>A	ENSP00000294517:p.Gly269Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	Missense_Mutation	SNP	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.G269D	ENST00000294517.6	37	c.806	CCDS375.1	1	.	.	.	.	.	.	.	.	.	.	G	18.12	3.553196	0.65425	.	.	ENSG00000142920	ENST00000294517;ENST00000341637;ENST00000358680;ENST00000373443;ENST00000398167;ENST00000373440;ENST00000373441	T;T;T;T;T;T	0.46819	0.86;0.86;0.86;0.86;0.86;0.86	5.66	5.66	0.87406	Orn/DAP/Arg decarboxylase 2, N-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (1);	0.072619	0.64402	D	0.000019	T	0.54854	0.1884	L	0.57130	1.785	0.40580	D	0.981387	P;D;B;B;B	0.52996	0.61;0.957;0.081;0.099;0.099	B;P;B;B;B	0.51866	0.323;0.682;0.052;0.094;0.094	T	0.56896	-0.7903	10	0.54805	T	0.06	-12.228	13.0285	0.58829	0.0748:0.0:0.9252:0.0	.	269;111;269;174;269	Q96A70-2;Q96A70-5;Q96A70-3;D3DPR0;Q96A70	.;.;.;.;ADC_HUMAN	D	269;281;111;269;269;111;269	ENSP00000294517:G269D;ENSP00000351508:G111D;ENSP00000362542:G269D;ENSP00000381233:G269D;ENSP00000362539:G111D;ENSP00000362540:G269D	ENSP00000294517:G269D	G	+	2	0	ADC	33334947	1.000000	0.71417	0.986000	0.45419	0.991000	0.79684	6.684000	0.74538	2.843000	0.97960	0.655000	0.94253	GGC	ADC	-	pfam_De-COase2_N,superfamily_Ala_racemase/Decarboxylase_C	ENSG00000142920		0.537	ADC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADC	HGNC	protein_coding	OTTHUMT00000011867.1	195	0.00	0	G			33562360	33562360	+1	no_errors	ENST00000373441	ensembl	human	known	69_37n	missense	199	17.08	41	SNP	0.997	A
ADCY5	111	genome.wustl.edu	37	3	123010174	123010174	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:123010174C>T	ENST00000462833.1	-	18	4325	c.3113G>A	c.(3112-3114)cGg>cAg	p.R1038Q	ADCY5_ENST00000491190.1_Missense_Mutation_p.R696Q|ADCY5_ENST00000309879.5_Missense_Mutation_p.R688Q	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	1038					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GTGCAGCAGCCGCCGGTTGTA	0.587																																						dbGAP											0													59.0	53.0	55.0					3																	123010174		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.3113G>A	3.37:g.123010174C>T	ENSP00000419361:p.Arg1038Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R1038Q	ENST00000462833.1	37	c.3113	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	C	29.6	5.020954	0.93462	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879	T;T;T	0.80909	-1.01;-1.43;-1.43	4.53	4.53	0.55603	Adenylyl cyclase class-3/4/guanylyl cyclase (1);	0.000000	0.64402	D	0.000001	D	0.83903	0.5355	L	0.52126	1.63	0.80722	D	1	P;D	0.69078	0.896;0.997	B;P	0.57425	0.266;0.82	T	0.81872	-0.0733	10	0.27082	T	0.32	.	17.4829	0.87679	0.0:1.0:0.0:0.0	.	1038;696	O95622;B3KWA8	ADCY5_HUMAN;.	Q	1038;696;688	ENSP00000419361:R1038Q;ENSP00000418537:R696Q;ENSP00000308685:R688Q	ENSP00000308685:R688Q	R	-	2	0	ADCY5	124492864	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.710000	0.61873	2.362000	0.80069	0.563000	0.77884	CGG	ADCY5	-	smart_A/G_cyclase	ENSG00000173175		0.587	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	38	0.00	0	C	XM_171048		123010174	123010174	-1	no_errors	ENST00000462833	ensembl	human	known	69_37n	missense	30	33.33	15	SNP	1.000	T
ADNP	23394	genome.wustl.edu	37	20	49508350	49508350	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr20:49508350G>A	ENST00000396029.3	-	5	3468	c.2901C>T	c.(2899-2901)gaC>gaT	p.D967D	ADNP_ENST00000396032.3_Silent_p.D967D|ADNP_ENST00000349014.3_Silent_p.D967D|ADNP_ENST00000371602.4_Silent_p.D967D	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	967					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GAGAAGCACCGTCTTTCCACT	0.453																																						dbGAP											0													174.0	161.0	166.0					20																	49508350		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2901C>T	20.37:g.49508350G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D967	ENST00000396029.3	37	c.2901	CCDS13433.1	20																																																																																			ADNP	-	NULL	ENSG00000101126		0.453	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	131	0.00	0	G	NM_181442		49508350	49508350	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	silent	126	17.11	26	SNP	0.780	A
ADNP2	22850	genome.wustl.edu	37	18	77895840	77895840	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:77895840C>T	ENST00000262198.4	+	4	2999	c.2544C>T	c.(2542-2544)caC>caT	p.H848H		NM_014913.3	NP_055728.1	Q6IQ32	ADNP2_HUMAN	ADNP homeobox 2	848					cellular response to oxidative stress (GO:0034599)|cellular response to retinoic acid (GO:0071300)|negative regulation of cell death (GO:0060548)|neuron differentiation (GO:0030182)|positive regulation of cell growth (GO:0030307)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(9)|liver(1)|lung(15)|ovary(5)|prostate(2)	42		all_cancers(4;1.06e-15)|all_epithelial(4;2.36e-10)|all_lung(4;0.000302)|Lung NSC(4;0.000518)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0256)|all_hematologic(56;0.15)|Melanoma(33;0.2)		Epithelial(2;1.1e-11)|OV - Ovarian serous cystadenocarcinoma(15;7.54e-09)|BRCA - Breast invasive adenocarcinoma(31;0.00247)|STAD - Stomach adenocarcinoma(84;0.164)		CTGGGATACACTCCAAGTCAC	0.567																																						dbGAP											0													59.0	60.0	60.0					18																	77895840		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020670	CCDS32853.1	18q23	2013-01-07	2007-07-17	2007-07-17	ENSG00000101544	ENSG00000101544		"""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	23803	protein-coding gene	gene with protein product			"""zinc finger protein 508"""	ZNF508			Standard	NM_014913		Approved	KIAA0863	uc002lnw.3	Q6IQ32	OTTHUMG00000172535	ENST00000262198.4:c.2544C>T	18.37:g.77895840C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K951|O94943|Q9H9P3	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.H848	ENST00000262198.4	37	c.2544	CCDS32853.1	18																																																																																			ADNP2	-	NULL	ENSG00000101544		0.567	ADNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP2	HGNC	protein_coding	OTTHUMT00000418979.1	34	0.00	0	C	NM_014913		77895840	77895840	+1	no_errors	ENST00000262198	ensembl	human	known	69_37n	silent	27	28.21	11	SNP	1.000	T
ALDH5A1	7915	genome.wustl.edu	37	6	24502792	24502792	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:24502792A>G	ENST00000357578.3	+	2	541	c.396A>G	c.(394-396)atA>atG	p.I132M	ALDH5A1_ENST00000546278.1_Missense_Mutation_p.I44M|ALDH5A1_ENST00000491546.1_Intron|ALDH5A1_ENST00000348925.2_Missense_Mutation_p.I132M	NM_001080.3	NP_001071.1	P51649	SSDH_HUMAN	aldehyde dehydrogenase 5 family, member A1	132					acetate metabolic process (GO:0006083)|central nervous system development (GO:0007417)|galactosylceramide metabolic process (GO:0006681)|gamma-aminobutyric acid catabolic process (GO:0009450)|glucose metabolic process (GO:0006006)|glucosylceramide metabolic process (GO:0006678)|glutamate metabolic process (GO:0006536)|glutamine metabolic process (GO:0006541)|glutathione metabolic process (GO:0006749)|glycerophospholipid metabolic process (GO:0006650)|neurotransmitter catabolic process (GO:0042135)|neurotransmitter secretion (GO:0007269)|post-embryonic development (GO:0009791)|protein homotetramerization (GO:0051289)|respiratory electron transport chain (GO:0022904)|short-chain fatty acid metabolic process (GO:0046459)|succinate metabolic process (GO:0006105)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	protein homodimerization activity (GO:0042803)|succinate-semialdehyde dehydrogenase (NAD+) activity (GO:0004777)|succinate-semialdehyde dehydrogenase [NAD(P)+] activity (GO:0009013)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(7)|skin(2)|urinary_tract(1)	20					Chlormerodrin(DB00534)|Succinic acid(DB00139)|Valproic Acid(DB00313)	ATTTAATGATACAAAATAAGG	0.373																																						dbGAP											0													120.0	112.0	115.0					6																	24502792		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34820	CCDS4555.1, CCDS4556.1	6p22	2013-06-03	2008-07-31		ENSG00000112294	ENSG00000112294	1.2.1.24	"""Aldehyde dehydrogenases"""	408	protein-coding gene	gene with protein product	"""succinate-semialdehyde dehydrogenase"""	610045				7814412, 9059628	Standard	NM_001080		Approved	SSADH, SSDH	uc003nef.3	P51649	OTTHUMG00000014356	ENST00000357578.3:c.396A>G	6.37:g.24502792A>G	ENSP00000350191:p.Ile132Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD26|G5E949|Q546H9|Q8N3W6	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_Succ_semiAld_DH	p.I132M	ENST00000357578.3	37	c.396	CCDS4555.1	6	.	.	.	.	.	.	.	.	.	.	A	2.333	-0.352841	0.05173	.	.	ENSG00000112294	ENST00000357578;ENST00000546278;ENST00000348925	T;T;T	0.75704	-0.96;-0.96;-0.96	5.35	-9.17	0.00691	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.447106	0.26496	N	0.024045	T	0.14098	0.0341	N	0.11427	0.14	0.33444	D	0.582763	B;B	0.22800	0.044;0.075	B;B	0.17433	0.018;0.015	T	0.29088	-1.0023	10	0.02654	T	1	-3.2875	1.3521	0.02175	0.2764:0.1918:0.341:0.1907	.	132;132	P51649;G5E949	SSDH_HUMAN;.	M	132;44;132	ENSP00000350191:I132M;ENSP00000438193:I44M;ENSP00000314649:I132M	ENSP00000314649:I132M	I	+	3	3	ALDH5A1	24610771	0.089000	0.21612	0.653000	0.29593	0.166000	0.22503	-0.267000	0.08619	-1.565000	0.01676	0.254000	0.18369	ATA	ALDH5A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH,tigrfam_Succ_semiAld_DH	ENSG00000112294		0.373	ALDH5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH5A1	HGNC	protein_coding	OTTHUMT00000040007.2	541	0.00	0	A			24502792	24502792	+1	no_errors	ENST00000348925	ensembl	human	known	69_37n	missense	511	37.33	305	SNP	0.522	G
ANKRD36	375248	genome.wustl.edu	37	2	97868069	97868069	+	Silent	SNP	C	C	T	rs189540273	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:97868069C>T	ENST00000461153.2	+	48	3142	c.2898C>T	c.(2896-2898)gaC>gaT	p.D966D	ANKRD36_ENST00000420699.2_Silent_p.D966D			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	966										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GTACAAGTGACGAGGAAGATT	0.333													.|||	2	0.000399361	0.0	0.0014	5008	,	,		26771	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													53.0	62.0	59.0					2																	97868069		692	1590	2282	-	-	-	SO:0001819	synonymous_variant	0			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.2898C>T	2.37:g.97868069C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D966	ENST00000461153.2	37	c.2898	CCDS54379.1	2																																																																																			ANKRD36	-	NULL	ENSG00000135976		0.333	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	720	0.00	0	C			97868069	97868069	+1	no_errors	ENST00000420699	ensembl	human	known	69_37n	silent	161	23.22	49	SNP	0.000	T
ANKS1B	56899	genome.wustl.edu	37	12	99640366	99640367	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:99640366_99640367insT	ENST00000547776.2	-	13	2031_2032	c.2032_2033insA	c.(2032-2034)agcfs	p.S678fs	ANKS1B_ENST00000550833.1_5'UTR|ANKS1B_ENST00000547010.1_Frame_Shift_Ins_p.S258fs|ANKS1B_ENST00000329257.7_Frame_Shift_Ins_p.S678fs	NM_152788.4	NP_690001.3	Q7Z6G8	ANS1B_HUMAN	ankyrin repeat and sterile alpha motif domain containing 1B	678						cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ephrin receptor binding (GO:0046875)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(15)|lung(38)|pancreas(1)|prostate(2)|skin(1)	70		all_cancers(3;0.0197)|all_epithelial(3;0.0101)|Esophageal squamous(3;0.0559)|Breast(359;0.209)		OV - Ovarian serous cystadenocarcinoma(2;2.89e-08)|Epithelial(2;6.12e-08)|all cancers(2;4.07e-06)		GAGTTGGTTGCTTTTTTTGTGA	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF145204	CCDS55864.1, CCDS55865.1, CCDS55866.1, CCDS55867.1, CCDS55868.1, CCDS55869.1, CCDS55870.1, CCDS55871.1, CCDS55872.1	12q23.1	2013-01-10						"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	24600	protein-coding gene	gene with protein product		607815				10490826, 12415113	Standard	NM_020140		Approved	EB-1, AIDA-1, cajalin-2, ANKS2	uc001tge.2	Q7Z6G8		ENST00000547776.2:c.2033dupA	12.37:g.99640373_99640373dupT	ENSP00000449629:p.Ser678fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY5|A7E259|A8K153|A8MSN4|B4DFP6|B4DH98|F8VPM3|F8VZR9|F8WC27|Q5XLJ0|Q6IVB5|Q6NUS4|Q7Z6G6|Q7Z6G7|Q8TAP3|Q9NRX7|Q9Y5K9	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_PTyr_interaction_dom,pfam_SAM_2,pfam_PTB,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,smart_PTyr_interaction_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PTyr_interaction_dom,pfscan_SAM,prints_Ankyrin_rpt	p.S678fs	ENST00000547776.2	37	c.2033_2032	CCDS55872.1	12																																																																																			ANKS1B	-	NULL	ENSG00000185046		0.421	ANKS1B-003	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	ANKS1B	HGNC	protein_coding	OTTHUMT00000408421.3	412	0.00	0	-	NM_020140		99640366	99640367	-1	no_errors	ENST00000329257	ensembl	human	known	69_37n	frame_shift_ins	322	21.84	90	INS	0.976:0.996	T
AP4M1	9179	genome.wustl.edu	37	7	99704464	99704464	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:99704464C>T	ENST00000359593.4	+	15	1479	c.1321C>T	c.(1321-1323)Cga>Tga	p.R441*	AP4M1_ENST00000429084.1_Nonsense_Mutation_p.R448*|AP4M1_ENST00000421755.1_Nonsense_Mutation_p.R441*|AP4M1_ENST00000422582.1_Nonsense_Mutation_p.R313*	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	441	MHD. {ECO:0000255|PROSITE- ProRule:PRU00404}.				Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAAGTGGGTGCGACACCTAAG	0.627																																					Pancreas(174;1182 2812 29595 49511)	dbGAP											0													55.0	51.0	52.0					7																	99704464		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.1321C>T	7.37:g.99704464C>T	ENSP00000352603:p.Arg441*	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5U1|Q8WV65|Q9UHK9	Nonsense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.R441*	ENST00000359593.4	37	c.1321	CCDS5685.1	7	.	.	.	.	.	.	.	.	.	.	C	39	7.701761	0.98441	.	.	ENSG00000221838	ENST00000429084;ENST00000359593;ENST00000421755;ENST00000422582	.	.	.	4.81	1.7	0.24286	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.4804	11.9991	0.53220	0.4528:0.5472:0.0:0.0	.	.	.	.	X	448;441;441;313	.	ENSP00000352603:R441X	R	+	1	2	AP4M1	99542400	0.999000	0.42202	0.992000	0.48379	0.973000	0.67179	2.086000	0.41643	0.617000	0.30160	-0.226000	0.12346	CGA	AP4M1	-	pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C	ENSG00000221838		0.627	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP4M1	HGNC	protein_coding	OTTHUMT00000336772.4	29	0.00	0	C	NM_004722		99704464	99704464	+1	no_errors	ENST00000359593	ensembl	human	known	69_37n	nonsense	33	23.26	10	SNP	0.996	T
APC	324	genome.wustl.edu	37	5	112175041	112175041	+	Missense_Mutation	SNP	A	A	C	rs142728143		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:112175041A>C	ENST00000457016.1	+	16	4130	c.3750A>C	c.(3748-3750)aaA>aaC	p.K1250N	APC_ENST00000257430.4_Missense_Mutation_p.K1250N|APC_ENST00000508376.2_Missense_Mutation_p.K1250N|CTC-554D6.1_ENST00000520401.1_Intron			P25054	APC_HUMAN	adenomatous polyposis coli	1250	Responsible for down-regulation through a process mediated by direct ubiquitination.|Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.K1192fs*3(1)|p.?(1)|p.V1251fs*14(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		CCACTTGCAAAGTTTCTTCTA	0.398		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	3	Deletion - Frameshift(2)|Unknown(1)	soft_tissue(1)|breast(1)|skin(1)											47.0	48.0	47.0					5																	112175041		2202	4300	6502	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.3750A>C	5.37:g.112175041A>C	ENSP00000413133:p.Lys1250Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.K1250N	ENST00000457016.1	37	c.3750	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	A	13.88	2.370446	0.42003	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376;ENST00000512211	D;D;D;D	0.91011	-2.59;-2.59;-2.59;-2.77	5.83	4.68	0.58851	.	0.000000	0.85682	D	0.000000	D	0.90445	0.7008	L	0.32530	0.975	0.50813	D	0.99989	P;D	0.71674	0.906;0.998	P;D	0.76071	0.521;0.987	D	0.88366	0.2991	9	.	.	.	-25.8921	6.9637	0.24611	0.7908:0.0:0.2092:0.0	.	1252;1250	Q4LE70;P25054	.;APC_HUMAN	N	1250	ENSP00000413133:K1250N;ENSP00000257430:K1250N;ENSP00000427089:K1250N;ENSP00000423828:K1250N	.	K	+	3	2	APC	112202940	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.612000	0.36889	2.225000	0.72522	0.533000	0.62120	AAA	APC	-	NULL	ENSG00000134982		0.398	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	73	0.00	0	A	NM_000038		112175041	112175041	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	missense	50	41.86	36	SNP	1.000	C
ARHGAP22	58504	genome.wustl.edu	37	10	49659122	49659122	+	Silent	SNP	C	C	T	rs575621861		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:49659122C>T	ENST00000249601.4	-	9	1346	c.1050G>A	c.(1048-1050)acG>acA	p.T350T	ARHGAP22_ENST00000417247.2_Silent_p.T260T|ARHGAP22_ENST00000417912.2_Silent_p.T366T|ARHGAP22_ENST00000374172.1_Silent_p.T241T|ARHGAP22_ENST00000435790.2_Silent_p.T356T|ARHGAP22_ENST00000374170.1_Silent_p.T191T|ARHGAP22_ENST00000477708.2_Silent_p.T183T	NM_001256024.1|NM_021226.3	NP_001242953.1|NP_067049.2	Q7Z5H3	RHG22_HUMAN	Rho GTPase activating protein 22	350					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of transcription, DNA-templated (GO:0006355)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			endometrium(3)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						GGACCGGTGCCGTGAAGAGCT	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		15966	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													16.0	19.0	18.0					10																	49659122		2096	4153	6249	-	-	-	SO:0001819	synonymous_variant	0			AY324801	CCDS7227.1, CCDS58079.1, CCDS58080.1, CCDS58081.1	10q11.23	2013-01-10			ENSG00000128805	ENSG00000128805		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	30320	protein-coding gene	gene with protein product		610585				8619474	Standard	NM_021226		Approved	RhoGAP2	uc010qgm.3	Q7Z5H3	OTTHUMG00000018176	ENST00000249601.4:c.1050G>A	10.37:g.49659122C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVP7|A5YM75|B4DED8|B9EGA0|C9JDM2|O00152|Q6ZSB0	Silent	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.T366	ENST00000249601.4	37	c.1098	CCDS7227.1	10																																																																																			ARHGAP22	-	NULL	ENSG00000128805		0.692	ARHGAP22-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGAP22	HGNC	protein_coding	OTTHUMT00000358767.1	41	0.00	0	C	NM_021226		49659122	49659122	-1	no_errors	ENST00000417912	ensembl	human	known	69_37n	silent	27	44.90	22	SNP	0.000	T
ARHGAP29	9411	genome.wustl.edu	37	1	94668215	94668216	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:94668215_94668216delTT	ENST00000260526.6	-	11	1209_1210	c.1027_1028delAA	c.(1027-1029)aagfs	p.K343fs	ARHGAP29_ENST00000370217.3_Frame_Shift_Del_p.K343fs	NM_004815.3	NP_004806.3	Q52LW3	RHG29_HUMAN	Rho GTPase activating protein 29	343					positive regulation of Rho GTPase activity (GO:0032321)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|Rho GTPase activator activity (GO:0005100)			NS(1)|breast(5)|endometrium(6)|kidney(2)|large_intestine(9)|lung(19)|ovary(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	54		all_lung(203;0.000732)|Lung NSC(277;0.00328)		all cancers(265;0.0187)|Epithelial(280;0.159)		CATGGAAGACTTTGCTTTCTCA	0.391																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS748.1	1p22.1	2011-06-29			ENSG00000137962	ENSG00000137962		"""Rho GTPase activating proteins"""	30207	protein-coding gene	gene with protein product		610496				9305890	Standard	NM_004815		Approved	PARG1	uc001dqj.4	Q52LW3	OTTHUMG00000010643	ENST00000260526.6:c.1027_1028delAA	1.37:g.94668215_94668216delTT	ENSP00000260526:p.Lys343fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O15463|Q59H86|Q5VYZ0|Q6NVX2|Q8TBI6	Frame_Shift_Del	DEL	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Rho_GTPase_activation_prot,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom	p.K343fs	ENST00000260526.6	37	c.1028_1027	CCDS748.1	1																																																																																			ARHGAP29	-	NULL	ENSG00000137962		0.391	ARHGAP29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP29	HGNC	protein_coding	OTTHUMT00000029376.2	387	0.00	0	TT	NM_004815		94668215	94668216	-1	no_errors	ENST00000260526	ensembl	human	known	69_37n	frame_shift_del	425	14.60	73	DEL	0.998:0.996	-
ARPC1B	10095	genome.wustl.edu	37	7	98991736	98991736	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:98991736T>C	ENST00000451682.1	+	11	1383	c.1074T>C	c.(1072-1074)gaT>gaC	p.D358D	PDAP1_ENST00000496335.1_Intron|ARPC1B_ENST00000252725.5_Silent_p.D358D			O15143	ARC1B_HUMAN	actin related protein 2/3 complex, subunit 1B, 41kDa	358					Arp2/3 complex-mediated actin nucleation (GO:0034314)|cellular component movement (GO:0006928)	actin cytoskeleton (GO:0015629)|Arp2/3 protein complex (GO:0005885)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	structural constituent of cytoskeleton (GO:0005200)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|liver(2)|lung(1)	11	all_cancers(62;3.49e-09)|all_epithelial(64;2.57e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)		STAD - Stomach adenocarcinoma(171;0.215)			GTATCTGGGATGTGAAGGTGA	0.617																																						dbGAP											0													96.0	88.0	90.0					7																	98991736		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF006084	CCDS5661.1	7q22.1	2013-03-14	2002-08-29		ENSG00000130429	ENSG00000130429		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	704	protein-coding gene	gene with protein product	"""ARP2/3 protein complex subunit p41"", ""actin related protein 2/3 complex, subunit 1A (41 kD)"""	604223	"""actin related protein 2/3 complex, subunit 1B (41 kD)"""			9230079, 9359840	Standard	NM_005720		Approved	ARC41, p40-ARC, p41-ARC	uc003upz.3	O15143	OTTHUMG00000154552	ENST00000451682.1:c.1074T>C	7.37:g.98991736T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BU00	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D358	ENST00000451682.1	37	c.1074	CCDS5661.1	7																																																																																			ARPC1B	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1	ENSG00000130429		0.617	ARPC1B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARPC1B	HGNC	protein_coding	OTTHUMT00000335894.1	56	0.00	0	T	NM_005720		98991736	98991736	+1	no_errors	ENST00000252725	ensembl	human	known	69_37n	silent	47	28.79	19	SNP	0.671	C
ATP12A	479	genome.wustl.edu	37	13	25272825	25272825	+	Silent	SNP	C	C	T	rs200072702		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr13:25272825C>T	ENST00000381946.3	+	12	1709	c.1542C>T	c.(1540-1542)caC>caT	p.H514H	ATP12A_ENST00000218548.6_Silent_p.H520H			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	514					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		ATGACCCCCACGGCAAGCGCT	0.537													C|||	1	0.000199681	0.0	0.0014	5008	,	,		20852	0.0		0.0	False		,,,				2504	0.0				Pancreas(156;1582 1935 18898 22665 26498)	dbGAP											0													63.0	59.0	60.0					13																	25272825		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.1542C>T	13.37:g.25272825C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.H520	ENST00000381946.3	37	c.1560	CCDS31948.1	13																																																																																			ATP12A	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk	ENSG00000075673		0.537	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1	56	0.00	0	C	NM_001676		25272825	25272825	+1	no_errors	ENST00000218548	ensembl	human	known	69_37n	silent	56	18.84	13	SNP	0.000	T
ATP13A4	84239	genome.wustl.edu	37	3	193183869	193183869	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:193183869A>G	ENST00000342695.4	-	11	1539	c.1217T>C	c.(1216-1218)gTa>gCa	p.V406A	ATP13A4_ENST00000392443.3_Splice_Site|ATP13A4_ENST00000295548.3_Missense_Mutation_p.V406A	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4	406						integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		GGCTGTTCCTACAAGGCACAG	0.453																																						dbGAP											0													232.0	210.0	218.0					3																	193183869		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.1217T>C	3.37:g.193183869A>G	ENSP00000339182:p.Val406Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	Splice_Site	SNP	-	e11+2	ENST00000342695.4	37	c.1215+2	CCDS3304.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	17.41|17.41	3.381792|3.381792	0.61845|0.61845	.|.	.|.	ENSG00000127249|ENSG00000127249	ENST00000392443|ENST00000342695;ENST00000295548	.|D;D	.|0.88818	.|-2.43;-2.43	5.85|5.85	5.85|5.85	0.93711|0.93711	.|ATPase, P-type, ATPase-associated domain (1);	.|0.163924	.|0.39544	.|N	.|0.001332	.|T	.|0.74390	.|0.3710	N|N	0.03304|0.03304	-0.355|-0.355	0.19575|0.19575	N|N	0.999968|0.999968	.|B;B;B	.|0.16802	.|0.015;0.015;0.019	.|B;B;B	.|0.23150	.|0.044;0.013;0.023	.|T	.|0.52616	.|-0.8552	.|10	.|0.02654	.|T	.|1	.|-2.1637	15.4167|15.4167	0.74974|0.74974	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|406;406;406	.|Q4VNC1-3;Q4VNC1-2;Q4VNC1	.|.;.;AT134_HUMAN	.|A	-1|406	.|ENSP00000339182:V406A;ENSP00000295548:V406A	.|ENSP00000295548:V406A	.|V	-|-	.|2	.|0	ATP13A4|ATP13A4	194666563|194666563	0.228000|0.228000	0.23718|0.23718	0.774000|0.774000	0.31636|0.31636	0.928000|0.928000	0.56348|0.56348	3.767000|3.767000	0.55288|0.55288	2.238000|2.238000	0.73509|0.73509	0.533000|0.533000	0.62120|0.62120	.|GTA	ATP13A4	-	-	ENSG00000127249		0.453	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4	HGNC	protein_coding	OTTHUMT00000157244.4	133	0.00	0	A	NM_032279		193183869	193183869	-1	no_errors	ENST00000392443	ensembl	human	novel	69_37n	splice_site	104	38.82	66	SNP	0.294	G
ATRNL1	26033	genome.wustl.edu	37	10	117221463	117221463	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:117221463T>C	ENST00000355044.3	+	22	3461	c.3335T>C	c.(3334-3336)aTt>aCt	p.I1112T	ATRNL1_ENST00000303745.7_Intron|ATRNL1_ENST00000423111.2_Missense_Mutation_p.I163T	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	1112					G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		AGCCTTTTGATTGATTATCAA	0.333																																						dbGAP											0													161.0	155.0	157.0					10																	117221463		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.3335T>C	10.37:g.117221463T>C	ENSP00000347152:p.Ile1112Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EGF-like,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.I1112T	ENST00000355044.3	37	c.3335	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	T	20.7	4.033380	0.75504	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;T	0.51817	0.69;0.69	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	T	0.63931	0.2553	L	0.56340	1.77	0.80722	D	1	D;D	0.63880	0.993;0.993	P;D	0.72338	0.823;0.977	T	0.67457	-0.5666	10	0.87932	D	0	-19.0105	15.1125	0.72368	0.0:0.0:0.0:1.0	.	163;1112	B4DH41;Q5VV63	.;ATRN1_HUMAN	T	1112;163	ENSP00000347152:I1112T;ENSP00000409624:I163T	ENSP00000347152:I1112T	I	+	2	0	ATRNL1	117211453	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.923000	0.87546	2.041000	0.60428	0.528000	0.53228	ATT	ATRNL1	-	NULL	ENSG00000107518		0.333	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	633	0.00	0	T	XM_049349		117221463	117221463	+1	no_errors	ENST00000355044	ensembl	human	known	69_37n	missense	312	38.10	192	SNP	1.000	C
ATXN2	6311	genome.wustl.edu	37	12	111990087	111990087	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:111990087delT	ENST00000377617.3	-	5	1209	c.1048delA	c.(1048-1050)agafs	p.R350fs	ATXN2_ENST00000550104.1_Frame_Shift_Del_p.R350fs|ATXN2_ENST00000549455.1_Intron|ATXN2_ENST00000535949.1_Frame_Shift_Del_p.R61fs|ATXN2_ENST00000608853.1_Frame_Shift_Del_p.R190fs|ATXN2_ENST00000389153.4_Frame_Shift_Del_p.R85fs|ATXN2_ENST00000542287.2_Frame_Shift_Del_p.R85fs	NM_002973.3	NP_002964.3	Q99700	ATX2_HUMAN	ataxin 2	350					cell death (GO:0008219)|cerebellar Purkinje cell differentiation (GO:0021702)|cytoplasmic mRNA processing body assembly (GO:0033962)|homeostasis of number of cells (GO:0048872)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of receptor internalization (GO:0002091)|neuromuscular process (GO:0050905)|neuron projection morphogenesis (GO:0048812)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA transport (GO:0050658)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|trans-Golgi network (GO:0005802)	epidermal growth factor receptor binding (GO:0005154)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	37						AACCCACCTCTTTTTGCATAA	0.328																																						dbGAP											0													76.0	76.0	76.0					12																	111990087		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U80749	CCDS31902.1	12q23-q24.1	2014-09-17	2004-08-12	2004-08-13	ENSG00000204842	ENSG00000204842		"""Ataxins"""	10555	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 13"""	601517	"""spinocerebellar ataxia 2 (olivopontocerebellar ataxia 2, autosomal dominant, ataxin 2)"""	SCA2, TNRC13		8358438, 9225980	Standard	NM_002973		Approved	ATX2	uc001tsj.3	Q99700	OTTHUMG00000133475	ENST00000377617.3:c.1048delA	12.37:g.111990087delT	ENSP00000366843:p.Arg350fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLD4|Q6ZQZ7|Q99493	Frame_Shift_Del	DEL	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.R350fs	ENST00000377617.3	37	c.1048	CCDS31902.1	12																																																																																			ATXN2	-	NULL	ENSG00000204842		0.328	ATXN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN2	HGNC	protein_coding	OTTHUMT00000257351.3	281	0.00	0	T	NM_002973		111990087	111990087	-1	no_errors	ENST00000377617	ensembl	human	known	69_37n	frame_shift_del	314	10.51	37	DEL	1.000	-
B4GALNT1	2583	genome.wustl.edu	37	12	58025102	58025103	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:58025102_58025103insC	ENST00000341156.4	-	3	847_848	c.263_264insG	c.(262-264)ggcfs	p.G88fs	B4GALNT1_ENST00000552350.1_Frame_Shift_Ins_p.G88fs|B4GALNT1_ENST00000550943.1_Intron|B4GALNT1_ENST00000550764.1_Frame_Shift_Ins_p.G88fs|B4GALNT1_ENST00000418555.2_Intron|B4GALNT1_ENST00000449184.3_Frame_Shift_Ins_p.G88fs	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	88					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)	p.G88fs*24(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GGAGGGGGAGGCCCCCCCCACT	0.589																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)								32,4228		0,32,2098						1.8	0.0			83	25,8229		0,25,4102	no	frameshift	B4GALNT1	NM_001478.3		0,57,6200	A1A1,A1R,RR		0.3029,0.7512,0.4555				57,12457				-	-	-	SO:0001589	frameshift_variant	0			M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.264dupG	12.37:g.58025110_58025110dupC	ENSP00000341562:p.Gly88fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE26|Q8N636	Frame_Shift_Ins	INS	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.L89fs	ENST00000341156.4	37	c.264_263	CCDS8950.1	12																																																																																			B4GALNT1	-	pirsf_GM2_synthase	ENSG00000135454		0.589	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	58	0.00	0	-	NM_001478		58025102	58025103	-1	no_errors	ENST00000341156	ensembl	human	known	69_37n	frame_shift_ins	58	22.67	17	INS	0.004:0.099	C
BIRC7	79444	genome.wustl.edu	37	20	61869314	61869314	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr20:61869314G>A	ENST00000217169.3	+	2	623	c.409G>A	c.(409-411)Ggg>Agg	p.G137R	BIRC7_ENST00000342412.6_Missense_Mutation_p.G137R|BIRC7_ENST00000395306.1_5'Flank|MIR3196_ENST00000579556.1_RNA	NM_139317.1	NP_647478.1	Q96CA5	BIRC7_HUMAN	baculoviral IAP repeat containing 7	137					activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of natural killer cell apoptotic process (GO:0070247)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|lung(9)|ovary(1)	12	all_cancers(38;2.72e-09)					CTGGAAGCGCGGGGACGACCC	0.687																																						dbGAP											0													40.0	41.0	41.0					20																	61869314		2200	4299	6499	-	-	-	SO:0001583	missense	0			AF301009	CCDS13512.1, CCDS13513.1	20q13.3	2011-01-25	2011-01-25		ENSG00000101197	ENSG00000101197		"""Baculoviral IAP repeat containing"", ""RING-type (C3HC4) zinc fingers"""	13702	protein-coding gene	gene with protein product	"""melanoma inhibitor of apoptosis protein"", ""kidney inhibitor of apoptosis protein"", ""livin inhibitor-of-apoptosis"", ""livin"""	605737	"""baculoviral IAP repeat-containing 7"""			11024045, 11162435	Standard	NM_139317		Approved	mliap, ML-IAP, KIAP, RNF50	uc002yej.3	Q96CA5	OTTHUMG00000032957	ENST00000217169.3:c.409G>A	20.37:g.61869314G>A	ENSP00000217169:p.Gly137Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQV0|Q9H2A8|Q9HAP7	Missense_Mutation	SNP	pfam_BIR,smart_BIR,smart_Znf_RING,pfscan_BIR,pfscan_Znf_RING	p.G137R	ENST00000217169.3	37	c.409	CCDS13513.1	20	.	.	.	.	.	.	.	.	.	.	G	16.57	3.159845	0.57368	.	.	ENSG00000101197	ENST00000342412;ENST00000217169	T;T	0.04502	3.61;3.61	5.16	4.21	0.49690	Baculoviral inhibition of apoptosis protein repeat (5);	0.000000	0.47455	D	0.000237	T	0.23806	0.0576	M	0.91090	3.175	0.80722	D	1	D;D;D	0.76494	0.999;0.993;0.999	P;P;P	0.62014	0.897;0.677;0.884	T	0.11348	-1.0591	10	0.39692	T	0.17	.	13.6343	0.62213	0.0763:0.0:0.9237:0.0	.	137;137;137	Q6R308;Q96CA5;Q96CA5-2	.;BIRC7_HUMAN;.	R	137	ENSP00000345213:G137R;ENSP00000217169:G137R	ENSP00000217169:G137R	G	+	1	0	BIRC7	61339759	1.000000	0.71417	0.081000	0.20488	0.402000	0.30811	3.324000	0.52022	1.163000	0.42636	0.561000	0.74099	GGG	BIRC7	-	pfam_BIR,smart_BIR,pfscan_BIR	ENSG00000101197		0.687	BIRC7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIRC7	HGNC	protein_coding	OTTHUMT00000080114.2	18	0.00	0	G	NM_139317		61869314	61869314	+1	no_errors	ENST00000217169	ensembl	human	known	69_37n	missense	22	42.11	16	SNP	0.969	A
BMP8B	656	genome.wustl.edu	37	1	40228838	40228838	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:40228838A>G	ENST00000372827.3	-	6	1360	c.985T>C	c.(985-987)Tac>Cac	p.Y329H	PPIE_ENST00000356511.2_Intron|PPIE_ENST00000372830.1_Intron	NM_001720.3	NP_001711.2	P34820	BMP8B_HUMAN	bone morphogenetic protein 8b	329					cartilage development (GO:0051216)|cell differentiation (GO:0030154)|growth (GO:0040007)|ossification (GO:0001503)|skeletal system development (GO:0001501)	extracellular space (GO:0005615)				endometrium(1)|liver(1)|ovary(1)|urinary_tract(1)	4	all_cancers(7;5.56e-14)|all_lung(5;3.88e-17)|all_epithelial(6;3.78e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;1.92e-17)|all cancers(16;4.03e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CCCTCACAGTAATAGGCCGAG	0.622																																						dbGAP											0													188.0	148.0	162.0					1																	40228838		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC023526	CCDS444.1	1p35-p32	2014-01-30	2008-05-22	2003-10-22	ENSG00000116985	ENSG00000116985		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1075	protein-coding gene	gene with protein product	"""osteogenic protein 2"""	602284	"""bone morphogenetic protein 8 (osteogenic protein 2)"""	BMP8		1460021, 9070944	Standard	NM_001720		Approved	OP-2	uc001cdz.1	P34820	OTTHUMG00000009247	ENST00000372827.3:c.985T>C	1.37:g.40228838A>G	ENSP00000361915:p.Tyr329His	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMY8|Q32NE5|Q53ZM7|Q9NUF0	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.Y329H	ENST00000372827.3	37	c.985	CCDS444.1	1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.321170	0.81580	.	.	ENSG00000116985	ENST00000372827	D	0.87179	-2.22	3.75	3.75	0.43078	Transforming growth factor beta, conserved site (1);Transforming growth factor-beta, C-terminal (3);	0.000000	0.64402	U	0.000001	D	0.92987	0.7768	M	0.85859	2.78	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.93627	0.6953	10	0.87932	D	0	.	11.5817	0.50896	1.0:0.0:0.0:0.0	.	329	P34820	BMP8B_HUMAN	H	329	ENSP00000361915:Y329H	ENSP00000361915:Y329H	Y	-	1	0	BMP8B	40001425	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.622000	0.90953	1.561000	0.49584	0.459000	0.35465	TAC	BMP8B	-	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	ENSG00000116985		0.622	BMP8B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8B	HGNC	protein_coding	OTTHUMT00000025641.1	135	0.00	0	A	NM_001720		40228838	40228838	-1	no_errors	ENST00000372827	ensembl	human	known	69_37n	missense	92	39.87	61	SNP	1.000	G
BROX	148362	genome.wustl.edu	37	1	222897497	222897497	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:222897497A>G	ENST00000340934.5	+	6	871	c.465A>G	c.(463-465)aaA>aaG	p.K155K	BROX_ENST00000537020.1_Silent_p.K155K|BROX_ENST00000539697.1_Silent_p.K123K	NM_144695.2	NP_653296.2	Q5VW32	BROX_HUMAN	BRO1 domain and CAAX motif containing	155	BRO1. {ECO:0000255|PROSITE- ProRule:PRU00526}.					extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)|stomach(1)	14						GGATTTTTAAACATTTAAAGG	0.299																																						dbGAP											0													49.0	49.0	49.0					1																	222897497		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS1534.1, CCDS73036.1, CCDS73037.1	1q41	2010-11-30	2010-11-30	2010-11-30	ENSG00000162819	ENSG00000162819			26512	protein-coding gene	gene with protein product	"""BRO1 domain containing protein"""		"""chromosome 1 open reading frame 58"""	C1orf58		18190528	Standard	XM_005273065		Approved	FLJ32421	uc001hnq.1	Q5VW32	OTTHUMG00000037650	ENST00000340934.5:c.465A>G	1.37:g.222897497A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9G5|Q96MG1	Silent	SNP	pfam_BRO1_dom,pfscan_BRO1_dom	p.K155	ENST00000340934.5	37	c.465	CCDS1534.1	1																																																																																			BROX	-	pfam_BRO1_dom,pfscan_BRO1_dom	ENSG00000162819		0.299	BROX-001	NOVEL	basic|appris_principal|CCDS	protein_coding	BROX	HGNC	protein_coding	OTTHUMT00000091815.2	245	0.00	0	A	NM_144695		222897497	222897497	+1	no_errors	ENST00000340934	ensembl	human	known	69_37n	silent	275	15.12	49	SNP	1.000	G
BTN2A1	11120	genome.wustl.edu	37	6	26468547	26468547	+	Missense_Mutation	SNP	G	G	A	rs201996542		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:26468547G>A	ENST00000312541.5	+	8	1602	c.1354G>A	c.(1354-1356)Gtc>Atc	p.V452I	BTN2A1_ENST00000541522.1_Missense_Mutation_p.V391I|BTN2A1_ENST00000469185.1_Intron|BTN2A1_ENST00000429381.1_3'UTR	NM_007049.3|NM_078476.2	NP_008980.1|NP_510961.1	Q7KYR7	BT2A1_HUMAN	butyrophilin, subfamily 2, member A1	452	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				lipid metabolic process (GO:0006629)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)|skin(3)|urinary_tract(3)	27						CCGGGTGGGCGTCTTCCTGGA	0.542													G|||	1	0.000199681	0.0	0.0	5008	,	,		20809	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													130.0	115.0	121.0					6																	26468547		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90543	CCDS4613.1, CCDS47390.1, CCDS56404.1, CCDS56405.1	6p22.1	2014-01-14			ENSG00000112763	ENSG00000112763		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1136	protein-coding gene	gene with protein product		613590				9382921, 9149941	Standard	NM_007049		Approved	BT2.1, BTF1, BTN2.1	uc003nib.2	Q7KYR7	OTTHUMG00000014457	ENST00000312541.5:c.1354G>A	6.37:g.26468547G>A	ENSP00000312158:p.Val452Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLP9|E9PGR4|O00475|P78408|Q59EN4|Q7KYQ7|Q7Z386|Q96AV7|Q9NU62	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.V452I	ENST00000312541.5	37	c.1354	CCDS4613.1	6	.	.	.	.	.	.	.	.	.	.	G	0.041	-1.283732	0.01398	.	.	ENSG00000112763	ENST00000312541;ENST00000541522;ENST00000265424	T;T	0.72167	-0.63;-0.63	2.6	-1.23	0.09465	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.798819	0.10874	N	0.624556	T	0.22704	0.0548	N	0.11154	0.105	0.09310	N	1	B;B	0.26512	0.151;0.052	B;B	0.30251	0.113;0.029	T	0.34030	-0.9845	10	0.12430	T	0.62	.	7.2022	0.25887	0.5258:0.0:0.4742:0.0	.	391;452	B4DLP9;Q7KYR7	.;BT2A1_HUMAN	I	452;391;438	ENSP00000312158:V452I;ENSP00000443909:V391I	ENSP00000265424:V438I	V	+	1	0	BTN2A1	26576526	0.000000	0.05858	0.070000	0.20053	0.447000	0.32167	-1.018000	0.03626	-0.337000	0.08426	0.491000	0.48974	GTC	BTN2A1	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000112763		0.542	BTN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A1	HGNC	protein_coding	OTTHUMT00000040122.2	284	0.00	0	G	NM_007049		26468547	26468547	+1	no_errors	ENST00000312541	ensembl	human	known	69_37n	missense	198	39.08	127	SNP	0.034	A
C11orf84	144097	genome.wustl.edu	37	11	63585474	63585474	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:63585474C>T	ENST00000294244.4	+	2	624	c.325C>T	c.(325-327)Cac>Tac	p.H109Y		NM_138471.1	NP_612480.1	Q9BUA3	CK084_HUMAN	chromosome 11 open reading frame 84	109										endometrium(3)|kidney(1)|lung(3)|skin(1)	8						AGCTCGCTCGCACATCTTGGA	0.642																																						dbGAP											0													78.0	76.0	76.0					11																	63585474		2201	4298	6499	-	-	-	SO:0001583	missense	0			BC007540	CCDS31594.1	11q13.1	2014-02-10			ENSG00000168005	ENSG00000168005			25115	protein-coding gene	gene with protein product						12477932	Standard	NM_138471		Approved		uc001nxt.3	Q9BUA3	OTTHUMG00000167746	ENST00000294244.4:c.325C>T	11.37:g.63585474C>T	ENSP00000294244:p.His109Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CV7|Q6PHS2|Q96IH0	Missense_Mutation	SNP	NULL	p.H109Y	ENST00000294244.4	37	c.325	CCDS31594.1	11	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445996	0.43429	.	.	ENSG00000168005	ENST00000294244	T	0.74947	-0.89	5.24	4.33	0.51752	.	0.000000	0.85682	D	0.000000	D	0.82600	0.5072	M	0.61703	1.905	0.33833	D	0.630504	D	0.69078	0.997	D	0.71414	0.973	D	0.87958	0.2728	10	0.87932	D	0	-22.5775	11.8677	0.52503	0.0:0.8237:0.1763:0.0	.	109	Q9BUA3	CK084_HUMAN	Y	109	ENSP00000294244:H109Y	ENSP00000294244:H109Y	H	+	1	0	C11orf84	63342050	0.972000	0.33761	0.824000	0.32777	0.154000	0.21943	2.434000	0.44802	1.214000	0.43395	0.561000	0.74099	CAC	C11orf84	-	NULL	ENSG00000168005		0.642	C11orf84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf84	HGNC	protein_coding	OTTHUMT00000396084.1	65	0.00	0	C	NM_138471		63585474	63585474	+1	no_errors	ENST00000294244	ensembl	human	known	69_37n	missense	49	45.56	41	SNP	0.927	T
C1QTNF6	114904	genome.wustl.edu	37	22	37578518	37578518	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:37578518A>G	ENST00000337843.2	-	3	622	c.547T>C	c.(547-549)Ttt>Ctt	p.F183L	C1QTNF6_ENST00000397110.2_Missense_Mutation_p.F183L|C1QTNF6_ENST00000470655.1_5'UTR|RP1-151B14.6_ENST00000419128.1_RNA|C1QTNF6_ENST00000255836.6_Missense_Mutation_p.F59L	NM_031910.3	NP_114116.3	Q9BXI9	C1QT6_HUMAN	C1q and tumor necrosis factor related protein 6	164	C1q. {ECO:0000255|PROSITE- ProRule:PRU00368}.				protein heterotrimerization (GO:0070208)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)				breast(1)|large_intestine(2)|lung(6)|stomach(1)|upper_aerodigestive_tract(1)	11						GGAGCAGCAAACTGGCCGGTC	0.552																																						dbGAP											0													65.0	63.0	64.0					22																	37578518		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329842	CCDS13943.1	22q13.1	2014-02-21			ENSG00000133466	ENSG00000133466			14343	protein-coding gene	gene with protein product		614910				12975309	Standard	NM_031910		Approved	CTRP6, ZACRP6	uc003aqy.1	Q9BXI9	OTTHUMG00000150538	ENST00000337843.2:c.547T>C	22.37:g.37578518A>G	ENSP00000338812:p.Phe183Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9G8|Q6ZRM7	Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.F183L	ENST00000337843.2	37	c.547	CCDS13943.1	22	.	.	.	.	.	.	.	.	.	.	A	18.71	3.681454	0.68042	.	.	ENSG00000133466	ENST00000397110;ENST00000337843;ENST00000255836	D;D;D	0.92911	-3.13;-3.13;-3.13	5.14	5.14	0.70334	Tumour necrosis factor-like (2);Complement C1q protein (3);	0.000000	0.85682	D	0.000000	D	0.97526	0.9190	H	0.97564	4.03	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98965	1.0799	10	0.87932	D	0	.	14.972	0.71241	1.0:0.0:0.0:0.0	.	183;164	Q9BXI9-2;Q9BXI9	.;C1QT6_HUMAN	L	183;183;59	ENSP00000380299:F183L;ENSP00000338812:F183L;ENSP00000255836:F59L	ENSP00000255836:F59L	F	-	1	0	C1QTNF6	35908464	1.000000	0.71417	0.924000	0.36721	0.041000	0.13682	9.339000	0.96797	1.939000	0.56221	0.454000	0.30748	TTT	C1QTNF6	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000133466		0.552	C1QTNF6-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF6	HGNC	protein_coding	OTTHUMT00000318807.1	33	0.00	0	A	NM_182486		37578518	37578518	-1	no_errors	ENST00000337843	ensembl	human	known	69_37n	missense	11	68.57	24	SNP	1.000	G
CACNA1I	8911	genome.wustl.edu	37	22	40043828	40043828	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:40043828T>C	ENST00000402142.3	+	9	1464	c.1464T>C	c.(1462-1464)caT>caC	p.H488H	CACNA1I_ENST00000404898.1_Intron|CACNA1I_ENST00000400164.3_Intron|CACNA1I_ENST00000336649.4_Splice_Site_p.H488H|CACNA1I_ENST00000407673.1_Intron|CACNA1I_ENST00000401624.1_Splice_Site_p.H488H	NM_021096.3	NP_066919.2	Q9P0X4	CAC1I_HUMAN	calcium channel, voltage-dependent, T type, alpha 1I subunit	488					axon guidance (GO:0007411)|calcium ion import (GO:0070509)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|signal transduction (GO:0007165)|sleep (GO:0030431)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(2)|lung(27)|ovary(1)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Melanoma(58;0.0749)				Cinnarizine(DB00568)|Flunarizine(DB04841)|Paramethadione(DB00617)|Spironolactone(DB00421)|Verapamil(DB00661)|Zonisamide(DB00909)	acttttcagatgggaagacta	0.517																																						dbGAP											0													61.0	63.0	62.0					22																	40043828		1905	4103	6008	-	-	-	SO:0001630	splice_region_variant	0			AF129133	CCDS46710.1, CCDS46711.1	22q13.1	2012-03-07	2007-02-16		ENSG00000100346	ENSG00000100346		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1396	protein-coding gene	gene with protein product		608230				10454147, 16382099	Standard	NM_021096		Approved	Cav3.3	uc003ayd.3	Q9P0X4	OTTHUMG00000151096	ENST00000402142.3:c.1463-1T>C	22.37:g.40043828T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QY12|B0QY13|B0QY14|O95504|Q5JZ88|Q7Z6S9|Q8NFX6|Q9NZC8|Q9UH15|Q9UH30|Q9ULU9|Q9UNE6	Silent	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_VDCCAlpha1	p.H488	ENST00000402142.3	37	c.1464	CCDS46710.1	22																																																																																			CACNA1I	-	NULL	ENSG00000100346		0.517	CACNA1I-001	KNOWN	basic|CCDS	protein_coding	CACNA1I	HGNC	protein_coding	OTTHUMT00000321290.1	67	0.00	0	T	NM_001003406	Silent	40043828	40043828	+1	no_errors	ENST00000336649	ensembl	human	known	69_37n	silent	31	56.94	41	SNP	0.019	C
CAMSAP3	57662	genome.wustl.edu	37	19	7676815	7676815	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:7676815C>T	ENST00000160298.4	+	11	1537	c.1436C>T	c.(1435-1437)gCc>gTc	p.A479V	CAMSAP3_ENST00000446248.2_Missense_Mutation_p.A506V	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	479	Pro-rich.				epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						GATGGGGCGGCCGACGGCAGC	0.692																																						dbGAP											0													25.0	31.0	29.0					19																	7676815		1928	4121	6049	-	-	-	SO:0001583	missense	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.1436C>T	19.37:g.7676815C>T	ENSP00000160298:p.Ala479Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDF1	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.A506V	ENST00000160298.4	37	c.1517	CCDS42489.1	19	.	.	.	.	.	.	.	.	.	.	c	17.08	3.297576	0.60086	.	.	ENSG00000076826	ENST00000446248;ENST00000160298	T;T	0.14516	2.5;2.5	4.39	4.39	0.52855	.	0.189619	0.46442	D	0.000296	T	0.19805	0.0476	L	0.40543	1.245	0.37703	D	0.924285	P;P	0.50819	0.847;0.939	B;P	0.50314	0.286;0.637	T	0.05801	-1.0863	10	0.48119	T	0.1	-14.9353	15.7344	0.77831	0.0:1.0:0.0:0.0	.	479;506	Q9P1Y5;Q9P1Y5-2	CAMP3_HUMAN;.	V	506;479	ENSP00000416797:A506V;ENSP00000160298:A479V	ENSP00000160298:A479V	A	+	2	0	KIAA1543	7582815	0.997000	0.39634	0.945000	0.38365	0.780000	0.44128	5.038000	0.64177	1.988000	0.58038	0.544000	0.68410	GCC	CAMSAP3	-	NULL	ENSG00000076826		0.692	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1	33	0.00	0	C	XM_048362		7676815	7676815	+1	no_errors	ENST00000446248	ensembl	human	known	69_37n	missense	21	43.24	16	SNP	0.998	T
CAST	831	genome.wustl.edu	37	5	96101008	96101008	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:96101008A>G	ENST00000341926.3	+	24	1929	c.1767A>G	c.(1765-1767)aaA>aaG	p.K589K	CAST_ENST00000504465.1_Silent_p.K517K|CAST_ENST00000508830.1_Silent_p.K672K|CAST_ENST00000511049.1_Silent_p.K574K|CAST_ENST00000509903.1_Silent_p.K554K|CAST_ENST00000359176.4_Silent_p.K653K|CAST_ENST00000511782.1_Silent_p.K575K|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000508608.1_Silent_p.K635K|CAST_ENST00000338252.3_Silent_p.K576K|ERAP1_ENST00000296754.3_Intron|CAST_ENST00000515663.1_Silent_p.K312K|CAST_ENST00000395813.1_Silent_p.K672K|CAST_ENST00000508579.1_Silent_p.K304K|CAST_ENST00000325674.7_Silent_p.K637K|CAST_ENST00000395812.2_Silent_p.K631K|CAST_ENST00000309190.5_Silent_p.K567K|CAST_ENST00000510756.1_Silent_p.K650K			P20810	ICAL_HUMAN	calpastatin	589					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		ATGAGAACAAACCAATGGAAG	0.343																																						dbGAP											0													97.0	96.0	97.0					5																	96101008		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.1767A>G	5.37:g.96101008A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	pfam_Prot_inh_calpain	p.T331A	ENST00000341926.3	37	c.991		5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.799|9.799	1.179917|1.179917	0.21787|0.21787	.|.	.|.	ENSG00000153113|ENSG00000153113	ENST00000437034|ENST00000510500	.|.	.|.	.|.	5.8|5.8	-1.99|-1.99	0.07457|0.07457	.|.	.|.	.|.	.|.	.|.	T|T	0.57636|0.57636	0.2067|0.2067	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.56727|0.56727	-0.7931|-0.7931	4|4	.|.	.|.	.|.	-21.5514|-21.5514	11.5036|11.5036	0.50451|0.50451	0.5996:0.0:0.4004:0.0|0.5996:0.0:0.4004:0.0	.|.	.|.	.|.	.|.	S|A	341|346	.|.	.|.	N|T	+|+	2|1	0|0	CAST|CAST	96126764|96126764	0.490000|0.490000	0.26012|0.26012	0.987000|0.987000	0.45799|0.45799	0.994000|0.994000	0.84299|0.84299	-0.331000|-0.331000	0.07914|0.07914	-0.103000|-0.103000	0.12175|0.12175	0.533000|0.533000	0.62120|0.62120	AAC|ACC	CAST	-	pfam_Prot_inh_calpain	ENSG00000153113		0.343	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	154	0.65	1	A	NM_173062		96101008	96101008	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000484552	ensembl	human	known	69_37n	missense	61	29.55	26	SNP	0.993	G
CATSPER2	117155	genome.wustl.edu	37	15	43927354	43927354	+	Intron	DEL	T	T	-	rs565591354		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:43927354delT	ENST00000321596.5	-	10	1378				STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000355438.2_Intron|CATSPER2_ENST00000381761.1_Intron|RNU6-610P_ENST00000384264.1_RNA|CATSPER2_ENST00000354127.4_Intron|CATSPER2_ENST00000396879.1_Intron			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2						calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		acttaggatcttttttttttt	0.393											OREG0003957	type=REGULATORY REGION|Gene=AK093318|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.1178+203A>-	15.37:g.43927354delT		Somatic	920	WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Splice_Site	DEL	-	e2-2	ENST00000321596.5	37	c.34-2	CCDS10099.1	15																																																																																			CATSPER2	-	-	ENSG00000166762		0.393	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	46	0.00	0	T	NM_054020		43927354	43927354	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419262	ensembl	human	known	69_37n	splice_site_del	28	35.42	17	DEL	0.002	-
CFAP58	159686	genome.wustl.edu	37	10	106118199	106118199	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:106118199A>G	ENST00000369704.3	+	2	244	c.110A>G	c.(109-111)gAa>gGa	p.E37G	CCDC147_ENST00000312902.5_5'UTR	NM_001008723.1	NP_001008723.1	Q5T655	CC147_HUMAN		37						extracellular space (GO:0005615)				NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	52		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;7.55e-10)|all cancers(201;3.37e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0189)		AAAAGTTTGGAAAAATTTCGG	0.398																																						dbGAP											0													51.0	53.0	52.0					10																	106118199		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000369704.3:c.110A>G	10.37:g.106118199A>G	ENSP00000358718:p.Glu37Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRA6|Q8NA27	Missense_Mutation	SNP	superfamily_Homeodomain-like	p.E37G	ENST00000369704.3	37	c.110	CCDS31282.1	10	.	.	.	.	.	.	.	.	.	.	A	16.88	3.245284	0.59103	.	.	ENSG00000120051	ENST00000369704	T	0.36340	1.26	5.57	5.57	0.84162	.	0.192573	0.53938	D	0.000050	T	0.41351	0.1155	M	0.71581	2.175	0.80722	D	1	B	0.09022	0.002	B	0.10450	0.005	T	0.24870	-1.0148	10	0.42905	T	0.14	-9.6088	16.0347	0.80617	1.0:0.0:0.0:0.0	.	37	Q5T655	CC147_HUMAN	G	37	ENSP00000358718:E37G	ENSP00000358718:E37G	E	+	2	0	CCDC147	106108189	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.385000	0.79763	2.248000	0.74166	0.533000	0.62120	GAA	CCDC147	-	NULL	ENSG00000120051		0.398	CCDC147-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC147	HGNC	protein_coding	OTTHUMT00000050216.1	151	0.00	0	A			106118199	106118199	+1	no_errors	ENST00000369704	ensembl	human	known	69_37n	missense	129	24.56	42	SNP	1.000	G
CDH20	28316	genome.wustl.edu	37	18	59157855	59157855	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:59157855G>T	ENST00000262717.4	+	2	467	c.69G>T	c.(67-69)tgG>tgT	p.W23C	CDH20_ENST00000536675.2_Missense_Mutation_p.W23C|CDH20_ENST00000538374.1_Missense_Mutation_p.W23C			Q9HBT6	CAD20_HUMAN	cadherin 20, type 2	23					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(33)|ovary(1)|pancreas(1)|skin(3)	61		Colorectal(73;0.186)				TGTACTTCTGGGGGCTGATGG	0.502																																						dbGAP											0													148.0	126.0	134.0					18																	59157855		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF217289	CCDS11977.1	18q21.33	2010-01-26			ENSG00000101542	ENSG00000101542		"""Cadherins / Major cadherins"""	1760	protein-coding gene	gene with protein product		605807				10995570	Standard	NM_031891		Approved	CDH7L3, Cdh7	uc010dps.1	Q9HBT6	OTTHUMG00000132768	ENST00000262717.4:c.69G>T	18.37:g.59157855G>T	ENSP00000262717:p.Trp23Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495S3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.W23C	ENST00000262717.4	37	c.69	CCDS11977.1	18	.	.	.	.	.	.	.	.	.	.	G	4.808	0.150260	0.09185	.	.	ENSG00000101542	ENST00000536675;ENST00000538374;ENST00000262717	T;T;T	0.55930	0.49;0.49;0.49	5.27	4.28	0.50868	.	0.343379	0.28327	N	0.015750	T	0.30262	0.0759	N	0.08118	0	0.51012	D	0.999902	B	0.02656	0.0	B	0.01281	0.0	T	0.09707	-1.0662	10	0.23302	T	0.38	.	11.8968	0.52661	0.0:0.1132:0.7208:0.166	.	23	Q9HBT6	CAD20_HUMAN	C	23	ENSP00000444767:W23C;ENSP00000442226:W23C;ENSP00000262717:W23C	ENSP00000262717:W23C	W	+	3	0	CDH20	57308835	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.462000	0.35266	2.620000	0.88729	0.563000	0.77884	TGG	CDH20	-	NULL	ENSG00000101542		0.502	CDH20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH20	HGNC	protein_coding	OTTHUMT00000256141.2	141	0.00	0	G	NM_031891		59157855	59157855	+1	no_errors	ENST00000262717	ensembl	human	known	69_37n	missense	117	24.03	37	SNP	0.994	T
CDH24	64403	genome.wustl.edu	37	14	23523784	23523785	+	Frame_Shift_Ins	INS	-	-	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:23523784_23523785insC	ENST00000267383.5	-	4	806_807	c.714_715insG	c.(712-717)gggctgfs	p.L239fs	CDH24_ENST00000554034.1_Frame_Shift_Ins_p.L239fs|CDH24_ENST00000487137.2_Frame_Shift_Ins_p.L239fs|CDH24_ENST00000397359.3_Frame_Shift_Ins_p.L239fs			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	239	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		CTGCCTGACAGCCCCCCCATGT	0.609											OREG0022594	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.715dupG	14.37:g.23523791_23523791dupC	ENSP00000267383:p.Leu239fs	Somatic	764	WXS	Illumina GAIIx	Phase_IV	D3DS44|Q86UP1|Q9NT84	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L238fs	ENST00000267383.5	37	c.715_714	CCDS9585.1	14																																																																																			CDH24	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000139880		0.609	CDH24-006	KNOWN	basic|CCDS	protein_coding	CDH24	HGNC	protein_coding	OTTHUMT00000257241.2	74	0.00	0	-	NM_022478		23523784	23523785	-1	no_errors	ENST00000267383	ensembl	human	known	69_37n	frame_shift_ins	65	28.57	26	INS	1.000:1.000	C
CDKN2D	1032	genome.wustl.edu	37	19	10677827	10677827	+	Silent	SNP	G	G	A	rs554620640		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:10677827G>A	ENST00000393599.2	-	2	732	c.408C>T	c.(406-408)gaC>gaT	p.D136D	KRI1_ENST00000361821.5_5'Flank|KRI1_ENST00000537964.1_5'Flank|CDKN2D_ENST00000335766.2_Silent_p.D136D|KRI1_ENST00000312962.6_5'Flank	NM_001800.3|NM_079421.2	NP_001791.1|NP_524145.1	P55273	CDN2D_HUMAN	cyclin-dependent kinase inhibitor 2D (p19, inhibits CDK4)	136					autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of phosphorylation (GO:0042326)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to retinoic acid (GO:0032526)|response to UV (GO:0009411)|response to vitamin D (GO:0033280)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein kinase binding (GO:0019901)			endometrium(3)|lung(2)|ovary(1)	6			Epithelial(33;1.58e-05)|all cancers(31;6.36e-05)			GACCCCTGGCGTCCCTGCGAT	0.617													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18682	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													100.0	97.0	98.0					19																	10677827		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12244.1	19p13	2013-01-10				ENSG00000129355		"""Ankyrin repeat domain containing"""	1790	protein-coding gene	gene with protein product		600927				8575754	Standard	NM_079421		Approved	INK4D, p19	uc002mpa.3	P55273		ENST00000393599.2:c.408C>T	19.37:g.10677827G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13102|Q6FGE9	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D136	ENST00000393599.2	37	c.408	CCDS12244.1	19																																																																																			CDKN2D	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000129355		0.617	CDKN2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN2D	HGNC	protein_coding	OTTHUMT00000452030.1	35	0.00	0	G	NM_079421		10677827	10677827	-1	no_errors	ENST00000335766	ensembl	human	known	69_37n	silent	33	37.74	20	SNP	0.621	A
CENPE	1062	genome.wustl.edu	37	4	104096015	104096015	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:104096015T>C	ENST00000265148.3	-	16	1614	c.1525A>G	c.(1525-1527)Aat>Gat	p.N509D	CENPE_ENST00000380026.3_Missense_Mutation_p.N509D	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	509					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		AATACCAGATTATCATAGTCA	0.294																																						dbGAP											0													69.0	64.0	66.0					4																	104096015		2187	4278	6465	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.1525A>G	4.37:g.104096015T>C	ENSP00000265148:p.Asn509Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.N509D	ENST00000265148.3	37	c.1525	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	T	9.402	1.078241	0.20227	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026;ENST00000503705	T;T;T	0.56103	0.48;0.48;0.48	5.73	3.25	0.37280	.	.	.	.	.	T	0.32852	0.0843	N	0.14661	0.345	0.19575	N	0.999965	B;B	0.12013	0.005;0.003	B;B	0.11329	0.006;0.003	T	0.20207	-1.0282	9	0.24483	T	0.36	.	8.6204	0.33857	0.0:0.2055:0.0:0.7945	.	509;509	Q02224-3;Q02224	.;CENPE_HUMAN	D	509	ENSP00000265148:N509D;ENSP00000369365:N509D;ENSP00000423981:N509D	ENSP00000265148:N509D	N	-	1	0	CENPE	104315464	0.967000	0.33354	0.983000	0.44433	0.985000	0.73830	0.977000	0.29475	0.420000	0.25954	0.528000	0.53228	AAT	CENPE	-	NULL	ENSG00000138778		0.294	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		483	0.00	0	T			104096015	104096015	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	459	13.07	69	SNP	0.811	C
CHD5	26038	genome.wustl.edu	37	1	6181297	6181297	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:6181297C>T	ENST00000262450.3	-	33	4879	c.4780G>A	c.(4780-4782)Gcc>Acc	p.A1594T	CHD5_ENST00000378021.1_Splice_Site_p.A451T	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		GCTGGAAGGGCCTGCAGAGGA	0.647																																						dbGAP											0													42.0	46.0	45.0					1																	6181297		2202	4300	6502	-	-	-	SO:0001630	splice_region_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.4780-1G>A	1.37:g.6181297C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.A1594T	ENST00000262450.3	37	c.4780	CCDS57.1	1	.	.	.	.	.	.	.	.	.	.	c	10.07	1.250495	0.22880	.	.	ENSG00000116254	ENST00000262450;ENST00000378006;ENST00000378021;ENST00000536802;ENST00000538279;ENST00000377999	D;T	0.90563	-2.69;2.27	4.54	2.6	0.31112	.	0.983883	0.08267	N	0.972054	T	0.79358	0.4432	N	0.08118	0	0.21220	N	0.999757	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.62421	-0.6858	10	0.13853	T	0.58	-5.0437	9.2793	0.37718	0.0:0.8181:0.0:0.1819	.	1594;451	Q8TDI0;Q5TG85	CHD5_HUMAN;.	T	1594;1110;451;1002;1002;451	ENSP00000262450:A1594T;ENSP00000367260:A451T	ENSP00000262450:A1594T	A	-	1	0	CHD5	6103884	0.999000	0.42202	0.946000	0.38457	0.359000	0.29487	0.612000	0.24283	0.571000	0.29365	0.478000	0.44815	GCC	CHD5	-	NULL	ENSG00000116254		0.647	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	104	0.00	0	C	NM_015557	Missense_Mutation	6181297	6181297	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	missense	128	14.29	22	SNP	0.700	T
CFH	3075	genome.wustl.edu	37	1	196695952	196695952	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:196695952C>T	ENST00000367429.4	+	14	2358	c.2118C>T	c.(2116-2118)tcC>tcT	p.S706S		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	706	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.S706S(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						AGCTTTCTTCCCCTCCTTATT	0.383																																						dbGAP											1	Substitution - coding silent(1)	ovary(1)											114.0	114.0	114.0					1																	196695952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2118C>T	1.37:g.196695952C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Silent	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S706	ENST00000367429.4	37	c.2118	CCDS1385.1	1																																																																																			CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.383	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	238	0.00	0	C	NM_000186		196695952	196695952	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	silent	143	11.18	18	SNP	0.009	T
CKMT2	1160	genome.wustl.edu	37	5	80554943	80554943	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:80554943A>G	ENST00000424301.2	+	9	1122	c.884A>G	c.(883-885)gAa>gGa	p.E295G	CKMT2-AS1_ENST00000503483.2_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2_ENST00000437669.1_Missense_Mutation_p.E295G|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2_ENST00000254035.4_Missense_Mutation_p.E295G|CKMT2-AS1_ENST00000500148.2_RNA|CKMT2-AS1_ENST00000502041.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	295	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)			breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	TTGTAGGTAGAACGGTTAATC	0.468																																						dbGAP											0													209.0	194.0	199.0					5																	80554943		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.884A>G	5.37:g.80554943A>G	ENSP00000404203:p.Glu295Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ICS8|Q8N1E1	Missense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.E295G	ENST00000424301.2	37	c.884	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	A	21.9	4.216257	0.79352	.	.	ENSG00000131730	ENST00000254035;ENST00000437669;ENST00000424301	T;T;T	0.18502	2.21;2.21;2.21	5.29	5.29	0.74685	ATP:guanido phosphotransferase, catalytic domain (2);Glutamine synthetase/guanido kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.49133	0.1539	M	0.89414	3.03	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.59413	-0.7459	10	0.87932	D	0	-16.4385	15.2066	0.73183	1.0:0.0:0.0:0.0	.	295	P17540	KCRS_HUMAN	G	295	ENSP00000254035:E295G;ENSP00000410289:E295G;ENSP00000404203:E295G	ENSP00000254035:E295G	E	+	2	0	CKMT2	80590699	1.000000	0.71417	0.972000	0.41901	0.587000	0.36485	9.287000	0.95975	2.008000	0.58898	0.482000	0.46254	GAA	CKMT2	-	pfam_ATP-guanido_PTrfase_cat	ENSG00000131730		0.468	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	HGNC	protein_coding	OTTHUMT00000369600.1	220	0.00	0	A	NM_001825		80554943	80554943	+1	no_errors	ENST00000254035	ensembl	human	known	69_37n	missense	196	32.30	94	SNP	1.000	G
CLEC2A	387836	genome.wustl.edu	37	12	10078860	10078860	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:10078860T>C	ENST00000455827.1	-	2	189	c.138A>G	c.(136-138)atA>atG	p.I46M	CLEC2A_ENST00000339766.4_Splice_Site_p.I46M	NM_001130711.1	NP_001124183.1	Q6UVW9	CLC2A_HUMAN	C-type lectin domain family 2, member A	46					natural killer cell mediated cytotoxicity (GO:0042267)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)	4						ACCACTCACCTATCATAATAA	0.353																																						dbGAP											0													189.0	170.0	176.0					12																	10078860		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AY359126	CCDS44829.1, CCDS8606.1	12p13.31	2010-06-30			ENSG00000188393	ENSG00000188393		"""C-type lectin domain containing"""	24191	protein-coding gene	gene with protein product	"""keratinocyte-associated C-type lectin"", ""proliferation-induced lymphocyte-associated receptor"""	612087				12975309	Standard	NM_001130711		Approved	UNQ5792, INPE5792, KACL, PILAR	uc009zhc.2	Q6UVW9	OTTHUMG00000140393	ENST00000455827.1:c.139+1A>G	12.37:g.10078860T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A5Y4G5|A9QKS2|A9QKS3	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.I46M	ENST00000455827.1	37	c.138	CCDS44829.1	12	.	.	.	.	.	.	.	.	.	.	T	7.609	0.674362	0.14841	.	.	ENSG00000188393	ENST00000339766;ENST00000455827	T;T	0.18016	2.24;2.24	1.66	1.66	0.24008	.	3.808740	0.03745	U	0.255563	T	0.09686	0.0238	N	0.08118	0	0.09310	N	1	P;P	0.46912	0.69;0.886	B;B	0.41466	0.04;0.358	T	0.18085	-1.0348	10	0.30854	T	0.27	.	5.4115	0.16351	0.0:0.0:0.0:1.0	.	46;46	Q6UVW9;Q6UVW9-2	CLC2A_HUMAN;.	M	46	ENSP00000339732:I46M;ENSP00000396163:I46M	ENSP00000339732:I46M	I	-	3	3	CLEC2A	9970127	0.075000	0.21258	0.100000	0.21137	0.334000	0.28698	1.452000	0.35156	1.026000	0.39733	0.254000	0.18369	ATA	CLEC2A	-	NULL	ENSG00000188393		0.353	CLEC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC2A	HGNC	protein_coding	OTTHUMT00000399919.1	292	0.00	0	T	NM_207375	Missense_Mutation	10078860	10078860	-1	no_errors	ENST00000455827	ensembl	human	known	69_37n	missense	154	35.02	83	SNP	0.128	C
CLMN	79789	genome.wustl.edu	37	14	95662949	95662949	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:95662949delT	ENST00000298912.4	-	10	2707	c.2594delA	c.(2593-2595)aagfs	p.K865fs	CLMN_ENST00000557215.1_5'Flank|CLMN_ENST00000556441.1_5'Flank	NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	865					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.K865fs*10(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		CCTTTTTTCCTTTTTTTTACT	0.408																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											152.0	132.0	139.0					14																	95662949		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2594delA	14.37:g.95662949delT	ENSP00000298912:p.Lys865fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Frame_Shift_Del	DEL	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.K865fs	ENST00000298912.4	37	c.2594	CCDS9933.1	14																																																																																			CLMN	-	NULL	ENSG00000165959		0.408	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2	354	0.00	0	T			95662949	95662949	-1	no_errors	ENST00000298912	ensembl	human	known	69_37n	frame_shift_del	383	27.49	152	DEL	1.000	-
CNKSR2	22866	genome.wustl.edu	37	X	21627677	21627678	+	In_Frame_Ins	INS	-	-	GAG			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:21627677_21627678insGAG	ENST00000379510.3	+	20	2670_2671	c.2634_2635insGAG	c.(2635-2637)gag>GAGgag	p.879_879E>EE	CNKSR2_ENST00000425654.2_In_Frame_Ins_p.849_849E>EE|CNKSR2_ENST00000543067.1_In_Frame_Ins_p.830_830E>EE|CNKSR2_ENST00000279451.4_In_Frame_Ins_p.879_879E>EE	NM_014927.3	NP_055742.2	Q8WXI2	CNKR2_HUMAN	connector enhancer of kinase suppressor of Ras 2	879	Poly-Glu.				regulation of signal transduction (GO:0009966)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|endometrium(8)|kidney(2)|large_intestine(15)|lung(28)|prostate(2)|upper_aerodigestive_tract(3)	61						aggtggaggaagaggaggagga	0.515																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB020709	CCDS14198.1, CCDS55387.1, CCDS55388.1, CCDS55389.1	Xp22.12	2013-01-10			ENSG00000149970	ENSG00000149970		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19701	protein-coding gene	gene with protein product		300724					Standard	NM_014927		Approved	KIAA0902, CNK2, KSR2	uc004czx.2	Q8WXI2	OTTHUMG00000021233	ENST00000379510.3:c.2653_2655dupGAG	X.37:g.21627684_21627686dupGAG	ENSP00000368824:p.Glu886dup	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGR4|B7ZLJ1|B9EG83|E7ESA4|O94976|Q5JPK4|Q5JPN0|Q8WXI1	In_Frame_Ins	INS	pfam_CNKSR2,pfam_CRIC_domain_Chordata,pfam_SAM_type1,pfam_Pleckstrin_homology,pfam_SAM_2,pfam_PDZ,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_PDZ,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.882in_frame_insE	ENST00000379510.3	37	c.2634_2635	CCDS14198.1	X																																																																																			CNKSR2	-	NULL	ENSG00000149970		0.515	CNKSR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNKSR2	HGNC	protein_coding	OTTHUMT00000056019.1	18	0.00	0	-	NM_014927		21627677	21627678	+1	no_errors	ENST00000379510	ensembl	human	known	69_37n	in_frame_ins	12	25.00	4	INS	0.989:0.997	GAG
COL6A6	131873	genome.wustl.edu	37	3	130380867	130380867	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:130380867delT	ENST00000358511.6	+	34	6248	c.6217delT	c.(6217-6219)tttfs	p.F2073fs	COL6A6_ENST00000453409.2_Frame_Shift_Del_p.F2073fs	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	2073	Nonhelical region.|VWFA 9. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGACAATGTATTTTTAAGTAC	0.403																																						dbGAP											0													95.0	92.0	93.0					3																	130380867		1882	4122	6004	-	-	-	SO:0001589	frameshift_variant	0			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.6217delT	3.37:g.130380867delT	ENSP00000351310:p.Phe2073fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Frame_Shift_Del	DEL	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.L2074fs	ENST00000358511.6	37	c.6217	CCDS46911.1	3																																																																																			COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000206384		0.403	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	166	0.00	0	T	NM_001102608		130380867	130380867	+1	no_errors	ENST00000358511	ensembl	human	known	69_37n	frame_shift_del	128	32.29	62	DEL	0.958	-
CPSF3	51692	genome.wustl.edu	37	2	9570133	9570135	+	In_Frame_Del	DEL	CTC	CTC	-	rs34738490		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:9570133_9570135delCTC	ENST00000238112.3	+	3	402_404	c.196_198delCTC	c.(196-198)ctcdel	p.L68del	CPSF3_ENST00000460593.1_In_Frame_Del_p.L31del	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	68					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TGAGATTGATCTCCTATTAATTA	0.365																																					Colon(194;1259 2048 3845 5218 19985)	dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.196_198delCTC	2.37:g.9570133_9570135delCTC	ENSP00000238112:p.Leu68del	Somatic		WXS	Illumina GAIIx	Phase_IV	O14769|Q53RS2|Q96F36	In_Frame_Del	DEL	pfam_CPSF73-100_C,pfam_Beta_Casp,pfam_Beta-lactamas-like,pfam_RMMBL,smart_Beta-lactamas-like	p.L68in_frame_del	ENST00000238112.3	37	c.196_198	CCDS1664.1	2																																																																																			CPSF3	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000119203		0.365	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3	HGNC	protein_coding	OTTHUMT00000206843.1	491	0.00	0	CTC	NM_016207		9570133	9570135	+1	no_errors	ENST00000238112	ensembl	human	known	69_37n	in_frame_del	539	10.89	66	DEL	1.000:1.000:0.989	-
CPXM2	119587	genome.wustl.edu	37	10	125521407	125521407	+	Silent	SNP	G	G	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:125521407G>T	ENST00000241305.3	-	11	1912	c.1758C>A	c.(1756-1758)tcC>tcA	p.S586S	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	586					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CGGTGTGCCAGGAGGCCCCAT	0.662																																						dbGAP											0													31.0	31.0	31.0					10																	125521407		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1758C>A	10.37:g.125521407G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3Q2	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.S586	ENST00000241305.3	37	c.1758	CCDS7637.1	10																																																																																			CPXM2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000121898		0.662	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	36	0.00	0	G	NM_198148		125521407	125521407	-1	no_errors	ENST00000241305	ensembl	human	known	69_37n	silent	16	54.29	19	SNP	0.993	T
CRAT	1384	genome.wustl.edu	37	9	131864323	131864323	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:131864323T>C	ENST00000318080.2	-	6	938	c.644A>G	c.(643-645)gAt>gGt	p.D215G	CRAT_ENST00000464290.1_5'UTR|RP11-247A12.1_ENST00000434250.1_RNA	NM_000755.3|NM_001257363.1	NP_000746|NP_001244292.1	P43155	CACP_HUMAN	carnitine O-acetyltransferase	215					carnitine metabolic process, CoA-linked (GO:0019254)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-acetyltransferase activity (GO:0004092)|receptor binding (GO:0005102)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(2)	13				UCEC - Uterine corpus endometrioid carcinoma (4;0.0178)	L-Carnitine(DB00583)	GTGGTACACATCCAGCTCAAA	0.577																																						dbGAP											0													83.0	71.0	75.0					9																	131864323		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78706	CCDS6919.1	9q34.1	2010-04-27	2010-04-27		ENSG00000095321	ENSG00000095321	2.3.1.7		2342	protein-coding gene	gene with protein product		600184	"""carnitine acetyltransferase"""			7829107	Standard	NM_000755		Approved	CAT1	uc004bxh.3	P43155	OTTHUMG00000147343	ENST00000318080.2:c.644A>G	9.37:g.131864323T>C	ENSP00000315013:p.Asp215Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T952|Q9BW16	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.D215G	ENST00000318080.2	37	c.644	CCDS6919.1	9	.	.	.	.	.	.	.	.	.	.	T	14.90	2.673298	0.47781	.	.	ENSG00000095321	ENST00000351352;ENST00000318080	D	0.90197	-2.63	4.6	4.6	0.57074	.	0.104565	0.64402	D	0.000005	D	0.88687	0.6504	M	0.68593	2.085	0.80722	D	1	B	0.12630	0.006	B	0.20384	0.029	D	0.85024	0.0913	10	0.26408	T	0.33	-24.2547	13.3191	0.60423	0.0:0.0:0.0:1.0	.	215	P43155	CACP_HUMAN	G	215	ENSP00000315013:D215G	ENSP00000315013:D215G	D	-	2	0	CRAT	130904144	1.000000	0.71417	0.974000	0.42286	0.858000	0.48976	6.028000	0.70889	1.930000	0.55929	0.459000	0.35465	GAT	CRAT	-	pfam_Carn_acyl_trans	ENSG00000095321		0.577	CRAT-006	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAT	HGNC	protein_coding	OTTHUMT00000253700.1	145	0.68	1	T			131864323	131864323	-1	no_errors	ENST00000318080	ensembl	human	known	69_37n	missense	148	19.57	36	SNP	0.994	C
CRIPAK	285464	genome.wustl.edu	37	4	1389289	1389289	+	Silent	SNP	C	C	T	rs189073689		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:1389289C>T	ENST00000324803.4	+	1	3950	c.990C>T	c.(988-990)ccC>ccT	p.P330P		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	330					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			GTGGAGTGCCCGCCTGCTCAC	0.672													-|||	1	0.000199681	0.0	0.0	5008	,	,		13649	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													181.0	184.0	183.0					4																	1389289		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.990C>T	4.37:g.1389289C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Silent	SNP	smart_Post-SET_dom	p.P330	ENST00000324803.4	37	c.990	CCDS3349.1	4																																																																																			CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.672	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	52	0.00	0	C	NM_175918		1389289	1389289	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	silent	54	32.93	27	SNP	0.008	T
CSMD1	64478	genome.wustl.edu	37	8	2815319	2815319	+	Missense_Mutation	SNP	G	G	A	rs560730568		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:2815319G>A	ENST00000520002.1	-	64	10271	c.9716C>T	c.(9715-9717)aCg>aTg	p.T3239M	CSMD1_ENST00000400186.3_Missense_Mutation_p.T3062M|CSMD1_ENST00000602723.1_Missense_Mutation_p.T3062M|CSMD1_ENST00000542608.1_Missense_Mutation_p.T3061M|CSMD1_ENST00000537824.1_Missense_Mutation_p.T3238M|CSMD1_ENST00000602557.1_Missense_Mutation_p.T3239M			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	3239	Sushi 27. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GAAAAAAACCGTGCTTCCAAC	0.448													G|||	1	0.000199681	0.0008	0.0	5008	,	,		18060	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													75.0	69.0	71.0					8																	2815319		1899	4117	6016	-	-	-	SO:0001583	missense	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.9716C>T	8.37:g.2815319G>A	ENSP00000430733:p.Thr3239Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.T3239M	ENST00000520002.1	37	c.9716		8	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765421	0.31228	.	.	ENSG00000183117	ENST00000400186;ENST00000520002;ENST00000318252;ENST00000537824;ENST00000542608	T;T;T;T	0.66099	-0.19;-0.19;-0.19;-0.19	5.48	1.54	0.23209	Complement control module (2);Sushi/SCR/CCP (3);	0.210345	0.39834	N	0.001250	T	0.51584	0.1683	M	0.65320	2	0.80722	D	1	B;B;B	0.30511	0.282;0.06;0.011	B;B;B	0.26693	0.035;0.072;0.027	T	0.35968	-0.9767	10	0.33940	T	0.23	.	6.846	0.23988	0.1991:0.2296:0.5714:0.0	.	3239;3239;3061	E5RIG2;Q96PZ7;F5H2I8	.;CSMD1_HUMAN;.	M	3062;3239;3100;3238;3061	ENSP00000383047:T3062M;ENSP00000430733:T3239M;ENSP00000441462:T3238M;ENSP00000446243:T3061M	ENSP00000320445:T3100M	T	-	2	0	CSMD1	2802726	0.890000	0.30428	0.138000	0.22173	0.909000	0.53808	1.229000	0.32600	0.055000	0.16094	0.643000	0.83706	ACG	CSMD1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000183117		0.448	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	152	0.65	1	G	NM_033225		2815319	2815319	-1	no_errors	ENST00000520002	ensembl	human	known	69_37n	missense	142	15.38	26	SNP	0.156	A
DALRD3	55152	genome.wustl.edu	37	3	49053683	49053684	+	Frame_Shift_Del	DEL	GT	GT	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:49053683_49053684delGT	ENST00000341949.4	-	9	1242_1243	c.1236_1237delAC	c.(1234-1239)acactcfs	p.L413fs	DALRD3_ENST00000440857.1_Frame_Shift_Del_p.L246fs|DALRD3_ENST00000395462.4_Frame_Shift_Del_p.L246fs|DALRD3_ENST00000441576.2_Frame_Shift_Del_p.L413fs|DALRD3_ENST00000313778.5_Frame_Shift_Del_p.L246fs|DALRD3_ENST00000496568.1_5'Flank	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	413					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		CTCTCAAAGAGTGTGGCAAGAC	0.495																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.1236_1237delAC	3.37:g.49053685_49053686delGT	ENSP00000344989:p.Leu413fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Frame_Shift_Del	DEL	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.F414fs	ENST00000341949.4	37	c.1237_1236	CCDS33754.1	3																																																																																			DALRD3	-	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	ENSG00000178149		0.495	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	111	0.00	0	GT	NM_018114		49053683	49053684	-1	no_errors	ENST00000341949	ensembl	human	known	69_37n	frame_shift_del	42	46.15	36	DEL	1.000:0.518	-
DAZAP1	26528	genome.wustl.edu	37	19	1430254	1430254	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:1430254delC	ENST00000233078.4	+	10	925	c.764delC	c.(763-765)gccfs	p.A255fs	DAZAP1_ENST00000336761.6_Frame_Shift_Del_p.A255fs	NM_018959.2	NP_061832.2	Q96EP5	DAZP1_HUMAN	DAZ associated protein 1	255	Pro-rich.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|maternal placenta development (GO:0001893)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA stem-loop binding (GO:0035613)			breast(2)|endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(1)	9		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGAGGAGCCCCCCCGCCA	0.652																																						dbGAP											0													17.0	21.0	19.0					19																	1430254		2196	4297	6493	-	-	-	SO:0001589	frameshift_variant	0				CCDS12065.1, CCDS12066.1	19p13.3	2013-07-16			ENSG00000071626	ENSG00000071626		"""RNA binding motif (RRM) containing"""	2683	protein-coding gene	gene with protein product	"""deleted in azoospermia associated protein 1"""	607430				10857750, 23658607	Standard	XM_005259530		Approved	MGC19907	uc002lsn.3	Q96EP5		ENST00000233078.4:c.764delC	19.37:g.1430254delC	ENSP00000233078:p.Ala255fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MJ3|Q9NRR9	Frame_Shift_Del	DEL	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P257fs	ENST00000233078.4	37	c.764	CCDS12065.1	19																																																																																			DAZAP1	-	NULL	ENSG00000071626		0.652	DAZAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAZAP1	HGNC	protein_coding	OTTHUMT00000449522.3	20	0.00	0	C	NM_170711		1430254	1430254	+1	no_errors	ENST00000233078	ensembl	human	known	69_37n	frame_shift_del	28	41.07	23	DEL	0.998	-
DCAF4L2	138009	genome.wustl.edu	37	8	88885440	88885440	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:88885440G>A	ENST00000319675.3	-	1	856	c.760C>T	c.(760-762)Cgc>Tgc	p.R254C		NM_152418.3	NP_689631.1	Q8NA75	DC4L2_HUMAN	DDB1 and CUL4 associated factor 4-like 2	254								p.R254C(1)		breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|liver(2)|lung(40)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	83						TTTCCACAGCGCAGATCAATG	0.507																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											122.0	115.0	117.0					8																	88885440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833507	CCDS6245.1	8q21.3	2013-01-09	2009-07-17	2009-07-17		ENSG00000176566		"""WD repeat domain containing"""	26657	protein-coding gene	gene with protein product			"""WD repeat domain 21C"""	WDR21C		14702039	Standard	NM_152418		Approved		uc003ydz.3	Q8NA75		ENST00000319675.3:c.760C>T	8.37:g.88885440G>A	ENSP00000316496:p.Arg254Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R254C	ENST00000319675.3	37	c.760	CCDS6245.1	8	.	.	.	.	.	.	.	.	.	.	G	17.78	3.473212	0.63737	.	.	ENSG00000176566	ENST00000319675	T	0.25414	1.8	1.92	-0.462	0.12168	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.43809	0.1264	M	0.78916	2.43	0.45621	D	0.998552	D	0.89917	1.0	D	0.81914	0.995	T	0.24870	-1.0148	10	0.87932	D	0	.	6.3105	0.21163	0.2816:0.0:0.7184:0.0	.	254	Q8NA75	DC4L2_HUMAN	C	254	ENSP00000316496:R254C	ENSP00000316496:R254C	R	-	1	0	DCAF4L2	88954556	1.000000	0.71417	0.126000	0.21872	0.469000	0.32828	4.495000	0.60353	-0.423000	0.07394	0.467000	0.42956	CGC	DCAF4L2	-	superfamily_WD40_repeat_dom	ENSG00000176566		0.507	DCAF4L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L2	HGNC	protein_coding	OTTHUMT00000375302.1	141	0.00	0	G	NM_152418		88885440	88885440	-1	no_errors	ENST00000319675	ensembl	human	known	69_37n	missense	129	34.18	67	SNP	0.994	A
DCTN1	1639	genome.wustl.edu	37	2	74593377	74593377	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:74593377delG	ENST00000361874.3	-	23	3071	c.2754delC	c.(2752-2754)cccfs	p.P918fs	DCTN1_ENST00000409868.1_Frame_Shift_Del_p.P901fs|DCTN1_ENST00000495643.1_5'UTR|DCTN1_ENST00000394003.3_Frame_Shift_Del_p.P911fs|DCTN1_ENST00000409567.3_Frame_Shift_Del_p.P898fs|DCTN1_ENST00000407639.2_Frame_Shift_Del_p.P784fs|DCTN1_ENST00000409438.1_Frame_Shift_Del_p.P784fs|RP11-287D1.3_ENST00000451608.2_5'Flank|DCTN1_ENST00000409240.1_Frame_Shift_Del_p.P881fs	NM_004082.4	NP_004073.2	Q14203	DCTN1_HUMAN	dynactin 1	918					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|G2/M transition of mitotic cell cycle (GO:0000086)|melanosome transport (GO:0032402)|microtubule-based transport (GO:0010970)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nervous system development (GO:0007399)	cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dynactin complex (GO:0005869)|dynein complex (GO:0030286)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(20)|ovary(4)|prostate(1)|skin(3)	45						CTACCTTGCTGGGGGGCCGCT	0.562																																						dbGAP											0													89.0	93.0	92.0					2																	74593377		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS1939.1, CCDS46341.1, CCDS46342.1, CCDS54368.1, CCDS54369.1	2p13	2014-09-17	2010-06-24		ENSG00000204843	ENSG00000204843			2711	protein-coding gene	gene with protein product	"""p150 glued homolog (Drosophila)"""	601143	"""dynactin 1 (p150, Glued (Drosophila) homolog)"""			1828535	Standard	NM_001190836		Approved		uc002skx.3	Q14203	OTTHUMG00000129963	ENST00000361874.3:c.2754delC	2.37:g.74593377delG	ENSP00000354791:p.Pro918fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY36|B4DM45|E9PFS5|E9PGE1|G5E9H4|O95296|Q6IQ37|Q9BRM9|Q9UIU1|Q9UIU2	Frame_Shift_Del	DEL	pfam_Dynactin,pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Polyketide_synth_docking,pfscan_CAP-Gly_domain	p.S919fs	ENST00000361874.3	37	c.2754	CCDS1939.1	2																																																																																			DCTN1	-	NULL	ENSG00000204843		0.562	DCTN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DCTN1	HGNC	protein_coding	OTTHUMT00000252227.3	79	0.00	0	G	NM_004082		74593377	74593377	-1	no_errors	ENST00000361874	ensembl	human	known	69_37n	frame_shift_del	82	10.75	10	DEL	0.997	-
DDX20	11218	genome.wustl.edu	37	1	112305336	112305336	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:112305336T>C	ENST00000369702.4	+	9	1762	c.1142T>C	c.(1141-1143)gTt>gCt	p.V381A	DDX20_ENST00000536167.1_3'UTR|DDX20_ENST00000475700.1_5'UTR	NM_007204.4	NP_009135.4	Q9UHI6	DDX20_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 20	381	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				ATP catabolic process (GO:0006200)|gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oogenesis (GO:0048477)|positive regulation of apoptotic process (GO:0043065)|regulation of steroid biosynthetic process (GO:0050810)|RNA metabolic process (GO:0016070)|RNA processing (GO:0006396)|spliceosomal snRNP assembly (GO:0000387)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)|transcriptional repressor complex (GO:0017053)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)			endometrium(3)|kidney(7)|large_intestine(6)|lung(3)|pancreas(1)|prostate(1)	21		all_cancers(81;1.06e-05)|all_epithelial(167;7.36e-06)|all_lung(203;2.44e-05)|Lung NSC(69;4.15e-05)		Lung(183;0.0234)|Colorectal(144;0.0282)|all cancers(265;0.0614)|Epithelial(280;0.0999)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		GTGAATCTGGTTGTAAATCTG	0.383																																						dbGAP											0													163.0	167.0	166.0					1																	112305336		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106019	CCDS842.1	1p21.1-p13.2	2008-02-05	2003-06-13		ENSG00000064703	ENSG00000064703		"""DEAD-boxes"""	2743	protein-coding gene	gene with protein product		606168	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 20, 103kD"""			10383418	Standard	NM_007204		Approved	DP103, GEMIN3	uc001ebs.3	Q9UHI6	OTTHUMG00000011956	ENST00000369702.4:c.1142T>C	1.37:g.112305336T>C	ENSP00000358716:p.Val381Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWV7|Q96F72|Q9NVM3|Q9UF59|Q9UIY0|Q9Y659	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.V381A	ENST00000369702.4	37	c.1142	CCDS842.1	1	.	.	.	.	.	.	.	.	.	.	T	27.7	4.852422	0.91355	.	.	ENSG00000064703	ENST00000369702	D	0.84730	-1.89	5.64	5.64	0.86602	Helicase, C-terminal (3);	0.000000	0.85682	D	0.000000	D	0.94958	0.8369	H	0.98111	4.15	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.96830	0.9610	10	0.87932	D	0	-44.1333	15.5302	0.75952	0.0:0.0:0.0:1.0	.	381	Q9UHI6	DDX20_HUMAN	A	381	ENSP00000358716:V381A	ENSP00000358716:V381A	V	+	2	0	DDX20	112106859	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.698000	0.84413	2.145000	0.66743	0.533000	0.62120	GTT	DDX20	-	pfam_Helicase_C,smart_Helicase_C,pfscan_Helicase_C	ENSG00000064703		0.383	DDX20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX20	HGNC	protein_coding	OTTHUMT00000033063.2	371	0.00	0	T	NM_007204		112305336	112305336	+1	no_errors	ENST00000369702	ensembl	human	known	69_37n	missense	448	13.82	72	SNP	1.000	C
DENND1B	163486	genome.wustl.edu	37	1	197480015	197480015	+	IGR	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:197480015C>T								CRB1 (32430 upstream) : DENND1B (41369 downstream)																							AGGGCACTATCGTCTTGCCCA	0.458																																						dbGAP											0													55.0	55.0	55.0					1																	197480015		2203	4299	6502	-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.197480015C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D275N		37	c.823		1	.	.	.	.	.	.	.	.	.	.	C	18.55	3.648037	0.67358	.	.	ENSG00000213047	ENST00000391979;ENST00000542760;ENST00000450419	T	0.61040	0.14	5.34	5.34	0.76211	.	0.294948	0.26442	U	0.024358	T	0.73063	0.3539	L	0.55990	1.75	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	T	0.74368	-0.3688	10	0.66056	D	0.02	.	19.389	0.94573	0.0:1.0:0.0:0.0	.	635	Q6P3S1-5	.	N	275;635;615	ENSP00000375839:D275N	ENSP00000375839:D275N	D	-	1	0	DENND1B	195746638	1.000000	0.71417	0.509000	0.27700	0.003000	0.03518	4.968000	0.63728	2.654000	0.90174	0.563000	0.77884	GAT	DENND1B	-	NULL	ENSG00000213047	0	0.458					DENND1B	HGNC			61	0.00	0	C			197480015	197480015	-1	no_start_codon	ENST00000391979	ensembl	human	putative	69_37n	missense	10	50.00	11	SNP	0.998	T
DIP2B	57609	genome.wustl.edu	37	12	51092970	51092970	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:51092970delA	ENST00000301180.5	+	19	2344	c.2310delA	c.(2308-2310)acafs	p.T770fs		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	770						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CTGGTGTGACAAAAAATACAT	0.443																																						dbGAP											0													176.0	155.0	162.0					12																	51092970		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2310delA	12.37:g.51092970delA	ENSP00000301180:p.Thr770fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B011|Q8N1L5|Q8NB38	Frame_Shift_Del	DEL	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.N772fs	ENST00000301180.5	37	c.2310	CCDS31799.1	12																																																																																			DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.443	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	295	0.00	0	A	NM_173602		51092970	51092970	+1	no_errors	ENST00000301180	ensembl	human	known	69_37n	frame_shift_del	343	12.69	50	DEL	0.285	-
DNAH5	1767	genome.wustl.edu	37	5	13871098	13871098	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:13871098G>A	ENST00000265104.4	-	24	3716	c.3612C>T	c.(3610-3612)ttC>ttT	p.F1204F	CTB-51A17.1_ENST00000503244.1_RNA	NM_001369.2	NP_001360.1	Q8TE73	DYH5_HUMAN	dynein, axonemal, heavy chain 5	1204	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|lateral ventricle development (GO:0021670)|left/right axis specification (GO:0070986)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(6)|breast(14)|central_nervous_system(4)|cervix(2)|endometrium(23)|haematopoietic_and_lymphoid_tissue(8)|kidney(11)|large_intestine(85)|liver(1)|lung(129)|ovary(16)|pancreas(2)|prostate(5)|skin(48)|stomach(5)|upper_aerodigestive_tract(11)|urinary_tract(8)	378	Lung NSC(4;0.00476)					CAGTCAGGGCGAACTTCAAGT	0.403									Kartagener syndrome																													dbGAP											0													75.0	76.0	75.0					5																	13871098		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AJ132090	CCDS3882.1	5p15.2	2008-07-18	2006-09-04		ENSG00000039139	ENSG00000039139		"""Axonemal dyneins"""	2950	protein-coding gene	gene with protein product	"""dynein heavy chain 5"""	603335	"""dynein, axonemal, heavy polypeptide 5"""			9256245, 11788826	Standard	NM_001369		Approved	Dnahc5, HL1, PCD, CILD3, KTGNR	uc003jfd.2	Q8TE73	OTTHUMG00000090533	ENST00000265104.4:c.3612C>T	5.37:g.13871098G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92860|Q96L74|Q9H5S7|Q9HCG9	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.F1204	ENST00000265104.4	37	c.3612	CCDS3882.1	5																																																																																			DNAH5	-	NULL	ENSG00000039139		0.403	DNAH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH5	HGNC	protein_coding	OTTHUMT00000207057.2	157	0.00	0	G	NM_001369		13871098	13871098	-1	no_errors	ENST00000265104	ensembl	human	known	69_37n	silent	73	38.14	45	SNP	0.099	A
DOCK10	55619	genome.wustl.edu	37	2	225750871	225750871	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:225750871delC	ENST00000258390.7	-	6	588	c.521delG	c.(520-522)ggtfs	p.G176fs	DOCK10_ENST00000409592.3_Frame_Shift_Del_p.G170fs	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	176					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CGCTCCTCCACCCCCCTTGGA	0.498																																						dbGAP											0													125.0	127.0	127.0					2																	225750871		1926	4106	6032	-	-	-	SO:0001589	frameshift_variant	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.521delG	2.37:g.225750871delC	ENSP00000258390:p.Gly176fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3FL70|O75178|Q9NW06|Q9NXI8	Frame_Shift_Del	DEL	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.G174fs	ENST00000258390.7	37	c.521	CCDS46528.1	2																																																																																			DOCK10	-	NULL	ENSG00000135905		0.498	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	63	0.00	0	C			225750871	225750871	-1	no_errors	ENST00000258390	ensembl	human	known	69_37n	frame_shift_del	47	26.47	18	DEL	0.999	-
DPP7	29952	genome.wustl.edu	37	9	140006430	140006430	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:140006430A>G	ENST00000371579.2	-	10	1106	c.1102T>C	c.(1102-1104)Ttc>Ctc	p.F368L		NM_013379.2	NP_037511.2	Q9UHL4	DPP2_HUMAN	dipeptidyl-peptidase 7	368						cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	dipeptidyl-peptidase activity (GO:0008239)|serine-type peptidase activity (GO:0008236)			endometrium(2)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;4.25e-05)|Epithelial(140;0.000633)		AGGTCCGGGAACATATCGGTC	0.672																																						dbGAP											0													90.0	101.0	98.0					9																	140006430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154502	CCDS7030.1	9q34.3	2008-02-05	2006-01-12		ENSG00000176978	ENSG00000176978			14892	protein-coding gene	gene with protein product		610537	"""dipeptidylpeptidase 7"""			10477574, 11139392	Standard	XM_005266075		Approved	DPPII	uc004clh.3	Q9UHL4	OTTHUMG00000020977	ENST00000371579.2:c.1102T>C	9.37:g.140006430A>G	ENSP00000360635:p.Phe368Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7U7|Q5VSF1|Q969X4	Missense_Mutation	SNP	pfam_Peptidase_S28,pfam_AB_hydrolase_1	p.F368L	ENST00000371579.2	37	c.1102	CCDS7030.1	9	.	.	.	.	.	.	.	.	.	.	A	17.88	3.498192	0.64186	.	.	ENSG00000176978	ENST00000371579	T	0.16897	2.31	3.97	3.97	0.46021	.	0.000000	0.85682	U	0.000000	T	0.42471	0.1204	M	0.85197	2.74	0.45005	D	0.998027	D	0.76494	0.999	D	0.70487	0.969	T	0.45071	-0.9286	10	0.62326	D	0.03	-16.6632	10.7597	0.46258	1.0:0.0:0.0:0.0	.	368	Q9UHL4	DPP2_HUMAN	L	368	ENSP00000360635:F368L	ENSP00000360635:F368L	F	-	1	0	DPP7	139126251	1.000000	0.71417	0.991000	0.47740	0.189000	0.23516	6.613000	0.74192	1.673000	0.50895	0.374000	0.22700	TTC	DPP7	-	pfam_Peptidase_S28	ENSG00000176978		0.672	DPP7-003	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP7	HGNC	protein_coding	OTTHUMT00000055279.1	64	0.00	0	A	NM_013379		140006430	140006430	-1	no_errors	ENST00000371579	ensembl	human	known	69_37n	missense	58	34.09	30	SNP	1.000	G
DST	667	genome.wustl.edu	37	6	56495093	56495095	+	In_Frame_Del	DEL	CTT	CTT	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:56495093_56495095delCTT	ENST00000361203.3	-	27	3603_3605	c.3596_3598delAAG	c.(3595-3600)gaagca>gca	p.E1199del	DST_ENST00000312431.6_In_Frame_Del_p.E1199del|DST_ENST00000244364.6_In_Frame_Del_p.E873del|DST_ENST00000446842.2_In_Frame_Del_p.E873del|DST_ENST00000370788.2_In_Frame_Del_p.E1199del|DST_ENST00000370754.5_In_Frame_Del_p.E1377del|DST_ENST00000370765.6_In_Frame_Del_p.E873del|DST_ENST00000421834.2_In_Frame_Del_p.E1199del|DST_ENST00000370769.4_In_Frame_Del_p.E1199del|DST_ENST00000518935.1_In_Frame_Del_p.E873del			Q03001	DYST_HUMAN	dystonin	1199					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			GCTATAACTGCTTCTTCTTCACA	0.305																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.3596_3598delAAG	6.37:g.56495099_56495101delCTT	ENSP00000354508:p.Glu1199del	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	In_Frame_Del	DEL	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E1377in_frame_del	ENST00000361203.3	37	c.4132_4130		6																																																																																			DST	-	superfamily_ABC_transptrTM_dom_typ1	ENSG00000151914		0.305	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	264	0.00	0	CTT	NM_001723		56495093	56495095	-1	no_errors	ENST00000370754	ensembl	human	known	69_37n	in_frame_del	226	30.46	99	DEL	1.000:1.000:1.000	-
DTX2	113878	genome.wustl.edu	37	7	76126704	76126704	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:76126704C>T	ENST00000324432.5	+	7	1570	c.1060C>T	c.(1060-1062)Cgc>Tgc	p.R354C	DTX2_ENST00000413936.2_Missense_Mutation_p.R354C|DTX2_ENST00000446820.2_Intron|DTX2_ENST00000446600.1_Missense_Mutation_p.R263C|DTX2_ENST00000430490.2_Missense_Mutation_p.R354C|DTX2_ENST00000307569.8_Intron	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	354					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						GTGTCTTAGCCGCGCACCCCA	0.557																																						dbGAP											0													71.0	62.0	65.0					7																	76126704		2201	4293	6494	-	-	-	SO:0001583	missense	0				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.1060C>T	7.37:g.76126704C>T	ENSP00000322885:p.Arg354Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Missense_Mutation	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.R354C	ENST00000324432.5	37	c.1060	CCDS5587.1	7	.	.	.	.	.	.	.	.	.	.	.	15.75	2.925000	0.52759	.	.	ENSG00000091073	ENST00000324432;ENST00000541989;ENST00000446600;ENST00000413936;ENST00000430490	T;T;T;T	0.14144	2.53;2.53;2.53;2.53	5.41	4.53	0.55603	.	0.557320	0.20084	N	0.099589	T	0.16128	0.0388	M	0.68593	2.085	0.80722	D	1	B;B;B	0.24426	0.103;0.004;0.016	B;B;B	0.23852	0.049;0.002;0.003	T	0.03157	-1.1066	10	0.62326	D	0.03	-27.1906	7.7798	0.29058	0.0:0.7542:0.0:0.2458	.	263;263;354	F5GX89;E7ET89;Q86UW9	.;.;DTX2_HUMAN	C	354;263;263;354;354	ENSP00000322885:R354C;ENSP00000397648:R263C;ENSP00000390218:R354C;ENSP00000411986:R354C	ENSP00000322885:R354C	R	+	1	0	AC005522.1	75964640	0.061000	0.20836	1.000000	0.80357	0.983000	0.72400	0.394000	0.20834	1.432000	0.47375	-0.136000	0.14681	CGC	DTX2	-	NULL	ENSG00000091073		0.557	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	Clone_based_vega_gene	protein_coding	OTTHUMT00000253104.2	98	0.00	0	C			76126704	76126704	+1	no_errors	ENST00000324432	ensembl	human	known	69_37n	missense	130	26.97	48	SNP	1.000	T
EDNRB	1910	genome.wustl.edu	37	13	78477305	78477305	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr13:78477305T>C	ENST00000334286.5	-	3	1023	c.787A>G	c.(787-789)Aca>Gca	p.T263A	EDNRB_ENST00000377211.4_Missense_Mutation_p.T353A|EDNRB_ENST00000446573.1_Missense_Mutation_p.T263A	NM_000115.3|NM_001122659.2	NP_000106.1|NP_001116131.1	P24530	EDNRB_HUMAN	endothelin receptor type B	263					aging (GO:0007568)|cell surface receptor signaling pathway (GO:0007166)|cellular response to lipopolysaccharide (GO:0071222)|cGMP-mediated signaling (GO:0019934)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|enteric smooth muscle cell differentiation (GO:0035645)|epithelial fluid transport (GO:0042045)|macrophage chemotaxis (GO:0048246)|melanocyte differentiation (GO:0030318)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular protein metabolic process (GO:0032269)|negative regulation of neuron maturation (GO:0014043)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|peripheral nervous system development (GO:0007422)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of penile erection (GO:0060406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|posterior midgut development (GO:0007497)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|regulation of fever generation (GO:0031620)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|response to organic cyclic compound (GO:0014070)|response to pain (GO:0048265)|sensory perception of pain (GO:0019233)|vasoconstriction (GO:0042310)|vasodilation (GO:0042311)|vein smooth muscle contraction (GO:0014826)	integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)	endothelin receptor activity (GO:0004962)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(2)|kidney(1)|large_intestine(18)|lung(16)|skin(3)	42		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0933)	Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	ATGAAAGCTGTCTTCTGAACG	0.398																																						dbGAP											0													120.0	121.0	121.0					13																	78477305		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06623	CCDS9461.1, CCDS55902.1	13q22	2012-08-08			ENSG00000136160	ENSG00000136160		"""GPCR / Class A : Endothelin receptors"""	3180	protein-coding gene	gene with protein product		131244		HSCR2, HSCR		1659806, 9556633	Standard	NM_000115		Approved	ETB	uc001vkp.1	P24530	OTTHUMG00000017111	ENST00000334286.5:c.787A>G	13.37:g.78477305T>C	ENSP00000335311:p.Thr263Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Z8|A8K3T4|O15343|Q59GB1|Q5W0G9|Q8NHM6|Q8NHM7|Q8NHM8|Q8NHM9|Q9UD23|Q9UQK3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_ETB_rcpt,prints_Endthln_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Bombsn_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.T263A	ENST00000334286.5	37	c.787	CCDS9461.1	13	.	.	.	.	.	.	.	.	.	.	T	12.82	2.052800	0.36181	.	.	ENSG00000136160	ENST00000377211;ENST00000446573;ENST00000334286	T;T;T	0.33865	1.39;1.39;1.39	5.62	5.62	0.85841	GPCR, rhodopsin-like superfamily (1);	0.214426	0.48286	D	0.000190	T	0.36110	0.0955	L	0.54908	1.71	0.35973	D	0.835441	B;B;B	0.26975	0.165;0.165;0.08	B;B;B	0.32211	0.049;0.142;0.119	T	0.45190	-0.9278	10	0.44086	T	0.13	-11.9913	10.9569	0.47362	0.1396:0.0:0.0:0.8604	.	263;353;263	P24530-2;P24530-3;P24530	.;.;EDNRB_HUMAN	A	353;263;263	ENSP00000366416:T353A;ENSP00000403401:T263A;ENSP00000335311:T263A	ENSP00000335311:T263A	T	-	1	0	EDNRB	77375306	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	3.004000	0.49513	2.123000	0.65237	0.528000	0.53228	ACA	EDNRB	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_ETB_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000136160		0.398	EDNRB-003	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRB	HGNC	protein_coding	OTTHUMT00000276505.1	210	0.47	1	T			78477305	78477305	-1	no_errors	ENST00000334286	ensembl	human	known	69_37n	missense	64	39.05	41	SNP	1.000	C
ENPP4	22875	genome.wustl.edu	37	6	46107649	46107650	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:46107649_46107650insT	ENST00000321037.4	+	2	559_560	c.329_330insT	c.(328-333)ccttttfs	p.PF110fs		NM_014936.4	NP_055751.1	Q9Y6X5	ENPP4_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 4 (putative)	110					blood coagulation (GO:0007596)|positive regulation of blood coagulation (GO:0030194)|purine ribonucleoside catabolic process (GO:0046130)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	bis(5'-adenosyl)-triphosphatase activity (GO:0047710)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(2)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	18						GACAAGGATCCTTTTTGGTGGA	0.436																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB020686	CCDS34468.1	6p12.3	2010-06-24	2010-06-24		ENSG00000001561	ENSG00000001561			3359	protein-coding gene	gene with protein product						11027689	Standard	NM_014936		Approved	NPP4, KIAA0879	uc003oxy.3	Q9Y6X5	OTTHUMG00000014779	ENST00000321037.4:c.334dupT	6.37:g.46107654_46107654dupT	ENSP00000318066:p.Pro110fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5G1|Q7L2N1	Frame_Shift_Ins	INS	pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.W112fs	ENST00000321037.4	37	c.329_330	CCDS34468.1	6																																																																																			ENPP4	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000001561		0.436	ENPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP4	HGNC	protein_coding	OTTHUMT00000040777.2	86	0.00	0	-			46107649	46107650	+1	no_errors	ENST00000321037	ensembl	human	known	69_37n	frame_shift_ins	30	33.33	15	INS	1.000:0.956	T
EPAS1	2034	genome.wustl.edu	37	2	46607728	46607728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:46607728G>A	ENST00000263734.3	+	12	2427	c.1917G>A	c.(1915-1917)tgG>tgA	p.W639*		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	639					angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			ATACCCAGTGGCCCCCAGATC	0.617																																						dbGAP											0													57.0	68.0	64.0					2																	46607728		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.1917G>A	2.37:g.46607728G>A	ENSP00000263734:p.Trp639*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VA2|Q99630	Nonsense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.W639*	ENST00000263734.3	37	c.1917	CCDS1825.1	2	.	.	.	.	.	.	.	.	.	.	G	45	11.423485	0.99559	.	.	ENSG00000116016	ENST00000263734	.	.	.	5.18	5.18	0.71444	.	0.513188	0.22324	N	0.061541	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	.	18.7217	0.91697	0.0:0.0:1.0:0.0	.	.	.	.	X	639	.	ENSP00000263734:W639X	W	+	3	0	EPAS1	46461232	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.465000	0.97660	2.426000	0.82243	0.585000	0.79938	TGG	EPAS1	-	NULL	ENSG00000116016		0.617	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	26	0.00	0	G	NM_001430		46607728	46607728	+1	no_errors	ENST00000263734	ensembl	human	known	69_37n	nonsense	40	19.61	10	SNP	1.000	A
AMER1	139285	genome.wustl.edu	37	X	63411278	63411278	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:63411278G>A	ENST00000330258.3	-	2	2161	c.1889C>T	c.(1888-1890)gCc>gTc	p.A630V	AMER1_ENST00000403336.1_Missense_Mutation_p.A630V|AMER1_ENST00000374869.3_Missense_Mutation_p.A630V	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	630					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									AACCTCTCGGGCCTGGGCTTC	0.602																																						dbGAP											67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											26.0	23.0	24.0					X																	63411278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.1889C>T	X.37:g.63411278G>A	ENSP00000329117:p.Ala630Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.A630V	ENST00000330258.3	37	c.1889	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	G	1.231	-0.624001	0.03636	.	.	ENSG00000184675	ENST00000374869;ENST00000330258;ENST00000403336	T;T;T	0.51325	0.76;0.71;0.76	4.16	0.139	0.14798	.	1.063830	0.07322	N	0.877831	T	0.36496	0.0969	L	0.43152	1.355	0.09310	N	1	B	0.10296	0.003	B	0.12156	0.007	T	0.28996	-1.0026	10	0.38643	T	0.18	1.7051	4.3149	0.10988	0.0888:0.2991:0.4708:0.1413	.	630	Q5JTC6	F123B_HUMAN	V	630	ENSP00000364003:A630V;ENSP00000329117:A630V;ENSP00000384722:A630V	ENSP00000329117:A630V	A	-	2	0	FAM123B	63328003	0.412000	0.25392	0.000000	0.03702	0.009000	0.06853	2.011000	0.40922	-0.103000	0.12175	0.600000	0.82982	GCC	FAM123B	-	NULL	ENSG00000184675		0.602	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	38	0.00	0	G	NM_152424		63411278	63411278	-1	no_errors	ENST00000330258	ensembl	human	known	69_37n	missense	36	40.98	25	SNP	0.001	A
FAM151B	167555	genome.wustl.edu	37	5	79797660	79797660	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:79797660T>C	ENST00000282226.4	+	2	230	c.75T>C	c.(73-75)atT>atC	p.I25I	FAM151B_ENST00000511718.1_3'UTR	NM_205548.2	NP_991111.2	Q6UXP7	F151B_HUMAN	family with sequence similarity 151, member B	25										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)	7		Lung NSC(167;0.0427)|all_lung(232;0.0464)|Ovarian(174;0.113)		OV - Ovarian serous cystadenocarcinoma(54;8.21e-47)|Epithelial(54;8.3e-42)|all cancers(79;1.97e-36)		ATAGCCAGATTACAGCAGAAG	0.358																																						dbGAP											0													146.0	150.0	148.0					5																	79797660		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4051.1	5q14.1	2007-12-18	2007-12-18		ENSG00000152380	ENSG00000152380			33716	protein-coding gene	gene with protein product							Standard	NM_205548		Approved	UNQ9217	uc003kgv.2	Q6UXP7	OTTHUMG00000131303	ENST00000282226.4:c.75T>C	5.37:g.79797660T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE4	Silent	SNP	pfam_DUF2181	p.I25	ENST00000282226.4	37	c.75	CCDS4051.1	5																																																																																			FAM151B	-	NULL	ENSG00000152380		0.358	FAM151B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM151B	HGNC	protein_coding	OTTHUMT00000254072.1	142	0.00	0	T	NM_205548		79797660	79797660	+1	no_errors	ENST00000282226	ensembl	human	known	69_37n	silent	152	24.75	50	SNP	0.985	C
FAM171A1	221061	genome.wustl.edu	37	10	15262985	15262985	+	Frame_Shift_Del	DEL	G	G	-	rs554506784		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:15262985delG	ENST00000378116.4	-	6	835	c.829delC	c.(829-831)cagfs	p.Q277fs	FAM171A1_ENST00000477161.1_5'UTR	NM_001010924.1	NP_001010924.1	Q5VUB5	F1711_HUMAN	family with sequence similarity 171, member A1	277						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(6)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(20)|ovary(3)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	52						TACCCCAACTGGGGGGCAATG	0.562																																						dbGAP											0													104.0	98.0	100.0					10																	15262985		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK022946	CCDS31154.1	10p13	2008-06-16	2008-06-16	2008-06-16	ENSG00000148468	ENSG00000148468			23522	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 38"""	C10orf38			Standard	NM_001010924		Approved	FLJ12884	uc001iob.3	Q5VUB5	OTTHUMG00000017732	ENST00000378116.4:c.829delC	10.37:g.15262985delG	ENSP00000367356:p.Gln277fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRT9|Q32M49|Q8N4I0	Frame_Shift_Del	DEL	pfam_Uncharacterised_FAM171	p.Q277fs	ENST00000378116.4	37	c.829	CCDS31154.1	10																																																																																			FAM171A1	-	pfam_Uncharacterised_FAM171	ENSG00000148468		0.562	FAM171A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171A1	HGNC	protein_coding	OTTHUMT00000046984.1	45	0.00	0	G	XM_167709		15262985	15262985	-1	no_errors	ENST00000378116	ensembl	human	known	69_37n	frame_shift_del	24	32.43	12	DEL	1.000	-
FAM173B	134145	genome.wustl.edu	37	5	10239163	10239163	+	Intron	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:10239163delT	ENST00000511437.1	-	2	319				FAM173B_ENST00000280330.8_5'UTR|FAM173B_ENST00000510047.1_Intron|FAM173B_ENST00000510052.1_Intron	NM_199133.3	NP_954584.2	Q6P4H8	F173B_HUMAN	family with sequence similarity 173, member B							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	16						CCTTAAAATGTTTTAGCAGAA	0.393																																						dbGAP											0													86.0	83.0	84.0					5																	10239163		1913	4113	6026	-	-	-	SO:0001627	intron_variant	0				CCDS43301.1, CCDS58942.1	5p15.2	2008-08-08			ENSG00000150756	ENSG00000150756			27029	protein-coding gene	gene with protein product						12477932	Standard	NM_199133		Approved		uc003jeo.3	Q6P4H8	OTTHUMG00000161771	ENST00000511437.1:c.306+15A>-	5.37:g.10239163delT		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DT41|B4DXK2|E9PBZ4	Frame_Shift_Del	DEL	NULL	p.T108fs	ENST00000511437.1	37	c.322	CCDS43301.1	5																																																																																			FAM173B	-	NULL	ENSG00000150756		0.393	FAM173B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM173B	HGNC	protein_coding	OTTHUMT00000366048.2	119	0.00	0	T	NM_199133		10239163	10239163	-1	no_errors	ENST00000504390	ensembl	human	known	69_37n	frame_shift_del	117	12.69	17	DEL	0.000	-
FAM208A	23272	genome.wustl.edu	37	3	56667416	56667416	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:56667416C>T	ENST00000493960.2	-	18	3413	c.3403G>A	c.(3403-3405)Gag>Aag	p.E1135K	FAM208A_ENST00000355628.5_Missense_Mutation_p.E1074K|FAM208A_ENST00000431842.2_Missense_Mutation_p.E698K	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1135				E -> G (in Ref. 1; AAD55098). {ECO:0000305}.			poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						CACAGTGGCTCAAGGAGATGT	0.438																																						dbGAP											0													142.0	136.0	138.0					3																	56667416		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3403G>A	3.37:g.56667416C>T	ENSP00000417509:p.Glu1135Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.E1074K	ENST00000493960.2	37	c.3220	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	C	16.93	3.257555	0.59321	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.13196	2.61;2.76;2.77	5.71	5.71	0.89125	.	0.523356	0.20035	N	0.100632	T	0.37544	0.1007	L	0.61218	1.895	0.22911	N	0.998577	D;D;D;D	0.76494	0.996;0.996;0.999;0.997	D;P;D;P	0.73708	0.919;0.877;0.981;0.87	T	0.06534	-1.0821	10	0.42905	T	0.14	-0.5778	20.2245	0.98337	0.0:1.0:0.0:0.0	.	1135;1074;698;1135	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	K	698;1135;1074	ENSP00000399410:E698K;ENSP00000417509:E1135K;ENSP00000347845:E1074K	ENSP00000347845:E1074K	E	-	1	0	C3orf63	56642456	0.298000	0.24417	0.220000	0.23810	0.800000	0.45204	2.445000	0.44899	2.861000	0.98227	0.650000	0.86243	GAG	FAM208A	-	NULL	ENSG00000163946		0.438	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	217	0.00	0	C	NM_015224		56667416	56667416	-1	no_errors	ENST00000355628	ensembl	human	known	69_37n	missense	126	28.41	50	SNP	0.405	T
FAM35BP	414241	genome.wustl.edu	37	10	46927960	46927963	+	IGR	DEL	ACAA	ACAA	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	ACAA	ACAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:46927960_46927963delACAA								FAM35BP (4272 upstream) : RP11-38L15.2 (9644 downstream)																							AACAGGATCTACAAACAATGTTTT	0.338																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															10.37:g.46927964_46927967delACAA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL		37	NULL		10																																																																																			FAM35B	-	-	ENSG00000165874	0	0.338					FAM35B	HGNC			142	0.00	0	ACAA			46927960	46927963	+1	no_errors	ENST00000497389	ensembl	human	known	69_37n	rna	105	22.79	31	DEL	0.998:0.988:0.986:0.965	-
FAM47A	158724	genome.wustl.edu	37	X	34148695	34148695	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:34148695A>T	ENST00000346193.3	-	1	1752	c.1701T>A	c.(1699-1701)caT>caA	p.H567Q		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	567										NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						CCGAGAATTGATGGGACTCTG	0.537																																						dbGAP											0													70.0	67.0	68.0					X																	34148695		2164	4269	6433	-	-	-	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.1701T>A	X.37:g.34148695A>T	ENSP00000345029:p.His567Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.H567Q	ENST00000346193.3	37	c.1701	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	a	2.383	-0.341678	0.05243	.	.	ENSG00000185448	ENST00000346193	T	0.18960	2.18	0.207	-0.413	0.12363	.	.	.	.	.	T	0.11665	0.0284	N	0.24115	0.695	0.09310	N	1	P	0.45827	0.867	P	0.44447	0.45	T	0.15206	-1.0445	8	0.13470	T	0.59	.	.	.	.	.	567	Q5JRC9	FA47A_HUMAN	Q	567	ENSP00000345029:H567Q	ENSP00000345029:H567Q	H	-	3	2	FAM47A	34058616	0.000000	0.05858	0.002000	0.10522	0.009000	0.06853	-0.311000	0.08124	-1.068000	0.03156	-1.141000	0.01876	CAT	FAM47A	-	NULL	ENSG00000185448		0.537	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	274	0.00	0	A	NM_203408		34148695	34148695	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	missense	306	17.91	67	SNP	0.003	T
FAM47A	158724	genome.wustl.edu	37	X	34150200	34150200	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:34150200C>T	ENST00000346193.3	-	1	247	c.196G>A	c.(196-198)Gaa>Aaa	p.E66K		NM_203408.3	NP_981953.2	Q5JRC9	FA47A_HUMAN	family with sequence similarity 47, member A	66								p.E66K(1)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(5)|large_intestine(17)|lung(44)|ovary(5)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	97						AGAGTATCTTCGGGAGACGGA	0.552																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											82.0	79.0	80.0					X																	34150200		2202	4300	6502	-	-	-	SO:0001583	missense	0			BC026171	CCDS43926.1	Xp21.1	2004-08-09			ENSG00000185448	ENSG00000185448			29962	protein-coding gene	gene with protein product	"""similar to hypothetical protein FLJ35782"""					12477932	Standard	NM_203408		Approved	MGC27003	uc004ddg.3	Q5JRC9	OTTHUMG00000021339	ENST00000346193.3:c.196G>A	X.37:g.34150200C>T	ENSP00000345029:p.Glu66Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8I9|Q8TAA0	Missense_Mutation	SNP	NULL	p.E66K	ENST00000346193.3	37	c.196	CCDS43926.1	X	.	.	.	.	.	.	.	.	.	.	C	13.51	2.257576	0.39896	.	.	ENSG00000185448	ENST00000346193	T	0.19806	2.12	1.17	1.17	0.20885	.	.	.	.	.	T	0.14570	0.0352	L	0.46741	1.465	0.09310	N	1	P	0.41159	0.74	B	0.35240	0.198	T	0.14839	-1.0458	9	0.33940	T	0.23	.	5.3637	0.16101	0.0:1.0:0.0:0.0	.	66	Q5JRC9	FA47A_HUMAN	K	66	ENSP00000345029:E66K	ENSP00000345029:E66K	E	-	1	0	FAM47A	34060121	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	0.167000	0.16602	0.880000	0.35969	0.544000	0.68410	GAA	FAM47A	-	NULL	ENSG00000185448		0.552	FAM47A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47A	HGNC	protein_coding	OTTHUMT00000056205.1	193	0.00	0	C	NM_203408		34150200	34150200	-1	no_errors	ENST00000346193	ensembl	human	known	69_37n	missense	226	11.28	29	SNP	0.002	T
FAM73A	374986	genome.wustl.edu	37	1	78272735	78272735	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:78272735A>T	ENST00000370791.3	+	5	618	c.586A>T	c.(586-588)Att>Ttt	p.I196F	FAM73A_ENST00000443751.2_Missense_Mutation_p.I158F	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	196						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		TGAAGATGATATTAAACTTGT	0.343																																						dbGAP											0													128.0	134.0	132.0					1																	78272735		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.586A>T	1.37:g.78272735A>T	ENSP00000359827:p.Ile196Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6MZG0	Missense_Mutation	SNP	pfam_DUF2217	p.I196F	ENST00000370791.3	37	c.586	CCDS681.1	1	.	.	.	.	.	.	.	.	.	.	A	13.57	2.277680	0.40294	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.22336	1.96;1.96	5.63	-7.13	0.01532	.	0.452014	0.24312	N	0.039639	T	0.03136	0.0092	L	0.44542	1.39	0.22666	N	0.998879	P;P;P	0.38440	0.631;0.491;0.491	B;B;B	0.37304	0.246;0.091;0.091	T	0.46219	-0.9207	10	0.09590	T	0.72	-16.1442	5.2315	0.15424	0.3952:0.0977:0.412:0.095	.	158;196;196	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	F	196;158	ENSP00000359827:I196F;ENSP00000393675:I158F	ENSP00000359827:I196F	I	+	1	0	FAM73A	78045323	0.001000	0.12720	0.761000	0.31378	0.944000	0.59088	-0.373000	0.07494	-1.199000	0.02666	-0.250000	0.11733	ATT	FAM73A	-	pfam_DUF2217	ENSG00000180488		0.343	FAM73A-001	KNOWN	basic|CCDS	protein_coding	FAM73A	HGNC	protein_coding	OTTHUMT00000026931.1	332	0.00	0	A	NM_198549		78272735	78272735	+1	no_errors	ENST00000370791	ensembl	human	known	69_37n	missense	291	34.31	152	SNP	0.198	T
FBXO15	201456	genome.wustl.edu	37	18	71807443	71807443	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:71807443A>G	ENST00000419743.2	-	2	300	c.221T>C	c.(220-222)cTg>cCg	p.L74P	FBXO15_ENST00000269500.5_5'UTR	NM_001142958.1	NP_001136430.1	Q8NCQ5	FBX15_HUMAN	F-box protein 15	74						SCF ubiquitin ligase complex (GO:0019005)				autonomic_ganglia(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)	27		Esophageal squamous(42;0.103)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.143)		TTACCCATCCAGGAACCCAGA	0.522																																						dbGAP											0													56.0	52.0	53.0					18																	71807443		692	1591	2283	-	-	-	SO:0001583	missense	0			AK094215	CCDS45884.1	18q22.3	2006-03-09	2004-06-15		ENSG00000141665	ENSG00000141665		"""F-boxes /  ""other"""""	13617	protein-coding gene	gene with protein product		609093	"""F-box only protein 15"""			12665572	Standard	NM_152676		Approved	MGC39671, FBX15	uc002llf.2	Q8NCQ5	OTTHUMG00000132842	ENST00000419743.2:c.221T>C	18.37:g.71807443A>G	ENSP00000393154:p.Leu74Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KST3	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.L74P	ENST00000419743.2	37	c.221	CCDS45884.1	18	.	.	.	.	.	.	.	.	.	.	A	17.76	3.468275	0.63625	.	.	ENSG00000141665	ENST00000419743	T	0.28895	1.59	4.84	4.84	0.62591	.	.	.	.	.	T	0.56949	0.2020	M	0.85373	2.75	0.80722	D	1	D	0.76494	0.999	D	0.73708	0.981	T	0.63470	-0.6630	9	0.72032	D	0.01	-10.8639	11.0992	0.48163	1.0:0.0:0.0:0.0	.	74	B3KST3	.	P	74	ENSP00000393154:L74P	ENSP00000393154:L74P	L	-	2	0	FBXO15	69958423	0.966000	0.33281	0.841000	0.33234	0.108000	0.19459	3.995000	0.57001	1.953000	0.56701	0.528000	0.53228	CTG	FBXO15	-	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	ENSG00000141665		0.522	FBXO15-002	KNOWN	basic|CCDS	protein_coding	FBXO15	HGNC	protein_coding	OTTHUMT00000444223.1	113	0.00	0	A	NM_152676		71807443	71807443	-1	no_errors	ENST00000419743	ensembl	human	known	69_37n	missense	97	28.15	38	SNP	0.903	G
FBXW10	10517	genome.wustl.edu	37	17	18682399	18682399	+	Missense_Mutation	SNP	A	A	G	rs1318979	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:18682399A>G	ENST00000395665.4	+	14	3168	c.2947A>G	c.(2947-2949)Act>Gct	p.T983A	TVP23B_ENST00000307767.8_5'Flank|TVP23B_ENST00000574226.1_5'Flank|FBXW10_ENST00000308799.4_Missense_Mutation_p.T992A|FBXW10_ENST00000301938.4_Missense_Mutation_p.T930A|TVP23B_ENST00000476139.1_5'Flank|FBXW10_ENST00000395667.1_Missense_Mutation_p.T982A			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	983								p.T982A(1)		NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						TAGAGTGAACACTGAGTTCGT	0.527																																						dbGAP											1	Substitution - Missense(1)	skin(1)											61.0	55.0	57.0					17																	18682399		2015	3877	5892	-	-	-	SO:0001583	missense	0			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.2947A>G	17.37:g.18682399A>G	ENSP00000379025:p.Thr983Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.T992A	ENST00000395665.4	37	c.2974	CCDS11199.3	17	409	0.18727106227106227	97	0.19715447154471544	81	0.22375690607734808	71	0.12412587412587413	160	0.21108179419525067	A	10.59	1.393102	0.25118	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.77877	-1.13;-1.13;-1.13;-1.13	3.38	3.38	0.38709	.	0.586804	0.12753	U	0.441979	T	0.00210	0.0006	M	0.61703	1.905	0.47276	P	6.270000000000442E-4	D;D;D;D	0.71674	0.99;0.998;0.984;0.998	D;D;D;D	0.80764	0.98;0.994;0.956;0.994	T	0.05273	-1.0895	9	0.35671	T	0.21	.	9.7578	0.40513	1.0:0.0:0.0:0.0	.	930;992;983;982	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	A	982;992;930;983	ENSP00000379026:T982A;ENSP00000310382:T992A;ENSP00000306937:T930A;ENSP00000379025:T983A	ENSP00000306937:T930A	T	+	1	0	FBXW10	18623124	0.422000	0.25473	0.559000	0.28332	0.113000	0.19764	1.755000	0.38379	1.381000	0.46364	0.338000	0.21704	ACT	FBXW10	-	NULL	ENSG00000171931		0.527	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	HGNC	protein_coding	OTTHUMT00000313531.2	95	0.00	0	A	NM_031456		18682399	18682399	+1	no_errors	ENST00000308799	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.609	G
FCGR2A	2212	genome.wustl.edu	37	1	161487829	161487829	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:161487829A>C	ENST00000271450.6	+	7	883	c.845A>C	c.(844-846)gAa>gCa	p.E282A	RP11-25K21.6_ENST00000537821.2_RNA|FCGR2A_ENST00000367972.4_Missense_Mutation_p.E281A|FCGR2A_ENST00000486608.1_3'UTR	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	282					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AATGACTATGAAACAGCTGAC	0.453																																						dbGAP											0													93.0	94.0	94.0					1																	161487829		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.845A>C	1.37:g.161487829A>C	ENSP00000271450:p.Glu282Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WUN1|Q8WW64	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E282A	ENST00000271450.6	37	c.845	CCDS44264.1	1	.	.	.	.	.	.	.	.	.	.	.	9.700	1.154308	0.21371	.	.	ENSG00000143226	ENST00000367972;ENST00000271450;ENST00000537821;ENST00000461298	T;T	0.02345	4.34;4.33	0.565	-1.03	0.10102	.	50.322400	0.00166	N	0.000001	T	0.00608	0.0020	N	0.08118	0	0.23036	N	0.998396	B;P	0.36837	0.435;0.571	B;B	0.36335	0.111;0.222	T	0.40194	-0.9576	8	0.72032	D	0.01	.	.	.	.	.	282;281	P12318;P12318-2	FCG2A_HUMAN;.	A	281;282;17;17	ENSP00000356949:E281A;ENSP00000271450:E282A	ENSP00000271450:E282A	E	+	2	0	FCGR2A	159754453	0.001000	0.12720	0.007000	0.13788	0.006000	0.05464	-0.115000	0.10741	-0.445000	0.07159	-0.490000	0.04691	GAA	FCGR2A	-	NULL	ENSG00000143226		0.453	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCGR2A	HGNC	protein_coding	OTTHUMT00000083318.3	374	0.00	0	A	NM_021642		161487829	161487829	+1	no_errors	ENST00000271450	ensembl	human	known	69_37n	missense	470	11.61	62	SNP	0.009	C
FKBP15	23307	genome.wustl.edu	37	9	115936859	115936859	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:115936859A>G	ENST00000238256.3	-	22	2345	c.2228T>C	c.(2227-2229)cTc>cCc	p.L743P		NM_015258.1	NP_056073.1	Q5T1M5	FKB15_HUMAN	FK506 binding protein 15, 133kDa	743					endocytosis (GO:0006897)|negative regulation of phosphatase activity (GO:0010923)|protein folding (GO:0006457)	actin filament (GO:0005884)|axon (GO:0030424)|endosome (GO:0005768)|growth cone (GO:0030426)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(9)|ovary(3)|urinary_tract(1)	26						CCTTTCTGAGAGGTTCTTAGG	0.443																																						dbGAP											0													66.0	64.0	65.0					9																	115936859		1882	4103	5985	-	-	-	SO:0001583	missense	0			AB014574	CCDS48007.1	9q33.1	2014-05-09	2006-10-31	2006-10-31	ENSG00000119321	ENSG00000119321		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23397	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 76"", ""WASP and FKBP-like protein"""		"""KIAA0674"""	KIAA0674		16756961, 20376207	Standard	NM_015258		Approved	PPP1R76, FKBP133, WAFL	uc004bgs.2	Q5T1M5	OTTHUMG00000020518	ENST00000238256.3:c.2228T>C	9.37:g.115936859A>G	ENSP00000238256:p.Leu743Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DK8|Q5T1M2|Q6DD85|Q9Y4D0	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,superfamily_Regulat_G_prot_signal_superfam,pfscan_PPIase_FKBP_dom	p.L743P	ENST00000238256.3	37	c.2228	CCDS48007.1	9	.	.	.	.	.	.	.	.	.	.	a	22.3	4.269737	0.80469	.	.	ENSG00000119321	ENST00000446284;ENST00000238256	T;T	0.29917	1.55;1.55	6.07	6.07	0.98685	.	.	.	.	.	T	0.55273	0.1910	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.78314	0.991;0.957	T	0.58370	-0.7648	9	0.87932	D	0	-11.325	14.5909	0.68365	1.0:0.0:0.0:0.0	.	324;743	B4DVS2;Q5T1M5	.;FKB15_HUMAN	P	768;743	ENSP00000416158:L768P;ENSP00000238256:L743P	ENSP00000238256:L743P	L	-	2	0	FKBP15	114976680	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.469000	0.73555	2.330000	0.79161	0.478000	0.44815	CTC	FKBP15	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000119321		0.443	FKBP15-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP15	HGNC	protein_coding		138	0.00	0	A	NM_015258		115936859	115936859	-1	no_errors	ENST00000238256	ensembl	human	known	69_37n	missense	116	15.83	22	SNP	1.000	G
FKBP9	11328	genome.wustl.edu	37	7	33044891	33044891	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:33044891G>A	ENST00000242209.4	+	10	1810	c.1641G>A	c.(1639-1641)cgG>cgA	p.R547R	FKBP9_ENST00000538336.1_Silent_p.R600R|FKBP9_ENST00000538443.1_Silent_p.R409R|FKBP9_ENST00000490776.2_Silent_p.R315R|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	547	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			ACCAGGACCGGAATGGAGATG	0.507																																						dbGAP											0													168.0	125.0	139.0					7																	33044891		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1641G>A	7.37:g.33044891G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.R600	ENST00000242209.4	37	c.1800	CCDS5439.1	7																																																																																			FKBP9	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000122642		0.507	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP9	HGNC	protein_coding	OTTHUMT00000215137.1	520	0.00	0	G	NM_007270		33044891	33044891	+1	no_errors	ENST00000538336	ensembl	human	known	69_37n	silent	613	10.90	75	SNP	0.990	A
FLII	2314	genome.wustl.edu	37	17	18149770	18149770	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:18149770G>A	ENST00000327031.4	-	24	3283	c.3058C>T	c.(3058-3060)Cgc>Tgc	p.R1020C	FLII_ENST00000579294.1_Missense_Mutation_p.R1009C|FLII_ENST00000379450.4_Missense_Mutation_p.R934C|FLII_ENST00000578558.1_Intron|FLII_ENST00000545457.2_Missense_Mutation_p.R965C	NM_002018.3	NP_002009.1	Q13045	FLII_HUMAN	flightless I homolog (Drosophila)	1020					multicellular organismal development (GO:0007275)|muscle contraction (GO:0006936)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|microtubule organizing center (GO:0005815)|nucleus (GO:0005634)	actin binding (GO:0003779)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(6)|lung(11)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32	all_neural(463;0.228)					TGCGTCATGCGTACCACCTGG	0.627																																						dbGAP											0													150.0	149.0	150.0					17																	18149770		2203	4299	6502	-	-	-	SO:0001583	missense	0			U01184	CCDS11192.1, CCDS58521.1, CCDS58522.1	17p11.2	2008-07-18	2001-11-28		ENSG00000177731	ENSG00000177731			3750	protein-coding gene	gene with protein product		600362	"""flightless I (Drosophila) homolog"""			7825574	Standard	NM_002018		Approved	FLI, FLIL, Fli1, MGC39265	uc002gsr.2	Q13045	OTTHUMG00000059389	ENST00000327031.4:c.3058C>T	17.37:g.18149770G>A	ENSP00000324573:p.Arg1020Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIL0|F5H407|J3QLG3	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Gelsolin,prints_Gelsolin	p.R1020C	ENST00000327031.4	37	c.3058	CCDS11192.1	17	.	.	.	.	.	.	.	.	.	.	G	21.4	4.150416	0.78001	.	.	ENSG00000177731	ENST00000327031;ENST00000545457;ENST00000379450	T;T	0.22134	1.97;1.97	5.52	5.52	0.82312	.	0.104842	0.64402	D	0.000008	T	0.50599	0.1625	M	0.84948	2.725	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.935;0.935;0.993;0.994	T	0.56159	-0.8025	10	0.87932	D	0	-20.8053	14.2942	0.66300	0.0:0.0:0.8513:0.1487	.	934;934;1020;989	E7EPM0;B4DIL0;Q13045;B4DIX0	.;.;FLII_HUMAN;.	C	1020;899;934	ENSP00000324573:R1020C;ENSP00000368763:R934C	ENSP00000324573:R1020C	R	-	1	0	FLII	18090495	1.000000	0.71417	0.993000	0.49108	0.950000	0.60333	5.546000	0.67243	2.601000	0.87937	0.643000	0.83706	CGC	FLII	-	smart_Gelsolin	ENSG00000177731		0.627	FLII-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLII	HGNC	protein_coding	OTTHUMT00000132032.2	118	0.00	0	G	NM_002018		18149770	18149770	-1	no_errors	ENST00000327031	ensembl	human	known	69_37n	missense	39	59.79	58	SNP	1.000	A
FLNC	2318	genome.wustl.edu	37	7	128488091	128488091	+	Missense_Mutation	SNP	G	G	A	rs532654321	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:128488091G>A	ENST00000325888.8	+	26	4810	c.4549G>A	c.(4549-4551)Gtc>Atc	p.V1517I	FLNC_ENST00000346177.6_Missense_Mutation_p.V1517I|RP11-309L24.2_ENST00000469965.1_RNA	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1517					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CACGGTAGCCGTCAAGTATGC	0.657													G|||	2	0.000399361	0.0008	0.0	5008	,	,		15479	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													27.0	34.0	32.0					7																	128488091		2147	4238	6385	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.4549G>A	7.37:g.128488091G>A	ENSP00000327145:p.Val1517Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.V1517I	ENST00000325888.8	37	c.4549	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	19.26	3.793149	0.70452	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.86865	-2.18;-2.18	5.12	5.12	0.69794	Immunoglobulin E-set (2);Fibronectin, type III (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.91540	0.7328	L	0.49350	1.555	0.58432	D	0.999996	D;P	0.89917	1.0;0.923	D;P	0.83275	0.996;0.495	D	0.89840	0.4002	10	0.32370	T	0.25	.	18.9115	0.92487	0.0:0.0:1.0:0.0	.	1517;1517	Q14315-2;Q14315	.;FLNC_HUMAN	I	1517	ENSP00000327145:V1517I;ENSP00000344002:V1517I	ENSP00000327145:V1517I	V	+	1	0	FLNC	128275327	1.000000	0.71417	0.951000	0.38953	0.431000	0.31685	7.912000	0.87465	2.543000	0.85770	0.561000	0.74099	GTC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.657	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	17	0.00	0	G			128488091	128488091	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	19	42.42	14	SNP	1.000	A
FLRT3	23767	genome.wustl.edu	37	20	14307596	14307596	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr20:14307596C>T	ENST00000378053.3	-	2	813	c.557G>A	c.(556-558)cGc>cAc	p.R186H	MACROD2_ENST00000310348.4_Intron|FLRT3_ENST00000462077.1_5'Flank|FLRT3_ENST00000341420.4_Missense_Mutation_p.R186H|MACROD2_ENST00000217246.4_Intron	NM_013281.3	NP_037413.1	Q9NZU0	FLRT3_HUMAN	fibronectin leucine rich transmembrane protein 3	186					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|intracellular signal transduction (GO:0035556)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|proteinaceous extracellular matrix (GO:0005578)	chemorepellent activity (GO:0045499)|protein binding, bridging (GO:0030674)|receptor signaling protein activity (GO:0005057)			breast(1)|kidney(2)|large_intestine(5)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Colorectal(1;0.0464)	COAD - Colon adenocarcinoma(2;0.129)	Colorectal(1;0.0393)		AGTGGATATGCGATTATCATC	0.438																																						dbGAP											0													96.0	94.0	95.0					20																	14307596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169677	CCDS13121.1	20p11	2013-02-11			ENSG00000125848	ENSG00000125848		"""Fibronectin type III domain containing"""	3762	protein-coding gene	gene with protein product		604808				10644439	Standard	NM_198391		Approved		uc002wow.2	Q9NZU0	OTTHUMG00000031914	ENST00000378053.3:c.557G>A	20.37:g.14307596C>T	ENSP00000367292:p.Arg186His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW20|Q542Z9|Q96K39|Q96K42|Q96KB1|Q9P259	Missense_Mutation	SNP	pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,pfscan_Fibronectin_type3	p.R186H	ENST00000378053.3	37	c.557	CCDS13121.1	20	.	.	.	.	.	.	.	.	.	.	C	19.74	3.884675	0.72410	.	.	ENSG00000125848	ENST00000378053;ENST00000341420;ENST00000541882	T;T	0.60171	0.21;0.21	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.68760	0.3036	L	0.31476	0.935	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66999	-0.5781	10	0.48119	T	0.1	-8.3368	20.6208	0.99490	0.0:1.0:0.0:0.0	.	186	Q9NZU0	FLRT3_HUMAN	H	186	ENSP00000367292:R186H;ENSP00000339912:R186H	ENSP00000339912:R186H	R	-	2	0	FLRT3	14255596	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.882000	0.98803	0.655000	0.94253	CGC	FLRT3	-	NULL	ENSG00000125848		0.438	FLRT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLRT3	HGNC	protein_coding	OTTHUMT00000078075.1	134	0.00	0	C	NM_013281		14307596	14307596	-1	no_errors	ENST00000341420	ensembl	human	known	69_37n	missense	51	25.00	17	SNP	1.000	T
FLYWCH1	84256	genome.wustl.edu	37	16	2983745	2983745	+	Frame_Shift_Del	DEL	G	G	-	rs186008408	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:2983745delG	ENST00000253928.9	+	6	1683	c.1278delG	c.(1276-1278)ctgfs	p.L426fs	FLYWCH1_ENST00000399667.2_Frame_Shift_Del_p.L426fs|FLYWCH1_ENST00000416288.2_Frame_Shift_Del_p.L425fs			Q4VC44	FWCH1_HUMAN	FLYWCH-type zinc finger 1	426						cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|lung(3)	4						AGACGCCCCTGGGGGGCAGCT	0.672																																						dbGAP											0													19.0	23.0	22.0					16																	2983745		1849	4077	5926	-	-	-	SO:0001589	frameshift_variant	0			AL136585	CCDS45390.1	16p13.3	2013-01-10	2007-06-21	2007-06-21	ENSG00000059122	ENSG00000059122		"""Zinc fingers"""	25404	protein-coding gene	gene with protein product						11230166, 10997877	Standard	XM_006720959		Approved	DKFZp761A132	uc002csc.3	Q4VC44		ENST00000253928.9:c.1278delG	16.37:g.2983745delG	ENSP00000253928:p.Leu426fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUA1|Q6ZSQ1|Q8WV62|Q9BQG6|Q9BUS5|Q9HCM0	Frame_Shift_Del	DEL	pfam_Znf_FLYWCH	p.G428fs	ENST00000253928.9	37	c.1278		16																																																																																			FLYWCH1	-	pfam_Znf_FLYWCH	ENSG00000059122		0.672	FLYWCH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	FLYWCH1	HGNC	protein_coding	OTTHUMT00000436479.1	62	0.00	0	G	NM_032296		2983745	2983745	+1	no_errors	ENST00000399667	ensembl	human	known	69_37n	frame_shift_del	91	14.02	15	DEL	0.959	-
FMR1	2332	genome.wustl.edu	37	X	147026442	147026442	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:147026442G>A	ENST00000370475.4	+	15	1653	c.1525G>A	c.(1525-1527)Gaa>Aaa	p.E509K	FMR1_ENST00000370477.1_Missense_Mutation_p.E476K|FMR1_ENST00000370471.3_Intron|FMR1_ENST00000439526.2_Missense_Mutation_p.E486K|FMR1_ENST00000218200.8_Missense_Mutation_p.E488K|FMR1_ENST00000440235.2_Missense_Mutation_p.E156K|FMR1_ENST00000370470.1_Intron|FMR1-IT1_ENST00000441414.1_RNA	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	509	Interaction with RANBP9.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					CCACAGAGACGAACTCAGTGA	0.463									Fragile X syndrome																													dbGAP											0													57.0	50.0	53.0					X																	147026442		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.1525G>A	X.37:g.147026442G>A	ENSP00000359506:p.Glu509Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.E509K	ENST00000370475.4	37	c.1525	CCDS14682.1	X	.	.	.	.	.	.	.	.	.	.	G	23.9	4.465524	0.84425	.	.	ENSG00000102081	ENST00000218200;ENST00000370477;ENST00000370475;ENST00000439526;ENST00000440235	T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59	5.96	5.96	0.96718	.	0.044341	0.85682	N	0.000000	T	0.71484	0.3345	M	0.62723	1.935	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.87578	0.988;0.998;0.998;0.992	T	0.71899	-0.4453	10	0.56958	D	0.05	-27.6323	18.1588	0.89702	0.0:0.0:1.0:0.0	.	156;509;404;486	F8W871;Q06787;Q59GC1;G3V0J0	.;FMR1_HUMAN;.;.	K	488;476;509;486;156	ENSP00000218200:E488K;ENSP00000359508:E476K;ENSP00000359506:E509K;ENSP00000395923:E486K;ENSP00000413764:E156K	ENSP00000218200:E488K	E	+	1	0	FMR1	146834134	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.130000	0.94437	2.512000	0.84698	0.594000	0.82650	GAA	FMR1	-	pfam_Frag_X_MRP_fam	ENSG00000102081		0.463	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	253	0.00	0	G	NM_002024		147026442	147026442	+1	no_errors	ENST00000370475	ensembl	human	known	69_37n	missense	193	18.22	43	SNP	1.000	A
FOXD4L1	200350	genome.wustl.edu	37	2	114257228	114257228	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:114257228G>A	ENST00000306507.5	+	1	568	c.395G>A	c.(394-396)gGc>gAc	p.G132D		NM_012184.4	NP_036316.1	Q9NU39	FX4L1_HUMAN	forkhead box D4-like 1	132					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(10)|prostate(1)|skin(2)	26						ACGCTCAGCGGCATCTGCGCC	0.627																																						dbGAP											0													37.0	49.0	45.0					2																	114257228		2165	4209	6374	-	-	-	SO:0001583	missense	0			AF452723	CCDS2117.1	2q14.1	2008-02-05			ENSG00000184492	ENSG00000184492			18521	protein-coding gene	gene with protein product		611084				12421752, 15233989	Standard	NM_012184		Approved	FOXD5	uc002tjw.4	Q9NU39	OTTHUMG00000131359	ENST00000306507.5:c.395G>A	2.37:g.114257228G>A	ENSP00000302756:p.Gly132Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWN1|B9EGF3	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G132D	ENST00000306507.5	37	c.395	CCDS2117.1	2	.	.	.	.	.	.	.	.	.	.	.	17.38	3.374599	0.61735	.	.	ENSG00000184492	ENST00000306507	D	0.95103	-3.61	2.85	1.89	0.25635	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);	0.000000	0.34555	U	0.003865	D	0.92476	0.7611	N	0.25890	0.77	0.46167	D	0.998906	P	0.41597	0.756	P	0.53988	0.739	D	0.89972	0.4094	10	0.52906	T	0.07	.	9.2285	0.37421	0.0:0.2257:0.7743:0.0	.	132	Q9NU39	FX4L1_HUMAN	D	132	ENSP00000302756:G132D	ENSP00000302756:G132D	G	+	2	0	FOXD4L1	113973698	0.962000	0.33011	1.000000	0.80357	0.924000	0.55760	1.525000	0.35953	0.476000	0.27440	0.184000	0.17185	GGC	FOXD4L1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000184492		0.627	FOXD4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXD4L1	HGNC	protein_coding	OTTHUMT00000254148.1	74	0.00	0	G	NM_012184		114257228	114257228	+1	no_errors	ENST00000306507	ensembl	human	known	69_37n	missense	64	34.02	33	SNP	1.000	A
FOXM1	2305	genome.wustl.edu	37	12	2968543	2968543	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:2968543C>A	ENST00000359843.3	-	9	1621	c.1553G>T	c.(1552-1554)aGt>aTt	p.S518I	AC005841.1_ENST00000382678.3_5'Flank|Y_RNA_ENST00000410561.1_RNA|ITFG2_ENST00000545509.1_Intron|FOXM1_ENST00000342628.2_Missense_Mutation_p.S556I|FOXM1_ENST00000361953.3_Missense_Mutation_p.S503I	NM_021953.3	NP_068772.2	Q08050	FOXM1_HUMAN	forkhead box M1	518					cell cycle (GO:0007049)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|G2/M transition of mitotic cell cycle (GO:0000086)|liver development (GO:0001889)|mitotic cell cycle (GO:0000278)|negative regulation of cell aging (GO:0090344)|negative regulation of stress-activated MAPK cascade (GO:0032873)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)|positive regulation of double-strand break repair (GO:2000781)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle (GO:0051726)|regulation of cell cycle arrest (GO:0071156)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|regulation of Ras protein signal transduction (GO:0046578)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein kinase binding (GO:0019901)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(3)	24			OV - Ovarian serous cystadenocarcinoma(31;0.000622)			CCTAAGCCCACTGTAGGACTT	0.562																																						dbGAP											0													92.0	96.0	94.0					12																	2968543		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y12773	CCDS8515.1, CCDS8516.1, CCDS8517.1	12p13	2007-09-18			ENSG00000111206	ENSG00000111206		"""Forkhead boxes"""	3818	protein-coding gene	gene with protein product	"""M-phase phosphoprotein 2"""	602341		FKHL16		9032290, 9441747	Standard	NM_202002		Approved	HFH-11, trident, HNF-3, INS-1, MPP2, MPHOSPH2, TGT3	uc001qlf.3	Q08050	OTTHUMG00000168118	ENST00000359843.3:c.1553G>T	12.37:g.2968543C>A	ENSP00000352901:p.Ser518Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O43258|O43259|O43260|Q4ZGG7|Q9BRL2	Missense_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S556I	ENST00000359843.3	37	c.1667	CCDS8515.1	12	.	.	.	.	.	.	.	.	.	.	C	4.389	0.071875	0.08436	.	.	ENSG00000111206	ENST00000342628;ENST00000361953;ENST00000359843	D;D;D	0.92911	-3.06;-3.13;-3.05	4.31	2.33	0.28932	.	0.583594	0.16178	N	0.225966	D	0.86740	0.6005	L	0.51422	1.61	0.09310	N	1	B;B;B;B;P	0.36315	0.134;0.187;0.21;0.187;0.547	B;B;B;B;B	0.33690	0.07;0.032;0.146;0.032;0.168	T	0.79533	-0.1764	10	0.54805	T	0.06	.	6.1581	0.20348	0.0:0.6259:0.2653:0.1088	.	502;518;503;518;556	A8K591;Q53Y49;Q08050-2;Q08050;Q08050-3	.;.;.;FOXM1_HUMAN;.	I	556;503;518	ENSP00000342307:S556I;ENSP00000354492:S503I;ENSP00000352901:S518I	ENSP00000342307:S556I	S	-	2	0	FOXM1	2838804	0.063000	0.20901	0.005000	0.12908	0.009000	0.06853	1.471000	0.35365	1.168000	0.42723	-0.379000	0.06801	AGT	FOXM1	-	NULL	ENSG00000111206		0.562	FOXM1-002	KNOWN	basic|CCDS	protein_coding	FOXM1	HGNC	protein_coding	OTTHUMT00000398272.1	145	0.00	0	C	NM_021953		2968543	2968543	-1	no_errors	ENST00000342628	ensembl	human	known	69_37n	missense	123	26.35	44	SNP	0.001	A
FUT10	84750	genome.wustl.edu	37	8	33318928	33318928	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:33318928A>G	ENST00000327671.5	-	2	674	c.43T>C	c.(43-45)Tgc>Cgc	p.C15R	FUT10_ENST00000335589.3_5'UTR|FUT10_ENST00000518672.1_Intron|FUT10_ENST00000524021.1_Splice_Site	NM_032664.3	NP_116053.3	Q6P4F1	FUT10_HUMAN	fucosyltransferase 10 (alpha (1,3) fucosyltransferase)	15					embryo development (GO:0009790)|fertilization (GO:0009566)|fucosylation (GO:0036065)|hemopoiesis (GO:0030097)|L-fucose catabolic process (GO:0042355)|nervous system development (GO:0007399)|protein folding (GO:0006457)|protein glycosylation (GO:0006486)|protein targeting (GO:0006605)|wound healing (GO:0042060)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-(1->3)-fucosyltransferase activity (GO:0046920)			cervix(1)|endometrium(1)|large_intestine(7)|liver(1)|lung(9)|ovary(1)|pancreas(1)|prostate(3)|stomach(3)|upper_aerodigestive_tract(2)	29				KIRC - Kidney renal clear cell carcinoma(67;0.129)|Kidney(114;0.154)		GCTGTGACGCACAGGCAAGAT	0.562																																						dbGAP											0													196.0	141.0	159.0					8																	33318928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ512465	CCDS6088.1	8p12	2013-02-26			ENSG00000172728	ENSG00000172728		"""Fucosyltransferases"""	19234	protein-coding gene	gene with protein product							Standard	NM_032664		Approved		uc003xje.3	Q6P4F1	OTTHUMG00000163954	ENST00000327671.5:c.43T>C	8.37:g.33318928A>G	ENSP00000332757:p.Cys15Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAC8|Q70GG3|Q8IVI6|Q8IVI7|Q8IVJ3|Q8TE43|Q9BSR3	Splice_Site	SNP	-	e0+2	ENST00000327671.5	37	c.1+2	CCDS6088.1	8	.	.	.	.	.	.	.	.	.	.	A	16.24	3.067024	0.55539	.	.	ENSG00000172728	ENST00000327671;ENST00000380081	T	0.22945	1.93	5.79	4.61	0.57282	.	1.417640	0.03775	N	0.260347	T	0.50650	0.1628	L	0.60455	1.87	0.80722	D	1	D;B;B	0.76494	0.999;0.047;0.151	D;B;B	0.83275	0.996;0.027;0.045	T	0.00523	-1.1690	10	0.46703	T	0.11	0.1282	9.9686	0.41741	0.8294:0.1706:0.0:0.0	.	15;15;15	B4DLS4;Q6P4F1-5;Q6P4F1	.;.;FUT10_HUMAN	R	15	ENSP00000332757:C15R	ENSP00000332757:C15R	C	-	1	0	FUT10	33438470	0.919000	0.31177	0.787000	0.31911	0.938000	0.57974	3.806000	0.55583	1.017000	0.39495	0.524000	0.50904	TGC	FUT10	-	-	ENSG00000172728		0.562	FUT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT10	HGNC	protein_coding	OTTHUMT00000376540.1	105	0.00	0	A	NM_032664		33318928	33318928	-1	no_errors	ENST00000524021	ensembl	human	novel	69_37n	splice_site	82	32.23	39	SNP	0.704	G
FZD9	8326	genome.wustl.edu	37	7	72849076	72849076	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:72849076G>A	ENST00000344575.3	+	1	968	c.739G>A	c.(739-741)Gcc>Acc	p.A247T		NM_003508.2	NP_003499.1	O00144	FZD9_HUMAN	frizzled class receptor 9	247					B cell differentiation (GO:0030183)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|gonad development (GO:0008406)|learning or memory (GO:0007611)|nervous system development (GO:0007399)|neuroblast proliferation (GO:0007405)|vasculature development (GO:0001944)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)|skin(1)	14		Lung NSC(55;0.0659)|all_lung(88;0.152)				CTTCTCCACCGCCTTCACTGT	0.652																																					Pancreas(144;909 1878 36867 38226 39554)	dbGAP											0													108.0	107.0	107.0					7																	72849076		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82169	CCDS5548.1	7q11.23	2014-01-29	2014-01-29		ENSG00000188763	ENSG00000188763		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4047	protein-coding gene	gene with protein product		601766	"""frizzled (Drosophila) homolog 9"", ""frizzled homolog 9 (Drosophila)"", ""frizzled 9, seven transmembrane spanning receptor"", ""frizzled family receptor 9"""			9147651, 10198163	Standard	NM_003508		Approved	FZD3, CD349	uc003tyb.3	O00144	OTTHUMG00000023051	ENST00000344575.3:c.739G>A	7.37:g.72849076G>A	ENSP00000345785:p.Ala247Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.A247T	ENST00000344575.3	37	c.739	CCDS5548.1	7	.	.	.	.	.	.	.	.	.	.	G	14.30	2.495589	0.44352	.	.	ENSG00000188763	ENST00000344575	T	0.47177	0.85	3.57	2.68	0.31781	GPCR, family 2-like (1);	0.000000	0.85682	U	0.000000	T	0.45637	0.1352	L	0.56124	1.755	0.47245	D	0.999368	D	0.56521	0.976	P	0.47376	0.545	T	0.32640	-0.9899	10	0.20046	T	0.44	.	12.266	0.54679	0.0:0.1728:0.8272:0.0	.	247	O00144	FZD9_HUMAN	T	247	ENSP00000345785:A247T	ENSP00000345785:A247T	A	+	1	0	FZD9	72487012	1.000000	0.71417	0.994000	0.49952	0.890000	0.51754	6.471000	0.73562	0.628000	0.30357	-0.485000	0.04761	GCC	FZD9	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000188763		0.652	FZD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD9	HGNC	protein_coding	OTTHUMT00000252120.1	61	0.00	0	G			72849076	72849076	+1	no_errors	ENST00000344575	ensembl	human	known	69_37n	missense	41	30.00	18	SNP	0.999	A
GALNTL5	168391	genome.wustl.edu	37	7	151699798	151699798	+	Splice_Site	SNP	G	G	A	rs142373868	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:151699798G>A	ENST00000392800.2	+	6	912		c.e6-1		GALNTL5_ENST00000431418.2_Splice_Site|GALNTL5_ENST00000483959.1_Splice_Site	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5						spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TGCCTCCCCAGGGGATGTTCT	0.478																																						dbGAP											0													72.0	67.0	69.0					7																	151699798		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.659-1G>A	7.37:g.151699798G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Splice_Site	SNP	-	e5-1	ENST00000392800.2	37	c.659-1	CCDS5929.1	7	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268873	0.80469	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	.	.	.	4.27	4.27	0.50696	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.9741	0.86309	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GALNTL5	151330731	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	9.190000	0.94934	2.673000	0.90976	0.650000	0.86243	.	GALNTL5	-	-	ENSG00000106648		0.478	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	HGNC	protein_coding	OTTHUMT00000348395.1	155	0.00	0	G	NM_145292	Intron	151699798	151699798	+1	no_errors	ENST00000392800	ensembl	human	known	69_37n	splice_site	104	29.25	43	SNP	1.000	A
GALNT11	63917	genome.wustl.edu	37	7	151805352	151805352	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:151805352G>T	ENST00000434507.1	+	8	1379	c.942G>T	c.(940-942)gaG>gaT	p.E314D	GALNT11_ENST00000422997.2_3'UTR|GALNT11_ENST00000452146.2_Missense_Mutation_p.E233D|GALNT11_ENST00000430044.2_Missense_Mutation_p.E314D|GALNT11_ENST00000320311.2_Missense_Mutation_p.E314D			Q8NCW6	GLT11_HUMAN	polypeptide N-acetylgalactosaminyltransferase 11	314					cellular protein metabolic process (GO:0044267)|cilium morphogenesis (GO:0060271)|determination of left/right symmetry (GO:0007368)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein O-linked glycosylation via threonine (GO:0018243)|regulation of Notch signaling pathway (GO:0008593)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|Notch binding (GO:0005112)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|prostate(5)|skin(2)	27	all_neural(206;0.187)	all_hematologic(28;0.0592)|Prostate(32;0.214)	OV - Ovarian serous cystadenocarcinoma(82;0.00168)	UCEC - Uterine corpus endometrioid carcinoma (81;0.177)|BRCA - Breast invasive adenocarcinoma(188;0.0932)		GACGAGCGGAGGGAGCCACTG	0.493																																						dbGAP											0													86.0	92.0	90.0					7																	151805352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC006017	CCDS5930.1	7q36.1	2014-05-09	2014-05-09		ENSG00000178234	ENSG00000178234	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19875	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 11"""	615130	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 11 (GalNAc-T11)"""			11925450	Standard	NM_022087		Approved	GalNAc-T11	uc010lqg.1	Q8NCW6	OTTHUMG00000157251	ENST00000434507.1:c.942G>T	7.37:g.151805352G>T	ENSP00000416787:p.Glu314Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWF4|Q6PCD1|Q9H6C2|Q9H6Z5|Q9UDR8	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.E314D	ENST00000434507.1	37	c.942	CCDS5930.1	7	.	.	.	.	.	.	.	.	.	.	G	11.13	1.548386	0.27652	.	.	ENSG00000178234	ENST00000430044;ENST00000452146;ENST00000443352;ENST00000434507;ENST00000320311	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	5.28	-9.38	0.00623	.	0.591283	0.18788	N	0.131131	T	0.33527	0.0866	L	0.38175	1.15	0.53005	D	0.999962	B;B;B	0.14012	0.002;0.009;0.002	B;B;B	0.18561	0.012;0.022;0.011	T	0.06041	-1.0849	10	0.22706	T	0.39	.	6.9069	0.24313	0.1488:0.3793:0.392:0.0799	.	233;314;314	B7Z5G5;B3KWF4;Q8NCW6	.;.;GLT11_HUMAN	D	314;233;314;314;314	ENSP00000395122:E314D;ENSP00000393399:E233D;ENSP00000416787:E314D;ENSP00000315835:E314D	ENSP00000315835:E314D	E	+	3	2	GALNT11	151436285	0.003000	0.15002	0.013000	0.15412	0.560000	0.35617	-1.258000	0.02863	-1.797000	0.01252	-0.312000	0.09012	GAG	GALNT11	-	NULL	ENSG00000178234		0.493	GALNT11-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GALNT11	HGNC	protein_coding	OTTHUMT00000348184.1	51	0.00	0	G	NM_022087		151805352	151805352	+1	no_errors	ENST00000320311	ensembl	human	known	69_37n	missense	56	23.29	17	SNP	0.138	T
GBF1	8729	genome.wustl.edu	37	10	104122393	104122393	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:104122393A>G	ENST00000369983.3	+	15	2105	c.1845A>G	c.(1843-1845)atA>atG	p.I615M		NM_001199378.1|NM_001199379.1|NM_004193.2	NP_001186307.1|NP_001186308.1|NP_004184.1	Q92538	GBF1_HUMAN	golgi brefeldin A resistant guanine nucleotide exchange factor 1	615					COPI coating of Golgi vesicle (GO:0048205)|membrane organization (GO:0061024)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of ARF protein signal transduction (GO:0032012)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	cis-Golgi network (GO:0005801)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisome (GO:0005777)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(14)|kidney(8)|large_intestine(15)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	71		Colorectal(252;0.0236)		Epithelial(162;5.16e-08)|all cancers(201;1.19e-06)		GCTGTGAGATAGTAGATGGCA	0.493																																						dbGAP											0													162.0	137.0	145.0					10																	104122393		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87435	CCDS7533.1	10q24	2010-02-12	2010-02-12		ENSG00000107862	ENSG00000107862			4181	protein-coding gene	gene with protein product		603698	"""golgi-specific brefeldin A resistance factor 1"""			9828135	Standard	NM_004193		Approved	KIAA0248, ARF1GEF	uc001kux.2	Q92538	OTTHUMG00000018955	ENST00000369983.3:c.1845A>G	10.37:g.104122393A>G	ENSP00000359000:p.Ile615Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXX3|Q96CK6|Q96HZ3|Q9H473	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.I615M	ENST00000369983.3	37	c.1845	CCDS7533.1	10	.	.	.	.	.	.	.	.	.	.	A	10.36	1.327574	0.24080	.	.	ENSG00000107862	ENST00000369983	T	0.09817	2.94	5.67	0.436	0.16549	.	1.007110	0.07951	N	0.980865	T	0.03348	0.0097	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.42396	-0.9454	10	0.33141	T	0.24	0.0396	0.7638	0.01011	0.3998:0.1064:0.1828:0.3111	.	615;615;615	Q149P1;Q149P0;Q92538	.;.;GBF1_HUMAN	M	615	ENSP00000359000:I615M	ENSP00000359000:I615M	I	+	3	3	GBF1	104112383	0.000000	0.05858	0.002000	0.10522	0.262000	0.26303	-0.065000	0.11617	0.112000	0.17975	0.533000	0.62120	ATA	GBF1	-	NULL	ENSG00000107862		0.493	GBF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBF1	HGNC	protein_coding	OTTHUMT00000050051.1	259	0.00	0	A			104122393	104122393	+1	no_errors	ENST00000369983	ensembl	human	known	69_37n	missense	237	28.83	96	SNP	0.000	G
GDI1	2664	genome.wustl.edu	37	X	153667353	153667353	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:153667353G>A	ENST00000447750.2	+	4	590	c.255G>A	c.(253-255)ggG>ggA	p.G85G		NM_001493.2	NP_001484.1	P31150	GDIA_HUMAN	GDP dissociation inhibitor 1	85					negative regulation of axonogenesis (GO:0050771)|negative regulation of protein targeting to membrane (GO:0090315)|protein transport (GO:0015031)|Rab protein signal transduction (GO:0032482)|regulation of catalytic activity (GO:0050790)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|midbody (GO:0030496)|neuron projection (GO:0043005)|protein complex (GO:0043234)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|Rab GDP-dissociation inhibitor activity (GO:0005093)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	16	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCCCACAGGGCAGCTGGTAA	0.582																																						dbGAP											0													89.0	78.0	82.0					X																	153667353		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			X79353	CCDS35452.1	Xq28	2008-08-01			ENSG00000203879	ENSG00000203879			4226	protein-coding gene	gene with protein product	"""mental retardation, X-linked 41"", ""mental retardation, X-linked 48"", ""rab GDP-dissociation inhibitor, alpha"""	300104		MRX48, MRX41, GDIL		7543319, 7849400	Standard	NM_001493		Approved	RABGDIA, XAP-4, OPHN2, FLJ41411	uc004fli.4	P31150	OTTHUMG00000033293	ENST00000447750.2:c.254-1G>A	X.37:g.153667353G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P50394|Q6FG50|Q7Z2G6|Q7Z2G9|Q7Z2H5|Q7Z2I6	Silent	SNP	pfam_GDP_dissociation_inhibitor,prints_RabGDI,prints_GDP_dissociation_inhibitor	p.G85	ENST00000447750.2	37	c.255	CCDS35452.1	X																																																																																			GDI1	-	pfam_GDP_dissociation_inhibitor,prints_RabGDI,prints_GDP_dissociation_inhibitor	ENSG00000203879		0.582	GDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDI1	HGNC	protein_coding	OTTHUMT00000081649.2	77	0.00	0	G	NM_001493	Silent	153667353	153667353	+1	no_errors	ENST00000447750	ensembl	human	known	69_37n	silent	80	20.00	20	SNP	0.978	A
GGT5	2687	genome.wustl.edu	37	22	24621312	24621312	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:24621312T>C	ENST00000327365.4	-	10	1820	c.1404A>G	c.(1402-1404)ccA>ccG	p.P468P	GGT5_ENST00000418439.2_Silent_p.P392P|GGT5_ENST00000398292.3_Silent_p.P469P|GGT5_ENST00000263112.7_Silent_p.P436P	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	468					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						CCATGGAGGATGGGGAACGCT	0.622																																						dbGAP											0													82.0	81.0	81.0					22																	24621312		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.1404A>G	22.37:g.24621312T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Missense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.H71R	ENST00000327365.4	37	c.212	CCDS13825.1	22	.	.	.	.	.	.	.	.	.	.	t	0.209	-1.037954	0.02013	.	.	ENSG00000099998	ENST00000425408	.	.	.	4.36	-8.71	0.00848	.	.	.	.	.	T	0.41696	0.1170	.	.	.	0.51233	D	0.999917	.	.	.	.	.	.	T	0.47971	-0.9075	4	.	.	.	-17.6205	3.9825	0.09501	0.1997:0.4517:0.2025:0.1462	.	.	.	.	R	71	.	.	H	-	2	0	GGT5	22951312	0.000000	0.05858	0.035000	0.18076	0.055000	0.15305	-5.284000	0.00135	-3.023000	0.00269	-2.225000	0.00294	CAT	GGT5	-	pfam_GGT_peptidase,prints_GGT_peptidase	ENSG00000099998		0.622	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GGT5	HGNC	protein_coding	OTTHUMT00000320119.1	55	0.00	0	T	NM_004121		24621312	24621312	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000425408	ensembl	human	putative	69_37n	missense	17	55.00	22	SNP	0.042	C
GINS4	84296	genome.wustl.edu	37	8	41397268	41397268	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:41397268G>A	ENST00000276533.3	+	5	579	c.369G>A	c.(367-369)tcG>tcA	p.S123S	GINS4_ENST00000518671.1_Silent_p.S123S|RP11-360L9.7_ENST00000524133.1_RNA|RP11-360L9.4_ENST00000523081.1_RNA|RP11-360L9.7_ENST00000578500.1_RNA|GINS4_ENST00000523277.2_Silent_p.S123S	NM_032336.2	NP_115712.1	Q9BRT9	SLD5_HUMAN	GINS complex subunit 4 (Sld5 homolog)	123					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)				breast(1)|lung(2)|skin(1)	4	Ovarian(28;0.014)|Colorectal(14;0.0202)|Lung SC(25;0.211)	all_lung(54;0.00732)|Lung NSC(58;0.0207)|Hepatocellular(245;0.0462)|Esophageal squamous(32;0.0844)	Colorectal(10;0.0014)|OV - Ovarian serous cystadenocarcinoma(14;0.00329)|LUSC - Lung squamous cell carcinoma(45;0.0137)|COAD - Colon adenocarcinoma(11;0.0147)			CCAGCCTCTCGCCGGAAGAGT	0.542																																						dbGAP											0													68.0	67.0	67.0					8																	41397268		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC005995	CCDS6116.1	8p11.21	2006-05-04			ENSG00000147536	ENSG00000147536			28226	protein-coding gene	gene with protein product		610611				12477932	Standard	NM_032336		Approved	MGC14799, SLD5	uc003xnx.3	Q9BRT9	OTTHUMG00000164079	ENST00000276533.3:c.369G>A	8.37:g.41397268G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H5|D3DSY0|Q8N648	Silent	SNP	pfam_GINS_complex,pirsf_GINS_Sld5	p.S123	ENST00000276533.3	37	c.369	CCDS6116.1	8																																																																																			GINS4	-	pfam_GINS_complex,pirsf_GINS_Sld5	ENSG00000147536		0.542	GINS4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS4	HGNC	protein_coding	OTTHUMT00000377150.1	107	0.00	0	G	NM_032336		41397268	41397268	+1	no_errors	ENST00000276533	ensembl	human	known	69_37n	silent	118	10.61	14	SNP	0.817	A
GJB3	2707	genome.wustl.edu	37	1	35250494	35250495	+	Frame_Shift_Del	DEL	GG	GG	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	GG	GG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:35250494_35250495delGG	ENST00000373366.2	+	2	746_747	c.131_132delGG	c.(130-132)tggfs	p.W44fs	RP1-34M23.5_ENST00000542839.1_RNA|GJB3_ENST00000373362.3_Frame_Shift_Del_p.W44fs	NM_024009.2	NP_076872.1	O75712	CXB3_HUMAN	gap junction protein, beta 3, 31kDa	44					cell communication (GO:0007154)|in utero embryonic development (GO:0001701)|placenta development (GO:0001890)|sensory perception of sound (GO:0007605)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	connexon complex (GO:0005922)|cytoplasm (GO:0005737)|gap junction (GO:0005921)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|prostate(3)	15		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.234)				GAGCGCGTGTGGGGGGATGAGC	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC012918	CCDS384.1	1p34	2008-05-14	2007-01-16		ENSG00000188910	ENSG00000188910		"""Ion channels / Gap junction proteins (connexins)"""	4285	protein-coding gene	gene with protein product	"""connexin 31"""	603324	"""gap junction protein, beta 3, 31kD (connexin 31)"", ""gap junction protein, beta 3, 31kDa (connexin 31)"", ""erythrokeratodermia variabilis"""	DFNA2, EKV		9843210, 9704026	Standard	NM_024009		Approved	CX31	uc001bxy.3	O75712	OTTHUMG00000004051	ENST00000373366.2:c.131_132delGG	1.37:g.35250498_35250499delGG	ENSP00000362464:p.Trp44fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R790|Q2TAZ8	Frame_Shift_Del	DEL	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin31	p.D46fs	ENST00000373366.2	37	c.131_132	CCDS384.1	1																																																																																			GJB3	-	pfam_Connexin_N,smart_Connexin_N	ENSG00000188910		0.599	GJB3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJB3	HGNC	protein_coding	OTTHUMT00000011559.1	154	0.00	0	GG	NM_024009		35250494	35250495	+1	no_errors	ENST00000373362	ensembl	human	known	69_37n	frame_shift_del	153	32.60	74	DEL	1.000:1.000	-
GLTSCR1	29998	genome.wustl.edu	37	19	48197891	48197891	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:48197891delC	ENST00000396720.3	+	8	2997	c.2803delC	c.(2803-2805)cccfs	p.P940fs	CTD-2571L23.8_ENST00000599924.1_lincRNA	NM_015711.3	NP_056526.3	Q9NZM4	GSCR1_HUMAN	glioma tumor suppressor candidate region gene 1	940	Poly-Pro.									breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|pancreas(3)|prostate(4)|skin(2)	20		all_cancers(25;1.8e-07)|all_lung(116;5.73e-06)|Lung NSC(112;9.69e-06)|all_epithelial(76;2.42e-05)|all_neural(266;0.0332)|Ovarian(192;0.086)		all cancers(93;0.000358)|OV - Ovarian serous cystadenocarcinoma(262;0.000576)|Epithelial(262;0.0212)|GBM - Glioblastoma multiforme(486;0.0355)		GCCGGCAGCACCCCCCCCACC	0.672																																						dbGAP											0										33,53,3378		2,0,29,2,49,1650	14.0	16.0	16.0			-4.0	0.0	19		16	51,107,7600		1,0,49,8,91,3730	no	codingComplex	GLTSCR1	NM_015711.3		3,0,78,10,140,5380	A1A1,A1A2,A1R,A2A2,A2R,RR		2.0366,2.4827,2.1743			48197891	84,160,10978	1829	4072	5901	-	-	-	SO:0001589	frameshift_variant	0			AF182077	CCDS46134.1	19q13.3	2012-11-29			ENSG00000063169	ENSG00000063169			4332	protein-coding gene	gene with protein product		605690				10708517	Standard	NM_015711		Approved		uc002phh.4	Q9NZM4		ENST00000396720.3:c.2803delC	19.37:g.48197891delC	ENSP00000379946:p.Pro940fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MW01	Frame_Shift_Del	DEL	NULL	p.P937fs	ENST00000396720.3	37	c.2803	CCDS46134.1	19																																																																																			GLTSCR1	-	NULL	ENSG00000063169		0.672	GLTSCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLTSCR1	HGNC	protein_coding	OTTHUMT00000465846.1	19	0.00	0	C	NM_015711		48197891	48197891	+1	no_errors	ENST00000396720	ensembl	human	known	69_37n	frame_shift_del	22	37.14	13	DEL	0.226	-
GOLGA6L7P	728310	genome.wustl.edu	37	15	29090683	29090684	+	RNA	INS	-	-	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:29090683_29090684insG	ENST00000569815.1	-	0	578_579					NR_047567.1				golgin A6 family-like 7, pseudogene																		ACCTTGTCCGCCCTCTCGTGCT	0.589																																						dbGAP											0																																										-	-	-			0			AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29090683_29090684insG		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			GOLGA6L7P	-	-	ENSG00000261649		0.589	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	HGNC	pseudogene	OTTHUMT00000431796.1	11	0.00	0	-	XR_078490		29090683	29090684	-1	no_errors	ENST00000569815	ensembl	human	putative	69_37n	rna	5	58.33	7	INS	0.001:0.001	G
GPR101	83550	genome.wustl.edu	37	X	136113257	136113257	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:136113257T>C	ENST00000298110.1	-	1	576	c.577A>G	c.(577-579)Act>Gct	p.T193A		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTGAGAATAGTGTAGCTGGGG	0.582																																						dbGAP											0													63.0	55.0	58.0					X																	136113257		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.577A>G	X.37:g.136113257T>C	ENSP00000298110:p.Thr193Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSM8|Q8NG93	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.T193A	ENST00000298110.1	37	c.577	CCDS14662.1	X	.	.	.	.	.	.	.	.	.	.	T	5.328	0.245840	0.10077	.	.	ENSG00000165370	ENST00000298110	T	0.37752	1.18	5.13	2.76	0.32466	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34725	N	0.003728	T	0.16257	0.0391	N	0.05158	-0.105	0.29207	N	0.874859	B	0.09022	0.002	B	0.06405	0.002	T	0.09574	-1.0668	10	0.42905	T	0.14	-10.8629	6.8194	0.23849	0.0:0.1969:0.0:0.8031	.	193	Q96P66	GP101_HUMAN	A	193	ENSP00000298110:T193A	ENSP00000298110:T193A	T	-	1	0	GPR101	135940923	1.000000	0.71417	0.431000	0.26735	0.663000	0.39108	1.296000	0.33389	0.616000	0.30141	-0.335000	0.08231	ACT	GPR101	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000165370		0.582	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR101	HGNC	protein_coding	OTTHUMT00000058519.1	25	0.00	0	T			136113257	136113257	-1	no_errors	ENST00000298110	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.993	C
GPS1	2873	genome.wustl.edu	37	17	80010320	80010320	+	Intron	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:80010320T>C	ENST00000306823.6	+	1	56				GPS1_ENST00000578552.1_Intron|RFNG_ENST00000310496.4_5'Flank|GPS1_ENST00000355130.2_Silent_p.C46C|GPS1_ENST00000392358.2_Silent_p.C46C|GPS1_ENST00000320548.4_5'UTR|RFNG_ENST00000584838.1_5'Flank|RFNG_ENST00000429557.3_5'Flank			Q13098	CSN1_HUMAN	G protein pathway suppressor 1						cell cycle (GO:0007049)|cullin deneddylation (GO:0010388)|inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)			breast(1)|central_nervous_system(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|skin(2)	13	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TGTCGGCCTGTACGCTGCTCT	0.697																																						dbGAP											0													26.0	25.0	25.0					17																	80010320		2190	4296	6486	-	-	-	SO:0001627	intron_variant	0				CCDS11800.1, CCDS32774.1	17q25.3	2013-03-14				ENSG00000169727			4549	protein-coding gene	gene with protein product	"""COP9 signalosome subunit 1"""	601934				9535219	Standard	NM_212492		Approved	COPS1, CSN1	uc002kdl.1	Q13098		ENST00000306823.6:c.33+480T>C	17.37:g.80010320T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA10|Q9BWL1	Splice_Site	SNP	-	e2+2	ENST00000306823.6	37	c.220+2	CCDS32774.1	17																																																																																			GPS1	-	-	ENSG00000169727		0.697	GPS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPS1	HGNC	protein_coding	OTTHUMT00000442176.1	23	0.00	0	T	NM_212492		80010320	80010320	+1	no_errors	ENST00000578392	ensembl	human	known	69_37n	splice_site	22	33.33	11	SNP	0.998	C
GPSM1	26086	genome.wustl.edu	37	9	139243205	139243206	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:139243205_139243206delCT	ENST00000440944.1	+	10	1484_1485	c.1264_1265delCT	c.(1264-1266)ctcfs	p.L422fs		NM_001145638.1	NP_001139110	Q86YR5	GPSM1_HUMAN	G-protein signaling modulator 1	422	Interaction with STK11/LKB1. {ECO:0000250}.|Mediates association with membranes. {ECO:0000250}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	GDP-dissociation inhibitor activity (GO:0005092)			biliary_tract(1)|endometrium(1)|kidney(2)|lung(4)|upper_aerodigestive_tract(1)	9		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.39e-06)|Epithelial(140;3.24e-06)		CCTGCTGAGACTCCCCCTGGAG	0.683																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AI272212	CCDS6996.2, CCDS48055.1, CCDS48056.1	9q34.3	2013-01-10	2010-06-24		ENSG00000160360	ENSG00000160360		"""Tetratricopeptide (TTC) repeat domain containing"""	17858	protein-coding gene	gene with protein product	"""AGS3 homolog (C. elegans)"""	609491	"""G-protein signalling modulator 1 (AGS3-like, C. elegans)"""			11278352, 10969064	Standard	NM_001145639		Approved	AGS3, DKFZP727I051	uc004chd.2	Q86YR5	OTTHUMG00000020930	ENST00000440944.1:c.1264_1265delCT	9.37:g.139243205_139243206delCT	ENSP00000392828:p.Leu422fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1X4|B1B0W3|Q86SR5|Q969T1|Q9UFS8	Frame_Shift_Del	DEL	pfam_GoLoco_motif,pfam_TPR-1,smart_TPR_repeat,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L422fs	ENST00000440944.1	37	c.1264_1265	CCDS48055.1	9																																																																																			GPSM1	-	NULL	ENSG00000160360		0.683	GPSM1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GPSM1	HGNC	protein_coding		20	0.00	0	CT	NM_015597		139243205	139243206	+1	no_errors	ENST00000440944	ensembl	human	known	69_37n	frame_shift_del	19	33.33	10	DEL	1.000:1.000	-
GRIN2A	2903	genome.wustl.edu	37	16	9858202	9858202	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:9858202G>A	ENST00000396573.2	-	14	3508	c.3199C>T	c.(3199-3201)Cgg>Tgg	p.R1067W	GRIN2A_ENST00000404927.2_Missense_Mutation_p.R1067W|GRIN2A_ENST00000330684.3_Missense_Mutation_p.R1067W|GRIN2A_ENST00000396575.2_Missense_Mutation_p.R1067W|GRIN2A_ENST00000562109.1_Missense_Mutation_p.R1067W|GRIN2A_ENST00000535259.1_Missense_Mutation_p.R910W	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1067					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.R1067W(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	CACGTGGCCCGATTTGACGTT	0.498																																						dbGAP											1	Substitution - Missense(1)	lung(1)											127.0	123.0	125.0					16																	9858202		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3199C>T	16.37:g.9858202G>A	ENSP00000379818:p.Arg1067Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.R1067W	ENST00000396573.2	37	c.3199	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603480	0.28534	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.14391	2.51;2.52;2.53;2.51;2.51	5.33	4.34	0.51931	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35566	0.0936	M	0.74881	2.28	0.53005	D	0.999969	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.994;0.997;0.998	T	0.04307	-1.0961	9	.	.	.	.	12.8907	0.58069	0.0:0.0:0.6167:0.3833	.	910;1067;1067	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	W	1067;1067;910;1067;1067	ENSP00000379818:R1067W;ENSP00000385872:R1067W;ENSP00000441572:R910W;ENSP00000332549:R1067W;ENSP00000379820:R1067W	.	R	-	1	2	GRIN2A	9765703	1.000000	0.71417	0.949000	0.38748	0.177000	0.22998	1.855000	0.39378	2.491000	0.84063	0.655000	0.94253	CGG	GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.498	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	91	0.00	0	G			9858202	9858202	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	93	13.89	15	SNP	1.000	A
GRM3	2913	genome.wustl.edu	37	7	86468223	86468223	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:86468223C>T	ENST00000361669.2	+	4	2492	c.1393C>T	c.(1393-1395)Cga>Tga	p.R465*	GRM3_ENST00000546348.1_Nonsense_Mutation_p.R57*|GRM3_ENST00000536043.1_Nonsense_Mutation_p.R337*|GRM3_ENST00000439827.1_Intron|GRM3_ENST00000394720.2_Intron	NM_000840.2	NP_000831.2	Q14832	GRM3_HUMAN	glutamate receptor, metabotropic 3	465					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of adenylate cyclase activity (GO:0007194)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)	astrocyte projection (GO:0097449)|axon (GO:0030424)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	calcium channel regulator activity (GO:0005246)|G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group II metabotropic glutamate receptor activity (GO:0001641)	p.R465*(1)		NS(2)|breast(6)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(43)|ovary(3)|pancreas(2)|prostate(4)|skin(25)|upper_aerodigestive_tract(5)	109	Esophageal squamous(14;0.0058)|all_lung(186;0.132)|Lung NSC(181;0.142)					TGGAATGGGGCGATACAACGT	0.383																																					GBM(52;969 1098 3139 52280)	dbGAP											1	Substitution - Nonsense(1)	large_intestine(1)											67.0	64.0	65.0					7																	86468223		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5600.1	7q21.1-q21.2	2012-08-29			ENSG00000198822	ENSG00000198822		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4595	protein-coding gene	gene with protein product		601115				8824806	Standard	NM_000840		Approved	GPRC1C, mGlu3, MGLUR3	uc003uid.3	Q14832	OTTHUMG00000022884	ENST00000361669.2:c.1393C>T	7.37:g.86468223C>T	ENSP00000355316:p.Arg465*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PNZ6|Q75MV4|Q75N17|Q86YG6|Q8TBH9	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_3,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_2,prints_GPCR_3_GABA_rcpt_B,pfscan_GPCR_3_C	p.R465*	ENST00000361669.2	37	c.1393	CCDS5600.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.682038	0.96774	.	.	ENSG00000198822	ENST00000361669;ENST00000546348;ENST00000536043	.	.	.	5.91	3.87	0.44632	.	0.121184	0.56097	D	0.000036	.	.	.	.	.	.	0.50313	D	0.999869	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2215	0.37379	0.2838:0.6428:0.0:0.0734	.	.	.	.	X	465;57;337	.	ENSP00000355316:R465X	R	+	1	2	GRM3	86306159	0.875000	0.30112	0.969000	0.41365	0.998000	0.95712	1.947000	0.40293	1.437000	0.47472	0.655000	0.94253	CGA	GRM3	-	pfam_ANF_lig-bd_rcpt	ENSG00000198822		0.383	GRM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRM3	HGNC	protein_coding	OTTHUMT00000253362.2	134	0.00	0	C			86468223	86468223	+1	no_errors	ENST00000361669	ensembl	human	known	69_37n	nonsense	72	27.27	27	SNP	0.677	T
GTPBP3	84705	genome.wustl.edu	37	19	17450401	17450401	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:17450401C>T	ENST00000324894.8	+	7	1035	c.967C>T	c.(967-969)Cgg>Tgg	p.R323W	GTPBP3_ENST00000598038.1_3'UTR|GTPBP3_ENST00000361619.5_Missense_Mutation_p.R345W|GTPBP3_ENST00000358792.7_Missense_Mutation_p.R355W|GTPBP3_ENST00000600625.1_Missense_Mutation_p.R323W	NM_032620.3|NM_133644.3	NP_116009.2|NP_598399.2	Q969Y2	GTPB3_HUMAN	GTP binding protein 3 (mitochondrial)	323	TrmE-type G.				tRNA modification (GO:0006400)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|skin(2)|upper_aerodigestive_tract(1)	18						GCGGCGCGCCCGGGAGAGGTG	0.652																																						dbGAP											0													14.0	15.0	15.0					19																	17450401		2180	4235	6415	-	-	-	SO:0001583	missense	0			AF360742	CCDS32950.1, CCDS32951.1, CCDS56088.1, CCDS59364.1	19p13.2	2008-02-05				ENSG00000130299			14880	protein-coding gene	gene with protein product		608536				1290633	Standard	NM_001128855		Approved	MSS1, THDF1, GTPBG3, MTGP1, FLJ14700	uc010xpo.2	Q969Y2		ENST00000324894.8:c.967C>T	19.37:g.17450401C>T	ENSP00000313818:p.Arg323Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFH1|A6NIG5|A6NKR4|A8K7B4|B7Z4V8|Q8TCY6|Q8WUW9|Q969G4|Q9BX61	Missense_Mutation	SNP	pfam_GTP-bd_TrmE_N,pfam_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	p.R355W	ENST00000324894.8	37	c.1063	CCDS32951.1	19	.	.	.	.	.	.	.	.	.	.	c	14.50	2.553870	0.45487	.	.	ENSG00000130299	ENST00000361619;ENST00000324894;ENST00000358792	T;T;T	0.17528	2.27;2.27;2.27	4.95	2.83	0.33086	Small GTP-binding protein domain (1);GTP-binding domain, HSR1-related (1);	0.443058	0.24298	N	0.039750	T	0.15825	0.0381	L	0.56396	1.775	0.42507	D	0.992955	B;B;B;B	0.27853	0.163;0.191;0.159;0.104	B;B;B;B	0.30179	0.038;0.112;0.068;0.027	T	0.05582	-1.0876	10	0.45353	T	0.12	-5.025	4.6256	0.12476	0.1738:0.6403:0.0:0.1859	.	345;323;323;355	A6NIG5;Q969Y2;Q969Y2-3;Q969Y2-2	.;GTPB3_HUMAN;.;.	W	345;323;355	ENSP00000354598:R345W;ENSP00000313818:R323W;ENSP00000351644:R355W	ENSP00000313818:R323W	R	+	1	2	GTPBP3	17311401	0.002000	0.14202	0.418000	0.26571	0.657000	0.38888	0.854000	0.27791	0.613000	0.30089	0.491000	0.48974	CGG	GTPBP3	-	pfam_GTP_binding_domain,tigrfam_Small_GTP-bd_dom	ENSG00000130299		0.652	GTPBP3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP3	HGNC	protein_coding	OTTHUMT00000463624.1	41	0.00	0	C	NM_032620		17450401	17450401	+1	no_errors	ENST00000358792	ensembl	human	known	69_37n	missense	38	31.58	18	SNP	0.959	T
GRWD1	83743	genome.wustl.edu	37	19	48953639	48953639	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:48953639C>T	ENST00000253237.5	+	4	771	c.538C>T	c.(538-540)Ctg>Ttg	p.L180L		NM_031485.3	NP_113673.3	Q9BQ67	GRWD1_HUMAN	glutamate-rich WD repeat containing 1	180						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|stomach(1)	19		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000206)|all cancers(93;0.000207)|Epithelial(262;0.0125)|GBM - Glioblastoma multiforme(486;0.0222)		GGTGTTTGCGCTGCGGCGGCT	0.637																																						dbGAP											0													71.0	74.0	73.0					19																	48953639		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF337808	CCDS12720.1	19q13.33	2013-05-21				ENSG00000105447		"""WD repeat domain containing"""	21270	protein-coding gene	gene with protein product	regulator of ribosome biogenesis 1 homolog (S. cerevisiae)	610597				15885502	Standard	NM_031485		Approved	WDR28, GRWD, RRB1	uc002pjd.2	Q9BQ67		ENST00000253237.5:c.538C>T	19.37:g.48953639C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TF59	Silent	SNP	pfam_WD40_repeat,pfam_Histone-bd_RBBP4,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L180	ENST00000253237.5	37	c.538	CCDS12720.1	19																																																																																			GRWD1	-	superfamily_WD40_repeat_dom	ENSG00000105447		0.637	GRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRWD1	HGNC	protein_coding	OTTHUMT00000466122.1	131	0.76	1	C	NM_031485		48953639	48953639	+1	no_errors	ENST00000253237	ensembl	human	known	69_37n	silent	126	39.52	83	SNP	1.000	T
GYS1	2997	genome.wustl.edu	37	19	49490492	49490492	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:49490492C>T	ENST00000323798.3	-	3	647	c.451G>A	c.(451-453)Gct>Act	p.A151T	GYS1_ENST00000263276.6_Intron|GYS1_ENST00000457974.1_5'UTR|GYS1_ENST00000541188.1_Missense_Mutation_p.A71T|GYS1_ENST00000544287.1_Intron|GYS1_ENST00000540532.1_Missense_Mutation_p.A71T	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	151					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		AAGAGGACAGCGTCGTTGGCC	0.607																																						dbGAP											0													89.0	68.0	75.0					19																	49490492		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.451G>A	19.37:g.49490492C>T	ENSP00000317904:p.Ala151Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTT9	Missense_Mutation	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.A151T	ENST00000323798.3	37	c.451	CCDS12747.1	19	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193954	0.58017	.	.	ENSG00000104812	ENST00000323798;ENST00000541188;ENST00000540532;ENST00000457974	T;T;T	0.68181	-0.31;-0.31;-0.31	3.82	3.82	0.43975	.	0.056312	0.64402	D	0.000001	T	0.61413	0.2345	L	0.35793	1.09	0.58432	D	0.999999	B;P	0.51653	0.128;0.947	B;P	0.47827	0.055;0.558	T	0.60606	-0.7230	10	0.30854	T	0.27	-12.7705	14.0486	0.64719	0.0:1.0:0.0:0.0	.	71;151	B7Z806;P13807	.;GYS1_HUMAN	T	151;71;71;150	ENSP00000317904:A151T;ENSP00000437922:A71T;ENSP00000445197:A71T	ENSP00000317904:A151T	A	-	1	0	GYS1	54182304	0.997000	0.39634	0.967000	0.41034	0.943000	0.58893	3.512000	0.53407	2.088000	0.63022	0.557000	0.71058	GCT	GYS1	-	pfam_Glycogen_synth,pfam_Starch_synth_cat_dom	ENSG00000104812		0.607	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	72	0.00	0	C	NM_002103		49490492	49490492	-1	no_errors	ENST00000323798	ensembl	human	known	69_37n	missense	52	42.39	39	SNP	1.000	T
HBP1	26959	genome.wustl.edu	37	7	106836466	106836466	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:106836466delA	ENST00000222574.4	+	9	1441	c.1255delA	c.(1255-1257)aaafs	p.K419fs	HBP1_ENST00000461963.1_3'UTR|HBP1_ENST00000485846.1_Frame_Shift_Del_p.K419fs|CTA-363E19.2_ENST00000607036.1_RNA|HBP1_ENST00000468410.1_Frame_Shift_Del_p.K419fs	NM_012257.3	NP_036389.2	O60381	HBP1_HUMAN	HMG-box transcription factor 1	419					cell cycle arrest (GO:0007050)|positive regulation of potassium ion transport (GO:0043268)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			large_intestine(4)|lung(3)|prostate(1)|skin(2)	10						TAAAGCTGTCAAAAACCACAG	0.418																																						dbGAP											0													99.0	96.0	97.0					7																	106836466		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			BC017069	CCDS5741.1	7q22-q31	2003-10-08			ENSG00000105856	ENSG00000105856			23200	protein-coding gene	gene with protein product						9030690, 11500377	Standard	NM_001244262		Approved		uc011klv.2	O60381	OTTHUMG00000157642	ENST00000222574.4:c.1255delA	7.37:g.106836466delA	ENSP00000222574:p.Lys419fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB7|Q8TBM1|Q8TE93|Q96AJ2	Frame_Shift_Del	DEL	pfam_Ataxin-1_HBP1,pfam_HMG_superfamily,superfamily_Ataxin-1_HBP1,superfamily_HMG_superfamily,smart_Ataxin_AXH_dom,smart_HMG_superfamily,pfscan_Ataxin-1_HBP1,pfscan_HMG_superfamily	p.N420fs	ENST00000222574.4	37	c.1255	CCDS5741.1	7																																																																																			HBP1	-	superfamily_HMG_superfamily	ENSG00000105856		0.418	HBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBP1	HGNC	protein_coding	OTTHUMT00000349297.1	173	0.00	0	A	NM_012257		106836466	106836466	+1	no_errors	ENST00000222574	ensembl	human	known	69_37n	frame_shift_del	189	10.33	22	DEL	1.000	-
HDGFRP2	84717	genome.wustl.edu	37	19	4493798	4493799	+	In_Frame_Ins	INS	-	-	TCC	rs533672657		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:4493798_4493799insTCC	ENST00000301284.4	+	7	841_842	c.777_778insTCC	c.(778-780)tcc>TCCtcc	p.260_260S>SS	HDGFRP2_ENST00000586684.1_In_Frame_Ins_p.260_260S>SS	NM_001001520.1|NM_032631.2	NP_001001520|NP_116020.1	Q7Z4V5	HDGR2_HUMAN		260	Ser-rich.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)										cctcctcctcttcctcctcctc	0.668																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0																														ENST00000301284.4:c.790_792dupTCC	19.37:g.4493805_4493807dupTCC	ENSP00000301284:p.Ser264dup	Somatic		WXS	Illumina GAIIx	Phase_IV	I3L080|K7EQZ6|Q96GI5|Q9BW08	In_Frame_Ins	INS	pfam_LEDGF,pfam_PWWP,smart_PWWP,pfscan_PWWP	p.263in_frame_insS	ENST00000301284.4	37	c.777_778	CCDS42472.1	19																																																																																			CTB-50L17.10	-	NULL	ENSG00000167674		0.668	HDGFRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HDGFRP2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458642.1	17	0.00	0	-			4493798	4493799	+1	no_errors	ENST00000301284	ensembl	human	known	69_37n	in_frame_ins	10	23.08	3	INS	0.004:0.060	TCC
HEATR1	55127	genome.wustl.edu	37	1	236727799	236727799	+	Splice_Site	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:236727799delT	ENST00000366582.3	-	32	4712	c.4598delA	c.(4597-4599)aag>ag	p.K1533fs	HEATR1_ENST00000366581.2_Splice_Site_p.K1452fs	NM_018072.5	NP_060542.4	Q9H583	HEAT1_HUMAN	HEAT repeat containing 1	1533					rRNA processing (GO:0006364)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(18)|lung(28)|ovary(3)|prostate(1)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	87	Ovarian(103;0.0634)|Breast(184;0.133)	all_cancers(173;0.0255)|Prostate(94;0.175)	OV - Ovarian serous cystadenocarcinoma(106;0.00117)			ACACATTACCTTTTTCAGAAA	0.363																																						dbGAP											0													69.0	69.0	69.0					1																	236727799		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC065205	CCDS31066.1	1q43	2011-08-12			ENSG00000119285	ENSG00000119285			25517	protein-coding gene	gene with protein product	"""UTP10, small subunit (SSU) processome component, homolog (yeast)"""					17699751	Standard	NM_018072		Approved	FLJ10359, BAP28, UTP10	uc001hyd.2	Q9H583	OTTHUMG00000040061	ENST00000366582.3:c.4599+1A>-	1.37:g.236727799delT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3Q8|Q6P197|Q9NW23	Frame_Shift_Del	DEL	pfam_BP28_C_dom,pfam_U3snoRNP10,superfamily_ARM-type_fold	p.K1533fs	ENST00000366582.3	37	c.4598	CCDS31066.1	1																																																																																			HEATR1	-	superfamily_ARM-type_fold	ENSG00000119285		0.363	HEATR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR1	HGNC	protein_coding	OTTHUMT00000096635.1	246	0.00	0	T	XM_375853	Frame_Shift_Del	236727799	236727799	-1	no_errors	ENST00000366582	ensembl	human	known	69_37n	frame_shift_del	201	35.58	116	DEL	1.000	-
HECTD2	143279	genome.wustl.edu	37	10	93247499	93247499	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:93247499G>C	ENST00000298068.5	+	11	1249	c.1155G>C	c.(1153-1155)caG>caC	p.Q385H	HECTD2_ENST00000498446.1_3'UTR|HECTD2_ENST00000536715.1_Intron|HECTD2_ENST00000371667.1_Missense_Mutation_p.Q35H|HECTD2_ENST00000446394.1_Missense_Mutation_p.Q389H	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2	385					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						TCATTATTCAGAGAGACTCAG	0.313																																					NSCLC(12;376 469 1699 39910 41417)	dbGAP											0													94.0	97.0	96.0					10																	93247499		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1155G>C	10.37:g.93247499G>C	ENSP00000298068:p.Gln385His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	p.Q389H	ENST00000298068.5	37	c.1167	CCDS7414.1	10	.	.	.	.	.	.	.	.	.	.	A	13.05	2.122692	0.37436	.	.	ENSG00000165338	ENST00000446394;ENST00000298068;ENST00000371667	T;T;T	0.76709	-1.04;-1.04;-1.04	5.45	-6.66	0.01789	.	0.000000	0.85682	D	0.000000	T	0.68769	0.3037	L	0.52266	1.64	0.80722	D	1	B;B	0.33964	0.056;0.434	B;B	0.28991	0.032;0.097	T	0.54166	-0.8334	10	0.54805	T	0.06	.	21.0836	0.99945	0.295:0.0:0.705:0.0	.	389;385	E7ERR3;Q5U5R9	.;HECD2_HUMAN	H	389;385;35	ENSP00000401023:Q389H;ENSP00000298068:Q385H;ENSP00000360731:Q35H	ENSP00000298068:Q385H	Q	+	3	2	HECTD2	93237479	0.433000	0.25562	0.726000	0.30738	0.979000	0.70002	-0.192000	0.09587	-1.615000	0.01573	-1.163000	0.01768	CAG	HECTD2	-	NULL	ENSG00000165338		0.313	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	347	0.29	1	G			93247499	93247499	+1	no_errors	ENST00000446394	ensembl	human	known	69_37n	missense	319	13.78	51	SNP	0.730	C
HGFAC	3083	genome.wustl.edu	37	4	3451048	3451048	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:3451048C>T	ENST00000382774.3	+	14	1985	c.1870C>T	c.(1870-1872)Cgg>Tgg	p.R624W	HGFAC_ENST00000511533.1_Missense_Mutation_p.R631W	NM_001528.2	NP_001519.1	Q04756	HGFA_HUMAN	HGF activator	624	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|rough endoplasmic reticulum (GO:0005791)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			central_nervous_system(3)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|upper_aerodigestive_tract(2)|urinary_tract(2)	22				UCEC - Uterine corpus endometrioid carcinoma (64;0.163)		CGGCTGCGGGCGGCTCCACAA	0.672																																						dbGAP											0													44.0	54.0	51.0					4																	3451048		2203	4297	6500	-	-	-	SO:0001583	missense	0			D14012	CCDS3369.1, CCDS75098.1	4p16	2008-02-07			ENSG00000109758	ENSG00000109758	3.4.21.-		4894	protein-coding gene	gene with protein product		604552				7683665, 8226803	Standard	XM_005247966		Approved	HGFAP, HGFA	uc003ghc.3	Q04756	OTTHUMG00000090281	ENST00000382774.3:c.1870C>T	4.37:g.3451048C>T	ENSP00000372224:p.Arg624Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14726|Q2M1W7|Q53X47	Missense_Mutation	SNP	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1_S6,pfam_Kringle,pfam_FN_type2_col-bd,pfam_Fibronectin_type1,pfam_EGF-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Kringle-like,smart_FN_type2_col-bd,smart_EGF-like,smart_Fibronectin_type1,smart_Kringle,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_EG-like_dom,pfscan_Fibronectin_type1,pfscan_FN_type2_col-bd,pfscan_Kringle,pfscan_Peptidase_S1_S6	p.R624W	ENST00000382774.3	37	c.1870	CCDS3369.1	4	.	.	.	.	.	.	.	.	.	.	C	17.36	3.369435	0.61624	.	.	ENSG00000109758	ENST00000382774;ENST00000511533	D;D	0.89415	-2.51;-2.51	4.05	-2.76	0.05896	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.664334	0.12981	N	0.423299	D	0.92642	0.7662	M	0.73319	2.225	0.09310	N	0.999998	D;D	0.89917	1.0;1.0	D;D	0.73708	0.981;0.953	D	0.87526	0.2449	10	0.72032	D	0.01	.	14.7068	0.69198	0.8219:0.1781:0.0:0.0	.	631;624	D6RAR4;Q04756	.;HGFA_HUMAN	W	624;631	ENSP00000372224:R624W;ENSP00000421801:R631W	ENSP00000372224:R624W	R	+	1	2	HGFAC	3420846	0.000000	0.05858	0.356000	0.25785	0.782000	0.44232	-1.196000	0.03041	-0.344000	0.08338	0.561000	0.74099	CGG	HGFAC	-	pirsf_Coagulation_fac_XIIa/HGFA,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000109758		0.672	HGFAC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGFAC	HGNC	protein_coding	OTTHUMT00000206607.3	21	0.00	0	C			3451048	3451048	+1	no_errors	ENST00000382774	ensembl	human	known	69_37n	missense	12	38.10	8	SNP	0.008	T
HIVEP2	3097	genome.wustl.edu	37	6	143095539	143095539	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:143095539T>C	ENST00000367604.1	-	4	976	c.337A>G	c.(337-339)Acc>Gcc	p.T113A	HIVEP2_ENST00000012134.2_Missense_Mutation_p.T113A|HIVEP2_ENST00000367603.2_Missense_Mutation_p.T113A			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	113					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		TGTGGCTTGGTGCTGTGCATG	0.542																																					Esophageal Squamous(107;843 1510 13293 16805 42198)	dbGAP											0													109.0	119.0	115.0					6																	143095539		2126	4250	6376	-	-	-	SO:0001583	missense	0			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.337A>G	6.37:g.143095539T>C	ENSP00000356576:p.Thr113Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02646|Q5THT5|Q9NS05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T113A	ENST00000367604.1	37	c.337	CCDS43510.1	6	.	.	.	.	.	.	.	.	.	.	T	1.115	-0.656976	0.03480	.	.	ENSG00000010818	ENST00000367604;ENST00000367603;ENST00000012134	T;T;T	0.02050	4.48;4.48;4.48	5.53	3.1	0.35709	.	0.513001	0.23523	N	0.047267	T	0.00496	0.0016	L	0.29908	0.895	0.21897	N	0.999485	B	0.02656	0.0	B	0.01281	0.0	T	0.47407	-0.9120	10	0.08381	T	0.77	-8.1436	5.5161	0.16908	0.0:0.1424:0.2762:0.5814	.	113	P31629	ZEP2_HUMAN	A	113	ENSP00000356576:T113A;ENSP00000356575:T113A;ENSP00000012134:T113A	ENSP00000012134:T113A	T	-	1	0	HIVEP2	143137232	0.935000	0.31712	0.713000	0.30519	0.969000	0.65631	0.663000	0.25053	0.367000	0.24454	0.528000	0.53228	ACC	HIVEP2	-	NULL	ENSG00000010818		0.542	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	95	0.00	0	T			143095539	143095539	-1	no_errors	ENST00000012134	ensembl	human	known	69_37n	missense	32	14.63	6	SNP	0.917	C
IDS	3423	genome.wustl.edu	37	X	148579795	148579795	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:148579795C>T	ENST00000340855.6	-	5	760	c.551G>A	c.(550-552)tGc>tAc	p.C184Y	IDS_ENST00000422081.2_5'UTR|IDS_ENST00000541269.1_5'UTR|IDS_ENST00000490775.1_5'UTR|IDS_ENST00000370443.4_Missense_Mutation_p.C184Y|IDS_ENST00000370441.4_Missense_Mutation_p.C184Y	NM_000202.5|NM_001166550.1	NP_000193.1|NP_001160022.1	P22304	IDS_HUMAN	iduronate 2-sulfatase	184			C -> F (in MPS2; mild/intermediate form). {ECO:0000269|PubMed:8940265}.|C -> W (in MPS2). {ECO:0000269|PubMed:10671065}.		carbohydrate metabolic process (GO:0005975)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	lysosomal lumen (GO:0043202)	iduronate-2-sulfatase activity (GO:0004423)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(5)|large_intestine(2)|lung(8)|prostate(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)|Colorectal(9;0.0662)					ATCCACAGGGCAAAGCAGGTT	0.458																																						dbGAP											0			GRCh37	CM960862	IDS	M							105.0	83.0	90.0					X																	148579795		2203	4300	6503	-	-	-	SO:0001583	missense	0			M58342	CCDS14685.1, CCDS14686.1	Xq27.3-q28	2012-10-02	2008-08-01		ENSG00000010404	ENSG00000010404	3.1.6.13		5389	protein-coding gene	gene with protein product	"""Hunter syndrome"""	300823		SIDS			Standard	NM_006123		Approved		uc011mxe.2	P22304	OTTHUMG00000022615	ENST00000340855.6:c.551G>A	X.37:g.148579795C>T	ENSP00000339801:p.Cys184Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWT4|Q14604|Q9BRM3	Missense_Mutation	SNP	pfam_Sulfatase,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.C184Y	ENST00000340855.6	37	c.551	CCDS14685.1	X	.	.	.	.	.	.	.	.	.	.	C	15.81	2.944244	0.53079	.	.	ENSG00000010404	ENST00000340855;ENST00000370441;ENST00000370443	D;D;D	0.99886	-7.52;-7.52;-7.52	4.89	4.89	0.63831	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.043580	0.85682	D	0.000000	D	0.99834	0.9925	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	0.979;1.0;1.0	D;D;D	0.97110	0.941;1.0;0.994	D	0.96677	0.9501	10	0.45353	T	0.12	.	17.3077	0.87199	0.0:1.0:0.0:0.0	.	184;94;184	P22304-2;B4DGD7;P22304	.;.;IDS_HUMAN	Y	184	ENSP00000339801:C184Y;ENSP00000359470:C184Y;ENSP00000359472:C184Y	ENSP00000339801:C184Y	C	-	2	0	IDS	148387700	1.000000	0.71417	1.000000	0.80357	0.223000	0.24884	7.456000	0.80751	2.010000	0.58986	0.523000	0.50628	TGC	IDS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	ENSG00000010404		0.458	IDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDS	HGNC	protein_coding	OTTHUMT00000058677.3	76	0.00	0	C			148579795	148579795	-1	no_errors	ENST00000340855	ensembl	human	known	69_37n	missense	68	31.68	32	SNP	1.000	T
IFNA16	3449	genome.wustl.edu	37	9	21216922	21216922	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:21216922C>T	ENST00000380216.1	-	1	388	c.383G>A	c.(382-384)gGg>gAg	p.G128E		NM_002173.2	NP_002164.1	P05015	IFN16_HUMAN	interferon, alpha 16	128					adaptive immune response (GO:0002250)|B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|blood coagulation (GO:0007596)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|humoral immune response (GO:0006959)|innate immune response (GO:0045087)|natural killer cell activation involved in immune response (GO:0002323)|positive regulation of peptidyl-serine phosphorylation of STAT protein (GO:0033141)|regulation of MHC class I biosynthetic process (GO:0045343)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to exogenous dsRNA (GO:0043330)|T cell activation involved in immune response (GO:0002286)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cytokine activity (GO:0005125)|type I interferon receptor binding (GO:0005132)			central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	13				Lung(24;2.12e-22)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.116)		CTCTTCCACCCCAACCTCCTG	0.458																																						dbGAP											0													182.0	179.0	180.0					9																	21216922		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34996.1	9p22	2010-12-10			ENSG00000147885	ENSG00000147885		"""Interferons"""	5421	protein-coding gene	gene with protein product		147580				1385305	Standard	NM_002173		Approved	IFN-alphaO	uc003zor.1	P05015	OTTHUMG00000019663	ENST00000380216.1:c.383G>A	9.37:g.21216922C>T	ENSP00000369564:p.Gly128Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VV12	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.G128E	ENST00000380216.1	37	c.383	CCDS34996.1	9	.	.	.	.	.	.	.	.	.	.	-	7.124	0.578452	0.13686	.	.	ENSG00000147885	ENST00000380216	T	0.05081	3.5	2.62	1.01	0.19927	Four-helical cytokine-like, core (1);Four-helical cytokine, core (1);	0.858929	0.10327	N	0.688084	T	0.06645	0.0170	L	0.41824	1.3	0.09310	N	1	B	0.20887	0.049	B	0.31245	0.126	T	0.42172	-0.9467	10	0.52906	T	0.07	.	4.089	0.09960	0.0:0.6616:0.0:0.3384	.	128	P05015	IFN16_HUMAN	E	128	ENSP00000369564:G128E	ENSP00000369564:G128E	G	-	2	0	IFNA16	21206922	0.000000	0.05858	0.001000	0.08648	0.011000	0.07611	-1.288000	0.02783	0.435000	0.26365	0.184000	0.17185	GGG	IFNA16	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000147885		0.458	IFNA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA16	HGNC	protein_coding	OTTHUMT00000051892.1	380	0.00	0	C	NM_002173		21216922	21216922	-1	no_errors	ENST00000380216	ensembl	human	known	69_37n	missense	230	29.01	94	SNP	0.001	T
IL25	64806	genome.wustl.edu	37	14	23844943	23844943	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:23844943T>C	ENST00000329715.2	+	2	646	c.388T>C	c.(388-390)Tcg>Ccg	p.S130P	CMTM5_ENST00000555731.1_5'Flank|CMTM5_ENST00000339180.4_5'Flank|IL25_ENST00000397242.2_Missense_Mutation_p.S114P|CMTM5_ENST00000397227.3_5'Flank|CMTM5_ENST00000382809.2_5'Flank|CMTM5_ENST00000342473.4_5'Flank|CMTM5_ENST00000359320.3_5'Flank	NM_022789.3	NP_073626.1	Q9H293	IL25_HUMAN	interleukin 25	130					eosinophil differentiation (GO:0030222)|inflammatory response to antigenic stimulus (GO:0002437)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to fungus (GO:0009620)|response to nematode (GO:0009624)	extracellular space (GO:0005615)	interleukin-17E receptor binding (GO:0030380)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)	9	all_cancers(95;2e-05)			GBM - Glioblastoma multiforme(265;0.00665)|READ - Rectum adenocarcinoma(4;0.0276)|Colorectal(4;0.0396)		CCGGGGCAACTCGGAGCTGCT	0.652																																						dbGAP											0													87.0	82.0	84.0					14																	23844943		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF305200	CCDS9597.1, CCDS45086.1	14q11.2	2008-01-07	2006-05-17	2006-05-17	ENSG00000166090	ENSG00000166090		"""Interleukins and interleukin receptors"""	13765	protein-coding gene	gene with protein product		605658	"""interleukin 17E"""	IL17E		11058597, 11754819	Standard	NM_172314		Approved	IL-25, IL-17E	uc001wjq.3	Q9H293	OTTHUMG00000028749	ENST00000329715.2:c.388T>C	14.37:g.23844943T>C	ENSP00000328111:p.Ser130Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3F0|Q8IZV3|Q8WXB0	Missense_Mutation	SNP	pfam_Interleukin-17	p.S130P	ENST00000329715.2	37	c.388	CCDS9597.1	14	.	.	.	.	.	.	.	.	.	.	T	22.0	4.228103	0.79576	.	.	ENSG00000166090	ENST00000397242;ENST00000329715	T;T	0.74002	-0.8;-0.8	4.5	4.5	0.54988	.	0.215170	0.26887	N	0.021998	D	0.85349	0.5676	M	0.84219	2.685	0.33747	D	0.620147	D;D	0.89917	1.0;0.999	D;D	0.85130	0.99;0.997	D	0.90048	0.4147	10	0.87932	D	0	-10.1629	10.1179	0.42603	0.0:0.0:0.0:1.0	.	130;114	Q9H293;Q9H293-2	IL25_HUMAN;.	P	114;130	ENSP00000380417:S114P;ENSP00000328111:S130P	ENSP00000328111:S130P	S	+	1	0	IL25	22914783	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	3.720000	0.54933	1.890000	0.54733	0.459000	0.35465	TCG	IL25	-	pfam_Interleukin-17	ENSG00000166090		0.652	IL25-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL25	HGNC	protein_coding	OTTHUMT00000071789.2	54	0.00	0	T			23844943	23844943	+1	no_errors	ENST00000329715	ensembl	human	known	69_37n	missense	69	15.85	13	SNP	0.999	C
IMPG2	50939	genome.wustl.edu	37	3	100992437	100992439	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:100992437_100992439delTTC	ENST00000193391.7	-	7	1001_1003	c.814_816delGAA	c.(814-816)gaadel	p.E272del		NM_016247.3	NP_057331.2	Q9BZV3	IMPG2_HUMAN	interphotoreceptor matrix proteoglycan 2	272	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				visual perception (GO:0007601)	integral component of membrane (GO:0016021)|proteinaceous extracellular matrix (GO:0005578)|receptor complex (GO:0043235)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|hyaluronic acid binding (GO:0005540)			NS(1)|breast(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(14)|lung(32)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	64					Hyaluronan(DB08818)	CTGAAATAAATTCTTCTTCAAGG	0.399																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AF173155	CCDS2940.1	3q12.2-q12.3	2014-01-28			ENSG00000081148	ENSG00000081148			18362	protein-coding gene	gene with protein product		607056				10542133	Standard	NM_016247		Approved	IPM200, RP56	uc003duq.2	Q9BZV3	OTTHUMG00000159091	ENST00000193391.7:c.814_816delGAA	3.37:g.100992443_100992445delTTC	ENSP00000193391:p.Glu272del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWT5|Q9UKD4|Q9UKK5	In_Frame_Del	DEL	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.E272in_frame_del	ENST00000193391.7	37	c.816_814	CCDS2940.1	3																																																																																			IMPG2	-	pfam_SEA,smart_SEA	ENSG00000081148		0.399	IMPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMPG2	HGNC	protein_coding	OTTHUMT00000353256.3	357	0.00	0	TTC			100992437	100992439	-1	no_errors	ENST00000193391	ensembl	human	known	69_37n	in_frame_del	294	33.11	148	DEL	0.920:0.979:0.983	-
INTS4	92105	genome.wustl.edu	37	11	77618841	77618841	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:77618841A>G	ENST00000534064.1	-	16	1972	c.1938T>C	c.(1936-1938)ctT>ctC	p.L646L	AAMDC_ENST00000532481.1_Intron|INTS4_ENST00000535943.1_Silent_p.L21L	NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	646					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			GAAGTTCTCCAAGTCTTTGCA	0.398																																						dbGAP											0													109.0	110.0	110.0					11																	77618841		2200	4292	6492	-	-	-	SO:0001819	synonymous_variant	0			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1938T>C	11.37:g.77618841A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.L646	ENST00000534064.1	37	c.1938	CCDS31644.1	11																																																																																			INTS4	-	NULL	ENSG00000149262		0.398	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS4	HGNC	protein_coding	OTTHUMT00000390927.1	184	0.00	0	A	NM_033547		77618841	77618841	-1	no_errors	ENST00000534064	ensembl	human	known	69_37n	silent	178	34.56	94	SNP	1.000	G
INTS8	55656	genome.wustl.edu	37	8	95869179	95869179	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:95869179C>T	ENST00000523731.1	+	15	2060	c.1927C>T	c.(1927-1929)Cga>Tga	p.R643*	INTS8_ENST00000520845.1_3'UTR|INTS8_ENST00000447247.1_Nonsense_Mutation_p.R643*	NM_017864.2	NP_060334.2	Q75QN2	INT8_HUMAN	integrator complex subunit 8	643					snRNA processing (GO:0016180)	integrator complex (GO:0032039)				breast(3)|endometrium(3)|kidney(1)|large_intestine(9)|liver(1)|lung(9)|prostate(1)|upper_aerodigestive_tract(1)	28	Breast(36;1.05e-06)					AAGTAGAGTACGAGGCTATCT	0.448																																						dbGAP											0													64.0	60.0	61.0					8																	95869179		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK091278	CCDS34925.1	8q22.1	2007-05-03	2006-03-15	2006-03-15	ENSG00000164941	ENSG00000164941			26048	protein-coding gene	gene with protein product		611351	"""chromosome 8 open reading frame 52"""	C8orf52		16239144	Standard	NM_017864		Approved	FLJ20530, INT8, MGC131633	uc003yhb.4	Q75QN2	OTTHUMG00000164695	ENST00000523731.1:c.1927C>T	8.37:g.95869179C>T	ENSP00000430338:p.Arg643*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN92|Q5RKZ3|Q6P1R5|Q7Z314|Q9NVS6|Q9NWY7	Nonsense_Mutation	SNP	NULL	p.R643*	ENST00000523731.1	37	c.1927	CCDS34925.1	8	.	.	.	.	.	.	.	.	.	.	C	37	6.426645	0.97559	.	.	ENSG00000164941	ENST00000523731;ENST00000447247	.	.	.	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.0009	19.4864	0.95030	0.0:1.0:0.0:0.0	.	.	.	.	X	643	.	ENSP00000343274:R643X	R	+	1	2	INTS8	95938355	0.996000	0.38824	0.982000	0.44146	0.538000	0.34931	2.790000	0.47821	2.687000	0.91594	0.561000	0.74099	CGA	INTS8	-	NULL	ENSG00000164941		0.448	INTS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS8	HGNC	protein_coding	OTTHUMT00000379794.1	86	0.00	0	C	NM_017864		95869179	95869179	+1	no_errors	ENST00000523731	ensembl	human	known	69_37n	nonsense	56	41.05	39	SNP	1.000	T
ITGB2	3689	genome.wustl.edu	37	21	46310051	46310051	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr21:46310051T>C	ENST00000397850.2	-	13	1951	c.1499A>G	c.(1498-1500)gAc>gGc	p.D500G	ITGB2_ENST00000355153.4_Missense_Mutation_p.D500G|ITGB2_ENST00000397852.1_Missense_Mutation_p.D500G|ITGB2_ENST00000397857.1_Missense_Mutation_p.D500G|ITGB2_ENST00000397854.3_Missense_Mutation_p.D443G|ITGB2_ENST00000302347.5_Missense_Mutation_p.D500G			P05107	ITB2_HUMAN	integrin, beta 2 (complement component 3 receptor 3 and 4 subunit)	500	Cysteine-rich tandem repeats.				apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|cell-matrix adhesion (GO:0007160)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterotypic cell-cell adhesion (GO:0034113)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|neutrophil chemotaxis (GO:0030593)|receptor clustering (GO:0043113)|regulation of cell shape (GO:0008360)|regulation of immune response (GO:0050776)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphaL-beta2 complex (GO:0034687)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|glycoprotein binding (GO:0001948)|ICAM-3 receptor activity (GO:0030369)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(3)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(4)|skin(3)	35				Colorectal(79;0.0669)	Simvastatin(DB00641)	GGAGTTGTTGTCCTTCCGGCA	0.612																																						dbGAP											0													120.0	82.0	95.0					21																	46310051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK222505	CCDS13716.1	21q22.3	2014-09-17	2006-03-02		ENSG00000160255	ENSG00000160255		"""CD molecules"", ""Complement system"", ""Integrins"""	6155	protein-coding gene	gene with protein product		600065	"""integrin, beta 2 (antigen CD18 (p95), lymphocyte function-associated antigen 1; macrophage antigen 1 (mac-1) beta subunit)"""	CD18, MFI7			Standard	NM_000211		Approved	LFA-1, MAC-1	uc002zgf.3	P05107	OTTHUMG00000090257	ENST00000397850.2:c.1499A>G	21.37:g.46310051T>C	ENSP00000380948:p.Asp500Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTS8|D3DSM1|Q16418|Q53HS5|Q9UD72	Missense_Mutation	SNP	pirsf_Integrin_bsu,pfam_Integrin_bsu_N,pfam_Integrin_bsu_tail,pfam_Integrin_bsu_cyt,pfam_EGF_extracell,superfamily_Integrin_bsu_tail,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,prints_Integrin_bsu	p.D500G	ENST00000397850.2	37	c.1499	CCDS13716.1	21	.	.	.	.	.	.	.	.	.	.	T	22.4	4.284494	0.80803	.	.	ENSG00000160255	ENST00000397852;ENST00000397857;ENST00000397854;ENST00000355153;ENST00000397850;ENST00000302347	T;T;T;T;T;T	0.64260	-0.09;-0.09;-0.09;-0.09;-0.09;-0.09	5.34	5.34	0.76211	.	.	.	.	.	T	0.67636	0.2914	L	0.42581	1.335	0.80722	D	1	P;D	0.56746	0.885;0.977	B;P	0.56823	0.408;0.807	T	0.70718	-0.4795	9	0.66056	D	0.02	.	13.2686	0.60148	0.0:0.0:0.0:1.0	.	443;500	A8MYE6;P05107	.;ITB2_HUMAN	G	500;500;443;500;500;500	ENSP00000380950:D500G;ENSP00000380955:D500G;ENSP00000380952:D443G;ENSP00000347279:D500G;ENSP00000380948:D500G;ENSP00000303242:D500G	ENSP00000303242:D500G	D	-	2	0	ITGB2	45134479	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.757000	0.62213	2.030000	0.59900	0.482000	0.46254	GAC	ITGB2	-	pirsf_Integrin_bsu,pfam_EGF_extracell	ENSG00000160255		0.612	ITGB2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB2	HGNC	protein_coding	OTTHUMT00000206566.2	39	0.00	0	T	NM_000211		46310051	46310051	-1	no_errors	ENST00000302347	ensembl	human	known	69_37n	missense	26	38.10	16	SNP	1.000	C
IYD	389434	genome.wustl.edu	37	6	150715323	150715323	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:150715323delA	ENST00000344419.3	+	4	759	c.619delA	c.(619-621)aaafs	p.K208fs	IYD_ENST00000392255.3_Frame_Shift_Del_p.K208fs|IYD_ENST00000229447.5_Frame_Shift_Del_p.K208fs|IYD_ENST00000425615.3_Frame_Shift_Del_p.K153fs|IYD_ENST00000392256.2_Frame_Shift_Del_p.K208fs|IYD_ENST00000500320.3_Frame_Shift_Del_p.K208fs	NM_203395.2	NP_981932.1	Q6PHW0	IYD1_HUMAN	iodotyrosine deiodinase	208					cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	iodide peroxidase activity (GO:0004447)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	15		Ovarian(120;0.028)	BRCA - Breast invasive adenocarcinoma(37;0.215)	OV - Ovarian serous cystadenocarcinoma(155;4.16e-12)		AAATGGCAAGAAAAAAGTCCA	0.443																																						dbGAP											0													131.0	117.0	122.0					6																	150715323		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK129950	CCDS5227.1, CCDS55066.1, CCDS55067.1	6q25.1	2006-08-24	2006-08-24	2006-08-24	ENSG00000009765	ENSG00000009765			21071	protein-coding gene	gene with protein product		612025	"""chromosome 6 open reading frame 71"""	C6orf71		16316988, 15289438	Standard	NM_001164694		Approved	dJ422F24.1, DEHAL1	uc003qnx.2	Q6PHW0	OTTHUMG00000016347	ENST00000344419.3:c.619delA	6.37:g.150715323delA	ENSP00000343763:p.Lys208fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JFW2|Q2VPW0|Q2VPW1|Q5F1L5|Q5F1L6|Q5THM4|Q6ZP69|Q7Z7D7|Q7Z7D8	Frame_Shift_Del	DEL	pfam_Nitroreductase-like,superfamily_Nitroreductase-like	p.V209fs	ENST00000344419.3	37	c.619	CCDS5227.1	6																																																																																			IYD	-	pfam_Nitroreductase-like,superfamily_Nitroreductase-like	ENSG00000009765		0.443	IYD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IYD	HGNC	protein_coding	OTTHUMT00000043754.3	225	0.00	0	A	NM_203395		150715323	150715323	+1	no_errors	ENST00000229447	ensembl	human	known	69_37n	frame_shift_del	88	45.98	80	DEL	1.000	-
KAT6B	23522	genome.wustl.edu	37	10	76789124	76789124	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:76789124G>A	ENST00000287239.4	+	18	5031	c.4542G>A	c.(4540-4542)aaG>aaA	p.K1514K	KAT6B_ENST00000372725.1_Silent_p.K1222K|KAT6B_ENST00000372714.1_Silent_p.K1222K|KAT6B_ENST00000372724.1_Silent_p.K1222K|KAT6B_ENST00000372711.1_Silent_p.K1331K	NM_001256468.1|NM_012330.3	NP_001243397.1|NP_036462.2	Q8WYB5	KAT6B_HUMAN	K(lysine) acetyltransferase 6B	1514					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	acetyltransferase activity (GO:0016407)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										AGGCACAGAAGCAGGACCAAA	0.532																																						dbGAP											0													87.0	86.0	87.0					10																	76789124		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF113514	CCDS7345.1, CCDS58084.1, CCDS58085.1	10q22.2	2013-01-28	2011-07-21	2011-07-21	ENSG00000156650	ENSG00000156650		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	17582	protein-coding gene	gene with protein product	"""MOZ-related factor"""	605880	"""MYST histone acetyltransferase (monocytic leukemia) 4"""	MYST4		9205841, 10497217	Standard	NM_012330		Approved	querkopf, qkf, Morf, MOZ2, ZC2HC6B	uc001jwn.2	Q8WYB5	OTTHUMG00000018509	ENST00000287239.4:c.4542G>A	10.37:g.76789124G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15087|Q86Y05|Q8WU81|Q9UKW2|Q9UKW3|Q9UKX0	Silent	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,pfam_Histone_H1/H5,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K1514	ENST00000287239.4	37	c.4542	CCDS7345.1	10																																																																																			KAT6B	-	NULL	ENSG00000156650		0.532	KAT6B-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6B	HGNC	protein_coding	OTTHUMT00000048771.1	167	0.00	0	G	NM_012330		76789124	76789124	+1	no_errors	ENST00000287239	ensembl	human	known	69_37n	silent	97	37.01	57	SNP	0.803	A
KCNB2	9312	genome.wustl.edu	37	8	73480397	73480397	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:73480397delA	ENST00000523207.1	+	2	1016	c.428delA	c.(427-429)caafs	p.Q143fs		NM_004770.2	NP_004761.2	Q92953	KCNB2_HUMAN	potassium voltage-gated channel, Shab-related subfamily, member 2	143					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of smooth muscle contraction (GO:0006940)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)	p.E146fs*3(1)		NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(20)|liver(2)|lung(31)|ovary(2)|pancreas(3)|prostate(2)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	85	Breast(64;0.137)		Epithelial(68;0.105)		Dalfampridine(DB06637)	AGATATCATCAAAAAAAAGAA	0.448																																						dbGAP											1	Deletion - Frameshift(1)	ovary(1)											106.0	112.0	110.0					8																	73480397		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U69962	CCDS6209.1	8q13.2	2012-07-05			ENSG00000182674	ENSG00000182674		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6232	protein-coding gene	gene with protein product		607738				9612272, 16382104	Standard	NM_004770		Approved	Kv2.2	uc003xzb.3	Q92953	OTTHUMG00000164498	ENST00000523207.1:c.428delA	8.37:g.73480397delA	ENSP00000430846:p.Gln143fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7D0|Q9BXD3	Frame_Shift_Del	DEL	pfam_K_chnl_volt-dep_Kv2,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv2.2,prints_K_chnl_volt-dep_Kv2,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv8	p.E146fs	ENST00000523207.1	37	c.428	CCDS6209.1	8																																																																																			KCNB2	-	prints_K_chnl_volt-dep_Kv2	ENSG00000182674		0.448	KCNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNB2	HGNC	protein_coding	OTTHUMT00000378998.1	163	0.00	0	A	NM_004770		73480397	73480397	+1	no_errors	ENST00000523207	ensembl	human	known	69_37n	frame_shift_del	161	29.13	67	DEL	1.000	-
KCNH3	23416	genome.wustl.edu	37	12	49934840	49934840	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:49934840G>A	ENST00000257981.6	+	2	495	c.235G>A	c.(235-237)Gtc>Atc	p.V79I		NM_012284.1	NP_036416.1	Q9ULD8	KCNH3_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 3	79	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(20)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	36						CAGTGAGCTCGTCCGCCAACA	0.632																																						dbGAP											0													59.0	58.0	58.0					12																	49934840		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB022696	CCDS8786.1	12q13	2012-07-05				ENSG00000135519		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6252	protein-coding gene	gene with protein product		604527				10455180, 16382104	Standard	NM_012284		Approved	Kv12.2, BEC1, elk2	uc001ruh.1	Q9ULD8	OTTHUMG00000169517	ENST00000257981.6:c.235G>A	12.37:g.49934840G>A	ENSP00000257981:p.Val79Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQ06	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,smart_PAC,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,pfscan_PAS,pfscan_PAS-assoc_C,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ELK,prints_K_chnl_volt-dep_ERG,tigrfam_PAS	p.V79I	ENST00000257981.6	37	c.235	CCDS8786.1	12	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233597	0.58886	.	.	ENSG00000135519	ENST00000257981	D	0.99563	-6.17	5.05	5.05	0.67936	PAS (3);PAS fold-4 (1);	0.000000	0.41194	D	0.000932	D	0.97882	0.9304	L	0.29908	0.895	0.30487	N	0.771747	B	0.31435	0.323	B	0.34824	0.19	D	0.96448	0.9332	10	0.24483	T	0.36	.	9.6343	0.39798	0.0927:0.0:0.9073:0.0	.	79	Q9ULD8	KCNH3_HUMAN	I	79	ENSP00000257981:V79I	ENSP00000257981:V79I	V	+	1	0	KCNH3	48221107	0.097000	0.21791	0.984000	0.44739	0.998000	0.95712	0.572000	0.23684	2.808000	0.96608	0.650000	0.86243	GTC	KCNH3	-	pfam_PAS_4,pfam_PAS_fold,pfam_PAS_fold_3,pfscan_PAS,tigrfam_PAS	ENSG00000135519		0.632	KCNH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH3	HGNC	protein_coding	OTTHUMT00000404571.2	41	0.00	0	G	NM_012284		49934840	49934840	+1	no_errors	ENST00000257981	ensembl	human	known	69_37n	missense	40	32.79	20	SNP	0.968	A
KDM6A	7403	genome.wustl.edu	37	X	44945128	44945128	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:44945128A>G	ENST00000377967.4	+	24	3493	c.3452A>G	c.(3451-3453)aAc>aGc	p.N1151S	KDM6A_ENST00000543216.1_Missense_Mutation_p.N1072S|KDM6A_ENST00000382899.4_Missense_Mutation_p.N1158S|KDM6A_ENST00000536777.1_Missense_Mutation_p.N1106S	NM_021140.2	NP_066963.2	O15550	KDM6A_HUMAN	lysine (K)-specific demethylase 6A	1151	JmjC. {ECO:0000255|PROSITE- ProRule:PRU00538}.				canonical Wnt signaling pathway (GO:0060070)|heart morphogenesis (GO:0003007)|histone H3-K4 methylation (GO:0051568)|in utero embryonic development (GO:0001701)|mesodermal cell differentiation (GO:0048333)|multicellular organism growth (GO:0035264)|neural tube closure (GO:0001843)|notochord morphogenesis (GO:0048570)|regulation of gene expression (GO:0010468)|respiratory system process (GO:0003016)|somite rostral/caudal axis specification (GO:0032525)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K27 specific) (GO:0071558)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)	p.0?(6)		NS(1)|breast(7)|central_nervous_system(27)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(24)|kidney(24)|large_intestine(9)|liver(1)|lung(21)|oesophagus(11)|pancreas(2)|prostate(5)|skin(1)|soft_tissue(1)|urinary_tract(29)	170						GAAAATAACAACTTCTGTTCA	0.373			"""D, N, F, S"""		"""renal, oesophageal SCC, MM"""																																Colon(129;1273 1667 15230 27352 52914)	dbGAP		Rec	yes		X	Xp11.2	7403	"""lysine (K)-specific demethylase 6A, UTX"""		"""E, L"""	6	Whole gene deletion(6)	oesophagus(2)|breast(2)|pancreas(2)											128.0	108.0	114.0					X																	44945128		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000992	CCDS14265.1	Xp11.2	2014-09-17	2009-04-17	2009-04-17	ENSG00000147050	ENSG00000147050		"""Chromatin-modifying enzymes / K-demethylases"", ""Tetratricopeptide (TTC) repeat domain containing"""	12637	protein-coding gene	gene with protein product		300128	"""ubiquitously transcribed tetratricopeptide repeat, X chromosome"""	UTX		9499428, 9381176	Standard	XM_005272655		Approved		uc004dge.4	O15550	OTTHUMG00000021402	ENST00000377967.4:c.3452A>G	X.37:g.44945128A>G	ENSP00000367203:p.Asn1151Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL9|Q5JVQ7	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TPR-1,smart_TPR_repeat,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.N1158S	ENST00000377967.4	37	c.3473	CCDS14265.1	X	.	.	.	.	.	.	.	.	.	.	A	20.6	4.018333	0.75275	.	.	ENSG00000147050	ENST00000334516;ENST00000377967;ENST00000536777;ENST00000382899;ENST00000543216	T;T;T;T	0.70869	-0.52;-0.52;-0.52;-0.52	5.37	5.37	0.77165	Transcription factor jumonji/aspartyl beta-hydroxylase (2);Transcription factor jumonji (1);	0.000000	0.85682	D	0.000000	D	0.82314	0.5010	M	0.66560	2.04	0.80722	D	1	D;D;P;P;P	0.69078	0.997;0.996;0.942;0.932;0.951	D;D;P;P;P	0.77004	0.989;0.98;0.72;0.595;0.734	D	0.84499	0.0615	10	0.87932	D	0	-13.8461	14.5935	0.68386	1.0:0.0:0.0:0.0	.	790;1158;1106;1203;1151	B4E0L8;F8W8R6;F5H6S1;B7ZKN5;O15550	.;.;.;.;KDM6A_HUMAN	S	848;1151;1106;1158;1072	ENSP00000367203:N1151S;ENSP00000437405:N1106S;ENSP00000372355:N1158S;ENSP00000443078:N1072S	ENSP00000334340:N848S	N	+	2	0	KDM6A	44830072	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.910000	0.92685	1.895000	0.54865	0.486000	0.48141	AAC	KDM6A	-	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	ENSG00000147050		0.373	KDM6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM6A	HGNC	protein_coding	OTTHUMT00000056324.1	633	0.00	0	A	NM_021140		44945128	44945128	+1	no_errors	ENST00000382899	ensembl	human	known	69_37n	missense	482	31.88	226	SNP	1.000	G
GLTSCR1L	23506	genome.wustl.edu	37	6	42797791	42797791	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:42797791C>T	ENST00000314073.5	+	6	1896	c.1720C>T	c.(1720-1722)Cca>Tca	p.P574S	GLTSCR1L_ENST00000394168.1_Missense_Mutation_p.P574S			Q6AI39	GSC1L_HUMAN	GLTSCR1-like	574																	GCTGACCCAGCCAAACAGGAC	0.517																																						dbGAP											0													96.0	89.0	92.0					6																	42797791		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833540	CCDS34451.1	6p21.1	2012-11-29	2012-11-29	2012-11-29	ENSG00000112624	ENSG00000112624			21111	protein-coding gene	gene with protein product			"""KIAA0240"""	KIAA0240			Standard	XM_005248972		Approved		uc003osp.1	Q6AI39	OTTHUMG00000014706	ENST00000314073.5:c.1720C>T	6.37:g.42797791C>T	ENSP00000313933:p.Pro574Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W2|Q5TFZ3|Q92514	Missense_Mutation	SNP	NULL	p.P574S	ENST00000314073.5	37	c.1720	CCDS34451.1	6	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492570	0.26774	.	.	ENSG00000112624	ENST00000394167;ENST00000536004;ENST00000314073;ENST00000394168	T;T	0.47869	0.83;0.83	6.06	5.18	0.71444	.	0.187052	0.38959	N	0.001516	T	0.16085	0.0387	N	0.22421	0.69	0.26994	N	0.965066	B;B;P	0.34724	0.013;0.328;0.465	B;B;B	0.28011	0.015;0.053;0.085	T	0.06991	-1.0796	10	0.25106	T	0.35	-9.6353	15.9642	0.79952	0.0:0.86:0.14:0.0	.	574;574;574	F5H616;Q6AI39;B7Z2G7	.;K0240_HUMAN;.	S	574	ENSP00000313933:P574S;ENSP00000377723:P574S	ENSP00000313933:P574S	P	+	1	0	KIAA0240	42905769	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	2.612000	0.46343	1.533000	0.49186	0.650000	0.86243	CCA	KIAA0240	-	NULL	ENSG00000112624		0.517	GLTSCR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0240	HGNC	protein_coding	OTTHUMT00000040562.3	121	0.00	0	C	NM_015349		42797791	42797791	+1	no_errors	ENST00000314073	ensembl	human	known	69_37n	missense	140	11.95	19	SNP	1.000	T
ICE1	23379	genome.wustl.edu	37	5	5465333	5465333	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:5465333delA	ENST00000296564.7	+	13	6108	c.5886delA	c.(5884-5886)acafs	p.T1962fs		NM_015325.2	NP_056140.1	Q9Y2F5	ICE1_HUMAN		1962					positive regulation of intracellular protein transport (GO:0090316)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	protein homodimerization activity (GO:0042803)	p.T1962T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(14)|ovary(1)|prostate(4)|upper_aerodigestive_tract(1)	35						TTAGCACAACAAAAAAGGTAT	0.383																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											49.0	42.0	44.0					5																	5465333		1870	4097	5967	-	-	-	SO:0001589	frameshift_variant	0																														ENST00000296564.7:c.5886delA	5.37:g.5465333delA	ENSP00000296564:p.Thr1962fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE1|Q6ZT40|Q7L587|Q7Z3A9|Q9NTH9	Frame_Shift_Del	DEL	superfamily_Vitellinogen_superhlx	p.K1964fs	ENST00000296564.7	37	c.5886	CCDS47187.1	5																																																																																			KIAA0947	-	NULL	ENSG00000164151		0.383	KIAA0947-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0947	HGNC	protein_coding	OTTHUMT00000365575.1	271	0.00	0	A			5465333	5465333	+1	no_errors	ENST00000296564	ensembl	human	known	69_37n	frame_shift_del	203	31.19	92	DEL	0.000	-
KIAA2026	158358	genome.wustl.edu	37	9	5969043	5969043	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:5969043delT	ENST00000399933.3	-	3	1187	c.1188delA	c.(1186-1188)aaafs	p.K396fs	KIAA2026_ENST00000381461.2_Frame_Shift_Del_p.K396fs	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	396										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		ACAACCCCAGTTTTTCAGCAC	0.423																																						dbGAP											0													43.0	43.0	43.0					9																	5969043		1843	4086	5929	-	-	-	SO:0001589	frameshift_variant	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.1188delA	9.37:g.5969043delT	ENSP00000382815:p.Lys396fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Frame_Shift_Del	DEL	superfamily_Bromodomain	p.K396fs	ENST00000399933.3	37	c.1188		9																																																																																			KIAA2026	-	NULL	ENSG00000183354		0.423	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	82	0.00	0	T	NM_001017969		5969043	5969043	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	frame_shift_del	57	25.32	20	DEL	0.974	-
KIF22	3835	genome.wustl.edu	37	16	29809769	29809769	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:29809769A>G	ENST00000160827.4	+	3	381	c.341A>G	c.(340-342)cAc>cGc	p.H114R	KIF22_ENST00000400750.2_5'UTR|KIF22_ENST00000569382.2_Missense_Mutation_p.H46R|KIF22_ENST00000561482.1_Missense_Mutation_p.H46R|KIF22_ENST00000400751.5_Missense_Mutation_p.H46R	NM_001256269.1|NM_007317.2	NP_001243198.1|NP_015556.1	Q14807	KIF22_HUMAN	kinesin family member 22	114	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|DNA repair (GO:0006281)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)			endometrium(1)|large_intestine(1)|lung(11)|skin(1)	14						ATCCTAAGGCACTTGCTGGAA	0.527																																						dbGAP											0													133.0	116.0	122.0					16																	29809769		2197	4300	6497	-	-	-	SO:0001583	missense	0			D38751	CCDS10653.1, CCDS58444.1	16p11.2	2008-03-03	2003-01-09	2003-01-10	ENSG00000079616	ENSG00000079616		"""Kinesins"""	6391	protein-coding gene	gene with protein product		603213	"""kinesin-like 4"""	KNSL4		8599929, 11416179	Standard	NM_007317		Approved	Kid, OBP-1, OBP-2	uc002dts.4	Q14807	OTTHUMG00000097771	ENST00000160827.4:c.341A>G	16.37:g.29809769A>G	ENSP00000160827:p.His114Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5M0|B7Z265|O60845|O94814|Q53F58|Q9BT46	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_RuvA_2-like,smart_Kinesin_motor_dom,smart_Hlx-hairpin-Hlx_DNA-bd_motif,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.H114R	ENST00000160827.4	37	c.341	CCDS10653.1	16	.	.	.	.	.	.	.	.	.	.	A	19.84	3.901622	0.72754	.	.	ENSG00000079616	ENST00000160827;ENST00000400751	T;T	0.72282	-0.64;-0.64	5.95	5.95	0.96441	Kinesin, motor domain (4);	.	.	.	.	T	0.68824	0.3043	L	0.27053	0.805	0.80722	D	1	B;P	0.34757	0.444;0.467	P;P	0.46026	0.501;0.451	T	0.71741	-0.4501	9	0.66056	D	0.02	.	14.3589	0.66757	1.0:0.0:0.0:0.0	.	46;114	B7Z265;Q14807	.;KIF22_HUMAN	R	114;46	ENSP00000160827:H114R;ENSP00000383562:H46R	ENSP00000160827:H114R	H	+	2	0	KIF22	29717270	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.151000	0.71806	2.274000	0.75844	0.533000	0.62120	CAC	KIF22	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000079616		0.527	KIF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF22	HGNC	protein_coding	OTTHUMT00000215012.2	110	0.00	0	A			29809769	29809769	+1	no_errors	ENST00000160827	ensembl	human	known	69_37n	missense	103	33.97	53	SNP	1.000	G
KLHL7	55975	genome.wustl.edu	37	7	23145676	23145678	+	In_Frame_Del	DEL	AAG	AAG	-	rs367891815		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	AAG	AAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:23145676_23145678delAAG	ENST00000339077.5	+	1	274_276	c.31_33delAAG	c.(31-33)aagdel	p.K13del	KLHL7_ENST00000542558.1_5'UTR|KLHL7_ENST00000539124.1_5'UTR|KLHL7_ENST00000545771.1_5'Flank|KLHL7-AS1_ENST00000419813.1_lincRNA|KLHL7_ENST00000409689.1_5'Flank|KLHL7_ENST00000410047.1_5'Flank|KLHL7_ENST00000479288.1_3'UTR|KLHL7_ENST00000322275.5_In_Frame_Del_p.K13del|KLHL7_ENST00000322231.7_5'UTR	NM_001031710.2	NP_001026880.2	Q8IXQ5	KLHL7_HUMAN	kelch-like family member 7	13					protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						GAAGAGCAGCAAGAAGAAGACCG	0.601																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS5378.1, CCDS34609.1, CCDS5378.2, CCDS55095.1	7p15.3	2013-01-30	2013-01-30		ENSG00000122550	ENSG00000122550		"""Kelch-like"", ""BTB/POZ domain containing"""	15646	protein-coding gene	gene with protein product	"""retinitis pigmentosa 42"""	611119	"""kelch-like 7 (Drosophila)"""			19520207	Standard	NM_001031710		Approved	KLHL6, SBBI26, RP42	uc003svs.4	Q8IXQ5	OTTHUMG00000094813	ENST00000339077.5:c.31_33delAAG	7.37:g.23145682_23145684delAAG	ENSP00000343273:p.Lys13del	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D144|B7Z5I9|G5E9G3|Q7Z765|Q96MV2|Q9BQF8|Q9UDQ9	In_Frame_Del	DEL	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.K13in_frame_del	ENST00000339077.5	37	c.31_33	CCDS34609.1	7																																																																																			KLHL7	-	pirsf_Kelch-like_gigaxonin	ENSG00000122550		0.601	KLHL7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL7	HGNC	protein_coding	OTTHUMT00000326860.3	66	0.00	0	AAG	NM_018846		23145676	23145678	+1	no_errors	ENST00000339077	ensembl	human	known	69_37n	in_frame_del	75	29.25	31	DEL	1.000:1.000:1.000	-
KRT75	9119	genome.wustl.edu	37	12	52818365	52818365	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:52818365delC	ENST00000252245.5	-	9	1812	c.1592delG	c.(1591-1593)ggcfs	p.G531fs	RP11-1020M18.10_ENST00000548135.1_RNA	NM_004693.2	NP_004684.2	O95678	K2C75_HUMAN	keratin 75	531	Tail.				hematopoietic progenitor cell differentiation (GO:0002244)	extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(10)|prostate(1)|skin(1)	28				BRCA - Breast invasive adenocarcinoma(357;0.192)		AGAACCACTGCCCCCTAAGCC	0.617																																						dbGAP											0													178.0	176.0	177.0					12																	52818365		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			Y19212	CCDS8827.1	12q13.13	2013-06-25			ENSG00000170454	ENSG00000170454		"""-"", ""Intermediate filaments type II, keratins (basic)"""	24431	protein-coding gene	gene with protein product		609025				9856802, 10692104, 16831889	Standard	NM_004693		Approved	K6HF	uc001saj.2	O95678	OTTHUMG00000169592	ENST00000252245.5:c.1592delG	12.37:g.52818365delC	ENSP00000252245:p.Gly531fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQU4|Q9NSA9	Frame_Shift_Del	DEL	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G531fs	ENST00000252245.5	37	c.1592	CCDS8827.1	12																																																																																			KRT75	-	NULL	ENSG00000170454		0.617	KRT75-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT75	HGNC	protein_coding	OTTHUMT00000404968.1	133	0.00	0	C	NM_004693		52818365	52818365	-1	no_errors	ENST00000252245	ensembl	human	known	69_37n	frame_shift_del	127	28.65	51	DEL	0.993	-
L1TD1	54596	genome.wustl.edu	37	1	62672476	62672476	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:62672476T>A	ENST00000498273.1	+	3	471	c.176T>A	c.(175-177)aTg>aAg	p.M59K		NM_001164835.1|NM_019079.4	NP_001158307.1|NP_061952.3	Q5T7N2	LITD1_HUMAN	LINE-1 type transposase domain containing 1	59										breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	35						aaggtcttaatggaaattcaa	0.353																																						dbGAP											0													26.0	25.0	25.0					1																	62672476		2195	4292	6487	-	-	-	SO:0001583	missense	0			BC060808	CCDS619.1	1p31.3	2009-01-12			ENSG00000240563	ENSG00000240563			25595	protein-coding gene	gene with protein product						12477932	Standard	NM_001164835		Approved	FLJ10884, ECAT11	uc001dae.4	Q5T7N2	OTTHUMG00000008914	ENST00000498273.1:c.176T>A	1.37:g.62672476T>A	ENSP00000419901:p.Met59Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDA1|Q9NUV8|Q9NV78	Missense_Mutation	SNP	pfam_Transposase_22,superfamily_STAT_TF_coiled-coil	p.M59K	ENST00000498273.1	37	c.176	CCDS619.1	1	.	.	.	.	.	.	.	.	.	.	T	12.22	1.873582	0.33069	.	.	ENSG00000240563	ENST00000498273	T	0.15834	2.39	2.1	2.1	0.27182	.	.	.	.	.	T	0.08980	0.0222	L	0.27053	0.805	0.25425	N	0.988239	P	0.43633	0.813	B	0.38880	0.284	T	0.08638	-1.0712	9	0.08179	T	0.78	.	6.1878	0.20508	0.0:0.0:0.0:1.0	.	59	Q5T7N2	LITD1_HUMAN	K	59	ENSP00000419901:M59K	ENSP00000419901:M59K	M	+	2	0	L1TD1	62445064	0.983000	0.35010	0.568000	0.28447	0.647000	0.38526	0.542000	0.23222	1.246000	0.43901	0.260000	0.18958	ATG	L1TD1	-	NULL	ENSG00000240563		0.353	L1TD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L1TD1	HGNC	protein_coding	OTTHUMT00000024688.1	84	0.00	0	T	NM_019079		62672476	62672476	+1	no_errors	ENST00000498273	ensembl	human	known	69_37n	missense	90	18.18	20	SNP	0.616	A
TRIM46	80128	genome.wustl.edu	37	1	155145235	155145235	+	5'Flank	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:155145235A>G	ENST00000334634.4	+	0	0				TRIM46_ENST00000543729.1_5'Flank|KRTCAP2_ENST00000490672.1_5'UTR|TRIM46_ENST00000368385.4_5'Flank|RP11-201K10.3_ENST00000473363.2_Missense_Mutation_p.S114P|TRIM46_ENST00000392451.2_5'Flank|KRTCAP2_ENST00000295682.4_Silent_p.G72G|TRIM46_ENST00000545012.1_5'Flank|TRIM46_ENST00000368382.1_5'Flank|TRIM46_ENST00000368383.3_5'Flank	NM_001256601.1|NM_001282378.1	NP_001243530.1|NP_001269307.1	Q7Z4K8	TRI46_HUMAN	tripartite motif containing 46							intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	29	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;6.62e-10)|all cancers(21;2.68e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			ACACGAAGAGACCCGAACCAA	0.637																																						dbGAP											0													72.0	71.0	71.0					1																	155145235		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0				CCDS1097.1, CCDS58033.1, CCDS60285.1, CCDS72932.1, CCDS72931.1	1q22	2013-01-09	2011-01-25		ENSG00000163462	ENSG00000163462		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19019	protein-coding gene	gene with protein product		600986	"""tripartite motif-containing 46"""				Standard	NM_025058		Approved	FLJ23229, TRIFIC	uc001fhs.2	Q7Z4K8	OTTHUMG00000035680		1.37:g.155145235A>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVI6|B1AVQ4|Q5VT60|Q5VT62|Q6NT17|Q6NT41|Q6ZRL7|Q9H5P2	Silent	SNP	pfam_Uncharacterised_KRTCAP2	p.G72	ENST00000334634.4	37	c.216	CCDS1097.1	1																																																																																			KRTCAP2	-	pfam_Uncharacterised_KRTCAP2	ENSG00000163463		0.637	TRIM46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTCAP2	HGNC	protein_coding	OTTHUMT00000086728.1	94	0.00	0	A	NM_025058		155145235	155145235	-1	no_errors	ENST00000295682	ensembl	human	known	69_37n	silent	117	12.50	17	SNP	0.999	G
LAMA3	3909	genome.wustl.edu	37	18	21419894	21419894	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:21419894G>T	ENST00000313654.9	+	27	3577		c.e27+1		LAMA3_ENST00000399516.3_Splice_Site	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3						cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					GGCACCGCAGGTAGTGTGCTG	0.498																																						dbGAP											0													77.0	76.0	76.0					18																	21419894		1998	4170	6168	-	-	-	SO:0001630	splice_region_variant	0			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.3336+1G>T	18.37:g.21419894G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Splice_Site	SNP	-	e27+1	ENST00000313654.9	37	c.3336+1	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148145	0.78001	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000416669	.	.	.	5.66	5.66	0.87406	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.907	0.86131	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMA3	19673892	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	5.724000	0.68500	2.693000	0.91896	0.650000	0.86243	.	LAMA3	-	-	ENSG00000053747		0.498	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	126	0.00	0	G	NM_000227, NM_198129	Intron	21419894	21419894	+1	no_errors	ENST00000313654	ensembl	human	known	69_37n	splice_site	73	47.10	65	SNP	1.000	T
LCT	3938	genome.wustl.edu	37	2	136558374	136558374	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:136558374A>T	ENST00000264162.2	-	12	4679	c.4669T>A	c.(4669-4671)Tcc>Acc	p.S1557T		NM_002299.2	NP_002290.2	P09848	LPH_HUMAN	lactase	1557	4 X approximate repeats.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycosylceramidase activity (GO:0017042)|lactase activity (GO:0000016)			breast(6)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(26)|lung(57)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(4)	124				BRCA - Breast invasive adenocarcinoma(221;0.169)	Vitamin C(DB00126)	GGCCTATTGGAGACTCCTGGA	0.502																																						dbGAP											0													55.0	50.0	52.0					2																	136558374		2203	4300	6503	-	-	-	SO:0001583	missense	0			X07994	CCDS2178.1	2q21	2014-09-17			ENSG00000115850	ENSG00000115850	3.2.1.108, 3.2.1.62		6530	protein-coding gene	gene with protein product		603202					Standard	NM_002299		Approved		uc002tuu.1	P09848	OTTHUMG00000131738	ENST00000264162.2:c.4669T>A	2.37:g.136558374A>T	ENSP00000264162:p.Ser1557Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG58	Missense_Mutation	SNP	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF,prints_Glyco_hydro_1	p.S1557T	ENST00000264162.2	37	c.4669	CCDS2178.1	2	.	.	.	.	.	.	.	.	.	.	A	10.36	1.328597	0.24167	.	.	ENSG00000115850	ENST00000264162	T	0.54479	0.57	5.94	5.94	0.96194	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.277180	0.41712	D	0.000825	T	0.33177	0.0854	N	0.11364	0.135	0.24962	N	0.991726	B	0.23540	0.087	B	0.27796	0.083	T	0.21143	-1.0254	10	0.20046	T	0.44	-16.8306	11.4737	0.50284	0.8659:0.0:0.0:0.1341	.	1557	P09848	LPH_HUMAN	T	1557	ENSP00000264162:S1557T	ENSP00000264162:S1557T	S	-	1	0	LCT	136274844	1.000000	0.71417	0.956000	0.39512	0.070000	0.16714	6.112000	0.71547	2.272000	0.75746	0.460000	0.39030	TCC	LCT	-	pfam_Glyco_hydro_1,superfamily_Glycoside_hydrolase_SF	ENSG00000115850		0.502	LCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCT	HGNC	protein_coding	OTTHUMT00000254657.1	68	0.00	0	A	NM_002299		136558374	136558374	-1	no_errors	ENST00000264162	ensembl	human	known	69_37n	missense	63	13.70	10	SNP	0.992	T
LGR5	8549	genome.wustl.edu	37	12	71974205	71974205	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:71974205T>C	ENST00000266674.5	+	16	1863		c.e16+2		RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000540815.2_Splice_Site|LGR5_ENST00000536515.1_Splice_Site			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5						G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						AGGCTCAAGGTAGGACTTGCT	0.408																																						dbGAP											0													234.0	215.0	221.0					12																	71974205		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1552+2T>C	12.37:g.71974205T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Splice_Site	SNP	-	e16+2	ENST00000266674.5	37	c.1552+2	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	T	20.7	4.026777	0.75390	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	.	.	.	5.38	5.38	0.77491	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6704	0.77270	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	LGR5	70260472	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	6.134000	0.71689	2.159000	0.67721	0.528000	0.53228	.	LGR5	-	-	ENSG00000139292		0.408	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	256	0.39	1	T	NM_003667	Intron	71974205	71974205	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	splice_site	242	10.33	28	SNP	1.000	C
NPIPB5	100132247	genome.wustl.edu	37	16	22503114	22503114	+	3'UTR	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:22503114T>C	ENST00000415654.1	+	0	2028				SMG1P1_ENST00000431681.1_RNA	NR_002555.2		A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5							integral component of membrane (GO:0016021)											TAAGGTATACTGTGTACCAGA	0.353																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000415654.1:c.*2025T>C	16.37:g.22503114T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK13	RNA	SNP	-	NULL	ENST00000415654.1	37	NULL		16																																																																																			RP11-368J21.2	-	-	ENSG00000243716		0.353	NPIPB5-016	KNOWN	mRNA_end_NF|basic	processed_transcript	LOC100132247	Clone_based_vega_gene	protein_coding	OTTHUMT00000402477.1	51	0.00	0	T	NM_001135865		22503114	22503114	+1	no_errors	ENST00000415654	ensembl	human	known	69_37n	rna	77	16.30	15	SNP	0.942	C
LOXL3	84695	genome.wustl.edu	37	2	74761116	74761116	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:74761116A>T	ENST00000264094.3	-	13	2152	c.2081T>A	c.(2080-2082)gTc>gAc	p.V694D	LOXL3_ENST00000393937.2_Missense_Mutation_p.V549D|LOXL3_ENST00000409986.1_Missense_Mutation_p.V549D|LOXL3_ENST00000409549.1_Missense_Mutation_p.V638D|LOXL3_ENST00000409249.1_Missense_Mutation_p.V412D	NM_032603.2	NP_115992.1	P58215	LOXL3_HUMAN	lysyl oxidase-like 3	694	Lysyl-oxidase like.				epithelial to mesenchymal transition (GO:0001837)|negative regulation of transcription, DNA-templated (GO:0045892)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)			endometrium(7)|kidney(2)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|urinary_tract(1)	30						TGGGTTGATGACAACCTGTGA	0.458																																						dbGAP											0													208.0	187.0	194.0					2																	74761116		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF282619	CCDS1953.1, CCDS74527.1	2p13	2008-05-23			ENSG00000115318	ENSG00000115318			13869	protein-coding gene	gene with protein product		607163				11386757	Standard	NM_032603		Approved		uc002smp.1	P58215	OTTHUMG00000129953	ENST00000264094.3:c.2081T>A	2.37:g.74761116A>T	ENSP00000264094:p.Val694Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5J1|Q2EHP2|Q6IPL7|Q96RS1	Missense_Mutation	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Lysyl_oxidase,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.V694D	ENST00000264094.3	37	c.2081	CCDS1953.1	2	.	.	.	.	.	.	.	.	.	.	A	14.05	2.420885	0.42918	.	.	ENSG00000115318	ENST00000264094;ENST00000409249;ENST00000393937;ENST00000409549;ENST00000409986	T;T;T;T;T	0.29655	1.56;1.56;1.56;1.56;1.56	5.02	5.02	0.67125	.	0.000000	0.85682	D	0.000000	T	0.51432	0.1674	M	0.72576	2.205	0.80722	D	1	D;P;B;D	0.76494	0.999;0.888;0.128;0.997	D;P;B;D	0.73380	0.98;0.762;0.366;0.959	T	0.47699	-0.9097	10	0.30854	T	0.27	.	12.7266	0.57174	1.0:0.0:0.0:0.0	.	549;638;549;694	B9A025;E7END4;Q6IPL7;P58215	.;.;.;LOXL3_HUMAN	D	694;412;549;638;549	ENSP00000264094:V694D;ENSP00000387103:V412D;ENSP00000377512:V549D;ENSP00000386696:V638D;ENSP00000386545:V549D	ENSP00000264094:V694D	V	-	2	0	LOXL3	74614624	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	9.109000	0.94291	2.110000	0.64415	0.460000	0.39030	GTC	LOXL3	-	pfam_Lysyl_oxidase,prints_Lysyl_oxidase	ENSG00000115318		0.458	LOXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL3	HGNC	protein_coding	OTTHUMT00000252215.1	434	0.23	1	A	NM_032603		74761116	74761116	-1	no_errors	ENST00000264094	ensembl	human	known	69_37n	missense	521	16.08	100	SNP	1.000	T
LRIT1	26103	genome.wustl.edu	37	10	86001143	86001144	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:86001143_86001144insG	ENST00000372105.3	-	1	73_74	c.52_53insC	c.(52-54)cagfs	p.Q18fs		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	18						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						GCCCCGGGCCTGGGGGGGCCAC	0.673																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.53dupC	10.37:g.86001150_86001150dupG	ENSP00000361177:p.Gln18fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0QD41|Q9Y4N7	Frame_Shift_Ins	INS	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q18fs	ENST00000372105.3	37	c.53_52	CCDS7373.1	10																																																																																			LRIT1	-	NULL	ENSG00000148602		0.673	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT1	HGNC	protein_coding	OTTHUMT00000049109.1	9	0.00	0	-	NM_015613		86001143	86001144	-1	no_errors	ENST00000372105	ensembl	human	known	69_37n	frame_shift_ins	8	42.86	6	INS	0.289:0.600	G
LRP4	4038	genome.wustl.edu	37	11	46898298	46898298	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:46898298T>C	ENST00000378623.1	-	24	3603	c.3361A>G	c.(3361-3363)Aca>Gca	p.T1121A	LRP4-AS1_ENST00000502049.2_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1121					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		GGCCCACCTGTGGTGATGATG	0.537																																						dbGAP											0													193.0	157.0	169.0					11																	46898298		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.3361A>G	11.37:g.46898298T>C	ENSP00000367888:p.Thr1121Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.T1121A	ENST00000378623.1	37	c.3361	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	T	16.30	3.083294	0.55861	.	.	ENSG00000134569	ENST00000378623	D	0.95821	-3.82	5.75	5.75	0.90469	Six-bladed beta-propeller, TolB-like (1);	0.050687	0.85682	D	0.000000	D	0.93986	0.8074	L	0.47016	1.485	0.58432	D	0.999999	B	0.26577	0.153	B	0.38296	0.27	D	0.91262	0.5037	10	0.12430	T	0.62	.	16.0664	0.80878	0.0:0.0:0.0:1.0	.	1121	O75096	LRP4_HUMAN	A	1121	ENSP00000367888:T1121A	ENSP00000367888:T1121A	T	-	1	0	LRP4	46854874	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.752000	0.68728	2.201000	0.70794	0.533000	0.62120	ACA	LRP4	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000134569		0.537	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	57	0.00	0	T	NM_002334		46898298	46898298	-1	no_errors	ENST00000378623	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	1.000	C
LRRC16B	90668	genome.wustl.edu	37	14	24532703	24532703	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:24532703delC	ENST00000342740.5	+	31	3094	c.2940delC	c.(2938-2940)cgcfs	p.R980fs	LRRC16B_ENST00000334420.7_Frame_Shift_Del_p.R76fs	NM_138360.3	NP_612369.3	Q8ND23	LR16B_HUMAN	leucine rich repeat containing 16B	980						cytoplasm (GO:0005737)				breast(3)|central_nervous_system(2)|cervix(3)|endometrium(7)|kidney(1)|large_intestine(9)|liver(1)|lung(15)|ovary(2)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	52				GBM - Glioblastoma multiforme(265;0.019)		GGAGGCCCCGCCCCCCCAGGA	0.592																																						dbGAP											0													40.0	49.0	46.0					14																	24532703		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AI017934	CCDS32054.1	14q11.2-q12	2010-09-10	2008-02-12	2008-02-12					20272	protein-coding gene	gene with protein product		614716	"""chromosome 14 open reading frame 121"""	C14orf121		19846667	Standard	NM_138360		Approved	BC008134, crml-1, CARMIL3	uc001wlj.2	Q8ND23		ENST00000342740.5:c.2940delC	14.37:g.24532703delC	ENSP00000340467:p.Arg980fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEF7|Q96HS9	Frame_Shift_Del	DEL	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.R983fs	ENST00000342740.5	37	c.2940	CCDS32054.1	14																																																																																			LRRC16B	-	NULL	ENSG00000186648		0.592	LRRC16B-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LRRC16B	HGNC	protein_coding	OTTHUMT00000416527.1	47	0.00	0	C	NM_138360		24532703	24532703	+1	no_errors	ENST00000342740	ensembl	human	known	69_37n	frame_shift_del	37	26.92	14	DEL	1.000	-
LRRC63	220416	genome.wustl.edu	37	13	46844470	46844471	+	Splice_Site	INS	-	-	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr13:46844470_46844471insG	ENST00000446175.1	+	10	1897_1898	c.1552_1553insG	c.(1552-1554)tgg>tGgg	p.W518fs	LRRC63_ENST00000595396.1_Intron	NM_001282460.1	NP_001269389.1	Q05C16	LRC63_HUMAN	leucine rich repeat containing 63	517										lung(1)|ovary(1)	2						GAAATTTAAGTGGGGGGCACAG	0.421																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS61325.1	13q14.12	2014-02-12			ENSG00000173988	ENSG00000173988			34296	protein-coding gene	gene with protein product							Standard	NM_001282460		Approved	RP11-139H14.4	uc001vbc.3	Q05C16	OTTHUMG00000016866	ENST00000446175.1:c.1551-1->G	13.37:g.46844476_46844476dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TBN0	Frame_Shift_Ins	INS	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.A520fs	ENST00000446175.1	37	c.1552_1553		13																																																																																			LRRC63	-	NULL	ENSG00000173988		0.421	LRRC63-201	KNOWN	basic|appris_candidate	protein_coding	LRRC63	HGNC	protein_coding		128	0.00	0	-	XM_001718341	Frame_Shift_Ins	46844470	46844471	+1	no_errors	ENST00000446175	ensembl	human	known	69_37n	frame_shift_ins	159	30.26	69	INS	0.669:0.849	G
LRTM1	57408	genome.wustl.edu	37	3	54952776	54952776	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:54952776C>T	ENST00000273286.5	-	3	910	c.748G>A	c.(748-750)Gcc>Acc	p.A250T	LRTM1_ENST00000493075.1_Missense_Mutation_p.A174T|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000415676.2_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	250						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		ACACCGTGGGCAGAGCCGGGC	0.632																																						dbGAP											0													52.0	47.0	49.0					3																	54952776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.748G>A	3.37:g.54952776C>T	ENSP00000273286:p.Ala250Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUU2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.A250T	ENST00000273286.5	37	c.748	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	C	1.271	-0.612947	0.03690	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;T	0.50001	0.76;1.08	5.75	3.78	0.43462	.	2.751430	0.01025	N	0.004057	T	0.49081	0.1536	L	0.52364	1.645	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.42582	-0.9443	10	0.24483	T	0.36	.	13.5649	0.61813	0.0:0.8539:0.0:0.1461	.	250	Q9HBL6	LRTM1_HUMAN	T	250;174	ENSP00000273286:A250T;ENSP00000419772:A174T	ENSP00000273286:A250T	A	-	1	0	LRTM1	54927816	0.736000	0.28164	0.103000	0.21229	0.009000	0.06853	0.960000	0.29253	0.275000	0.22094	-1.134000	0.01955	GCC	LRTM1	-	NULL	ENSG00000144771		0.632	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	HGNC	protein_coding	OTTHUMT00000351399.1	66	0.00	0	C	NM_020678		54952776	54952776	-1	no_errors	ENST00000273286	ensembl	human	known	69_37n	missense	20	62.96	34	SNP	0.020	T
LUZP4	51213	genome.wustl.edu	37	X	114536623	114536623	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:114536623A>G	ENST00000371920.3	+	2	165	c.158A>G	c.(157-159)aAc>aGc	p.N53S	LUZP4_ENST00000451986.2_Missense_Mutation_p.T11A	NM_016383.3	NP_057467.1	Q9P127	LUZP4_HUMAN	leucine zipper protein 4	53						nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(4)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	14						AAAAGACAGAACCATAGTAAA	0.328																																						dbGAP											0													142.0	134.0	137.0					X																	114536623		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF124430	CCDS14567.1	Xq24	2009-03-25			ENSG00000102021	ENSG00000102021			24971	protein-coding gene	gene with protein product	"""cancer/testis antigen 28"""	300616				12032826, 11051238	Standard	XM_005268343		Approved	HOM-TES-85, CT-8, CT28	uc004eqa.3	Q9P127	OTTHUMG00000022234	ENST00000371920.3:c.158A>G	X.37:g.114536623A>G	ENSP00000360988:p.Asn53Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSD6	Missense_Mutation	SNP	NULL	p.N53S	ENST00000371920.3	37	c.158	CCDS14567.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.477|4.477	0.088404|0.088404	0.08583|0.08583	.|.	.|.	ENSG00000102021|ENSG00000102021	ENST00000371921;ENST00000371920|ENST00000451986	T;T|T	0.54479|0.51574	0.57;1.22|0.7	3.16|3.16	-4.54|-4.54	0.03452|0.03452	.|.	.|.	.|.	.|.	.|.	T|T	0.23926|0.23926	0.0579|0.0579	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B|B	0.29432|0.28713	0.244|0.22	B|B	0.28139|0.26416	0.086|0.069	T|T	0.18398|0.18398	-1.0338|-1.0338	9|9	0.05959|0.87932	T|D	0.93|0	.|.	0.631|0.631	0.00794|0.00794	0.3548:0.2558:0.2314:0.158|0.3548:0.2558:0.2314:0.158	.|.	53|11	Q9P127|B3KSD6	LUZP4_HUMAN|.	S|A	53|11	ENSP00000360989:N53S;ENSP00000360988:N53S|ENSP00000411212:T11A	ENSP00000360988:N53S|ENSP00000411212:T11A	N|T	+|+	2|1	0|0	LUZP4|LUZP4	114442879|114442879	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.009000|0.009000	0.06853|0.06853	-1.394000|-1.394000	0.02518|0.02518	-1.165000|-1.165000	0.02786|0.02786	-0.799000|-0.799000	0.03217|0.03217	AAC|ACC	LUZP4	-	NULL	ENSG00000102021		0.328	LUZP4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LUZP4	HGNC	protein_coding	OTTHUMT00000057972.1	348	0.00	0	A	NM_016383		114536623	114536623	+1	no_errors	ENST00000371920	ensembl	human	known	69_37n	missense	253	39.95	169	SNP	0.000	G
LYG2	254773	genome.wustl.edu	37	2	99858889	99858889	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:99858889C>T	ENST00000409238.1	-	5	597	c.577G>A	c.(577-579)Gac>Aac	p.D193N	LYG2_ENST00000423800.1_3'UTR|LYG2_ENST00000333017.2_Missense_Mutation_p.D193N			Q86SG7	LYG2_HUMAN	lysozyme G-like 2	193					cell wall macromolecule catabolic process (GO:0016998)|peptidoglycan catabolic process (GO:0009253)	extracellular region (GO:0005576)	lysozyme activity (GO:0003796)			large_intestine(3)|lung(4)|ovary(1)|prostate(2)|skin(1)|stomach(1)	12						AAGTCATTGTCTATGTCCGAT	0.433																																						dbGAP											0													151.0	144.0	146.0					2																	99858889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF323919	CCDS2042.1	2q11.2	2008-02-05			ENSG00000185674	ENSG00000185674			29615	protein-coding gene	gene with protein product						8889548, 12574869	Standard	NM_175735		Approved	LYGH	uc002szw.1	Q86SG7	OTTHUMG00000130643	ENST00000409238.1:c.577G>A	2.37:g.99858889C>T	ENSP00000386939:p.Asp193Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q496G2|Q53RW0	Missense_Mutation	SNP	pfam_Lytic_TGlycosylase-like_cat,superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	p.D193N	ENST00000409238.1	37	c.577	CCDS2042.1	2	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009236	0.54361	.	.	ENSG00000185674	ENST00000409238;ENST00000333017	.	.	.	5.15	4.27	0.50696	Lysozyme-like domain (1);	0.765682	0.12089	N	0.500562	T	0.61451	0.2348	M	0.77486	2.375	0.31481	N	0.66713	P	0.42078	0.77	P	0.46144	0.505	T	0.65639	-0.6119	8	.	.	.	-4.6813	11.5237	0.50567	0.0:0.8198:0.1802:0.0	.	193	Q86SG7	LYG2_HUMAN	N	193	.	.	D	-	1	0	LYG2	99225321	1.000000	0.71417	0.978000	0.43139	0.661000	0.39034	3.070000	0.50033	1.382000	0.46385	0.563000	0.77884	GAC	LYG2	-	superfamily_Lysozyme-like_dom,pirsf_Glyco_hydro_23,prints_Glyco_hydro_23	ENSG00000185674		0.433	LYG2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LYG2	HGNC	protein_coding	OTTHUMT00000330307.1	176	0.00	0	C	NM_175735		99858889	99858889	-1	no_errors	ENST00000333017	ensembl	human	known	69_37n	missense	125	25.60	43	SNP	0.995	T
MAGEB4	4115	genome.wustl.edu	37	X	30260720	30260720	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:30260720G>A	ENST00000378982.2	+	1	664	c.468G>A	c.(466-468)caG>caA	p.Q156Q	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	156	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						AAGTCTCTCAGCGCACGGAGC	0.498																																						dbGAP											0													58.0	42.0	48.0					X																	30260720		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.468G>A	X.37:g.30260720G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.Q156	ENST00000378982.2	37	c.468	CCDS14221.1	X																																																																																			MAGEB4	-	pfam_MAGE,pfscan_MAGE	ENSG00000120289		0.498	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	79	0.00	0	G	NM_002367		30260720	30260720	+1	no_errors	ENST00000378982	ensembl	human	known	69_37n	silent	83	25.23	28	SNP	0.000	A
MAML3	55534	genome.wustl.edu	37	4	140640648	140640648	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:140640648T>C	ENST00000509479.2	-	5	4102	c.3246A>G	c.(3244-3246)caA>caG	p.Q1082Q	MGST2_ENST00000515137.1_Intron	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GCTCATAGGCTTGGCTCTGGC	0.632																																						dbGAP											0													46.0	51.0	50.0					4																	140640648		2189	4296	6485	-	-	-	SO:0001819	synonymous_variant	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.3246A>G	4.37:g.140640648T>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Neuroggenic_mastermind-like_N	p.Q1082	ENST00000509479.2	37	c.3246	CCDS54805.1	4																																																																																			MAML3	-	NULL	ENSG00000196782		0.632	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	51	0.00	0	T			140640648	140640648	-1	no_errors	ENST00000509479	ensembl	human	known	69_37n	silent	47	42.68	35	SNP	0.497	C
MAN2A2	4122	genome.wustl.edu	37	15	91453858	91453858	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:91453858C>A	ENST00000559717.1	+	11	2164	c.1705C>A	c.(1705-1707)Cac>Aac	p.H569N	MAN2A2_ENST00000430376.2_5'Flank|MAN2A2_ENST00000360468.3_Missense_Mutation_p.H569N|MAN2A2_ENST00000431652.2_Missense_Mutation_p.H77N			P49641	MA2A2_HUMAN	mannosidase, alpha, class 2A, member 2	569					cellular protein metabolic process (GO:0044267)|mannose metabolic process (GO:0006013)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			CTTCCAGCATCACGATGCCAT	0.612																																						dbGAP											0													62.0	58.0	59.0					15																	91453858		2198	4298	6496	-	-	-	SO:0001583	missense	0			L28821	CCDS32332.1	15q25	2011-06-30			ENSG00000196547	ENSG00000196547			6825	protein-coding gene	gene with protein product		600988				8524845	Standard	NM_006122		Approved	MANA2X, HsT19662	uc002bqc.3	P49641		ENST00000559717.1:c.1705C>A	15.37:g.91453858C>A	ENSP00000452948:p.His569Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH12|A8K1E8|Q13754	Nonsense_Mutation	SNP	pfam_Glyco_hydro_38_cen_dom,pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd,smart_Glyco_hydro_38_cen_dom	p.S89*	ENST00000559717.1	37	c.266	CCDS32332.1	15	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733188	0.89482	.	.	ENSG00000196547	ENST00000360468;ENST00000431652	D;D	0.98762	-5.12;-5.12	5.28	5.28	0.74379	Glycoside hydrolase, family 38, central domain (2);	0.000000	0.85682	D	0.000000	D	0.99554	0.9840	H	0.98559	4.265	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.97772	1.0227	10	0.87932	D	0	-41.001	18.956	0.92658	0.0:1.0:0.0:0.0	.	77;197;569;569	B4DEU9;B4DIK4;P49641-1;P49641	.;.;.;MA2A2_HUMAN	N	569;77	ENSP00000353655:H569N;ENSP00000388221:H77N	ENSP00000353655:H569N	H	+	1	0	MAN2A2	89254862	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	7.739000	0.84976	2.492000	0.84095	0.306000	0.20318	CAC	MAN2A2	-	pfam_Glyco_hydro_38_cen_dom,smart_Glyco_hydro_38_cen_dom	ENSG00000196547		0.612	MAN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A2	HGNC	protein_coding	OTTHUMT00000418246.5	70	0.00	0	C	NM_006122		91453858	91453858	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000558171	ensembl	human	novel	69_37n	nonsense	78	12.36	11	SNP	1.000	A
MAP2K4	6416	genome.wustl.edu	37	17	12028690	12028690	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:12028690T>C	ENST00000353533.5	+	8	954		c.e8+2		MAP2K4_ENST00000415385.3_Splice_Site	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4						apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		ATCACATTGGTATGTTTATGC	0.403			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																	dbGAP		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|lung(1)|pancreas(1)											237.0	183.0	201.0					17																	12028690		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.891+2T>C	17.37:g.12028690T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Splice_Site	SNP	-	e9+2	ENST00000353533.5	37	c.924+2	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	T	22.2	4.259921	0.80246	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	.	.	.	5.1	5.1	0.69264	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.2907	0.66275	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	MAP2K4	11969415	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.793000	0.85851	2.270000	0.75569	0.460000	0.39030	.	MAP2K4	-	-	ENSG00000065559		0.403	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	311	0.32	1	T		Intron	12028690	12028690	+1	no_errors	ENST00000415385	ensembl	human	known	69_37n	splice_site	118	56.30	152	SNP	1.000	C
MAP3K8	1326	genome.wustl.edu	37	10	30747044	30747044	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:30747044G>T	ENST00000263056.1	+	7	1601	c.905G>T	c.(904-906)aGg>aTg	p.R302M	MAP3K8_ENST00000375321.1_Missense_Mutation_p.R302M|MAP3K8_ENST00000542547.1_Missense_Mutation_p.R302M	NM_001244134.1|NM_005204.3	NP_001231063.1|NP_005195.2	P41279	M3K8_HUMAN	mitogen-activated protein kinase kinase kinase 8	302	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|protein phosphorylation (GO:0006468)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|protein serine/threonine kinase activity (GO:0004674)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23		Prostate(175;0.151)				ATCCTGTGCAGGGGCCATTCA	0.547																																						dbGAP											0													90.0	91.0	91.0					10																	30747044		2203	4300	6503	-	-	-	SO:0001583	missense	0			D14497	CCDS7166.1	10p11.2	2011-06-09			ENSG00000107968	ENSG00000107968		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6860	protein-coding gene	gene with protein product		191195		COT, ESTF		2072910, 8479752	Standard	NM_005204		Approved	Tpl-2, EST, c-COT, MEKK8	uc009xlf.2	P41279	OTTHUMG00000017889	ENST00000263056.1:c.905G>T	10.37:g.30747044G>T	ENSP00000263056:p.Arg302Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q5|D3DRX1|Q14275|Q5T855|Q9HC81	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R302M	ENST00000263056.1	37	c.905	CCDS7166.1	10	.	.	.	.	.	.	.	.	.	.	G	26.6	4.749977	0.89753	.	.	ENSG00000107968	ENST00000375328;ENST00000263056;ENST00000542547;ENST00000375321	T;T;T	0.67171	-0.25;-0.25;-0.25	5.05	5.05	0.67936	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.75917	0.3915	L	0.38838	1.175	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.76520	-0.2929	10	0.49607	T	0.09	.	18.8345	0.92155	0.0:0.0:1.0:0.0	.	302	P41279	M3K8_HUMAN	M	302	ENSP00000263056:R302M;ENSP00000443610:R302M;ENSP00000364470:R302M	ENSP00000263056:R302M	R	+	2	0	MAP3K8	30787050	1.000000	0.71417	0.966000	0.40874	0.925000	0.55904	9.203000	0.95033	2.537000	0.85549	0.644000	0.83932	AGG	MAP3K8	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000107968		0.547	MAP3K8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MAP3K8	HGNC	protein_coding	OTTHUMT00000047416.2	85	0.00	0	G	NM_005204		30747044	30747044	+1	no_errors	ENST00000263056	ensembl	human	known	69_37n	missense	81	11.96	11	SNP	0.994	T
MAPKBP1	23005	genome.wustl.edu	37	15	42110267	42110267	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:42110267C>T	ENST00000456763.2	+	18	2179	c.1983C>T	c.(1981-1983)gaC>gaT	p.D661D	MAPKBP1_ENST00000514566.1_Silent_p.D655D|MAPKBP1_ENST00000457542.2_Silent_p.D655D|MAPKBP1_ENST00000221214.6_Silent_p.D538D|MAPKBP1_ENST00000260357.7_Silent_p.D494D	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	661										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		AGGGTGAGGACGGCACACTCA	0.527																																						dbGAP											0													110.0	112.0	111.0					15																	42110267		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.1983C>T	15.37:g.42110267C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D661	ENST00000456763.2	37	c.1983	CCDS45239.1	15																																																																																			MAPKBP1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000137802		0.527	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	68	0.00	0	C	NM_014994		42110267	42110267	+1	no_errors	ENST00000456763	ensembl	human	known	69_37n	silent	83	30.25	36	SNP	0.998	T
MBD1	4152	genome.wustl.edu	37	18	47803052	47803052	+	Missense_Mutation	SNP	G	G	A	rs545375854		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:47803052G>A	ENST00000591416.1	-	5	886	c.455C>T	c.(454-456)aCg>aTg	p.T152M	MBD1_ENST00000585672.1_Missense_Mutation_p.T152M|MBD1_ENST00000339998.6_Missense_Mutation_p.T152M|MBD1_ENST00000398488.1_Missense_Mutation_p.T152M|MBD1_ENST00000382948.5_Missense_Mutation_p.T152M|MBD1_ENST00000457839.2_Missense_Mutation_p.T152M|MBD1_ENST00000398493.1_Missense_Mutation_p.T152M|MBD1_ENST00000436910.1_Missense_Mutation_p.T152M|MBD1_ENST00000353909.3_Missense_Mutation_p.T152M|MBD1_ENST00000269471.5_Missense_Mutation_p.T152M|MBD1_ENST00000588937.1_Missense_Mutation_p.T152M|MBD1_ENST00000590208.1_Missense_Mutation_p.T152M|MBD1_ENST00000587605.1_Missense_Mutation_p.T152M|MBD1_ENST00000585595.1_Missense_Mutation_p.T152M|MBD1_ENST00000591535.1_Missense_Mutation_p.T152M|MBD1_ENST00000398495.2_Missense_Mutation_p.T152M|MBD1_ENST00000424334.2_Missense_Mutation_p.T178M|MBD1_ENST00000269468.5_Missense_Mutation_p.T152M|MBD1_ENST00000349085.2_Missense_Mutation_p.T152M|MBD1_ENST00000347968.3_Missense_Mutation_p.T152M			Q9UIS9	MBD1_HUMAN	methyl-CpG binding domain protein 1	152					negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36						TTTGCACAACGTTTTGAGCCG	0.577																																						dbGAP											0													86.0	72.0	76.0					18																	47803052		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y10746	CCDS11941.1, CCDS11942.1, CCDS11943.1, CCDS11944.1, CCDS32832.1, CCDS56071.1, CCDS56072.1, CCDS56073.1, CCDS59318.1, CCDS59319.1, CCDS59320.1	18q21	2014-02-18			ENSG00000141644	ENSG00000141644			6916	protein-coding gene	gene with protein product		156535				9207790, 10441743	Standard	NM_015844		Approved	PCM1, CXXC3	uc002lem.4	Q9UIS9	OTTHUMG00000132669	ENST00000591416.1:c.455C>T	18.37:g.47803052G>A	ENSP00000467017:p.Thr152Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A4UTZ0|B4DXJ5|E9PEC5|K7ELI2|K7EQZ4|K7ESN0|O15248|O95241|Q7Z7B5|Q8N4W4|Q9UNZ6|Q9UNZ7|Q9UNZ8|Q9UNZ9	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_CXXC	p.T178M	ENST00000591416.1	37	c.533	CCDS11943.1	18	.	.	.	.	.	.	.	.	.	.	G	16.32	3.091056	0.55968	.	.	ENSG00000141644	ENST00000382948;ENST00000353909;ENST00000349085;ENST00000269468;ENST00000347968;ENST00000436910;ENST00000269471;ENST00000424334;ENST00000339998;ENST00000398495;ENST00000457839;ENST00000398493;ENST00000398488	D;D;D;D;D;D;D;D;D;D;D;D;D	0.95690	-3.77;-3.74;-3.73;-3.77;-3.73;-3.75;-3.74;-3.78;-3.75;-3.73;-3.77;-3.73;-3.73	5.39	5.39	0.77823	.	0.195523	0.36101	N	0.002796	D	0.95313	0.8479	L	0.27053	0.805	0.34637	D	0.720224	D;D;D;D;D;D;D;D;D;D;D	0.89917	0.998;0.999;0.999;0.995;0.998;0.999;0.997;0.997;0.995;1.0;0.995	P;P;P;P;D;D;D;P;P;D;P	0.67103	0.794;0.891;0.899;0.886;0.931;0.93;0.921;0.754;0.886;0.949;0.886	D	0.96871	0.9639	10	0.46703	T	0.11	-1.957	15.037	0.71754	0.0:0.0:1.0:0.0	.	152;178;152;152;152;152;152;152;152;152;152	B4DUR3;B4DI41;Q9UIS9-8;A8K654;Q9UIS9-6;Q9UIS9-2;Q9UIS9-5;Q9UIS9-4;Q9UIS9;Q9UIS9-7;B4DXJ5	.;.;.;.;.;.;.;.;MBD1_HUMAN;.;.	M	152;152;152;152;152;152;152;178;152;152;152;152;152	ENSP00000372407:T152M;ENSP00000269469:T152M;ENSP00000342531:T152M;ENSP00000269468:T152M;ENSP00000285102:T152M;ENSP00000409561:T152M;ENSP00000269471:T152M;ENSP00000408846:T178M;ENSP00000339546:T152M;ENSP00000381508:T152M;ENSP00000405268:T152M;ENSP00000381506:T152M;ENSP00000381502:T152M	ENSP00000269468:T152M	T	-	2	0	MBD1	46057050	0.966000	0.33281	0.988000	0.46212	0.362000	0.29581	2.297000	0.43593	2.693000	0.91896	0.655000	0.94253	ACG	MBD1	-	NULL	ENSG00000141644		0.577	MBD1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	MBD1	HGNC	protein_coding	OTTHUMT00000255926.3	117	0.00	0	G	NM_015846		47803052	47803052	-1	no_errors	ENST00000424334	ensembl	human	known	69_37n	missense	75	33.04	37	SNP	0.989	A
MBOAT4	619373	genome.wustl.edu	37	8	29990074	29990074	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:29990074T>C	ENST00000320542.3	-	3	777	c.693A>G	c.(691-693)ggA>ggG	p.G231G	LEPROTL1_ENST00000442880.2_Intron|LEPROTL1_ENST00000523116.1_Intron	NM_001100916.1	NP_001094386.1	Q96T53	MBOA4_HUMAN	membrane bound O-acyltransferase domain containing 4	231			G -> E (in dbSNP:rs16876563).		cellular protein metabolic process (GO:0044267)|peptidyl-serine octanoylation (GO:0018191)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	serine O-acyltransferase activity (GO:0016412)			endometrium(1)	1						AATCAGTCAGTCCCGCTCCTG	0.557																																						dbGAP											0													144.0	135.0	138.0					8																	29990074		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF359269	CCDS47835.1	8p12	2008-08-04	2006-06-29	2006-06-29	ENSG00000177669	ENSG00000177669			32311	protein-coding gene	gene with protein product	"""ghrelin O-acyltransferase"""	611940	"""O-acyltransferase (membrane bound) domain containing 4"""	OACT4		18443287	Standard	NM_001100916		Approved	FKSG89, GOAT	uc010lvg.3	Q96T53	OTTHUMG00000163824	ENST00000320542.3:c.693A>G	8.37:g.29990074T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1Q003	Silent	SNP	pfam_MBOAT_fam	p.G231	ENST00000320542.3	37	c.693	CCDS47835.1	8																																																																																			MBOAT4	-	pfam_MBOAT_fam	ENSG00000177669		0.557	MBOAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT4	HGNC	protein_coding	OTTHUMT00000375795.1	119	0.00	0	T			29990074	29990074	-1	no_errors	ENST00000320542	ensembl	human	known	69_37n	silent	112	11.02	14	SNP	0.000	C
MCU	90550	genome.wustl.edu	37	10	74618991	74618991	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:74618991C>T	ENST00000373053.3	+	3	298	c.277C>T	c.(277-279)Cgg>Tgg	p.R93W	MCU_ENST00000357157.6_Missense_Mutation_p.R93W|MCU_ENST00000536019.1_Missense_Mutation_p.R44W	NM_138357.2	NP_612366.1	Q8NE86	MCU_HUMAN	mitochondrial calcium uniporter	93					calcium ion transmembrane import into mitochondrion (GO:0036444)|calcium-mediated signaling (GO:0019722)|glucose homeostasis (GO:0042593)|mitochondrial calcium ion transport (GO:0006851)|positive regulation of insulin secretion (GO:0032024)|positive regulation of mitochondrial calcium ion concentration (GO:0051561)|protein complex oligomerization (GO:0035786)	calcium channel complex (GO:0034704)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrial inner membrane (GO:0005743)|uniplex complex (GO:1990246)	calcium channel activity (GO:0005262)|uniporter activity (GO:0015292)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(1)	14						GCTACCATCCCGGCGTGAACG	0.423																																						dbGAP											0													219.0	201.0	207.0					10																	74618991		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034235	CCDS7317.1, CCDS59218.1, CCDS59219.1	10q22.2	2011-06-23	2011-06-23	2011-06-23	ENSG00000156026	ENSG00000156026			23526	protein-coding gene	gene with protein product		614197	"""coiled-coil domain containing 109A"""	C10orf42, CCDC109A		21685886, 21685888	Standard	NM_138357		Approved	FLJ46135	uc001jtc.3	Q8NE86	OTTHUMG00000018443	ENST00000373053.3:c.277C>T	10.37:g.74618991C>T	ENSP00000362144:p.Arg93Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDF3|B3KXV7|Q96FL3	Missense_Mutation	SNP	pfam_Coiled-coil-dom_prot_109_C	p.R93W	ENST00000373053.3	37	c.277	CCDS7317.1	10	.	.	.	.	.	.	.	.	.	.	C	28.2	4.902840	0.92035	.	.	ENSG00000156026	ENST00000373053;ENST00000357157;ENST00000536019	T;T;T	0.30182	1.56;1.54;1.61	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.63189	0.2490	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.998	T	0.67971	-0.5532	10	0.87932	D	0	-6.258	19.7303	0.96180	0.0:1.0:0.0:0.0	.	93;44;93	Q8NE86-2;Q8NE86-3;Q8NE86	.;.;MCU_HUMAN	W	93;93;44	ENSP00000362144:R93W;ENSP00000349680:R93W;ENSP00000440913:R44W	ENSP00000349680:R93W	R	+	1	2	MCU	74288997	0.999000	0.42202	1.000000	0.80357	0.996000	0.88848	2.240000	0.43088	2.663000	0.90544	0.591000	0.81541	CGG	MCU	-	NULL	ENSG00000156026		0.423	MCU-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCU	HGNC	protein_coding	OTTHUMT00000048594.1	337	0.00	0	C	NM_138357		74618991	74618991	+1	no_errors	ENST00000373053	ensembl	human	known	69_37n	missense	255	31.82	119	SNP	1.000	T
MED23	9439	genome.wustl.edu	37	6	131923494	131923495	+	Frame_Shift_Del	DEL	TA	TA	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	TA	TA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:131923494_131923495delTA	ENST00000368068.3	-	17	2137_2138	c.1958_1959delTA	c.(1957-1959)atafs	p.I653fs	MED23_ENST00000545957.1_Frame_Shift_Del_p.I294fs|MED23_ENST00000539158.1_3'UTR|MED23_ENST00000368060.3_Frame_Shift_Del_p.I653fs|MED23_ENST00000540546.1_Frame_Shift_Del_p.I659fs|MED23_ENST00000354577.4_Frame_Shift_Del_p.I659fs|MED23_ENST00000368058.1_Frame_Shift_Del_p.I659fs|MED23_ENST00000403834.3_Frame_Shift_Del_p.I659fs|MED23_ENST00000368053.4_Frame_Shift_Del_p.I659fs	NM_004830.3	NP_004821.2	Q9ULK4	MED23_HUMAN	mediator complex subunit 23	653					gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(12)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	44	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0115)|OV - Ovarian serous cystadenocarcinoma(155;0.0608)		CTAATGCTGTTATAAGCCTGAG	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF104255	CCDS5146.1, CCDS5147.1, CCDS59039.1	6q22.33-q24.1	2008-02-05	2007-08-08	2007-07-30	ENSG00000112282	ENSG00000112282			2372	protein-coding gene	gene with protein product		605042	"""cofactor required for Sp1 transcriptional activation, subunit 3, 130kDa"""	CRSP3		9989412	Standard	NM_004830		Approved	CRSP130, DRIP130, Sur2	uc003qcs.2	Q9ULK4	OTTHUMG00000015565	ENST00000368068.3:c.1958_1959delTA	6.37:g.131923496_131923497delTA	ENSP00000357047:p.Ile653fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B9TX55|O95403|Q5JWT3|Q5JWT4|Q6P9H6|Q9H0J2|Q9NTT9|Q9NTU0|Q9Y5P7|Q9Y667	Frame_Shift_Del	DEL	pfam_Mediator_Med23	p.I659fs	ENST00000368068.3	37	c.1977_1976	CCDS5147.1	6																																																																																			MED23	-	pfam_Mediator_Med23	ENSG00000112282		0.386	MED23-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED23	HGNC	protein_coding	OTTHUMT00000042215.1	232	0.00	0	TA			131923494	131923495	-1	no_errors	ENST00000368058	ensembl	human	known	69_37n	frame_shift_del	53	47.57	49	DEL	0.995:1.000	-
MEGF8	1954	genome.wustl.edu	37	19	42841287	42841289	+	In_Frame_Del	DEL	TCT	TCT	-	rs370287880		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:42841287_42841289delTCT	ENST00000251268.6	+	8	1442_1444	c.1442_1444delTCT	c.(1441-1446)atcttc>atc	p.F483del	MEGF8_ENST00000334370.4_In_Frame_Del_p.F483del	NM_001271938.1	NP_001258867.1	Q7Z7M0	MEGF8_HUMAN	multiple EGF-like-domains 8	483					BMP signaling pathway (GO:0030509)|cell migration involved in gastrulation (GO:0042074)|craniofacial suture morphogenesis (GO:0097094)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of heart left/right asymmetry (GO:0061371)|embryonic heart tube left/right pattern formation (GO:0060971)|embryonic heart tube morphogenesis (GO:0003143)|embryonic limb morphogenesis (GO:0030326)|embryonic skeletal system morphogenesis (GO:0048704)|epiboly involved in gastrulation with mouth forming second (GO:0055113)|fasciculation of sensory neuron axon (GO:0097155)|left/right pattern formation (GO:0060972)|limb morphogenesis (GO:0035108)|positive regulation of axon extension involved in axon guidance (GO:0048842)|regulation of gene expression (GO:0010468)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|receptor activity (GO:0004872)			breast(2)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(20)|ovary(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	50		Prostate(69;0.00682)				GAAGATGGCATCTTCTTCTACCA	0.591																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB011541	CCDS12604.2, CCDS62693.1	19q13.2	2011-11-24	2006-03-31	2006-03-31	ENSG00000105429	ENSG00000105429			3233	protein-coding gene	gene with protein product	"""HBV pre s2 binding protein 1"""	604267	"""EGF-like-domain, multiple 4"", ""chromosome 19 open reading frame 49"""	EGFL4, C19orf49		9693030	Standard	NM_001410		Approved	SBP1, FLJ22365	uc002otm.5	Q7Z7M0	OTTHUMG00000150342	ENST00000251268.6:c.1442_1444delTCT	19.37:g.42841293_42841295delTCT	ENSP00000251268:p.Phe483del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAY0|O75097	In_Frame_Del	DEL	pfam_CUB,pfam_EGF_laminin,pfam_Plexin_repeat,superfamily_Gal_Oxase/kelch_b-propeller,superfamily_CUB,superfamily_Plexin-like_fold,smart_CUB,smart_EGF-like,smart_Plexin-like,smart_EGF-like_Ca-bd,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin	p.F483in_frame_del	ENST00000251268.6	37	c.1442_1444		19																																																																																			MEGF8	-	NULL	ENSG00000105429		0.591	MEGF8-002	KNOWN	basic|appris_candidate_longest	protein_coding	MEGF8	HGNC	protein_coding	OTTHUMT00000463854.1	67	0.00	0	TCT	NM_001410		42841287	42841289	+1	no_errors	ENST00000251268	ensembl	human	known	69_37n	in_frame_del	74	16.85	15	DEL	1.000:1.000:1.000	-
MLH1	4292	genome.wustl.edu	37	3	37042542	37042542	+	Nonsense_Mutation	SNP	G	G	T	rs63750453		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:37042542G>T	ENST00000231790.2	+	3	520	c.304G>T	c.(304-306)Gag>Tag	p.E102*	MLH1_ENST00000458205.2_5'UTR|MLH1_ENST00000435176.1_Intron|MLH1_ENST00000536378.1_5'UTR|MLH1_ENST00000539477.1_5'UTR|MLH1_ENST00000455445.2_5'UTR|MLH1_ENST00000492474.1_3'UTR	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	102			E -> K (in HNPCC2; unknown pathological significance). {ECO:0000269|PubMed:17510385}.		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)			NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						CTTTCGAGGTGAGGTAAGCTA	0.348		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	0			GRCh37	CM011409	MLH1	M							122.0	121.0	122.0					3																	37042542		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.304G>T	3.37:g.37042542G>T	ENSP00000231790:p.Glu102*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI13|B4DQ11|E9PCU2	Nonsense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	p.E102*	ENST00000231790.2	37	c.304	CCDS2663.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.419292	0.96092	.	.	ENSG00000076242	ENST00000231790;ENST00000436867;ENST00000537937	.	.	.	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-24.0814	19.0698	0.93127	0.0:0.0:1.0:0.0	.	.	.	.	X	102;68;68	.	ENSP00000231790:E102X	E	+	1	0	MLH1	37017546	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	8.827000	0.92041	2.802000	0.96397	0.655000	0.94253	GAG	MLH1	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,tigrfam_DNA_mismatch_repair_N	ENSG00000076242		0.348	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	HGNC	protein_coding	OTTHUMT00000253337.2	358	0.00	0	G	NM_000249		37042542	37042542	+1	no_errors	ENST00000231790	ensembl	human	known	69_37n	nonsense	114	52.48	127	SNP	1.000	T
MMP20	9313	genome.wustl.edu	37	11	102465418	102465418	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:102465418delG	ENST00000260228.2	-	7	1036	c.1024delC	c.(1024-1026)cagfs	p.Q342fs	MMP20_ENST00000544938.1_Intron	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	365					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	GACATGAGCTGGGGGAAGGAG	0.473																																						dbGAP											0													84.0	78.0	80.0					11																	102465418		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.1024delC	11.37:g.102465418delG	ENSP00000260228:p.Gln342fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUA8|Q9H3Q0	Frame_Shift_Del	DEL	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.Q342fs	ENST00000260228.2	37	c.1024	CCDS8318.1	11																																																																																			MMP20	-	pirsf_Pept_M10A_matrix_strom,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat	ENSG00000137674		0.473	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP20	HGNC	protein_coding	OTTHUMT00000398012.1	132	0.00	0	G			102465418	102465418	-1	no_errors	ENST00000260228	ensembl	human	known	69_37n	frame_shift_del	106	13.60	17	DEL	1.000	-
MMP20	9313	genome.wustl.edu	37	11	102487558	102487558	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:102487558delT	ENST00000260228.2	-	2	371	c.359delA	c.(358-360)aatfs	p.N120fs	RP11-817J15.2_ENST00000542119.1_RNA	NM_004771.3	NP_004762.2	Q9NPA2	MMP25_HUMAN	matrix metallopeptidase 20	118					hard palate development (GO:0060022)|inflammatory response (GO:0006954)|proteolysis (GO:0006508)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27	all_cancers(8;8.95e-05)|all_epithelial(12;0.00227)|Lung NSC(15;0.139)	Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.0033)	Epithelial(9;0.0216)|Lung(13;0.0711)|all cancers(10;0.0889)|LUSC - Lung squamous cell carcinoma(19;0.13)	BRCA - Breast invasive adenocarcinoma(274;0.0161)	Marimastat(DB00786)	TGTCAAAGTATTTTTTTTCCA	0.398																																						dbGAP											0													76.0	70.0	72.0					11																	102487558		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			Y12779	CCDS8318.1	11q22.3	2008-05-22	2008-05-22			ENSG00000137674			7167	protein-coding gene	gene with protein product	"""enamelysin"""	604629	"""matrix metalloproteinase 20 (enamelysin)"""			9398237	Standard	NM_004771		Approved		uc001phc.3	O60882		ENST00000260228.2:c.359delA	11.37:g.102487558delT	ENSP00000260228:p.Asn120fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUA8|Q9H3Q0	Frame_Shift_Del	DEL	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,prints_Pept_M10A_matrixin	p.N120fs	ENST00000260228.2	37	c.359	CCDS8318.1	11																																																																																			MMP20	-	pirsf_Pept_M10A_matrix_strom,pfam_Pept_M10_metallopeptidase,smart_Peptidase_Metallo	ENSG00000137674		0.398	MMP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP20	HGNC	protein_coding	OTTHUMT00000398012.1	179	0.00	0	T			102487558	102487558	-1	no_errors	ENST00000260228	ensembl	human	known	69_37n	frame_shift_del	139	33.65	71	DEL	0.999	-
MORN1	79906	genome.wustl.edu	37	1	2319730	2319730	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:2319730C>T	ENST00000378531.3	-	3	368	c.195G>A	c.(193-195)gcG>gcA	p.A65A	MORN1_ENST00000606372.1_5'UTR|MORN1_ENST00000378529.3_Silent_p.A65A	NM_024848.1	NP_079124.1	Q5T089	MORN1_HUMAN	MORN repeat containing 1	65										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(1)|ovary(2)	9	all_cancers(77;0.000194)|all_epithelial(69;9.96e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.3e-15)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;2.21e-37)|OV - Ovarian serous cystadenocarcinoma(86;5.01e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000241)|Kidney(185;0.00137)|BRCA - Breast invasive adenocarcinoma(365;0.00488)|STAD - Stomach adenocarcinoma(132;0.00665)|KIRC - Kidney renal clear cell carcinoma(229;0.0203)|Lung(427;0.212)		CGTCCACAAACGCCCCTTCGT	0.532																																						dbGAP											0													156.0	140.0	145.0					1																	2319730		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024003	CCDS40.1, CCDS72688.1	1p36.33-p36.32	2008-02-05			ENSG00000116151	ENSG00000116151			25852	protein-coding gene	gene with protein product						12477932	Standard	XM_005244798		Approved	FLJ13941	uc001ajb.1	Q5T089	OTTHUMG00000001402	ENST00000378531.3:c.195G>A	1.37:g.2319730C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKZ6|Q8WW30|Q9H852	Missense_Mutation	SNP	NULL	p.R16H	ENST00000378531.3	37	c.47	CCDS40.1	1	.	.	.	.	.	.	.	.	.	.	C	7.351	0.622947	0.14193	.	.	ENSG00000116151	ENST00000449373	.	.	.	5.03	-8.0	0.01126	.	.	.	.	.	T	0.34135	0.0887	.	.	.	0.49915	D	0.999833	D	0.62365	0.991	P	0.45881	0.496	T	0.58752	-0.7581	7	0.87932	D	0	.	2.3725	0.04334	0.154:0.2528:0.3773:0.2159	.	16	Q5T088	.	H	16	.	ENSP00000390261:R16H	R	-	2	0	MORN1	2309590	0.513000	0.26194	0.051000	0.19133	0.060000	0.15804	-0.969000	0.03813	-0.825000	0.04290	0.561000	0.74099	CGT	MORN1	-	NULL	ENSG00000116151		0.532	MORN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MORN1	HGNC	protein_coding	OTTHUMT00000004055.1	197	0.00	0	C	NM_024848		2319730	2319730	-1	no_start_codon	ENST00000449373	ensembl	human	known	69_37n	missense	155	34.87	83	SNP	0.041	T
MRGPRX1	259249	genome.wustl.edu	37	11	18955816	18955816	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:18955816C>T	ENST00000302797.3	-	1	740	c.516G>A	c.(514-516)tgG>tgA	p.W172*	RP11-583F24.8_ENST00000528646.1_RNA|MRGPRX1_ENST00000526914.1_5'UTR	NM_147199.3	NP_671732.3	Q96LB2	MRGX1_HUMAN	MAS-related GPR, member X1	172					acute-phase response (GO:0006953)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.W172*(1)		central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(12)|pancreas(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						ATGTTTGACACCAAGCAGAAT	0.532																																						dbGAP											1	Substitution - Nonsense(1)	kidney(1)											132.0	109.0	117.0					11																	18955816		2194	4286	6480	-	-	-	SO:0001587	stop_gained	0				CCDS7846.1	11p15.1	2013-10-10			ENSG00000170255	ENSG00000170255		"""GPCR / Class A : Orphans"""	17962	protein-coding gene	gene with protein product		607227				11551509	Standard	NM_147199		Approved	MRGX1	uc001mpg.3	Q96LB2	OTTHUMG00000162655	ENST00000302797.3:c.516G>A	11.37:g.18955816C>T	ENSP00000305766:p.Trp172*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4V9L2|Q8TDD8|Q8TDD9	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.W172*	ENST00000302797.3	37	c.516	CCDS7846.1	11	.	.	.	.	.	.	.	.	.	.	.	15.88	2.964353	0.53507	.	.	ENSG00000170255	ENST00000302797	.	.	.	2.2	1.27	0.21489	.	1.482540	0.03762	N	0.258270	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	4.3048	0.10942	0.0:0.6533:0.0:0.3467	.	.	.	.	X	172	.	ENSP00000305766:W172X	W	-	3	0	MRGPRX1	18912392	0.006000	0.16342	0.020000	0.16555	0.009000	0.06853	-0.328000	0.07945	0.473000	0.27368	0.491000	0.48974	TGG	MRGPRX1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000170255		0.532	MRGPRX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX1	HGNC	protein_coding	OTTHUMT00000369913.1	299	0.00	0	C	NM_147199		18955816	18955816	-1	no_errors	ENST00000302797	ensembl	human	known	69_37n	nonsense	245	36.69	142	SNP	0.009	T
MTHFD1	4522	genome.wustl.edu	37	14	64891576	64891576	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:64891576C>T	ENST00000545908.1	+	9	1179	c.950C>T	c.(949-951)gCc>gTc	p.A317V	MTHFD1_ENST00000216605.8_Missense_Mutation_p.A261V|CTD-2555O16.2_ENST00000556640.1_RNA			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	261	Formyltetrahydrofolate synthetase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	TACGACGAGGCCAAAGAGAGG	0.458																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													114.0	90.0	98.0					14																	64891576		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.950C>T	14.37:g.64891576C>T	ENSP00000438588:p.Ala317Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.A317V	ENST00000545908.1	37	c.950		14	.	.	.	.	.	.	.	.	.	.	C	16.94	3.259891	0.59321	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.52295	0.67;0.67;0.67;0.67	5.93	5.93	0.95920	Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.42810	0.1219	L	0.43646	1.37	0.80722	D	1	B;B;B	0.33826	0.427;0.041;0.158	B;B;B	0.29267	0.1;0.099;0.093	T	0.29671	-1.0004	10	0.45353	T	0.12	-17.8546	18.5344	0.91004	0.0:1.0:0.0:0.0	.	317;261;261	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	V	317;261;317;241	ENSP00000438588:A317V;ENSP00000450560:A261V;ENSP00000216605:A317V;ENSP00000451309:A241V	ENSP00000216605:A261V	A	+	2	0	MTHFD1	63961329	1.000000	0.71417	1.000000	0.80357	0.135000	0.20990	7.763000	0.85283	2.826000	0.97356	0.655000	0.94253	GCC	MTHFD1	-	pfam_THF_DH/CycHdrlase_NAD-bd_dom,prints_THF_DH/CycHdrlase	ENSG00000100714		0.458	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	145	0.00	0	C			64891576	64891576	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	missense	214	13.15	33	SNP	1.000	T
MUC5B	727897	genome.wustl.edu	37	11	1268579	1268579	+	Missense_Mutation	SNP	T	T	G	rs190148881	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:1268579T>G	ENST00000529681.1	+	31	10527	c.10469T>G	c.(10468-10470)gTg>gGg	p.V3490G	MUC5B_ENST00000447027.1_Missense_Mutation_p.V3493G|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3490	7 X Cys-rich subdomain repeats.|Thr-rich.			Missing (in Ref. 6; AAB61398). {ECO:0000305}.|V -> G (in Ref. 4; CAA96577). {ECO:0000305}.	cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)		p.V3469G(1)		cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		CCTTCCACGGTGACTTCCCAC	0.667																																						dbGAP											1	Substitution - Missense(1)	skin(1)											101.0	122.0	115.0					11																	1268579		2134	4215	6349	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.10469T>G	11.37:g.1268579T>G	ENSP00000436812:p.Val3490Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V3493G	ENST00000529681.1	37	c.10478	CCDS44515.2	11	29	0.013278388278388278	10	0.02032520325203252	7	0.019337016574585635	2	0.0034965034965034965	10	0.013192612137203167	t	2.632	-0.286071	0.05605	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.21932	1.98;2.17	1.44	-1.72	0.08107	.	.	.	.	.	T	0.10165	0.0249	L	0.43152	1.355	0.09310	N	1	P;P	0.44090	0.826;0.563	P;B	0.48571	0.582;0.032	T	0.14504	-1.0470	9	0.87932	D	0	.	2.5883	0.04836	0.0:0.381:0.2946:0.3243	.	4018;3493	A7Y9J9;E9PBJ0	.;.	G	3490;3493;3462;3395	ENSP00000436812:V3490G;ENSP00000415793:V3493G	ENSP00000343037:V3462G	V	+	2	0	MUC5B	1225155	0.000000	0.05858	0.001000	0.08648	0.089000	0.18198	-2.439000	0.01016	-0.179000	0.10654	0.246000	0.17985	GTG	MUC5B	-	NULL	ENSG00000117983		0.667	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	290	0.00	0	T	XM_001126093		1268579	1268579	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	238	28.44	95	SNP	0.000	G
MYBL1	4603	genome.wustl.edu	37	8	67488453	67488453	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:67488453delT	ENST00000522677.3	-	10	1669	c.1259delA	c.(1258-1260)aacfs	p.N420fs	MYBL1_ENST00000517885.1_Intron|MYBL1_ENST00000524176.2_Frame_Shift_Del_p.N420fs	NM_001080416.2|NM_001144755.1	NP_001073885.1|NP_001138227.1	P10243	MYBA_HUMAN	v-myb avian myeloblastosis viral oncogene homolog-like 1	420	Negative regulatory domain. {ECO:0000250}.				positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			breast(1)|endometrium(1)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|pancreas(1)|skin(1)	25			Epithelial(68;0.00211)|all cancers(69;0.00726)|OV - Ovarian serous cystadenocarcinoma(28;0.00989)|BRCA - Breast invasive adenocarcinoma(89;0.0938)			ATTACAAGTGTTTTTTTTCCC	0.403																																						dbGAP											0													210.0	194.0	199.0					8																	67488453		1900	4122	6022	-	-	-	SO:0001589	frameshift_variant	0			X13294	CCDS47867.1, CCDS55241.1	8q22	2013-07-09	2013-07-09		ENSG00000185697	ENSG00000185697			7547	protein-coding gene	gene with protein product		159405					Standard	XM_005251251		Approved	AMYB, A-myb	uc003xwj.3	P10243	OTTHUMG00000164559	ENST00000522677.3:c.1259delA	8.37:g.67488453delT	ENSP00000429633:p.Asn420fs	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EW29|Q495F9	Frame_Shift_Del	DEL	pfam_C-myb_C,pfam_SANT/Myb,pfam_Tscrpt_reg_Wos2-domain,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.N420fs	ENST00000522677.3	37	c.1259	CCDS47867.1	8																																																																																			MYBL1	-	NULL	ENSG00000185697		0.403	MYBL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBL1	HGNC	protein_coding	OTTHUMT00000379221.3	381	0.00	0	T	XM_034274		67488453	67488453	-1	no_errors	ENST00000522677	ensembl	human	known	69_37n	frame_shift_del	271	44.88	228	DEL	0.992	-
MYH15	22989	genome.wustl.edu	37	3	108129537	108129537	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:108129537T>C	ENST00000273353.3	-	32	4504	c.4448A>G	c.(4447-4449)cAg>cGg	p.Q1483R		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	1483						cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						AACTTCCTTCTGAGAGGCATC	0.582																																						dbGAP											0													76.0	74.0	75.0					3																	108129537		2051	4223	6274	-	-	-	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.4448A>G	3.37:g.108129537T>C	ENSP00000273353:p.Gln1483Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.Q1483R	ENST00000273353.3	37	c.4448	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	T	7.400	0.632518	0.14322	.	.	ENSG00000144821	ENST00000273353	T	0.80480	-1.38	5.39	1.63	0.23807	Myosin tail (1);	.	.	.	.	T	0.80110	0.4563	M	0.72479	2.2	0.32600	N	0.525989	B	0.20887	0.049	B	0.33799	0.17	T	0.76969	-0.2762	9	0.66056	D	0.02	.	8.7631	0.34687	0.0:0.1253:0.1095:0.7652	.	1483	Q9Y2K3	MYH15_HUMAN	R	1483	ENSP00000273353:Q1483R	ENSP00000273353:Q1483R	Q	-	2	0	MYH15	109612227	1.000000	0.71417	0.007000	0.13788	0.006000	0.05464	2.593000	0.46180	-0.197000	0.10350	-1.447000	0.01057	CAG	MYH15	-	pfam_Myosin_tail	ENSG00000144821		0.582	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	67	0.00	0	T	XM_036988		108129537	108129537	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	missense	62	38.83	40	SNP	1.000	C
MYH15	22989	genome.wustl.edu	37	3	108189615	108189615	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:108189615G>A	ENST00000273353.3	-	14	1429	c.1373C>T	c.(1372-1374)gCc>gTc	p.A458V		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	458	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						GGCATCCAGGGCCCTGTTGAT	0.448																																						dbGAP											0													96.0	90.0	92.0					3																	108189615		1988	4141	6129	-	-	-	SO:0001583	missense	0			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1373C>T	3.37:g.108189615G>A	ENSP00000273353:p.Ala458Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.A458V	ENST00000273353.3	37	c.1373	CCDS43127.1	3	.	.	.	.	.	.	.	.	.	.	G	14.15	2.449783	0.43531	.	.	ENSG00000144821	ENST00000273353	D	0.88201	-2.35	5.53	-0.254	0.12992	Myosin head, motor domain (2);	.	.	.	.	T	0.81498	0.4835	L	0.46819	1.47	0.09310	N	1	B	0.09022	0.002	B	0.12837	0.008	T	0.67738	-0.5593	9	0.48119	T	0.1	.	2.029	0.03525	0.2508:0.1322:0.4818:0.1353	.	458	Q9Y2K3	MYH15_HUMAN	V	458	ENSP00000273353:A458V	ENSP00000273353:A458V	A	-	2	0	MYH15	109672305	0.861000	0.29849	0.005000	0.12908	0.989000	0.77384	2.289000	0.43523	-0.048000	0.13401	0.650000	0.86243	GCC	MYH15	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000144821		0.448	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	127	0.00	0	G	XM_036988		108189615	108189615	-1	no_errors	ENST00000273353	ensembl	human	known	69_37n	missense	91	31.39	43	SNP	0.007	A
MYT1L	23040	genome.wustl.edu	37	2	1946770	1946771	+	In_Frame_Ins	INS	-	-	TCC	rs148009982	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:1946770_1946771insTCC	ENST00000399161.2	-	9	1235_1236	c.488_489insGGA	c.(487-489)gaa>gaGGAa	p.163_163E>EE	MYT1L_ENST00000428368.2_In_Frame_Ins_p.163_163E>EE	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	163	Asp/Glu-rich.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		cttcttcctcttcctcctcctc	0.475																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.486_488dupGGA	2.37:g.1946777_1946779dupTCC	ENSP00000382114:p.Glu167dup	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	In_Frame_Ins	INS	pfam_Myelin_TF,pfam_Znf_C2HC	p.167in_frame_insE	ENST00000399161.2	37	c.489_488		2																																																																																			MYT1L	-	NULL	ENSG00000186487		0.475	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	170	0.00	0	-	NM_015025		1946770	1946771	-1	no_errors	ENST00000399161	ensembl	human	known	69_37n	in_frame_ins	221	18.15	49	INS	0.991:0.950	TCC
NAA20	51126	genome.wustl.edu	37	20	20003100	20003100	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr20:20003100T>C	ENST00000334982.4	+	2	335	c.54T>C	c.(52-54)atT>atC	p.I18I	NAA20_ENST00000484480.1_3'UTR|NAA20_ENST00000398602.2_Splice_Site_p.C6C|NAA20_ENST00000310450.4_Splice_Site_p.I18I	NM_016100.4	NP_057184.1	P61599	NAA20_HUMAN	N(alpha)-acetyltransferase 20, NatB catalytic subunit	18	N-acetyltransferase. {ECO:0000255|PROSITE-ProRule:PRU00532}.					cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(3)|lung(2)|prostate(1)	6						TTTCTTTCAGTAACTTGGATC	0.313																																						dbGAP											0													141.0	123.0	129.0					20																	20003100		2200	4300	6500	-	-	-	SO:0001630	splice_region_variant	0			AF085355	CCDS13141.1, CCDS13142.1, CCDS42854.1	20p11.23	2010-05-07	2010-01-14	2010-01-14	ENSG00000173418	ENSG00000173418	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	15908	protein-coding gene	gene with protein product	"""N-acetyltransferase 3 homolog (S. cerevisiae)"""	610833	"""N-acetyltransferase 5, ARD1 subunit (arrest-defective 1, S. cerevisiae, homolog)"", ""N-acetyltransferase 5 (ARD1 homolog, S. cerevisiae)"", ""N-acetyltransferase 5"", ""N-acetyltransferase 5 (GCN5-related, putative)"""	NAT5		12888564, 19660095	Standard	NM_016100		Approved	dJ1002M8.1, NAT3	uc002wrp.3	P61599	OTTHUMG00000031998	ENST00000334982.4:c.54-1T>C	20.37:g.20003100T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA3|B2R4G4|Q5TFT7|Q9D7H8|Q9H0Y4|Q9NQH6|Q9Y6D2	Silent	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.I18	ENST00000334982.4	37	c.54	CCDS13141.1	20																																																																																			NAA20	-	superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	ENSG00000173418		0.313	NAA20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA20	HGNC	protein_coding	OTTHUMT00000078217.2	479	0.00	0	T	NM_016100	Silent	20003100	20003100	+1	no_errors	ENST00000334982	ensembl	human	known	69_37n	silent	509	13.14	77	SNP	1.000	C
NALCN	259232	genome.wustl.edu	37	13	101714459	101714459	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr13:101714459T>C	ENST00000251127.6	-	41	4697	c.4616A>G	c.(4615-4617)tAc>tGc	p.Y1539C	NALCN-AS1_ENST00000457843.1_RNA	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1539					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					CACGGACCGGTATGAAAGCAT	0.537																																						dbGAP											0													69.0	54.0	59.0					13																	101714459		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.4616A>G	13.37:g.101714459T>C	ENSP00000251127:p.Tyr1539Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.Y1539C	ENST00000251127.6	37	c.4616	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	T	23.2	4.389484	0.82902	.	.	ENSG00000102452	ENST00000251127	D	0.97994	-4.65	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	D	0.97967	0.9331	L	0.45352	1.415	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99497	1.0952	10	0.72032	D	0.01	.	16.1755	0.81847	0.0:0.0:0.0:1.0	.	1539	Q8IZF0	NALCN_HUMAN	C	1539	ENSP00000251127:Y1539C	ENSP00000251127:Y1539C	Y	-	2	0	NALCN	100512460	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	7.483000	0.81158	2.226000	0.72624	0.528000	0.53228	TAC	NALCN	-	NULL	ENSG00000102452		0.537	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	38	0.00	0	T	NM_052867		101714459	101714459	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	missense	28	50.85	30	SNP	1.000	C
NAT10	55226	genome.wustl.edu	37	11	34164994	34164994	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:34164994A>G	ENST00000257829.3	+	28	3094	c.2888A>G	c.(2887-2889)tAc>tGc	p.Y963C	NAT10_ENST00000532555.1_3'UTR|NAT10_ENST00000531159.2_Missense_Mutation_p.Y891C|NAT10_ENST00000527971.1_Intron	NM_024662.2	NP_078938	Q9H0A0	NAT10_HUMAN	N-acetyltransferase 10 (GCN5-related)	963	Required for localization to the nucleolus and midbody.					membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)			endometrium(4)|large_intestine(8)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	23		Acute lymphoblastic leukemia(5;0.0119)|all_hematologic(20;0.0231)				TTTTTTAGATACATAATCCGT	0.453																																						dbGAP											0													80.0	76.0	77.0					11																	34164994		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF489535	CCDS7889.1, CCDS44568.1	11p13	2011-11-16	2008-09-24		ENSG00000135372	ENSG00000135372	2.3.1.-		29830	protein-coding gene	gene with protein product		609221	"""N-acetyltransferase 10"""			14592445, 21177859	Standard	NM_024662		Approved	hALP, FLJ10774, FLJ12179, NET43, KIAA1709	uc001mvk.3	Q9H0A0	OTTHUMG00000166249	ENST00000257829.3:c.2888A>G	11.37:g.34164994A>G	ENSP00000257829:p.Tyr963Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFD5|E7ESU4|E9PMN9|Q86WK5|Q9C0F4|Q9HA61|Q9NVF2	Missense_Mutation	SNP	pfam_Helicase_dom,pfam_DUF1726,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.Y963C	ENST00000257829.3	37	c.2888	CCDS7889.1	11	.	.	.	.	.	.	.	.	.	.	A	15.41	2.826641	0.50739	.	.	ENSG00000135372	ENST00000257829;ENST00000531159	T;T	0.50813	0.74;0.73	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.69646	0.3134	M	0.78916	2.43	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.74396	-0.3679	10	0.87932	D	0	-19.8149	15.5536	0.76173	1.0:0.0:0.0:0.0	.	963	Q9H0A0	NAT10_HUMAN	C	963;891	ENSP00000257829:Y963C;ENSP00000433011:Y891C	ENSP00000257829:Y963C	Y	+	2	0	NAT10	34121570	1.000000	0.71417	0.429000	0.26710	0.104000	0.19210	8.563000	0.90723	2.060000	0.61445	0.533000	0.62120	TAC	NAT10	-	NULL	ENSG00000135372		0.453	NAT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAT10	HGNC	protein_coding	OTTHUMT00000388693.1	382	0.00	0	A	NM_024662		34164994	34164994	+1	no_errors	ENST00000257829	ensembl	human	known	69_37n	missense	428	18.29	96	SNP	1.000	G
NEK9	91754	genome.wustl.edu	37	14	75577041	75577041	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:75577041T>C	ENST00000238616.5	-	9	1130	c.972A>G	c.(970-972)gcA>gcG	p.A324A		NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	324					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		TCTTTGTAGGTGCATTAAGCA	0.348																																						dbGAP											0													142.0	142.0	142.0					14																	75577041		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.972A>G	14.37:g.75577041T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A324	ENST00000238616.5	37	c.972	CCDS9839.1	14																																																																																			NEK9	-	superfamily_Kinase-like_dom	ENSG00000119638		0.348	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	HGNC	protein_coding	OTTHUMT00000415021.1	609	0.16	1	T	NM_033116		75577041	75577041	-1	no_errors	ENST00000238616	ensembl	human	known	69_37n	silent	662	11.72	88	SNP	0.999	C
NKD2	85409	genome.wustl.edu	37	5	1033615	1033615	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:1033615G>A	ENST00000296849.5	+	5	559		c.e5+1		NKD2_ENST00000274150.4_Splice_Site|NKD2_ENST00000537972.1_Splice_Site	NM_033120.3	NP_149111.1	Q969F2	NKD2_HUMAN	naked cuticle homolog 2 (Drosophila)						exocytosis (GO:0006887)|Golgi vesicle fusion to target membrane (GO:0048210)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein processing (GO:0010954)|protein targeting to plasma membrane (GO:0072661)|Wnt signaling pathway (GO:0016055)	basolateral plasma membrane (GO:0016323)|cell periphery (GO:0071944)|cytoplasmic vesicle (GO:0031410)	calcium ion binding (GO:0005509)|growth factor binding (GO:0019838)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(3)|large_intestine(1)|lung(8)|pancreas(1)	14	Lung NSC(6;2.47e-13)|all_lung(6;1.67e-12)|all_epithelial(6;3.28e-09)		Epithelial(17;0.00093)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|all cancers(22;0.00417)|Lung(60;0.165)			CAACATTGACGTGGGTCTCTC	0.682																																						dbGAP											0													19.0	23.0	22.0					5																	1033615		2068	4057	6125	-	-	-	SO:0001630	splice_region_variant	0			AF358137	CCDS3859.1, CCDS59486.1	5p15.3	2013-01-10			ENSG00000145506	ENSG00000145506		"""EF-hand domain containing"""	17046	protein-coding gene	gene with protein product	"""naked cuticle-2"", ""Dvl-binding protein NKD2"""	607852				11356022, 11604995	Standard	NM_033120		Approved	Naked2	uc003jbt.2	Q969F2	OTTHUMG00000090348	ENST00000296849.5:c.330+1G>A	5.37:g.1033615G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96EK8|Q9BSN0	Splice_Site	SNP	-	e5+1	ENST00000296849.5	37	c.330+1	CCDS3859.1	5	.	.	.	.	.	.	.	.	.	.	G	4.422	0.077964	0.08485	.	.	ENSG00000145506	ENST00000296849;ENST00000274150;ENST00000537972	.	.	.	3.59	2.71	0.32032	.	.	.	.	.	.	.	.	.	.	.	0.50171	D	0.99985	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3157	0.26499	0.1305:0.0:0.8695:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NKD2	1086615	0.998000	0.40836	0.068000	0.19968	0.142000	0.21351	3.277000	0.51654	0.624000	0.30286	0.561000	0.74099	.	NKD2	-	-	ENSG00000145506		0.682	NKD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NKD2	HGNC	protein_coding	OTTHUMT00000206720.2	20	0.00	0	G	NM_033120	Intron	1033615	1033615	+1	no_errors	ENST00000296849	ensembl	human	known	69_37n	splice_site	12	25.00	4	SNP	0.284	A
NLGN3	54413	genome.wustl.edu	37	X	70389300	70389300	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:70389300C>A	ENST00000358741.3	+	8	2203	c.1900C>A	c.(1900-1902)Ctg>Atg	p.L634M	NLGN3_ENST00000536169.1_Missense_Mutation_p.L594M|NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000374051.3_Missense_Mutation_p.L614M	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	634					adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					CCTATACAACCTGCATGACAT	0.567																																					Esophageal Squamous(103;760 1488 16849 22250 40351)	dbGAP											0													77.0	62.0	67.0					X																	70389300		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.1900C>A	X.37:g.70389300C>A	ENSP00000351591:p.Leu634Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L634M	ENST00000358741.3	37	c.1900	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	C	14.34	2.505596	0.44558	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000358741	T;T;T	0.67171	-0.24;-0.25;-0.25	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.69655	0.3135	M	0.79926	2.475	0.58432	D	0.999999	P;P;P	0.40431	0.594;0.594;0.717	B;B;B	0.37888	0.133;0.133;0.26	T	0.74118	-0.3768	10	0.42905	T	0.14	.	17.7198	0.88348	0.0:1.0:0.0:0.0	.	594;634;614	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	M	594;614;634	ENSP00000445298:L594M;ENSP00000363163:L614M;ENSP00000351591:L634M	ENSP00000351591:L634M	L	+	1	2	NLGN3	70306025	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.723000	0.61965	2.372000	0.80975	0.431000	0.28591	CTG	NLGN3	-	NULL	ENSG00000196338		0.567	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	111	0.00	0	C	NM_018977		70389300	70389300	+1	no_errors	ENST00000358741	ensembl	human	known	69_37n	missense	89	36.43	51	SNP	1.000	A
NOL9	79707	genome.wustl.edu	37	1	6610529	6610529	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:6610529G>A	ENST00000377705.5	-	2	575	c.543C>T	c.(541-543)taC>taT	p.Y181Y		NM_024654.4	NP_078930	Q5SY16	NOL9_HUMAN	nucleolar protein 9	181					maturation of 5.8S rRNA (GO:0000460)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|polynucleotide 5'-hydroxyl-kinase activity (GO:0051731)|RNA binding (GO:0003723)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(2)|urinary_tract(1)	19	Ovarian(185;0.0212)|all_lung(157;0.154)	all_cancers(23;2.46e-35)|all_epithelial(116;1.41e-22)|all_lung(118;7.59e-07)|Lung NSC(185;4.28e-06)|Colorectal(325;4.52e-05)|Breast(487;0.000353)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0443)		Colorectal(212;1.47e-07)|COAD - Colon adenocarcinoma(227;1.47e-05)|Kidney(185;5.27e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000971)|BRCA - Breast invasive adenocarcinoma(365;0.00113)|STAD - Stomach adenocarcinoma(132;0.0017)|READ - Rectum adenocarcinoma(331;0.0649)		CAGGCTGTGAGTAGTGAAGTG	0.443																																						dbGAP											0													144.0	143.0	143.0					1																	6610529		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK091284	CCDS80.1	1p36.31	2012-05-02			ENSG00000162408	ENSG00000162408			26265	protein-coding gene	gene with protein product	"""polynucleotide 5'-kinase"""					21063389	Standard	NM_024654		Approved	FLJ23323, NET6, Grc3	uc001ans.3	Q5SY16	OTTHUMG00000000904	ENST00000377705.5:c.543C>T	1.37:g.6610529G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NL84|Q4VBY3|Q6P472|Q7L4D6|Q96EE0|Q9H5L4	Silent	SNP	pfam_Pre-mRNA_cleavage_cplxII_Clp1	p.Y181	ENST00000377705.5	37	c.543	CCDS80.1	1																																																																																			NOL9	-	NULL	ENSG00000162408		0.443	NOL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL9	HGNC	protein_coding	OTTHUMT00000002625.1	281	0.00	0	G	NM_024654		6610529	6610529	-1	no_errors	ENST00000377705	ensembl	human	known	69_37n	silent	245	37.97	150	SNP	0.001	A
NPR2	4882	genome.wustl.edu	37	9	35792578	35792578	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:35792578G>A	ENST00000342694.2	+	1	428	c.173G>A	c.(172-174)cGg>cAg	p.R58Q		NM_003995.3	NP_003986.2	P20594	ANPRB_HUMAN	natriuretic peptide receptor 2	58					bone development (GO:0060348)|cell surface receptor signaling pathway (GO:0007166)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cGMP biosynthetic process (GO:0006182)|intracellular signal transduction (GO:0035556)|negative regulation of meiotic cell cycle (GO:0051447)|negative regulation of oocyte maturation (GO:1900194)|ossification (GO:0001503)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|signal transduction (GO:0007165)|single organism reproductive process (GO:0044702)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|hormone binding (GO:0042562)|natriuretic peptide receptor activity (GO:0016941)|peptide hormone binding (GO:0017046)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(14)|ovary(2)|prostate(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	45	all_epithelial(49;0.161)		LUSC - Lung squamous cell carcinoma(32;0.00521)|Lung(28;0.00697)|STAD - Stomach adenocarcinoma(86;0.194)		Erythrityl Tetranitrate(DB01613)|Nesiritide(DB04899)	GCTCTGGGCCGGGCACTGCCC	0.657																																						dbGAP											0													57.0	55.0	56.0					9																	35792578		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ005282	CCDS6590.1	9p21-p12	2014-03-03	2014-03-03		ENSG00000159899	ENSG00000159899			7944	protein-coding gene	gene with protein product	"""guanylate cyclase B"""	108961	"""acromesomelic dysplasia, Maroteaux type"", ""atrionatriuretic peptide receptor B"", ""natriuretic peptide receptor B"""	ANPRB, NPRB, AMDM		9634515, 15146390	Standard	XM_005251478		Approved	GUCY2B, ANPb	uc003zyd.3	P20594	OTTHUMG00000019871	ENST00000342694.2:c.173G>A	9.37:g.35792578G>A	ENSP00000341083:p.Arg58Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0ZBF2|B0ZBF3|D3DRP3|D3DRP4|O60871|Q4VAK7|Q5TCV2|Q8TA93|Q9UQ50	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ntpep_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.R58Q	ENST00000342694.2	37	c.173	CCDS6590.1	9	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550750	0.45383	.	.	ENSG00000159899	ENST00000342694	T	0.74421	-0.84	4.09	3.18	0.36537	Extracellular ligand-binding receptor (1);	0.000000	0.39834	N	0.001244	T	0.45357	0.1338	N	0.04508	-0.205	0.39687	D	0.970997	B;B	0.31153	0.31;0.015	B;B	0.22753	0.041;0.015	T	0.38672	-0.9650	10	0.14656	T	0.56	.	9.3621	0.38201	0.1024:0.0:0.8976:0.0	.	58;58	P20594-2;P20594	.;ANPRB_HUMAN	Q	58	ENSP00000341083:R58Q	ENSP00000341083:R58Q	R	+	2	0	NPR2	35782578	0.958000	0.32768	1.000000	0.80357	0.990000	0.78478	1.839000	0.39220	1.054000	0.40438	0.563000	0.77884	CGG	NPR2	-	pfam_ANF_lig-bd_rcpt	ENSG00000159899		0.657	NPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPR2	HGNC	protein_coding	OTTHUMT00000052345.1	16	0.00	0	G			35792578	35792578	+1	no_errors	ENST00000342694	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	A
NR1D1	9572	genome.wustl.edu	37	17	38252334	38252334	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:38252334C>T	ENST00000246672.3	-	5	1241	c.611G>A	c.(610-612)cGt>cAt	p.R204H		NM_021724.3	NP_068370.1	P20393	NR1D1_HUMAN	nuclear receptor subfamily 1, group D, member 1	204	Crucial for activation of GJA1. {ECO:0000250}.				cell differentiation (GO:0030154)|cellular response to lipopolysaccharide (GO:0071222)|circadian regulation of gene expression (GO:0032922)|circadian temperature homeostasis (GO:0060086)|gene expression (GO:0010467)|glycogen biosynthetic process (GO:0005978)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of bile acid biosynthetic process (GO:0070859)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasomal protein catabolic process (GO:0010498)|regulation of cholesterol homeostasis (GO:2000188)|regulation of circadian rhythm (GO:0042752)|regulation of fat cell differentiation (GO:0045598)|regulation of gluconeogenesis by regulation of transcription from RNA polymerase II promoter (GO:0035947)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of lipid metabolic process (GO:0019216)|regulation of type B pancreatic cell proliferation (GO:0061469)|response to leptin (GO:0044321)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|heme binding (GO:0020037)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|steroid hormone receptor activity (GO:0003707)|transcription corepressor activity (GO:0003714)|transcription corepressor binding (GO:0001222)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(2)|skin(1)|upper_aerodigestive_tract(2)	11	Colorectal(19;0.000442)					GCGCCCAAAACGCACAGCTGC	0.562																																						dbGAP											0													50.0	46.0	47.0					17																	38252334		2202	4287	6489	-	-	-	SO:0001583	missense	0			X72631	CCDS11361.1	17q11.2	2013-01-16			ENSG00000126368	ENSG00000126368		"""Nuclear hormone receptors"""	7962	protein-coding gene	gene with protein product		602408		THRAL		1971514	Standard	NM_021724		Approved	ear-1, hRev, Rev-ErbAalpha, THRA1	uc002htz.3	P20393	OTTHUMG00000133327	ENST00000246672.3:c.611G>A	17.37:g.38252334C>T	ENSP00000246672:p.Arg204His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P5Z4|Q15304	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.R204H	ENST00000246672.3	37	c.611	CCDS11361.1	17	.	.	.	.	.	.	.	.	.	.	C	16.25	3.071424	0.55646	.	.	ENSG00000126368	ENST00000246672	D	0.96587	-4.06	4.73	3.74	0.42951	Nuclear hormone receptor, ligand-binding (1);Zinc finger, nuclear hormone receptor-type (1);	0.073573	0.50627	D	0.000117	D	0.97303	0.9118	M	0.64997	1.995	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.97717	1.0194	10	0.87932	D	0	.	13.4835	0.61351	0.1581:0.8419:0.0:0.0	.	204	P20393	NR1D1_HUMAN	H	204	ENSP00000246672:R204H	ENSP00000246672:R204H	R	-	2	0	NR1D1	35505860	1.000000	0.71417	1.000000	0.80357	0.140000	0.21249	4.636000	0.61339	1.316000	0.45131	0.563000	0.77884	CGT	NR1D1	-	prints_Str_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	ENSG00000126368		0.562	NR1D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1D1	HGNC	protein_coding	OTTHUMT00000257135.1	11	0.00	0	C			38252334	38252334	-1	no_errors	ENST00000246672	ensembl	human	known	69_37n	missense	7	38.46	5	SNP	1.000	T
NRXN1	9378	genome.wustl.edu	37	2	50758375	50758375	+	Silent	SNP	C	C	T	rs202231291		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:50758375C>T	ENST00000406316.2	-	11	3813	c.2337G>A	c.(2335-2337)acG>acA	p.T779T	NRXN1_ENST00000404971.1_Silent_p.T819T|NRXN1_ENST00000406859.3_Silent_p.T779T|NRXN1_ENST00000402717.3_Silent_p.T771T|NRXN1_ENST00000401669.2_Silent_p.T779T|NRXN1_ENST00000331040.5_5'UTR|NRXN1_ENST00000405472.3_Silent_p.T771T	NM_004801.4	NP_004792.1	Q9ULB1	NRX1A_HUMAN	neurexin 1	779	Laminin G-like 4. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|axon guidance (GO:0007411)|calcium-dependent cell-cell adhesion (GO:0016339)|cerebellar granule cell differentiation (GO:0021707)|establishment of protein localization (GO:0045184)|extracellular matrix organization (GO:0030198)|gamma-aminobutyric acid receptor clustering (GO:0097112)|gephyrin clustering (GO:0097116)|guanylate kinase-associated protein clustering (GO:0097117)|heterophilic cell-cell adhesion (GO:0007157)|learning (GO:0007612)|N-methyl-D-aspartate receptor clustering (GO:0097114)|negative regulation of filopodium assembly (GO:0051490)|neuroligin clustering (GO:0097118)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|neuron maturation (GO:0042551)|neurotransmitter secretion (GO:0007269)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor localization to synapse (GO:0097120)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic vesicle clustering (GO:0097091)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	axonal growth cone (GO:0044295)|cell junction (GO:0030054)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	acetylcholine receptor binding (GO:0033130)|calcium channel regulator activity (GO:0005246)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|neuroligin family protein binding (GO:0097109)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(33)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	58		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.192)	Lung(47;0.0813)|LUSC - Lung squamous cell carcinoma(58;0.116)			CTAGATTGACCGTCAGTTTCA	0.478																																						dbGAP											0													70.0	73.0	72.0					2																	50758375		2021	4197	6218	-	-	-	SO:0001819	synonymous_variant	0			AB011150	CCDS1845.1, CCDS46282.1, CCDS54360.1	2p16.3	2008-05-15			ENSG00000179915	ENSG00000179915			8008	protein-coding gene	gene with protein product		600565					Standard	NM_001135659		Approved	KIAA0578, Hs.22998	uc021vhj.1	P58400	OTTHUMG00000129263	ENST00000406316.2:c.2337G>A	2.37:g.50758375C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7KRL9|O60323|Q53TJ9|Q53TQ1|Q9C079|Q9C080|Q9C081|Q9H3M2|Q9UDM6	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.T771	ENST00000406316.2	37	c.2313	CCDS54360.1	2																																																																																			NRXN1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000179915		0.478	NRXN1-001	KNOWN	basic|CCDS	protein_coding	NRXN1	HGNC	protein_coding	OTTHUMT00000325291.2	140	0.00	0	C			50758375	50758375	-1	no_errors	ENST00000402717	ensembl	human	known	69_37n	silent	67	31.63	31	SNP	1.000	T
TENM1	10178	genome.wustl.edu	37	X	123657271	123657271	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:123657271C>T	ENST00000371130.3	-	17	3039	c.2976G>A	c.(2974-2976)ccG>ccA	p.P992P	TENM1_ENST00000422452.2_Silent_p.P992P	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	992					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATGATGTGAGCGGTGAAGGAA	0.448																																						dbGAP											0													146.0	131.0	136.0					X																	123657271		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.2976G>A	X.37:g.123657271C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.P992	ENST00000371130.3	37	c.2976	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.448	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	302	0.33	1	C	NM_014253		123657271	123657271	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	185	38.33	115	SNP	0.956	T
TENM3	55714	genome.wustl.edu	37	4	183714372	183714372	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:183714372C>T	ENST00000511685.1	+	26	6670	c.6547C>T	c.(6547-6549)Cga>Tga	p.R2183*	TENM3_ENST00000406950.2_Nonsense_Mutation_p.R2183*			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	2183					camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										CAGAATCACTCGACTGGGTGA	0.483																																						dbGAP											0													112.0	108.0	109.0					4																	183714372		1963	4164	6127	-	-	-	SO:0001587	stop_gained	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.6547C>T	4.37:g.183714372C>T	ENSP00000424226:p.Arg2183*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Nonsense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.R2183*	ENST00000511685.1	37	c.6547	CCDS47165.1	4	.	.	.	.	.	.	.	.	.	.	C	45	11.974659	0.99623	.	.	ENSG00000218336	ENST00000511685;ENST00000406950	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.9818	0.58568	0.1614:0.8386:0.0:0.0	.	.	.	.	X	2183	.	ENSP00000385276:R2183X	R	+	1	2	ODZ3	183951366	1.000000	0.71417	0.715000	0.30552	0.562000	0.35680	4.648000	0.61425	2.460000	0.83146	0.455000	0.32223	CGA	ODZ3	-	superfamily_Cyt_c_dom	ENSG00000218336		0.483	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	169	0.00	0	C			183714372	183714372	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	nonsense	121	41.55	86	SNP	0.997	T
OFCC1	266553	genome.wustl.edu	37	6	9897162	9897162	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:9897162A>G	ENST00000316020.6	-	7	785	c.786T>C	c.(784-786)acT>acC	p.T262T	OFCC1_ENST00000472329.1_5'UTR			Q8IZS5	OFCC1_HUMAN	orofacial cleft 1 candidate 1	217										endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)	11	Ovarian(93;0.0473)|Breast(50;0.201)	all_hematologic(90;0.124)				TGATTACAGCAGTTACTTTGA	0.413																																						dbGAP											0													155.0	126.0	136.0					6																	9897162		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF548113		6p24.3	2010-11-23			ENSG00000181355	ENSG00000181355			21017	protein-coding gene	gene with protein product		614287					Standard	XM_003119969		Approved	MRDS1	uc003myh.1	Q8IZS5	OTTHUMG00000159104	ENST00000316020.6:c.786T>C	6.37:g.9897162A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z2X5|Q8IUL6|Q8IUM1|Q8IZR9|Q8IZS1|Q8IZS3	Missense_Mutation	SNP	NULL	p.L104P	ENST00000316020.6	37	c.311		6																																																																																			OFCC1	-	NULL	ENSG00000181355		0.413	OFCC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	OFCC1	HGNC	protein_coding		189	0.00	0	A	NM_153003		9897162	9897162	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000469656	ensembl	human	known	69_37n	missense	198	28.52	79	SNP	0.000	G
OR5T2	219464	genome.wustl.edu	37	11	55999765	55999765	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:55999765C>T	ENST00000313264.4	-	1	972	c.897G>A	c.(895-897)gtG>gtA	p.V299V		NM_001004746.1	NP_001004746.1	Q8NGG2	OR5T2_HUMAN	olfactory receptor, family 5, subfamily T, member 2	299						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(6)|kidney(1)|large_intestine(5)|lung(22)|ovary(2)|prostate(1)|skin(1)|stomach(3)	41	Esophageal squamous(21;0.00448)					AACTTGGTCTCACATACATGA	0.428																																						dbGAP											0													201.0	178.0	186.0					11																	55999765		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB065838	CCDS31523.1	11q11	2012-08-09			ENSG00000181718	ENSG00000181718		"""GPCR / Class A : Olfactory receptors"""	15296	protein-coding gene	gene with protein product							Standard	NM_001004746		Approved		uc010rjc.2	Q8NGG2	OTTHUMG00000166851	ENST00000313264.4:c.897G>A	11.37:g.55999765C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGX5|Q6IFC8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.V299	ENST00000313264.4	37	c.897	CCDS31523.1	11																																																																																			OR5T2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000181718		0.428	OR5T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T2	HGNC	protein_coding	OTTHUMT00000391598.1	257	0.00	0	C	NM_001004746		55999765	55999765	-1	no_errors	ENST00000313264	ensembl	human	known	69_37n	silent	240	12.09	33	SNP	0.000	T
OSBPL1A	114876	genome.wustl.edu	37	18	21759703	21759703	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:21759703G>A	ENST00000319481.3	-	20	2115	c.1909C>T	c.(1909-1911)Cga>Tga	p.R637*	OSBPL1A_ENST00000357041.4_Splice_Site_p.R255*|OSBPL1A_ENST00000399443.3_Splice_Site_p.R124*	NM_080597.3	NP_542164.2	Q9BXW6	OSBL1_HUMAN	oxysterol binding protein-like 1A	637					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cholesterol metabolic process (GO:0008203)|lipid transport (GO:0006869)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	cholesterol binding (GO:0015485)|phospholipid binding (GO:0005543)	p.R637*(1)		breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(16)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	all_cancers(21;0.000396)|all_epithelial(16;4.36e-06)|Lung NSC(20;0.00171)|all_lung(20;0.0055)|Colorectal(14;0.0505)|Ovarian(20;0.17)					AGGCCTCACCGCACTAATTCA	0.443																																						dbGAP											1	Substitution - Nonsense(1)	lung(1)											112.0	97.0	102.0					18																	21759703		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF392449, AF274714	CCDS11884.1, CCDS11885.1, CCDS56056.1	18q11.2	2014-06-03	2014-06-03	2014-06-03	ENSG00000141447	ENSG00000141447		"""Oxysterol binding proteins"", ""Ankyrin repeat domain containing"""	16398	protein-coding gene	gene with protein product		606730	"""oxysterol binding protein-like 1B"""	OSBPL1B		11279184, 10588946	Standard	NM_080597		Approved	ORP-1, ORP1	uc002kve.3	Q9BXW6	OTTHUMG00000131944	ENST00000319481.3:c.1910+1C>T	18.37:g.21759703G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7D3|Q9BZF5|Q9NW87	Nonsense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pleckstrin_homology,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,prints_Ankyrin_rpt	p.R637*	ENST00000319481.3	37	c.1909	CCDS11884.1	18	.	.	.	.	.	.	.	.	.	.	G	18.24	3.579768	0.65992	.	.	ENSG00000141447	ENST00000319481;ENST00000399443;ENST00000357041	.	.	.	5.82	4.94	0.65067	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-1.9634	14.1993	0.65690	0.0:0.0:0.6741:0.3258	.	.	.	.	X	637;124;255	.	ENSP00000320291:R637X	R	-	1	2	OSBPL1A	20013701	1.000000	0.71417	0.966000	0.40874	0.014000	0.08584	4.686000	0.61700	1.433000	0.47394	-0.181000	0.13052	CGA	OSBPL1A	-	pfam_Oxysterol-bd	ENSG00000141447		0.443	OSBPL1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL1A	HGNC	protein_coding	OTTHUMT00000254902.1	178	0.00	0	G	NM_080597	Nonsense_Mutation	21759703	21759703	-1	no_errors	ENST00000319481	ensembl	human	known	69_37n	nonsense	138	40.00	92	SNP	0.999	A
PCBP2	5094	genome.wustl.edu	37	12	53848642	53848642	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:53848642A>G	ENST00000439930.3	+	1	80	c.58A>G	c.(58-60)Atg>Gtg	p.M20V	PCBP2_ENST00000603815.1_Missense_Mutation_p.M20V|PCBP2_ENST00000447282.1_Missense_Mutation_p.M20V|PCBP2_ENST00000552296.2_Missense_Mutation_p.M20V|PCBP2_ENST00000437231.1_Missense_Mutation_p.M20V|PCBP2_ENST00000546463.1_Missense_Mutation_p.M20V|PCBP2_ENST00000552819.1_Missense_Mutation_p.M20V|PCBP2_ENST00000359462.5_Missense_Mutation_p.M20V|RP11-793H13.8_ENST00000547717.1_RNA|PCBP2_ENST00000549863.1_Missense_Mutation_p.M20V|PCBP2_ENST00000455667.3_Missense_Mutation_p.M20V|PCBP2_ENST00000541275.1_Missense_Mutation_p.M20V|PCBP2_ENST00000548933.1_Missense_Mutation_p.M20V|PCBP2_ENST00000359282.5_Missense_Mutation_p.M20V			Q15366	PCBP2_HUMAN	poly(rC) binding protein 2	20	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA metabolic process (GO:0016071)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of defense response to virus (GO:0050687)|negative regulation of type I interferon production (GO:0032480)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	15						CCGGCTACTTATGCATGGAAA	0.502																																						dbGAP											0													144.0	117.0	126.0					12																	53848642		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035420	CCDS8859.1, CCDS44900.1, CCDS44901.1, CCDS44902.1, CCDS44903.1, CCDS44904.1, CCDS55830.1	12q13.13	2013-10-30	2001-11-28		ENSG00000197111	ENSG00000197111			8648	protein-coding gene	gene with protein product	"""heterogenous nuclear ribonucleoprotein E2"""	601210	"""poly(rC)-binding protein 2"""			8833161	Standard	NM_001098620		Approved	HNRPE2, hnRNP-E2, HNRNPE2	uc001sdc.4	Q15366	OTTHUMG00000169439	ENST00000439930.3:c.58A>G	12.37:g.53848642A>G	ENSP00000408949:p.Met20Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7X6|F8VYL7|G3V0E8|I6L8F9|Q32Q82|Q59HD4|Q68Y55|Q6IPF4|Q6PKG5	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.M20V	ENST00000439930.3	37	c.58	CCDS44901.1	12	.	.	.	.	.	.	.	.	.	.	A	24.0	4.476977	0.84640	.	.	ENSG00000197111	ENST00000541275;ENST00000359282;ENST00000447282;ENST00000437231;ENST00000439930;ENST00000549863;ENST00000359462;ENST00000550927;ENST00000546463;ENST00000550192;ENST00000551104;ENST00000550520;ENST00000552296;ENST00000552083;ENST00000552819;ENST00000455667;ENST00000548933;ENST00000546652	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.34472	2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;2.29;1.36;2.29;2.29;2.29;2.29	5.31	5.31	0.75309	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.085593	0.85682	D	0.000000	T	0.33644	0.0870	N	0.12182	0.205	0.80722	D	1	P;P;P;B;B;B;B;P;B	0.45348	0.749;0.707;0.856;0.042;0.066;0.191;0.18;0.856;0.228	P;P;P;B;B;B;B;P;B	0.58970	0.675;0.624;0.849;0.165;0.148;0.167;0.412;0.849;0.345	T	0.07520	-1.0768	10	0.05833	T	0.94	.	14.371	0.66840	1.0:0.0:0.0:0.0	.	20;20;20;20;20;20;20;20;20	B4DLC0;F8VRG9;Q15366;Q32Q82;G3V0E8;F8VYL7;Q68Y55;Q6IPF4;A8K7X6	.;.;PCBP2_HUMAN;.;.;.;.;.;.	V	20;20;20;20;20;20;20;20;20;20;20;20;20;20;20;20;20;1	ENSP00000446130:M20V;ENSP00000352228:M20V;ENSP00000394116:M20V;ENSP00000390304:M20V;ENSP00000408949:M20V;ENSP00000447670:M20V;ENSP00000352438:M20V;ENSP00000448762:M20V;ENSP00000448079:M20V;ENSP00000446601:M20V;ENSP00000448847:M20V;ENSP00000448927:M20V;ENSP00000449070:M20V;ENSP00000388008:M20V;ENSP00000449062:M20V	ENSP00000352228:M20V	M	+	1	0	PCBP2	52134909	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.930000	0.92872	2.231000	0.72958	0.454000	0.30748	ATG	PCBP2	-	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000197111		0.502	PCBP2-027	NOVEL	NAGNAG_splice_site|non_canonical_conserved|basic|CCDS	protein_coding	PCBP2	HGNC	protein_coding	OTTHUMT00000407545.2	169	0.00	0	A	NM_005016		53848642	53848642	+1	no_errors	ENST00000546463	ensembl	human	known	69_37n	missense	135	30.26	59	SNP	1.000	G
PCDHGA3	56112	genome.wustl.edu	37	5	140724340	140724340	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:140724340A>G	ENST00000253812.6	+	1	740	c.740A>G	c.(739-741)tAc>tGc	p.Y247C	PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron	NM_018916.3|NM_032011.1	NP_061739.2|NP_114400.1	Q9Y5H0	PCDG3_HUMAN	protocadherin gamma subfamily A, 3	247	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)	1			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGCCTGAGTACCGTGTGAGT	0.527																																						dbGAP											0													59.0	62.0	61.0					5																	140724340		2171	4282	6453	-	-	-	SO:0001583	missense	0			AF152510	CCDS47290.1, CCDS75329.1	5q31	2010-01-26			ENSG00000254245	ENSG00000254245		"""Cadherins / Protocadherins : Clustered"""	8701	other	protocadherin		606290				10380929	Standard	NM_032011		Approved	PCDH-GAMMA-A3		Q9Y5H0	OTTHUMG00000163680	ENST00000253812.6:c.740A>G	5.37:g.140724340A>G	ENSP00000253812:p.Tyr247Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5D4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Y247C	ENST00000253812.6	37	c.740	CCDS47290.1	5	.	.	.	.	.	.	.	.	.	.	.	16.93	3.257328	0.59321	.	.	ENSG00000254245	ENST00000253812	T	0.72725	-0.68	5.65	5.65	0.86999	Cadherin (4);Cadherin-like (1);	0.000000	0.30752	U	0.008956	D	0.91626	0.7354	H	0.99626	4.665	0.42102	D	0.991346	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.95441	0.8525	10	0.87932	D	0	.	15.8511	0.78930	1.0:0.0:0.0:0.0	.	247;247	Q9Y5H0-2;Q9Y5H0	.;PCDG3_HUMAN	C	247	ENSP00000253812:Y247C	ENSP00000253812:Y247C	Y	+	2	0	PCDHGA3	140704524	1.000000	0.71417	0.752000	0.31206	0.621000	0.37620	7.363000	0.79516	2.279000	0.76181	0.533000	0.62120	TAC	PCDHGA3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000254245		0.527	PCDHGA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA3	HGNC	protein_coding	OTTHUMT00000377017.1	56	0.00	0	A	NM_018916		140724340	140724340	+1	no_errors	ENST00000253812	ensembl	human	known	69_37n	missense	54	31.65	25	SNP	0.997	G
PCDHGB7	56099	genome.wustl.edu	37	5	140799608	140799608	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:140799608G>C	ENST00000398594.2	+	1	2182	c.2182G>C	c.(2182-2184)Gag>Cag	p.E728Q	PCDHGA5_ENST00000518069.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA1_ENST00000517417.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB6_ENST00000520790.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	728					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGACTGCTTTGAGTCAGTTCT	0.527																																						dbGAP											0													67.0	69.0	68.0					5																	140799608		1970	4154	6124	-	-	-	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.2182G>C	5.37:g.140799608G>C	ENSP00000381594:p.Glu728Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E728Q	ENST00000398594.2	37	c.2182	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	0.871	-0.731866	0.03135	.	.	ENSG00000254122	ENST00000398594	T	0.12672	2.66	5.49	3.68	0.42216	.	1.099670	0.07353	N	0.882782	T	0.02807	0.0084	N	0.00108	-2.11	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.001;0.002	T	0.15723	-1.0427	10	0.02654	T	1	.	11.0173	0.47696	0.0811:0.2137:0.7052:0.0	.	728;728	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	Q	728	ENSP00000381594:E728Q	ENSP00000381594:E728Q	E	+	1	0	PCDHGB7	140779792	0.009000	0.17119	0.961000	0.40146	0.471000	0.32888	1.382000	0.34374	1.332000	0.45431	0.561000	0.74099	GAG	PCDHGB7	-	NULL	ENSG00000254122		0.527	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	130	0.00	0	G	NM_018927		140799608	140799608	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	missense	134	10.67	16	SNP	0.003	C
PCNX	22990	genome.wustl.edu	37	14	71444749	71444749	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:71444749delA	ENST00000304743.2	+	6	2141	c.1695delA	c.(1693-1695)ggafs	p.G565fs	PCNX_ENST00000238570.5_Frame_Shift_Del_p.G565fs|PCNX_ENST00000439984.3_Frame_Shift_Del_p.G565fs	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	565						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		GACGCACAGGAAAAAAACGGG	0.473																																						dbGAP											0													102.0	102.0	102.0					14																	71444749		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.1695delA	14.37:g.71444749delA	ENSP00000304192:p.Gly565fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR6|O94897|Q96AI7|Q9Y2J9	Frame_Shift_Del	DEL	pfam_Pecanex	p.K567fs	ENST00000304743.2	37	c.1695	CCDS9806.1	14																																																																																			PCNX	-	NULL	ENSG00000100731		0.473	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	103	0.00	0	A	NM_014982		71444749	71444749	+1	no_errors	ENST00000304743	ensembl	human	known	69_37n	frame_shift_del	71	33.94	37	DEL	0.950	-
PDE6B	5158	genome.wustl.edu	37	4	660344	660344	+	Missense_Mutation	SNP	G	G	A	rs199521106	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:660344G>A	ENST00000496514.1	+	20	2314	c.2293G>A	c.(2293-2295)Gcc>Acc	p.A765T	PDE6B_ENST00000255622.6_Missense_Mutation_p.A765T|PDE6B_ENST00000429163.2_Missense_Mutation_p.A486T			P35913	PDE6B_HUMAN	phosphodiesterase 6B, cGMP-specific, rod, beta	765					cytosolic calcium ion homeostasis (GO:0051480)|GMP metabolic process (GO:0046037)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|retina development in camera-type eye (GO:0060041)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(2)|urinary_tract(1)	30					Caffeine(DB00201)	GAACAAGGCGGCCGAGCTCCC	0.652																																					GBM(71;463 1194 9848 25922 46834)	dbGAP											0													100.0	80.0	87.0					4																	660344		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000249	CCDS33932.1, CCDS46993.1, CCDS54703.1	4p16.3	2014-01-28	2008-07-31		ENSG00000133256	ENSG00000133256	3.1.4.17	"""Phosphodiesterases"""	8786	protein-coding gene	gene with protein product	"""congenital stationary night blindness 3, autosomal dominant"""	180072		PDEB		1313787	Standard	NM_001145292		Approved	CSNB3, rd1, RP40, CSNBAD2	uc003gap.3	P35913	OTTHUMG00000159909	ENST00000496514.1:c.2293G>A	4.37:g.660344G>A	ENSP00000420295:p.Ala765Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9T9|E7ETT3|Q53XN5|Q9BWH5|Q9UD49	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.A765T	ENST00000496514.1	37	c.2293	CCDS33932.1	4	.	.	.	.	.	.	.	.	.	.	G	18.78	3.696546	0.68386	.	.	ENSG00000133256	ENST00000255622;ENST00000496514;ENST00000429163;ENST00000471824	T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06	4.26	3.4	0.38934	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.056069	0.64402	D	0.000001	T	0.61949	0.2388	N	0.12527	0.23	0.31429	N	0.673306	B;B	0.21071	0.028;0.051	B;B	0.25140	0.027;0.058	T	0.64655	-0.6356	10	0.72032	D	0.01	.	11.3432	0.49546	0.0:0.0:0.8165:0.1835	.	765;765	P35913;P35913-2	PDE6B_HUMAN;.	T	765;765;486;125	ENSP00000255622:A765T;ENSP00000420295:A765T;ENSP00000406334:A486T;ENSP00000417852:A125T	ENSP00000255622:A765T	A	+	1	0	PDE6B	650344	0.996000	0.38824	0.985000	0.45067	0.991000	0.79684	7.396000	0.79891	0.874000	0.35823	0.650000	0.86243	GCC	PDE6B	-	pfam_PDEase_catalytic_dom	ENSG00000133256		0.652	PDE6B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDE6B	HGNC	protein_coding	OTTHUMT00000358109.1	49	0.00	0	G	NM_000283		660344	660344	+1	no_errors	ENST00000496514	ensembl	human	known	69_37n	missense	94	12.96	14	SNP	0.412	A
PEX2	5828	genome.wustl.edu	37	8	77896091	77896091	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:77896091A>G	ENST00000419564.2	-	4	788	c.324T>C	c.(322-324)gtT>gtC	p.V108V	PEX2_ENST00000357039.4_Silent_p.V108V|PEX2_ENST00000522527.1_Silent_p.V108V|PEX2_ENST00000520103.1_Silent_p.V108V	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2	108					bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						CAATTGTACAAACAGCATACC	0.373																																						dbGAP											0													65.0	61.0	62.0					8																	77896091		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.324T>C	8.37:g.77896091A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567S6|Q9BW41	Silent	SNP	pfam_Pex_N,smart_Znf_RING,pfscan_Znf_RING	p.V108	ENST00000419564.2	37	c.324	CCDS6221.1	8																																																																																			PEX2	-	pfam_Pex_N	ENSG00000164751		0.373	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	137	0.00	0	A	NM_000318		77896091	77896091	-1	no_errors	ENST00000357039	ensembl	human	known	69_37n	silent	100	39.02	64	SNP	0.905	G
PHF2	5253	genome.wustl.edu	37	9	96422612	96422612	+	Frame_Shift_Del	DEL	A	A	-	rs76832193		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:96422612delA	ENST00000359246.4	+	12	1835	c.1468delA	c.(1468-1470)aaafs	p.K492fs	PHF2_ENST00000375376.4_Intron	NM_005392.3	NP_005383.3	O75151	PHF2_HUMAN	PHD finger protein 2	492	Lys-rich.|Pro-rich.				liver development (GO:0001889)|negative regulation of chromatin silencing at rDNA (GO:0061188)|protein demethylation (GO:0006482)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|histone demethylase activity (H3-K9 specific) (GO:0032454)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)	p.K492fs*6(1)		breast(1)|central_nervous_system(2)|endometrium(6)|large_intestine(9)|lung(14)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40		Myeloproliferative disorder(762;0.0255)		OV - Ovarian serous cystadenocarcinoma(323;9.11e-28)		GAAAGTGTCCAAAAAAAAGAC	0.597																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											20.0	23.0	22.0					9																	96422612		2202	4299	6501	-	-	-	SO:0001589	frameshift_variant	0			AF043725	CCDS35069.1	9q22	2013-01-28			ENSG00000197724	ENSG00000197724		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	8920	protein-coding gene	gene with protein product	"""jumonji C domain-containing histone demethylase 1E"", ""centromere protein 35"""	604351				10051327, 20129925	Standard	NM_005392		Approved	KIAA0662, JHDM1E, CENP-35	uc004aub.3	O75151	OTTHUMG00000020253	ENST00000359246.4:c.1468delA	9.37:g.96422612delA	ENSP00000352185:p.Lys492fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXG0|Q8N3K2|Q9Y6N4	Frame_Shift_Del	DEL	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.K492fs	ENST00000359246.4	37	c.1468	CCDS35069.1	9																																																																																			PHF2	-	NULL	ENSG00000197724		0.597	PHF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF2	HGNC	protein_coding	OTTHUMT00000053162.1	53	0.00	0	A	NM_005392		96422612	96422612	+1	no_errors	ENST00000359246	ensembl	human	known	69_37n	frame_shift_del	24	35.90	14	DEL	1.000	-
PIGW	284098	genome.wustl.edu	37	17	34893944	34893944	+	Missense_Mutation	SNP	C	C	G	rs141448923		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:34893944C>G	ENST00000592983.1	+	2	1574	c.994C>G	c.(994-996)Cat>Gat	p.H332D	MYO19_ENST00000590081.1_Intron|PIGW_ENST00000328396.2_Missense_Mutation_p.H332D			Q7Z7B1	PIGW_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class W	332					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups (GO:0016746)			breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Breast(25;0.00957)|Ovarian(249;0.17)	Kidney(155;0.104)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		GAACCGATCACATATCAAAGA	0.393																																						dbGAP											0													98.0	88.0	91.0					17																	34893944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB097818	CCDS11313.1	17q21.1	2014-05-06	2006-06-28		ENSG00000184886	ENSG00000277161		"""Phosphatidylinositol glycan anchor biosynthesis"""	23213	protein-coding gene	gene with protein product		610275	"""phosphatidylinositol glycan, class W"""			14517336, 12714589	Standard	XM_005257238		Approved	Gwt1, FLJ37433	uc002hmz.1	Q7Z7B1	OTTHUMG00000188438	ENST00000592983.1:c.994C>G	17.37:g.34893944C>G	ENSP00000468778:p.His332Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N9G3	Missense_Mutation	SNP	pfam_GWT1,pirsf_GWT1	p.H332D	ENST00000592983.1	37	c.994	CCDS11313.1	17	.	.	.	.	.	.	.	.	.	.	C	2.647	-0.282890	0.05642	.	.	ENSG00000184886	ENST00000328396	.	.	.	5.49	2.37	0.29283	.	0.759301	0.13065	N	0.416599	T	0.17746	0.0426	N	0.12182	0.205	0.09310	N	1	B	0.30973	0.302	B	0.30855	0.121	T	0.21999	-1.0229	8	.	.	.	0.0094	5.26	0.15567	0.0:0.4462:0.306:0.2478	.	332	Q7Z7B1	PIGW_HUMAN	D	332	.	.	H	+	1	0	PIGW	31968057	0.000000	0.05858	0.011000	0.14972	0.835000	0.47333	0.507000	0.22675	0.356000	0.24157	0.561000	0.74099	CAT	PIGW	-	pfam_GWT1,pirsf_GWT1	ENSG00000184886		0.393	PIGW-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIGW	HGNC	protein_coding	OTTHUMT00000451318.1	177	0.00	0	C	NM_178517		34893944	34893944	+1	no_errors	ENST00000328396	ensembl	human	known	69_37n	missense	171	32.94	84	SNP	0.000	G
PIK3C2A	5286	genome.wustl.edu	37	11	17122898	17122900	+	In_Frame_Del	DEL	AAC	AAC	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:17122898_17122900delAAC	ENST00000265970.7	-	24	3932_3934	c.3933_3935delGTT	c.(3931-3936)ttgttt>ttt	p.L1311del	PIK3C2A_ENST00000531428.1_Intron|PIK3C2A_ENST00000540361.1_In_Frame_Del_p.L931del	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1311	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						GAGGTCCACAAACAACTGAAAAC	0.399																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.3933_3935delGTT	11.37:g.17122901_17122903delAAC	ENSP00000265970:p.Leu1311del	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH2|B4E2G4|Q14CQ9	In_Frame_Del	DEL	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_Ca-dep,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.L1311in_frame_del	ENST00000265970.7	37	c.3935_3933	CCDS7824.1	11																																																																																			PIK3C2A	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000011405		0.399	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1	302	0.00	0	AAC	NM_002645		17122898	17122900	-1	no_errors	ENST00000265970	ensembl	human	known	69_37n	in_frame_del	245	34.83	132	DEL	1.000:1.000:1.000	-
PIK3CA	5290	genome.wustl.edu	37	3	178916938	178916940	+	In_Frame_Del	DEL	GAA	GAA	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:178916938_178916940delGAA	ENST00000263967.3	+	2	482_484	c.325_327delGAA	c.(325-327)gaadel	p.E110del		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	110					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E109del(3)|p.G106_R108del(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AGGCAACCGTGAAGAAAAGATCC	0.34		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	4	Deletion - In frame(4)	endometrium(2)|large_intestine(1)|lung(1)																																								-	-	-	SO:0001651	inframe_deletion	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.325_327delGAA	3.37:g.178916941_178916943delGAA	ENSP00000263967:p.Glu110del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	In_Frame_Del	DEL	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E110in_frame_del	ENST00000263967.3	37	c.325_327	CCDS43171.1	3																																																																																			PIK3CA	-	NULL	ENSG00000121879		0.340	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	123	0.00	0	GAA			178916938	178916940	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	in_frame_del	100	31.03	45	DEL	1.000:1.000:1.000	-
PIWIL1	9271	genome.wustl.edu	37	12	130833950	130833950	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:130833950A>G	ENST00000245255.3	+	8	1173	c.901A>G	c.(901-903)Aaa>Gaa	p.K301E		NM_001190971.1|NM_004764.4	NP_001177900.1|NP_004755.2	Q96J94	PIWL1_HUMAN	piwi-like RNA-mediated gene silencing 1	301	PAZ. {ECO:0000255|PROSITE- ProRule:PRU00142}.				gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|mRNA cap binding complex (GO:0005845)|P granule (GO:0043186)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)|single-stranded RNA binding (GO:0003727)			breast(6)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(8)|lung(26)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	57	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;3.02e-06)|Epithelial(86;3.85e-05)|all cancers(50;4.65e-05)		ACAAGTTTCCAAAGAACTAAT	0.333																																						dbGAP											0													60.0	58.0	59.0					12																	130833950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF104260	CCDS9268.1	12q24.33	2014-01-21	2013-02-15		ENSG00000125207	ENSG00000125207		"""Argonaute/PIWI family"""	9007	protein-coding gene	gene with protein product		605571	"""piwi (Drosophila)-like 1"", ""piwi-like 1 (Drosophila)"""			9851978, 12906857	Standard	NM_004764		Approved	PIWI, HIWI, CT80.1	uc001uik.3	Q96J94	OTTHUMG00000168382	ENST00000245255.3:c.901A>G	12.37:g.130833950A>G	ENSP00000245255:p.Lys301Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F266|O95404|Q8NA60|Q8TBY5|Q96JD5	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_GAGE,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.K301E	ENST00000245255.3	37	c.901	CCDS9268.1	12	.	.	.	.	.	.	.	.	.	.	A	31	5.075757	0.94000	.	.	ENSG00000125207	ENST00000245255	T	0.14391	2.51	5.85	5.85	0.93711	Argonaute/Dicer protein, PAZ (4);	0.000000	0.85682	D	0.000000	T	0.35998	0.0951	M	0.66560	2.04	0.80722	D	1	B;D	0.69078	0.325;0.997	P;D	0.71656	0.471;0.974	T	0.05920	-1.0856	10	0.66056	D	0.02	-6.4272	15.4187	0.74995	1.0:0.0:0.0:0.0	.	301;301	Q96J94;Q96J94-2	PIWL1_HUMAN;.	E	301	ENSP00000245255:K301E	ENSP00000245255:K301E	K	+	1	0	PIWIL1	129399903	1.000000	0.71417	0.960000	0.40013	0.996000	0.88848	9.231000	0.95317	2.222000	0.72286	0.533000	0.62120	AAA	PIWIL1	-	pfam_PAZ,superfamily_PAZ,smart_PAZ,pfscan_PAZ	ENSG00000125207		0.333	PIWIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL1	HGNC	protein_coding	OTTHUMT00000399510.1	238	0.00	0	A			130833950	130833950	+1	no_errors	ENST00000245255	ensembl	human	known	69_37n	missense	208	33.97	107	SNP	0.999	G
PJA1	64219	genome.wustl.edu	37	X	68382828	68382828	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:68382828G>A	ENST00000361478.1	-	2	631	c.254C>T	c.(253-255)tCg>tTg	p.S85L	PJA1_ENST00000374583.1_Missense_Mutation_p.S85L|PJA1_ENST00000477231.1_5'UTR|PJA1_ENST00000374584.3_Missense_Mutation_p.S85L|PJA1_ENST00000374571.4_Missense_Mutation_p.S30L	NM_001032396.2|NM_022368.4|NM_145119.3	NP_001027568.1|NP_071763.2|NP_660095.1	Q8NG27	PJA1_HUMAN	praja ring finger 1, E3 ubiquitin protein ligase	85					protein catabolic process (GO:0030163)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(5)|lung(12)|ovary(1)	21						GTTGGTTCCCGAACTCTCGCT	0.507																																						dbGAP											0													138.0	119.0	125.0					X																	68382828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021892	CCDS14392.1, CCDS14393.1, CCDS35316.1	Xq13.1	2013-01-09	2012-02-23		ENSG00000181191	ENSG00000181191		"""RING-type (C3HC4) zinc fingers"""	16648	protein-coding gene	gene with protein product		300420	"""praja 1"", ""praja ring finger 1"""			12036302	Standard	NM_001032396		Approved	FLJ11830, RNF70	uc004dxh.3	Q8NG27	OTTHUMG00000021753	ENST00000361478.1:c.254C>T	X.37:g.68382828G>A	ENSP00000355014:p.Ser85Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A322|Q5JUT8|Q5JUT9|Q8NG28|Q9HAC1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S85L	ENST00000361478.1	37	c.254	CCDS14393.1	X	.	.	.	.	.	.	.	.	.	.	G	7.884	0.730830	0.15507	.	.	ENSG00000181191	ENST00000396010;ENST00000374584;ENST00000374583;ENST00000361478;ENST00000374571	T;T;T;T	0.10860	3.44;3.48;3.48;2.83	3.39	3.39	0.38822	.	0.448931	0.15762	U	0.245874	T	0.18299	0.0439	L	0.28556	0.865	0.09310	N	1	D;D	0.76494	0.999;0.996	D;P	0.72625	0.978;0.889	T	0.04635	-1.0937	10	0.40728	T	0.16	-4.4727	9.5421	0.39257	0.0:0.0:1.0:0.0	.	85;85	Q8NG27;Q8NG27-2	PJA1_HUMAN;.	L	30;85;85;85;30	ENSP00000363712:S85L;ENSP00000363711:S85L;ENSP00000355014:S85L;ENSP00000363699:S30L	ENSP00000355014:S85L	S	-	2	0	PJA1	68299553	0.989000	0.36119	0.010000	0.14722	0.006000	0.05464	5.329000	0.65892	1.996000	0.58369	0.534000	0.68092	TCG	PJA1	-	NULL	ENSG00000181191		0.507	PJA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PJA1	HGNC	protein_coding	OTTHUMT00000057031.2	240	0.00	0	G	NM_145119		68382828	68382828	-1	no_errors	ENST00000361478	ensembl	human	known	69_37n	missense	225	33.91	117	SNP	0.009	A
PKP1	5317	genome.wustl.edu	37	1	201282534	201282535	+	Missense_Mutation	DNP	CG	CG	TA			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C|G	C|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:201282534_201282535CG>TA	ENST00000352845.3	+	3	547_548	c.547_548CG>TA	c.(547-549)CGc>TAc	p.R183Y	PKP1_ENST00000367324.3_Missense_Mutation_p.R183Y|PKP1_ENST00000263946.3_Missense_Mutation_p.R183Y			Q13835	PKP1_HUMAN	plakophilin 1	183					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						CACCCAGAACCGCTACAGCTTT	0.619																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	Exception_encountered	1.37:g.201282534_201282535delinsTA	ENSP00000295597:p.Arg183Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00645|Q14CA0|Q15152	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R183C|p.R183H	ENST00000352845.3	37	c.547|c.548	CCDS30966.1	1																																																																																			PKP1	-	NULL	ENSG00000081277		0.619	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1	34	0.00	0	C|G	NM_000299		201282534|201282535	201282534|201282535	+1	no_errors	ENST00000263946	ensembl	human	known	69_37n	missense	48|38	12.73|33.33	7|19	SNP	1.000	T|A
PLD1	5337	genome.wustl.edu	37	3	171431831	171431831	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:171431831A>G	ENST00000351298.4	-	9	889	c.763T>C	c.(763-765)Tta>Cta	p.L255L	PLD1_ENST00000356327.5_Silent_p.L255L|PLD1_ENST00000340989.4_Silent_p.L255L|PLD1_ENST00000342215.6_Silent_p.L255L	NM_002662.4	NP_002653.1	Q13393	PLD1_HUMAN	phospholipase D1, phosphatidylcholine-specific	255	PH.				chemotaxis (GO:0006935)|defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|Ras protein signal transduction (GO:0007265)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	N-acylphosphatidylethanolamine-specific phospholipase D activity (GO:0070290)|phosphatidylinositol binding (GO:0035091)|phospholipase D activity (GO:0004630)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(15)|lung(27)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	63	all_cancers(22;4.53e-19)|Ovarian(172;0.00197)|Breast(254;0.186)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)		Choline(DB00122)	TTCACTATTAACCATCTGTAA	0.348																																					NSCLC(149;2174 3517 34058)	dbGAP											0													75.0	78.0	77.0					3																	171431831		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U38545	CCDS3216.1, CCDS46957.1	3q26	2013-01-10	2006-02-17		ENSG00000075651	ENSG00000075651	3.1.4.4	"""Pleckstrin homology (PH) domain containing"""	9067	protein-coding gene	gene with protein product	"""choline phosphatase 1"""	602382				9858822, 8530346	Standard	NM_002662		Approved		uc003fhs.3	Q13393	OTTHUMG00000156947	ENST00000351298.4:c.763T>C	3.37:g.171431831A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Phox,pfam_PLipase_D/transphosphatidylase,pfam_Pleckstrin_homology,superfamily_Phox,smart_Phox,smart_Pleckstrin_homology,smart_PLipase_D/transphosphatidylase,pirsf_PLipase_D_euk,pfscan_Phox,pfscan_PLipase_D/transphosphatidylase	p.L255	ENST00000351298.4	37	c.763	CCDS3216.1	3																																																																																			PLD1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pirsf_PLipase_D_euk	ENSG00000075651		0.348	PLD1-001	KNOWN	basic|CCDS	protein_coding	PLD1	HGNC	protein_coding	OTTHUMT00000346730.2	189	0.00	0	A	NM_002662		171431831	171431831	-1	no_errors	ENST00000351298	ensembl	human	known	69_37n	silent	164	34.14	85	SNP	1.000	G
PLXNB2	23654	genome.wustl.edu	37	22	50727190	50727190	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:50727190G>A	ENST00000449103.1	-	5	1502	c.1362C>T	c.(1360-1362)taC>taT	p.Y454Y	PLXNB2_ENST00000359337.4_Silent_p.Y454Y|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	454	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGGTCATGGCGTACAGGCTGC	0.602																																						dbGAP											0													51.0	53.0	53.0					22																	50727190		2136	4231	6367	-	-	-	SO:0001819	synonymous_variant	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.1362C>T	22.37:g.50727190G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.Y454	ENST00000449103.1	37	c.1362	CCDS43035.1	22																																																																																			PLXNB2	-	superfamily_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000196576		0.602	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	38	0.00	0	G	NM_012401		50727190	50727190	-1	no_errors	ENST00000359337	ensembl	human	known	69_37n	silent	30	33.33	15	SNP	0.997	A
POC5	134359	genome.wustl.edu	37	5	74973684	74973684	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:74973684delT	ENST00000428202.2	-	11	1688	c.1499delA	c.(1498-1500)aatfs	p.N500fs	POC5_ENST00000514838.2_Frame_Shift_Del_p.N472fs|POC5_ENST00000446329.2_Frame_Shift_Del_p.N475fs|POC5_ENST00000510798.1_Intron|POC5_ENST00000380475.2_Intron	NM_001099271.1	NP_001092741.1	Q8NA72	POC5_HUMAN	POC5 centriolar protein	500					cell cycle (GO:0007049)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						GCTAATTCTATTTTTTGAAGC	0.418																																						dbGAP											0													129.0	115.0	120.0					5																	74973684		1843	4094	5937	-	-	-	SO:0001589	frameshift_variant	0			AK093098	CCDS47236.1, CCDS47237.1	5q13.3	2013-08-05	2013-08-05	2010-03-26	ENSG00000152359	ENSG00000152359			26658	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 37"", ""POC5 centriolar protein homolog (Chlamydomonas)"""	C5orf37		19349582	Standard	NM_152408		Approved	FLJ35779, MGC120442, MGC120443, MGC120444, hPOC5	uc003keh.4	Q8NA72	OTTHUMG00000162487	ENST00000428202.2:c.1499delA	5.37:g.74973684delT	ENSP00000410216:p.Asn500fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJG7|Q494X7|Q494X9|Q6P085	Frame_Shift_Del	DEL	NULL	p.N500fs	ENST00000428202.2	37	c.1499	CCDS47236.1	5																																																																																			POC5	-	NULL	ENSG00000152359		0.418	POC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POC5	HGNC	protein_coding	OTTHUMT00000369124.1	451	0.00	0	T	NM_152408		74973684	74973684	-1	no_errors	ENST00000428202	ensembl	human	known	69_37n	frame_shift_del	301	41.35	220	DEL	0.001	-
POLA1	5422	genome.wustl.edu	37	X	24830822	24830822	+	Silent	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:24830822T>C	ENST00000379059.3	+	29	3135	c.3120T>C	c.(3118-3120)atT>atC	p.I1040I	POLA1_ENST00000379068.3_Silent_p.I1046I	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	1040					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	AAATAGACATTGATGGGGTTT	0.378																																						dbGAP											0													84.0	83.0	83.0					X																	24830822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.3120T>C	X.37:g.24830822T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UQ7	Silent	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.I1046	ENST00000379059.3	37	c.3138	CCDS14214.1	X																																																																																			POLA1	-	pfam_DNA-dir_DNA_pol_B_multi_dom,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.378	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	242	0.41	1	T	NM_016937		24830822	24830822	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	silent	221	26.97	82	SNP	0.983	C
POLE	5426	genome.wustl.edu	37	12	133220438	133220438	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:133220438G>A	ENST00000320574.5	-	33	4318	c.4275C>T	c.(4273-4275)ggC>ggT	p.G1425G	POLE_ENST00000434528.3_5'Flank|POLE_ENST00000535270.1_Silent_p.G1398G	NM_006231.2	NP_006222.2	Q07864	DPOE1_HUMAN	polymerase (DNA directed), epsilon, catalytic subunit	1425					base-excision repair, gap-filling (GO:0006287)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA synthesis involved in DNA repair (GO:0000731)|G1/S transition of mitotic cell cycle (GO:0000082)|in utero embryonic development (GO:0001701)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	cytoplasm (GO:0005737)|epsilon DNA polymerase complex (GO:0008622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|nucleotide binding (GO:0000166)|zinc ion binding (GO:0008270)			NS(2)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(41)|ovary(3)|pancreas(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	89	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0416)		OV - Ovarian serous cystadenocarcinoma(86;5.22e-08)|Epithelial(86;4.03e-07)|all cancers(50;1.18e-05)	Cladribine(DB00242)	TCTCATATACGCCCTCGATGT	0.557								DNA polymerases (catalytic subunits)																														dbGAP											0													159.0	135.0	143.0					12																	133220438		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9278.1	12q24.3	2014-09-17	2012-05-18		ENSG00000177084	ENSG00000177084		"""DNA polymerases"""	9177	protein-coding gene	gene with protein product	"""DNA polymerase epsilon catalytic subunit A"""	174762	"""polymerase (DNA directed), epsilon"""			8020968	Standard	NM_006231		Approved	POLE1	uc001uks.1	Q07864	OTTHUMG00000168045	ENST00000320574.5:c.4275C>T	12.37:g.133220438G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13533|Q86VH9	Silent	SNP	pfam_DNA_pol_e_suA_C,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_3'-5'_exonuclease_PolB-like,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B	p.G1436	ENST00000320574.5	37	c.4308	CCDS9278.1	12																																																																																			POLE	-	NULL	ENSG00000177084		0.557	POLE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE	HGNC	protein_coding	OTTHUMT00000397689.2	150	0.00	0	G	NM_006231		133220438	133220438	-1	no_errors	ENST00000455752	ensembl	human	known	69_37n	silent	155	23.27	47	SNP	0.455	A
POLR2B	5431	genome.wustl.edu	37	4	57896449	57896452	+	Frame_Shift_Del	DEL	TTGT	TTGT	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	TTGT	TTGT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:57896449_57896452delTTGT	ENST00000381227.1	+	25	3732_3735	c.3319_3322delTTGT	c.(3319-3324)ttgtttfs	p.LF1107fs	POLR2B_ENST00000431623.2_Frame_Shift_Del_p.LF1032fs|POLR2B_ENST00000314595.5_Frame_Shift_Del_p.LF1107fs|POLR2B_ENST00000441246.2_Frame_Shift_Del_p.LF1100fs|IGFBP7_ENST00000512512.1_5'Flank			P30876	RPB2_HUMAN	polymerase (RNA) II (DNA directed) polypeptide B, 140kDa	1107					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonucleoside binding (GO:0032549)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(10)|large_intestine(9)|lung(17)|ovary(2)|prostate(4)|skin(1)	52	Glioma(25;0.08)|all_neural(26;0.181)					AAGGGAAAGATTGTTTGAGGCATC	0.441																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS3511.1	4q12	2013-01-21	2002-08-29		ENSG00000047315	ENSG00000047315		"""RNA polymerase subunits"""	9188	protein-coding gene	gene with protein product		180661	"""polymerase (RNA) II (DNA directed) polypeptide B (140kD)"""			1518060, 8034326	Standard	NM_000938		Approved	RPB2	uc003hcl.1	P30876	OTTHUMG00000128771	ENST00000381227.1:c.3319_3322delTTGT	4.37:g.57896449_57896452delTTGT	ENSP00000370625:p.Leu1107fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1A8|Q8IZ61	Frame_Shift_Del	DEL	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpb2_4,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_5	p.F1108fs	ENST00000381227.1	37	c.3319_3322	CCDS3511.1	4																																																																																			POLR2B	-	pfam_RNA_pol_Rpb2_7	ENSG00000047315		0.441	POLR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2B	HGNC	protein_coding	OTTHUMT00000250692.1	326	0.00	0	TTGT	NM_000938		57896449	57896452	+1	no_errors	ENST00000314595	ensembl	human	known	69_37n	frame_shift_del	240	30.88	109	DEL	0.436:0.999:1.000:1.000	-
POTEH	23784	genome.wustl.edu	37	22	16287406	16287406	+	Silent	SNP	G	G	A	rs564721474	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:16287406G>A	ENST00000343518.6	-	1	531	c.480C>T	c.(478-480)taC>taT	p.Y160Y		NM_001136213.1	NP_001129685.1	Q6S545	POTEH_HUMAN	POTE ankyrin domain family, member H	160										NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|lung(20)|ovary(1)|skin(7)|urinary_tract(2)	37						CGCTGTCGTCGTAGTCTCCCC	0.587													G|||	2	0.000399361	0.0008	0.0	5008	,	,		27678	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													129.0	139.0	135.0					22																	16287406		2033	3896	5929	-	-	-	SO:0001819	synonymous_variant	0			AY462874	CCDS74808.1	22q11.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000198062	ENSG00000198062		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	133	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 7"""	608913	"""actin, beta-like 1"", ""ANKRD26-like family C, member 3"""	ACTBL1, A26C3		10591208, 15276201, 21439273	Standard	NM_001136213		Approved	POTE22, CT104.7	uc010gqp.2	Q6S545	OTTHUMG00000140314	ENST00000343518.6:c.480C>T	22.37:g.16287406G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2CEK4|A6NCI1|A9Z1W0	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.Y160	ENST00000343518.6	37	c.480	CCDS46658.1	22																																																																																			POTEH	-	NULL	ENSG00000198062		0.587	POTEH-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEH	HGNC	protein_coding	OTTHUMT00000276918.4	379	0.26	1	G	NM_001136213		16287406	16287406	-1	no_errors	ENST00000343518	ensembl	human	known	69_37n	silent	438	17.01	90	SNP	0.000	A
PPAP2C	8612	genome.wustl.edu	37	19	287568	287568	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:287568C>T	ENST00000269812.3	-	3	437	c.388G>A	c.(388-390)Gtc>Atc	p.V130I	PPAP2C_ENST00000327790.3_Missense_Mutation_p.V151I|PPAP2C_ENST00000434325.2_Missense_Mutation_p.V74I	NM_003712.2|NM_177526.1	NP_003703.1|NP_803545.1	O43688	LPP2_HUMAN	phosphatidic acid phosphatase type 2C	130					dephosphorylation (GO:0016311)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)			breast(1)|central_nervous_system(1)|endometrium(1)|lung(1)|skin(1)	5		all_cancers(10;1.13e-36)|all_epithelial(18;1.46e-23)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;1.1e-06)|all_lung(49;1.55e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGTCGCAGACGGCTAGGAAG	0.617																																						dbGAP											0													92.0	95.0	94.0					19																	287568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035959	CCDS12023.1, CCDS12024.1, CCDS45889.1	19p13	2009-05-27				ENSG00000141934	3.1.3.4		9230	protein-coding gene	gene with protein product		607126				9570154, 9607309	Standard	NM_177543		Approved	PAP-2c, LPP2	uc002loh.3	O43688		ENST00000269812.3:c.388G>A	19.37:g.287568C>T	ENSP00000269812:p.Val130Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLV0|E9PAY8	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.V151I	ENST00000269812.3	37	c.451	CCDS12023.1	19	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617470	0.28801	.	.	ENSG00000141934	ENST00000269812;ENST00000327790;ENST00000434325	T;T;T	0.75154	-0.91;-0.91;-0.91	4.73	2.51	0.30379	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.067846	0.64402	N	0.000019	T	0.68888	0.3050	M	0.75447	2.3	0.51767	D	0.999934	B;P	0.38250	0.391;0.624	B;B	0.33254	0.16;0.083	T	0.66960	-0.5791	10	0.56958	D	0.05	-1.805	9.178	0.37123	0.0:0.7701:0.1464:0.0834	.	130;151	O43688;O43688-2	LPP2_HUMAN;.	I	130;151;74	ENSP00000269812:V130I;ENSP00000329697:V151I;ENSP00000388565:V74I	ENSP00000269812:V130I	V	-	1	0	PPAP2C	238568	0.998000	0.40836	0.075000	0.20258	0.124000	0.20399	3.804000	0.55568	0.391000	0.25143	-0.175000	0.13238	GTC	PPAP2C	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	ENSG00000141934		0.617	PPAP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2C	HGNC	protein_coding	OTTHUMT00000451777.2	37	0.00	0	C			287568	287568	-1	no_errors	ENST00000327790	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.992	T
PPIP5K1	9677	genome.wustl.edu	37	15	43831723	43831723	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:43831723A>G	ENST00000396923.3	-	29	3565	c.3444T>C	c.(3442-3444)cgT>cgC	p.R1148R	PPIP5K1_ENST00000420765.1_Silent_p.R1148R|PPIP5K1_ENST00000334933.4_Silent_p.R1123R|PPIP5K1_ENST00000360301.4_Silent_p.R1123R|PPIP5K1_ENST00000348806.6_Silent_p.R1081R|PPIP5K1_ENST00000381885.1_Silent_p.R1144R|PPIP5K1_ENST00000360135.4_Silent_p.R1081R|PPIP5K1_ENST00000381879.4_Silent_p.R1124R			Q6PFW1	VIP1_HUMAN	diphosphoinositol pentakisphosphate kinase 1	1148					inositol metabolic process (GO:0006020)|inositol phosphate metabolic process (GO:0043647)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	acid phosphatase activity (GO:0003993)|ATP binding (GO:0005524)|diphosphoinositol-pentakisphosphate kinase activity (GO:0033857)|inositol hexakisphosphate 1-kinase activity (GO:0052723)|inositol hexakisphosphate 3-kinase activity (GO:0052724)|inositol hexakisphosphate 5-kinase activity (GO:0000832)|inositol-1,3,4,5,6-pentakisphosphate kinase activity (GO:0000827)			large_intestine(1)	1						AATGAAGAGTACGTGGTGGAG	0.498																																						dbGAP											0													112.0	104.0	107.0					15																	43831723		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF502586	CCDS32215.1, CCDS45252.1, CCDS53937.1	15q15.3	2010-01-27	2010-01-26	2010-01-26	ENSG00000168781	ENSG00000168781	2.7.4.24		29023	protein-coding gene	gene with protein product		610979	"""histidine acid phosphatase domain containing 2A"""	HISPPD2A		17412958, 17690096, 18981179	Standard	NM_001190214		Approved	KIAA0377, IPS1, VIP1	uc001zrw.3	Q6PFW1	OTTHUMG00000059758	ENST00000396923.3:c.3444T>C	15.37:g.43831723A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15082|Q5HYF8|Q7Z3A7|Q86TE7|Q86UV3|Q86UV4|Q86XW8|Q8IZN0	Silent	SNP	pfam_His_Pase_superF_clade-2,superfamily_MTCP1	p.R1148	ENST00000396923.3	37	c.3444	CCDS45252.1	15																																																																																			PPIP5K1	-	NULL	ENSG00000168781		0.498	PPIP5K1-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	PPIP5K1	HGNC	protein_coding	OTTHUMT00000132907.1	553	0.18	1	A	NM_014659		43831723	43831723	-1	no_errors	ENST00000420765	ensembl	human	known	69_37n	silent	612	14.88	107	SNP	0.997	G
PRELP	5549	genome.wustl.edu	37	1	203452615	203452615	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:203452615G>A	ENST00000343110.2	+	2	430	c.303G>A	c.(301-303)ccG>ccA	p.P101P		NM_002725.3|NM_201348.1	NP_002716.1|NP_958505.1	P51888	PRELP_HUMAN	proline/arginine-rich end leucine-rich repeat protein	101					carbohydrate metabolic process (GO:0005975)|cell aging (GO:0007569)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			BRCA - Breast invasive adenocarcinoma(75;0.109)			CTGTCATCCCGCCCCGCATCC	0.562																																						dbGAP											0													88.0	86.0	87.0					1																	203452615		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC032498	CCDS1438.1	1q32	2008-02-05	2005-07-24		ENSG00000188783	ENSG00000188783		"""Proteoglycans / Extracellular Matrix : Small leucine-rich repeats"""	9357	protein-coding gene	gene with protein product	"""prolargin proteoglycan"""	601914	"""proline arginine-rich end leucine-rich repeat protein"""				Standard	NM_002725		Approved	SLRR2A, prolargin	uc001gzt.3	P51888	OTTHUMG00000035911	ENST00000343110.2:c.303G>A	1.37:g.203452615G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FG38	Silent	SNP	pfam_Leu-rich_rpt,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp	p.P101	ENST00000343110.2	37	c.303	CCDS1438.1	1																																																																																			PRELP	-	pfam_LRR-contain_N,smart_LRR-contain_N	ENSG00000188783		0.562	PRELP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRELP	HGNC	protein_coding	OTTHUMT00000087474.1	196	0.00	0	G	NM_002725		203452615	203452615	+1	no_errors	ENST00000343110	ensembl	human	known	69_37n	silent	159	34.00	85	SNP	0.000	A
PRKD3	23683	genome.wustl.edu	37	2	37507071	37507071	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:37507071T>C	ENST00000379066.1	-	8	1752	c.990A>G	c.(988-990)gaA>gaG	p.E330E	PRKD3_ENST00000234179.2_Splice_Site_p.E330E			O94806	KPCD3_HUMAN	protein kinase D3	330					intracellular signal transduction (GO:0035556)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)			breast(3)|central_nervous_system(2)|kidney(3)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33		all_hematologic(82;0.21)				GACTGGAAGGTTCTGGGAAAA	0.318																																					Melanoma(80;621 1355 8613 11814 51767)	dbGAP											0													40.0	41.0	40.0					2																	37507071		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB015982	CCDS1789.1	2p21	2013-01-10	2004-10-28	2004-10-30	ENSG00000115825	ENSG00000115825		"""Pleckstrin homology (PH) domain containing"""	9408	protein-coding gene	gene with protein product		607077	"""protein kinase C, nu"""	PRKCN		10231560	Standard	NM_005813		Approved	EPK2	uc002rqd.3	O94806	OTTHUMG00000100961	ENST00000379066.1:c.989-1A>G	2.37:g.37507071T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W587|Q53TR7|Q8NEL8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.E330	ENST00000379066.1	37	c.990	CCDS1789.1	2																																																																																			PRKD3	-	NULL	ENSG00000115825		0.318	PRKD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD3	HGNC	protein_coding	OTTHUMT00000218570.3	146	0.67	1	T	NM_005813	Silent	37507071	37507071	-1	no_errors	ENST00000234179	ensembl	human	known	69_37n	silent	136	38.22	86	SNP	0.992	C
PRRG3	79057	genome.wustl.edu	37	X	150869297	150869297	+	Frame_Shift_Del	DEL	G	G	-	rs139807152	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:150869297delG	ENST00000370353.3	+	4	878	c.488delG	c.(487-489)cggfs	p.R163fs	PRRG3_ENST00000538575.1_Frame_Shift_Del_p.R163fs			Q9BZD7	TMG3_HUMAN	proline rich Gla (G-carboxyglutamic acid) 3 (transmembrane)	163						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)	p.R163P(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(6)|ovary(3)|prostate(2)|skin(3)	24	Acute lymphoblastic leukemia(192;6.56e-05)					GGGCCCAGTCGGGGGGGCAGG	0.672																																						dbGAP											1	Substitution - Missense(1)	lung(1)											31.0	28.0	29.0					X																	150869297		2202	4297	6499	-	-	-	SO:0001589	frameshift_variant	0			AK074574	CCDS14699.1	Xq28	2008-02-05			ENSG00000130032	ENSG00000130032			30798	protein-coding gene	gene with protein product		300685				11171957	Standard	NM_024082		Approved	TMG3	uc022cgt.1	Q9BZD7	OTTHUMG00000024170	ENST00000370353.3:c.488delG	X.37:g.150869297delG	ENSP00000359378:p.Arg163fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A523|A1A575|Q8N2N6	Frame_Shift_Del	DEL	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,prints_GLA_domain,pfscan_GLA_domain	p.G165fs	ENST00000370353.3	37	c.488	CCDS14699.1	X																																																																																			PRRG3	-	NULL	ENSG00000130032		0.672	PRRG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG3	HGNC	protein_coding	OTTHUMT00000060880.1	18	0.00	0	G	NM_024082		150869297	150869297	+1	no_errors	ENST00000370353	ensembl	human	known	69_37n	frame_shift_del	24	29.41	10	DEL	0.000	-
PRSS8	5652	genome.wustl.edu	37	16	31143790	31143790	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:31143790A>C	ENST00000317508.6	-	5	928	c.665T>G	c.(664-666)gTg>gGg	p.V222G	RP11-388M20.2_ENST00000563605.1_RNA|PRSS8_ENST00000568261.1_Missense_Mutation_p.V168G	NM_002773.3	NP_002764.1	Q16651	PRSS8_HUMAN	protease, serine, 8	222	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				positive regulation of sodium ion transport (GO:0010765)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)	8						GCCAGCACACACCATGTCCTC	0.612																																						dbGAP											0													101.0	106.0	105.0					16																	31143790		2111	4218	6329	-	-	-	SO:0001583	missense	0			U33446	CCDS45469.1	16p11.2	2010-05-07	2007-02-21			ENSG00000052344		"""Serine peptidases / Serine peptidases"""	9491	protein-coding gene	gene with protein product	"""prostasin"""	600823				8838796, 7768952	Standard	NM_002773		Approved		uc002ebc.4	Q16651		ENST00000317508.6:c.665T>G	16.37:g.31143790A>C	ENSP00000319730:p.Val222Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWP2|Q9UCA3	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.V222G	ENST00000317508.6	37	c.665	CCDS45469.1	16	.	.	.	.	.	.	.	.	.	.	A	24.5	4.541202	0.85917	.	.	ENSG00000052344	ENST00000317508;ENST00000419768	D	0.89810	-2.57	5.51	5.51	0.81932	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.745300	0.11774	N	0.530794	D	0.93759	0.8005	M	0.71920	2.185	0.58432	D	0.999994	D;D	0.69078	0.997;0.997	P;D	0.65874	0.86;0.939	D	0.92425	0.5949	10	0.87932	D	0	.	14.6064	0.68481	1.0:0.0:0.0:0.0	.	168;222	B4DWP2;Q16651	.;PRSS8_HUMAN	G	222;140	ENSP00000319730:V222G	ENSP00000319730:V222G	V	-	2	0	PRSS8	31051291	0.997000	0.39634	0.998000	0.56505	0.949000	0.60115	4.018000	0.57174	2.098000	0.63641	0.459000	0.35465	GTG	PRSS8	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000052344		0.612	PRSS8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS8	HGNC	protein_coding	OTTHUMT00000433536.1	86	0.00	0	A	NM_002773		31143790	31143790	-1	no_errors	ENST00000317508	ensembl	human	known	69_37n	missense	66	39.45	43	SNP	1.000	C
PTENP1	11191	genome.wustl.edu	37	9	33675365	33675365	+	RNA	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:33675365delA	ENST00000532280.1	-	0	2132					NR_023917.1				phosphatase and tensin homolog pseudogene 1 (functional)																		TATTGCCATTAAAAAAAAAGG	0.323																																						dbGAP											0																																										-	-	-			0			AF023139, BC038293, BY797336		9p13.3	2014-09-11	2014-01-16		ENSG00000237984	ENSG00000237984		"""-"""	9589	pseudogene	pseudogene		613531	"""phosphatase and tensin homolog pseudogene 1"""			9393738, 9620558	Standard	NR_023917		Approved	PTEN2, psiPTEN, PTH2, PTEN-rs, PTENpg1	uc003zth.4		OTTHUMG00000000410		9.37:g.33675365delA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	DEL	-	NULL	ENST00000532280.1	37	NULL		9																																																																																			PTENP1	-	-	ENSG00000237984		0.323	PTENP1-002	KNOWN	basic	processed_transcript	PTENP1	HGNC	pseudogene	OTTHUMT00000395145.1	27	0.00	0	A	NR_023917		33675365	33675365	-1	no_errors	ENST00000532280	ensembl	human	known	69_37n	rna	17	26.09	6	DEL	0.998	-
PRUNE2	158471	genome.wustl.edu	37	9	79319782	79319782	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:79319782G>A	ENST00000376718.3	-	8	7531	c.7408C>T	c.(7408-7410)Ccg>Tcg	p.P2470S	PRUNE2_ENST00000428286.1_Missense_Mutation_p.P2111S	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2470					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						GCTCCTACCGGCAAATAAACG	0.493											OREG0019258	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													68.0	56.0	60.0					9																	79319782		1568	3582	5150	-	-	-	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.7408C>T	9.37:g.79319782G>A	ENSP00000365908:p.Pro2470Ser	Somatic	1190	WXS	Illumina GAIIx	Phase_IV	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.P2111S	ENST00000376718.3	37	c.6331	CCDS47982.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.065|8.065	0.768972|0.768972	0.15983|0.15983	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000426088|ENST00000376718;ENST00000428286;ENST00000422033	.|T;T	.|0.47177	.|0.85;0.86	6.08|6.08	2.17|2.17	0.27698|0.27698	.|.	.|0.227351	.|0.31624	.|N	.|0.007329	T|T	0.35335|0.35335	0.0928|0.0928	L|L	0.59436|0.59436	1.845|1.845	0.09310|0.09310	N|N	0.999997|0.999997	.|B	.|0.24721	.|0.11	.|B	.|0.16722	.|0.016	T|T	0.24119|0.24119	-1.0169|-1.0169	5|10	.|0.38643	.|T	.|0.18	-2.3853|-2.3853	2.3477|2.3477	0.04276|0.04276	0.2049:0.2354:0.4387:0.1209|0.2049:0.2354:0.4387:0.1209	.|.	.|2470	.|Q8WUY3	.|PRUN2_HUMAN	V|S	1791|2470;2111;2469	.|ENSP00000365908:P2470S;ENSP00000397425:P2111S	.|ENSP00000365908:P2470S	A|P	-|-	2|1	0|0	PRUNE2|PRUNE2	78509602|78509602	0.516000|0.516000	0.26218|0.26218	0.049000|0.049000	0.19019|0.19019	0.025000|0.025000	0.11179|0.11179	1.012000|1.012000	0.29924|0.29924	0.434000|0.434000	0.26340|0.26340	0.655000|0.655000	0.94253|0.94253	GCC|CCG	PRUNE2	-	NULL	ENSG00000106772		0.493	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	168	0.00	0	G	NM_138818		79319782	79319782	-1	no_errors	ENST00000428286	ensembl	human	known	69_37n	missense	101	37.27	60	SNP	0.001	A
PTPRF	5792	genome.wustl.edu	37	1	44069494	44069494	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:44069494C>T	ENST00000359947.4	+	16	3011	c.2671C>T	c.(2671-2673)Cgg>Tgg	p.R891W	PTPRF_ENST00000372414.3_Missense_Mutation_p.R891W|PTPRF_ENST00000438120.1_Missense_Mutation_p.R882W|PTPRF_ENST00000422171.2_Missense_Mutation_p.R239W|PTPRF_ENST00000372413.3_Missense_Mutation_p.R882W|PTPRF_ENST00000496447.1_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	891	Fibronectin type-III 6. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTACATCTTCCGGCTTGCTGC	0.627																																						dbGAP											0													54.0	57.0	56.0					1																	44069494		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.2671C>T	1.37:g.44069494C>T	ENSP00000353030:p.Arg891Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.R891W	ENST00000359947.4	37	c.2671	CCDS489.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.41|17.41	3.381402|3.381402	0.61845|0.61845	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000414879|ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171	.|T;T;T;T;T	.|0.60920	.|0.15;0.15;0.15;0.15;0.15	5.03|5.03	1.92|1.92	0.25849|0.25849	.|Fibronectin, type III (4);Immunoglobulin-like fold (1);	.|0.000000	.|0.31519	.|N	.|0.007514	T|T	0.71341|0.71341	0.3328|0.3328	M|M	0.83953|0.83953	2.67|2.67	0.42561|0.42561	D|D	0.993145|0.993145	.|D;D;D;D	.|0.76494	.|0.999;0.994;0.986;0.995	.|D;P;P;P	.|0.76071	.|0.987;0.806;0.534;0.863	T|T	0.70182|0.70182	-0.4942|-0.4942	5|10	.|0.72032	.|D	.|0.01	.|.	5.0178|5.0178	0.14345|0.14345	0.3145:0.5066:0.0:0.1788|0.3145:0.5066:0.0:0.1788	.|.	.|536;239;882;891	.|Q59FI2;F2Z3B8;P10586-2;P10586	.|.;.;.;PTPRF_HUMAN	L|W	304|891;882;891;882;239	.|ENSP00000353030:R891W;ENSP00000398822:R882W;ENSP00000361491:R891W;ENSP00000361490:R882W;ENSP00000387885:R239W	.|ENSP00000353030:R891W	P|R	+|+	2|1	0|2	PTPRF|PTPRF	43842081|43842081	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.930000|0.930000	0.56654|0.56654	2.785000|2.785000	0.47782|0.47782	0.639000|0.639000	0.30564|0.30564	0.655000|0.655000	0.94253|0.94253	CCG|CGG	PTPRF	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000142949		0.627	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	24	0.00	0	C			44069494	44069494	+1	no_errors	ENST00000359947	ensembl	human	known	69_37n	missense	19	44.44	16	SNP	1.000	T
PUS7	54517	genome.wustl.edu	37	7	105148864	105148864	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:105148864delT	ENST00000356362.2	-	2	310	c.96delA	c.(94-96)aaafs	p.K32fs	PUS7_ENST00000469408.1_Frame_Shift_Del_p.K32fs	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	32					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						ACAGCTTCTGTTTTTTTGTCT	0.478																																					Colon(138;2387 3051 17860)	dbGAP											0													221.0	193.0	202.0					7																	105148864		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.96delA	7.37:g.105148864delT	ENSP00000348722:p.Lys32fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MG4|Q9NX19	Frame_Shift_Del	DEL	pfam_PsdUridine_synth_TruD,superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk,pfscan_PsdUridine_synth_TruD_insert,tigrfam_PsdUridine_synth_TruD	p.K32fs	ENST00000356362.2	37	c.96	CCDS34725.1	7																																																																																			PUS7	-	pirsf_PsdUridine_synth_TruD_euk	ENSG00000091127		0.478	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PUS7	HGNC	protein_coding	OTTHUMT00000348681.1	437	0.00	0	T	NM_019042		105148864	105148864	-1	no_errors	ENST00000356362	ensembl	human	known	69_37n	frame_shift_del	339	34.16	180	DEL	0.986	-
QRICH2	84074	genome.wustl.edu	37	17	74278024	74278024	+	Missense_Mutation	SNP	C	C	T	rs554427852		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:74278024C>T	ENST00000262765.5	-	8	3865	c.3686G>A	c.(3685-3687)cGg>cAg	p.R1229Q		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1229										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CTCATAGCGCCGCACCAGCGT	0.647													C|||	1	0.000199681	0.0	0.0	5008	,	,		22112	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													62.0	50.0	54.0					17																	74278024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3686G>A	17.37:g.74278024C>T	ENSP00000262765:p.Arg1229Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.R1229Q	ENST00000262765.5	37	c.3686	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	C	0.018	-1.466503	0.01053	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.37235	3.54;1.21	5.55	0.811	0.18739	.	.	.	.	.	T	0.10508	0.0257	N	0.01874	-0.695	0.20873	N	0.99984	B;B	0.13594	0.008;0.001	B;B	0.04013	0.001;0.001	T	0.33599	-0.9862	9	0.02654	T	1	-1.3993	5.481	0.16723	0.0:0.2155:0.1343:0.6502	.	1229;1229	B5MD94;Q9H0J4	.;QRIC2_HUMAN	Q	1229;237;1229	ENSP00000262765:R1229Q;ENSP00000394461:R237Q	ENSP00000262765:R1229Q	R	-	2	0	QRICH2	71789619	0.998000	0.40836	0.947000	0.38551	0.035000	0.12851	0.701000	0.25616	-0.154000	0.11118	-2.282000	0.00269	CGG	QRICH2	-	NULL	ENSG00000129646		0.647	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	40	0.00	0	C	NM_032134		74278024	74278024	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.890	T
R3HDM4	91300	genome.wustl.edu	37	19	900926	900926	+	Silent	SNP	G	G	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:900926G>T	ENST00000361574.5	-	4	451	c.378C>A	c.(376-378)tcC>tcA	p.S126S	R3HDM4_ENST00000587975.1_Silent_p.S105S	NM_138774.3	NP_620129.2	Q96D70	R3HD4_HUMAN	R3H domain containing 4	126						nucleus (GO:0005634)	nucleic acid binding (GO:0003676)										GCTCCTCCCCGGAGCGGTTCA	0.657																																						dbGAP											0													22.0	24.0	23.0					19																	900926		2198	4296	6494	-	-	-	SO:0001819	synonymous_variant	0			BC012775	CCDS12048.1	19p13.3	2011-11-23	2011-11-23	2011-11-23	ENSG00000198858	ENSG00000198858			28270	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 22"""	C19orf22		12477932	Standard	NM_138774		Approved	MGC16353	uc002lqg.2	Q96D70		ENST00000361574.5:c.378C>A	19.37:g.900926G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfscan_R3H_ss-bd	p.S126	ENST00000361574.5	37	c.378	CCDS12048.1	19																																																																																			R3HDM4	-	NULL	ENSG00000198858		0.657	R3HDM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	R3HDM4	HGNC	protein_coding	OTTHUMT00000458209.1	22	0.00	0	G	NM_138774		900926	900926	-1	no_errors	ENST00000361574	ensembl	human	known	69_37n	silent	16	33.33	8	SNP	0.267	T
RAB11A	8766	genome.wustl.edu	37	15	66180167	66180167	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:66180167C>T	ENST00000261890.2	+	5	768	c.640C>T	c.(640-642)Cag>Tag	p.Q214*	RAB11A_ENST00000564910.1_Nonsense_Mutation_p.Q144*|RAB11A_ENST00000569896.1_3'UTR|RAB11A_ENST00000565075.1_Nonsense_Mutation_p.Q196*	NM_001206836.1|NM_004663.4	NP_001193765.1|NP_004654.1	P62491	RB11A_HUMAN	RAB11A, member RAS oncogene family	214					cytokinesis (GO:0000910)|establishment of protein localization to membrane (GO:0090150)|exosomal secretion (GO:1990182)|GTP catabolic process (GO:0006184)|melanosome transport (GO:0032402)|multivesicular body assembly (GO:0036258)|neuron projection development (GO:0031175)|plasma membrane to endosome transport (GO:0048227)|positive regulation of axon extension (GO:0045773)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of multivesicular body size (GO:0010796)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	axon (GO:0030424)|cleavage furrow (GO:0032154)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|multivesicular body (GO:0005771)|perinuclear region of cytoplasm (GO:0048471)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|recycling endosome (GO:0055037)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|syntaxin binding (GO:0019905)			kidney(1)|large_intestine(2)|lung(1)|prostate(1)	5						GCAGTGCTGTCAGAACATCTA	0.413																																						dbGAP											0													136.0	126.0	130.0					15																	66180167		2201	4299	6500	-	-	-	SO:0001587	stop_gained	0			X56740	CCDS10212.1, CCDS58373.1	15q22.31	2008-05-14			ENSG00000103769	ENSG00000103769		"""RAB, member RAS oncogene"""	9760	protein-coding gene	gene with protein product		605570				1704119, 9662449	Standard	NM_004663		Approved	YL8	uc002apk.3	P62491	OTTHUMG00000133162	ENST00000261890.2:c.640C>T	15.37:g.66180167C>T	ENSP00000261890:p.Gln214*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4B6|B4DT13|P24410|Q5TZN9|Q9JLX1	Nonsense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q214*	ENST00000261890.2	37	c.640	CCDS10212.1	15	.	.	.	.	.	.	.	.	.	.	C	19.67	3.870215	0.72065	.	.	ENSG00000103769	ENST00000261890	.	.	.	5.45	5.45	0.79879	.	0.163049	0.56097	D	0.000029	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	.	19.3	0.94140	0.0:1.0:0.0:0.0	.	.	.	.	X	214	.	ENSP00000261890:Q214X	Q	+	1	0	RAB11A	63967221	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.547000	0.85894	0.655000	0.94253	CAG	RAB11A	-	smart_Ran_GTPase	ENSG00000103769		0.413	RAB11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11A	HGNC	protein_coding	OTTHUMT00000256864.1	166	0.00	0	C			66180167	66180167	+1	no_errors	ENST00000261890	ensembl	human	known	69_37n	nonsense	142	20.22	36	SNP	1.000	T
RAD9A	5883	genome.wustl.edu	37	11	67163284	67163286	+	In_Frame_Del	DEL	GAG	GAG	-	rs201034834		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	GAG	GAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:67163284_67163286delGAG	ENST00000307980.2	+	6	640_642	c.547_549delGAG	c.(547-549)gagdel	p.E185del	PPP1CA_ENST00000532446.1_5'Flank|RAD9A_ENST00000535644.1_3'UTR|RNU6-1238P_ENST00000517215.1_RNA	NM_001243224.1|NM_004584.2	NP_001230153.1|NP_004575.1	Q99638	RAD9A_HUMAN	RAD9 homolog A (S. pombe)	185					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|intra-S DNA damage checkpoint (GO:0031573)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902231)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|enzyme binding (GO:0019899)|exodeoxyribonuclease III activity (GO:0008853)|histone deacetylase binding (GO:0042826)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			lung(7)|upper_aerodigestive_tract(1)	8			BRCA - Breast invasive adenocarcinoma(15;8.53e-07)			CAGCTACCACGAGGAGGAGGCAG	0.66								Other conserved DNA damage response genes																														dbGAP											0										0,4264		0,0,2132						0.1	1.0			36	9,8245		0,9,4118	no	coding	RAD9A	NM_004584.2		0,9,6250	A1A1,A1R,RR		0.109,0.0,0.0719				9,12509				-	-	-	SO:0001651	inframe_deletion	0			U53174	CCDS8159.1	11q13.1-q13.2	2008-02-05	2003-07-21	2003-07-23	ENSG00000172613	ENSG00000172613			9827	protein-coding gene	gene with protein product		603761	"""RAD9 (S. pombe) homolog"""	RAD9		8943031	Standard	NM_004584		Approved		uc001okr.3	Q99638	OTTHUMG00000167670	ENST00000307980.2:c.547_549delGAG	11.37:g.67163290_67163292delGAG	ENSP00000311360:p.Glu185del	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCZ8|Q6FI29|Q96C41	In_Frame_Del	DEL	pfam_Rad9,pirsf_Cell_cycle_RAD9	p.E185in_frame_del	ENST00000307980.2	37	c.547_549	CCDS8159.1	11																																																																																			RAD9A	-	pfam_Rad9,pirsf_Cell_cycle_RAD9	ENSG00000172613		0.660	RAD9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD9A	HGNC	protein_coding	OTTHUMT00000395481.2	35	0.00	0	GAG	NM_004584		67163284	67163286	+1	no_errors	ENST00000307980	ensembl	human	known	69_37n	in_frame_del	31	16.22	6	DEL	1.000:1.000:0.998	-
RFX6	222546	genome.wustl.edu	37	6	117248313	117248313	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:117248313C>A	ENST00000332958.2	+	17	2025	c.2009C>A	c.(2008-2010)cCa>cAa	p.P670Q		NM_173560.3	NP_775831.2	Q8HWS3	RFX6_HUMAN	regulatory factor X, 6	670					endocrine pancreas development (GO:0031018)|glucose homeostasis (GO:0042593)|pancreatic A cell differentiation (GO:0003310)|pancreatic D cell differentiation (GO:0003311)|pancreatic epsilon cell differentiation (GO:0090104)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of insulin secretion (GO:0050796)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell differentiation (GO:0003309)	nucleus (GO:0005634)	transcription regulatory region DNA binding (GO:0044212)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(29)|ovary(1)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	59						AGTGTGGGCCCAGTACTGTCA	0.532																																						dbGAP											0													142.0	133.0	137.0					6																	117248313		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC039248	CCDS5113.1	6q22.31	2008-08-04	2008-08-04	2008-08-04	ENSG00000185002	ENSG00000185002			21478	protein-coding gene	gene with protein product		612659	"""regulatory factor X domain containing 1"""	RFXDC1			Standard	NM_173560		Approved	MGC33442, dJ955L16.1	uc003pxm.3	Q8HWS3	OTTHUMG00000015449	ENST00000332958.2:c.2009C>A	6.37:g.117248313C>A	ENSP00000332208:p.Pro670Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6B3	Missense_Mutation	SNP	pfam_DNA-bd_RFX	p.P670Q	ENST00000332958.2	37	c.2009	CCDS5113.1	6	.	.	.	.	.	.	.	.	.	.	C	10.99	1.507299	0.27036	.	.	ENSG00000185002	ENST00000332958	T	0.55413	0.52	5.68	4.73	0.59995	.	0.558936	0.20589	N	0.089387	T	0.19005	0.0456	N	0.04880	-0.145	0.09310	N	0.999992	B	0.17465	0.022	B	0.12156	0.007	T	0.19910	-1.0291	10	0.54805	T	0.06	-1.9504	16.6031	0.84821	0.1564:0.8436:0.0:0.0	.	670	Q8HWS3	RFX6_HUMAN	Q	670	ENSP00000332208:P670Q	ENSP00000332208:P670Q	P	+	2	0	RFX6	117355006	0.378000	0.25114	0.026000	0.17262	0.931000	0.56810	4.091000	0.57700	2.682000	0.91365	0.655000	0.94253	CCA	RFX6	-	NULL	ENSG00000185002		0.532	RFX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX6	HGNC	protein_coding	OTTHUMT00000041970.2	193	0.00	0	C	NM_173560		117248313	117248313	+1	no_errors	ENST00000332958	ensembl	human	known	69_37n	missense	74	25.25	25	SNP	0.126	A
RHOT1	55288	genome.wustl.edu	37	17	30521111	30521111	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:30521111A>G	ENST00000333942.6	+	11	1093	c.854A>G	c.(853-855)gAa>gGa	p.E285G	RHOT1_ENST00000581094.1_Missense_Mutation_p.E285G|RHOT1_ENST00000394692.2_Missense_Mutation_p.E285G|RHOT1_ENST00000583994.1_Missense_Mutation_p.E158G|RHOT1_ENST00000580976.1_3'UTR|RHOT1_ENST00000354266.3_Missense_Mutation_p.E264G|RHOT1_ENST00000545287.2_Missense_Mutation_p.E285G|RHOT1_ENST00000358365.3_Missense_Mutation_p.E285G	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	285					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				TTGACACCTGAATATTTGTTC	0.388																																						dbGAP											0													472.0	461.0	465.0					17																	30521111		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.854A>G	17.37:g.30521111A>G	ENSP00000334724:p.Glu285Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	pfam_MIRO-like,pfam_EF_hand_assoc_2,pfam_EF_hand_assoc_1,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_EF_hand_Ca-bd,pirsf_Small_GTPase_Miro,pfscan_EF_HAND_2,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E285G	ENST00000333942.6	37	c.854	CCDS32612.1	17	.	.	.	.	.	.	.	.	.	.	A	15.85	2.954922	0.53293	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942	T;T;T	0.46451	0.87;0.87;0.87	5.97	5.97	0.96955	EF hand associated, type-2 (1);	0.089012	0.85682	D	0.000000	T	0.50034	0.1592	L	0.54323	1.7	0.80722	D	1	P;P;P;P	0.44521	0.486;0.776;0.735;0.837	B;P;B;P	0.47941	0.273;0.515;0.287;0.562	T	0.52064	-0.8625	10	0.72032	D	0.01	-13.4634	16.4383	0.83889	1.0:0.0:0.0:0.0	.	285;285;285;285	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	G	285	ENSP00000351132:E285G;ENSP00000378184:E285G;ENSP00000334724:E285G	ENSP00000334724:E285G	E	+	2	0	RHOT1	27545224	1.000000	0.71417	0.970000	0.41538	0.995000	0.86356	9.339000	0.96797	2.287000	0.76781	0.482000	0.46254	GAA	RHOT1	-	pfam_EF_hand_assoc_2,pirsf_Small_GTPase_Miro	ENSG00000126858		0.388	RHOT1-001	KNOWN	basic|CCDS	protein_coding	RHOT1	HGNC	protein_coding	OTTHUMT00000447097.1	697	0.14	1	A	NM_018307		30521111	30521111	+1	no_errors	ENST00000358365	ensembl	human	known	69_37n	missense	606	34.56	320	SNP	1.000	G
RIN2	54453	genome.wustl.edu	37	20	19915793	19915793	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr20:19915793G>A	ENST00000255006.6	+	3	404	c.255G>A	c.(253-255)gtG>gtA	p.V85V	RIN2_ENST00000484638.1_3'UTR|RIN2_ENST00000440354.2_Silent_p.V36V	NM_001242581.1|NM_018993.3	NP_001229510.1|NP_061866.1	Q8WYP3	RIN2_HUMAN	Ras and Rab interactor 2	36					endocytosis (GO:0006897)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of catalytic activity (GO:0050790)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	GTPase activator activity (GO:0005096)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(11)|ovary(1)|prostate(1)|urinary_tract(2)	27						AGGAGATGGTGCGGACAGATG	0.507																																						dbGAP											0													75.0	74.0	74.0					20																	19915793		2003	4168	6171	-	-	-	SO:0001819	synonymous_variant	0			AB060339	CCDS56182.1	20p11.22	2008-07-30			ENSG00000132669	ENSG00000132669			18750	protein-coding gene	gene with protein product		610222				11733506, 1849280, 16423831	Standard	NM_018993		Approved	RASSF4	uc002wro.2	Q8WYP3	OTTHUMG00000031996	ENST00000255006.6:c.255G>A	20.37:g.19915793G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q00425|Q5TFT8|Q9BQL3|Q9H071	Silent	SNP	pfam_VPS9,pfam_Ras-assoc,smart_VPS9_subgr,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SH2,pfscan_VPS9	p.V85	ENST00000255006.6	37	c.255	CCDS56182.1	20																																																																																			RIN2	-	NULL	ENSG00000132669		0.507	RIN2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RIN2	HGNC	protein_coding	OTTHUMT00000078212.1	185	0.00	0	G			19915793	19915793	+1	no_errors	ENST00000255006	ensembl	human	known	69_37n	silent	147	34.67	78	SNP	1.000	A
RNF113B	140432	genome.wustl.edu	37	13	98828674	98828674	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr13:98828674G>A	ENST00000267291.6	-	1	845	c.817C>T	c.(817-819)Cat>Tat	p.H273Y	FARP1_ENST00000595437.1_Intron|FARP1_ENST00000376581.5_Intron|FARP1_ENST00000376586.2_Intron|FARP1_ENST00000319562.6_Intron	NM_178861.4	NP_849192.1	Q8IZP6	R113B_HUMAN	ring finger protein 113B	273							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)		BRCA - Breast invasive adenocarcinoma(86;0.13)			CAGAAATAATGCCTGCACTTG	0.562																																						dbGAP											0													122.0	124.0	124.0					13																	98828674		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF539427	CCDS9486.1	13q32.2	2006-08-22	2005-03-22	2005-03-22	ENSG00000139797	ENSG00000139797		"""RING-type (C3HC4) zinc fingers"""	17267	protein-coding gene	gene with protein product			"""zinc finger protein 183-like 1"""	ZNF183L1			Standard	NM_178861		Approved	RNF161	uc001vnk.3	Q8IZP6	OTTHUMG00000017245	ENST00000267291.6:c.817C>T	13.37:g.98828674G>A	ENSP00000267291:p.His273Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WWF9|Q96QY9	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.H273Y	ENST00000267291.6	37	c.817	CCDS9486.1	13	.	.	.	.	.	.	.	.	.	.	G	16.97	3.269145	0.59540	.	.	ENSG00000139797	ENST00000267291	D	0.93133	-3.17	1.39	1.39	0.22231	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type, conserved site (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.000000	0.85682	U	0.000000	D	0.98055	0.9359	H	0.99929	4.97	0.48901	D	0.999728	D	0.89917	1.0	D	0.97110	1.0	D	0.96069	0.9044	10	0.87932	D	0	.	8.6969	0.34301	0.0:0.0:1.0:0.0	.	273	Q8IZP6	R113B_HUMAN	Y	273	ENSP00000267291:H273Y	ENSP00000267291:H273Y	H	-	1	0	RNF113B	97626675	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.027000	0.57239	1.074000	0.40909	0.591000	0.81541	CAT	RNF113B	-	smart_Znf_RING,pfscan_Znf_RING	ENSG00000139797		0.562	RNF113B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF113B	HGNC	protein_coding	OTTHUMT00000045536.3	173	0.00	0	G	NM_178861		98828674	98828674	-1	no_errors	ENST00000267291	ensembl	human	known	69_37n	missense	142	36.32	81	SNP	1.000	A
RP1L1	94137	genome.wustl.edu	37	8	10470757	10470757	+	Frame_Shift_Del	DEL	G	G	-	rs74594406	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:10470757delG	ENST00000382483.3	-	4	1074	c.851delC	c.(850-852)ccgfs	p.P284fs		NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	284					cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)				breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		AGGGCCCACCGGGGGGTTGCT	0.662																																						dbGAP											0													57.0	63.0	61.0					8																	10470757		1951	4139	6090	-	-	-	SO:0001589	frameshift_variant	0			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.851delC	8.37:g.10470757delG	ENSP00000371923:p.Pro284fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Frame_Shift_Del	DEL	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.P284fs	ENST00000382483.3	37	c.851	CCDS43708.1	8																																																																																			RP1L1	-	NULL	ENSG00000183638		0.662	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	20	0.00	0	G			10470757	10470757	-1	no_errors	ENST00000382483	ensembl	human	known	69_37n	frame_shift_del	23	30.30	10	DEL	0.000	-
RPGR	6103	genome.wustl.edu	37	X	38145271	38145272	+	Intron	INS	-	-	CCC			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:38145271_38145272insCCC	ENST00000339363.3	-	14	2688				TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000378505.2_In_Frame_Ins_p.993_994insG|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000318842.7_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000309513.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						ttcttccccttcctcctcttcc	0.609																																						dbGAP											0									,	22,3370		0,22,0,1474,400					,	-0.6	0.0			12	50,5822		2,31,15,2183,1425	no	coding,intron	RPGR	NM_001034853.1,NM_000328.2	,	2,53,15,3657,1825	A1A1,A1R,A1,RR,R		0.8515,0.6486,0.7772	,	,		72,9192				-	-	-	SO:0001627	intron_variant	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+1074->GGG	X.37:g.38145271_38145272insCCC		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	In_Frame_Ins	INS	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.994in_frame_insG	ENST00000339363.3	37	c.2981_2980		X																																																																																			RPGR	-	NULL	ENSG00000156313		0.609	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		54	0.00	0	-	NM_000328		38145271	38145272	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	in_frame_ins	29	12.12	4	INS	0.060:0.135	CCC
RPLP0P2	113157	genome.wustl.edu	37	11	61404625	61404625	+	RNA	SNP	G	G	A	rs191031264	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:61404625G>A	ENST00000496593.1	+	0	1229					NR_002775.2				ribosomal protein, large, P0 pseudogene 2																		TGAGTGATGCGCAGCTGATCA	0.547													G|||	2	0.000399361	0.0008	0.0014	5008	,	,		19399	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			BC010523		11q12.2	2014-08-07			ENSG00000243742	ENSG00000243742		"""L ribosomal proteins"""	17960	pseudogene	pseudogene						19123937, 25089627	Standard	NR_002775		Approved		uc001nrz.1		OTTHUMG00000158396		11.37:g.61404625G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000496593.1	37	NULL		11																																																																																			RPLP0P2	-	-	ENSG00000243742		0.547	RPLP0P2-002	KNOWN	basic	processed_transcript	RPLP0P2	HGNC	pseudogene	OTTHUMT00000350911.1	81	0.00	0	G	NR_002775		61404625	61404625	+1	no_errors	ENST00000496593	ensembl	human	known	69_37n	rna	69	36.11	39	SNP	0.997	A
RPS5	6193	genome.wustl.edu	37	19	58904783	58904783	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:58904783A>G	ENST00000596046.1	+	3	1225	c.376A>G	c.(376-378)Aca>Gca	p.T126A	RPS5_ENST00000196551.3_Missense_Mutation_p.T126A|RPS5_ENST00000598495.1_Missense_Mutation_p.T147A|RPS5_ENST00000598098.1_Missense_Mutation_p.T56A|RPS5_ENST00000601521.1_Missense_Mutation_p.T126A|AC012313.1_ENST00000601382.1_5'Flank			P46782	RS5_HUMAN	ribosomal protein S5	126					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational fidelity (GO:0006450)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			cervix(1)|large_intestine(1)|lung(1)|prostate(1)	4		all_cancers(17;1.71e-22)|all_epithelial(17;1.69e-16)|Lung NSC(17;2.25e-06)|all_lung(17;9.97e-06)|Colorectal(82;3.46e-05)|Renal(17;0.00179)|all_neural(62;0.00607)|Breast(46;0.0194)|Ovarian(87;0.0443)|Medulloblastoma(540;0.184)		UCEC - Uterine corpus endometrioid carcinoma (67;0.171)|GBM - Glioblastoma multiforme(193;0.0323)|Lung(386;0.0543)|LUSC - Lung squamous cell carcinoma(496;0.176)		GGAGGACTCCACACGCATTGG	0.627																																						dbGAP											0													91.0	76.0	81.0					19																	58904783		2203	4300	6503	-	-	-	SO:0001583	missense	0			U14970	CCDS12978.1	19q13.4	2011-04-05				ENSG00000083845		"""S ribosomal proteins"""	10426	protein-coding gene	gene with protein product	"""40S ribosomal protein S5"""	603630				7772601, 9582194	Standard	NM_001009		Approved	S5	uc002qsn.3	P46782		ENST00000596046.1:c.376A>G	19.37:g.58904783A>G	ENSP00000472985:p.Thr126Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4T2|Q96BN0	Missense_Mutation	SNP	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom,tigrfam_Ribosomal_S5/S7_euk/arc	p.T126A	ENST00000596046.1	37	c.376	CCDS12978.1	19	.	.	.	.	.	.	.	.	.	.	A	14.19	2.460549	0.43736	.	.	ENSG00000083845	ENST00000196551	.	.	.	4.78	4.78	0.61160	Ribosomal protein S7 domain (3);	0.000000	0.85682	D	0.000000	T	0.78355	0.4270	M	0.90019	3.08	0.80722	D	1	D	0.54964	0.969	P	0.56474	0.799	D	0.83429	0.0037	9	0.87932	D	0	-31.9595	12.5727	0.56347	1.0:0.0:0.0:0.0	.	126	P46782	RS5_HUMAN	A	126	.	ENSP00000196551:T126A	T	+	1	0	RPS5	63596595	1.000000	0.71417	0.640000	0.29408	0.783000	0.44284	7.934000	0.87649	1.934000	0.56057	0.533000	0.62120	ACA	RPS5	-	pfam_Ribosomal_S7_dom,superfamily_Ribosomal_S7_dom,tigrfam_Ribosomal_S5/S7_euk/arc	ENSG00000083845		0.627	RPS5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPS5	HGNC	protein_coding	OTTHUMT00000467016.1	41	0.00	0	A	NM_001009		58904783	58904783	+1	no_errors	ENST00000196551	ensembl	human	known	69_37n	missense	37	13.64	6	SNP	0.992	G
RTTN	25914	genome.wustl.edu	37	18	67698148	67698148	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr18:67698148C>A	ENST00000255674.6	-	41	5897	c.5611G>T	c.(5611-5613)Gct>Tct	p.A1871S	RTTN_ENST00000579986.1_5'UTR|RTTN_ENST00000454359.1_3'UTR	NM_173630.3	NP_775901.3	Q86VV8	RTTN_HUMAN	rotatin	1871					determination of left/right symmetry (GO:0007368)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(9)|lung(35)|ovary(4)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Esophageal squamous(42;0.129)				CTACTGACAGCCAGCAGTGAC	0.398																																						dbGAP											0													147.0	139.0	142.0					18																	67698148		1981	4185	6166	-	-	-	SO:0001583	missense	0			AL117635	CCDS42443.1	18q22.1	2008-08-01				ENSG00000176225			18654	protein-coding gene	gene with protein product		610436				11900971	Standard	NM_173630		Approved	DKFZP434G145	uc002lkp.2	Q86VV8		ENST00000255674.6:c.5611G>T	18.37:g.67698148C>A	ENSP00000255674:p.Ala1871Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68CS9|Q6ZRL8|Q6ZTK3|Q86TG4|Q8N8N8|Q8TBQ4|Q96IN9|Q9UFJ4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.A1871S	ENST00000255674.6	37	c.5611	CCDS42443.1	18	.	.	.	.	.	.	.	.	.	.	C	23.5	4.428546	0.83667	.	.	ENSG00000176225	ENST00000255674	T	0.51325	0.71	5.17	5.17	0.71159	Armadillo-like helical (1);	0.110744	0.64402	D	0.000011	T	0.54367	0.1854	L	0.46157	1.445	0.80722	D	1	D	0.52996	0.957	P	0.51918	0.684	T	0.56450	-0.7977	10	0.54805	T	0.06	.	17.4437	0.87573	0.0:1.0:0.0:0.0	.	1871	Q86VV8	RTTN_HUMAN	S	1871	ENSP00000255674:A1871S	ENSP00000255674:A1871S	A	-	1	0	RTTN	65849128	1.000000	0.71417	0.994000	0.49952	0.892000	0.51952	5.179000	0.65043	2.415000	0.81967	0.591000	0.81541	GCT	RTTN	-	superfamily_ARM-type_fold	ENSG00000176225		0.398	RTTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTTN	HGNC	protein_coding	OTTHUMT00000442988.1	272	0.00	0	C	NM_173630		67698148	67698148	-1	no_errors	ENST00000255674	ensembl	human	known	69_37n	missense	207	32.35	99	SNP	1.000	A
RWDD2A	112611	genome.wustl.edu	37	6	83904358	83904358	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:83904358T>C	ENST00000369724.4	+	2	393	c.188T>C	c.(187-189)aTt>aCt	p.I63T	RWDD2A_ENST00000539997.1_5'UTR|PGM3_ENST00000512866.1_5'Flank|PGM3_ENST00000283977.4_5'Flank|PGM3_ENST00000506587.1_5'Flank|PGM3_ENST00000513973.1_5'Flank	NM_033411.3	NP_219479.2	Q9UIY3	RWD2A_HUMAN	RWD domain containing 2A	63	RWD. {ECO:0000255|PROSITE- ProRule:PRU00179}.									cervix(1)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	5		all_cancers(76;2.38e-06)|Acute lymphoblastic leukemia(125;3.41e-06)|all_hematologic(105;0.000865)|all_epithelial(107;0.00217)		BRCA - Breast invasive adenocarcinoma(397;0.045)		ACACTCCAGATTGAAGAGCCC	0.408																																						dbGAP											0													77.0	76.0	77.0					6																	83904358		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC010930	CCDS4998.1	6q15	2012-12-07	2007-07-17	2007-07-17	ENSG00000013392	ENSG00000013392			21385	protein-coding gene	gene with protein product			"""RWD domain containing 2"""	RWDD2			Standard	NM_033411		Approved	MGC13523, dJ747H23.2	uc003pjx.4	Q9UIY3	OTTHUMG00000015109	ENST00000369724.4:c.188T>C	6.37:g.83904358T>C	ENSP00000358739:p.Ile63Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIQ3|E1P548|Q2M3R3|Q96FH1	Missense_Mutation	SNP	pfam_DUF1115,pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pirsf_UCP038021_RWD,pfscan_RWD-domain	p.I63T	ENST00000369724.4	37	c.188	CCDS4998.1	6	.	.	.	.	.	.	.	.	.	.	T	19.76	3.886932	0.72410	.	.	ENSG00000013392	ENST00000369724	T	0.19938	2.11	4.31	4.31	0.51392	Ubiquitin-conjugating enzyme/RWD-like (2);RWD domain (3);	0.176762	0.40469	N	0.001100	T	0.31167	0.0788	L	0.48642	1.525	0.80722	D	1	P	0.35307	0.494	D	0.67231	0.95	T	0.05402	-1.0887	10	0.36615	T	0.2	-19.0881	13.6856	0.62513	0.0:0.0:0.0:1.0	.	63	Q9UIY3	RWD2A_HUMAN	T	63	ENSP00000358739:I63T	ENSP00000358739:I63T	I	+	2	0	RWDD2A	83961077	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.037000	0.70956	2.168000	0.68352	0.533000	0.62120	ATT	RWDD2A	-	pfam_RWD-domain,superfamily_UBQ-conjugating_enzyme/RWD,smart_RWD-domain,pirsf_UCP038021_RWD,pfscan_RWD-domain	ENSG00000013392		0.408	RWDD2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RWDD2A	HGNC	protein_coding	OTTHUMT00000041348.2	119	0.00	0	T	NM_033411		83904358	83904358	+1	no_errors	ENST00000369724	ensembl	human	known	69_37n	missense	176	11.56	23	SNP	1.000	C
SALL4	57167	genome.wustl.edu	37	20	50400983	50400983	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr20:50400983delC	ENST00000217086.4	-	4	3094	c.2983delG	c.(2983-2985)gttfs	p.V995fs	SALL4_ENST00000371539.3_Frame_Shift_Del_p.V218fs|SALL4_ENST00000395997.3_Frame_Shift_Del_p.V558fs	NM_020436.3	NP_065169.1	Q9UJQ4	SALL4_HUMAN	spalt-like transcription factor 4	995					embryonic limb morphogenesis (GO:0030326)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(27)|ovary(5)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						AGGGTAGGAACCCCCCCACTC	0.562																																						dbGAP											0													74.0	70.0	72.0					20																	50400983		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK001666	CCDS13438.1	20q13.2	2014-09-17	2013-10-17		ENSG00000101115	ENSG00000101115		"""Zinc fingers, C2H2-type"""	15924	protein-coding gene	gene with protein product		607343	"""sal (Drosophila)-like 4"", ""sal-like 4 (Drosophila)"""				Standard	NM_020436		Approved	dJ1112F19.1, ZNF797	uc002xwh.4	Q9UJQ4	OTTHUMG00000032752	ENST00000217086.4:c.2983delG	20.37:g.50400983delC	ENSP00000217086:p.Val995fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2D8|Q540H3|Q6Y8G6	Frame_Shift_Del	DEL	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V995fs	ENST00000217086.4	37	c.2983	CCDS13438.1	20																																																																																			SALL4	-	NULL	ENSG00000101115		0.562	SALL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SALL4	HGNC	protein_coding	OTTHUMT00000079738.3	112	0.00	0	C			50400983	50400983	-1	no_errors	ENST00000217086	ensembl	human	known	69_37n	frame_shift_del	90	35.92	51	DEL	0.001	-
SAMD15	161394	genome.wustl.edu	37	14	77845125	77845125	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr14:77845125T>A	ENST00000216471.4	+	1	1650	c.1364T>A	c.(1363-1365)tTt>tAt	p.F455Y	SAMD15_ENST00000533095.2_Intron|TMED8_ENST00000216468.7_5'Flank	NM_001010860.1	NP_001010860.1	Q9P1V8	SAM15_HUMAN	sterile alpha motif domain containing 15	455										breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|pancreas(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AGTGACAAATTTAGAAAAGAA	0.373																																						dbGAP											0													74.0	73.0	74.0					14																	77845125		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK093282	CCDS32126.1	14q24.3	2013-01-10	2010-10-20	2010-10-20	ENSG00000100583	ENSG00000100583		"""Sterile alpha motif (SAM) domain containing"""	18631	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member A"", ""chromosome 14 open reading frame 174"""	FAM15A, C14orf174			Standard	XM_006720069		Approved	FLJ35963	uc001xtq.1	Q9P1V8		ENST00000216471.4:c.1364T>A	14.37:g.77845125T>A	ENSP00000216471:p.Phe455Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3P3	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.F455Y	ENST00000216471.4	37	c.1364	CCDS32126.1	14	.	.	.	.	.	.	.	.	.	.	T	3.874	-0.027279	0.07589	.	.	ENSG00000100583	ENST00000216471	T	0.18960	2.18	2.4	-1.87	0.07737	.	.	.	.	.	T	0.10380	0.0254	L	0.34521	1.04	0.09310	N	1	P	0.42078	0.77	B	0.32624	0.149	T	0.17992	-1.0351	9	0.56958	D	0.05	.	2.2962	0.04151	0.2607:0.3965:0.0:0.3427	.	455	Q9P1V8	SAM15_HUMAN	Y	455	ENSP00000216471:F455Y	ENSP00000216471:F455Y	F	+	2	0	SAMD15	76914878	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.340000	0.07821	-0.246000	0.09611	0.454000	0.30748	TTT	SAMD15	-	NULL	ENSG00000100583		0.373	SAMD15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAMD15	HGNC	protein_coding	OTTHUMT00000394587.2	150	0.00	0	T	NM_001010860		77845125	77845125	+1	no_errors	ENST00000216471	ensembl	human	known	69_37n	missense	152	19.15	36	SNP	0.000	A
SBF1	6305	genome.wustl.edu	37	22	50906253	50906253	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:50906253C>T	ENST00000390679.3	-	3	425	c.241G>A	c.(241-243)Gcc>Acc	p.A81T	SBF1_ENST00000380817.3_Missense_Mutation_p.A81T|SBF1_ENST00000348911.6_Missense_Mutation_p.A81T			O95248	MTMR5_HUMAN	SET binding factor 1	81	UDENN.				cell death (GO:0008219)|positive regulation of Rab GTPase activity (GO:0032851)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(8)|large_intestine(3)|lung(18)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	43		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.206)|LUAD - Lung adenocarcinoma(64;0.247)		GTCAAGCAGGCGCAGTAGTGG	0.607																																						dbGAP											0													34.0	40.0	38.0					22																	50906253		2131	4228	6359	-	-	-	SO:0001583	missense	0			U93181	CCDS14091.1, CCDS14091.2	22q13.33	2013-01-10			ENSG00000100241	ENSG00000100241		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"", ""DENN/MADD domain containing"", ""Pleckstrin homology (PH) domain containing"""	10542	protein-coding gene	gene with protein product	"""myotubularin related 5"", ""DENN/MADD domain containing 7A"""	603560				9537414, 9736772	Standard	NM_002972		Approved	MTMR5, DENND7A	uc003blh.3	O95248	OTTHUMG00000150204	ENST00000390679.3:c.241G>A	22.37:g.50906253C>T	ENSP00000375097:p.Ala81Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVG9|O60228|Q5JXD8|Q5PPM2|Q96GR9|Q9UGB8	Missense_Mutation	SNP	pfam_SBF2,pfam_DENN_dom,pfam_uDENN_dom,pfam_Myotub-related,pfam_dDENN_dom,pfam_GRAM,pfam_Pleckstrin_homology,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_GRAM,smart_Pleckstrin_homology,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_Pleckstrin_homology	p.A81T	ENST00000390679.3	37	c.241		22	.	.	.	.	.	.	.	.	.	.	C	22.3	4.274986	0.80580	.	.	ENSG00000100241	ENST00000380817;ENST00000348911;ENST00000356279;ENST00000337034;ENST00000390679	T;T;T	0.41065	1.01;1.01;1.01	4.78	4.78	0.61160	.	0.212177	0.38663	N	0.001610	T	0.43523	0.1251	M	0.64170	1.965	0.49051	D	0.999746	D;D	0.55605	0.972;0.972	P;P	0.45099	0.469;0.469	T	0.47420	-0.9119	10	0.62326	D	0.03	.	11.1414	0.48404	0.0:0.914:0.0:0.086	.	81;81	G5E933;O95248-4	.;.	T	81;81;91;91;81	ENSP00000370196:A81T;ENSP00000252027:A81T;ENSP00000375097:A81T	ENSP00000336522:A91T	A	-	1	0	SBF1	49253119	0.970000	0.33590	0.999000	0.59377	0.740000	0.42216	2.344000	0.44010	2.483000	0.83821	0.561000	0.74099	GCC	SBF1	-	pfam_uDENN_dom,smart_uDENN_dom,pfscan_uDENN_dom	ENSG00000100241		0.607	SBF1-201	KNOWN	basic	protein_coding	SBF1	HGNC	protein_coding		35	0.00	0	C			50906253	50906253	-1	no_errors	ENST00000380817	ensembl	human	known	69_37n	missense	21	37.84	14	SNP	1.000	T
SEC24B	10427	genome.wustl.edu	37	4	110442315	110442315	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:110442315A>G	ENST00000265175.5	+	13	2343	c.2288A>G	c.(2287-2289)tAt>tGt	p.Y763C	SEC24B_ENST00000399100.2_Missense_Mutation_p.Y728C|SEC24B_ENST00000504968.2_Missense_Mutation_p.Y793C	NM_006323.2	NP_006314.2	O95487	SC24B_HUMAN	SEC24 family member B	763					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|aorta morphogenesis (GO:0035909)|auditory receptor cell stereocilium organization (GO:0060088)|cellular protein metabolic process (GO:0044267)|cochlear nucleus development (GO:0021747)|COPII vesicle coating (GO:0048208)|coronary artery morphogenesis (GO:0060982)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|lung lobe morphogenesis (GO:0060463)|membrane organization (GO:0061024)|neural tube closure (GO:0001843)|outflow tract morphogenesis (GO:0003151)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|pulmonary artery morphogenesis (GO:0061156)|regulation of cargo loading into COPII-coated vesicle (GO:1901301)|regulation of establishment of planar polarity involved in neural tube closure (GO:0090178)|small molecule metabolic process (GO:0044281)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|membrane (GO:0016020)	transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(12)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;3.03e-05)		GTGAATCTATATGAAAGTAAA	0.239																																						dbGAP											0													60.0	55.0	56.0					4																	110442315		1780	4039	5819	-	-	-	SO:0001583	missense	0			AJ131245	CCDS43260.1, CCDS47124.1, CCDS75179.1	4q25	2013-10-21	2013-10-21		ENSG00000138802	ENSG00000138802			10704	protein-coding gene	gene with protein product		607184	"""SEC24 (S. cerevisiae) related gene family, member B"", ""SEC24 family, member B (S. cerevisiae)"""			10075675, 10329445	Standard	XM_005262688		Approved		uc003hzk.3	O95487	OTTHUMG00000161372	ENST00000265175.5:c.2288A>G	4.37:g.110442315A>G	ENSP00000265175:p.Tyr763Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM8|B7ZKN4|Q0VG08	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.Y763C	ENST00000265175.5	37	c.2288	CCDS47124.1	4	.	.	.	.	.	.	.	.	.	.	A	17.33	3.361449	0.61403	.	.	ENSG00000138802	ENST00000504968;ENST00000399100;ENST00000265175	T;T;T	0.74315	-0.83;-0.83;-0.83	5.78	4.6	0.57074	Sec23/Sec24, trunk domain (1);	0.391082	0.30302	N	0.009930	T	0.75072	0.3800	L	0.50333	1.59	0.42558	D	0.993137	P;P;P;P;P	0.40578	0.506;0.506;0.722;0.675;0.722	B;B;P;B;B	0.47744	0.432;0.312;0.556;0.306;0.432	T	0.75929	-0.3144	10	0.62326	D	0.03	-4.0278	11.4963	0.50410	0.9304:0.0:0.0695:0.0	.	677;362;793;728;763	B4DTM6;B4E2E1;B7ZKM8;O95487-2;O95487	.;.;.;.;SC24B_HUMAN	C	793;728;763	ENSP00000428564:Y793C;ENSP00000382051:Y728C;ENSP00000265175:Y763C	ENSP00000265175:Y763C	Y	+	2	0	SEC24B	110661764	1.000000	0.71417	0.813000	0.32504	0.986000	0.74619	5.208000	0.65203	1.025000	0.39708	0.460000	0.39030	TAT	SEC24B	-	pfam_Sec23/24_trunk_dom	ENSG00000138802		0.239	SEC24B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24B	HGNC	protein_coding	OTTHUMT00000364693.2	419	0.00	0	A			110442315	110442315	+1	no_errors	ENST00000265175	ensembl	human	known	69_37n	missense	400	33.33	200	SNP	0.995	G
SEC24D	9871	genome.wustl.edu	37	4	119745855	119745855	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:119745855C>T	ENST00000280551.6	-	3	406	c.168G>A	c.(166-168)atG>atA	p.M56I	SEC24D_ENST00000419654.2_5'UTR|SEC24D_ENST00000379735.5_Missense_Mutation_p.M56I			O94855	SC24D_HUMAN	SEC24 family member D	56	Pro-rich.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|in utero embryonic development (GO:0001701)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(13)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	37						CCGGAGGCAACATTCCCCTAG	0.537																																						dbGAP											0													99.0	109.0	105.0					4																	119745855		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018298	CCDS3710.1	4q26	2013-10-21	2013-10-21		ENSG00000150961	ENSG00000150961			10706	protein-coding gene	gene with protein product		607186	"""SEC24 (S. cerevisiae) related gene family, member D"", ""SEC24 family, member D (S. cerevisiae)"""			9872452, 10075675	Standard	NM_014822		Approved	KIAA0755	uc003ici.4	O94855	OTTHUMG00000132957	ENST00000280551.6:c.168G>A	4.37:g.119745855C>T	ENSP00000280551:p.Met56Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYI7	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom	p.M56I	ENST00000280551.6	37	c.168	CCDS3710.1	4	.	.	.	.	.	.	.	.	.	.	C	1.954	-0.440491	0.04636	.	.	ENSG00000150961	ENST00000280551;ENST00000379735;ENST00000503683	T;T;T	0.75477	-0.94;-0.94;0.95	4.87	2.15	0.27550	.	0.560127	0.19311	N	0.117393	T	0.51924	0.1703	N	0.14661	0.345	0.28475	N	0.915215	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.36040	-0.9764	10	0.22109	T	0.4	-6.9032	7.2308	0.26040	0.0:0.7117:0.0:0.2883	.	56;56	O94855-2;O94855	.;SC24D_HUMAN	I	56	ENSP00000280551:M56I;ENSP00000369059:M56I;ENSP00000426309:M56I	ENSP00000280551:M56I	M	-	3	0	SEC24D	119965303	0.001000	0.12720	0.243000	0.24186	0.035000	0.12851	0.045000	0.14013	0.645000	0.30675	-0.252000	0.11476	ATG	SEC24D	-	NULL	ENSG00000150961		0.537	SEC24D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SEC24D	HGNC	protein_coding	OTTHUMT00000256514.4	48	0.00	0	C			119745855	119745855	-1	no_errors	ENST00000379735	ensembl	human	known	69_37n	missense	32	44.83	26	SNP	0.281	T
SETD1B	23067	genome.wustl.edu	37	12	122242658	122242658	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:122242658delC	ENST00000604567.1	+	2	83	c.15delC	c.(13-15)cacfs	p.H5fs	RP11-347I19.8_ENST00000609067.1_lincRNA|RHOF_ENST00000545544.1_5'Flank|SETD1B_ENST00000267197.5_Frame_Shift_Del_p.H5fs|SETD1B_ENST00000542440.1_Frame_Shift_Del_p.H5fs			Q9UPS6	SET1B_HUMAN	SET domain containing 1B	5					histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone-lysine N-methyltransferase activity (GO:0018024)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.H8fs*27(2)		NS(1)|endometrium(6)|kidney(2)|prostate(2)	11						AGAACAGTCACCCCCCCCACC	0.632																																						dbGAP											2	Deletion - Frameshift(2)	large_intestine(2)											37.0	44.0	42.0					12																	122242658		692	1591	2283	-	-	-	SO:0001589	frameshift_variant	0			AB028999	CCDS53838.1	12q24.31	2013-02-12			ENSG00000139718	ENSG00000139718		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29187	protein-coding gene	gene with protein product		611055				10470851, 17355966	Standard	NM_015048		Approved	KIAA1076, Set1B, KMT2G	uc001ubi.3	Q9UPS6	OTTHUMG00000169080	ENST00000604567.1:c.15delC	12.37:g.122242658delC	ENSP00000474253:p.His5fs	Somatic		WXS	Illumina GAIIx	Phase_IV	F6MFW1	Frame_Shift_Del	DEL	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.H8fs	ENST00000604567.1	37	c.15		12																																																																																			SETD1B	-	NULL	ENSG00000139718		0.632	SETD1B-002	PUTATIVE	non_canonical_U12|basic|appris_candidate_longest	protein_coding	SETD1B	HGNC	protein_coding	OTTHUMT00000468264.1	59	0.00	0	C	XM_037523		122242658	122242658	+1	no_errors	ENST00000267197	ensembl	human	known	69_37n	frame_shift_del	47	21.31	13	DEL	1.000	-
SETDB1	9869	genome.wustl.edu	37	1	150917623	150917624	+	Intron	INS	-	-	G	rs587715611|rs587751384|rs186820437	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:150917623_150917624insG	ENST00000271640.5	+	9	1330				SETDB1_ENST00000368962.2_Frame_Shift_Ins_p.G394fs|SETDB1_ENST00000368969.4_Intron|SETDB1_ENST00000459773.1_Intron	NM_001145415.1|NM_012432.3	NP_001138887.1|NP_036564.3	Q15047	SETB1_HUMAN	SET domain, bifurcated 1						bone development (GO:0060348)|histone H3-K9 trimethylation (GO:0036124)|inner cell mass cell proliferation (GO:0001833)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)	12	all_lung(15;9e-35)|Lung NSC(24;3.45e-31)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.108)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|BRCA - Breast invasive adenocarcinoma(12;0.0152)|LUSC - Lung squamous cell carcinoma(543;0.211)			CAGAGGTTGGTGGGGGGGGAAC	0.475																																						dbGAP											0									,	53,4213		1,51,2081					,	-6.3	0.0			32	26,8228		0,26,4101	no	intron,intron	SETDB1	NM_012432.3,NM_001145415.1	,	1,77,6182	A1A1,A1R,RR		0.315,1.2424,0.631	,	,		79,12441				-	-	-	SO:0001627	intron_variant	0			D31891	CCDS972.1, CCDS44217.1, CCDS58026.1	1q21	2013-01-23			ENSG00000143379	ENSG00000143379		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Tudor domain containing"""	10761	protein-coding gene	gene with protein product	"""tudor domain containing 21"""	604396				10343109	Standard	NM_001145415		Approved	KG1T, KIAA0067, ESET, KMT1E, TDRD21	uc001evu.2	Q15047	OTTHUMG00000035003	ENST00000271640.5:c.1140+39->G	1.37:g.150917631_150917631dupG		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEW2|Q5SZD8|Q5SZD9|Q5SZE0|Q5SZE7|Q96GM9	Frame_Shift_Ins	INS	smart_Tudor	p.T396fs	ENST00000271640.5	37	c.1179_1180	CCDS44217.1	1																																																																																			SETDB1	-	NULL	ENSG00000143379		0.475	SETDB1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB1	HGNC	protein_coding	OTTHUMT00000084717.2	125	0.00	0	-			150917623	150917624	+1	no_errors	ENST00000368962	ensembl	human	known	69_37n	frame_shift_ins	106	24.82	35	INS	0.000:0.000	G
SGOL2	151246	genome.wustl.edu	37	2	201438018	201438019	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:201438018_201438019insA	ENST00000357799.4	+	7	3047_3048	c.2949_2950insA	c.(2950-2952)aaafs	p.K984fs		NM_001160033.1|NM_001160046.1|NM_152524.5	NP_001153505.1|NP_001153518.1|NP_689737.4	Q562F6	SGOL2_HUMAN	shugoshin-like 2 (S. pombe)	984					meiotic sister chromatid cohesion, centromeric (GO:0051754)|mitotic cell cycle (GO:0000278)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinetochore (GO:0000776)|mitotic cohesin complex (GO:0030892)|nucleus (GO:0005634)				NS(2)|breast(2)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(7)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	46						ACAAAGTAGTTAAAAAACGTAA	0.307																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY094614	CCDS42796.1	2q33.2	2008-02-05			ENSG00000163535	ENSG00000163535			30812	protein-coding gene	gene with protein product		612425					Standard	NM_001160046		Approved	TRIPIN, FLJ25211	uc002uvw.2	Q562F6	OTTHUMG00000154535	ENST00000357799.4:c.2955dupA	2.37:g.201438024_201438024dupA	ENSP00000350447:p.Lys984fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53RR9|Q53T20|Q86XY4|Q8IWK2|Q8IZK1|Q8N1Q5|Q96LQ3	Frame_Shift_Ins	INS	NULL	p.R985fs	ENST00000357799.4	37	c.2949_2950	CCDS42796.1	2																																																																																			SGOL2	-	NULL	ENSG00000163535		0.307	SGOL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGOL2	HGNC	protein_coding	OTTHUMT00000335834.1	51	0.00	0	-	NM_152524		201438018	201438019	+1	no_errors	ENST00000357799	ensembl	human	known	69_37n	frame_shift_ins	18	47.06	16	INS	0.140:0.133	A
SH2B1	25970	genome.wustl.edu	37	16	28884850	28884850	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:28884850G>A	ENST00000322610.8	+	11	2419	c.1980G>A	c.(1978-1980)gcG>gcA	p.A660A	SH2B1_ENST00000545570.1_3'UTR|SH2B1_ENST00000395532.4_3'UTR|SH2B1_ENST00000563674.1_3'UTR|SH2B1_ENST00000337120.5_3'UTR|SH2B1_ENST00000359285.5_3'UTR|SH2B1_ENST00000538342.1_3'UTR			Q9NRF2	SH2B1_HUMAN	SH2B adaptor protein 1	660					blood coagulation (GO:0007596)|cellular component movement (GO:0006928)|intracellular signal transduction (GO:0035556)|lamellipodium assembly (GO:0030032)|positive regulation of mitosis (GO:0045840)|regulation of DNA biosynthetic process (GO:2000278)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	signal transducer activity (GO:0004871)			endometrium(2)|kidney(1)|large_intestine(2)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	25						CAGAAGAGGCGTCGAGGGCGC	0.642																																						dbGAP											0													41.0	67.0	59.0					16																	28884850		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK055104	CCDS32424.1, CCDS53996.1, CCDS53997.1	16p11.2	2013-02-14						"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	30417	protein-coding gene	gene with protein product	"""SH2-B homolog"""	608937				11827956, 10594240	Standard	NM_001145812		Approved	FLJ30542, SH2B	uc002drl.3	Q9NRF2		ENST00000322610.8:c.1980G>A	16.37:g.28884850G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2R7|Q96FK3|Q96SX3|Q9NRF1|Q9NRF3|Q9P2P7|Q9Y3Y3	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.V153I	ENST00000322610.8	37	c.457	CCDS53996.1	16																																																																																			SH2B1	-	NULL	ENSG00000178188		0.642	SH2B1-001	KNOWN	basic|CCDS	protein_coding	SH2B1	HGNC	protein_coding	OTTHUMT00000432666.1	109	0.00	0	G	NM_015503		28884850	28884850	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000569651	ensembl	human	putative	69_37n	missense	93	27.34	35	SNP	0.991	A
SH3BGRL	6451	genome.wustl.edu	37	X	80457737	80457737	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:80457737C>T	ENST00000373212.5	+	1	296	c.38C>T	c.(37-39)tCt>tTt	p.S13F	SH3BGRL_ENST00000481106.1_3'UTR|HMGN5_ENST00000358130.2_5'Flank	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	13					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				TCCTCTGGCTCTACAGCGGTA	0.527																																						dbGAP											0													126.0	99.0	108.0					X																	80457737		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.38C>T	X.37:g.80457737C>T	ENSP00000362308:p.Ser13Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Missense_Mutation	SNP	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	p.S13F	ENST00000373212.5	37	c.38	CCDS14449.1	X	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052758	0.36181	.	.	ENSG00000131171	ENST00000373212	T	0.75704	-0.96	5.32	5.32	0.75619	Thioredoxin-like fold (2);	0.189726	0.47455	D	0.000240	T	0.75576	0.3868	L	0.55213	1.73	0.46849	D	0.999222	D	0.54207	0.965	P	0.51297	0.665	T	0.72704	-0.4213	10	0.26408	T	0.33	-6.367	12.9826	0.58572	0.0:1.0:0.0:0.0	.	13	O75368	SH3L1_HUMAN	F	13	ENSP00000362308:S13F	ENSP00000362308:S13F	S	+	2	0	SH3BGRL	80344393	0.987000	0.35691	0.987000	0.45799	0.972000	0.66771	3.389000	0.52516	2.464000	0.83262	0.513000	0.50165	TCT	SH3BGRL	-	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	ENSG00000131171		0.527	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGRL	HGNC	protein_coding	OTTHUMT00000057350.1	249	0.00	0	C	NM_003022		80457737	80457737	+1	no_errors	ENST00000373212	ensembl	human	known	69_37n	missense	222	30.19	96	SNP	0.988	T
SHD	56961	genome.wustl.edu	37	19	4280122	4280122	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:4280122C>A	ENST00000543264.2	+	1	1525	c.62C>A	c.(61-63)cCc>cAc	p.P21H	SHD_ENST00000599689.1_Missense_Mutation_p.P21H	NM_020209.3	NP_064594.3	Q96IW2	SHD_HUMAN	Src homology 2 domain containing transforming protein D	21										breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|stomach(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0337)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGCAGCCGCCCACCCCGGAC	0.667																																						dbGAP											0													19.0	24.0	22.0					19																	4280122		2200	4300	6500	-	-	-	SO:0001583	missense	0			BC007206	CCDS12125.1	19p13.3	2013-02-14				ENSG00000105251		"""SH2 domain containing"""	30633	protein-coding gene	gene with protein product		610481				9315092	Standard	NM_020209		Approved		uc002lzw.2	Q96IW2		ENST00000543264.2:c.62C>A	19.37:g.4280122C>A	ENSP00000446058:p.Pro21His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96NC2	Missense_Mutation	SNP	pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	p.P21H	ENST00000543264.2	37	c.62	CCDS12125.1	19	.	.	.	.	.	.	.	.	.	.	C	31	5.070253	0.93950	.	.	ENSG00000105251	ENST00000543264	T	0.48522	0.81	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.67683	0.2919	M	0.73962	2.25	0.48571	D	0.999679	D	0.89917	1.0	D	0.76071	0.987	T	0.72981	-0.4126	10	0.87932	D	0	-9.1008	14.7082	0.69208	0.0:1.0:0.0:0.0	.	21	Q96IW2	SHD_HUMAN	H	21	ENSP00000446058:P21H	ENSP00000446058:P21H	P	+	2	0	SHD	4231122	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.506000	0.73712	2.118000	0.64928	0.484000	0.47621	CCC	SHD	-	NULL	ENSG00000105251		0.667	SHD-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	SHD	HGNC	protein_coding	OTTHUMT00000458082.1	30	0.00	0	C	NM_020209		4280122	4280122	+1	no_errors	ENST00000543264	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	1.000	A
SHMT2	6472	genome.wustl.edu	37	12	57626239	57626239	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:57626239delA	ENST00000328923.3	+	6	1050	c.598delA	c.(598-600)aaafs	p.K200fs	SHMT2_ENST00000449049.3_Frame_Shift_Del_p.K179fs|SHMT2_ENST00000554600.1_3'UTR|SHMT2_ENST00000393827.4_Frame_Shift_Del_p.K104fs|SHMT2_ENST00000553474.1_Frame_Shift_Del_p.K179fs|SHMT2_ENST00000557487.1_Intron|SHMT2_ENST00000414700.3_Frame_Shift_Del_p.K179fs	NM_001166356.1|NM_005412.5	NP_001159828.1|NP_005403.2	P34897	GLYM_HUMAN	serine hydroxymethyltransferase 2 (mitochondrial)	200					glycine biosynthetic process from serine (GO:0019264)|L-serine biosynthetic process (GO:0006564)|one-carbon metabolic process (GO:0006730)|positive regulation of cell proliferation (GO:0008284)|protein homotetramerization (GO:0051289)|tetrahydrofolate interconversion (GO:0035999)	extracellular vesicular exosome (GO:0070062)|microtubule cytoskeleton (GO:0015630)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	amino acid binding (GO:0016597)|chromatin binding (GO:0003682)|glycine hydroxymethyltransferase activity (GO:0004372)|L-allo-threonine aldolase activity (GO:0008732)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15					Glycine(DB00145)|Tetrahydrofolic acid(DB00116)	TGTCCAGCCCAAAACTGGCCT	0.582																																					Esophageal Squamous(150;1369 2416 49071 49364)	dbGAP											0													101.0	100.0	101.0					12																	57626239		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK223555	CCDS8934.1, CCDS53805.1, CCDS55837.1	12q12-q14	2006-03-27				ENSG00000182199	2.1.2.1		10852	protein-coding gene	gene with protein product		138450		SHMT		8999870	Standard	NM_005412		Approved		uc001snf.2	P34897		ENST00000328923.3:c.598delA	12.37:g.57626239delA	ENSP00000333667:p.Lys200fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z9F1|E7EQ19|E7EU43|O00740|Q8N1A5	Frame_Shift_Del	DEL	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	p.T201fs	ENST00000328923.3	37	c.598	CCDS8934.1	12																																																																																			SHMT2	-	pfam_Ser_HO-MeTrfase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Ser_HO-MeTrfase	ENSG00000182199		0.582	SHMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHMT2	HGNC	protein_coding	OTTHUMT00000412525.2	91	0.00	0	A	NM_005412		57626239	57626239	+1	no_errors	ENST00000328923	ensembl	human	known	69_37n	frame_shift_del	61	35.11	33	DEL	0.008	-
SLC18A3	6572	genome.wustl.edu	37	10	50819070	50819070	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:50819070C>T	ENST00000374115.3	+	1	724	c.284C>T	c.(283-285)gCc>gTc	p.A95V	CHAT_ENST00000351556.3_5'Flank|CHAT_ENST00000339797.1_Intron|CHAT_ENST00000395559.2_5'Flank	NM_003055.2	NP_003046.2	Q16572	VACHT_HUMAN	solute carrier family 18 (vesicular acetylcholine transporter), member 3	95					acetylcholine transport (GO:0015870)|cation transmembrane transport (GO:0098655)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)	clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)			endometrium(6)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)	43						GCCTACACGGCCAACACCTCG	0.721																																						dbGAP											0													33.0	35.0	34.0					10																	50819070		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC007765	CCDS7231.1	10q11.2	2013-07-18	2013-07-18		ENSG00000187714	ENSG00000187714		"""Solute carriers"""	10936	protein-coding gene	gene with protein product		600336				8071310	Standard	NM_003055		Approved	VACHT	uc001jhw.3	Q16572	OTTHUMG00000018196	ENST00000374115.3:c.284C>T	10.37:g.50819070C>T	ENSP00000363229:p.Ala95Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7S1	Missense_Mutation	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A95V	ENST00000374115.3	37	c.284	CCDS7231.1	10	.	.	.	.	.	.	.	.	.	.	C	0.785	-0.761054	0.02996	.	.	ENSG00000187714	ENST00000374115	T	0.04706	3.57	4.94	1.8	0.24995	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	1.251900	0.06401	N	0.718807	T	0.04048	0.0113	N	0.22421	0.69	0.09310	N	1	B	0.10296	0.003	B	0.09377	0.004	T	0.48445	-0.9035	10	0.24483	T	0.36	1.9913	6.7443	0.23453	0.0:0.4263:0.3733:0.2003	.	95	Q16572	VACHT_HUMAN	V	95	ENSP00000363229:A95V	ENSP00000363229:A95V	A	+	2	0	SLC18A3	50489076	0.004000	0.15560	0.316000	0.25252	0.031000	0.12232	-0.234000	0.09028	0.044000	0.15775	0.561000	0.74099	GCC	SLC18A3	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000187714		0.721	SLC18A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC18A3	HGNC	protein_coding	OTTHUMT00000047995.1	22	0.00	0	C	NM_003055		50819070	50819070	+1	no_errors	ENST00000374115	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	0.107	T
SLC20A2	6575	genome.wustl.edu	37	8	42295045	42295045	+	Missense_Mutation	SNP	C	C	T	rs115961682		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:42295045C>T	ENST00000342228.3	-	8	1354	c.985G>A	c.(985-987)Ggc>Agc	p.G329S	SLC20A2_ENST00000520179.1_Missense_Mutation_p.G329S|SLC20A2_ENST00000520262.1_Missense_Mutation_p.G329S	NM_006749.4	NP_006740.1	Q08357	S20A2_HUMAN	solute carrier family 20 (phosphate transporter), member 2	329					ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	inorganic phosphate transmembrane transporter activity (GO:0005315)|receptor activity (GO:0004872)|sodium:phosphate symporter activity (GO:0005436)|virus receptor activity (GO:0001618)			breast(1)|endometrium(6)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|stomach(1)	26	all_lung(13;8.33e-12)|Lung NSC(13;1.41e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;5.73e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00419)|Lung(22;0.0302)|LUSC - Lung squamous cell carcinoma(45;0.0869)			CCGAAGGTGCCGTTGGAGATG	0.502																																						dbGAP											0													70.0	65.0	66.0					8																	42295045		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6132.1	8p11.21	2013-05-22			ENSG00000168575	ENSG00000168575		"""Solute carriers"""	10947	protein-coding gene	gene with protein product		158378		MLVAR, GLVR2		7745689, 16790504	Standard	NM_001257180		Approved	PiT-2, Glvr-2	uc010lxm.4	Q08357	OTTHUMG00000164169	ENST00000342228.3:c.985G>A	8.37:g.42295045C>T	ENSP00000340465:p.Gly329Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Phos_transporter	p.G329S	ENST00000342228.3	37	c.985	CCDS6132.1	8	.	.	.	.	.	.	.	.	.	.	C	25.5	4.641985	0.87859	.	.	ENSG00000168575	ENST00000342228;ENST00000520262;ENST00000520179	D;D;D	0.90444	-2.67;-2.67;-2.67	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.90473	0.7016	L	0.27053	0.805	0.80722	D	1	D	0.63046	0.992	D	0.63597	0.916	D	0.86392	0.1736	10	0.10111	T	0.7	-18.7253	17.3745	0.87387	0.0:1.0:0.0:0.0	.	329	Q08357	S20A2_HUMAN	S	329	ENSP00000340465:G329S;ENSP00000429754:G329S;ENSP00000429712:G329S	ENSP00000340465:G329S	G	-	1	0	SLC20A2	42414202	1.000000	0.71417	0.968000	0.41197	0.393000	0.30537	5.731000	0.68554	2.698000	0.92095	0.655000	0.94253	GGC	SLC20A2	-	pfam_Phos_transporter	ENSG00000168575		0.502	SLC20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC20A2	HGNC	protein_coding	OTTHUMT00000377578.1	70	0.00	0	C			42295045	42295045	-1	no_errors	ENST00000342228	ensembl	human	known	69_37n	missense	60	40.00	40	SNP	1.000	T
SLC24A1	9187	genome.wustl.edu	37	15	65918176	65918177	+	In_Frame_Ins	INS	-	-	CTG	rs370680044		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:65918176_65918177insCTG	ENST00000261892.6	+	2	2045_2046	c.1758_1759insCTG	c.(1759-1761)ctg>CTGctg	p.587_587L>LL	SLC24A1_ENST00000546330.1_In_Frame_Ins_p.587_587L>LL|SLC24A1_ENST00000399033.4_In_Frame_Ins_p.587_587L>LL|SLC24A1_ENST00000339868.6_In_Frame_Ins_p.587_587L>LL|SLC24A1_ENST00000544319.2_In_Frame_Ins_p.587_587L>LL|SLC24A1_ENST00000537259.1_In_Frame_Ins_p.587_587L>LL	NM_001254740.1|NM_004727.2	NP_001241669.1|NP_004718.1	O60721	NCKX1_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 1	587					calcium ion transport (GO:0006816)|ion transport (GO:0006811)|phototransduction, visible light (GO:0007603)|response to light intensity (GO:0009642)|rhodopsin mediated signaling pathway (GO:0016056)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(2)|endometrium(7)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	23						GGTGGGAGAGCCTGCTGCTGCT	0.545																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AF062922	CCDS45284.1, CCDS73742.1, CCDS73743.1, CCDS73744.1	15q22.31	2014-01-28			ENSG00000074621	ENSG00000074621		"""Solute carriers"""	10975	protein-coding gene	gene with protein product		603617				9856482	Standard	NM_004727		Approved	NCKX1, NCKX, RODX, KIAA0702, HsT17412, CSNB1D	uc010ujf.2	O60721	OTTHUMG00000167960	ENST00000261892.6:c.1771_1773dupCTG	15.37:g.65918183_65918185dupCTG	ENSP00000261892:p.Leu591dup	Somatic		WXS	Illumina GAIIx	Phase_IV	O43485|O75184|Q17RM9	In_Frame_Ins	INS	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K-dep_Na/Ca-exchanger-like	p.590in_frame_insL	ENST00000261892.6	37	c.1758_1759	CCDS45284.1	15																																																																																			SLC24A1	-	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger,tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000074621		0.545	SLC24A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A1	HGNC	protein_coding	OTTHUMT00000397304.1	304	0.00	0	-	NM_004727		65918176	65918177	+1	no_errors	ENST00000261892	ensembl	human	known	69_37n	in_frame_ins	331	17.46	70	INS	1.000:1.000	CTG
SLC25A44	9673	genome.wustl.edu	37	1	156180034	156180034	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:156180034G>A	ENST00000359511.4	+	4	929	c.757G>A	c.(757-759)Gag>Aag	p.E253K	PMF1-BGLAP_ENST00000320139.5_5'Flank|PMF1_ENST00000368277.3_5'Flank|PMF1-BGLAP_ENST00000368276.4_5'Flank|SLC25A44_ENST00000469537.1_3'UTR|SLC25A44_ENST00000423538.2_Missense_Mutation_p.E230K|PMF1-BGLAP_ENST00000490491.1_5'Flank|PMF1_ENST00000368273.4_5'Flank|PMF1_ENST00000565805.1_5'Flank|PMF1_ENST00000567140.1_5'Flank|PMF1_ENST00000368279.3_5'Flank	NM_014655.2	NP_055470.1	Q96H78	S2544_HUMAN	solute carrier family 25, member 44	253					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				breast(3)|kidney(2)|large_intestine(2)|lung(1)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Hepatocellular(266;0.158)					TTTCCAGGTTGAGGGCAAGAA	0.552																																						dbGAP											0													197.0	182.0	187.0					1																	156180034		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007915	CCDS1133.1, CCDS72943.1	1q22	2013-05-22			ENSG00000160785	ENSG00000160785		"""Solute carriers"""	29036	protein-coding gene	gene with protein product		610824				16949250	Standard	NM_001286184		Approved	FLJ90431, KIAA0446	uc001fnp.3	Q96H78	OTTHUMG00000014816	ENST00000359511.4:c.757G>A	1.37:g.156180034G>A	ENSP00000352497:p.Glu253Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75034	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_Mitochondrial_sb/sol_carrier	p.E253K	ENST00000359511.4	37	c.757	CCDS1133.1	1	.	.	.	.	.	.	.	.	.	.	G	17.76	3.467698	0.63625	.	.	ENSG00000160785	ENST00000359511;ENST00000423538	T;T	0.78126	-1.15;-1.15	4.7	4.7	0.59300	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	T	0.69557	0.3124	L	0.52011	1.625	0.80722	D	1	B;P;B	0.39759	0.262;0.687;0.434	B;B;B	0.43018	0.164;0.405;0.405	T	0.75277	-0.3374	10	0.59425	D	0.04	-3.6029	15.196	0.73088	0.0:0.0:1.0:0.0	.	230;230;253	E9PGQ0;B4DGC4;Q96H78	.;.;S2544_HUMAN	K	253;230	ENSP00000352497:E253K;ENSP00000407560:E230K	ENSP00000352497:E253K	E	+	1	0	SLC25A44	154446658	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.382000	0.97209	2.437000	0.82529	0.655000	0.94253	GAG	SLC25A44	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,prints_Mit_carrier,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000160785		0.552	SLC25A44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A44	HGNC	protein_coding	OTTHUMT00000040856.1	289	0.00	0	G	NM_014655		156180034	156180034	+1	no_errors	ENST00000359511	ensembl	human	known	69_37n	missense	219	41.76	157	SNP	1.000	A
SLC27A2	11001	genome.wustl.edu	37	15	50526110	50526110	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:50526110A>G	ENST00000267842.5	+	9	1833	c.1601A>G	c.(1600-1602)aAc>aGc	p.N534S	SLC27A2_ENST00000380902.4_Missense_Mutation_p.N481S|SLC27A2_ENST00000544960.1_Missense_Mutation_p.N299S	NM_003645.3	NP_003636.2	O14975	S27A2_HUMAN	solute carrier family 27 (fatty acid transporter), member 2	534					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cellular lipid metabolic process (GO:0044255)|fatty acid alpha-oxidation (GO:0001561)|fatty acid beta-oxidation (GO:0006635)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|methyl-branched fatty acid metabolic process (GO:0097089)|small molecule metabolic process (GO:0044281)|very long-chain fatty acid catabolic process (GO:0042760)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of peroxisomal membrane (GO:0005779)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|phytanate-CoA ligase activity (GO:0050197)|pristanate-CoA ligase activity (GO:0070251)|receptor binding (GO:0005102)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(1)|breast(2)|endometrium(3)|large_intestine(4)|lung(9)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_lung(180;0.00177)		all cancers(107;1.16e-06)|GBM - Glioblastoma multiforme(94;0.000113)		ATGAAAGAAAACCATGAATTT	0.368																																						dbGAP											0													106.0	100.0	102.0					15																	50526110		2196	4295	6491	-	-	-	SO:0001583	missense	0			D88308	CCDS10133.1, CCDS53943.1	15q21.2	2013-05-22			ENSG00000140284	ENSG00000140284		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10996	protein-coding gene	gene with protein product		603247		FACVL1		9730624	Standard	NM_003645		Approved	FATP2, hFACVL1, VLACS, VLCS, HsT17226, ACSVL1	uc001zxw.3	O14975	OTTHUMG00000131643	ENST00000267842.5:c.1601A>G	15.37:g.50526110A>G	ENSP00000267842:p.Asn534Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2J7|Q53FY6|Q6PF09	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.N534S	ENST00000267842.5	37	c.1601	CCDS10133.1	15	.	.	.	.	.	.	.	.	.	.	A	3.964	-0.009804	0.07727	.	.	ENSG00000140284	ENST00000380902;ENST00000267842;ENST00000544960	T;T;T	0.47869	0.83;0.83;0.83	5.93	2.4	0.29515	.	0.294784	0.41823	D	0.000808	T	0.31199	0.0789	L	0.28192	0.835	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.12156	0.004;0.007	T	0.16719	-1.0393	10	0.33940	T	0.23	.	8.5446	0.33413	0.7757:0.0:0.2243:0.0	.	481;534	Q6PF09;O14975	.;S27A2_HUMAN	S	481;534;299	ENSP00000370289:N481S;ENSP00000267842:N534S;ENSP00000444549:N299S	ENSP00000267842:N534S	N	+	2	0	SLC27A2	48313402	0.020000	0.18652	0.086000	0.20670	0.090000	0.18270	1.834000	0.39171	0.167000	0.19631	-0.256000	0.11100	AAC	SLC27A2	-	NULL	ENSG00000140284		0.368	SLC27A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A2	HGNC	protein_coding	OTTHUMT00000254539.2	280	0.00	0	A	NM_003645		50526110	50526110	+1	no_errors	ENST00000267842	ensembl	human	known	69_37n	missense	306	11.05	38	SNP	0.067	G
SLC27A4	10999	genome.wustl.edu	37	9	131115028	131115028	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:131115028T>C	ENST00000300456.4	+	7	1104		c.e7+2		SLC27A4_ENST00000372870.1_Intron	NM_005094.3	NP_005085.2	Q6P1M0	S27A4_HUMAN	solute carrier family 27 (fatty acid transporter), member 4						fatty acid transport (GO:0015908)|lipid metabolic process (GO:0006629)|long-chain fatty acid import (GO:0044539)|long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|medium-chain fatty acid transport (GO:0001579)|response to nutrient (GO:0007584)|skin development (GO:0043588)|transmembrane transport (GO:0055085)|transport (GO:0006810)|very long-chain fatty acid catabolic process (GO:0042760)	brush border membrane (GO:0031526)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	fatty acid transporter activity (GO:0015245)|long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			autonomic_ganglia(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(2)	13						AACTGCACGGTGAGCGAGAGC	0.562																																					Pancreas(107;1554 2241 10946 12953)	dbGAP											0													101.0	81.0	88.0					9																	131115028		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF055899	CCDS6899.1	9q34.13	2013-05-22			ENSG00000167114	ENSG00000167114		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10998	protein-coding gene	gene with protein product		604194				9878842	Standard	NM_005094		Approved	FATP4, ACSVL4	uc004but.3	Q6P1M0	OTTHUMG00000020746	ENST00000300456.4:c.987+2T>C	9.37:g.131115028T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2F7|O95186|Q96G53	Splice_Site	SNP	-	e6+2	ENST00000300456.4	37	c.987+2	CCDS6899.1	9	.	.	.	.	.	.	.	.	.	.	T	20.9	4.063840	0.76187	.	.	ENSG00000167114	ENST00000300456	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.1938	0.65656	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLC27A4	130154849	1.000000	0.71417	0.993000	0.49108	0.772000	0.43724	7.525000	0.81892	2.130000	0.65690	0.449000	0.29647	.	SLC27A4	-	-	ENSG00000167114		0.562	SLC27A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A4	HGNC	protein_coding	OTTHUMT00000054432.2	73	0.00	0	T		Intron	131115028	131115028	+1	no_errors	ENST00000300456	ensembl	human	known	69_37n	splice_site	66	19.51	16	SNP	1.000	C
SLC2A9	56606	genome.wustl.edu	37	4	9828107	9828107	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:9828107C>T	ENST00000264784.3	-	12	1590	c.1537G>A	c.(1537-1539)Gca>Aca	p.A513T	SLC2A9_ENST00000309065.3_Missense_Mutation_p.A484T|SLC2A9_ENST00000506583.1_Missense_Mutation_p.A484T	NM_020041.2	NP_064425.2	Q9NRM0	GTR9_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 9	513					glucose transport (GO:0015758)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|urate metabolic process (GO:0046415)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)|sugar:proton symporter activity (GO:0005351)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(12)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(1)	35					Losartan(DB00678)|Probenecid(DB01032)	TTGGAAAATGCCTGGCTGATT	0.423																																						dbGAP											0													168.0	156.0	160.0					4																	9828107		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF210317	CCDS3406.1, CCDS3407.1	4p16.1	2013-05-22			ENSG00000109667	ENSG00000109667		"""Solute carriers"""	13446	protein-coding gene	gene with protein product	"""urate voltage-driven efflux transporter 1"""	606142				10860667, 17710649	Standard	NM_020041		Approved	Glut9, GLUTX, URATv1	uc003gmc.3	Q9NRM0	OTTHUMG00000044263	ENST00000264784.3:c.1537G>A	4.37:g.9828107C>T	ENSP00000264784:p.Ala513Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VGC4|Q4W5D1|Q8WV30|Q96P00	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,prints_Sugar/inositol_transpt,tigrfam_Sugar/inositol_transpt	p.A513T	ENST00000264784.3	37	c.1537	CCDS3407.1	4	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977397	0.53720	.	.	ENSG00000109667	ENST00000506583;ENST00000264784;ENST00000309065	T;T;T	0.74842	-0.88;-0.88;-0.88	6.16	4.32	0.51571	Major facilitator superfamily domain, general substrate transporter (1);	0.236062	0.43747	D	0.000531	T	0.73187	0.3555	M	0.63843	1.955	0.30224	N	0.796498	B;P	0.38473	0.426;0.633	B;P	0.46208	0.287;0.507	T	0.65705	-0.6103	10	0.15066	T	0.55	.	10.1302	0.42674	0.0:0.7852:0.1386:0.0762	.	484;513	Q9NRM0-2;Q9NRM0	.;GTR9_HUMAN	T	484;513;484	ENSP00000422209:A484T;ENSP00000264784:A513T;ENSP00000311383:A484T	ENSP00000264784:A513T	A	-	1	0	SLC2A9	9437205	1.000000	0.71417	0.999000	0.59377	0.893000	0.52053	1.586000	0.36611	2.937000	0.99478	0.650000	0.86243	GCA	SLC2A9	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt	ENSG00000109667		0.423	SLC2A9-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC2A9	HGNC	protein_coding	OTTHUMT00000207055.1	354	0.28	1	C			9828107	9828107	-1	no_errors	ENST00000264784	ensembl	human	known	69_37n	missense	209	35.09	113	SNP	0.979	T
SLC30A6	55676	genome.wustl.edu	37	2	32396392	32396392	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:32396392delT	ENST00000282587.5	+	2	77	c.40delT	c.(40-42)tttfs	p.F15fs	SLC30A6_ENST00000357055.3_5'UTR|SLC30A6_ENST00000406369.1_Intron|SLC30A6_ENST00000538303.1_Intron|SLC30A6_ENST00000379343.2_Frame_Shift_Del_p.F15fs|SLC30A6_ENST00000435660.1_Frame_Shift_Del_p.F15fs	NM_017964.3	NP_060434.2	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter), member 6	15					cellular protein metabolic process (GO:0044267)|Golgi to endosome transport (GO:0006895)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(4)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					ACAAAGATCCTTTTTTGGCAA	0.333																																						dbGAP											0													108.0	106.0	107.0					2																	32396392		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK055663	CCDS1780.1, CCDS54341.1, CCDS54342.1, CCDS54343.1	2p22.3	2013-05-22			ENSG00000152683	ENSG00000152683		"""Solute carriers"""	19305	protein-coding gene	gene with protein product		611148					Standard	NM_017964		Approved	FLJ31101, ZNT6	uc002rof.2	Q6NXT4	OTTHUMG00000128456	ENST00000282587.5:c.40delT	2.37:g.32396392delT	ENSP00000282587:p.Phe15fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM45|B7Z901|Q8N5C9|Q96NC3	Frame_Shift_Del	DEL	pfam_Cation_efflux,tigrfam_Cation_efflux	p.F15fs	ENST00000282587.5	37	c.40	CCDS1780.1	2																																																																																			SLC30A6	-	NULL	ENSG00000152683		0.333	SLC30A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A6	HGNC	protein_coding	OTTHUMT00000250254.2	395	0.25	1	T			32396392	32396392	+1	no_errors	ENST00000282587	ensembl	human	known	69_37n	frame_shift_del	543	10.80	66	DEL	1.000	-
SLC34A2	10568	genome.wustl.edu	37	4	25675985	25675985	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:25675985C>A	ENST00000382051.3	+	11	1334	c.1284C>A	c.(1282-1284)ttC>ttA	p.F428L	SLC34A2_ENST00000503434.1_Missense_Mutation_p.F427L|SLC34A2_ENST00000504570.1_Missense_Mutation_p.F427L	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	428					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				GCATGACCTTCATCGTACAGA	0.562			T	ROS1	NSCLC																																	dbGAP		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0													213.0	170.0	184.0					4																	25675985		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1284C>A	4.37:g.25675985C>A	ENSP00000371483:p.Phe428Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	p.F428L	ENST00000382051.3	37	c.1284	CCDS3435.1	4	.	.	.	.	.	.	.	.	.	.	C	21.6	4.179143	0.78564	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	D;D;D	0.84873	-1.91;-1.91;-1.91	5.2	4.34	0.51931	.	0.000000	0.85682	D	0.000000	D	0.85716	0.5761	L	0.47016	1.485	0.58432	D	0.999992	P;B	0.48640	0.913;0.289	P;B	0.55112	0.769;0.344	D	0.83652	0.0156	10	0.36615	T	0.2	-23.3141	11.0028	0.47616	0.0:0.8524:0.0:0.1476	.	427;428	O95436-2;O95436	.;NPT2B_HUMAN	L	427;428;427	ENSP00000425501:F427L;ENSP00000371483:F428L;ENSP00000423021:F427L	ENSP00000371483:F428L	F	+	3	2	SLC34A2	25285083	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	1.016000	0.29976	2.596000	0.87737	0.561000	0.74099	TTC	SLC34A2	-	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	ENSG00000157765		0.562	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	HGNC	protein_coding	OTTHUMT00000214990.1	189	0.00	0	C	NM_006424		25675985	25675985	+1	no_errors	ENST00000382051	ensembl	human	known	69_37n	missense	202	10.18	23	SNP	1.000	A
SLC9A1	6548	genome.wustl.edu	37	1	27440699	27440699	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:27440699delC	ENST00000263980.3	-	2	1006	c.431delG	c.(430-432)ggcfs	p.G144fs	SLC9A1_ENST00000545949.1_Intron|SLC9A1_ENST00000374086.3_Frame_Shift_Del_p.G144fs	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	144					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)			central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	CTTGATCAGGCCCCCCACCAG	0.627																																						dbGAP											0													55.0	54.0	55.0					1																	27440699		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.431delG	1.37:g.27440699delC	ENSP00000263980:p.Gly144fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALD6|D3DPL4|Q96EM2	Frame_Shift_Del	DEL	pfam_Cation/H_exchanger,prints_Na/H_exchanger_1,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.G144fs	ENST00000263980.3	37	c.431	CCDS295.1	1																																																																																			SLC9A1	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000090020		0.627	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	HGNC	protein_coding	OTTHUMT00000012336.2	35	0.00	0	C	NM_003047		27440699	27440699	-1	no_errors	ENST00000263980	ensembl	human	known	69_37n	frame_shift_del	29	26.83	11	DEL	1.000	-
SLC9A7P1	121456	genome.wustl.edu	37	12	98850411	98850412	+	RNA	INS	-	-	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:98850411_98850412insG	ENST00000554295.1	-	0	511_512					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1																		TGATCTTGCCAGGGCTGATTTC	0.416																																						dbGAP											0																																										-	-	-			0					12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98850414_98850414dupG		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			SLC9A7P1	-	-	ENSG00000227825		0.416	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1	53	0.00	0	-			98850411	98850412	-1	no_errors	ENST00000554295	ensembl	human	putative	69_37n	rna	73	13.10	11	INS	0.990:0.994	G
SLCO1B1	10599	genome.wustl.edu	37	12	21377736	21377736	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:21377736C>T	ENST00000256958.2	+	14	1924	c.1828C>T	c.(1828-1830)Cgt>Tgt	p.R610C		NM_006446.4	NP_006437.3	Q9Y6L6	SO1B1_HUMAN	solute carrier organic anion transporter family, member 1B1	610					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|pancreas(1)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)	70					Acetylcysteine(DB06151)|Aminohippurate(DB00345)|Atorvastatin(DB01076)|Axitinib(DB06626)|Benzylpenicillin(DB01053)|Bezafibrate(DB01393)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dextrothyroxine(DB00509)|Digoxin(DB00390)|Dinoprostone(DB00917)|Eltrombopag(DB06210)|Estradiol(DB00783)|Estrone(DB00655)|Ezetimibe(DB00973)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Gemfibrozil(DB01241)|Indinavir(DB00224)|Irinotecan(DB00762)|L-Carnitine(DB00583)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nelfinavir(DB00220)|Olmesartan(DB00275)|Ouabain(DB01092)|Pantoprazole(DB00213)|Pazopanib(DB06589)|Penicillamine(DB00859)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Quinidine(DB00908)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Rosuvastatin(DB01098)|Saquinavir(DB01232)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sumatriptan(DB00669)|Valsartan(DB00177)|Verapamil(DB00661)	CTGTGGCACACGTGGGTCATG	0.338																																						dbGAP											0													146.0	139.0	142.0					12																	21377736		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8685.1	12p12	2013-05-22	2003-11-25	2003-11-26	ENSG00000134538	ENSG00000134538		"""Solute carriers"""	10959	protein-coding gene	gene with protein product		604843	"""solute carrier family 21 (organic anion transporter), member 6"""	SLC21A6		10358072	Standard	NM_006446		Approved	OATP-C, LST-1, OATP1B1	uc001req.4	Q9Y6L6	OTTHUMG00000169047	ENST00000256958.2:c.1828C>T	12.37:g.21377736C>T	ENSP00000256958:p.Arg610Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7G2|Q29R64|Q9NQ37|Q9UBF3|Q9UH89	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.R610C	ENST00000256958.2	37	c.1828	CCDS8685.1	12	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102188	0.37048	.	.	ENSG00000134538	ENST00000256958	T	0.43688	0.94	3.66	0.352	0.16051	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.504191	0.20573	N	0.089697	T	0.62636	0.2444	M	0.86805	2.84	0.18873	N	0.999989	D	0.76494	0.999	D	0.67900	0.954	T	0.55617	-0.8113	10	0.87932	D	0	.	10.0055	0.41955	0.5235:0.4765:0.0:0.0	.	610	Q9Y6L6	SO1B1_HUMAN	C	610	ENSP00000256958:R610C	ENSP00000256958:R610C	R	+	1	0	SLCO1B1	21269003	0.000000	0.05858	0.001000	0.08648	0.084000	0.17831	0.152000	0.16302	0.202000	0.20498	-0.518000	0.04402	CGT	SLCO1B1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000134538		0.338	SLCO1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO1B1	HGNC	protein_coding	OTTHUMT00000402070.1	425	0.00	0	C	NM_006446		21377736	21377736	+1	no_errors	ENST00000256958	ensembl	human	known	69_37n	missense	239	44.29	190	SNP	0.010	T
SLTM	79811	genome.wustl.edu	37	15	59182525	59182526	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:59182525_59182526delTC	ENST00000380516.2	-	15	2120_2121	c.2033_2034delGA	c.(2032-2034)agafs	p.R678fs	AC025918.2_ENST00000452467.1_RNA|SLTM_ENST00000536328.1_Frame_Shift_Del_p.R247fs	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	678	Arg/Glu-rich.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						CGCGTTCCATTCTCTCTCTCTC	0.431																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.2033_2034delGA	15.37:g.59182535_59182536delTC	ENSP00000369887:p.Arg678fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Frame_Shift_Del	DEL	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.R678fs	ENST00000380516.2	37	c.2034_2033	CCDS10168.2	15																																																																																			SLTM	-	NULL	ENSG00000137776		0.431	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1	247	0.00	0	TC	NM_024755		59182525	59182526	-1	no_errors	ENST00000380516	ensembl	human	known	69_37n	frame_shift_del	228	10.51	27	DEL	0.999:1.000	-
SMC4	10051	genome.wustl.edu	37	3	160131390	160131390	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:160131390A>G	ENST00000357388.3	+	8	1561	c.1110A>G	c.(1108-1110)aaA>aaG	p.K370K	SMC4_ENST00000360111.2_Silent_p.K370K|SMC4_ENST00000462787.1_Silent_p.K370K|SMC4_ENST00000344722.5_Silent_p.K370K|RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000469762.1_Silent_p.K345K	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	370					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AAGATGTAAAAGATACAGAAA	0.249																																						dbGAP											0													24.0	25.0	25.0					3																	160131390		2137	4255	6392	-	-	-	SO:0001819	synonymous_variant	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.1110A>G	3.37:g.160131390A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Silent	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.K370	ENST00000357388.3	37	c.1110	CCDS3189.1	3																																																																																			SMC4	-	pfam_RecF/RecN/SMC	ENSG00000113810		0.249	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	195	0.00	0	A			160131390	160131390	+1	no_errors	ENST00000344722	ensembl	human	known	69_37n	silent	159	30.87	71	SNP	1.000	G
SORBS1	10580	genome.wustl.edu	37	10	97170460	97170460	+	Silent	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:97170460G>A	ENST00000361941.3	-	8	911	c.885C>T	c.(883-885)agC>agT	p.S295S	SORBS1_ENST00000353505.5_Silent_p.S226S|SORBS1_ENST00000371239.1_Silent_p.S140S|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000371245.3_Silent_p.S226S|SORBS1_ENST00000371249.2_Silent_p.S263S|SORBS1_ENST00000371227.4_Silent_p.S295S|SORBS1_ENST00000354106.3_Silent_p.S286S|SORBS1_ENST00000371247.2_Silent_p.S295S|SORBS1_ENST00000347291.4_Silent_p.S163S|SORBS1_ENST00000371241.1_Silent_p.S131S|SORBS1_ENST00000393949.1_Silent_p.S286S|SORBS1_ENST00000306402.6_Silent_p.S172S|SORBS1_ENST00000277982.5_Silent_p.S295S|SORBS1_ENST00000607232.1_Silent_p.S140S|SORBS1_ENST00000371246.2_Silent_p.S295S	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		ATGAAGGCTTGCTAACTGATG	0.453																																						dbGAP											0													139.0	121.0	127.0					10																	97170460		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.885C>T	10.37:g.97170460G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.S295	ENST00000361941.3	37	c.885	CCDS31255.1	10																																																																																			SORBS1	-	NULL	ENSG00000095637		0.453	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	211	0.00	0	G			97170460	97170460	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	silent	190	15.56	35	SNP	1.000	A
SOX15	6665	genome.wustl.edu	37	17	7491760	7491760	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:7491760delG	ENST00000250055.2	-	2	1131	c.638delC	c.(637-639)cctfs	p.P213fs	FXR2_ENST00000573057.1_5'Flank|SOX15_ENST00000538513.2_Frame_Shift_Del_p.P213fs|MPDU1_ENST00000423172.2_Intron	NM_006942.1	NP_008873.1	O60248	SOX15_HUMAN	SRY (sex determining region Y)-box 15	213					cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|male gonad development (GO:0008584)|myoblast development (GO:0048627)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G0 to G1 transition (GO:0070318)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014718)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|skeletal muscle tissue regeneration (GO:0043403)	cytoplasm (GO:0005737)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)	2						GGGAGAGCCAGGGGGCAGGTA	0.637																																						dbGAP											0													116.0	129.0	125.0					17																	7491760		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ006222	CCDS32549.1	17p13.1	2014-08-12	2002-07-22	2002-07-26	ENSG00000129194	ENSG00000129194		"""SRY (sex determining region Y)-boxes"""	11196	protein-coding gene	gene with protein product		601297	"""SRY (sex determining region Y)-box 20"""	SOX20		8978787, 9730625	Standard	NM_006942		Approved	SOX27, SOX26	uc002ghz.1	O60248	OTTHUMG00000178146	ENST00000250055.2:c.638delC	17.37:g.7491760delG	ENSP00000355354:p.Pro213fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWU7|D3DTQ0|P35717|Q9Y6W7	Frame_Shift_Del	DEL	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.P213fs	ENST00000250055.2	37	c.638	CCDS32549.1	17																																																																																			SOX15	-	NULL	ENSG00000129194		0.637	SOX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX15	HGNC	protein_coding	OTTHUMT00000440757.1	193	0.00	0	G	NM_006942		7491760	7491760	-1	no_errors	ENST00000250055	ensembl	human	known	69_37n	frame_shift_del	81	57.92	117	DEL	0.784	-
SPDYC	387778	genome.wustl.edu	37	11	64938932	64938932	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:64938932G>A	ENST00000377185.2	+	2	243	c.161G>A	c.(160-162)cGc>cAc	p.R54H	AP003068.18_ENST00000534819.1_RNA	NM_001008778.1	NP_001008778.1			speedy/RINGO cell cycle regulator family member C											breast(1)|endometrium(3)|large_intestine(2)|lung(9)|prostate(1)	16						CTCCGTTTTCGCCAGCACCAG	0.617																																						dbGAP											0													33.0	30.0	31.0					11																	64938932		2201	4297	6498	-	-	-	SO:0001583	missense	0			AY820305	CCDS31606.1	11q13.1	2013-05-08	2013-05-08		ENSG00000204710	ENSG00000204710		"""Speedy homologs"""	32681	protein-coding gene	gene with protein product		614030	"""speedy homolog C (Xenopus laevis)"""			15611625	Standard	NM_001008778		Approved	Ringo2	uc010rnz.2	Q5MJ68	OTTHUMG00000165611	ENST00000377185.2:c.161G>A	11.37:g.64938932G>A	ENSP00000366390:p.Arg54His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.R54H	ENST00000377185.2	37	c.161	CCDS31606.1	11	.	.	.	.	.	.	.	.	.	.	G	11.18	1.561620	0.27915	.	.	ENSG00000204710	ENST00000377185	.	.	.	4.09	-5.17	0.02849	.	0.911338	0.08837	U	0.886362	T	0.14917	0.0360	N	0.17082	0.46	0.09310	N	1	B	0.18610	0.029	B	0.06405	0.002	T	0.28004	-1.0057	9	0.15066	T	0.55	.	3.5411	0.07811	0.3655:0.0:0.2312:0.4033	.	54	Q5MJ68	SPDYC_HUMAN	H	54	.	ENSP00000366390:R54H	R	+	2	0	SPDYC	64695508	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.233000	0.01204	-0.904000	0.03876	-0.140000	0.14226	CGC	SPDYC	-	NULL	ENSG00000204710		0.617	SPDYC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPDYC	HGNC	protein_coding	OTTHUMT00000385299.1	63	0.00	0	G	NM_001008778		64938932	64938932	+1	no_errors	ENST00000377185	ensembl	human	known	69_37n	missense	38	38.71	24	SNP	0.000	A
SPEN	23013	genome.wustl.edu	37	1	16259042	16259043	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:16259042_16259043insG	ENST00000375759.3	+	11	6511_6512	c.6307_6308insG	c.(6307-6309)aggfs	p.R2103fs		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	2103					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		TGTCAGTCCCAGGGGGGCTGCA	0.51																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.6313dupG	1.37:g.16259048_16259048dupG	ENSP00000364912:p.Arg2103fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.A2105fs	ENST00000375759.3	37	c.6307_6308	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.510	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	107	0.00	0	-	NM_015001		16259042	16259043	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_ins	90	15.89	17	INS	0.000:0.000	G
SQSTM1	8878	genome.wustl.edu	37	5	179260660	179260660	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr5:179260660C>T	ENST00000389805.4	+	7	1221	c.1043C>T	c.(1042-1044)cCg>cTg	p.P348L	SQSTM1_ENST00000376929.3_Missense_Mutation_p.P264L|SQSTM1_ENST00000402874.3_Missense_Mutation_p.P264L|SQSTM1_ENST00000360718.5_Missense_Mutation_p.P264L|SQSTM1_ENST00000510187.1_Intron	NM_003900.4	NP_003891.1	Q13501	SQSTM_HUMAN	sequestosome 1	348	Interaction with NTRK1. {ECO:0000250}.				apoptotic signaling pathway (GO:0097190)|autophagy (GO:0006914)|cell differentiation (GO:0030154)|endosomal transport (GO:0016197)|immune system process (GO:0002376)|intracellular signal transduction (GO:0035556)|macroautophagy (GO:0016236)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein heterooligomerization (GO:0051291)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of Ras protein signal transduction (GO:0046578)|response to stress (GO:0006950)|ubiquitin-dependent protein catabolic process (GO:0006511)	aggresome (GO:0016235)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)|lysosome (GO:0005764)|nucleoplasm (GO:0005654)|PML body (GO:0016605)|pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|receptor tyrosine kinase binding (GO:0030971)|SH2 domain binding (GO:0042169)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)		SQSTM1/ALK(2)	NS(1)|breast(1)|endometrium(1)|large_intestine(2)|liver(2)|lung(5)|ovary(1)	13	all_cancers(89;0.000205)|all_epithelial(37;7.15e-05)|Renal(175;0.000159)|Lung NSC(126;0.00136)|all_lung(126;0.00243)	all_cancers(40;0.0395)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GAAGTGGACCCGTCTACAGGT	0.547																																						dbGAP											0													94.0	88.0	90.0					5																	179260660		2203	4300	6503	-	-	-	SO:0001583	missense	0			U46751	CCDS34317.1, CCDS47355.1	5q35	2008-02-05	2004-04-15		ENSG00000161011	ENSG00000161011			11280	protein-coding gene	gene with protein product		601530	"""Paget disease of bone 3"", ""oxidative stress induced like"""	PDB3, OSIL		8650207, 8551575	Standard	NM_003900		Approved	p62, p60, p62B, A170	uc003mkw.4	Q13501	OTTHUMG00000150643	ENST00000389805.4:c.1043C>T	5.37:g.179260660C>T	ENSP00000374455:p.Pro348Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFN7|B2R661|B3KUW5|Q13446|Q9BUV7|Q9BVS6|Q9UEU1	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_OPR_PB1,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.P348L	ENST00000389805.4	37	c.1043	CCDS34317.1	5	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833101	0.91036	.	.	ENSG00000161011	ENST00000376929;ENST00000389805;ENST00000454378;ENST00000402874;ENST00000360718	D;D;D;D	0.96136	-3.92;-3.92;-3.92;-3.92	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	D	0.97081	0.9046	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.73708	0.981	D	0.96120	0.9084	10	0.29301	T	0.29	-19.9038	17.8688	0.88804	0.0:1.0:0.0:0.0	.	348	Q13501	SQSTM_HUMAN	L	264;348;204;264;264	ENSP00000366128:P264L;ENSP00000374455:P348L;ENSP00000385553:P264L;ENSP00000353944:P264L	ENSP00000353944:P264L	P	+	2	0	SQSTM1	179193266	1.000000	0.71417	0.959000	0.39883	0.804000	0.45430	7.266000	0.78452	2.452000	0.82932	0.561000	0.74099	CCG	SQSTM1	-	NULL	ENSG00000161011		0.547	SQSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SQSTM1	HGNC	protein_coding	OTTHUMT00000319344.1	104	0.95	1	C			179260660	179260660	+1	no_errors	ENST00000389805	ensembl	human	known	69_37n	missense	79	42.34	58	SNP	1.000	T
SRGAP2	23380	genome.wustl.edu	37	1	206611342	206611342	+	Silent	SNP	C	C	T	rs534685024		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:206611342C>T	ENST00000414007.1	+	12	1242	c.1242C>T	c.(1240-1242)aaC>aaT	p.N414N	SRGAP2_ENST00000419187.2_5'UTR			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	554	F-BAR domain.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.N414N(1)		NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					GGGACCAGAACGACCATGACA	0.547																																						dbGAP											1	Substitution - coding silent(1)	prostate(1)											100.0	102.0	101.0					1																	206611342		1903	4114	6017	-	-	-	SO:0001819	synonymous_variant	0			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.1242C>T	1.37:g.206611342C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_RhoGAP_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.R468*	ENST00000414007.1	37	c.1402		1	.	.	.	.	.	.	.	.	.	.	C	8.516	0.867630	0.17250	.	.	ENSG00000163486	ENST00000295713	.	.	.	6.03	-0.334	0.12666	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	11.8015	0.52130	0.0:0.3595:0.0:0.6405	.	.	.	.	X	468	.	.	R	+	1	2	SRGAP2	204677965	0.710000	0.27896	1.000000	0.80357	0.875000	0.50365	-0.161000	0.10026	0.167000	0.19631	-1.105000	0.02106	CGA	SRGAP2	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000163486		0.547	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	HGNC	protein_coding		162	0.00	0	C	NM_015326		206611342	206611342	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000295713	ensembl	human	known	69_37n	nonsense	126	31.15	57	SNP	0.995	T
JMJD8	339123	genome.wustl.edu	37	16	731505	731507	+	IGR	DEL	GAA	GAA	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	GAA	GAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:731505_731507delGAA	ENST00000293882.4	-	0	2123				STUB1_ENST00000566181.2_3'UTR|LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000564370.1_In_Frame_Del_p.K73del|STUB1_ENST00000219548.4_In_Frame_Del_p.K145del|LA16c-313D11.9_ENST00000567091.1_RNA|STUB1_ENST00000565677.1_In_Frame_Del_p.K73del			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						TTCGAATCGCGAAGAAGAAGCGC	0.631																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16			16.37:g.731511_731513delGAA		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	In_Frame_Del	DEL	pfam_Ubox_domain,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ubox_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K145in_frame_del	ENST00000293882.4	37	c.426_428		16																																																																																			STUB1	-	NULL	ENSG00000103266		0.631	JMJD8-201	KNOWN	basic	protein_coding	STUB1	HGNC	protein_coding		14	0.00	0	GAA	NM_001005920		731505	731507	+1	no_errors	ENST00000219548	ensembl	human	known	69_37n	in_frame_del	11	35.29	6	DEL	1.000:1.000:1.000	-
SUPT6H	6830	genome.wustl.edu	37	17	27027201	27027202	+	In_Frame_Ins	INS	-	-	AGC			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:27027201_27027202insAGC	ENST00000314616.6	+	34	4855_4856	c.4572_4573insAGC	c.(4573-4575)agc>AGCagc	p.1525_1525S>SS	SUPT6H_ENST00000347486.4_In_Frame_Ins_p.1525_1525S>SS	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)	1525	Poly-Ser.				chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					GCATCACCCCTAGCAGCAGCAG	0.535																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.4582_4584dupAGC	17.37:g.27027208_27027210dupAGC	ENSP00000319104:p.Ser1528dup	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	In_Frame_Ins	INS	pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_SH2,superfamily_NA-bd_OB-fold-like,smart_YqgF/RNaseH-like_dom,smart_RNA-binding_domain_S1,smart_SH2,pirsf_TF_Spt6,pfscan_SH2,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.1528in_frame_insS	ENST00000314616.6	37	c.4572_4573	CCDS32596.1	17																																																																																			SUPT6H	-	pirsf_TF_Spt6	ENSG00000109111		0.535	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	96	0.00	0	-	NM_003170		27027201	27027202	+1	no_errors	ENST00000314616	ensembl	human	known	69_37n	in_frame_ins	111	18.98	26	INS	1.000:1.000	AGC
TACC2	10579	genome.wustl.edu	37	10	123844494	123844494	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:123844494G>C	ENST00000369005.1	+	4	2819	c.2479G>C	c.(2479-2481)Gag>Cag	p.E827Q	TACC2_ENST00000334433.3_Missense_Mutation_p.E827Q|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000453444.2_Missense_Mutation_p.E827Q|TACC2_ENST00000515603.1_Missense_Mutation_p.E827Q|TACC2_ENST00000515273.1_Missense_Mutation_p.E827Q	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	827					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				ACTATCTTCTGAGAAGCATCT	0.562																																						dbGAP											0													117.0	117.0	117.0					10																	123844494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.2479G>C	10.37:g.123844494G>C	ENSP00000358001:p.Glu827Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.E827Q	ENST00000369005.1	37	c.2479	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	G	10.23	1.293637	0.23564	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.04406	3.71;3.63;3.63;3.71;3.63	5.68	-1.18	0.09617	.	0.933983	0.08778	N	0.895202	T	0.02649	0.0080	N	0.12746	0.255	0.09310	N	1	B;B;B	0.24721	0.11;0.11;0.11	B;B;B	0.23150	0.044;0.044;0.044	T	0.45556	-0.9253	10	0.46703	T	0.11	-7.8184	3.6592	0.08232	0.1433:0.3628:0.3698:0.1242	.	827;827;827	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	Q	827;827;827;827;827;817	ENSP00000358001:E827Q;ENSP00000424467:E827Q;ENSP00000427618:E827Q;ENSP00000334280:E827Q;ENSP00000395048:E827Q	ENSP00000334280:E827Q	E	+	1	0	TACC2	123834484	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	-0.037000	0.12164	-0.173000	0.10761	0.561000	0.74099	GAG	TACC2	-	NULL	ENSG00000138162		0.562	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	135	0.00	0	G			123844494	123844494	+1	no_errors	ENST00000334433	ensembl	human	known	69_37n	missense	149	10.24	17	SNP	0.000	C
TAS2R10	50839	genome.wustl.edu	37	12	10978282	10978282	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:10978282delA	ENST00000240619.2	-	1	675	c.587delT	c.(586-588)ttafs	p.L196fs		NM_023921.1	NP_076410.1	Q9NYW0	T2R10_HUMAN	taste receptor, type 2, member 10	196					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(1)|large_intestine(7)|lung(5)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	17						GGAAATGATTAAAAAAATACA	0.348																																						dbGAP											0													68.0	70.0	69.0					12																	10978282		2203	4296	6499	-	-	-	SO:0001589	frameshift_variant	0			AF227136	CCDS8634.1	12p13	2012-08-22			ENSG00000121318	ENSG00000121318		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14918	protein-coding gene	gene with protein product		604791				10761934, 10766242	Standard	NM_023921		Approved	T2R10, TRB2	uc001qyy.1	Q9NYW0	OTTHUMG00000168508	ENST00000240619.2:c.587delT	12.37:g.10978282delA	ENSP00000240619:p.Leu196fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIM9|Q6NTD9	Frame_Shift_Del	DEL	pfam_TAS2_rcpt	p.L196fs	ENST00000240619.2	37	c.587	CCDS8634.1	12																																																																																			TAS2R10	-	pfam_TAS2_rcpt	ENSG00000121318		0.348	TAS2R10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R10	HGNC	protein_coding	OTTHUMT00000399934.1	63	0.00	0	A			10978282	10978282	-1	no_errors	ENST00000240619	ensembl	human	known	69_37n	frame_shift_del	32	24.44	11	DEL	0.009	-
TBC1D10C	374403	genome.wustl.edu	37	11	67171808	67171808	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:67171808C>T	ENST00000542590.1	+	1	149	c.135C>T	c.(133-135)ggC>ggT	p.G45G	PPP1CA_ENST00000532446.1_5'Flank|PPP1CA_ENST00000312989.7_5'Flank|PPP1CA_ENST00000358239.4_5'Flank|TBC1D10C_ENST00000312390.5_Silent_p.G45G|TBC1D10C_ENST00000526387.1_Silent_p.G45G|PPP1CA_ENST00000376745.4_5'Flank			Q8IV04	TB10C_HUMAN	TBC1 domain family, member 10C	45					retrograde transport, endosome to Golgi (GO:0042147)	filopodium membrane (GO:0031527)|membrane (GO:0016020)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	16			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			TCATTGGGGGCAGCTCAGCAG	0.662																																						dbGAP											0													20.0	24.0	23.0					11																	67171808		2195	4282	6477	-	-	-	SO:0001819	synonymous_variant	0			BC035630	CCDS8162.1, CCDS58150.1	11q13.1	2013-07-09			ENSG00000175463	ENSG00000175463			24702	protein-coding gene	gene with protein product		610831				17230191, 20404108	Standard	NM_001256508		Approved	FLJ00332, Carabin, EPI64C	uc001ola.4	Q8IV04	OTTHUMG00000167139	ENST00000542590.1:c.135C>T	11.37:g.67171808C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G3V1D6	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.G45	ENST00000542590.1	37	c.135	CCDS8162.1	11																																																																																			TBC1D10C	-	NULL	ENSG00000175463		0.662	TBC1D10C-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10C	HGNC	protein_coding	OTTHUMT00000395492.2	19	0.00	0	C	NM_198517		67171808	67171808	+1	no_errors	ENST00000312390	ensembl	human	known	69_37n	silent	8	42.86	6	SNP	0.999	T
TBC1D21	161514	genome.wustl.edu	37	15	74177124	74177124	+	Missense_Mutation	SNP	C	C	T	rs375612647		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:74177124C>T	ENST00000300504.2	+	5	453	c.370C>T	c.(370-372)Cgt>Tgt	p.R124C	TBC1D21_ENST00000562056.1_Intron|TBC1D21_ENST00000535547.2_Missense_Mutation_p.R88C	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	124	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.	Arginine finger. {ECO:0000250}.				acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						CAACCTAGCACGTGACATTCA	0.522																																						dbGAP											0													91.0	72.0	78.0					15																	74177124		2198	4297	6495	-	-	-	SO:0001583	missense	0			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.370C>T	15.37:g.74177124C>T	ENSP00000300504:p.Arg124Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6M2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R124C	ENST00000300504.2	37	c.370	CCDS10252.1	15	.	.	.	.	.	.	.	.	.	.	C	12.71	2.019889	0.35606	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	T;T	0.04654	3.58;3.58	5.45	4.33	0.51752	Rab-GAP/TBC domain (4);	0.857947	0.10206	N	0.702697	T	0.04092	0.0114	N	0.19112	0.55	0.20764	N	0.999855	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.40869	-0.9540	10	0.56958	D	0.05	.	6.5965	0.22677	0.0:0.1186:0.0:0.8814	.	88;124	B9A6M2;Q8IYX1	.;TBC21_HUMAN	C	124;88	ENSP00000300504:R124C;ENSP00000439325:R88C	ENSP00000300504:R124C	R	+	1	0	TBC1D21	71964177	0.002000	0.14202	0.001000	0.08648	0.266000	0.26442	1.110000	0.31147	0.896000	0.36366	0.561000	0.74099	CGT	TBC1D21	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167139		0.522	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D21	HGNC	protein_coding	OTTHUMT00000268994.1	60	0.00	0	C	NM_153356		74177124	74177124	+1	no_errors	ENST00000300504	ensembl	human	known	69_37n	missense	33	44.07	26	SNP	0.003	T
TBCD	6904	genome.wustl.edu	37	17	80895232	80895232	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:80895232G>A	ENST00000355528.4	+	35	3407	c.3277G>A	c.(3277-3279)Gca>Aca	p.A1093T	TBCD_ENST00000539345.2_Missense_Mutation_p.A1093T	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	1093					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			GTCAGGCATCGCAGTGTGAGT	0.547																																						dbGAP											0													75.0	77.0	76.0					17																	80895232		2032	4188	6220	-	-	-	SO:0001583	missense	0			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.3277G>A	17.37:g.80895232G>A	ENSP00000347719:p.Ala1093Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Missense_Mutation	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.A1093T	ENST00000355528.4	37	c.3277	CCDS45818.1	17	.	.	.	.	.	.	.	.	.	.	G	2.918	-0.223736	0.06061	.	.	ENSG00000141556	ENST00000355528;ENST00000334614;ENST00000539345	T	0.18174	2.23	4.77	0.309	0.15820	Armadillo-type fold (1);	0.390922	0.25887	N	0.027653	T	0.15046	0.0363	M	0.72479	2.2	0.26649	N	0.97213	P;P;P	0.43750	0.628;0.816;0.811	B;B;B	0.37267	0.165;0.124;0.245	T	0.12426	-1.0548	9	.	.	.	.	6.2264	0.20710	0.0729:0.1152:0.5771:0.2347	.	844;1093;1093	F8WC00;Q9BTW9;Q9BTW9-4	.;TBCD_HUMAN;.	T	1093;844;85	ENSP00000347719:A1093T	.	A	+	1	0	TBCD	78488521	0.895000	0.30542	0.000000	0.03702	0.000000	0.00434	1.976000	0.40579	-0.307000	0.08804	-1.978000	0.00458	GCA	TBCD	-	superfamily_ARM-type_fold	ENSG00000141556		0.547	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	103	0.00	0	G	NM_005993		80895232	80895232	+1	no_errors	ENST00000355528	ensembl	human	known	69_37n	missense	103	25.71	36	SNP	0.003	A
TBX5	6910	genome.wustl.edu	37	12	114804192	114804193	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr12:114804192_114804193insA	ENST00000310346.4	-	8	1425_1426	c.759_760insT	c.(757-762)aaagaafs	p.E254fs	TBX5_ENST00000405440.2_Frame_Shift_Ins_p.E254fs|TBX5_ENST00000349716.5_Frame_Shift_Ins_p.E204fs|TBX5_ENST00000526441.1_Frame_Shift_Ins_p.E254fs	NM_000192.3	NP_000183.2	Q99593	TBX5_HUMAN	T-box 5	254					apoptotic nuclear changes (GO:0030262)|atrial septum morphogenesis (GO:0060413)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His development (GO:0003166)|cardiac left ventricle formation (GO:0003218)|cardiac muscle cell differentiation (GO:0055007)|cell migration involved in coronary vasculogenesis (GO:0060980)|cell-cell signaling (GO:0007267)|embryonic forelimb morphogenesis (GO:0035115)|embryonic limb morphogenesis (GO:0030326)|endocardial cushion development (GO:0003197)|forelimb morphogenesis (GO:0035136)|gene expression (GO:0010467)|heart development (GO:0007507)|lung development (GO:0030324)|morphogenesis of an epithelium (GO:0002009)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|pattern specification process (GO:0007389)|pericardium development (GO:0060039)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cardioblast differentiation (GO:0051891)|positive regulation of secondary heart field cardioblast proliferation (GO:0072513)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of execution phase of apoptosis (GO:1900117)|transcription initiation from RNA polymerase II promoter (GO:0006367)|ventricular cardiac muscle tissue development (GO:0003229)|ventricular septum development (GO:0003281)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(29)|ovary(6)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0893)		ACGGGATATTCTTTACTGAAAG	0.5																																					NSCLC(152;1358 1980 4050 23898 40356)	dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U89353	CCDS9173.1, CCDS9174.1	12q24.1	2014-09-17			ENSG00000089225	ENSG00000089225		"""T-boxes"""	11604	protein-coding gene	gene with protein product		601620		HOS		8988165, 8054982	Standard	NM_000192		Approved		uc001tvo.4	Q99593	OTTHUMG00000166191	ENST00000310346.4:c.759_760insT	12.37:g.114804192_114804193insA	ENSP00000309913:p.Glu254fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND77|O15301|Q96TB0|Q9Y4I2	Frame_Shift_Ins	INS	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,prints_TF_T-box,pfscan_TF_T-box	p.E253fs	ENST00000310346.4	37	c.760_759	CCDS9173.1	12																																																																																			TBX5	-	NULL	ENSG00000089225		0.500	TBX5-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TBX5	HGNC	protein_coding	OTTHUMT00000388297.1	53	0.00	0	-	NM_080717		114804192	114804193	-1	no_errors	ENST00000310346	ensembl	human	known	69_37n	frame_shift_ins	34	10.53	4	INS	1.000:1.000	A
TFE3	7030	genome.wustl.edu	37	X	48887952	48887952	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:48887952delC	ENST00000315869.7	-	10	1704	c.1445delG	c.(1444-1446)ggafs	p.G482fs	TFE3_ENST00000487451.1_5'Flank	NM_006521.4	NP_006512.2	P19532	TFE3_HUMAN	transcription factor binding to IGHM enhancer 3	482					humoral immune response (GO:0006959)|positive regulation of cell adhesion (GO:0045785)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of osteoclast differentiation (GO:0045670)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)		NONO/TFE3(2)|PRCC/TFE3(25)|SFPQ/TFE3(6)|CLTC/TFE3(2)|ASPSCR1/TFE3(167)	central_nervous_system(1)	1						CTGGGCAGGTCCCCCCCCTAC	0.647			T	"""SFPQ, ASPSCR1, PRCC, NONO, CLTC"""	"""papillary renal, alveolar soft part sarcoma, renal"""																																	dbGAP		Dom	yes		X	Xp11.22	7030	transcription factor binding to IGHM enhancer 3		E	0													80.0	76.0	78.0					X																	48887952		2203	4299	6502	-	-	-	SO:0001589	frameshift_variant	0			X96717	CCDS14315.3	Xp11.22	2013-05-21			ENSG00000068323	ENSG00000068323		"""Basic helix-loop-helix proteins"""	11752	protein-coding gene	gene with protein product	transcription factor E family, member A	314310				1672758, 1685140	Standard	NM_006521		Approved	TFEA, bHLHe33	uc004dmb.3	P19532	OTTHUMG00000022690	ENST00000315869.7:c.1445delG	X.37:g.48887952delC	ENSP00000314129:p.Gly482fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZL6|Q5JU74|Q92757|Q92758|Q99964	Frame_Shift_Del	DEL	pfam_bHLH_ZIP_TF_MiT/TFE,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.G482fs	ENST00000315869.7	37	c.1445	CCDS14315.3	X																																																																																			TFE3	-	pfam_bHLH_ZIP_TF_MiT/TFE	ENSG00000068323		0.647	TFE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFE3	HGNC	protein_coding	OTTHUMT00000058872.2	56	0.00	0	C	NM_006521		48887952	48887952	-1	no_errors	ENST00000315869	ensembl	human	known	69_37n	frame_shift_del	45	16.36	9	DEL	0.037	-
THBS1	7057	genome.wustl.edu	37	15	39885373	39885373	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:39885373C>T	ENST00000260356.5	+	18	3105	c.2940C>T	c.(2938-2940)cgC>cgT	p.R980R	CTD-2033D15.1_ENST00000560769.1_RNA	NM_003246.2	NP_003237.2	P07996	TSP1_HUMAN	thrombospondin 1	980	TSP C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00635}.				activation of MAPK activity (GO:0000187)|behavioral response to pain (GO:0048266)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular response to growth factor stimulus (GO:0071363)|cellular response to heat (GO:0034605)|cellular response to tumor necrosis factor (GO:0071356)|chronic inflammatory response (GO:0002544)|endocardial cushion development (GO:0003197)|engulfment of apoptotic cell (GO:0043652)|extracellular matrix organization (GO:0030198)|growth plate cartilage development (GO:0003417)|immune response (GO:0006955)|negative regulation of angiogenesis (GO:0016525)|negative regulation of antigen processing and presentation of peptide or polysaccharide antigen via MHC class II (GO:0002581)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of cGMP-mediated signaling (GO:0010754)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell antigen processing and presentation (GO:0002605)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of plasma membrane long-chain fatty acid transport (GO:0010748)|negative regulation of plasminogen activation (GO:0010757)|outflow tract morphogenesis (GO:0003151)|peptide cross-linking (GO:0018149)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood coagulation (GO:0030194)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of chemotaxis (GO:0050921)|positive regulation of endothelial cell apoptotic process (GO:2000353)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of macrophage activation (GO:0043032)|positive regulation of macrophage chemotaxis (GO:0010759)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive regulation of transforming growth factor beta1 production (GO:0032914)|positive regulation of translation (GO:0045727)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to endoplasmic reticulum stress (GO:0034976)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to magnesium ion (GO:0032026)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|response to testosterone (GO:0033574)|response to unfolded protein (GO:0006986)|sprouting angiogenesis (GO:0002040)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|sarcoplasmic reticulum (GO:0016529)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|collagen V binding (GO:0070052)|fibrinogen binding (GO:0070051)|fibroblast growth factor binding (GO:0017134)|fibronectin binding (GO:0001968)|glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|laminin binding (GO:0043236)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|proteoglycan binding (GO:0043394)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(5)|large_intestine(15)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	53		all_cancers(109;1.35e-17)|all_epithelial(112;2.07e-15)|Lung NSC(122;4.44e-11)|all_lung(180;1.11e-09)|Melanoma(134;0.0574)|Colorectal(260;0.117)|Ovarian(310;0.223)		GBM - Glioblastoma multiforme(113;2.77e-06)|BRCA - Breast invasive adenocarcinoma(123;0.105)		GGGTTGTACGCCATCAGGGTA	0.493																																						dbGAP											0													70.0	63.0	65.0					15																	39885373		2200	4297	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS32194.1	15q15	2009-04-08			ENSG00000137801	ENSG00000137801			11785	protein-coding gene	gene with protein product	"""thrombospondin-1p180"""	188060				2341158, 2335352	Standard	NM_003246		Approved	TSP1, THBS, TSP, THBS-1, TSP-1	uc001zkh.3	P07996	OTTHUMG00000133665	ENST00000260356.5:c.2940C>T	15.37:g.39885373C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H4|B4E3J7|B9EGH6|Q15667|Q59E99	Silent	SNP	pfam_Thrombospondin_C,pfam_Thrombospondin_1_rpt,pfam_VWF_C,pfam_Thrombospondin_3-like_rpt,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Thrombospondin_1_rpt,smart_Laminin_G,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.R980	ENST00000260356.5	37	c.2940	CCDS32194.1	15																																																																																			THBS1	-	pfam_Thrombospondin_C,superfamily_ConA-like_lec_gl	ENSG00000137801		0.493	THBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBS1	HGNC	protein_coding	OTTHUMT00000257831.2	39	0.00	0	C	NM_003246		39885373	39885373	+1	no_errors	ENST00000260356	ensembl	human	known	69_37n	silent	42	37.31	25	SNP	0.977	T
TIRAP	114609	genome.wustl.edu	37	11	126162826	126162826	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr11:126162826C>T	ENST00000392680.2	+	5	927	c.522C>T	c.(520-522)tgC>tgT	p.C174C	TIRAP_ENST00000392678.3_Silent_p.C174C|RP11-712L6.7_ENST00000533378.1_RNA|RP11-712L6.5_ENST00000528876.1_5'Flank|TIRAP_ENST00000392679.1_Silent_p.C174C	NM_001039661.1	NP_001034750.1	P58753	TIRAP_HUMAN	toll-interleukin 1 receptor (TIR) domain containing adaptor protein	174	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				3'-UTR-mediated mRNA stabilization (GO:0070935)|cell surface receptor signaling pathway (GO:0007166)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to lipoteichoic acid (GO:0071223)|defense response to Gram-positive bacterium (GO:0050830)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|myeloid cell differentiation (GO:0030099)|negative regulation of growth of symbiont in host (GO:0044130)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine (C-X-C motif) ligand 1 production (GO:2000340)|positive regulation of chemokine (C-X-C motif) ligand 2 production (GO:2000343)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-15 production (GO:0032738)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of toll-like receptor 2 signaling pathway (GO:0034137)|positive regulation of toll-like receptor 3 signaling pathway (GO:0034141)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of innate immune response (GO:0045088)|regulation of interferon-beta production (GO:0032648)|response to lipopolysaccharide (GO:0032496)|TIRAP-dependent toll-like receptor 4 signaling pathway (GO:0035665)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein binding, bridging (GO:0030674)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)|Toll-like receptor 2 binding (GO:0035663)|Toll-like receptor 4 binding (GO:0035662)			breast(1)|endometrium(1)|large_intestine(2)|ovary(1)|upper_aerodigestive_tract(1)	6	all_hematologic(175;0.145)	Breast(109;0.00156)|Lung NSC(97;0.00948)|all_lung(97;0.0101)|Medulloblastoma(222;0.0425)|all_neural(223;0.0604)		BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0739)		CCGAGGGCTGCACCATCCCCC	0.652																																						dbGAP											0													34.0	37.0	36.0					11																	126162826		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AF378129	CCDS8472.1, CCDS41731.1	11q24.2	2008-02-05	2002-01-14		ENSG00000150455	ENSG00000150455			17192	protein-coding gene	gene with protein product	"""MyD88 adapter-like"""	606252	"""Toll-interleukin 1 receptor (TIR) domain-containing adaptor protein"""			11526399, 11544529	Standard	XM_005271399		Approved	Mal, wyatt	uc001qdl.1	P58753	OTTHUMG00000140373	ENST00000392680.2:c.522C>T	11.37:g.126162826C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW65|Q56UH9|Q56UI0|Q8N5E5	Silent	SNP	pfam_TIR_dom,superfamily_TIR_dom,pirsf_Tol-interleuk_rcpt_adapt_Tirap,pfscan_TIR_dom	p.C174	ENST00000392680.2	37	c.522	CCDS8472.1	11																																																																																			TIRAP	-	superfamily_TIR_dom,pirsf_Tol-interleuk_rcpt_adapt_Tirap	ENSG00000150455		0.652	TIRAP-002	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TIRAP	HGNC	protein_coding	OTTHUMT00000277092.1	61	0.00	0	C	NM_148910		126162826	126162826	+1	no_errors	ENST00000392678	ensembl	human	known	69_37n	silent	52	14.52	9	SNP	1.000	T
TLR9	54106	genome.wustl.edu	37	3	52257017	52257017	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:52257017delC	ENST00000360658.2	-	2	1948	c.1315delG	c.(1315-1317)gagfs	p.E439fs	TLR9_ENST00000597542.1_Frame_Shift_Del_p.E463fs|TLR9_ENST00000494383.1_Frame_Shift_Del_p.G593fs	NM_017442.3	NP_059138.1	Q9NR96	TLR9_HUMAN	toll-like receptor 9	439					defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|maintenance of gastrointestinal epithelium (GO:0030277)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|positive regulation of chemokine production (GO:0032722)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to molecule of bacterial origin (GO:0002237)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			endometrium(4)|large_intestine(11)|lung(9)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;2.41e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)	Chloroquine(DB00608)|Hydroxychloroquine(DB01611)	CCATCTGCCTCCCCCATGGTG	0.657																																						dbGAP											0													74.0	76.0	75.0					3																	52257017		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF259262	CCDS2848.1	3p21.3	2006-02-23			ENSG00000239732	ENSG00000239732		"""CD molecules"""	15633	protein-coding gene	gene with protein product		605474				11022119	Standard	NM_017442		Approved	CD289	uc003ddb.3	Q9NR96	OTTHUMG00000158106	ENST00000360658.2:c.1315delG	3.37:g.52257017delC	ENSP00000353874:p.Glu439fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3Y661|D1CS56|Q6UVZ2|Q9HD68|Q9HD69|Q9HD70|Q9NYC2|Q9NYC3	Frame_Shift_Del	DEL	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_TIR_dom,pfscan_TIR_dom	p.E439fs	ENST00000360658.2	37	c.1315	CCDS2848.1	3																																																																																			TLR9	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000239732		0.657	TLR9-001	KNOWN	basic|CCDS	protein_coding	TLR9	HGNC	protein_coding	OTTHUMT00000350203.1	12	0.00	0	C			52257017	52257017	-1	no_errors	ENST00000360658	ensembl	human	known	69_37n	frame_shift_del	9	50.00	9	DEL	0.133	-
TM2D3	80213	genome.wustl.edu	37	15	102182699	102182699	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:102182699C>A	ENST00000333202.3	-	6	732	c.727G>T	c.(727-729)Ggc>Tgc	p.G243C	TM2D3_ENST00000347970.3_Missense_Mutation_p.G217C|TM2D3_ENST00000428002.2_Intron|TM2D3_ENST00000559107.1_Intron|TM2D3_ENST00000561373.1_Missense_Mutation_p.G178C	NM_078474.2	NP_510883.2	Q9BRN9	TM2D3_HUMAN	TM2 domain containing 3	243						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(6)|ovary(1)	10	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TACAAAGAGCCATCTGCTGGT	0.507																																						dbGAP											0													123.0	126.0	125.0					15																	102182699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094955	CCDS10392.1, CCDS10393.1	15q26.3	2014-02-12			ENSG00000184277	ENSG00000184277			24128	protein-coding gene	gene with protein product		610014				11278849	Standard	XM_005254980		Approved	BLP2, FLJ22604	uc002bxi.3	Q9BRN9	OTTHUMG00000149872	ENST00000333202.3:c.727G>T	15.37:g.102182699C>A	ENSP00000330433:p.Gly243Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDK9|Q9H046|Q9H651	Missense_Mutation	SNP	pfam_TM2	p.G243C	ENST00000333202.3	37	c.727	CCDS10393.1	15	.	.	.	.	.	.	.	.	.	.	C	27.2	4.812604	0.90707	.	.	ENSG00000184277	ENST00000347970;ENST00000333202	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	D	0.87305	0.6144	H	0.95574	3.69	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90778	0.4677	9	0.87932	D	0	-34.0308	16.8956	0.86099	0.0:1.0:0.0:0.0	.	217;243	Q9BRN9-2;Q9BRN9	.;TM2D3_HUMAN	C	217;243	.	ENSP00000330433:G243C	G	-	1	0	TM2D3	100000222	1.000000	0.71417	0.986000	0.45419	0.995000	0.86356	7.546000	0.82137	2.660000	0.90430	0.643000	0.83706	GGC	TM2D3	-	NULL	ENSG00000184277		0.507	TM2D3-002	KNOWN	basic|CCDS	protein_coding	TM2D3	HGNC	protein_coding	OTTHUMT00000313623.1	89	0.00	0	C	NM_078474		102182699	102182699	-1	no_errors	ENST00000333202	ensembl	human	known	69_37n	missense	67	40.18	45	SNP	1.000	A
TMEM74	157753	genome.wustl.edu	37	8	109796495	109796495	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:109796495A>G	ENST00000297459.3	-	2	1011	c.833T>C	c.(832-834)tTc>tCc	p.F278S	TMEM74_ENST00000518838.1_Intron	NM_153015.1	NP_694560.1	Q96NL1	TMM74_HUMAN	transmembrane protein 74	278					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	29			OV - Ovarian serous cystadenocarcinoma(57;3.08e-10)			CCTGAAGTTGAAAGAACCATA	0.438																																						dbGAP											0													86.0	83.0	84.0					8																	109796495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055230	CCDS6310.1	8q23.1	2009-11-06				ENSG00000164841			26409	protein-coding gene	gene with protein product		613935				12477932	Standard	NM_153015		Approved	FLJ30668, NET36	uc003ymy.1	Q96NL1		ENST00000297459.3:c.833T>C	8.37:g.109796495A>G	ENSP00000297459:p.Phe278Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.F278S	ENST00000297459.3	37	c.833	CCDS6310.1	8	.	.	.	.	.	.	.	.	.	.	A	23.5	4.423552	0.83559	.	.	ENSG00000164841	ENST00000297459	.	.	.	5.93	5.93	0.95920	.	0.110972	0.64402	D	0.000011	T	0.74030	0.3663	L	0.51422	1.61	0.49299	D	0.999773	D	0.76494	0.999	D	0.66351	0.943	T	0.76160	-0.3061	9	0.72032	D	0.01	-27.2635	16.3778	0.83412	1.0:0.0:0.0:0.0	.	278	Q96NL1	TMM74_HUMAN	S	278	.	ENSP00000297459:F278S	F	-	2	0	TMEM74	109865671	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.331000	0.96430	2.268000	0.75426	0.519000	0.50382	TTC	TMEM74	-	NULL	ENSG00000164841		0.438	TMEM74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM74	HGNC	protein_coding	OTTHUMT00000380755.1	201	0.00	0	A	NM_153015		109796495	109796495	-1	no_errors	ENST00000297459	ensembl	human	known	69_37n	missense	152	33.91	78	SNP	1.000	G
TMPRSS11F	389208	genome.wustl.edu	37	4	68925078	68925078	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:68925078G>A	ENST00000356291.2	-	9	1183	c.1124C>T	c.(1123-1125)gCt>gTt	p.A375V	RP11-35D5.1_ENST00000600441.1_RNA|UBA6-AS1_ENST00000500538.2_RNA	NM_207407.2	NP_997290.2	Q6ZWK6	TM11F_HUMAN	transmembrane protease, serine 11F	375	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(4)	39						CATGAATCCAGCACATAACAT	0.393																																						dbGAP											0													204.0	177.0	186.0					4																	68925078		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK122625	CCDS3520.1	4q13.2	2010-04-13			ENSG00000198092	ENSG00000198092		"""Serine peptidases / Transmembrane"""	29994	protein-coding gene	gene with protein product							Standard	NM_207407		Approved	FLJ16046	uc003hdt.1	Q6ZWK6	OTTHUMG00000129307	ENST00000356291.2:c.1124C>T	4.37:g.68925078G>A	ENSP00000348639:p.Ala375Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXX2	Missense_Mutation	SNP	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,pfam_SEA,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_SEA,pfscan_Peptidase_S1_S6	p.A375V	ENST00000356291.2	37	c.1124	CCDS3520.1	4	.	.	.	.	.	.	.	.	.	.	G	24.8	4.571717	0.86542	.	.	ENSG00000198092	ENST00000356291	D	0.94966	-3.57	5.2	5.2	0.72013	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.000000	0.50627	D	0.000118	D	0.97228	0.9094	M	0.82323	2.585	0.43703	D	0.996161	D	0.89917	1.0	D	0.80764	0.994	D	0.97662	1.0161	10	0.62326	D	0.03	.	16.225	0.82285	0.0:0.0:1.0:0.0	.	375	Q6ZWK6	TM11F_HUMAN	V	375	ENSP00000348639:A375V	ENSP00000348639:A375V	A	-	2	0	TMPRSS11F	68607673	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	7.212000	0.77941	2.427000	0.82271	0.591000	0.81541	GCT	TMPRSS11F	-	pirsf_Pept_S1A_HAT/DESC1,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000198092		0.393	TMPRSS11F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS11F	HGNC	protein_coding	OTTHUMT00000251439.1	560	0.00	0	G	NM_207407		68925078	68925078	-1	no_errors	ENST00000356291	ensembl	human	known	69_37n	missense	541	13.30	83	SNP	1.000	A
TNKS2	80351	genome.wustl.edu	37	10	93601946	93601946	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:93601946delA	ENST00000371627.4	+	16	2236	c.1857delA	c.(1855-1857)acafs	p.T619fs		NM_025235.3	NP_079511.1	Q9H2K2	TNKS2_HUMAN	tankyrase, TRF1-interacting ankyrin-related ADP-ribose polymerase 2	619					multicellular organism growth (GO:0035264)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of telomere maintenance via telomerase (GO:0032212)|protein ADP-ribosylation (GO:0006471)|protein auto-ADP-ribosylation (GO:0070213)|protein localization to chromosome, telomeric region (GO:0070198)|protein polyubiquitination (GO:0000209)|regulation of multicellular organism growth (GO:0040014)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nuclear chromosome, telomeric region (GO:0000784)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)|perinuclear region of cytoplasm (GO:0048471)	enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)	p.N622fs*29(1)		biliary_tract(1)|breast(1)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(11)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	48		Colorectal(252;0.162)				CAGACCCTACAAAAAAAAACA	0.393																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											66.0	69.0	68.0					10																	93601946		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF342982	CCDS7417.1	10q23.3	2013-01-10			ENSG00000107854	ENSG00000107854		"""Poly (ADP-ribose) polymerases"", ""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15677	protein-coding gene	gene with protein product		607128					Standard	NM_025235		Approved	TNKL, TANK2, PARP-5b, PARP-5c, PARP5B, PARP5C, pART6	uc001khp.3	Q9H2K2	OTTHUMG00000018747	ENST00000371627.4:c.1857delA	10.37:g.93601946delA	ENSP00000360689:p.Thr619fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD3|Q9H8F2|Q9HAS4	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,pfam_Poly(ADP-ribose)pol_cat_dom,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SAM,pfscan_Poly(ADP-ribose)pol_cat_dom,prints_Ankyrin_rpt	p.N622fs	ENST00000371627.4	37	c.1857	CCDS7417.1	10																																																																																			TNKS2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000107854		0.393	TNKS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNKS2	HGNC	protein_coding	OTTHUMT00000049374.1	194	0.00	0	A	NM_025235		93601946	93601946	+1	no_errors	ENST00000371627	ensembl	human	known	69_37n	frame_shift_del	124	34.72	67	DEL	0.997	-
TNS4	84951	genome.wustl.edu	37	17	38643488	38643488	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr17:38643488delG	ENST00000254051.6	-	4	1246	c.1088delC	c.(1087-1089)ccafs	p.P363fs		NM_032865.5	NP_116254.4	Q8IZW8	TENS4_HUMAN	tensin 4	363					apoptotic process (GO:0006915)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)				NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	30		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(5;5.91e-05)			GGTGATGGATGGGGGGCAGCT	0.597																																						dbGAP											0													147.0	137.0	140.0					17																	38643488		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF417488	CCDS11368.1	17q21.2	2013-02-14			ENSG00000131746	ENSG00000131746		"""SH2 domain containing"""	24352	protein-coding gene	gene with protein product	"""C terminal tensin like"""	608385				12154022, 12711115	Standard	NM_032865		Approved	CTEN	uc010cxb.3	Q8IZW8	OTTHUMG00000133330	ENST00000254051.6:c.1088delC	17.37:g.38643488delG	ENSP00000254051:p.Pro363fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMJ7|Q71RB7|Q8WV64|Q96JV4	Frame_Shift_Del	DEL	pfam_PTB,pfam_SH2,smart_SH2,smart_PTyr_interaction_dom,pfscan_SH2	p.P363fs	ENST00000254051.6	37	c.1088	CCDS11368.1	17																																																																																			TNS4	-	NULL	ENSG00000131746		0.597	TNS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNS4	HGNC	protein_coding	OTTHUMT00000257154.3	483	0.00	0	G	NM_032865		38643488	38643488	-1	no_errors	ENST00000254051	ensembl	human	known	69_37n	frame_shift_del	431	15.07	77	DEL	1.000	-
TNXB	7148	genome.wustl.edu	37	6	32049423	32049424	+	Frame_Shift_Ins	INS	-	-	G	rs376472382|rs12211410	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:32049423_32049424insG	ENST00000375244.3	-	10	3964_3965	c.3763_3764insC	c.(3763-3765)cgcfs	p.R1255fs	TNXB_ENST00000375247.2_Frame_Shift_Ins_p.R1255fs			P22105	TENX_HUMAN	tenascin XB	1342	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GAACTCAGGGCGGGGGGGCTCC	0.639																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.3764dupC	6.37:g.32049430_32049430dupG	ENSP00000364393:p.Arg1255fs	Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Frame_Shift_Ins	INS	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R1255fs	ENST00000375244.3	37	c.3764_3763		6																																																																																			TNXB	-	superfamily_Fibronectin_type3	ENSG00000168477		0.639	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	14	0.00	0	-	NM_019105		32049423	32049424	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	frame_shift_ins	22	21.43	6	INS	0.000:0.009	G
TOP3B	8940	genome.wustl.edu	37	22	22326278	22326278	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr22:22326278C>T	ENST00000398793.2	-	5	789	c.355G>A	c.(355-357)Gac>Aac	p.D119N	TOP3B_ENST00000357179.5_Missense_Mutation_p.D119N|TOP3B_ENST00000413067.2_Intron	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	119	Toprim. {ECO:0000255|PROSITE- ProRule:PRU00995}.				chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		CCCTCCTTGTCGCAGTCCAGC	0.582																																						dbGAP											0													245.0	134.0	172.0					22																	22326278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.355G>A	22.37:g.22326278C>T	ENSP00000381773:p.Asp119Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.D119N	ENST00000398793.2	37	c.355	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.563196	0.96527	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000424393;ENST00000437929;ENST00000430142	T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81	5.36	4.34	0.51931	DNA topoisomerase, type IA, core domain (1);Toprim domain (2);	0.000000	0.85682	D	0.000000	T	0.81427	0.4820	H	0.99273	4.495	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.89225	0.3573	10	0.87932	D	0	0.6154	14.3641	0.66792	0.0:0.9291:0.0:0.0709	.	119	O95985	TOP3B_HUMAN	N	119	ENSP00000349705:D119N;ENSP00000381773:D119N;ENSP00000390977:D119N;ENSP00000402622:D119N;ENSP00000414538:D119N	ENSP00000349705:D119N	D	-	1	0	TOP3B	20656278	1.000000	0.71417	0.991000	0.47740	0.991000	0.79684	7.598000	0.82745	1.491000	0.48482	0.655000	0.94253	GAC	TOP3B	-	pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,prints_Topo_IA	ENSG00000100038		0.582	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	103	0.00	0	C	NM_003935		22326278	22326278	-1	no_errors	ENST00000357179	ensembl	human	known	69_37n	missense	36	61.29	57	SNP	1.000	T
TPO	7173	genome.wustl.edu	37	2	1440158	1440158	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:1440158T>C	ENST00000345913.4	+	5	573		c.e5+2		TPO_ENST00000349624.3_Splice_Site|TPO_ENST00000346956.3_Splice_Site|TPO_ENST00000382269.3_Splice_Site|TPO_ENST00000382201.3_Splice_Site|TPO_ENST00000497517.2_Intron|TPO_ENST00000329066.4_Splice_Site|TPO_ENST00000382198.1_Splice_Site|TPO_ENST00000539820.1_Splice_Site|TPO_ENST00000337415.3_Splice_Site	NM_000547.5	NP_000538.3	P07202	PERT_HUMAN	thyroid peroxidase						cellular nitrogen compound metabolic process (GO:0034641)|embryonic hemopoiesis (GO:0035162)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|small molecule metabolic process (GO:0044281)|thyroid hormone generation (GO:0006590)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|iodide peroxidase activity (GO:0004447)|peroxidase activity (GO:0004601)			breast(1)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(14)|liver(2)|lung(33)|ovary(8)|pancreas(6)|prostate(4)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	95	all_hematologic(175;0.0487)|Acute lymphoblastic leukemia(172;0.0627)	all_cancers(51;0.0338)		all cancers(51;0.0356)|OV - Ovarian serous cystadenocarcinoma(76;0.0748)|Epithelial(75;0.12)	Carbimazole(DB00389)|Dextrothyroxine(DB00509)|Methimazole(DB00763)|Propylthiouracil(DB00550)	CAACAACAGGTATTGTTTGTG	0.453																																						dbGAP											0													112.0	110.0	110.0					2																	1440158		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS1643.1, CCDS1644.1, CCDS1646.1	2p25	2008-02-05			ENSG00000115705	ENSG00000115705	1.11.1.7		12015	protein-coding gene	gene with protein product		606765					Standard	NM_175722		Approved	TPX	uc002qww.3	P07202	OTTHUMG00000090271	ENST00000345913.4:c.482+2T>C	2.37:g.1440158T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P09934|P09935|Q8IUL0|Q8NF94|Q8NF95|Q8NF96|Q8NF97|Q8TCI9	Splice_Site	SNP	-	e4+2	ENST00000345913.4	37	c.482+2	CCDS1643.1	2	.	.	.	.	.	.	.	.	.	.	T	12.71	2.019796	0.35606	.	.	ENSG00000115705	ENST00000382269;ENST00000337415;ENST00000345913;ENST00000346956;ENST00000349624;ENST00000539820;ENST00000329066;ENST00000382201;ENST00000423320;ENST00000382198;ENST00000422464	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.3518	0.55153	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	TPO	1419165	1.000000	0.71417	0.977000	0.42913	0.378000	0.30076	4.563000	0.60823	1.906000	0.55180	0.260000	0.18958	.	TPO	-	-	ENSG00000115705		0.453	TPO-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPO	HGNC	protein_coding	OTTHUMT00000206594.2	194	0.51	1	T	NM_000547	Intron	1440158	1440158	+1	no_errors	ENST00000329066	ensembl	human	known	69_37n	splice_site	271	10.82	33	SNP	0.997	C
TRAF7	84231	genome.wustl.edu	37	16	2220730	2220730	+	Splice_Site	SNP	C	C	T	rs201037324		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:2220730C>T	ENST00000326181.6	+	5	479	c.347C>T	c.(346-348)cCg>cTg	p.P116L		NM_032271.2	NP_115647.2	Q6Q0C0	TRAF7_HUMAN	TNF receptor-associated factor 7, E3 ubiquitin protein ligase	116					activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of MAPK cascade (GO:0043410)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasmic vesicle (GO:0031410)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	23						GAGGAGGAGCCGGTAGGTGTG	0.692													C|||	1	0.000199681	0.0	0.0	5008	,	,		14934	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													21.0	17.0	19.0					16																	2220730		2174	4293	6467	-	-	-	SO:0001630	splice_region_variant	0			AL136921	CCDS10461.1	16p13.3	2013-01-10	2012-02-23	2004-06-04	ENSG00000131653	ENSG00000131653		"""RING-type (C3HC4) zinc fingers"", ""WD repeat domain containing"""	20456	protein-coding gene	gene with protein product		606692	"""ring finger and WD repeat domain 1"", ""TNF receptor-associated factor 7"""	RFWD1		11230166, 15001576	Standard	NM_032271		Approved	RNF119, DKFZp586I021, MGC7807	uc002cow.3	Q6Q0C0	OTTHUMG00000128826	ENST00000326181.6:c.348+1C>T	16.37:g.2220730C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H073	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_TRAF-like,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING,pfscan_Znf_TRAF,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.P116L	ENST00000326181.6	37	c.347	CCDS10461.1	16	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.22	1.289678	0.23478	.	.	ENSG00000131653	ENST00000326181	T	0.50277	0.75	4.79	0.689	0.18033	.	0.239601	0.42420	N	0.000710	T	0.26195	0.0639	N	0.14661	0.345	0.54753	D	0.999982	B	0.24132	0.098	B	0.15052	0.012	T	0.04333	-1.0959	10	0.52906	T	0.07	-13.4798	8.5224	0.33285	0.0:0.6817:0.0:0.3183	.	116	Q6Q0C0	TRAF7_HUMAN	L	116	ENSP00000318944:P116L	ENSP00000318944:P116L	P	+	2	0	TRAF7	2160731	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	2.413000	0.44618	0.012000	0.14892	0.561000	0.74099	CCG	TRAF7	-	NULL	ENSG00000131653		0.692	TRAF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF7	HGNC	protein_coding	OTTHUMT00000250762.1	26	0.00	0	C	NM_032271	Missense_Mutation	2220730	2220730	+1	no_errors	ENST00000326181	ensembl	human	known	69_37n	missense	23	37.84	14	SNP	1.000	T
TRIM32	22954	genome.wustl.edu	37	9	119460577	119460577	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:119460577C>T	ENST00000450136.1	+	2	717	c.556C>T	c.(556-558)Cag>Tag	p.Q186*	ASTN2_ENST00000361209.2_Intron|ASTN2_ENST00000361477.3_Intron|ASTN2_ENST00000313400.4_Intron|ASTN2_ENST00000373996.3_Intron|TRIM32_ENST00000373983.2_Nonsense_Mutation_p.Q186*	NM_001099679.1|NM_012210.3	NP_001093149.1|NP_036342.2	Q13049	TRI32_HUMAN	tripartite motif containing 32	186					fat cell differentiation (GO:0045444)|innate immune response (GO:0045087)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell motility (GO:2000147)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neurogenesis (GO:0050769)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of proteolysis (GO:0045862)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of type I interferon production (GO:0032481)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of type I interferon production (GO:0032479)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|striated muscle myosin thick filament (GO:0005863)	ligase activity (GO:0016874)|myosin binding (GO:0017022)|protein self-association (GO:0043621)|RNA binding (GO:0003723)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|translation initiation factor binding (GO:0031369)|ubiquitin binding (GO:0043130)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(5)|liver(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	26						AGCAGTTCTCCAGGAGTATGG	0.552																																					Esophageal Squamous(92;212 1916 19711 26951)	dbGAP											0													53.0	57.0	56.0					9																	119460577		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U18543	CCDS6817.1	9q33.1	2014-09-17	2011-01-25		ENSG00000119401	ENSG00000119401		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16380	protein-coding gene	gene with protein product		602290	"""limb girdle muscular dystrophy 2H (autosomal recessive)"", ""tripartite motif-containing 32"""	LGMD2H		11331580, 7778269, 16606853	Standard	NM_001099679		Approved	HT2A, TATIP, BBS11	uc004bjx.2	Q13049	OTTHUMG00000021026	ENST00000450136.1:c.556C>T	9.37:g.119460577C>T	ENSP00000408292:p.Gln186*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NQP8	Nonsense_Mutation	SNP	pfam_NHL_repeat,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_NHL_repeat_subgr,pfscan_Znf_B-box,pfscan_Znf_RING	p.Q186*	ENST00000450136.1	37	c.556	CCDS6817.1	9	.	.	.	.	.	.	.	.	.	.	C	23.8	4.457913	0.84317	.	.	ENSG00000119401	ENST00000450136;ENST00000373983	.	.	.	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.215	19.09	0.93223	0.0:1.0:0.0:0.0	.	.	.	.	X	186	.	.	Q	+	1	0	TRIM32	118500398	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.451000	0.80668	2.486000	0.83907	0.655000	0.94253	CAG	TRIM32	-	NULL	ENSG00000119401		0.552	TRIM32-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM32	HGNC	protein_coding	OTTHUMT00000055466.2	71	0.00	0	C	NM_012210		119460577	119460577	+1	no_errors	ENST00000373983	ensembl	human	known	69_37n	nonsense	55	40.86	38	SNP	1.000	T
TRIM50	135892	genome.wustl.edu	37	7	72730631	72730632	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:72730631_72730632insT	ENST00000333149.2	-	6	1006_1007	c.806_807insA	c.(805-807)aagfs	p.K269fs	TRIM50_ENST00000453152.1_Frame_Shift_Ins_p.K269fs	NM_178125.2	NP_835226.2	Q86XT4	TRI50_HUMAN	tripartite motif containing 50	269						cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)|skin(2)	20						GGAGGCCTGGCTTGAAGGAGAT	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY081948	CCDS34654.1	7q11.23	2013-01-09	2011-01-25	2006-03-31	ENSG00000146755	ENSG00000146755		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19017	protein-coding gene	gene with protein product		612548	"""tripartite motif-containing 50A"", ""tripartite motif-containing 50"""	TRIM50A			Standard	NM_001281450		Approved	FLJ32804	uc003txy.1	Q86XT4	OTTHUMG00000156805	ENST00000333149.2:c.807dupA	7.37:g.72730633_72730633dupT	ENSP00000327994:p.Lys269fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XT3	Frame_Shift_Ins	INS	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P270fs	ENST00000333149.2	37	c.807_806	CCDS34654.1	7																																																																																			TRIM50	-	NULL	ENSG00000146755		0.589	TRIM50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM50	HGNC	protein_coding	OTTHUMT00000345925.1	73	0.00	0	-	NM_178125		72730631	72730632	-1	no_errors	ENST00000333149	ensembl	human	known	69_37n	frame_shift_ins	92	13.21	14	INS	1.000:1.000	T
TRO	7216	genome.wustl.edu	37	X	54956207	54956207	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:54956207T>C	ENST00000173898.7	+	12	3162	c.3050T>C	c.(3049-3051)gTc>gCc	p.V1017A	TRO_ENST00000319167.8_Intron|TRO_ENST00000375041.2_Missense_Mutation_p.V620A|TRO_ENST00000420798.2_Missense_Mutation_p.V548A|TRO_ENST00000399736.1_Intron|TRO_ENST00000375022.4_Intron|SNORA11_ENST00000408823.1_RNA	NM_001039705.2	NP_001034794.1	Q12816	TROP_HUMAN	trophinin	1017	62 X 10 AA approximate tandem repeats.				embryo implantation (GO:0007566)|homophilic cell adhesion (GO:0007156)|negative regulation of cell growth (GO:0030308)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(2)|skin(2)|urinary_tract(1)	37						GGCACCAGTGTCAGCTTTGGC	0.522																																						dbGAP											0													74.0	68.0	70.0					X																	54956207		2081	4197	6278	-	-	-	SO:0001583	missense	0			U04811	CCDS43958.1, CCDS43959.1, CCDS59527.1, CCDS59528.1, CCDS59529.1	Xp11.22-p11.21	2008-02-05			ENSG00000067445	ENSG00000067445			12326	protein-coding gene	gene with protein product		300132				9533028, 11454705	Standard	NM_001039705		Approved	MAGE-D3, KIAA1114, MAGED3	uc004dtq.4	Q12816	OTTHUMG00000021640	ENST00000173898.7:c.3050T>C	X.37:g.54956207T>C	ENSP00000173898:p.Val1017Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKE9|B1AKF1|F5GY27|Q96SX2|Q9NU89|Q9UPN8	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.V1017A	ENST00000173898.7	37	c.3050	CCDS43959.1	X	.	.	.	.	.	.	.	.	.	.	T	0.006	-2.096375	0.00364	.	.	ENSG00000067445	ENST00000173898;ENST00000420798;ENST00000375041	T;T;T	0.33865	2.36;2.36;1.39	2.19	-4.39	0.03611	.	.	.	.	.	T	0.09598	0.0236	N	0.00801	-1.175	0.09310	N	1	B;B	0.18013	0.025;0.015	B;B	0.15484	0.008;0.013	T	0.33701	-0.9858	9	0.02654	T	1	.	12.6774	0.56901	0.0:0.7751:0.0:0.2249	.	620;1017	B1AKE9;Q12816	.;TROP_HUMAN	A	1017;548;620	ENSP00000173898:V1017A;ENSP00000405126:V548A;ENSP00000364181:V620A	ENSP00000173898:V1017A	V	+	2	0	TRO	54972932	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-2.649000	0.00858	-1.846000	0.01175	-0.526000	0.04340	GTC	TRO	-	NULL	ENSG00000067445		0.522	TRO-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRO	HGNC	protein_coding	OTTHUMT00000056837.3	74	0.00	0	T	NM_016157		54956207	54956207	+1	no_errors	ENST00000173898	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179430671	179430671	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr2:179430671A>G	ENST00000591111.1	-	276	75489	c.75265T>C	c.(75265-75267)Tat>Cat	p.Y25089H	TTN_ENST00000342992.6_Missense_Mutation_p.Y24162H|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Y17790H|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Y17857H|TTN_ENST00000460472.2_Missense_Mutation_p.Y17665H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.Y26730H|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586452.1_RNA			Q8WZ42	TITIN_HUMAN	titin	25089	Fibronectin type-III 82. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ACATTAGCATACGCTTTTCTG	0.403																																						dbGAP											0													164.0	151.0	155.0					2																	179430671		1932	4136	6068	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.75265T>C	2.37:g.179430671A>G	ENSP00000465570:p.Tyr25089His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Y24162H	ENST00000591111.1	37	c.72484		2	.	.	.	.	.	.	.	.	.	.	A	12.58	1.981244	0.34942	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.53857	0.6;0.6;0.6;0.6	5.72	5.72	0.89469	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.72479	0.3465	M	0.75447	2.3	0.54753	D	0.999984	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	D;D;D;D	0.73708	0.971;0.981;0.981;0.981	T	0.76189	-0.3050	9	0.87932	D	0	.	15.9746	0.80054	1.0:0.0:0.0:0.0	.	17665;17790;17857;25089	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	24162;17665;17857;17790;17663	ENSP00000343764:Y24162H;ENSP00000434586:Y17665H;ENSP00000340554:Y17857H;ENSP00000352154:Y17790H	ENSP00000340554:Y17857H	Y	-	1	0	TTN	179138917	1.000000	0.71417	0.977000	0.42913	0.869000	0.49853	9.339000	0.96797	2.179000	0.69175	0.454000	0.30748	TAT	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.403	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	339	0.00	0	A	NM_133378		179430671	179430671	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	138	33.01	68	SNP	0.999	G
TUBB4A	10382	genome.wustl.edu	37	19	6495769	6495769	+	Silent	SNP	G	G	A	rs201693075	byFrequency	TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr19:6495769G>A	ENST00000264071.2	-	4	1112	c.741C>T	c.(739-741)aaC>aaT	p.N247N	CTD-2396E7.9_ENST00000599292.1_RNA|CTD-2396E7.10_ENST00000596027.1_RNA|TUBB4A_ENST00000540257.1_Silent_p.N247N			P04350	TBB4A_HUMAN	tubulin, beta 4A class IVa	247					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based process (GO:0007017)|mitotic cell cycle (GO:0000278)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|internode region of axon (GO:0033269)|microtubule (GO:0005874)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)										GCAGGTCGGCGTTCAGCTGGC	0.672													G|||	2	0.000399361	0.0	0.0014	5008	,	,		17440	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													62.0	59.0	60.0					19																	6495769		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK075307	CCDS12168.1	19p13.3	2014-02-05	2011-10-11	2011-10-10	ENSG00000104833	ENSG00000104833		"""Tubulins"""	20774	protein-coding gene	gene with protein product	"""class IVa beta-tubulin"""	602662	"""tubulin, beta 4"", ""tubulin, beta 4 class IVa"", ""dystonia 4, torsion (autosomal dominant)"""	TUBB4, DYT4		6865944, 6462917, 23595291	Standard	NM_001289123		Approved	beta-5	uc002mfg.1	P04350		ENST00000264071.2:c.741C>T	19.37:g.6495769G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQP4|Q969E5	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Alpha_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin	p.N247	ENST00000264071.2	37	c.741	CCDS12168.1	19																																																																																			TUBB4A	-	superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin	ENSG00000104833		0.672	TUBB4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB4A	HGNC	protein_coding	OTTHUMT00000457841.1	54	0.00	0	G	NM_006087		6495769	6495769	-1	no_errors	ENST00000264071	ensembl	human	known	69_37n	silent	26	46.00	23	SNP	1.000	A
UBE3C	9690	genome.wustl.edu	37	7	157009636	157009636	+	Missense_Mutation	SNP	T	T	C	rs78274219		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:157009636T>C	ENST00000348165.5	+	14	2245	c.1885T>C	c.(1885-1887)Tca>Cca	p.S629P		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	629					protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		CCACTGGCTGTCAGAACAAGA	0.348																																						dbGAP											0													69.0	65.0	66.0					7																	157009636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.1885T>C	7.37:g.157009636T>C	ENSP00000309198:p.Ser629Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.S629P	ENST00000348165.5	37	c.1885	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	T	24.2	4.500485	0.85176	.	.	ENSG00000009335	ENST00000348165	T	0.46819	0.86	5.36	5.36	0.76844	.	0.195724	0.45867	D	0.000330	T	0.65616	0.2708	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.949;0.987	T	0.63559	-0.6610	10	0.30078	T	0.28	-13.1157	15.3548	0.74418	0.0:0.0:0.0:1.0	.	629;629	Q15386;Q15386-2	UBE3C_HUMAN;.	P	629	ENSP00000309198:S629P	ENSP00000309198:S629P	S	+	1	0	UBE3C	156702397	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.214000	0.77958	2.034000	0.60081	0.482000	0.46254	TCA	UBE3C	-	NULL	ENSG00000009335		0.348	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1	159	0.00	0	T	NM_014671		157009636	157009636	+1	no_errors	ENST00000348165	ensembl	human	known	69_37n	missense	217	12.75	32	SNP	1.000	C
UGT2B4	7363	genome.wustl.edu	37	4	70350946	70350946	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr4:70350946C>T	ENST00000305107.6	-	5	1336	c.1290G>A	c.(1288-1290)aaG>aaA	p.K430K	UGT2B4_ENST00000512583.1_Intron|UGT2B4_ENST00000381096.3_Silent_p.K294K|UGT2B4_ENST00000506580.1_Intron	NM_021139.2	NP_066962.2	P06133	UD2B4_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B4	430					cellular glucuronidation (GO:0052695)|estrogen catabolic process (GO:0006711)|metabolic process (GO:0008152)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(29)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	47					Canagliflozin(DB08907)|Codeine(DB00318)|Dapagliflozin(DB06292)|Flurbiprofen(DB00712)|Ibuprofen(DB01050)|Morphine(DB00295)	TAATTACTGTCTTCAGTGCAT	0.383																																						dbGAP											0													184.0	183.0	184.0					4																	70350946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC026264	CCDS43234.1, CCDS75137.1	4q13	2008-02-05	2005-07-20			ENSG00000156096		"""UDP glucuronosyltransferases"""	12553	protein-coding gene	gene with protein product		600067	"""UDP glycosyltransferase 2 family, polypeptide B4"""			3109396, 7835904	Standard	NM_021139		Approved	UGT2B11	uc003hek.4	P06133		ENST00000305107.6:c.1290G>A	4.37:g.70350946C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCP7|B4DT75|G5E9X8|O60731|O60867|O75614|P36538|Q1HBF9|Q6QQX7	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.K430	ENST00000305107.6	37	c.1290	CCDS43234.1	4																																																																																			UGT2B4	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000156096		0.383	UGT2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B4	HGNC	protein_coding	OTTHUMT00000365526.1	404	0.00	0	C	NM_021139		70350946	70350946	-1	no_errors	ENST00000305107	ensembl	human	known	69_37n	silent	290	35.98	163	SNP	0.211	T
USP16	10600	genome.wustl.edu	37	21	30411428	30411428	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr21:30411428delA	ENST00000334352.4	+	9	1045	c.814delA	c.(814-816)aaafs	p.K273fs	USP16_ENST00000399976.2_Frame_Shift_Del_p.K273fs|USP16_ENST00000399975.3_Frame_Shift_Del_p.K272fs|USP16_ENST00000535828.1_Intron	NM_001032410.1	NP_001027582.1			ubiquitin specific peptidase 16											breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(2)	34						GCAAGAGACCAAAAAGGGGGT	0.428																																					Melanoma(92;625 1444 27493 34101 44971)	dbGAP											0													78.0	81.0	80.0					21																	30411428		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF126736	CCDS13583.1, CCDS42912.1	21q21	2008-04-11	2005-08-08		ENSG00000156256	ENSG00000156256		"""Ubiquitin-specific peptidases"""	12614	protein-coding gene	gene with protein product		604735	"""ubiquitin specific protease 16"""			12838346	Standard	NM_006447		Approved	Ubp-M	uc002ymy.3	Q9Y5T5	OTTHUMG00000078802	ENST00000334352.4:c.814delA	21.37:g.30411428delA	ENSP00000334808:p.Lys273fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Peptidase_C19,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.K273fs	ENST00000334352.4	37	c.814	CCDS13583.1	21																																																																																			USP16	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000156256		0.428	USP16-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	USP16	HGNC	protein_coding	OTTHUMT00000171847.1	188	0.00	0	A			30411428	30411428	+1	no_errors	ENST00000334352	ensembl	human	known	69_37n	frame_shift_del	143	32.11	70	DEL	1.000	-
COG8	84342	genome.wustl.edu	37	16	69358203	69358204	+	IGR	DEL	AG	AG	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:69358203_69358204delAG	ENST00000306875.4	-	0	4247				COG8_ENST00000564419.1_Intron|VPS4A_ENST00000254950.11_Frame_Shift_Del_p.E436fs	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8						protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						ACTTTGGGCAAGAGAGTTAAAA	0.559																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277		16.37:g.69358207_69358208delAG		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAK2|Q8WVV6|Q9H6F8	Frame_Shift_Del	DEL	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_MIT,pfam_IstB_ATP-bd,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_MIT,smart_AAA+_ATPase	p.S437fs	ENST00000306875.4	37	c.1305_1306	CCDS10876.1	16																																																																																			VPS4A	-	NULL	ENSG00000132612		0.559	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS4A	HGNC	protein_coding	OTTHUMT00000268948.2	109	0.00	0	AG	NM_032382		69358203	69358204	+1	no_errors	ENST00000254950	ensembl	human	known	69_37n	frame_shift_del	91	30.60	41	DEL	1.000:1.000	-
VPS52	6293	genome.wustl.edu	37	6	33235071	33235071	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr6:33235071C>T	ENST00000445902.2	-	11	1237	c.1019G>A	c.(1018-1020)aGc>aAc	p.S340N	VPS52_ENST00000478934.1_Intron|VPS52_ENST00000482399.1_3'UTR|VPS52_ENST00000436044.2_Missense_Mutation_p.S215N	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)	340					ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						GGTGTTCCTGCTGCGGAGCGA	0.567																																						dbGAP											0													89.0	82.0	84.0					6																	33235071		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.1019G>A	6.37:g.33235071C>T	ENSP00000409952:p.Ser340Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Missense_Mutation	SNP	pfam_Vps52,pfam_Exocyst_Exoc1	p.S340N	ENST00000445902.2	37	c.1019	CCDS4770.2	6	.	.	.	.	.	.	.	.	.	.	C	10.26	1.301201	0.23650	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.13329	0.0323	N	0.02213	-0.635	0.58432	D	0.999999	B	0.10296	0.003	B	0.08055	0.003	T	0.17531	-1.0366	9	0.09590	T	0.72	-19.6769	16.8656	0.86028	0.0:1.0:0.0:0.0	.	340	Q8N1B4	VPS52_HUMAN	N	340;318;215	.	ENSP00000414785:S318N	S	-	2	0	VPS52	33343049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.918000	0.48829	2.932000	0.99384	0.643000	0.83706	AGC	VPS52	-	pfam_Vps52	ENSG00000223501		0.567	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	HGNC	protein_coding	OTTHUMT00000076598.2	134	0.00	0	C	NM_022553		33235071	33235071	-1	no_errors	ENST00000445902	ensembl	human	known	69_37n	missense	154	14.44	26	SNP	1.000	T
WDR6	11180	genome.wustl.edu	37	3	49049490	49049490	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:49049490A>G	ENST00000608424.1	+	2	562	c.523A>G	c.(523-525)Ata>Gta	p.I175V	WDR6_ENST00000448293.1_Missense_Mutation_p.I124V|WDR6_ENST00000415265.2_Intron|WDR6_ENST00000489684.1_3'UTR|WDR6_ENST00000395474.3_Missense_Mutation_p.I205V			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	175					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		GGAGCTGACCATAGTGGCAGG	0.567																																						dbGAP											0													53.0	46.0	48.0					3																	49049490		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.523A>G	3.37:g.49049490A>G	ENSP00000477389:p.Ile175Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I205V	ENST00000608424.1	37	c.613		3	.	.	.	.	.	.	.	.	.	.	A	10.31	1.315419	0.23908	.	.	ENSG00000178252	ENST00000395474;ENST00000438660;ENST00000354294;ENST00000448293	T;T;D	0.89810	-0.55;-0.55;-2.57	5.23	-4.96	0.03038	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.556047	0.18357	N	0.143693	T	0.63522	0.2518	N	0.01352	-0.895	0.32160	N	0.583074	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.04013	0.001;0.0;0.001	T	0.57406	-0.7817	10	0.17832	T	0.49	-0.538	9.5458	0.39279	0.2543:0.2163:0.5294:0.0	.	46;175;124	B4DK45;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	V	205;207;175;124	ENSP00000378857:I205V;ENSP00000387692:I207V;ENSP00000413432:I124V	ENSP00000346247:I175V	I	+	1	0	WDR6	49024494	0.000000	0.05858	0.450000	0.26969	0.990000	0.78478	-0.620000	0.05565	-0.500000	0.06614	0.459000	0.35465	ATA	WDR6	-	superfamily_WD40_repeat_dom	ENSG00000178252		0.567	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1	37	0.00	0	A			49049490	49049490	+1	no_errors	ENST00000395474	ensembl	human	known	69_37n	missense	15	53.12	17	SNP	0.765	G
VWA5B2	90113	genome.wustl.edu	37	3	183954187	183954187	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr3:183954187C>T	ENST00000426955.2	+	9	1369	c.1269C>T	c.(1267-1269)ccC>ccT	p.P423P	VWA5B2_ENST00000273794.5_Silent_p.P204P|EIF2B5_ENST00000444495.1_Intron	NM_138345.1	NP_612354.1	Q8N398	VW5B2_HUMAN	von Willebrand factor A domain containing 5B2	434	VWFA.									breast(3)|endometrium(4)|kidney(1)|lung(1)|prostate(1)|skin(5)	15						CGAGTGGGCCCCCAGACGTGC	0.662																																						dbGAP											0													23.0	25.0	25.0					3																	183954187		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS54686.1	3q27.1	2008-07-25	2008-07-25		ENSG00000145198	ENSG00000145198			25144	protein-coding gene	gene with protein product						15231747	Standard	NM_138345		Approved	DKFZp761K032, LOC90113	uc011bra.2	Q8N398	OTTHUMG00000156820	ENST00000426955.2:c.1269C>T	3.37:g.183954187C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGN7	Silent	SNP	NULL	p.P423	ENST00000426955.2	37	c.1269	CCDS54686.1	3																																																																																			VWA5B2	-	NULL	ENSG00000145198		0.662	VWA5B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWA5B2	HGNC	protein_coding	OTTHUMT00000346004.2	34	0.00	0	C	XM_291077		183954187	183954187	+1	no_errors	ENST00000426955	ensembl	human	known	69_37n	silent	28	44.00	22	SNP	0.008	T
WDR72	256764	genome.wustl.edu	37	15	54025194	54025194	+	Splice_Site	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr15:54025194C>T	ENST00000396328.1	-	2	392	c.153G>A	c.(151-153)aaG>aaA	p.K51K	WDR72_ENST00000360509.5_Splice_Site_p.K51K|WDR72_ENST00000559418.1_Splice_Site_p.K51K|WDR72_ENST00000557913.1_Splice_Site_p.K51K	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	51										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TTTCACTAACCTTTAGTTCAT	0.428																																						dbGAP											0													106.0	92.0	97.0					15																	54025194		2194	4293	6487	-	-	-	SO:0001630	splice_region_variant	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.153+1G>A	15.37:g.54025194C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K51	ENST00000396328.1	37	c.153	CCDS10151.1	15																																																																																			WDR72	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166415		0.428	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	156	0.00	0	C	NM_182758	Silent	54025194	54025194	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	silent	90	36.62	52	SNP	1.000	T
WISP1	8840	genome.wustl.edu	37	8	134237699	134237699	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:134237699G>A	ENST00000250160.6	+	4	783	c.677G>A	c.(676-678)tGc>tAc	p.C226Y	WISP1_ENST00000220856.6_Missense_Mutation_p.C139Y|WISP1_ENST00000519433.1_Intron|WISP1_ENST00000377863.2_Missense_Mutation_p.C54Y|WISP1_ENST00000517423.1_Intron	NM_003882.3	NP_003873.1	O95388	WISP1_HUMAN	WNT1 inducible signaling pathway protein 1	226	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cell adhesion (GO:0007155)|cell-cell signaling (GO:0007267)|regulation of cell growth (GO:0001558)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	21	all_epithelial(106;5.39e-23)|Lung NSC(106;7.26e-07)|all_lung(105;2.77e-06)|Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0107)			TGGAGCCCTTGCTCCACCAGC	0.597																																						dbGAP											0													66.0	69.0	68.0					8																	134237699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100779	CCDS6371.1, CCDS6372.1, CCDS56555.1, CCDS56556.1	8q24.22	2007-05-14			ENSG00000104415	ENSG00000104415			12769	protein-coding gene	gene with protein product		603398				9843955	Standard	NM_003882		Approved	CCN4	uc003yub.3	O95388	OTTHUMG00000164440	ENST00000250160.6:c.677G>A	8.37:g.134237699G>A	ENSP00000250160:p.Cys226Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG6|E7EMM5|Q5JBS6|Q5JBS7|Q5JBS8|Q9HCS3	Missense_Mutation	SNP	pfam_IGFBP-like,pfam_VWF_C,pfam_Cys_knot,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_IGFBP-like,smart_VWF_C,smart_Thrombospondin_1_rpt,smart_Cys_knot_C,pirsf_IGFBP_CNN,pfscan_Cys_knot_C,pfscan_Thrombospondin_1_rpt,pfscan_VWF_C	p.C226Y	ENST00000250160.6	37	c.677	CCDS6371.1	8	.	.	.	.	.	.	.	.	.	.	G	28.5	4.926188	0.92319	.	.	ENSG00000104415	ENST00000250160;ENST00000377863;ENST00000220856	D;D;D	0.98585	-5.01;-5.01;-5.01	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	D	0.99513	0.9826	H	0.99182	4.46	0.80722	D	1	D;D;D	0.89917	1.0;0.995;1.0	D;D;D	0.83275	0.995;0.929;0.996	D	0.97974	1.0345	10	0.72032	D	0.01	-8.4404	19.2688	0.94000	0.0:0.0:1.0:0.0	.	54;139;226	Q5JBS7;O95388-2;O95388	.;.;WISP1_HUMAN	Y	226;54;139	ENSP00000250160:C226Y;ENSP00000367094:C54Y;ENSP00000220856:C139Y	ENSP00000220856:C139Y	C	+	2	0	WISP1	134306881	1.000000	0.71417	0.985000	0.45067	0.970000	0.65996	9.814000	0.99346	2.795000	0.96236	0.643000	0.83706	TGC	WISP1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pirsf_IGFBP_CNN,pfscan_Thrombospondin_1_rpt	ENSG00000104415		0.597	WISP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WISP1	HGNC	protein_coding	OTTHUMT00000378794.2	45	0.00	0	G	NM_003882		134237699	134237699	+1	no_errors	ENST00000250160	ensembl	human	known	69_37n	missense	26	41.30	19	SNP	1.000	A
WNK2	65268	genome.wustl.edu	37	9	96060333	96060333	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:96060333C>T	ENST00000297954.4	+	24	6018	c.6018C>T	c.(6016-6018)gtC>gtT	p.V2006V	WNK2_ENST00000395475.2_3'UTR|WNK2_ENST00000356055.3_Silent_p.V331V|WNK2_ENST00000395477.2_Silent_p.V1969V|WNK2_ENST00000349097.3_Silent_p.V1618V|WNK2_ENST00000427277.2_Silent_p.V1581V	NM_001282394.1	NP_001269323.1	Q9Y3S1	WNK2_HUMAN	WNK lysine deficient protein kinase 2	2006					intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|endometrium(11)|kidney(4)|large_intestine(5)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)	54						AGCTCAAGGTCGTGGCCTCCA	0.672																																						dbGAP											0													19.0	17.0	18.0					9																	96060333		2080	4118	6198	-	-	-	SO:0001819	synonymous_variant	0			AJ242724	CCDS75858.1	9q22.3	2008-02-05	2003-06-23	2005-01-22	ENSG00000165238	ENSG00000165238			14542	protein-coding gene	gene with protein product		606249	"""serologically defined colon cancer antigen 43"""	SDCCAG43, PRKWNK2		9610721, 11571656	Standard	NM_006648		Approved	NY-CO-43, KIAA1760	uc004atj.3	Q9Y3S1	OTTHUMG00000020247	ENST00000297954.4:c.6018C>T	9.37:g.96060333C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWF1|Q5VWF2|Q8IY36|Q9C0A3|Q9H3P4	Missense_Mutation	SNP	NULL	p.S491L	ENST00000297954.4	37	c.1472		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	c|c	9.304|9.304	1.053855|1.053855	0.19907|0.19907	.|.	.|.	ENSG00000165238|ENSG00000165238	ENST00000411624|ENST00000432730;ENST00000448251;ENST00000453718	.|.	.|.	.|.	5.2|5.2	1.92|1.92	0.25849|0.25849	.|.	.|.	.|.	.|.	.|.	T|T	0.51958|0.51958	0.1705|0.1705	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.41070|0.41070	-0.9529|-0.9529	4|4	.|.	.|.	.|.	.|.	5.383|5.383	0.16201|0.16201	0.0:0.455:0.0:0.545|0.0:0.455:0.0:0.545	.|.	.|.	.|.	.|.	C|L	1573|1965;766;491	.|.	.|.	R|S	+|+	1|2	0|0	WNK2|WNK2	95100154|95100154	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	0.473000|0.473000	0.22132|0.22132	0.579000|0.579000	0.29504|0.29504	-0.156000|-0.156000	0.13503|0.13503	CGT|TCG	WNK2	-	NULL	ENSG00000165238		0.672	WNK2-001	KNOWN	basic|appris_candidate_longest	protein_coding	WNK2	HGNC	protein_coding	OTTHUMT00000317359.1	9	0.00	0	C	NM_006648		96060333	96060333	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453718	ensembl	human	putative	69_37n	missense	9	55.00	11	SNP	1.000	T
XPO7	23039	genome.wustl.edu	37	8	21844747	21844747	+	Missense_Mutation	SNP	G	G	A	rs145466010		TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr8:21844747G>A	ENST00000252512.9	+	14	1773	c.1673G>A	c.(1672-1674)cGt>cAt	p.R558H	XPO7_ENST00000433566.4_Missense_Mutation_p.R559H|XPO7_ENST00000434536.1_Missense_Mutation_p.R567H	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	558					mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		GAACAGTTTCGTAAGATCTAC	0.483													G|||	1	0.000199681	0.0008	0.0	5008	,	,		20922	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													112.0	114.0	113.0					8																	21844747		1916	4120	6036	-	-	-	SO:0001583	missense	0			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.1673G>A	8.37:g.21844747G>A	ENSP00000252512:p.Arg558His	Somatic		WXS	Illumina GAIIx	Phase_IV	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.R567H	ENST00000252512.9	37	c.1700	CCDS47818.1	8	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	24.2	4.504759	0.85176	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.67171	-0.25;-0.25;-0.25	5.78	5.78	0.91487	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.82407	0.5030	M	0.89214	3.015	0.80722	D	1	D;D;D	0.63880	0.989;0.993;0.993	P;P;P	0.58970	0.51;0.849;0.849	T	0.80296	-0.1442	10	0.22706	T	0.39	-8.456	19.6228	0.95665	0.0:0.0:1.0:0.0	.	559;567;558	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	H	567;558;559	ENSP00000404853:R567H;ENSP00000252512:R558H;ENSP00000410249:R559H	ENSP00000252512:R558H	R	+	2	0	XPO7	21900693	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.659000	0.98597	2.732000	0.93576	0.655000	0.94253	CGT	XPO7	-	superfamily_ARM-type_fold	ENSG00000130227		0.483	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	147	0.00	0	G	NM_015024		21844747	21844747	+1	no_errors	ENST00000434536	ensembl	human	known	69_37n	missense	192	11.93	26	SNP	1.000	A
ZC4H2	55906	genome.wustl.edu	37	X	64137672	64137672	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:64137672C>T	ENST00000374839.3	-	5	772	c.666G>A	c.(664-666)caG>caA	p.Q222Q	ZC4H2_ENST00000337990.2_Silent_p.Q199Q|ZC4H2_ENST00000545618.1_Silent_p.Q217Q|ZC4H2_ENST00000447788.2_Missense_Mutation_p.R168K|ZC4H2_ENST00000488608.1_5'UTR	NM_018684.3	NP_061154.1	Q9NQZ6	ZC4H2_HUMAN	zinc finger, C4H2 domain containing	222					nervous system development (GO:0007399)|neuromuscular junction development (GO:0007528)|spinal cord motor neuron differentiation (GO:0021522)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	metal ion binding (GO:0046872)			endometrium(2)|large_intestine(4)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	24						TTTATTCATCCTGCTTCCGTT	0.483																																						dbGAP											0													181.0	110.0	134.0					X																	64137672		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF270491	CCDS14380.1, CCDS55431.1, CCDS55432.1	Xq11.1	2013-07-23	2008-10-01	2008-10-01	ENSG00000126970	ENSG00000126970		"""Zinc fingers"""	24931	protein-coding gene	gene with protein product		300897	"""KIAA1166"", ""Wieacker-Wolff syndrome"""	KIAA1166, WWS		10574461, 12097419, 23623388	Standard	NM_018684		Approved	HCA127	uc004dvu.3	Q9NQZ6	OTTHUMG00000021712	ENST00000374839.3:c.666G>A	X.37:g.64137672C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDC2|B3KVZ5|B4DED0|E7EM74|G3V1L3|Q53H73|Q5JTF9|Q9H9C3|Q9H9H7|Q9ULQ4	Missense_Mutation	SNP	pfam_Znf-C4H2	p.R168K	ENST00000374839.3	37	c.503	CCDS14380.1	X	.	.	.	.	.	.	.	.	.	.	C	5.219	0.225958	0.09916	.	.	ENSG00000126970	ENST00000447788	.	.	.	5.42	-1.12	0.09808	.	.	.	.	.	T	0.49236	0.1545	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.22103	-1.0226	7	0.48119	T	0.1	.	10.6996	0.45920	0.0:0.3599:0.0:0.6401	.	168	B4DED0	.	K	168	.	ENSP00000399126:R168K	R	-	2	0	ZC4H2	64054397	0.914000	0.31030	0.967000	0.41034	0.993000	0.82548	-0.067000	0.11579	-0.649000	0.05430	-0.198000	0.12761	AGG	ZC4H2	-	NULL	ENSG00000126970		0.483	ZC4H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC4H2	HGNC	protein_coding	OTTHUMT00000056958.1	293	0.00	0	C	NM_018684		64137672	64137672	-1	no_errors	ENST00000447788	ensembl	human	known	69_37n	missense	174	36.50	100	SNP	0.508	T
ZCCHC6	79670	genome.wustl.edu	37	9	88938113	88938113	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr9:88938113T>C	ENST00000375963.3	-	13	2724	c.2552A>G	c.(2551-2553)gAc>gGc	p.D851G	ZCCHC6_ENST00000375961.2_Missense_Mutation_p.D851G|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.D728G|ZCCHC6_ENST00000469004.1_5'Flank|ZCCHC6_ENST00000277141.6_Missense_Mutation_p.D140G	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	851	Glu-rich.				RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						ctcttcttcgtcgtcctcctc	0.463																																						dbGAP											0													114.0	99.0	104.0					9																	88938113		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.2552A>G	9.37:g.88938113T>C	ENSP00000365130:p.Asp851Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.D851G	ENST00000375963.3	37	c.2552	CCDS35057.1	9	.	.	.	.	.	.	.	.	.	.	T	8.072	0.770549	0.15983	.	.	ENSG00000083223	ENST00000277141;ENST00000375960;ENST00000375961;ENST00000375963	T;T;T;T	0.62105	0.05;0.53;0.55;0.57	4.04	4.04	0.47022	.	0.436137	0.19907	N	0.103393	T	0.37679	0.1012	N	0.03608	-0.345	0.29855	N	0.828102	B;B	0.26635	0.05;0.155	B;B	0.25884	0.014;0.064	T	0.35500	-0.9786	10	0.33940	T	0.23	-30.7341	12.0968	0.53758	0.0:0.0:0.0:1.0	.	728;851	Q5VYS8-4;Q5VYS8	.;TUT7_HUMAN	G	140;728;851;851	ENSP00000277141:D140G;ENSP00000365127:D728G;ENSP00000365128:D851G;ENSP00000365130:D851G	ENSP00000277141:D140G	D	-	2	0	ZCCHC6	88127933	0.005000	0.15991	0.777000	0.31699	0.037000	0.13140	1.300000	0.33436	1.675000	0.50919	0.438000	0.28831	GAC	ZCCHC6	-	NULL	ENSG00000083223		0.463	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	172	0.00	0	T	NM_024617		88938113	88938113	-1	no_errors	ENST00000375963	ensembl	human	known	69_37n	missense	105	28.57	42	SNP	0.871	C
ZDHHC16	84287	genome.wustl.edu	37	10	99211936	99211936	+	Silent	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr10:99211936A>G	ENST00000370854.3	+	3	522	c.333A>G	c.(331-333)tcA>tcG	p.S111S	ZDHHC16_ENST00000352634.4_Silent_p.S111S|ZDHHC16_ENST00000370846.4_Silent_p.S111S|ZDHHC16_ENST00000393760.1_Silent_p.S111S|ZDHHC16_ENST00000495735.1_3'UTR|ZDHHC16_ENST00000345745.5_Intron|ZDHHC16_ENST00000370842.2_Silent_p.S111S|ZDHHC16_ENST00000353979.3_Silent_p.S111S	NM_032327.2	NP_115703.2	Q969W1	ZDH16_HUMAN	zinc finger, DHHC-type containing 16	111					apoptotic process (GO:0006915)|protein palmitoylation (GO:0018345)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	palmitoyltransferase activity (GO:0016409)|protein-cysteine S-palmitoyltransferase activity (GO:0019706)|zinc ion binding (GO:0008270)			kidney(4)|large_intestine(3)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	14		Colorectal(252;0.0846)		Epithelial(162;5.81e-10)|all cancers(201;4.19e-08)		GAACCTACTCAGTGCCACGAC	0.552																																						dbGAP											0													163.0	125.0	138.0					10																	99211936		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF258563	CCDS7460.1, CCDS7461.1, CCDS7462.1, CCDS7463.1, CCDS73176.1	10q24.1	2008-05-02			ENSG00000171307	ENSG00000171307		"""Zinc fingers, DHHC-type"""	20714	protein-coding gene	gene with protein product						12021275	Standard	NM_198043		Approved	APH2	uc001knk.3	Q969W1	OTTHUMG00000018847	ENST00000370854.3:c.333A>G	10.37:g.99211936A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR52|D3DR53|D3DR54|Q5JTG7|Q5JTH0|Q8N4Z6|Q8WY84|Q9BSV3	Missense_Mutation	SNP	pfam_Znf_DHHC_palmitoyltrfase,pfscan_Znf_DHHC_palmitoyltrfase	p.Q87R	ENST00000370854.3	37	c.260	CCDS7460.1	10	.	.	.	.	.	.	.	.	.	.	A	8.225	0.803327	0.16397	.	.	ENSG00000171307	ENST00000420089;ENST00000417044	.	.	.	5.55	-5.85	0.02311	.	.	.	.	.	T	0.35828	0.0945	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.43621	-0.9380	4	.	.	.	-24.4917	1.6923	0.02854	0.2535:0.3739:0.1887:0.1839	.	.	.	.	R	87;53	.	.	Q	+	2	0	ZDHHC16	99201926	0.006000	0.16342	0.990000	0.47175	0.992000	0.81027	-1.012000	0.03649	-0.469000	0.06911	0.459000	0.35465	CAG	ZDHHC16	-	NULL	ENSG00000171307		0.552	ZDHHC16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZDHHC16	HGNC	protein_coding	OTTHUMT00000049658.2	170	0.00	0	A	NM_032327		99211936	99211936	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000420089	ensembl	human	known	69_37n	missense	154	28.24	61	SNP	0.178	G
ZMYM3	9203	genome.wustl.edu	37	X	70472854	70472854	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:70472854delC	ENST00000353904.2	-	2	439	c.252delG	c.(250-252)gggfs	p.G84fs	ZMYM3_ENST00000314425.5_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000373982.1_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000373984.3_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000373981.1_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000373998.1_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000373978.1_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000373988.1_Frame_Shift_Del_p.G84fs|ZMYM3_ENST00000489332.1_5'UTR	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	84					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TATAGAGCAGCCCCCCCAGCC	0.642																																						dbGAP											0													15.0	17.0	16.0					X																	70472854		2194	4281	6475	-	-	-	SO:0001589	frameshift_variant	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.252delG	X.37:g.70472854delC	ENSP00000343909:p.Gly84fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVV3|O15089|Q96E26	Frame_Shift_Del	DEL	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.L85fs	ENST00000353904.2	37	c.252	CCDS14409.1	X																																																																																			ZMYM3	-	NULL	ENSG00000147130		0.642	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	30	0.00	0	C	NM_201599		70472854	70472854	-1	no_errors	ENST00000373988	ensembl	human	known	69_37n	frame_shift_del	30	31.91	15	DEL	1.000	-
ZNF282	8427	genome.wustl.edu	37	7	148921569	148921569	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:148921569A>G	ENST00000262085.3	+	8	1951	c.1846A>G	c.(1846-1848)Aac>Gac	p.N616D	ZNF282_ENST00000479907.1_3'UTR	NM_003575.2	NP_003566.1	Q9UDV7	ZN282_HUMAN	zinc finger protein 282	616					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(3)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	17	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00171)	Lung(243;0.145)		CCGCAAGCAGAACCTGCTCAA	0.632																																						dbGAP											0													60.0	53.0	55.0					7																	148921569		2203	4300	6503	-	-	-	SO:0001583	missense	0			D30612	CCDS5895.1	7q36.1	2013-01-08			ENSG00000170265	ENSG00000170265		"""Zinc fingers, C2H2-type"", ""-"""	13076	protein-coding gene	gene with protein product		603397				9396811	Standard	NM_003575		Approved	HUB1	uc003wfm.3	Q9UDV7	OTTHUMG00000158974	ENST00000262085.3:c.1846A>G	7.37:g.148921569A>G	ENSP00000262085:p.Asn616Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRI5|O43691|Q6DKK0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,pfam_DUF3669_Znf,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N616D	ENST00000262085.3	37	c.1846	CCDS5895.1	7	.	.	.	.	.	.	.	.	.	.	A	14.28	2.488523	0.44249	.	.	ENSG00000170265	ENST00000430197;ENST00000262085	T	0.07444	3.19	4.15	1.62	0.23740	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000033	T	0.04318	0.0119	N	0.05230	-0.09	0.80722	D	1	B	0.15141	0.012	B	0.17979	0.02	T	0.40403	-0.9565	10	0.62326	D	0.03	-19.389	9.9456	0.41607	0.4658:0.5342:0.0:0.0	.	616	Q9UDV7	ZN282_HUMAN	D	269;616	ENSP00000262085:N616D	ENSP00000262085:N616D	N	+	1	0	ZNF282	148552502	0.000000	0.05858	0.999000	0.59377	0.986000	0.74619	-3.145000	0.00584	0.230000	0.21059	0.379000	0.24179	AAC	ZNF282	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170265		0.632	ZNF282-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF282	HGNC	protein_coding	OTTHUMT00000352746.1	29	0.00	0	A	NM_003575		148921569	148921569	+1	no_errors	ENST00000262085	ensembl	human	known	69_37n	missense	33	40.00	22	SNP	0.957	G
ZNF362	149076	genome.wustl.edu	37	1	33745989	33745989	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:33745989C>T	ENST00000539719.1	+	5	784	c.614C>T	c.(613-615)cCg>cTg	p.P205L	ZNF362_ENST00000373428.5_Missense_Mutation_p.P205L	NM_152493.2	NP_689706.2	Q5T0B9	ZN362_HUMAN	zinc finger protein 362	205					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(1)|large_intestine(4)|lung(2)	10		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				CCGGGGGGTCCGCCTGTCCTT	0.652																																					Pancreas(162;1431 2676 35353 38425)	dbGAP											0													17.0	18.0	18.0					1																	33745989		2202	4297	6499	-	-	-	SO:0001583	missense	0				CCDS377.1	1p35.1	2013-01-08			ENSG00000160094	ENSG00000160094		"""Zinc fingers, C2H2-type"""	18079	protein-coding gene	gene with protein product	"""rotund homolog (Drosophila)"""						Standard	NM_152493		Approved	FLJ25476, lin-29, RN	uc001bxc.1	Q5T0B9	OTTHUMG00000004124	ENST00000539719.1:c.614C>T	1.37:g.33745989C>T	ENSP00000446335:p.Pro205Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WYU4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P205L	ENST00000539719.1	37	c.614	CCDS377.1	1	.	.	.	.	.	.	.	.	.	.	C	18.54	3.645947	0.67358	.	.	ENSG00000160094	ENST00000483388;ENST00000539719;ENST00000373428	T;T	0.42900	0.96;0.96	5.99	5.99	0.97316	.	0.352984	0.20474	N	0.091631	T	0.36413	0.0966	L	0.52759	1.655	0.80722	D	1	P	0.47545	0.897	B	0.35859	0.212	T	0.16958	-1.0385	10	0.21540	T	0.41	-25.0105	18.0311	0.89285	0.0:1.0:0.0:0.0	.	205	Q5T0B9	ZN362_HUMAN	L	192;205;205	ENSP00000446335:P205L;ENSP00000362527:P205L	ENSP00000362527:P205L	P	+	2	0	ZNF362	33518576	1.000000	0.71417	0.967000	0.41034	0.999000	0.98932	7.373000	0.79623	2.857000	0.98124	0.650000	0.86243	CCG	ZNF362	-	NULL	ENSG00000160094		0.652	ZNF362-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF362	HGNC	protein_coding	OTTHUMT00000011857.2	18	0.00	0	C	NM_152493		33745989	33745989	+1	no_errors	ENST00000373428	ensembl	human	known	69_37n	missense	19	40.62	13	SNP	0.994	T
ZNF645	158506	genome.wustl.edu	37	X	22292144	22292144	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chrX:22292144C>T	ENST00000323684.1	+	1	1080	c.1036C>T	c.(1036-1038)Caa>Taa	p.Q346*		NM_152577.3	NP_689790.1	Q8N7E2	ZN645_HUMAN	zinc finger protein 645	346					protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(4)|large_intestine(8)|lung(9)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(1)	27						TCCCCAGTCTCAAAATGGTAA	0.423																																						dbGAP											0													128.0	108.0	115.0					X																	22292144		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK098601	CCDS14205.1	Xp22.11	2014-01-21			ENSG00000175809	ENSG00000175809			26371	protein-coding gene	gene with protein product							Standard	NM_152577		Approved	FLJ25735, HAKAIL, CT138	uc004dai.2	Q8N7E2	OTTHUMG00000021242	ENST00000323684.1:c.1036C>T	X.37:g.22292144C>T	ENSP00000323348:p.Gln346*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV29|A0AV31|E3SBK4|Q6DJY9	Nonsense_Mutation	SNP	pfscan_Znf_RING,pfscan_Znf_C2H2	p.Q346*	ENST00000323684.1	37	c.1036	CCDS14205.1	X	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939708	0.52972	.	.	ENSG00000175809	ENST00000323684	.	.	.	2.8	0.864	0.19068	.	0.000000	0.64402	U	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	.	4.3734	0.11258	0.2221:0.6381:0.0:0.1398	.	.	.	.	X	346	.	ENSP00000323348:Q346X	Q	+	1	0	ZNF645	22202065	0.992000	0.36948	0.001000	0.08648	0.035000	0.12851	1.123000	0.31308	0.090000	0.17273	0.600000	0.82982	CAA	ZNF645	-	NULL	ENSG00000175809		0.423	ZNF645-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF645	HGNC	protein_coding	OTTHUMT00000056037.1	230	0.00	0	C	NM_152577		22292144	22292144	+1	no_errors	ENST00000323684	ensembl	human	known	69_37n	nonsense	244	15.46	45	SNP	0.910	T
ZNF687	57592	genome.wustl.edu	37	1	151261079	151261079	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr1:151261079delC	ENST00000368879.2	+	3	2289	c.2191delC	c.(2191-2193)cccfs	p.P732fs		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	732					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.H733fs*30(1)		breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TAAGAATCGACCCCCCCATGT	0.577																																						dbGAP											1	Deletion - Frameshift(1)	large_intestine(1)											117.0	98.0	105.0					1																	151261079		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.2191delC	1.37:g.151261079delC	ENSP00000357874:p.Pro732fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H733fs	ENST00000368879.2	37	c.2191		1																																																																																			ZNF687	-	smart_Znf_C2H2-like	ENSG00000143373		0.577	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding		65	0.00	0	C	NM_020832		151261079	151261079	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	frame_shift_del	71	12.20	10	DEL	0.430	-
ZNF785	146540	genome.wustl.edu	37	16	30594700	30594700	+	Silent	SNP	C	C	T			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr16:30594700C>T	ENST00000395216.2	-	3	558	c.399G>A	c.(397-399)gcG>gcA	p.A133A	ZNF785_ENST00000470110.1_Silent_p.A118A|AC002310.7_ENST00000492040.1_RNA|RP11-146F11.5_ENST00000563540.1_RNA|AC002310.7_ENST00000486926.1_RNA	NM_152458.6	NP_689671.2	A8K8V0	ZN785_HUMAN	zinc finger protein 785	133					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|lung(2)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	9						CCACTTCATGCGCCACCTCTT	0.522																																						dbGAP											0													87.0	95.0	92.0					16																	30594700		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			BC040642	CCDS10685.1	16p11.2	2013-01-08			ENSG00000197162	ENSG00000197162		"""Zinc fingers, C2H2-type"", ""-"""	26496	protein-coding gene	gene with protein product						10493829	Standard	NM_152458		Approved	FLJ32130	uc002dyu.3	A8K8V0	OTTHUMG00000132398	ENST00000395216.2:c.399G>A	16.37:g.30594700C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75701|Q8IW91|Q8WV14|Q96MN0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A133	ENST00000395216.2	37	c.399	CCDS10685.1	16																																																																																			ZNF785	-	NULL	ENSG00000197162		0.522	ZNF785-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF785	HGNC	protein_coding	OTTHUMT00000255529.2	52	0.00	0	C	NM_152458		30594700	30594700	-1	no_errors	ENST00000395216	ensembl	human	known	69_37n	silent	37	44.78	30	SNP	0.000	T
ZNF786	136051	genome.wustl.edu	37	7	148769157	148769157	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0HA-01A-11D-A12Q-09	TCGA-BH-A0HA-11A-31D-A12Q-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	95f2ee35-a485-4995-8205-01623d97da2d	eb1421a0-3424-4a55-be66-9bea2d867c12	g.chr7:148769157A>G	ENST00000491431.1	-	4	771	c.707T>C	c.(706-708)gTa>gCa	p.V236A	ZNF786_ENST00000451334.3_Missense_Mutation_p.V199A|ZNF786_ENST00000316286.9_Missense_Mutation_p.V150A	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	236					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			GTGCCTCTGTACCCGAGGGCT	0.647																																						dbGAP											0													28.0	35.0	33.0					7																	148769157		2133	4221	6354	-	-	-	SO:0001583	missense	0			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.707T>C	7.37:g.148769157A>G	ENSP00000417470:p.Val236Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A568|B4DMI1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V236A	ENST00000491431.1	37	c.707	CCDS47738.1	7	.	.	.	.	.	.	.	.	.	.	A	1.767	-0.485249	0.04352	.	.	ENSG00000197362	ENST00000316286;ENST00000538412;ENST00000491431;ENST00000451334	T;T;T	0.07688	3.17;3.3;3.25	3.72	-0.226	0.13106	.	.	.	.	.	T	0.04318	0.0119	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39603	-0.9606	9	0.66056	D	0.02	0.2561	7.4205	0.27069	0.2549:0.5554:0.1897:0.0	.	236	Q8N393	ZN786_HUMAN	A	150;150;236;199	ENSP00000313516:V150A;ENSP00000417470:V236A;ENSP00000404984:V199A	ENSP00000313516:V150A	V	-	2	0	ZNF786	148400090	0.000000	0.05858	0.000000	0.03702	0.019000	0.09904	0.097000	0.15168	-0.271000	0.09272	-1.202000	0.01658	GTA	ZNF786	-	NULL	ENSG00000197362		0.647	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	31	0.00	0	A	NM_152411		148769157	148769157	-1	no_errors	ENST00000491431	ensembl	human	known	69_37n	missense	24	35.71	15	SNP	0.000	G
