#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A1CF	29974	genome.wustl.edu	37	10	52595854	52595854	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:52595854G>A	ENST00000373993.1	-	4	628	c.584C>T	c.(583-585)gCg>gTg	p.A195V	A1CF_ENST00000373997.3_Missense_Mutation_p.A195V|A1CF_ENST00000282641.2_Missense_Mutation_p.A195V|A1CF_ENST00000373995.3_Missense_Mutation_p.A203V|A1CF_ENST00000395489.2_Missense_Mutation_p.A188V|A1CF_ENST00000374001.2_Missense_Mutation_p.A195V|A1CF_ENST00000395495.1_Missense_Mutation_p.A195V			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	195	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.A203V(2)|p.A195V(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTTCCTCCTCGCCATGGCAGC	0.488																																						dbGAP											4	Substitution - Missense(4)	lung(2)|breast(2)											106.0	96.0	100.0					10																	52595854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.584C>T	10.37:g.52595854G>A	ENSP00000363105:p.Ala195Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A195V	ENST00000373993.1	37	c.584	CCDS7242.1	10	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550854	0.86127	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	6.04	5.1	0.69264	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.046025	0.85682	D	0.000000	T	0.64616	0.2614	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.993;0.998	D;P;P;P	0.64042	0.921;0.893;0.73;0.888	T	0.71255	-0.4647	10	0.87932	D	0	-9.2963	16.5645	0.84575	0.0:0.1418:0.8582:0.0	.	188;195;195;203	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	V	195;195;195;203;195;195;178;188;195	ENSP00000363113:A195V;ENSP00000363105:A195V;ENSP00000363109:A195V;ENSP00000363107:A203V;ENSP00000282641:A195V;ENSP00000378873:A195V;ENSP00000378868:A188V;ENSP00000397953:A195V	ENSP00000282641:A195V	A	-	2	0	A1CF	52265860	1.000000	0.71417	0.999000	0.59377	0.619000	0.37552	7.811000	0.86092	2.873000	0.98535	0.563000	0.77884	GCG	A1CF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000148584		0.488	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	98	0.00	0	G	NM_014576		52595854	52595854	-1	no_errors	ENST00000282641	ensembl	human	known	69_37n	missense	43	33.85	22	SNP	1.000	A
A1CF	29974	genome.wustl.edu	37	10	52595854	52595854	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:52595854G>A	ENST00000373993.1	-	4	628	c.584C>T	c.(583-585)gCg>gTg	p.A195V	A1CF_ENST00000373997.3_Missense_Mutation_p.A195V|A1CF_ENST00000282641.2_Missense_Mutation_p.A195V|A1CF_ENST00000373995.3_Missense_Mutation_p.A203V|A1CF_ENST00000395489.2_Missense_Mutation_p.A188V|A1CF_ENST00000374001.2_Missense_Mutation_p.A195V|A1CF_ENST00000395495.1_Missense_Mutation_p.A195V			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	195	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)	p.A203V(2)|p.A195V(2)		NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTTCCTCCTCGCCATGGCAGC	0.488																																						dbGAP											4	Substitution - Missense(4)	lung(2)|breast(2)											106.0	96.0	100.0					10																	52595854		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.584C>T	10.37:g.52595854G>A	ENSP00000363105:p.Ala195Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.A195V	ENST00000373993.1	37	c.584	CCDS7242.1	10	.	.	.	.	.	.	.	.	.	.	G	24.6	4.550854	0.86127	.	.	ENSG00000148584	ENST00000374001;ENST00000373993;ENST00000373997;ENST00000373995;ENST00000282641;ENST00000395495;ENST00000395488;ENST00000395489;ENST00000414883	T;T;T;T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28;1.28;1.28;1.28	6.04	5.1	0.69264	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.046025	0.85682	D	0.000000	T	0.64616	0.2614	M	0.88450	2.955	0.80722	D	1	D;D;D;D	0.76494	0.999;0.997;0.993;0.998	D;P;P;P	0.64042	0.921;0.893;0.73;0.888	T	0.71255	-0.4647	10	0.87932	D	0	-9.2963	16.5645	0.84575	0.0:0.1418:0.8582:0.0	.	188;195;195;203	F8W9F8;Q9NQ94;Q9NQ94-2;Q9NQ94-4	.;A1CF_HUMAN;.;.	V	195;195;195;203;195;195;178;188;195	ENSP00000363113:A195V;ENSP00000363105:A195V;ENSP00000363109:A195V;ENSP00000363107:A203V;ENSP00000282641:A195V;ENSP00000378873:A195V;ENSP00000378868:A188V;ENSP00000397953:A195V	ENSP00000282641:A195V	A	-	2	0	A1CF	52265860	1.000000	0.71417	0.999000	0.59377	0.619000	0.37552	7.811000	0.86092	2.873000	0.98535	0.563000	0.77884	GCG	A1CF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000148584		0.488	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	98	0.00	0	G	NM_014576		52595854	52595854	-1	no_errors	ENST00000282641	ensembl	human	known	69_37n	missense	63	32.98	31	SNP	1.000	A
A2ML1	144568	genome.wustl.edu	37	12	9001389	9001389	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:9001389C>G	ENST00000299698.7	+	16	2087	c.1907C>G	c.(1906-1908)tCt>tGt	p.S636C	A2ML1_ENST00000539547.1_Missense_Mutation_p.S145C|A2ML1_ENST00000540049.1_3'UTR	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.S636C(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TGTCCAGTGTCTGGCCCATGG	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											186.0	173.0	177.0					12																	9001389		1978	4152	6130	-	-	-	SO:0001583	missense	0			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1907C>G	12.37:g.9001389C>G	ENSP00000299698:p.Ser636Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.S636C	ENST00000299698.7	37	c.1907	CCDS8596.2	12	.	.	.	.	.	.	.	.	.	.	C	7.869	0.727756	0.15507	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547;ENST00000545692	T;T;T;T	0.32515	1.45;1.57;2.13;1.46	2.99	2.0	0.26442	.	1.077950	0.07265	N	0.868069	T	0.14570	0.0352	N	0.04355	-0.22	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.23261	-1.0193	10	0.38643	T	0.18	.	5.78	0.18301	0.0:0.8342:0.0:0.1658	.	636	A8K2U0	A2ML1_HUMAN	C	636;636;186;145;148	ENSP00000299698:S636C;ENSP00000443174:S186C;ENSP00000438292:S145C;ENSP00000440057:S148C	ENSP00000299698:S636C	S	+	2	0	A2ML1	8892656	0.000000	0.05858	0.144000	0.22314	0.121000	0.20230	0.271000	0.18626	0.731000	0.32448	0.456000	0.33151	TCT	A2ML1	-	NULL	ENSG00000166535		0.537	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	HGNC	protein_coding	OTTHUMT00000250304.3	89	0.00	0	C	NM_144670		9001389	9001389	+1	no_errors	ENST00000299698	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	0.165	G
A2ML1	144568	genome.wustl.edu	37	12	9001389	9001389	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:9001389C>G	ENST00000299698.7	+	16	2087	c.1907C>G	c.(1906-1908)tCt>tGt	p.S636C	A2ML1_ENST00000539547.1_Missense_Mutation_p.S145C|A2ML1_ENST00000540049.1_3'UTR	NM_001282424.1|NM_144670.4	NP_001269353.1|NP_653271			alpha-2-macroglobulin-like 1									p.S636C(1)		NS(2)|breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(2)|lung(36)|ovary(2)|skin(4)|stomach(1)|urinary_tract(1)	80						TGTCCAGTGTCTGGCCCATGG	0.537																																						dbGAP											1	Substitution - Missense(1)	breast(1)											186.0	173.0	177.0					12																	9001389		1978	4152	6130	-	-	-	SO:0001583	missense	0			AK057908	CCDS8596.2, CCDS73439.1	12p13	2010-12-14	2005-09-01	2005-09-01	ENSG00000166535	ENSG00000166535			23336	protein-coding gene	gene with protein product		610627	"""C3 and PZP-like, alpha-2-macroglobulin domain containing 9"""	CPAMD9		16298998	Standard	NM_144670		Approved	FLJ25179	uc001quz.5	A8K2U0	OTTHUMG00000128499	ENST00000299698.7:c.1907C>G	12.37:g.9001389C>G	ENSP00000299698:p.Ser636Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_A2M_comp,pfam_Macroglobln_a2,pfam_A2M_N_2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.S636C	ENST00000299698.7	37	c.1907	CCDS8596.2	12	.	.	.	.	.	.	.	.	.	.	C	7.869	0.727756	0.15507	.	.	ENSG00000166535	ENST00000299698;ENST00000539161;ENST00000541459;ENST00000539547;ENST00000545692	T;T;T;T	0.32515	1.45;1.57;2.13;1.46	2.99	2.0	0.26442	.	1.077950	0.07265	N	0.868069	T	0.14570	0.0352	N	0.04355	-0.22	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.23261	-1.0193	10	0.38643	T	0.18	.	5.78	0.18301	0.0:0.8342:0.0:0.1658	.	636	A8K2U0	A2ML1_HUMAN	C	636;636;186;145;148	ENSP00000299698:S636C;ENSP00000443174:S186C;ENSP00000438292:S145C;ENSP00000440057:S148C	ENSP00000299698:S636C	S	+	2	0	A2ML1	8892656	0.000000	0.05858	0.144000	0.22314	0.121000	0.20230	0.271000	0.18626	0.731000	0.32448	0.456000	0.33151	TCT	A2ML1	-	NULL	ENSG00000166535		0.537	A2ML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2ML1	HGNC	protein_coding	OTTHUMT00000250304.3	89	0.00	0	C	NM_144670		9001389	9001389	+1	no_errors	ENST00000299698	ensembl	human	known	69_37n	missense	99	21.43	27	SNP	0.165	G
ABCA13	154664	genome.wustl.edu	37	7	48427518	48427518	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:48427518C>T	ENST00000435803.1	+	36	11459	c.11435C>T	c.(11434-11436)tCt>tTt	p.S3812F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3812					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S3757F(1)|p.S3812F(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTCTAAGTTCTAGTCTGTTC	0.348																																						dbGAP											2	Substitution - Missense(2)	breast(2)											119.0	115.0	117.0					7																	48427518		1814	4078	5892	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11435C>T	7.37:g.48427518C>T	ENSP00000411096:p.Ser3812Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S3812F	ENST00000435803.1	37	c.11435	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	17.25	3.343181	0.61073	.	.	ENSG00000179869	ENST00000435803	D	0.86865	-2.18	5.42	5.42	0.78866	.	0.127681	0.36134	N	0.002773	D	0.91768	0.7396	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	0.986;1.0	P;D	0.69307	0.742;0.963	D	0.92265	0.5820	10	0.87932	D	0	.	16.3074	0.82854	0.0:1.0:0.0:0.0	.	1514;3812	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	F	3812	ENSP00000411096:S3812F	ENSP00000411096:S3812F	S	+	2	0	ABCA13	48398064	0.034000	0.19679	0.013000	0.15412	0.002000	0.02628	2.428000	0.44749	2.709000	0.92574	0.655000	0.94253	TCT	ABCA13	-	NULL	ENSG00000179869		0.348	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	246	0.00	0	C	NM_152701		48427518	48427518	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	296	19.78	73	SNP	0.093	T
ABCA13	154664	genome.wustl.edu	37	7	48427518	48427518	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:48427518C>T	ENST00000435803.1	+	36	11459	c.11435C>T	c.(11434-11436)tCt>tTt	p.S3812F		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	3812					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.S3757F(1)|p.S3812F(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTCTAAGTTCTAGTCTGTTC	0.348																																						dbGAP											2	Substitution - Missense(2)	breast(2)											119.0	115.0	117.0					7																	48427518		1814	4078	5892	-	-	-	SO:0001583	missense	0			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.11435C>T	7.37:g.48427518C>T	ENSP00000411096:p.Ser3812Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S3812F	ENST00000435803.1	37	c.11435	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	17.25	3.343181	0.61073	.	.	ENSG00000179869	ENST00000435803	D	0.86865	-2.18	5.42	5.42	0.78866	.	0.127681	0.36134	N	0.002773	D	0.91768	0.7396	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	0.986;1.0	P;D	0.69307	0.742;0.963	D	0.92265	0.5820	10	0.87932	D	0	.	16.3074	0.82854	0.0:1.0:0.0:0.0	.	1514;3812	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	F	3812	ENSP00000411096:S3812F	ENSP00000411096:S3812F	S	+	2	0	ABCA13	48398064	0.034000	0.19679	0.013000	0.15412	0.002000	0.02628	2.428000	0.44749	2.709000	0.92574	0.655000	0.94253	TCT	ABCA13	-	NULL	ENSG00000179869		0.348	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	246	0.00	0	C	NM_152701		48427518	48427518	+1	no_errors	ENST00000435803	ensembl	human	known	69_37n	missense	423	19.73	104	SNP	0.093	T
ABCA2	20	genome.wustl.edu	37	9	139904093	139904093	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:139904093C>T	ENST00000371605.3	-	43	6778	c.6631G>A	c.(6631-6633)Gag>Aag	p.E2211K	ABCA2_ENST00000265662.5_Missense_Mutation_p.E2212K|ABCA2_ENST00000341511.6_Missense_Mutation_p.E2212K			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	2211	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GTGGTGGGCTCGTCCTGGGGA	0.642																																						dbGAP											0													56.0	69.0	64.0					9																	139904093		2188	4294	6482	-	-	-	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.6631G>A	9.37:g.139904093C>T	ENSP00000360666:p.Glu2211Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E2212K	ENST00000371605.3	37	c.6634		9	.	.	.	.	.	.	.	.	.	.	C	28.6	4.934973	0.92458	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000398210;ENST00000355090;ENST00000341511	D;D;D	0.98849	-5.18;-5.18;-5.18	3.42	3.42	0.39159	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.332844	0.29760	N	0.011275	D	0.99174	0.9714	H	0.99705	4.715	0.80722	D	1	D;D	0.61080	0.979;0.989	P;P	0.46237	0.508;0.508	D	0.99218	1.0878	10	0.87932	D	0	.	15.3743	0.74593	0.0:1.0:0.0:0.0	.	2211;2242	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	K	2212;2211;113;2242;2212	ENSP00000265662:E2212K;ENSP00000360666:E2211K;ENSP00000344155:E2212K	ENSP00000265662:E2212K	E	-	1	0	ABCA2	139023914	1.000000	0.71417	0.975000	0.42487	0.879000	0.50718	7.167000	0.77562	1.914000	0.55421	0.491000	0.48974	GAG	ABCA2	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000107331		0.642	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		59	0.00	0	C	NM_001606		139904093	139904093	-1	no_errors	ENST00000265662	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	T
ADAMTS14	140766	genome.wustl.edu	37	10	72462167	72462167	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:72462167C>T	ENST00000373207.1	+	3	622	c.622C>T	c.(622-624)Cgc>Tgc	p.R208C	ADAMTS14_ENST00000373208.1_Missense_Mutation_p.R208C	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	208					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						TGTGGTGTACCGCCGGGAGGC	0.642																																						dbGAP											0													65.0	68.0	67.0					10																	72462167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.622C>T	10.37:g.72462167C>T	ENSP00000362303:p.Arg208Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.R208C	ENST00000373207.1	37	c.622	CCDS7306.1	10	.	.	.	.	.	.	.	.	.	.	C	24.5	4.537815	0.85917	.	.	ENSG00000138316	ENST00000373208;ENST00000373207	T;T	0.66460	-0.21;-0.18	5.93	5.93	0.95920	.	0.072405	0.52532	D	0.000077	T	0.78470	0.4288	L	0.56769	1.78	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.79405	-0.1817	10	0.87932	D	0	.	14.7475	0.69499	0.1447:0.8553:0.0:0.0	.	208;208	Q8WXS8;Q5T4G1	ATS14_HUMAN;.	C	208	ENSP00000362304:R208C;ENSP00000362303:R208C	ENSP00000362303:R208C	R	+	1	0	ADAMTS14	72132173	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.623000	0.54224	2.821000	0.97095	0.555000	0.69702	CGC	ADAMTS14	-	NULL	ENSG00000138316		0.642	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	53	0.00	0	C	NM_080722		72462167	72462167	+1	no_errors	ENST00000373208	ensembl	human	known	69_37n	missense	11	21.43	3	SNP	1.000	T
ADNP	23394	genome.wustl.edu	37	20	49508164	49508164	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:49508164C>G	ENST00000396029.3	-	5	3654	c.3087G>C	c.(3085-3087)aaG>aaC	p.K1029N	ADNP_ENST00000396032.3_Missense_Mutation_p.K1029N|ADNP_ENST00000371602.4_Missense_Mutation_p.K1029N|ADNP_ENST00000349014.3_Missense_Mutation_p.K1029N	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	1029					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K1029N(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						AGGAACTATTCTTCCATTTCA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	130.0	132.0					20																	49508164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.3087G>C	20.37:g.49508164C>G	ENSP00000379346:p.Lys1029Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.K1029N	ENST00000396029.3	37	c.3087	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244024	0.39697	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.17	6.17	0.99709	.	0.127101	0.53938	D	0.000047	T	0.62600	0.2441	N	0.19112	0.55	0.44771	D	0.99777	D	0.71674	0.998	D	0.73708	0.981	T	0.65240	-0.6216	9	0.72032	D	0.01	-2.5208	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	1029	Q9H2P0	ADNP_HUMAN	N	1029	.	ENSP00000342905:K1029N	K	-	3	2	ADNP	48941571	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.099000	0.41767	2.941000	0.99782	0.655000	0.94253	AAG	ADNP	-	NULL	ENSG00000101126		0.463	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	81	0.00	0	C	NM_181442		49508164	49508164	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	127	10.56	15	SNP	1.000	G
ADNP	23394	genome.wustl.edu	37	20	49508164	49508164	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:49508164C>G	ENST00000396029.3	-	5	3654	c.3087G>C	c.(3085-3087)aaG>aaC	p.K1029N	ADNP_ENST00000396032.3_Missense_Mutation_p.K1029N|ADNP_ENST00000371602.4_Missense_Mutation_p.K1029N|ADNP_ENST00000349014.3_Missense_Mutation_p.K1029N	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	1029					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.K1029N(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						AGGAACTATTCTTCCATTTCA	0.463																																						dbGAP											1	Substitution - Missense(1)	breast(1)											135.0	130.0	132.0					20																	49508164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.3087G>C	20.37:g.49508164C>G	ENSP00000379346:p.Lys1029Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.K1029N	ENST00000396029.3	37	c.3087	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	13.46	2.244024	0.39697	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.17	6.17	0.99709	.	0.127101	0.53938	D	0.000047	T	0.62600	0.2441	N	0.19112	0.55	0.44771	D	0.99777	D	0.71674	0.998	D	0.73708	0.981	T	0.65240	-0.6216	9	0.72032	D	0.01	-2.5208	13.9957	0.64397	0.0:0.9315:0.0:0.0685	.	1029	Q9H2P0	ADNP_HUMAN	N	1029	.	ENSP00000342905:K1029N	K	-	3	2	ADNP	48941571	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.099000	0.41767	2.941000	0.99782	0.655000	0.94253	AAG	ADNP	-	NULL	ENSG00000101126		0.463	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	81	0.00	0	C	NM_181442		49508164	49508164	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	81	10.99	10	SNP	1.000	G
ADNP	23394	genome.wustl.edu	37	20	49508391	49508391	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:49508391C>G	ENST00000396029.3	-	5	3427	c.2860G>C	c.(2860-2862)Gat>Cat	p.D954H	ADNP_ENST00000396032.3_Missense_Mutation_p.D954H|ADNP_ENST00000371602.4_Missense_Mutation_p.D954H|ADNP_ENST00000349014.3_Missense_Mutation_p.D954H	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	954					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D954H(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ACCTCACTATCAGATGCATTG	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											174.0	166.0	169.0					20																	49508391		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2860G>C	20.37:g.49508391C>G	ENSP00000379346:p.Asp954His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D954H	ENST00000396029.3	37	c.2860	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173185	0.38413	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.17	6.17	0.99709	.	0.062472	0.64402	D	0.000011	T	0.47154	0.1430	N	0.19112	0.55	0.52501	D	0.999957	D	0.52996	0.957	P	0.45377	0.478	T	0.40942	-0.9536	9	0.42905	T	0.14	-7.5824	20.8794	0.99867	0.0:1.0:0.0:0.0	.	954	Q9H2P0	ADNP_HUMAN	H	954	.	ENSP00000342905:D954H	D	-	1	0	ADNP	48941798	1.000000	0.71417	0.259000	0.24435	0.274000	0.26718	6.494000	0.73661	2.941000	0.99782	0.655000	0.94253	GAT	ADNP	-	NULL	ENSG00000101126		0.438	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	46	0.00	0	C	NM_181442		49508391	49508391	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	151	11.70	20	SNP	0.948	G
ADNP	23394	genome.wustl.edu	37	20	49508391	49508391	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:49508391C>G	ENST00000396029.3	-	5	3427	c.2860G>C	c.(2860-2862)Gat>Cat	p.D954H	ADNP_ENST00000396032.3_Missense_Mutation_p.D954H|ADNP_ENST00000371602.4_Missense_Mutation_p.D954H|ADNP_ENST00000349014.3_Missense_Mutation_p.D954H	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	954					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.D954H(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ACCTCACTATCAGATGCATTG	0.438																																						dbGAP											1	Substitution - Missense(1)	breast(1)											174.0	166.0	169.0					20																	49508391		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2860G>C	20.37:g.49508391C>G	ENSP00000379346:p.Asp954His	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D954H	ENST00000396029.3	37	c.2860	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	13.22	2.173185	0.38413	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.17	6.17	0.99709	.	0.062472	0.64402	D	0.000011	T	0.47154	0.1430	N	0.19112	0.55	0.52501	D	0.999957	D	0.52996	0.957	P	0.45377	0.478	T	0.40942	-0.9536	9	0.42905	T	0.14	-7.5824	20.8794	0.99867	0.0:1.0:0.0:0.0	.	954	Q9H2P0	ADNP_HUMAN	H	954	.	ENSP00000342905:D954H	D	-	1	0	ADNP	48941798	1.000000	0.71417	0.259000	0.24435	0.274000	0.26718	6.494000	0.73661	2.941000	0.99782	0.655000	0.94253	GAT	ADNP	-	NULL	ENSG00000101126		0.438	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	46	0.00	0	C	NM_181442		49508391	49508391	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	99	10.81	12	SNP	0.948	G
ADNP	23394	genome.wustl.edu	37	20	49508687	49508687	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:49508687C>G	ENST00000396029.3	-	5	3131	c.2564G>C	c.(2563-2565)aGa>aCa	p.R855T	ADNP_ENST00000396032.3_Missense_Mutation_p.R855T|ADNP_ENST00000371602.4_Missense_Mutation_p.R855T|ADNP_ENST00000349014.3_Missense_Mutation_p.R855T	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	855					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R855T(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						AGCATTGACTCTGGAATCCTT	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	125.0	124.0					20																	49508687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2564G>C	20.37:g.49508687C>G	ENSP00000379346:p.Arg855Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.R855T	ENST00000396029.3	37	c.2564	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	14.89	2.668989	0.47677	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.88	5.88	0.94601	.	0.117593	0.56097	D	0.000021	T	0.44993	0.1320	N	0.14661	0.345	0.40018	D	0.975378	P	0.51791	0.948	P	0.46362	0.514	T	0.50004	-0.8878	9	0.54805	T	0.06	1.4565	18.3992	0.90510	0.0:1.0:0.0:0.0	.	855	Q9H2P0	ADNP_HUMAN	T	855	.	ENSP00000342905:R855T	R	-	2	0	ADNP	48942094	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.541000	0.45735	2.780000	0.95670	0.655000	0.94253	AGA	ADNP	-	NULL	ENSG00000101126		0.378	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	118	0.00	0	C	NM_181442		49508687	49508687	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	130	10.34	15	SNP	1.000	G
ADNP	23394	genome.wustl.edu	37	20	49508687	49508687	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:49508687C>G	ENST00000396029.3	-	5	3131	c.2564G>C	c.(2563-2565)aGa>aCa	p.R855T	ADNP_ENST00000396032.3_Missense_Mutation_p.R855T|ADNP_ENST00000371602.4_Missense_Mutation_p.R855T|ADNP_ENST00000349014.3_Missense_Mutation_p.R855T	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	855					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R855T(1)		NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						AGCATTGACTCTGGAATCCTT	0.378																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	125.0	124.0					20																	49508687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2564G>C	20.37:g.49508687C>G	ENSP00000379346:p.Arg855Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.R855T	ENST00000396029.3	37	c.2564	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	14.89	2.668989	0.47677	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.88	5.88	0.94601	.	0.117593	0.56097	D	0.000021	T	0.44993	0.1320	N	0.14661	0.345	0.40018	D	0.975378	P	0.51791	0.948	P	0.46362	0.514	T	0.50004	-0.8878	9	0.54805	T	0.06	1.4565	18.3992	0.90510	0.0:1.0:0.0:0.0	.	855	Q9H2P0	ADNP_HUMAN	T	855	.	ENSP00000342905:R855T	R	-	2	0	ADNP	48942094	1.000000	0.71417	1.000000	0.80357	0.904000	0.53231	2.541000	0.45735	2.780000	0.95670	0.655000	0.94253	AGA	ADNP	-	NULL	ENSG00000101126		0.378	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	118	0.00	0	C	NM_181442		49508687	49508687	-1	no_errors	ENST00000349014	ensembl	human	known	69_37n	missense	204	11.69	27	SNP	1.000	G
AFF1	4299	genome.wustl.edu	37	4	87968288	87968288	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:87968288C>T	ENST00000307808.6	+	3	1000	c.580C>T	c.(580-582)Cca>Tca	p.P194S	AFF1_ENST00000544085.1_Intron|AFF1_ENST00000395146.4_Missense_Mutation_p.P201S	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	194					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P201S(1)		breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AGATTCGGCTCCAGAGAGGGA	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	131.0	133.0					4																	87968288		2203	4300	6503	-	-	-	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.580C>T	4.37:g.87968288C>T	ENSP00000305689:p.Pro194Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P201S	ENST00000307808.6	37	c.601	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.458172	0.00173	.	.	ENSG00000172493	ENST00000395146;ENST00000395142;ENST00000507468;ENST00000503477;ENST00000307808	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.27	2.53	0.30540	.	1.076590	0.07124	N	0.844359	T	0.51415	0.1673	L	0.28344	0.845	0.09310	N	1	P;P;P;P;P;P	0.46859	0.851;0.885;0.885;0.659;0.659;0.851	P;P;P;B;B;P	0.49226	0.603;0.589;0.589;0.372;0.372;0.603	T	0.28681	-1.0036	10	0.05620	T	0.96	-1.5669	6.9509	0.24544	0.0:0.3336:0.5176:0.1488	.	201;201;135;194;194;201	E9PBM3;B4DXZ8;B4DJM6;Q14C88;P51825;B4DTU1	.;.;.;.;AFF1_HUMAN;.	S	201;201;201;201;194	ENSP00000378578:P201S;ENSP00000427593:P201S;ENSP00000424483:P201S;ENSP00000305689:P194S	ENSP00000305689:P194S	P	+	1	0	AFF1	88187312	0.000000	0.05858	0.295000	0.24960	0.002000	0.02628	0.259000	0.18405	0.194000	0.20326	-0.172000	0.13284	CCA	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.547	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	94	0.00	0	C	NM_005935		87968288	87968288	+1	no_errors	ENST00000395146	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	0.002	T
AFF1	4299	genome.wustl.edu	37	4	87968288	87968288	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:87968288C>T	ENST00000307808.6	+	3	1000	c.580C>T	c.(580-582)Cca>Tca	p.P194S	AFF1_ENST00000544085.1_Intron|AFF1_ENST00000395146.4_Missense_Mutation_p.P201S	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	194					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P201S(1)		breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AGATTCGGCTCCAGAGAGGGA	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	131.0	133.0					4																	87968288		2203	4300	6503	-	-	-	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.580C>T	4.37:g.87968288C>T	ENSP00000305689:p.Pro194Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.P201S	ENST00000307808.6	37	c.601	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	0.003	-2.458172	0.00173	.	.	ENSG00000172493	ENST00000395146;ENST00000395142;ENST00000507468;ENST00000503477;ENST00000307808	T;T;T;T	0.63255	-0.03;-0.03;-0.03;-0.03	5.27	2.53	0.30540	.	1.076590	0.07124	N	0.844359	T	0.51415	0.1673	L	0.28344	0.845	0.09310	N	1	P;P;P;P;P;P	0.46859	0.851;0.885;0.885;0.659;0.659;0.851	P;P;P;B;B;P	0.49226	0.603;0.589;0.589;0.372;0.372;0.603	T	0.28681	-1.0036	10	0.05620	T	0.96	-1.5669	6.9509	0.24544	0.0:0.3336:0.5176:0.1488	.	201;201;135;194;194;201	E9PBM3;B4DXZ8;B4DJM6;Q14C88;P51825;B4DTU1	.;.;.;.;AFF1_HUMAN;.	S	201;201;201;201;194	ENSP00000378578:P201S;ENSP00000427593:P201S;ENSP00000424483:P201S;ENSP00000305689:P194S	ENSP00000305689:P194S	P	+	1	0	AFF1	88187312	0.000000	0.05858	0.295000	0.24960	0.002000	0.02628	0.259000	0.18405	0.194000	0.20326	-0.172000	0.13284	CCA	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.547	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	94	0.00	0	C	NM_005935		87968288	87968288	+1	no_errors	ENST00000395146	ensembl	human	known	69_37n	missense	73	19.78	18	SNP	0.002	T
AFF3	3899	genome.wustl.edu	37	2	100625289	100625289	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:100625289G>T	ENST00000409236.2	-	3	271	c.159C>A	c.(157-159)ttC>ttA	p.F53L	AFF3_ENST00000356421.2_Missense_Mutation_p.F78L|AFF3_ENST00000317233.4_Missense_Mutation_p.F53L|AFF3_ENST00000409579.1_Missense_Mutation_p.F78L			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	53					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.F78L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						AGGGCTCACTGAAGAGAGAGT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											255.0	215.0	229.0					2																	100625289		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.159C>A	2.37:g.100625289G>T	ENSP00000387207:p.Phe53Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.F78L	ENST00000409236.2	37	c.234	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176273	0.78564	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288;ENST00000432037;ENST00000423966;ENST00000441400;ENST00000424600;ENST00000416492;ENST00000440445	T;T;T;T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.97	4.1	0.47936	.	0.335391	0.29040	N	0.013331	D	0.85902	0.5805	M	0.73430	2.235	0.35490	D	0.798851	D;D;D;D	0.89917	1.0;0.998;0.999;0.998	D;D;D;D	0.87578	0.998;0.994;0.996;0.994	D	0.88741	0.3243	10	0.87932	D	0	.	9.5635	0.39385	0.2209:0.0:0.7791:0.0	.	207;207;53;78	B7Z4I6;C9JXV5;P51826;P51826-2	.;.;AFF3_HUMAN;.	L	53;78;78;53;53;207;78;53;53;53;53;53;130	ENSP00000317421:F53L;ENSP00000348793:F78L;ENSP00000386834:F78L;ENSP00000387207:F53L;ENSP00000406484:F53L;ENSP00000396582:F53L;ENSP00000399795:F53L;ENSP00000411383:F53L;ENSP00000395068:F53L;ENSP00000393732:F130L	ENSP00000317421:F53L	F	-	3	2	AFF3	99991721	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.487000	0.60293	0.782000	0.33613	0.655000	0.94253	TTC	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.423	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	268	0.00	0	G	NM_002285		100625289	100625289	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	197	13.60	31	SNP	1.000	T
AFF3	3899	genome.wustl.edu	37	2	100625289	100625289	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:100625289G>T	ENST00000409236.2	-	3	271	c.159C>A	c.(157-159)ttC>ttA	p.F53L	AFF3_ENST00000356421.2_Missense_Mutation_p.F78L|AFF3_ENST00000317233.4_Missense_Mutation_p.F53L|AFF3_ENST00000409579.1_Missense_Mutation_p.F78L			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	53					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)	p.F78L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						AGGGCTCACTGAAGAGAGAGT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											255.0	215.0	229.0					2																	100625289		2203	4300	6503	-	-	-	SO:0001583	missense	0			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.159C>A	2.37:g.100625289G>T	ENSP00000387207:p.Phe53Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.F78L	ENST00000409236.2	37	c.234	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.176273	0.78564	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236;ENST00000433370;ENST00000444786;ENST00000432288;ENST00000432037;ENST00000423966;ENST00000441400;ENST00000424600;ENST00000416492;ENST00000440445	T;T;T;T;T;T;T;T;T;T	0.76968	-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06;-1.06	5.97	4.1	0.47936	.	0.335391	0.29040	N	0.013331	D	0.85902	0.5805	M	0.73430	2.235	0.35490	D	0.798851	D;D;D;D	0.89917	1.0;0.998;0.999;0.998	D;D;D;D	0.87578	0.998;0.994;0.996;0.994	D	0.88741	0.3243	10	0.87932	D	0	.	9.5635	0.39385	0.2209:0.0:0.7791:0.0	.	207;207;53;78	B7Z4I6;C9JXV5;P51826;P51826-2	.;.;AFF3_HUMAN;.	L	53;78;78;53;53;207;78;53;53;53;53;53;130	ENSP00000317421:F53L;ENSP00000348793:F78L;ENSP00000386834:F78L;ENSP00000387207:F53L;ENSP00000406484:F53L;ENSP00000396582:F53L;ENSP00000399795:F53L;ENSP00000411383:F53L;ENSP00000395068:F53L;ENSP00000393732:F130L	ENSP00000317421:F53L	F	-	3	2	AFF3	99991721	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.487000	0.60293	0.782000	0.33613	0.655000	0.94253	TTC	AFF3	-	pfam_TF_AF4/FMR2	ENSG00000144218		0.423	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	268	0.00	0	G	NM_002285		100625289	100625289	-1	no_errors	ENST00000356421	ensembl	human	known	69_37n	missense	306	14.29	51	SNP	1.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105409680	105409680	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:105409680G>A	ENST00000333244.5	-	7	12227	c.12108C>T	c.(12106-12108)ctC>ctT	p.L4036L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4036						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L4036L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCCTCTGGGAGTTTCACGT	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											99.0	106.0	104.0					14																	105409680		1905	4107	6012	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12108C>T	14.37:g.105409680G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L4036	ENST00000333244.5	37	c.12108	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	172	0.00	0	G	NM_138420		105409680	105409680	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	33	29.79	14	SNP	0.000	A
AHNAK2	113146	genome.wustl.edu	37	14	105409680	105409680	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:105409680G>A	ENST00000333244.5	-	7	12227	c.12108C>T	c.(12106-12108)ctC>ctT	p.L4036L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4036						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L4036L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGCCCTCTGGGAGTTTCACGT	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											99.0	106.0	104.0					14																	105409680		1905	4107	6012	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12108C>T	14.37:g.105409680G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L4036	ENST00000333244.5	37	c.12108	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	172	0.00	0	G	NM_138420		105409680	105409680	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	54	27.03	20	SNP	0.000	A
AHNAK2	113146	genome.wustl.edu	37	14	105414690	105414690	+	Silent	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:105414690G>T	ENST00000333244.5	-	7	7217	c.7098C>A	c.(7096-7098)ctC>ctA	p.L2366L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2366						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L2366L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGAACGCTGAGGTCAGTGG	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											129.0	143.0	138.0					14																	105414690		1988	4168	6156	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7098C>A	14.37:g.105414690G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L2366	ENST00000333244.5	37	c.7098	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	143	0.00	0	G	NM_138420		105414690	105414690	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	39	20.41	10	SNP	0.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105414690	105414690	+	Silent	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:105414690G>T	ENST00000333244.5	-	7	7217	c.7098C>A	c.(7096-7098)ctC>ctA	p.L2366L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	2366						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L2366L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GCTGAACGCTGAGGTCAGTGG	0.652																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											129.0	143.0	138.0					14																	105414690		1988	4168	6156	-	-	-	SO:0001819	synonymous_variant	0			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.7098C>A	14.37:g.105414690G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L2366	ENST00000333244.5	37	c.7098	CCDS45177.1	14																																																																																			AHNAK2	-	NULL	ENSG00000185567		0.652	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	143	0.00	0	G	NM_138420		105414690	105414690	-1	no_errors	ENST00000333244	ensembl	human	known	69_37n	silent	61	16.44	12	SNP	0.000	T
AK4	205	genome.wustl.edu	37	1	65656505	65656505	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:65656505C>T	ENST00000327299.7	+	2	463	c.258C>T	c.(256-258)ctC>ctT	p.L86L	AK4_ENST00000395334.2_Silent_p.L86L|AK4_ENST00000545314.1_Silent_p.L86L|AK4_ENST00000546702.1_Silent_p.L34L|AK4_ENST00000470888.2_3'UTR	NM_013410.3	NP_037542.1			adenylate kinase 4									p.L86L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	9						AGCACTGGCTCCTTGATGGTG	0.458																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											64.0	59.0	61.0					1																	65656505		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025926	CCDS629.1	1p31.3	2012-10-02	2010-06-15	2010-06-15	ENSG00000162433	ENSG00000162433	2.7.4.3	"""Adenylate kinases"""	363	protein-coding gene	gene with protein product		103030	"""adenylate kinase 3"", ""adenylate kinase 3-like 1"""	AK3, AK3L1		11485571	Standard	NM_203464		Approved		uc001dby.3	P27144	OTTHUMG00000009033	ENST00000327299.7:c.258C>T	1.37:g.65656505C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Adenylate_kin,pfam_Adenylate_kinase_lid-dom,superfamily_Adenylate_kinase_lid-dom,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	p.L86	ENST00000327299.7	37	c.258	CCDS629.1	1																																																																																			AK4	-	pfam_Adenylate_kin,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	ENSG00000162433		0.458	AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK4	HGNC	protein_coding	OTTHUMT00000025040.2	71	0.00	0	C	NM_013410		65656505	65656505	+1	no_errors	ENST00000327299	ensembl	human	known	69_37n	silent	45	26.23	16	SNP	0.001	T
AK4	205	genome.wustl.edu	37	1	65656505	65656505	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:65656505C>T	ENST00000327299.7	+	2	463	c.258C>T	c.(256-258)ctC>ctT	p.L86L	AK4_ENST00000395334.2_Silent_p.L86L|AK4_ENST00000545314.1_Silent_p.L86L|AK4_ENST00000546702.1_Silent_p.L34L|AK4_ENST00000470888.2_3'UTR	NM_013410.3	NP_037542.1			adenylate kinase 4									p.L86L(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	9						AGCACTGGCTCCTTGATGGTG	0.458																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											64.0	59.0	61.0					1																	65656505		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025926	CCDS629.1	1p31.3	2012-10-02	2010-06-15	2010-06-15	ENSG00000162433	ENSG00000162433	2.7.4.3	"""Adenylate kinases"""	363	protein-coding gene	gene with protein product		103030	"""adenylate kinase 3"", ""adenylate kinase 3-like 1"""	AK3, AK3L1		11485571	Standard	NM_203464		Approved		uc001dby.3	P27144	OTTHUMG00000009033	ENST00000327299.7:c.258C>T	1.37:g.65656505C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Adenylate_kin,pfam_Adenylate_kinase_lid-dom,superfamily_Adenylate_kinase_lid-dom,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	p.L86	ENST00000327299.7	37	c.258	CCDS629.1	1																																																																																			AK4	-	pfam_Adenylate_kin,prints_Adenylate_kin,tigrfam_Adenyl_kin_sub	ENSG00000162433		0.458	AK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK4	HGNC	protein_coding	OTTHUMT00000025040.2	71	0.00	0	C	NM_013410		65656505	65656505	+1	no_errors	ENST00000327299	ensembl	human	known	69_37n	silent	83	26.55	30	SNP	0.001	T
AKR1C1	1645	genome.wustl.edu	37	10	5014915	5014915	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:5014915G>A	ENST00000380872.4	+	7	1012	c.820G>A	c.(820-822)Gag>Aag	p.E274K	AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000434459.2_Missense_Mutation_p.E274K	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	274					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.E274K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	GAGCTACAATGAGCAGCGCAT	0.582																																					Colon(130;2054 2316 13360 15380)	dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	52.0	54.0					10																	5014915		2202	4298	6500	-	-	-	SO:0001583	missense	0			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.820G>A	10.37:g.5014915G>A	ENSP00000370254:p.Glu274Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.E274K	ENST00000380872.4	37	c.820	CCDS7061.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.785|2.785	-0.252726|-0.252726	0.05829|0.05829	.|.	.|.	ENSG00000187134|ENSG00000187134	ENST00000434459;ENST00000380872|ENST00000442997	T;T|.	0.50548|.	0.74;0.74|.	1.98|1.98	0.0689|0.0689	0.14371|0.14371	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);|.	0.447919|.	0.20468|.	N|.	0.091750|.	T|T	0.15089|0.15089	0.0364|0.0364	N|N	0.10809|0.10809	0.05|0.05	0.21355|0.21355	N|N	0.999719|0.999719	B|.	0.17667|.	0.023|.	B|.	0.24155|.	0.051|.	T|T	0.24154|0.24154	-1.0168|-1.0168	10|5	0.20046|.	T|.	0.44|.	.|.	3.0759|3.0759	0.06246|0.06246	0.2807:0.2377:0.4815:0.0|0.2807:0.2377:0.4815:0.0	.|.	274|.	Q04828|.	AK1C1_HUMAN|.	K|I	274|240	ENSP00000412248:E274K;ENSP00000370254:E274K|.	ENSP00000370254:E274K|.	E|M	+|+	1|3	0|0	AKR1C1|AKR1C1	5004915|5004915	0.113000|0.113000	0.22115|0.22115	0.145000|0.145000	0.22337|0.22337	0.541000|0.541000	0.35023|0.35023	1.990000|1.990000	0.40717|0.40717	0.010000|0.010000	0.14839|0.14839	0.313000|0.313000	0.20887|0.20887	GAG|ATG	AKR1C1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000187134		0.582	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	HGNC	protein_coding	OTTHUMT00000046523.2	202	0.00	0	G	NM_001353		5014915	5014915	+1	no_errors	ENST00000380872	ensembl	human	known	69_37n	missense	40	27.27	15	SNP	0.331	A
AKR1C1	1645	genome.wustl.edu	37	10	5014915	5014915	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:5014915G>A	ENST00000380872.4	+	7	1012	c.820G>A	c.(820-822)Gag>Aag	p.E274K	AKR1C1_ENST00000477661.1_3'UTR|AKR1C1_ENST00000434459.2_Missense_Mutation_p.E274K	NM_001353.5	NP_001344.2	Q04828	AK1C1_HUMAN	aldo-keto reductase family 1, member C1	274					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|cellular response to jasmonic acid stimulus (GO:0071395)|cholesterol homeostasis (GO:0042632)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|intestinal cholesterol absorption (GO:0030299)|oxidation-reduction process (GO:0055114)|phototransduction, visible light (GO:0007603)|progesterone metabolic process (GO:0042448)|protein homooligomerization (GO:0051260)|response to organophosphorus (GO:0046683)|retinal metabolic process (GO:0042574)|retinoid metabolic process (GO:0001523)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	17-alpha,20-alpha-dihydroxypregn-4-en-3-one dehydrogenase activity (GO:0047006)|alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|androsterone dehydrogenase (B-specific) activity (GO:0047042)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|indanol dehydrogenase activity (GO:0047718)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)	p.E274K(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|lung(2)|ovary(3)|prostate(1)	13					Acetylsalicylic acid(DB00945)|Salicylic acid(DB00936)	GAGCTACAATGAGCAGCGCAT	0.582																																					Colon(130;2054 2316 13360 15380)	dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	52.0	54.0					10																	5014915		2202	4298	6500	-	-	-	SO:0001583	missense	0			D26124	CCDS7061.1	10p15-p14	2012-12-04	2012-12-04		ENSG00000187134	ENSG00000187134	1.3.1.20, 1.1.1.149, 1.1.1.112	"""Aldo-keto reductases"""	384	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase"""	600449	"""aldo-keto reductase family 1, member C1 (dihydrodiol dehydrogenase 1; 20-alpha (3-alpha)-hydroxysteroid dehydrogenase)"""	DDH1		8011662	Standard	NM_001353		Approved	DDH, MBAB, DD1, HAKRC		Q04828	OTTHUMG00000017580	ENST00000380872.4:c.820G>A	10.37:g.5014915G>A	ENSP00000370254:p.Glu274Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P52896|Q5SR15|Q7M4N2|Q9UCX2	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom,prints_Aldo/keto_reductase_subgr	p.E274K	ENST00000380872.4	37	c.820	CCDS7061.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	2.785|2.785	-0.252726|-0.252726	0.05829|0.05829	.|.	.|.	ENSG00000187134|ENSG00000187134	ENST00000434459;ENST00000380872|ENST00000442997	T;T|.	0.50548|.	0.74;0.74|.	1.98|1.98	0.0689|0.0689	0.14371|0.14371	Aldo/keto reductase, conserved site (1);NADP-dependent oxidoreductase domain (3);|.	0.447919|.	0.20468|.	N|.	0.091750|.	T|T	0.15089|0.15089	0.0364|0.0364	N|N	0.10809|0.10809	0.05|0.05	0.21355|0.21355	N|N	0.999719|0.999719	B|.	0.17667|.	0.023|.	B|.	0.24155|.	0.051|.	T|T	0.24154|0.24154	-1.0168|-1.0168	10|5	0.20046|.	T|.	0.44|.	.|.	3.0759|3.0759	0.06246|0.06246	0.2807:0.2377:0.4815:0.0|0.2807:0.2377:0.4815:0.0	.|.	274|.	Q04828|.	AK1C1_HUMAN|.	K|I	274|240	ENSP00000412248:E274K;ENSP00000370254:E274K|.	ENSP00000370254:E274K|.	E|M	+|+	1|3	0|0	AKR1C1|AKR1C1	5004915|5004915	0.113000|0.113000	0.22115|0.22115	0.145000|0.145000	0.22337|0.22337	0.541000|0.541000	0.35023|0.35023	1.990000|1.990000	0.40717|0.40717	0.010000|0.010000	0.14839|0.14839	0.313000|0.313000	0.20887|0.20887	GAG|ATG	AKR1C1	-	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	ENSG00000187134		0.582	AKR1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C1	HGNC	protein_coding	OTTHUMT00000046523.2	202	0.00	0	G	NM_001353		5014915	5014915	+1	no_errors	ENST00000380872	ensembl	human	known	69_37n	missense	65	23.53	20	SNP	0.331	A
ANK3	288	genome.wustl.edu	37	10	61815778	61815778	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:61815778C>G	ENST00000280772.2	-	42	12894	c.12703G>C	c.(12703-12705)Gat>Cat	p.D4235H	ANK3_ENST00000355288.2_Missense_Mutation_p.D859H|ANK3_ENST00000503366.1_Missense_Mutation_p.D1726H|ANK3_ENST00000373827.2_Missense_Mutation_p.D1719H|RP11-388P9.2_ENST00000414383.1_RNA	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4235					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D4235H(1)|p.D859H(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTAATGGAATCTCTACACTGG	0.378																																						dbGAP											2	Substitution - Missense(2)	breast(2)											59.0	58.0	58.0					10																	61815778		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12703G>C	10.37:g.61815778C>G	ENSP00000280772:p.Asp4235His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.D4235H	ENST00000280772.2	37	c.12703	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409270	0.83340	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000502769;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T;T	0.77750	-0.74;-1.12;0.35;0.34;-0.31;-1.1	5.89	5.89	0.94794	.	0.000000	0.43579	D	0.000548	T	0.82240	0.4994	N	0.24115	0.695	0.80722	D	1	P;D;P;D;D;D;D	0.89917	0.914;0.984;0.914;0.997;0.977;0.984;1.0	P;P;P;D;P;P;D	0.71656	0.674;0.67;0.674;0.974;0.823;0.67;0.956	D	0.83881	0.0279	10	0.72032	D	0.01	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	1726;859;1719;4235;960;859;258	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	H	4235;1719;317;7;859;1726;1705;960	ENSP00000280772:D4235H;ENSP00000362933:D1719H;ENSP00000362926:D317H;ENSP00000423057:D7H;ENSP00000347436:D859H;ENSP00000425236:D1726H	ENSP00000280772:D4235H	D	-	1	0	ANK3	61485784	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.483000	0.73617	2.793000	0.96121	0.561000	0.74099	GAT	ANK3	-	NULL	ENSG00000151150		0.378	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	104	0.00	0	C	NM_020987		61815778	61815778	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	151	17.03	31	SNP	1.000	G
ANK3	288	genome.wustl.edu	37	10	61815778	61815778	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:61815778C>G	ENST00000280772.2	-	42	12894	c.12703G>C	c.(12703-12705)Gat>Cat	p.D4235H	ANK3_ENST00000355288.2_Missense_Mutation_p.D859H|ANK3_ENST00000503366.1_Missense_Mutation_p.D1726H|ANK3_ENST00000373827.2_Missense_Mutation_p.D1719H|RP11-388P9.2_ENST00000414383.1_RNA	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	4235					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.D4235H(1)|p.D859H(1)		NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GTAATGGAATCTCTACACTGG	0.378																																						dbGAP											2	Substitution - Missense(2)	breast(2)											59.0	58.0	58.0					10																	61815778		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12703G>C	10.37:g.61815778C>G	ENSP00000280772:p.Asp4235His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.D4235H	ENST00000280772.2	37	c.12703	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	23.4	4.409270	0.83340	.	.	ENSG00000151150	ENST00000280772;ENST00000373827;ENST00000373820;ENST00000502769;ENST00000355288;ENST00000503366;ENST00000395299;ENST00000373817	T;T;T;T;T;T	0.77750	-0.74;-1.12;0.35;0.34;-0.31;-1.1	5.89	5.89	0.94794	.	0.000000	0.43579	D	0.000548	T	0.82240	0.4994	N	0.24115	0.695	0.80722	D	1	P;D;P;D;D;D;D	0.89917	0.914;0.984;0.914;0.997;0.977;0.984;1.0	P;P;P;D;P;P;D	0.71656	0.674;0.67;0.674;0.974;0.823;0.67;0.956	D	0.83881	0.0279	10	0.72032	D	0.01	.	20.2566	0.98424	0.0:1.0:0.0:0.0	.	1726;859;1719;4235;960;859;258	E9PE32;A8KA62;Q5CZH9;Q12955;F5GXK0;B1AQT2;B1AQT0	.;.;.;ANK3_HUMAN;.;.;.	H	4235;1719;317;7;859;1726;1705;960	ENSP00000280772:D4235H;ENSP00000362933:D1719H;ENSP00000362926:D317H;ENSP00000423057:D7H;ENSP00000347436:D859H;ENSP00000425236:D1726H	ENSP00000280772:D4235H	D	-	1	0	ANK3	61485784	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.483000	0.73617	2.793000	0.96121	0.561000	0.74099	GAT	ANK3	-	NULL	ENSG00000151150		0.378	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	104	0.00	0	C	NM_020987		61815778	61815778	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	232	18.31	52	SNP	1.000	G
ANKLE2	23141	genome.wustl.edu	37	12	133306539	133306539	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:133306539C>G	ENST00000357997.5	-	11	2298	c.2209G>C	c.(2209-2211)Gat>Cat	p.D737H	ANKLE2_ENST00000542374.1_Intron|ANKLE2_ENST00000542282.1_Missense_Mutation_p.D92H|ANKLE2_ENST00000539605.1_Missense_Mutation_p.D675H|ANKLE2_ENST00000542657.1_Missense_Mutation_p.D92H	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	737					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)	p.D737H(1)		NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TTCAGTTTATCAAACTCAACA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	119.0	119.0					12																	133306539		1938	4133	6071	-	-	-	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.2209G>C	12.37:g.133306539C>G	ENSP00000350686:p.Asp737His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM,superfamily_LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM	p.D737H	ENST00000357997.5	37	c.2209	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457131	0.63401	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000542282;ENST00000542657;ENST00000538766	T;T;T;T;T	0.53640	1.7;1.68;0.61;0.61;0.62	5.74	2.72	0.32119	.	0.198943	0.56097	D	0.000040	T	0.58666	0.2138	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.62813	0.907	T	0.59059	-0.7525	10	0.56958	D	0.05	-16.5762	9.3322	0.38030	0.0:0.7508:0.1196:0.1296	.	737	Q86XL3	ANKL2_HUMAN	H	675;737;92;92;92	ENSP00000446268:D675H;ENSP00000350686:D737H;ENSP00000437807:D92H;ENSP00000438551:D92H;ENSP00000445760:D92H	ENSP00000350686:D737H	D	-	1	0	ANKLE2	131816612	1.000000	0.71417	0.058000	0.19502	0.515000	0.34225	1.235000	0.32671	0.873000	0.35799	0.645000	0.84053	GAT	ANKLE2	-	NULL	ENSG00000176915		0.473	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	82	0.00	0	C			133306539	133306539	-1	no_errors	ENST00000357997	ensembl	human	known	69_37n	missense	146	15.12	26	SNP	1.000	G
ANKLE2	23141	genome.wustl.edu	37	12	133306539	133306539	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:133306539C>G	ENST00000357997.5	-	11	2298	c.2209G>C	c.(2209-2211)Gat>Cat	p.D737H	ANKLE2_ENST00000542374.1_Intron|ANKLE2_ENST00000542282.1_Missense_Mutation_p.D92H|ANKLE2_ENST00000539605.1_Missense_Mutation_p.D675H|ANKLE2_ENST00000542657.1_Missense_Mutation_p.D92H	NM_015114.1	NP_055929.1	Q86XL3	ANKL2_HUMAN	ankyrin repeat and LEM domain containing 2	737					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope reassembly (GO:0007084)|negative regulation of phosphorylation (GO:0042326)|positive regulation of protein dephosphorylation (GO:0035307)|regulation of catalytic activity (GO:0050790)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)	protein phosphatase 2A binding (GO:0051721)|protein phosphatase type 2A regulator activity (GO:0008601)	p.D737H(1)		NS(2)|autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(4)|lung(20)|ovary(1)|urinary_tract(2)	45	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.3e-08)|Epithelial(86;1.56e-07)|all cancers(50;4.94e-06)		TTCAGTTTATCAAACTCAACA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	119.0	119.0					12																	133306539		1938	4133	6071	-	-	-	SO:0001583	missense	0			AB014592	CCDS41869.1	12q24.33	2013-01-11	2008-03-25	2008-03-25	ENSG00000176915	ENSG00000176915		"""Ankyrin repeat domain containing"""	29101	protein-coding gene	gene with protein product	"""LEM domain containing 7"""		"""KIAA0692"""	KIAA0692		9734811	Standard	XM_005266159		Approved	LEMD7, Lem4	uc001ukx.2	Q86XL3	OTTHUMG00000168046	ENST00000357997.5:c.2209G>C	12.37:g.133306539C>G	ENSP00000350686:p.Asp737His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAG3|B3KN97|B3KSF8|O75176|Q6P6A5|Q8TAZ9|Q96DH4	Missense_Mutation	SNP	pfam_LEM,superfamily_LEM-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Ribosomal_L9/RNase_H1_N,pfscan_LEM	p.D737H	ENST00000357997.5	37	c.2209	CCDS41869.1	12	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457131	0.63401	.	.	ENSG00000176915	ENST00000539605;ENST00000357997;ENST00000542282;ENST00000542657;ENST00000538766	T;T;T;T;T	0.53640	1.7;1.68;0.61;0.61;0.62	5.74	2.72	0.32119	.	0.198943	0.56097	D	0.000040	T	0.58666	0.2138	M	0.62723	1.935	0.80722	D	1	D	0.71674	0.998	P	0.62813	0.907	T	0.59059	-0.7525	10	0.56958	D	0.05	-16.5762	9.3322	0.38030	0.0:0.7508:0.1196:0.1296	.	737	Q86XL3	ANKL2_HUMAN	H	675;737;92;92;92	ENSP00000446268:D675H;ENSP00000350686:D737H;ENSP00000437807:D92H;ENSP00000438551:D92H;ENSP00000445760:D92H	ENSP00000350686:D737H	D	-	1	0	ANKLE2	131816612	1.000000	0.71417	0.058000	0.19502	0.515000	0.34225	1.235000	0.32671	0.873000	0.35799	0.645000	0.84053	GAT	ANKLE2	-	NULL	ENSG00000176915		0.473	ANKLE2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKLE2	HGNC	protein_coding	OTTHUMT00000397712.1	82	0.00	0	C			133306539	133306539	-1	no_errors	ENST00000357997	ensembl	human	known	69_37n	missense	91	14.15	15	SNP	1.000	G
AP4M1	9179	genome.wustl.edu	37	7	99701112	99701112	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:99701112C>T	ENST00000359593.4	+	5	590	c.432C>T	c.(430-432)ttC>ttT	p.F144F	AP4M1_ENST00000429084.1_Silent_p.F151F|AP4M1_ENST00000421755.1_Silent_p.F144F|AP4M1_ENST00000422582.1_Silent_p.F16F|MCM7_ENST00000303887.5_5'Flank|MCM7_ENST00000343023.6_5'Flank|MCM7_ENST00000354230.3_5'Flank	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	144					Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.F144F(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAAGCCCTTCAGCCTCTTTG	0.522																																					Pancreas(174;1182 2812 29595 49511)	dbGAP											1	Substitution - coding silent(1)	breast(1)											121.0	117.0	119.0					7																	99701112		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.432C>T	7.37:g.99701112C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5U1|Q8WV65|Q9UHK9	Nonsense_Mutation	SNP	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pfscan_Clathrin_mu_C	p.Q130*	ENST00000359593.4	37	c.388	CCDS5685.1	7																																																																																			AP4M1	-	NULL	ENSG00000221838		0.522	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP4M1	HGNC	protein_coding	OTTHUMT00000336772.4	125	0.00	0	C	NM_004722		99701112	99701112	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416938	ensembl	human	known	69_37n	nonsense	45	25.00	15	SNP	1.000	T
AP4M1	9179	genome.wustl.edu	37	7	99701112	99701112	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:99701112C>T	ENST00000359593.4	+	5	590	c.432C>T	c.(430-432)ttC>ttT	p.F144F	AP4M1_ENST00000429084.1_Silent_p.F151F|AP4M1_ENST00000421755.1_Silent_p.F144F|AP4M1_ENST00000422582.1_Silent_p.F16F|MCM7_ENST00000303887.5_5'Flank|MCM7_ENST00000343023.6_5'Flank|MCM7_ENST00000354230.3_5'Flank	NM_004722.3	NP_004713.2	O00189	AP4M1_HUMAN	adaptor-related protein complex 4, mu 1 subunit	144					Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|coated pit (GO:0005905)|extracellular vesicular exosome (GO:0070062)|Golgi trans cisterna (GO:0000138)|trans-Golgi network (GO:0005802)	transporter activity (GO:0005215)	p.F144F(1)		breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GCAAGCCCTTCAGCCTCTTTG	0.522																																					Pancreas(174;1182 2812 29595 49511)	dbGAP											1	Substitution - coding silent(1)	breast(1)											121.0	117.0	119.0					7																	99701112		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08387	CCDS5685.1	7q22.1	2012-06-29			ENSG00000221838	ENSG00000221838			574	protein-coding gene	gene with protein product	"""mu-adaptin-related protein-2"", ""mu subunit of AP-4"", ""AP-4 adapter complex mu subunit"", ""adaptor-related protein complex AP-4 mu4 subunit"""	602296				9013859, 10066790, 21620353	Standard	NM_004722		Approved	MU-ARP2, MU-4, SPG50	uc003utb.4	O00189	OTTHUMG00000154722	ENST00000359593.4:c.432C>T	7.37:g.99701112C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W5U1|Q8WV65|Q9UHK9	Nonsense_Mutation	SNP	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pfscan_Clathrin_mu_C	p.Q130*	ENST00000359593.4	37	c.388	CCDS5685.1	7																																																																																			AP4M1	-	NULL	ENSG00000221838		0.522	AP4M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP4M1	HGNC	protein_coding	OTTHUMT00000336772.4	125	0.00	0	C	NM_004722		99701112	99701112	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416938	ensembl	human	known	69_37n	nonsense	80	21.57	22	SNP	1.000	T
APAF1	317	genome.wustl.edu	37	12	99042512	99042512	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:99042512C>T	ENST00000551964.1	+	3	983	c.247C>T	c.(247-249)Ctt>Ttt	p.L83F	APAF1_ENST00000547743.1_Missense_Mutation_p.L83F|APAF1_ENST00000333991.1_Missense_Mutation_p.L83F|APAF1_ENST00000339433.3_Missense_Mutation_p.L83F|APAF1_ENST00000552268.1_Missense_Mutation_p.L83F|APAF1_ENST00000549007.1_Missense_Mutation_p.L83F|APAF1_ENST00000547045.1_Missense_Mutation_p.L83F|APAF1_ENST00000550527.1_Missense_Mutation_p.L83F|APAF1_ENST00000359972.2_Missense_Mutation_p.L83F|APAF1_ENST00000357310.1_Missense_Mutation_p.L83F	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	83	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.L83F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	ATATAAAGATCTTGCTGCCCT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	190.0	191.0					12																	99042512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.247C>T	12.37:g.99042512C>T	ENSP00000448165:p.Leu83Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.L83F	ENST00000551964.1	37	c.247	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013012	0.75161	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000333991;ENST00000547743;ENST00000552268;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.64	4.56	0.56223	DEATH-like (2);Caspase Recruitment (2);	0.000000	0.85682	D	0.000000	T	0.61035	0.2315	M	0.78049	2.395	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.994	T	0.64525	-0.6387	10	0.59425	D	0.04	-19.7605	15.4565	0.75318	0.0:0.9223:0.0:0.0777	.	83;83;83;83;83	O14727-6;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	F	83	ENSP00000448165:L83F;ENSP00000353059:L83F;ENSP00000349862:L83F;ENSP00000341830:L83F;ENSP00000334558:L83F;ENSP00000450175:L83F;ENSP00000448826:L83F;ENSP00000448449:L83F;ENSP00000449791:L83F;ENSP00000448161:L83F	ENSP00000334558:L83F	L	+	1	0	APAF1	97566643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.120000	0.50430	2.627000	0.88993	0.655000	0.94253	CTT	APAF1	-	pfam_CARD,superfamily_DEATH-like,pirsf_Apoptotic_pept-activating_1,pfscan_CARD	ENSG00000120868		0.363	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	94	0.00	0	C	NM_181861.1		99042512	99042512	+1	no_errors	ENST00000551964	ensembl	human	known	69_37n	missense	177	30.86	79	SNP	1.000	T
APAF1	317	genome.wustl.edu	37	12	99042512	99042512	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:99042512C>T	ENST00000551964.1	+	3	983	c.247C>T	c.(247-249)Ctt>Ttt	p.L83F	APAF1_ENST00000547743.1_Missense_Mutation_p.L83F|APAF1_ENST00000333991.1_Missense_Mutation_p.L83F|APAF1_ENST00000339433.3_Missense_Mutation_p.L83F|APAF1_ENST00000552268.1_Missense_Mutation_p.L83F|APAF1_ENST00000549007.1_Missense_Mutation_p.L83F|APAF1_ENST00000547045.1_Missense_Mutation_p.L83F|APAF1_ENST00000550527.1_Missense_Mutation_p.L83F|APAF1_ENST00000359972.2_Missense_Mutation_p.L83F|APAF1_ENST00000357310.1_Missense_Mutation_p.L83F	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1	83	CARD. {ECO:0000255|PROSITE- ProRule:PRU00046}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)	p.L83F(1)		breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	ATATAAAGATCTTGCTGCCCT	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											195.0	190.0	191.0					12																	99042512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.247C>T	12.37:g.99042512C>T	ENSP00000448165:p.Leu83Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NB-ARC,pfam_CARD,superfamily_WD40_repeat_dom,superfamily_DEATH-like,smart_WD40_repeat,pirsf_Apoptotic_pept-activating_1,pfscan_CARD,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Disease_R,prints_G-protein_beta_WD-40_rep	p.L83F	ENST00000551964.1	37	c.247	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	C	20.6	4.013012	0.75161	.	.	ENSG00000120868	ENST00000551964;ENST00000359972;ENST00000357310;ENST00000339433;ENST00000333991;ENST00000547743;ENST00000552268;ENST00000550527;ENST00000547045;ENST00000549007	T;T;T;T;T;T;T;T;T;T	0.36157	1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27;1.27	5.64	4.56	0.56223	DEATH-like (2);Caspase Recruitment (2);	0.000000	0.85682	D	0.000000	T	0.61035	0.2315	M	0.78049	2.395	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.999	D;D;D;D;D	0.97110	1.0;1.0;0.999;0.999;0.994	T	0.64525	-0.6387	10	0.59425	D	0.04	-19.7605	15.4565	0.75318	0.0:0.9223:0.0:0.0777	.	83;83;83;83;83	O14727-6;O14727-4;O14727-3;O14727;O14727-2	.;.;.;APAF_HUMAN;.	F	83	ENSP00000448165:L83F;ENSP00000353059:L83F;ENSP00000349862:L83F;ENSP00000341830:L83F;ENSP00000334558:L83F;ENSP00000450175:L83F;ENSP00000448826:L83F;ENSP00000448449:L83F;ENSP00000449791:L83F;ENSP00000448161:L83F	ENSP00000334558:L83F	L	+	1	0	APAF1	97566643	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.120000	0.50430	2.627000	0.88993	0.655000	0.94253	CTT	APAF1	-	pfam_CARD,superfamily_DEATH-like,pirsf_Apoptotic_pept-activating_1,pfscan_CARD	ENSG00000120868		0.363	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	94	0.00	0	C	NM_181861.1		99042512	99042512	+1	no_errors	ENST00000551964	ensembl	human	known	69_37n	missense	280	27.46	106	SNP	1.000	T
ARHGAP23	57636	genome.wustl.edu	37	17	36623403	36623403	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:36623403G>A	ENST00000431231.2	+	7	1547	c.1479G>A	c.(1477-1479)caG>caA	p.Q493Q	ARHGAP23_ENST00000437668.3_Silent_p.Q493Q|ARHGAP23_ENST00000443378.1_Silent_p.Q399Q	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	493					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)	p.Q818Q(1)		breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						TCCTGAGGCAGAAGCCCCCGA	0.682																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											16.0	19.0	18.0					17																	36623403		691	1591	2282	-	-	-	SO:0001819	synonymous_variant	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.1479G>A	17.37:g.36623403G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.Q493	ENST00000431231.2	37	c.1479	CCDS56027.1	17																																																																																			ARHGAP23	-	NULL	ENSG00000225485		0.682	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	22	0.00	0	G	XM_290799		36623403	36623403	+1	no_errors	ENST00000431231	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	1.000	A
ARHGAP23	57636	genome.wustl.edu	37	17	36623403	36623403	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:36623403G>A	ENST00000431231.2	+	7	1547	c.1479G>A	c.(1477-1479)caG>caA	p.Q493Q	ARHGAP23_ENST00000437668.3_Silent_p.Q493Q|ARHGAP23_ENST00000443378.1_Silent_p.Q399Q	NM_001199417.1	NP_001186346.1	Q9P227	RHG23_HUMAN	Rho GTPase activating protein 23	493					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	GTPase activator activity (GO:0005096)	p.Q818Q(1)		breast(2)|endometrium(8)|kidney(6)|lung(1)|skin(1)|stomach(2)	20						TCCTGAGGCAGAAGCCCCCGA	0.682																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											16.0	19.0	18.0					17																	36623403		691	1591	2282	-	-	-	SO:0001819	synonymous_variant	0			AB040934	CCDS56027.1	17q12	2014-05-06			ENSG00000225485	ENSG00000275832		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	29293	protein-coding gene	gene with protein product		610590				10819331, 15254754	Standard	NM_001199417		Approved	KIAA1501	uc021twd.1	Q9P227	OTTHUMG00000188547	ENST00000431231.2:c.1479G>A	17.37:g.36623403G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_RhoGAP_dom,pfam_PDZ,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.Q493	ENST00000431231.2	37	c.1479	CCDS56027.1	17																																																																																			ARHGAP23	-	NULL	ENSG00000225485		0.682	ARHGAP23-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP23	HGNC	protein_coding	OTTHUMT00000441789.1	22	0.00	0	G	XM_290799		36623403	36623403	+1	no_errors	ENST00000431231	ensembl	human	known	69_37n	silent	8	33.33	4	SNP	1.000	A
ARHGAP30	257106	genome.wustl.edu	37	1	161018228	161018228	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:161018228G>A	ENST00000368013.3	-	12	2903	c.2583C>T	c.(2581-2583)ctC>ctT	p.L861L	USF1_ENST00000368021.3_5'Flank|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Intron|ARHGAP30_ENST00000368015.1_Silent_p.L684L	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	861	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.L861L(1)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			AACCTTCAGAGAGGGTGTCCT	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											111.0	114.0	113.0					1																	161018228		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2583C>T	1.37:g.161018228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L861	ENST00000368013.3	37	c.2583	CCDS30918.1	1																																																																																			ARHGAP30	-	NULL	ENSG00000186517		0.577	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	125	0.00	0	G	NM_181720		161018228	161018228	-1	no_errors	ENST00000368013	ensembl	human	known	69_37n	silent	143	26.15	51	SNP	0.033	A
ARHGAP30	257106	genome.wustl.edu	37	1	161018228	161018228	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:161018228G>A	ENST00000368013.3	-	12	2903	c.2583C>T	c.(2581-2583)ctC>ctT	p.L861L	USF1_ENST00000368021.3_5'Flank|USF1_ENST00000435396.1_5'Flank|ARHGAP30_ENST00000368016.3_Intron|ARHGAP30_ENST00000368015.1_Silent_p.L684L	NM_001025598.1|NM_181720.2	NP_001020769.1|NP_859071.2	Q7Z6I6	RHG30_HUMAN	Rho GTPase activating protein 30	861	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)	GTPase activator activity (GO:0005096)	p.L861L(1)		breast(2)|cervix(3)|endometrium(4)|kidney(2)|large_intestine(4)|lung(6)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_cancers(52;8.05e-20)|Breast(13;0.00188)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00122)			AACCTTCAGAGAGGGTGTCCT	0.577																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											111.0	114.0	113.0					1																	161018228		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL832852	CCDS1215.1, CCDS30918.1, CCDS72958.1	1q23.3	2011-06-29			ENSG00000186517	ENSG00000186517		"""Rho GTPase activating proteins"""	27414	protein-coding gene	gene with protein product		614264					Standard	NM_001287602		Approved	FLJ00267	uc001fxl.3	Q7Z6I6	OTTHUMG00000031477	ENST00000368013.3:c.2583C>T	1.37:g.161018228G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY52|Q5SY53|Q5SY54|Q6ZML6|Q7Z3J8|Q86XI7	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L861	ENST00000368013.3	37	c.2583	CCDS30918.1	1																																																																																			ARHGAP30	-	NULL	ENSG00000186517		0.577	ARHGAP30-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP30	HGNC	protein_coding	OTTHUMT00000077090.2	125	0.00	0	G	NM_181720		161018228	161018228	-1	no_errors	ENST00000368013	ensembl	human	known	69_37n	silent	90	26.02	32	SNP	0.033	A
ARHGAP32	9743	genome.wustl.edu	37	11	128844843	128844843	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:128844843G>C	ENST00000310343.9	-	20	2206	c.2207C>G	c.(2206-2208)tCt>tGt	p.S736C	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.S662C|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.S387C|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.S387C	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	736					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.S387C(1)|p.S736C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						AAAAGAGGCAGACAGTGCATC	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											76.0	72.0	74.0					11																	128844843		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2207C>G	11.37:g.128844843G>C	ENSP00000310561:p.Ser736Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.S736C	ENST00000310343.9	37	c.2207	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	G	17.69	3.453002	0.63290	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.59	4.68	0.58851	.	0.106321	0.64402	D	0.000003	T	0.25827	0.0629	L	0.41710	1.295	0.54753	D	0.999988	P;P	0.37663	0.604;0.584	B;B	0.38985	0.205;0.287	T	0.04268	-1.0964	10	0.62326	D	0.03	.	14.8209	0.70070	0.0:0.1949:0.8051:0.0	.	670;736	Q86T64;A7KAX9	.;RHG32_HUMAN	C	736;387;662;670;387	ENSP00000310561:S736C;ENSP00000376425:S387C;ENSP00000432468:S662C;ENSP00000432862:S387C	ENSP00000310561:S736C	S	-	2	0	ARHGAP32	128350053	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.060000	0.76692	1.369000	0.46134	0.650000	0.86243	TCT	ARHGAP32	-	NULL	ENSG00000134909		0.448	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	53	0.00	0	G	NM_014715		128844843	128844843	-1	no_errors	ENST00000310343	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	1.000	C
ARHGAP32	9743	genome.wustl.edu	37	11	128844843	128844843	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:128844843G>C	ENST00000310343.9	-	20	2206	c.2207C>G	c.(2206-2208)tCt>tGt	p.S736C	ARHGAP32_ENST00000524655.1_Missense_Mutation_p.S662C|ARHGAP32_ENST00000392657.3_Missense_Mutation_p.S387C|ARHGAP32_ENST00000527272.1_Missense_Mutation_p.S387C	NM_001142685.1	NP_001136157.1	A7KAX9	RHG32_HUMAN	Rho GTPase activating protein 32	736					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cell projection (GO:0042995)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|postsynaptic membrane (GO:0045211)	GTPase activator activity (GO:0005096)|phosphatidylinositol binding (GO:0035091)	p.S387C(1)|p.S736C(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(28)|ovary(3)|prostate(6)|urinary_tract(3)	60						AAAAGAGGCAGACAGTGCATC	0.448																																						dbGAP											2	Substitution - Missense(2)	breast(2)											76.0	72.0	74.0					11																	128844843		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB018255	CCDS31718.1, CCDS44769.1	11q24.3	2011-06-29			ENSG00000134909	ENSG00000134909		"""Rho GTPase activating proteins"""	17399	protein-coding gene	gene with protein product		608541				12446789, 12819203, 17663722	Standard	NM_014715		Approved	GRIT, KIAA0712, MGC1892, RICS, GC-GAP	uc009zcp.3	A7KAX9	OTTHUMG00000165774	ENST00000310343.9:c.2207C>G	11.37:g.128844843G>C	ENSP00000310561:p.Ser736Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	I7H0B0|O94820|Q86YL6|Q8IUG4|Q9BWG3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,pfam_Phox,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Phox,smart_SH3_domain,smart_RhoGAP_dom,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.S736C	ENST00000310343.9	37	c.2207	CCDS44769.1	11	.	.	.	.	.	.	.	.	.	.	G	17.69	3.453002	0.63290	.	.	ENSG00000134909	ENST00000310343;ENST00000392657;ENST00000524655;ENST00000457677;ENST00000527272	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.59	4.68	0.58851	.	0.106321	0.64402	D	0.000003	T	0.25827	0.0629	L	0.41710	1.295	0.54753	D	0.999988	P;P	0.37663	0.604;0.584	B;B	0.38985	0.205;0.287	T	0.04268	-1.0964	10	0.62326	D	0.03	.	14.8209	0.70070	0.0:0.1949:0.8051:0.0	.	670;736	Q86T64;A7KAX9	.;RHG32_HUMAN	C	736;387;662;670;387	ENSP00000310561:S736C;ENSP00000376425:S387C;ENSP00000432468:S662C;ENSP00000432862:S387C	ENSP00000310561:S736C	S	-	2	0	ARHGAP32	128350053	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	7.060000	0.76692	1.369000	0.46134	0.650000	0.86243	TCT	ARHGAP32	-	NULL	ENSG00000134909		0.448	ARHGAP32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP32	HGNC	protein_coding	OTTHUMT00000386151.3	53	0.00	0	G	NM_014715		128844843	128844843	-1	no_errors	ENST00000310343	ensembl	human	known	69_37n	missense	42	35.38	23	SNP	1.000	C
ARMC7	79637	genome.wustl.edu	37	17	73106677	73106677	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:73106677G>A	ENST00000245543.1	+	2	513	c.211G>A	c.(211-213)Gag>Aag	p.E71K	ARMC7_ENST00000582136.1_Missense_Mutation_p.E71K|ARMC7_ENST00000584947.1_Missense_Mutation_p.E71K|ARMC7_ENST00000581078.1_Intron	NM_024585.2	NP_078861.1	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	71						cytoplasm (GO:0005737)		p.E71K(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|pancreas(3)	9	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			GGAGGAGAATGAGACCCTGGT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	80.0	81.0					17																	73106677		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025813	CCDS11714.1	17q25	2013-02-14				ENSG00000125449		"""Armadillo repeat containing"""	26168	protein-coding gene	gene with protein product						12477932	Standard	NM_024585		Approved	FLJ22160	uc002jmw.1	Q9H6L4		ENST00000245543.1:c.211G>A	17.37:g.73106677G>A	ENSP00000245543:p.Glu71Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVA4	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	p.E71K	ENST00000245543.1	37	c.211	CCDS11714.1	17	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340165	0.81911	.	.	ENSG00000125449	ENST00000245543	T	0.53206	0.63	6.07	6.07	0.98685	Armadillo-like helical (1);Armadillo-type fold (1);	0.235047	0.42964	D	0.000629	T	0.56321	0.1977	M	0.69823	2.125	0.80722	D	1	P	0.41313	0.745	B	0.41988	0.372	T	0.59332	-0.7474	10	0.66056	D	0.02	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	71	Q9H6L4	ARMC7_HUMAN	K	71	ENSP00000245543:E71K	ENSP00000245543:E71K	E	+	1	0	ARMC7	70618272	1.000000	0.71417	0.993000	0.49108	0.890000	0.51754	9.476000	0.97823	2.884000	0.98904	0.655000	0.94253	GAG	ARMC7	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000125449		0.542	ARMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC7	HGNC	protein_coding	OTTHUMT00000445846.1	42	0.00	0	G	NM_024585		73106677	73106677	+1	no_errors	ENST00000245543	ensembl	human	known	69_37n	missense	16	42.86	12	SNP	1.000	A
ARMC7	79637	genome.wustl.edu	37	17	73106677	73106677	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:73106677G>A	ENST00000245543.1	+	2	513	c.211G>A	c.(211-213)Gag>Aag	p.E71K	ARMC7_ENST00000582136.1_Missense_Mutation_p.E71K|ARMC7_ENST00000584947.1_Missense_Mutation_p.E71K|ARMC7_ENST00000581078.1_Intron	NM_024585.2	NP_078861.1	Q9H6L4	ARMC7_HUMAN	armadillo repeat containing 7	71						cytoplasm (GO:0005737)		p.E71K(1)		breast(2)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|pancreas(3)	9	all_lung(278;0.14)|Lung NSC(278;0.168)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)			GGAGGAGAATGAGACCCTGGT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	80.0	81.0					17																	73106677		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025813	CCDS11714.1	17q25	2013-02-14				ENSG00000125449		"""Armadillo repeat containing"""	26168	protein-coding gene	gene with protein product						12477932	Standard	NM_024585		Approved	FLJ22160	uc002jmw.1	Q9H6L4		ENST00000245543.1:c.211G>A	17.37:g.73106677G>A	ENSP00000245543:p.Glu71Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVA4	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	p.E71K	ENST00000245543.1	37	c.211	CCDS11714.1	17	.	.	.	.	.	.	.	.	.	.	G	22.8	4.340165	0.81911	.	.	ENSG00000125449	ENST00000245543	T	0.53206	0.63	6.07	6.07	0.98685	Armadillo-like helical (1);Armadillo-type fold (1);	0.235047	0.42964	D	0.000629	T	0.56321	0.1977	M	0.69823	2.125	0.80722	D	1	P	0.41313	0.745	B	0.41988	0.372	T	0.59332	-0.7474	10	0.66056	D	0.02	.	20.6439	0.99570	0.0:0.0:1.0:0.0	.	71	Q9H6L4	ARMC7_HUMAN	K	71	ENSP00000245543:E71K	ENSP00000245543:E71K	E	+	1	0	ARMC7	70618272	1.000000	0.71417	0.993000	0.49108	0.890000	0.51754	9.476000	0.97823	2.884000	0.98904	0.655000	0.94253	GAG	ARMC7	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000125449		0.542	ARMC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMC7	HGNC	protein_coding	OTTHUMT00000445846.1	42	0.00	0	G	NM_024585		73106677	73106677	+1	no_errors	ENST00000245543	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	1.000	A
ARMCX2	9823	genome.wustl.edu	37	X	100911132	100911132	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:100911132C>T	ENST00000328766.5	-	5	1896	c.1443G>A	c.(1441-1443)ctG>ctA	p.L481L	ARMCX2_ENST00000356824.4_Silent_p.L481L|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Silent_p.L481L	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	481						integral component of membrane (GO:0016021)		p.L481L(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						CTGCTGAGTTCAGGTTAGAGG	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	125.0	126.0					X																	100911132		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1443G>A	X.37:g.100911132C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60267|Q5H9D9	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.L481	ENST00000328766.5	37	c.1443	CCDS14490.1	X																																																																																			ARMCX2	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000184867		0.393	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	145	0.00	0	C	NM_014782		100911132	100911132	-1	no_errors	ENST00000328766	ensembl	human	known	69_37n	silent	126	17.11	26	SNP	1.000	T
ARMCX2	9823	genome.wustl.edu	37	X	100911132	100911132	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:100911132C>T	ENST00000328766.5	-	5	1896	c.1443G>A	c.(1441-1443)ctG>ctA	p.L481L	ARMCX2_ENST00000356824.4_Silent_p.L481L|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Silent_p.L481L	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	481						integral component of membrane (GO:0016021)		p.L481L(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						CTGCTGAGTTCAGGTTAGAGG	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											127.0	125.0	126.0					X																	100911132		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1443G>A	X.37:g.100911132C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60267|Q5H9D9	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.L481	ENST00000328766.5	37	c.1443	CCDS14490.1	X																																																																																			ARMCX2	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000184867		0.393	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	145	0.00	0	C	NM_014782		100911132	100911132	-1	no_errors	ENST00000328766	ensembl	human	known	69_37n	silent	200	18.70	46	SNP	1.000	T
ARMCX2	9823	genome.wustl.edu	37	X	100911530	100911530	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:100911530C>G	ENST00000328766.5	-	5	1498	c.1045G>C	c.(1045-1047)Gag>Cag	p.E349Q	ARMCX2_ENST00000356824.4_Missense_Mutation_p.E349Q|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Missense_Mutation_p.E349Q	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	349						integral component of membrane (GO:0016021)		p.E349Q(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						GAATCTGACTCTGTGTCAGTC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	62.0	64.0					X																	100911530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1045G>C	X.37:g.100911530C>G	ENSP00000331662:p.Glu349Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O60267|Q5H9D9	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.E349Q	ENST00000328766.5	37	c.1045	CCDS14490.1	X	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750491	0.30955	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.33654	1.4;1.4;1.4	3.66	3.66	0.41972	.	0.922681	0.09296	N	0.821651	T	0.25344	0.0616	N	0.19112	0.55	0.31816	N	0.626578	B	0.25850	0.136	B	0.22386	0.039	T	0.13072	-1.0523	10	0.27082	T	0.32	-7.6012	12.439	0.55614	0.0:1.0:0.0:0.0	.	349	Q7L311	ARMX2_HUMAN	Q	349	ENSP00000331662:E349Q;ENSP00000328631:E349Q;ENSP00000349281:E349Q	ENSP00000331662:E349Q	E	-	1	0	ARMCX2	100798186	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.848000	0.55903	2.086000	0.62901	0.422000	0.28245	GAG	ARMCX2	-	NULL	ENSG00000184867		0.582	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	93	0.00	0	C	NM_014782		100911530	100911530	-1	no_errors	ENST00000328766	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	G
ARMCX2	9823	genome.wustl.edu	37	X	100911530	100911530	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:100911530C>G	ENST00000328766.5	-	5	1498	c.1045G>C	c.(1045-1047)Gag>Cag	p.E349Q	ARMCX2_ENST00000356824.4_Missense_Mutation_p.E349Q|ARMCX2_ENST00000467416.1_5'Flank|ARMCX2_ENST00000330154.2_Missense_Mutation_p.E349Q	NM_014782.5	NP_055597.1	Q7L311	ARMX2_HUMAN	armadillo repeat containing, X-linked 2	349						integral component of membrane (GO:0016021)		p.E349Q(1)		NS(1)|breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(6)|prostate(1)|skin(1)	29						GAATCTGACTCTGTGTCAGTC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	62.0	64.0					X																	100911530		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011084	CCDS14490.1	Xq21.33-q22.2	2014-03-21			ENSG00000184867	ENSG00000184867		"""Armadillo repeat containing"""	16869	protein-coding gene	gene with protein product		300363				9628581, 11162520, 16221301, 22569362	Standard	XM_005278109		Approved	ALEX2, KIAA0512, GASP9	uc004eif.3	Q7L311	OTTHUMG00000022038	ENST00000328766.5:c.1045G>C	X.37:g.100911530C>G	ENSP00000331662:p.Glu349Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O60267|Q5H9D9	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,smart_Armadillo	p.E349Q	ENST00000328766.5	37	c.1045	CCDS14490.1	X	.	.	.	.	.	.	.	.	.	.	C	11.81	1.750491	0.30955	.	.	ENSG00000184867	ENST00000328766;ENST00000330154;ENST00000356824	T;T;T	0.33654	1.4;1.4;1.4	3.66	3.66	0.41972	.	0.922681	0.09296	N	0.821651	T	0.25344	0.0616	N	0.19112	0.55	0.31816	N	0.626578	B	0.25850	0.136	B	0.22386	0.039	T	0.13072	-1.0523	10	0.27082	T	0.32	-7.6012	12.439	0.55614	0.0:1.0:0.0:0.0	.	349	Q7L311	ARMX2_HUMAN	Q	349	ENSP00000331662:E349Q;ENSP00000328631:E349Q;ENSP00000349281:E349Q	ENSP00000331662:E349Q	E	-	1	0	ARMCX2	100798186	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.848000	0.55903	2.086000	0.62901	0.422000	0.28245	GAG	ARMCX2	-	NULL	ENSG00000184867		0.582	ARMCX2-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ARMCX2	HGNC	protein_coding	OTTHUMT00000057586.1	93	0.00	0	C	NM_014782		100911530	100911530	-1	no_errors	ENST00000328766	ensembl	human	known	69_37n	missense	76	21.65	21	SNP	1.000	G
ATAD2B	54454	genome.wustl.edu	37	2	24011418	24011418	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:24011418G>C	ENST00000238789.5	-	20	3083	c.2740C>G	c.(2740-2742)Cag>Gag	p.Q914E	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	914						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)	p.Q914E(1)		central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTGATGCCTGATTGAGAATC	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											149.0	138.0	141.0					2																	24011418		1840	4078	5918	-	-	-	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2740C>G	2.37:g.24011418G>C	ENSP00000238789:p.Gln914Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.Q914E	ENST00000238789.5	37	c.2740	CCDS46227.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.52|14.52	2.561137|2.561137	0.45590|0.45590	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789;ENST00000546030	.|D	.|0.94232	.|-3.38	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.848613	.|0.10508	.|N	.|0.666537	D|D	0.88826|0.88826	0.6542|0.6542	L|L	0.28115|0.28115	0.83|0.83	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B	.|0.17038	.|0.012;0.02	.|B;B	.|0.23150	.|0.02;0.044	T|T	0.78927|0.78927	-0.2011|-0.2011	5|10	.|0.08599	.|T	.|0.76	.|.	16.3886|16.3886	0.83524|0.83524	0.0:0.1402:0.8598:0.0|0.0:0.1402:0.8598:0.0	.|.	.|914;914	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	M|E	194|914;82	.|ENSP00000238789:Q914E	.|ENSP00000238789:Q914E	I|Q	-|-	3|1	3|0	ATAD2B|ATAD2B	23864922|23864922	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.259000|5.259000	0.65485|0.65485	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	ATC|CAG	ATAD2B	-	NULL	ENSG00000119778		0.368	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	270	0.00	0	G	NM_017552		24011418	24011418	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	missense	329	10.84	40	SNP	1.000	C
ATAD2B	54454	genome.wustl.edu	37	2	24011418	24011418	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:24011418G>C	ENST00000238789.5	-	20	3083	c.2740C>G	c.(2740-2742)Cag>Gag	p.Q914E	ATAD2B_ENST00000474583.1_5'UTR	NM_001242338.1|NM_017552.2	NP_001229267.1|NP_060022.1	Q9ULI0	ATD2B_HUMAN	ATPase family, AAA domain containing 2B	914						nucleus (GO:0005634)	ATP binding (GO:0005524)|lysine-acetylated histone binding (GO:0070577)	p.Q914E(1)		central_nervous_system(1)	1	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTGATGCCTGATTGAGAATC	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											149.0	138.0	141.0					2																	24011418		1840	4078	5918	-	-	-	SO:0001583	missense	0			AB033066	CCDS46227.1	2p24.1-p23.3	2010-04-21		2007-02-08	ENSG00000119778	ENSG00000119778		"""ATPases / AAA-type"""	29230	protein-coding gene	gene with protein product		615347					Standard	XM_005264372		Approved	KIAA1240	uc002rek.4	Q9ULI0	OTTHUMG00000151902	ENST00000238789.5:c.2740C>G	2.37:g.24011418G>C	ENSP00000238789:p.Gln914Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVQ5|Q6ZNA6|Q8N9E7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,pfam_IstB_ATP-bd,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.Q914E	ENST00000238789.5	37	c.2740	CCDS46227.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.52|14.52	2.561137|2.561137	0.45590|0.45590	.|.	.|.	ENSG00000119778|ENSG00000119778	ENST00000381024|ENST00000238789;ENST00000546030	.|D	.|0.94232	.|-3.38	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	.|0.848613	.|0.10508	.|N	.|0.666537	D|D	0.88826|0.88826	0.6542|0.6542	L|L	0.28115|0.28115	0.83|0.83	0.58432|0.58432	D|D	0.999999|0.999999	.|B;B	.|0.17038	.|0.012;0.02	.|B;B	.|0.23150	.|0.02;0.044	T|T	0.78927|0.78927	-0.2011|-0.2011	5|10	.|0.08599	.|T	.|0.76	.|.	16.3886|16.3886	0.83524|0.83524	0.0:0.1402:0.8598:0.0|0.0:0.1402:0.8598:0.0	.|.	.|914;914	.|Q9ULI0;Q9ULI0-2	.|ATD2B_HUMAN;.	M|E	194|914;82	.|ENSP00000238789:Q914E	.|ENSP00000238789:Q914E	I|Q	-|-	3|1	3|0	ATAD2B|ATAD2B	23864922|23864922	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	5.259000|5.259000	0.65485|0.65485	2.785000|2.785000	0.95823|0.95823	0.655000|0.655000	0.94253|0.94253	ATC|CAG	ATAD2B	-	NULL	ENSG00000119778		0.368	ATAD2B-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	ATAD2B	HGNC	protein_coding	OTTHUMT00000324333.1	270	0.00	0	G	NM_017552		24011418	24011418	-1	no_errors	ENST00000238789	ensembl	human	known	69_37n	missense	488	10.62	58	SNP	1.000	C
ATP2B1	490	genome.wustl.edu	37	12	90005123	90005123	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:90005123C>T	ENST00000428670.3	-	13	2550	c.2094G>A	c.(2092-2094)caG>caA	p.Q698Q	ATP2B1_ENST00000261173.2_Silent_p.Q698Q|ATP2B1_ENST00000348959.3_Silent_p.Q698Q|ATP2B1_ENST00000359142.3_Silent_p.Q698Q|ATP2B1_ENST00000393164.2_Silent_p.Q441Q			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	698					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.Q698Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TTCCAGCCCTCTGACACTTTT	0.363																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											153.0	160.0	158.0					12																	90005123		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2094G>A	12.37:g.90005123C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.Q698	ENST00000428670.3	37	c.2094	CCDS9035.1	12																																																																																			ATP2B1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000070961		0.363	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	121	0.00	0	C	NM_001682		90005123	90005123	-1	no_errors	ENST00000261173	ensembl	human	known	69_37n	silent	104	22.39	30	SNP	1.000	T
ATP2B1	490	genome.wustl.edu	37	12	90005123	90005123	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:90005123C>T	ENST00000428670.3	-	13	2550	c.2094G>A	c.(2092-2094)caG>caA	p.Q698Q	ATP2B1_ENST00000261173.2_Silent_p.Q698Q|ATP2B1_ENST00000348959.3_Silent_p.Q698Q|ATP2B1_ENST00000359142.3_Silent_p.Q698Q|ATP2B1_ENST00000393164.2_Silent_p.Q441Q			P20020	AT2B1_HUMAN	ATPase, Ca++ transporting, plasma membrane 1	698					blood coagulation (GO:0007596)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)	p.Q698Q(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	45						TTCCAGCCCTCTGACACTTTT	0.363																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											153.0	160.0	158.0					12																	90005123		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J04027	CCDS9035.1, CCDS41817.1	12q21.33	2010-04-20			ENSG00000070961	ENSG00000070961	3.6.3.8	"""ATPases / P-type"""	814	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 1"""	108731				1674727	Standard	NM_001682		Approved	PMCA1	uc001tbh.3	P20020		ENST00000428670.3:c.2094G>A	12.37:g.90005123C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12992|Q12993|Q13819|Q13820|Q13821|Q16504|Q93082	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.Q698	ENST00000428670.3	37	c.2094	CCDS9035.1	12																																																																																			ATP2B1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000070961		0.363	ATP2B1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP2B1	HGNC	protein_coding	OTTHUMT00000406653.1	121	0.00	0	C	NM_001682		90005123	90005123	-1	no_errors	ENST00000261173	ensembl	human	known	69_37n	silent	151	29.44	63	SNP	1.000	T
BMP2K	55589	genome.wustl.edu	37	4	79831828	79831828	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:79831828C>G	ENST00000335016.5	+	16	2293	c.2127C>G	c.(2125-2127)atC>atG	p.I709M	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	709					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.I709M(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						CAAACCCTATCAAGAACGGTA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	58.0	60.0					4																	79831828		1855	4094	5949	-	-	-	SO:0001583	missense	0			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2127C>G	4.37:g.79831828C>G	ENSP00000334836:p.Ile709Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I709M	ENST00000335016.5	37	c.2127	CCDS47083.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.517|1.517	-0.547933|-0.547933	0.04024|0.04024	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000335016|ENST00000502613	T|.	0.72725|.	-0.68|.	5.34|5.34	0.312|0.312	0.15837|0.15837	.|.	1.424740|.	0.04058|.	N|.	0.305792|.	T|T	0.32285|0.32285	0.0824|0.0824	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	0.999994|0.999994	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.27123|0.27123	-1.0083|-1.0083	10|5	0.46703|.	T|.	0.11|.	-0.1142|-0.1142	2.7309|2.7309	0.05227|0.05227	0.1131:0.3549:0.3291:0.2029|0.1131:0.3549:0.3291:0.2029	.|.	709|.	Q9NSY1|.	BMP2K_HUMAN|.	M|E	709|402	ENSP00000334836:I709M|.	ENSP00000334836:I709M|.	I|Q	+|+	3|1	3|0	BMP2K|BMP2K	80050852|80050852	0.001000|0.001000	0.12720|0.12720	0.051000|0.051000	0.19133|0.19133	0.006000|0.006000	0.05464|0.05464	-0.161000|-0.161000	0.10026|0.10026	0.005000|0.005000	0.14708|0.14708	0.484000|0.484000	0.47621|0.47621	ATC|CAA	BMP2K	-	NULL	ENSG00000138756		0.383	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BMP2K	HGNC	protein_coding		94	0.00	0	C	NM_017593		79831828	79831828	+1	no_errors	ENST00000335016	ensembl	human	known	69_37n	missense	122	18.12	27	SNP	0.004	G
BMP2K	55589	genome.wustl.edu	37	4	79831828	79831828	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:79831828C>G	ENST00000335016.5	+	16	2293	c.2127C>G	c.(2125-2127)atC>atG	p.I709M	PAQR3_ENST00000295462.3_Intron	NM_198892.1	NP_942595.1	Q9NSY1	BMP2K_HUMAN	BMP2 inducible kinase	709					regulation of bone mineralization (GO:0030500)	nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatase regulator activity (GO:0019208)|protein serine/threonine kinase activity (GO:0004674)	p.I709M(1)		NS(1)|breast(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|urinary_tract(1)	13						CAAACCCTATCAAGAACGGTA	0.383																																						dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	58.0	60.0					4																	79831828		1855	4094	5949	-	-	-	SO:0001583	missense	0			AB015331	CCDS34019.1, CCDS47083.1	4q21.21	2008-05-15			ENSG00000138756	ENSG00000138756			18041	protein-coding gene	gene with protein product							Standard	NM_017593		Approved	DKFZp434K0614, BIKe	uc003hlk.3	Q9NSY1	OTTHUMG00000160900	ENST00000335016.5:c.2127C>G	4.37:g.79831828C>G	ENSP00000334836:p.Ile709Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O94791|Q4W5H2|Q8IYF2|Q8N2G7|Q8NHG9|Q9NTG8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I709M	ENST00000335016.5	37	c.2127	CCDS47083.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.517|1.517	-0.547933|-0.547933	0.04024|0.04024	.|.	.|.	ENSG00000138756|ENSG00000138756	ENST00000335016|ENST00000502613	T|.	0.72725|.	-0.68|.	5.34|5.34	0.312|0.312	0.15837|0.15837	.|.	1.424740|.	0.04058|.	N|.	0.305792|.	T|T	0.32285|0.32285	0.0824|0.0824	L|L	0.44542|0.44542	1.39|1.39	0.09310|0.09310	N|N	0.999994|0.999994	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.27123|0.27123	-1.0083|-1.0083	10|5	0.46703|.	T|.	0.11|.	-0.1142|-0.1142	2.7309|2.7309	0.05227|0.05227	0.1131:0.3549:0.3291:0.2029|0.1131:0.3549:0.3291:0.2029	.|.	709|.	Q9NSY1|.	BMP2K_HUMAN|.	M|E	709|402	ENSP00000334836:I709M|.	ENSP00000334836:I709M|.	I|Q	+|+	3|1	3|0	BMP2K|BMP2K	80050852|80050852	0.001000|0.001000	0.12720|0.12720	0.051000|0.051000	0.19133|0.19133	0.006000|0.006000	0.05464|0.05464	-0.161000|-0.161000	0.10026|0.10026	0.005000|0.005000	0.14708|0.14708	0.484000|0.484000	0.47621|0.47621	ATC|CAA	BMP2K	-	NULL	ENSG00000138756		0.383	BMP2K-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BMP2K	HGNC	protein_coding		94	0.00	0	C	NM_017593		79831828	79831828	+1	no_errors	ENST00000335016	ensembl	human	known	69_37n	missense	81	15.62	15	SNP	0.004	G
BRCC3	79184	genome.wustl.edu	37	X	154327650	154327650	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:154327650G>A	ENST00000369462.1	+	8	634	c.609G>A	c.(607-609)caG>caA	p.Q203Q	BRCC3_ENST00000340647.4_Intron|BRCC3_ENST00000399042.1_Silent_p.Q203Q|BRCC3_ENST00000369459.2_Intron|BRCC3_ENST00000330045.7_Intron|MTCP1_ENST00000362018.2_Intron	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	203					double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.Q203Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ttgagggccagaaggaagagg	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											45.0	40.0	42.0					X																	154327650		1909	4125	6034	-	-	-	SO:0001819	synonymous_variant	0			X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.609G>A	X.37:g.154327650G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Silent	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.Q203	ENST00000369462.1	37	c.609	CCDS56611.1	X																																																																																			BRCC3	-	NULL	ENSG00000185515		0.507	BRCC3-001	KNOWN	basic|CCDS	protein_coding	BRCC3	HGNC	protein_coding	OTTHUMT00000058788.4	71	0.00	0	G	NM_024332		154327650	154327650	+1	no_errors	ENST00000399042	ensembl	human	known	69_37n	silent	45	18.18	10	SNP	0.999	A
BRCC3	79184	genome.wustl.edu	37	X	154327650	154327650	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:154327650G>A	ENST00000369462.1	+	8	634	c.609G>A	c.(607-609)caG>caA	p.Q203Q	BRCC3_ENST00000340647.4_Intron|BRCC3_ENST00000399042.1_Silent_p.Q203Q|BRCC3_ENST00000369459.2_Intron|BRCC3_ENST00000330045.7_Intron|MTCP1_ENST00000362018.2_Intron	NM_024332.3	NP_077308.1	P46736	BRCC3_HUMAN	BRCA1/BRCA2-containing complex, subunit 3	203					double-strand break repair (GO:0006302)|G2 DNA damage checkpoint (GO:0031572)|histone H2A K63-linked deubiquitination (GO:0070537)|positive regulation of DNA repair (GO:0045739)|protein K63-linked deubiquitination (GO:0070536)|regulation of catalytic activity (GO:0050790)|response to ionizing radiation (GO:0010212)|response to X-ray (GO:0010165)	BRCA1-A complex (GO:0070531)|BRISC complex (GO:0070552)|nuclear ubiquitin ligase complex (GO:0000152)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	enzyme regulator activity (GO:0030234)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|polyubiquitin binding (GO:0031593)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.Q203Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)|pancreas(1)|skin(1)	22	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ttgagggccagaaggaagagg	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											45.0	40.0	42.0					X																	154327650		1909	4125	6034	-	-	-	SO:0001819	synonymous_variant	0			X64643	CCDS56610.1, CCDS56611.1, CCDS56612.1	Xq28	2013-05-29	2005-11-21	2005-11-21	ENSG00000185515	ENSG00000185515			24185	protein-coding gene	gene with protein product	"""Lys-63-specific deubiquitinase"""	300617	"""chromosome X open reading frame 53"""	CXorf53		1303175, 14636569	Standard	NM_024332		Approved	C6.1A, BRCC36	uc004fna.3	P46736	OTTHUMG00000022658	ENST00000369462.1:c.609G>A	X.37:g.154327650G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRF8|A6QRF9|A8MUX5|A8MWH0|A9Z1Y0|A9Z1Y5|B1B062|B4DQN7|Q16107|Q53YX5|Q9BTZ6	Silent	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.Q203	ENST00000369462.1	37	c.609	CCDS56611.1	X																																																																																			BRCC3	-	NULL	ENSG00000185515		0.507	BRCC3-001	KNOWN	basic|CCDS	protein_coding	BRCC3	HGNC	protein_coding	OTTHUMT00000058788.4	71	0.00	0	G	NM_024332		154327650	154327650	+1	no_errors	ENST00000399042	ensembl	human	known	69_37n	silent	66	17.50	14	SNP	0.999	A
BUB1	699	genome.wustl.edu	37	2	111398712	111398712	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:111398712C>G	ENST00000302759.6	-	23	2972	c.2854G>C	c.(2854-2856)Gat>Cat	p.D952H	BUB1_ENST00000535254.1_Missense_Mutation_p.D932H|BUB1_ENST00000409311.1_Missense_Mutation_p.D895H|BUB1_ENST00000478175.1_5'Flank	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	952	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D952H(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		AGTTTCATATCTATACTCTGA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	91.0	92.0					2																	111398712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.2854G>C	2.37:g.111398712C>G	ENSP00000302530:p.Asp952His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.D952H	ENST00000302759.6	37	c.2854	CCDS33273.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632645	0.87660	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759	T;T;T	0.65549	-0.16;2.1;-0.16	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045984	0.85682	D	0.000000	T	0.82010	0.4944	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84435	0.0579	10	0.87932	D	0	-28.4202	18.2228	0.89906	0.0:1.0:0.0:0.0	.	932;895;952	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	H	932;895;952	ENSP00000441013:D932H;ENSP00000386701:D895H;ENSP00000302530:D952H	ENSP00000302530:D952H	D	-	1	0	BUB1	111115184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.656000	0.83736	2.736000	0.93811	0.591000	0.81541	GAT	BUB1	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169679		0.393	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	HGNC	protein_coding	OTTHUMT00000331925.1	80	0.00	0	C	NM_004336		111398712	111398712	-1	no_errors	ENST00000302759	ensembl	human	known	69_37n	missense	127	19.62	31	SNP	1.000	G
BUB1	699	genome.wustl.edu	37	2	111398712	111398712	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:111398712C>G	ENST00000302759.6	-	23	2972	c.2854G>C	c.(2854-2856)Gat>Cat	p.D952H	BUB1_ENST00000535254.1_Missense_Mutation_p.D932H|BUB1_ENST00000409311.1_Missense_Mutation_p.D895H|BUB1_ENST00000478175.1_5'Flank	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	952	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.D952H(1)		breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		AGTTTCATATCTATACTCTGA	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											94.0	91.0	92.0					2																	111398712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.2854G>C	2.37:g.111398712C>G	ENSP00000302530:p.Asp952His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Missense_Mutation	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.D952H	ENST00000302759.6	37	c.2854	CCDS33273.1	2	.	.	.	.	.	.	.	.	.	.	C	25.4	4.632645	0.87660	.	.	ENSG00000169679	ENST00000535254;ENST00000409311;ENST00000302759	T;T;T	0.65549	-0.16;2.1;-0.16	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.045984	0.85682	D	0.000000	T	0.82010	0.4944	M	0.85859	2.78	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.84435	0.0579	10	0.87932	D	0	-28.4202	18.2228	0.89906	0.0:1.0:0.0:0.0	.	932;895;952	F5GXI5;E9PC26;O43683	.;.;BUB1_HUMAN	H	932;895;952	ENSP00000441013:D932H;ENSP00000386701:D895H;ENSP00000302530:D952H	ENSP00000302530:D952H	D	-	1	0	BUB1	111115184	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.656000	0.83736	2.736000	0.93811	0.591000	0.81541	GAT	BUB1	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169679		0.393	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	HGNC	protein_coding	OTTHUMT00000331925.1	80	0.00	0	C	NM_004336		111398712	111398712	-1	no_errors	ENST00000302759	ensembl	human	known	69_37n	missense	77	20.62	20	SNP	1.000	G
C1QTNF2	114898	genome.wustl.edu	37	5	159776212	159776212	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:159776212A>T	ENST00000393975.3	-	3	959	c.956T>A	c.(955-957)cTa>cAa	p.L319Q		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	274					activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)		p.L319Q(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCATAGATTAGGAAGCCCGT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	75.0	74.0					5																	159776212		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.956T>A	5.37:g.159776212A>T	ENSP00000377545:p.Leu319Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.L319Q	ENST00000393975.3	37	c.956	CCDS4351.2	5	.	.	.	.	.	.	.	.	.	.	A	18.07	3.542684	0.65198	.	.	ENSG00000145861	ENST00000393975	D	0.86432	-2.12	4.99	4.99	0.66335	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.95503	0.8539	H	0.95982	3.75	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96894	0.9655	10	0.87932	D	0	.	14.649	0.68784	1.0:0.0:0.0:0.0	.	274	Q9BXJ5	C1QT2_HUMAN	Q	319	ENSP00000377545:L319Q	ENSP00000377545:L319Q	L	-	2	0	C1QTNF2	159708790	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	9.213000	0.95133	2.010000	0.58986	0.533000	0.62120	CTA	C1QTNF2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000145861		0.542	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF2	HGNC	protein_coding	OTTHUMT00000252672.2	71	0.00	0	A			159776212	159776212	-1	no_errors	ENST00000393975	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	1.000	T
C1QTNF2	114898	genome.wustl.edu	37	5	159776212	159776212	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:159776212A>T	ENST00000393975.3	-	3	959	c.956T>A	c.(955-957)cTa>cAa	p.L319Q		NM_031908.4	NP_114114.2	Q9BXJ5	C1QT2_HUMAN	C1q and tumor necrosis factor related protein 2	274					activation of MAPK activity (GO:0000187)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|protein heterotrimerization (GO:0070208)|protein homooligomerization (GO:0051260)	collagen trimer (GO:0005581)|extracellular space (GO:0005615)		p.L319Q(1)		breast(2)|endometrium(2)|large_intestine(1)|lung(4)|prostate(1)|skin(3)	13	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGCATAGATTAGGAAGCCCGT	0.542																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	75.0	74.0					5																	159776212		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF329836	CCDS4351.2	5q33.3	2008-05-15			ENSG00000145861	ENSG00000145861			14325	protein-coding gene	gene with protein product							Standard	XM_005265815		Approved	CTRP2	uc003lyd.3	Q9BXJ5	OTTHUMG00000130323	ENST00000393975.3:c.956T>A	5.37:g.159776212A>T	ENSP00000377545:p.Leu319Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_C1q,pfam_Collagen,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.L319Q	ENST00000393975.3	37	c.956	CCDS4351.2	5	.	.	.	.	.	.	.	.	.	.	A	18.07	3.542684	0.65198	.	.	ENSG00000145861	ENST00000393975	D	0.86432	-2.12	4.99	4.99	0.66335	Tumour necrosis factor-like (2);Complement C1q protein (4);	0.000000	0.85682	D	0.000000	D	0.95503	0.8539	H	0.95982	3.75	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.96894	0.9655	10	0.87932	D	0	.	14.649	0.68784	1.0:0.0:0.0:0.0	.	274	Q9BXJ5	C1QT2_HUMAN	Q	319	ENSP00000377545:L319Q	ENSP00000377545:L319Q	L	-	2	0	C1QTNF2	159708790	1.000000	0.71417	1.000000	0.80357	0.476000	0.33039	9.213000	0.95133	2.010000	0.58986	0.533000	0.62120	CTA	C1QTNF2	-	pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	ENSG00000145861		0.542	C1QTNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF2	HGNC	protein_coding	OTTHUMT00000252672.2	71	0.00	0	A			159776212	159776212	-1	no_errors	ENST00000393975	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	1.000	T
OSER1	51526	genome.wustl.edu	37	20	42835595	42835595	+	Start_Codon_SNP	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:42835595C>G	ENST00000372970.2	-	4	183	c.3G>C	c.(1-3)atG>atC	p.M1I	OSER1_ENST00000255174.2_Start_Codon_SNP_p.M1I			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1	1					cellular response to hydrogen peroxide (GO:0070301)			p.M1I(1)									CTTCGGATTTCATTGTGCAAG	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	91.0	94.0					20																	42835595		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.3G>C	20.37:g.42835595C>G	ENSP00000362061:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK4|O95912|Q9NZ84|Q9P0R8	Missense_Mutation	SNP	pfam_DUF776	p.M1I	ENST00000372970.2	37	c.3	CCDS13327.1	20	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799313	0.90538	.	.	ENSG00000132823	ENST00000255174;ENST00000372970	T;T	0.48201	0.82;0.82	5.6	5.6	0.85130	.	0.034774	0.85682	D	0.000000	T	0.68787	0.3039	.	.	.	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.70146	-0.4952	9	0.62326	D	0.03	-13.1197	19.9659	0.97266	0.0:1.0:0.0:0.0	.	1	Q9NX31	CT111_HUMAN	I	1	ENSP00000255174:M1I;ENSP00000362061:M1I	ENSP00000255174:M1I	M	-	3	0	C20orf111	42269009	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.753000	0.62183	2.802000	0.96397	0.650000	0.86243	ATG	C20orf111	-	pfam_DUF776	ENSG00000132823		0.338	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf111	HGNC	protein_coding	OTTHUMT00000079334.2	139	0.00	0	C	NM_016470	Missense_Mutation	42835595	42835595	-1	no_errors	ENST00000255174	ensembl	human	known	69_37n	missense	217	24.13	69	SNP	1.000	G
OSER1	51526	genome.wustl.edu	37	20	42835595	42835595	+	Start_Codon_SNP	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:42835595C>G	ENST00000372970.2	-	4	183	c.3G>C	c.(1-3)atG>atC	p.M1I	OSER1_ENST00000255174.2_Start_Codon_SNP_p.M1I			Q9NX31	OSER1_HUMAN	oxidative stress responsive serine-rich 1	1					cellular response to hydrogen peroxide (GO:0070301)			p.M1I(1)									CTTCGGATTTCATTGTGCAAG	0.338																																						dbGAP											1	Substitution - Missense(1)	breast(1)											101.0	91.0	94.0					20																	42835595		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AL035447	CCDS13327.1	20q13.11	2013-05-17	2013-05-17	2013-05-17	ENSG00000132823	ENSG00000132823			16105	protein-coding gene	gene with protein product	"""peroxide-inducible transcript 1"", ""oxidative stress-responsive 1"""		"""chromosome 20 open reading frame 111"""	C20orf111		17148688	Standard	NM_016470		Approved	dJ1183I21.1, HSPC207, Perit1, Osr1		Q9NX31	OTTHUMG00000032518	ENST00000372970.2:c.3G>C	20.37:g.42835595C>G	ENSP00000362061:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK4|O95912|Q9NZ84|Q9P0R8	Missense_Mutation	SNP	pfam_DUF776	p.M1I	ENST00000372970.2	37	c.3	CCDS13327.1	20	.	.	.	.	.	.	.	.	.	.	C	27.1	4.799313	0.90538	.	.	ENSG00000132823	ENST00000255174;ENST00000372970	T;T	0.48201	0.82;0.82	5.6	5.6	0.85130	.	0.034774	0.85682	D	0.000000	T	0.68787	0.3039	.	.	.	0.80722	D	1	D	0.69078	0.997	P	0.62885	0.908	T	0.70146	-0.4952	9	0.62326	D	0.03	-13.1197	19.9659	0.97266	0.0:1.0:0.0:0.0	.	1	Q9NX31	CT111_HUMAN	I	1	ENSP00000255174:M1I;ENSP00000362061:M1I	ENSP00000255174:M1I	M	-	3	0	C20orf111	42269009	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.753000	0.62183	2.802000	0.96397	0.650000	0.86243	ATG	C20orf111	-	pfam_DUF776	ENSG00000132823		0.338	OSER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf111	HGNC	protein_coding	OTTHUMT00000079334.2	139	0.00	0	C	NM_016470	Missense_Mutation	42835595	42835595	-1	no_errors	ENST00000255174	ensembl	human	known	69_37n	missense	352	24.63	115	SNP	1.000	G
RTCB	51493	genome.wustl.edu	37	22	32788229	32788229	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr22:32788229C>G	ENST00000216038.5	-	11	1506	c.1408G>C	c.(1408-1410)Gag>Cag	p.E470Q	RTCB_ENST00000451746.2_3'UTR	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase									p.E470Q(1)									TCACTTACCTCTTCCATAACC	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	91.0	91.0					22																	32788229		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.1408G>C	22.37:g.32788229C>G	ENSP00000216038:p.Glu470Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RtcB_family,superfamily_RtcB_family	p.E470Q	ENST00000216038.5	37	c.1408	CCDS13905.1	22	.	.	.	.	.	.	.	.	.	.	C	32	5.173491	0.94807	.	.	ENSG00000100220	ENST00000216038	T	0.73047	-0.71	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89420	0.6710	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91458	0.5187	10	0.87932	D	0	-25.9717	20.1731	0.98165	0.0:1.0:0.0:0.0	.	470	Q9Y3I0	RTCB_HUMAN	Q	470	ENSP00000216038:E470Q	ENSP00000216038:E470Q	E	-	1	0	C22orf28	31118229	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.805000	0.86005	2.768000	0.95171	0.655000	0.94253	GAG	C22orf28	-	pfam_RtcB_family,superfamily_RtcB_family	ENSG00000100220		0.368	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf28	HGNC	protein_coding	OTTHUMT00000075188.3	79	0.00	0	C	NM_014306		32788229	32788229	-1	no_errors	ENST00000216038	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	G
RTCB	51493	genome.wustl.edu	37	22	32788229	32788229	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr22:32788229C>G	ENST00000216038.5	-	11	1506	c.1408G>C	c.(1408-1410)Gag>Cag	p.E470Q	RTCB_ENST00000451746.2_3'UTR	NM_014306.4	NP_055121.1			RNA 2',3'-cyclic phosphate and 5'-OH ligase									p.E470Q(1)									TCACTTACCTCTTCCATAACC	0.368																																						dbGAP											1	Substitution - Missense(1)	breast(1)											93.0	91.0	91.0					22																	32788229		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016707	CCDS13905.1	22q12.3	2013-05-22	2013-05-22	2013-05-22	ENSG00000100220	ENSG00000100220	6.5.1.3		26935	protein-coding gene	gene with protein product	"""focal adhesion-associated protein"""	613901	"""chromosome 22 open reading frame 28"""	C22orf28		11042152, 21209330, 21311021	Standard	NM_014306		Approved	HSPC117, FAAP		Q9Y3I0	OTTHUMG00000030300	ENST00000216038.5:c.1408G>C	22.37:g.32788229C>G	ENSP00000216038:p.Glu470Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RtcB_family,superfamily_RtcB_family	p.E470Q	ENST00000216038.5	37	c.1408	CCDS13905.1	22	.	.	.	.	.	.	.	.	.	.	C	32	5.173491	0.94807	.	.	ENSG00000100220	ENST00000216038	T	0.73047	-0.71	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89420	0.6710	H	0.94771	3.58	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91458	0.5187	10	0.87932	D	0	-25.9717	20.1731	0.98165	0.0:1.0:0.0:0.0	.	470	Q9Y3I0	RTCB_HUMAN	Q	470	ENSP00000216038:E470Q	ENSP00000216038:E470Q	E	-	1	0	C22orf28	31118229	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.805000	0.86005	2.768000	0.95171	0.655000	0.94253	GAG	C22orf28	-	pfam_RtcB_family,superfamily_RtcB_family	ENSG00000100220		0.368	RTCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C22orf28	HGNC	protein_coding	OTTHUMT00000075188.3	79	0.00	0	C	NM_014306		32788229	32788229	-1	no_errors	ENST00000216038	ensembl	human	known	69_37n	missense	76	26.21	27	SNP	1.000	G
C3orf33	285315	genome.wustl.edu	37	3	155493550	155493550	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:155493550C>G	ENST00000340171.2	-	3	360	c.262G>C	c.(262-264)Gag>Cag	p.E88Q	C3orf33_ENST00000534941.1_Missense_Mutation_p.E45Q			Q6P1S2	CC033_HUMAN	chromosome 3 open reading frame 33	88					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)	p.E39Q(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)	8			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AAACCATTCTCAGTTATTCGG	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	101.0	101.0					3																	155493550		1810	4066	5876	-	-	-	SO:0001583	missense	0			AF115515	CCDS54659.1	3q25.31	2012-10-31			ENSG00000174928	ENSG00000174928			26434	protein-coding gene	gene with protein product						20680465	Standard	NM_173657		Approved	FLJ31139, AC3-33	uc003fal.1	Q6P1S2	OTTHUMG00000158496	ENST00000340171.2:c.262G>C	3.37:g.155493550C>G	ENSP00000342512:p.Glu88Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1H5|Q86YE6|Q8IXA7|Q96NB5	Missense_Mutation	SNP	superfamily_Staphylococal_nuclease_OB-fold	p.E88Q	ENST00000340171.2	37	c.262		3	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819185	0.71028	.	.	ENSG00000174928	ENST00000534941;ENST00000340171;ENST00000537385	T;T	0.46451	0.87;0.87	5.45	4.58	0.56647	.	0.163304	0.52532	D	0.000070	T	0.55481	0.1923	M	0.69823	2.125	0.38121	D	0.93786	D	0.57571	0.98	P	0.55303	0.773	T	0.62798	-0.6778	10	0.49607	T	0.09	-5.8675	13.0044	0.58696	0.0:0.921:0.0:0.079	.	88	Q6P1S2	CC033_HUMAN	Q	45;88;88	ENSP00000445446:E45Q;ENSP00000342512:E88Q	ENSP00000342512:E88Q	E	-	1	0	C3orf33	156976244	0.993000	0.37304	0.496000	0.27539	0.996000	0.88848	3.472000	0.53114	1.298000	0.44778	0.655000	0.94253	GAG	C3orf33	-	superfamily_Staphylococal_nuclease_OB-fold	ENSG00000174928		0.303	C3orf33-001	KNOWN	basic	protein_coding	C3orf33	HGNC	protein_coding	OTTHUMT00000351167.1	100	0.00	0	C	NM_173657		155493550	155493550	-1	no_errors	ENST00000340171	ensembl	human	known	69_37n	missense	200	18.70	46	SNP	0.805	G
C3orf33	285315	genome.wustl.edu	37	3	155493550	155493550	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:155493550C>G	ENST00000340171.2	-	3	360	c.262G>C	c.(262-264)Gag>Cag	p.E88Q	C3orf33_ENST00000534941.1_Missense_Mutation_p.E45Q			Q6P1S2	CC033_HUMAN	chromosome 3 open reading frame 33	88					negative regulation of ERK1 and ERK2 cascade (GO:0070373)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)	p.E39Q(1)		breast(1)|kidney(1)|large_intestine(3)|lung(3)	8			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AAACCATTCTCAGTTATTCGG	0.303																																						dbGAP											1	Substitution - Missense(1)	breast(1)											100.0	101.0	101.0					3																	155493550		1810	4066	5876	-	-	-	SO:0001583	missense	0			AF115515	CCDS54659.1	3q25.31	2012-10-31			ENSG00000174928	ENSG00000174928			26434	protein-coding gene	gene with protein product						20680465	Standard	NM_173657		Approved	FLJ31139, AC3-33	uc003fal.1	Q6P1S2	OTTHUMG00000158496	ENST00000340171.2:c.262G>C	3.37:g.155493550C>G	ENSP00000342512:p.Glu88Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1H5|Q86YE6|Q8IXA7|Q96NB5	Missense_Mutation	SNP	superfamily_Staphylococal_nuclease_OB-fold	p.E88Q	ENST00000340171.2	37	c.262		3	.	.	.	.	.	.	.	.	.	.	C	19.39	3.819185	0.71028	.	.	ENSG00000174928	ENST00000534941;ENST00000340171;ENST00000537385	T;T	0.46451	0.87;0.87	5.45	4.58	0.56647	.	0.163304	0.52532	D	0.000070	T	0.55481	0.1923	M	0.69823	2.125	0.38121	D	0.93786	D	0.57571	0.98	P	0.55303	0.773	T	0.62798	-0.6778	10	0.49607	T	0.09	-5.8675	13.0044	0.58696	0.0:0.921:0.0:0.079	.	88	Q6P1S2	CC033_HUMAN	Q	45;88;88	ENSP00000445446:E45Q;ENSP00000342512:E88Q	ENSP00000342512:E88Q	E	-	1	0	C3orf33	156976244	0.993000	0.37304	0.496000	0.27539	0.996000	0.88848	3.472000	0.53114	1.298000	0.44778	0.655000	0.94253	GAG	C3orf33	-	superfamily_Staphylococal_nuclease_OB-fold	ENSG00000174928		0.303	C3orf33-001	KNOWN	basic	protein_coding	C3orf33	HGNC	protein_coding	OTTHUMT00000351167.1	100	0.00	0	C	NM_173657		155493550	155493550	-1	no_errors	ENST00000340171	ensembl	human	known	69_37n	missense	306	19.69	75	SNP	0.805	G
CACNA1E	777	genome.wustl.edu	37	1	181767970	181767970	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:181767970G>A	ENST00000367573.2	+	48	6942	c.6942G>A	c.(6940-6942)taG>taA	p.*2314*	CACNA1E_ENST00000357570.5_Silent_p.*2265*|CACNA1E_ENST00000367567.4_Silent_p.*1878*|CACNA1E_ENST00000526775.1_Silent_p.*2252*|CACNA1E_ENST00000358338.5_Silent_p.*2203*|CACNA1E_ENST00000360108.3_Silent_p.*2295*|CACNA1E_ENST00000367570.1_Silent_p.*2271*	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	0					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.*2314*(1)|p.*2271*(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACAAATGCTAGAGGCTGCTCC	0.602																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											18.0	22.0	21.0					1																	181767970		2007	4169	6176	-	-	-	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6942G>A	1.37:g.181767970G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.*2314	ENST00000367573.2	37	c.6942	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.602	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	32	0.00	0	G	NM_000721		181767970	181767970	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	silent	14	22.22	4	SNP	1.000	A
CACNA1E	777	genome.wustl.edu	37	1	181767970	181767970	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:181767970G>A	ENST00000367573.2	+	48	6942	c.6942G>A	c.(6940-6942)taG>taA	p.*2314*	CACNA1E_ENST00000357570.5_Silent_p.*2265*|CACNA1E_ENST00000367567.4_Silent_p.*1878*|CACNA1E_ENST00000526775.1_Silent_p.*2252*|CACNA1E_ENST00000358338.5_Silent_p.*2203*|CACNA1E_ENST00000360108.3_Silent_p.*2295*|CACNA1E_ENST00000367570.1_Silent_p.*2271*	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	0					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)	p.*2314*(1)|p.*2271*(1)		NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						ACAAATGCTAGAGGCTGCTCC	0.602																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											18.0	22.0	21.0					1																	181767970		2007	4169	6176	-	-	-	SO:0001819	synonymous_variant	0			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.6942G>A	1.37:g.181767970G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.*2314	ENST00000367573.2	37	c.6942	CCDS55664.1	1																																																																																			CACNA1E	-	NULL	ENSG00000198216		0.602	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	32	0.00	0	G	NM_000721		181767970	181767970	+1	no_errors	ENST00000367573	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	1.000	A
CACNA1S	779	genome.wustl.edu	37	1	201030419	201030419	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:201030419C>T	ENST00000362061.3	-	25	3457	c.3231G>A	c.(3229-3231)aaG>aaA	p.K1077K	CACNA1S_ENST00000367338.3_Silent_p.K1077K	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1077	Dihydropyridine binding. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.K1077K(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTCACAGTTCTTGTACTCAG	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											133.0	106.0	115.0					1																	201030419		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3231G>A	1.37:g.201030419C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.K1077	ENST00000362061.3	37	c.3231	CCDS1407.1	1																																																																																			CACNA1S	-	prints_VDCCAlpha1	ENSG00000081248		0.552	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	122	0.00	0	C	NM_000069		201030419	201030419	-1	no_errors	ENST00000362061	ensembl	human	known	69_37n	silent	125	16.11	24	SNP	1.000	T
CACNA1S	779	genome.wustl.edu	37	1	201030419	201030419	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:201030419C>T	ENST00000362061.3	-	25	3457	c.3231G>A	c.(3229-3231)aaG>aaA	p.K1077K	CACNA1S_ENST00000367338.3_Silent_p.K1077K	NM_000069.2	NP_000060.2	Q13698	CAC1S_HUMAN	calcium channel, voltage-dependent, L type, alpha 1S subunit	1077	Dihydropyridine binding. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport (GO:0006816)|endoplasmic reticulum organization (GO:0007029)|extraocular skeletal muscle development (GO:0002074)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|myoblast fusion (GO:0007520)|neuromuscular junction development (GO:0007528)|skeletal muscle adaptation (GO:0043501)|skeletal muscle fiber development (GO:0048741)|skeletal system development (GO:0001501)|striated muscle contraction (GO:0006941)	cytoplasm (GO:0005737)|I band (GO:0031674)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.K1077K(1)		NS(2)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(19)|lung(37)|ovary(6)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	102					Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	GCTCACAGTTCTTGTACTCAG	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											133.0	106.0	115.0					1																	201030419		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L33798	CCDS1407.1	1q32	2012-03-07			ENSG00000081248	ENSG00000081248		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1397	protein-coding gene	gene with protein product		114208		HOKPP, MHS5, CACNL1A3		7916735, 16382099	Standard	NM_000069		Approved	Cav1.1, hypoPP	uc001gvv.3	Q13698	OTTHUMG00000035784	ENST00000362061.3:c.3231G>A	1.37:g.201030419C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF51|B1ALM2|Q12896|Q13934	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_VDCC_L_a1ssu	p.K1077	ENST00000362061.3	37	c.3231	CCDS1407.1	1																																																																																			CACNA1S	-	prints_VDCCAlpha1	ENSG00000081248		0.552	CACNA1S-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1S	HGNC	protein_coding	OTTHUMT00000087049.1	122	0.00	0	C	NM_000069		201030419	201030419	-1	no_errors	ENST00000362061	ensembl	human	known	69_37n	silent	189	18.88	44	SNP	1.000	T
CATSPER2	117155	genome.wustl.edu	37	15	43940233	43940233	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:43940233C>T	ENST00000321596.5	-	2	226	c.27G>A	c.(25-27)caG>caA	p.Q9Q	CATSPER2_ENST00000355438.2_Silent_p.Q9Q|CATSPER2_ENST00000354127.4_Silent_p.Q9Q|CATSPER2_ENST00000381761.1_Silent_p.Q15Q|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000464721.1_Intron|CATSPER2_ENST00000396879.1_Silent_p.Q9Q			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	9					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.Q9Q(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GAAGCTGCATCTGCTCTTCTT	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											244.0	246.0	245.0					15																	43940233		2199	4296	6495	-	-	-	SO:0001819	synonymous_variant	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.27G>A	15.37:g.43940233C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Silent	SNP	pfam_Ion_trans_dom	p.Q9	ENST00000321596.5	37	c.27	CCDS10099.1	15																																																																																			CATSPER2	-	NULL	ENSG00000166762		0.483	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	125	0.00	0	C	NM_054020		43940233	43940233	-1	no_errors	ENST00000299989	ensembl	human	known	69_37n	silent	18	33.33	9	SNP	0.010	T
CATSPER2	117155	genome.wustl.edu	37	15	43940233	43940233	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:43940233C>T	ENST00000321596.5	-	2	226	c.27G>A	c.(25-27)caG>caA	p.Q9Q	CATSPER2_ENST00000355438.2_Silent_p.Q9Q|CATSPER2_ENST00000354127.4_Silent_p.Q9Q|CATSPER2_ENST00000381761.1_Silent_p.Q15Q|STRC_ENST00000541030.1_Intron|CATSPER2_ENST00000464721.1_Intron|CATSPER2_ENST00000396879.1_Silent_p.Q9Q			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	9					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.Q9Q(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		GAAGCTGCATCTGCTCTTCTT	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											244.0	246.0	245.0					15																	43940233		2199	4296	6495	-	-	-	SO:0001819	synonymous_variant	0			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.27G>A	15.37:g.43940233C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHT9|Q96P54|Q96P55	Silent	SNP	pfam_Ion_trans_dom	p.Q9	ENST00000321596.5	37	c.27	CCDS10099.1	15																																																																																			CATSPER2	-	NULL	ENSG00000166762		0.483	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	125	0.00	0	C	NM_054020		43940233	43940233	-1	no_errors	ENST00000299989	ensembl	human	known	69_37n	silent	38	33.33	19	SNP	0.010	T
CCNB3	85417	genome.wustl.edu	37	X	50052923	50052923	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:50052923C>T	ENST00000376042.1	+	6	2052	c.1754C>T	c.(1753-1755)tCg>tTg	p.S585L	CCNB3_ENST00000276014.7_Missense_Mutation_p.S585L|CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	585					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.S585L(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					ACCAAGACATCGTTGTCTTTA	0.398																																						dbGAP											2	Substitution - Missense(2)	breast(2)											40.0	36.0	37.0					X																	50052923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.1754C>T	X.37:g.50052923C>T	ENSP00000365210:p.Ser585Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.S585L	ENST00000376042.1	37	c.1754	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	6.763	0.509742	0.12883	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.36699	1.24;1.24	3.88	3.02	0.34903	.	7.006940	0.00447	N	0.000094	T	0.15825	0.0381	N	0.01874	-0.695	0.09310	N	1	B	0.25850	0.136	B	0.14023	0.01	T	0.21415	-1.0246	9	.	.	.	.	6.5749	0.22560	0.0:0.8676:0.0:0.1324	.	585	Q8WWL7	CCNB3_HUMAN	L	585	ENSP00000365210:S585L;ENSP00000276014:S585L	.	S	+	2	0	CCNB3	50069663	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.117000	0.15583	1.014000	0.39417	-0.297000	0.09499	TCG	CCNB3	-	NULL	ENSG00000147082		0.398	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	79	0.00	0	C			50052923	50052923	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	48	14.29	8	SNP	0.001	T
CCNB3	85417	genome.wustl.edu	37	X	50052923	50052923	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:50052923C>T	ENST00000376042.1	+	6	2052	c.1754C>T	c.(1753-1755)tCg>tTg	p.S585L	CCNB3_ENST00000276014.7_Missense_Mutation_p.S585L|CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	585					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)		p.S585L(2)		breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					ACCAAGACATCGTTGTCTTTA	0.398																																						dbGAP											2	Substitution - Missense(2)	breast(2)											40.0	36.0	37.0					X																	50052923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.1754C>T	X.37:g.50052923C>T	ENSP00000365210:p.Ser585Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.S585L	ENST00000376042.1	37	c.1754	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	6.763	0.509742	0.12883	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.36699	1.24;1.24	3.88	3.02	0.34903	.	7.006940	0.00447	N	0.000094	T	0.15825	0.0381	N	0.01874	-0.695	0.09310	N	1	B	0.25850	0.136	B	0.14023	0.01	T	0.21415	-1.0246	9	.	.	.	.	6.5749	0.22560	0.0:0.8676:0.0:0.1324	.	585	Q8WWL7	CCNB3_HUMAN	L	585	ENSP00000365210:S585L;ENSP00000276014:S585L	.	S	+	2	0	CCNB3	50069663	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	0.117000	0.15583	1.014000	0.39417	-0.297000	0.09499	TCG	CCNB3	-	NULL	ENSG00000147082		0.398	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	79	0.00	0	C			50052923	50052923	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	77	17.20	16	SNP	0.001	T
CDCA4	55038	genome.wustl.edu	37	14	105478091	105478091	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:105478091G>A	ENST00000336219.3	-	2	331	c.176C>T	c.(175-177)tCa>tTa	p.S59L	CDCA4_ENST00000392590.3_Missense_Mutation_p.S59L	NM_017955.3	NP_060425.2	Q9BXL8	CDCA4_HUMAN	cell division cycle associated 4	59	SERTA. {ECO:0000255|PROSITE- ProRule:PRU00396}.					nucleus (GO:0005634)				endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	6		all_cancers(154;0.0798)|Melanoma(154;0.155)|all_epithelial(191;0.183)	OV - Ovarian serous cystadenocarcinoma(23;0.00778)|all cancers(16;0.00936)|Epithelial(46;0.0227)	Epithelial(152;0.142)		AATGAGGACTGAGCGGCACAG	0.622																																						dbGAP											0													64.0	49.0	54.0					14																	105478091		2203	4300	6503	-	-	-	SO:0001583	missense	0			BG354577	CCDS9996.1	14q32.33	2014-02-14			ENSG00000170779	ENSG00000170779			14625	protein-coding gene	gene with protein product	"""hematopoietic progenitor protein"""	612270				12188893	Standard	NM_145701		Approved	FLJ20764, Hepp	uc001yqb.2	Q9BXL8	OTTHUMG00000170767	ENST00000336219.3:c.176C>T	14.37:g.105478091G>A	ENSP00000337226:p.Ser59Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB18|Q9NWK7	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.S59L	ENST00000336219.3	37	c.176	CCDS9996.1	14	.	.	.	.	.	.	.	.	.	.	G	17.51	3.408088	0.62399	.	.	ENSG00000170779	ENST00000336219;ENST00000392590	T;T	0.40225	1.04;1.04	4.56	3.64	0.41730	.	0.067439	0.64402	N	0.000007	T	0.25306	0.0615	N	0.14661	0.345	0.58432	D	0.999997	P	0.34757	0.467	B	0.33620	0.167	T	0.03641	-1.1017	10	0.19590	T	0.45	-13.9814	13.8215	0.63322	0.0:0.1547:0.8453:0.0	.	59	Q9BXL8	CDCA4_HUMAN	L	59	ENSP00000337226:S59L;ENSP00000376369:S59L	ENSP00000337226:S59L	S	-	2	0	CDCA4	104549136	1.000000	0.71417	0.824000	0.32777	0.913000	0.54294	9.037000	0.93765	1.007000	0.39238	0.655000	0.94253	TCA	CDCA4	-	pfam_SERTA,pfscan_SERTA	ENSG00000170779		0.622	CDCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA4	HGNC	protein_coding	OTTHUMT00000410311.1	26	0.00	0	G	NM_145701		105478091	105478091	-1	no_errors	ENST00000336219	ensembl	human	known	69_37n	missense	7	30.00	3	SNP	0.990	A
CDH1	999	genome.wustl.edu	37	16	68844099	68844099	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:68844099G>A	ENST00000261769.5	+	6	878		c.e6-1		CDH1_ENST00000562836.1_Splice_Site|CDH1_ENST00000422392.2_Splice_Site	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(4)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GGTTCTTTCAGCTCTTCTCTC	0.527			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(4)	breast(4)											150.0	140.0	144.0					16																	68844099		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.688-1G>A	16.37:g.68844099G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Splice_Site	SNP	-	e6-1	ENST00000261769.5	37	c.688-1	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474826	0.84640	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5624	0.87910	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH1	67401600	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.125000	0.94402	2.510000	0.84645	0.557000	0.71058	.	CDH1	-	-	ENSG00000039068		0.527	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	75	0.00	0	G	NM_004360	Intron	68844099	68844099	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	splice_site	24	44.19	19	SNP	1.000	A
CDH1	999	genome.wustl.edu	37	16	68844099	68844099	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:68844099G>A	ENST00000261769.5	+	6	878		c.e6-1		CDH1_ENST00000562836.1_Splice_Site|CDH1_ENST00000422392.2_Splice_Site	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)						adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(4)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		GGTTCTTTCAGCTCTTCTCTC	0.527			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(4)	breast(4)											150.0	140.0	144.0					16																	68844099		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.688-1G>A	16.37:g.68844099G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Splice_Site	SNP	-	e6-1	ENST00000261769.5	37	c.688-1	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	23.9	4.474826	0.84640	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.5624	0.87910	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH1	67401600	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.125000	0.94402	2.510000	0.84645	0.557000	0.71058	.	CDH1	-	-	ENSG00000039068		0.527	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	75	0.00	0	G	NM_004360	Intron	68844099	68844099	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	splice_site	36	44.62	29	SNP	1.000	A
CDHR3	222256	genome.wustl.edu	37	7	105662855	105662855	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:105662855C>T	ENST00000317716.9	+	14	2117	c.2037C>T	c.(2035-2037)gtC>gtT	p.V679V	CDHR3_ENST00000542731.1_Silent_p.V679V|CDHR3_ENST00000478080.1_Silent_p.V591V|CDHR3_ENST00000343407.5_Intron|CDHR3_ENST00000470188.1_Intron	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	679	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V679V(2)		breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GTATTAAAGTCATTCCCCACC	0.483																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											220.0	206.0	211.0					7																	105662855		1977	4167	6144	-	-	-	SO:0001819	synonymous_variant	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2037C>T	7.37:g.105662855C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCI7	Missense_Mutation	SNP	superfamily_Cadherin-like,pfscan_Cadherin	p.S148L	ENST00000317716.9	37	c.443	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	C	5.637	0.302123	0.10678	.	.	ENSG00000128536	ENST00000468477	.	.	.	5.39	2.38	0.29361	.	.	.	.	.	T	0.47040	0.1424	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32348	-0.9910	4	.	.	.	-22.1427	4.2173	0.10540	0.0:0.4413:0.1764:0.3823	.	.	.	.	L	148	.	.	S	+	2	0	CDHR3	105450091	0.866000	0.29940	0.998000	0.56505	0.545000	0.35147	0.105000	0.15333	0.699000	0.31761	0.655000	0.94253	TCA	CDHR3	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000128536		0.483	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	103	0.00	0	C	NM_152750		105662855	105662855	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000468477	ensembl	human	novel	69_37n	missense	146	25.38	50	SNP	0.998	T
CDHR3	222256	genome.wustl.edu	37	7	105662855	105662855	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:105662855C>T	ENST00000317716.9	+	14	2117	c.2037C>T	c.(2035-2037)gtC>gtT	p.V679V	CDHR3_ENST00000542731.1_Silent_p.V679V|CDHR3_ENST00000478080.1_Silent_p.V591V|CDHR3_ENST00000343407.5_Intron|CDHR3_ENST00000470188.1_Intron	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	679	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.V679V(2)		breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						GTATTAAAGTCATTCCCCACC	0.483																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											220.0	206.0	211.0					7																	105662855		1977	4167	6144	-	-	-	SO:0001819	synonymous_variant	0			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2037C>T	7.37:g.105662855C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCI7	Missense_Mutation	SNP	superfamily_Cadherin-like,pfscan_Cadherin	p.S148L	ENST00000317716.9	37	c.443	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	C	5.637	0.302123	0.10678	.	.	ENSG00000128536	ENST00000468477	.	.	.	5.39	2.38	0.29361	.	.	.	.	.	T	0.47040	0.1424	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.32348	-0.9910	4	.	.	.	-22.1427	4.2173	0.10540	0.0:0.4413:0.1764:0.3823	.	.	.	.	L	148	.	.	S	+	2	0	CDHR3	105450091	0.866000	0.29940	0.998000	0.56505	0.545000	0.35147	0.105000	0.15333	0.699000	0.31761	0.655000	0.94253	TCA	CDHR3	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000128536		0.483	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	103	0.00	0	C	NM_152750		105662855	105662855	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000468477	ensembl	human	novel	69_37n	missense	93	25.40	32	SNP	0.998	T
CDON	50937	genome.wustl.edu	37	11	125871671	125871671	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:125871671C>G	ENST00000392693.3	-	11	2228	c.2101G>C	c.(2101-2103)Gag>Cag	p.E701Q	CDON_ENST00000531738.1_Missense_Mutation_p.E78Q|CDON_ENST00000263577.7_Missense_Mutation_p.E701Q	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	701					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E701Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTTGCAGCCTCTGAAACAACG	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	107.0	107.0					11																	125871671		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.2101G>C	11.37:g.125871671C>G	ENSP00000376458:p.Glu701Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O14631	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E701Q	ENST00000392693.3	37	c.2101	CCDS58192.1	11	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249873	0.80024	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.70164	-0.45;0.24;-0.46	5.78	5.78	0.91487	.	0.000000	0.53938	D	0.000047	T	0.72779	0.3503	L	0.29908	0.895	0.42438	D	0.992702	D;D;P	0.67145	0.996;0.995;0.895	P;P;P	0.61070	0.883;0.881;0.468	T	0.72849	-0.4168	10	0.51188	T	0.08	-31.1138	20.3668	0.98882	0.0:1.0:0.0:0.0	.	701;701;78	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	Q	701;78;701	ENSP00000376458:E701Q;ENSP00000432901:E78Q;ENSP00000263577:E701Q	ENSP00000263577:E701Q	E	-	1	0	CDON	125376881	0.999000	0.42202	0.523000	0.27875	0.960000	0.62799	5.409000	0.66374	2.894000	0.99253	0.655000	0.94253	GAG	CDON	-	NULL	ENSG00000064309		0.388	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	HGNC	protein_coding	OTTHUMT00000386749.2	326	0.00	0	C	NM_016952		125871671	125871671	-1	no_errors	ENST00000392693	ensembl	human	known	69_37n	missense	108	17.56	23	SNP	0.965	G
CDON	50937	genome.wustl.edu	37	11	125871671	125871671	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:125871671C>G	ENST00000392693.3	-	11	2228	c.2101G>C	c.(2101-2103)Gag>Cag	p.E701Q	CDON_ENST00000531738.1_Missense_Mutation_p.E78Q|CDON_ENST00000263577.7_Missense_Mutation_p.E701Q	NM_001243597.1|NM_016952.4	NP_001230526.1|NP_058648.4	Q4KMG0	CDON_HUMAN	cell adhesion associated, oncogene regulated	701					anterior/posterior pattern specification (GO:0009952)|cell adhesion (GO:0007155)|cell fate specification (GO:0001708)|cerebral cortex development (GO:0021987)|embryonic body morphogenesis (GO:0010172)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|lens development in camera-type eye (GO:0002088)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of skeletal muscle tissue development (GO:0048643)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of protein heterodimerization activity (GO:0043497)|skeletal muscle satellite cell differentiation (GO:0014816)|smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E701Q(1)		breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(9)|ovary(3)|prostate(2)|skin(4)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	61	all_hematologic(175;0.177)	Breast(109;0.00157)|Lung NSC(97;0.0127)|all_lung(97;0.0133)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.51e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0604)		TTTGCAGCCTCTGAAACAACG	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											107.0	107.0	107.0					11																	125871671		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF004841	CCDS8468.1, CCDS58192.1	11q24.2	2013-02-11	2012-12-07		ENSG00000064309	ENSG00000064309		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	17104	protein-coding gene	gene with protein product	"""cell adhesion molecule-related/down-regulated by oncogenes"""	608707	"""Cdon homolog (mouse)"""			9214393	Standard	NM_016952		Approved	ORCAM, CDO, CDON1	uc009zbw.3	Q4KMG0	OTTHUMG00000165862	ENST00000392693.3:c.2101G>C	11.37:g.125871671C>G	ENSP00000376458:p.Glu701Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O14631	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E701Q	ENST00000392693.3	37	c.2101	CCDS58192.1	11	.	.	.	.	.	.	.	.	.	.	C	22.1	4.249873	0.80024	.	.	ENSG00000064309	ENST00000392693;ENST00000531738;ENST00000263577	T;T;T	0.70164	-0.45;0.24;-0.46	5.78	5.78	0.91487	.	0.000000	0.53938	D	0.000047	T	0.72779	0.3503	L	0.29908	0.895	0.42438	D	0.992702	D;D;P	0.67145	0.996;0.995;0.895	P;P;P	0.61070	0.883;0.881;0.468	T	0.72849	-0.4168	10	0.51188	T	0.08	-31.1138	20.3668	0.98882	0.0:1.0:0.0:0.0	.	701;701;78	Q4KMG0;Q4KMG0-2;E9PN78	CDON_HUMAN;.;.	Q	701;78;701	ENSP00000376458:E701Q;ENSP00000432901:E78Q;ENSP00000263577:E701Q	ENSP00000263577:E701Q	E	-	1	0	CDON	125376881	0.999000	0.42202	0.523000	0.27875	0.960000	0.62799	5.409000	0.66374	2.894000	0.99253	0.655000	0.94253	GAG	CDON	-	NULL	ENSG00000064309		0.388	CDON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDON	HGNC	protein_coding	OTTHUMT00000386749.2	326	0.00	0	C	NM_016952		125871671	125871671	-1	no_errors	ENST00000392693	ensembl	human	known	69_37n	missense	159	18.88	37	SNP	0.965	G
CENPN	55839	genome.wustl.edu	37	16	81062223	81062223	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:81062223G>C	ENST00000305850.5	+	11	1777	c.987G>C	c.(985-987)aaG>aaC	p.K329N	CENPN_ENST00000428963.2_Missense_Mutation_p.K295N|CENPN_ENST00000393335.3_Intron|RP11-303E16.3_ENST00000561808.1_RNA|RP11-303E16.3_ENST00000566390.1_RNA|RP11-303E16.2_ENST00000566639.1_RNA|CENPN_ENST00000439957.3_Missense_Mutation_p.K309N	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	329					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K329N(1)		breast(1)|large_intestine(5)|lung(4)	10						TACCCAACAAGAGAATGAATT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					16																	81062223		1829	4099	5928	-	-	-	SO:0001583	missense	0			AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.987G>C	16.37:g.81062223G>C	ENSP00000305608:p.Lys329Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	pfam_CHL4	p.K295N	ENST00000305850.5	37	c.885	CCDS42200.1	16	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709417	0.48517	.	.	ENSG00000166451	ENST00000305850;ENST00000439957;ENST00000428963	T;T;T	0.22539	1.95;1.95;1.95	6.02	2.39	0.29439	.	.	.	.	.	T	0.40222	0.1108	M	0.70275	2.135	0.36254	D	0.854104	D;D;D	0.60575	0.978;0.988;0.983	D;D;D	0.69142	0.947;0.961;0.962	T	0.48833	-0.9000	9	0.62326	D	0.03	.	9.0471	0.36354	0.3736:0.0:0.6264:0.0	.	309;295;329	E7ETS3;E7ES30;Q96H22	.;.;CENPN_HUMAN	N	329;309;295	ENSP00000305608:K329N;ENSP00000395235:K309N;ENSP00000393991:K295N	ENSP00000305608:K329N	K	+	3	2	CENPN	79619724	1.000000	0.71417	0.018000	0.16275	0.562000	0.35680	1.793000	0.38764	0.776000	0.33473	0.655000	0.94253	AAG	CENPN	-	pfam_CHL4	ENSG00000166451		0.353	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CENPN	HGNC	protein_coding	OTTHUMT00000269051.1	78	0.00	0	G	NM_018455		81062223	81062223	+1	no_errors	ENST00000428963	ensembl	human	putative	69_37n	missense	115	23.33	35	SNP	0.615	C
CENPN	55839	genome.wustl.edu	37	16	81062223	81062223	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:81062223G>C	ENST00000305850.5	+	11	1777	c.987G>C	c.(985-987)aaG>aaC	p.K329N	CENPN_ENST00000428963.2_Missense_Mutation_p.K295N|CENPN_ENST00000393335.3_Intron|RP11-303E16.3_ENST00000561808.1_RNA|RP11-303E16.3_ENST00000566390.1_RNA|RP11-303E16.2_ENST00000566639.1_RNA|CENPN_ENST00000439957.3_Missense_Mutation_p.K309N	NM_001100624.2|NM_001270474.1	NP_001094094.2|NP_001257403.1	Q96H22	CENPN_HUMAN	centromere protein N	329					CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)		p.K329N(1)		breast(1)|large_intestine(5)|lung(4)	10						TACCCAACAAGAGAATGAATT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											63.0	65.0	64.0					16																	81062223		1829	4099	5928	-	-	-	SO:0001583	missense	0			AK026313	CCDS10931.1, CCDS42199.1, CCDS42200.1, CCDS58482.1, CCDS58483.1	16q23.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000166451	ENSG00000166451			30873	protein-coding gene	gene with protein product		611509	"""chromosome 16 open reading frame 60"""	C16orf60		16622419	Standard	NM_001100625		Approved	FLJ13607, FLJ22660, BM039	uc002ffy.4	Q96H22	OTTHUMG00000137628	ENST00000305850.5:c.987G>C	16.37:g.81062223G>C	ENSP00000305608:p.Lys329Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZE6|B3KN53|B4DJD1|B4DPY7|C9JJM5|D3DUK8|E7ES30|E7ETS3|Q9NZ83	Missense_Mutation	SNP	pfam_CHL4	p.K295N	ENST00000305850.5	37	c.885	CCDS42200.1	16	.	.	.	.	.	.	.	.	.	.	G	15.02	2.709417	0.48517	.	.	ENSG00000166451	ENST00000305850;ENST00000439957;ENST00000428963	T;T;T	0.22539	1.95;1.95;1.95	6.02	2.39	0.29439	.	.	.	.	.	T	0.40222	0.1108	M	0.70275	2.135	0.36254	D	0.854104	D;D;D	0.60575	0.978;0.988;0.983	D;D;D	0.69142	0.947;0.961;0.962	T	0.48833	-0.9000	9	0.62326	D	0.03	.	9.0471	0.36354	0.3736:0.0:0.6264:0.0	.	309;295;329	E7ETS3;E7ES30;Q96H22	.;.;CENPN_HUMAN	N	329;309;295	ENSP00000305608:K329N;ENSP00000395235:K309N;ENSP00000393991:K295N	ENSP00000305608:K329N	K	+	3	2	CENPN	79619724	1.000000	0.71417	0.018000	0.16275	0.562000	0.35680	1.793000	0.38764	0.776000	0.33473	0.655000	0.94253	AAG	CENPN	-	pfam_CHL4	ENSG00000166451		0.353	CENPN-001	NOVEL	basic|appris_principal|CCDS	protein_coding	CENPN	HGNC	protein_coding	OTTHUMT00000269051.1	78	0.00	0	G	NM_018455		81062223	81062223	+1	no_errors	ENST00000428963	ensembl	human	putative	69_37n	missense	66	25.84	23	SNP	0.615	C
CHD5	26038	genome.wustl.edu	37	1	6215763	6215763	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:6215763C>T	ENST00000262450.3	-	4	501	c.402G>A	c.(400-402)tcG>tcA	p.S134S	CHD5_ENST00000378021.1_5'UTR	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGAGCTGCCCCGAGGACTTGG	0.612																																						dbGAP											0													78.0	73.0	75.0					1																	6215763		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.402G>A	1.37:g.6215763C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.S134	ENST00000262450.3	37	c.402	CCDS57.1	1																																																																																			CHD5	-	NULL	ENSG00000116254		0.612	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	83	0.00	0	C	NM_015557		6215763	6215763	-1	no_errors	ENST00000262450	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.414	T
CHD1L	9557	genome.wustl.edu	37	1	146759364	146759364	+	Nonsense_Mutation	SNP	C	C	T	rs190301424		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:146759364C>T	ENST00000369258.4	+	19	2292	c.2272C>T	c.(2272-2274)Cga>Tga	p.R758*	CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_Nonsense_Mutation_p.R477*|CHD1L_ENST00000431239.1_Nonsense_Mutation_p.R664*|CHD1L_ENST00000369259.3_Nonsense_Mutation_p.R554*	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	758	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.R758*(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TCTGGAAAAGCGATCCGCTGA	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		18623	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Nonsense(1)	breast(1)											65.0	67.0	67.0					1																	146759364		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2272C>T	1.37:g.146759364C>T	ENSP00000358262:p.Arg758*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R758*	ENST00000369258.4	37	c.2272	CCDS927.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	36	5.722685	0.96847	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	.	.	.	5.52	4.6	0.57074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5084	0.50481	0.189:0.811:0.0:0.0	.	.	.	.	X	664;554;758;477	.	ENSP00000355100:R477X	R	+	1	2	CHD1L	145225988	0.977000	0.34250	0.883000	0.34634	0.622000	0.37654	2.434000	0.44802	1.304000	0.44892	0.561000	0.74099	CGA	CHD1L	-	pfscan_A1pp	ENSG00000131778		0.443	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	124	0.80	1	C	NM_004284		146759364	146759364	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	nonsense	183	18.30	41	SNP	0.948	T
CHD1L	9557	genome.wustl.edu	37	1	146759364	146759364	+	Nonsense_Mutation	SNP	C	C	T	rs190301424		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:146759364C>T	ENST00000369258.4	+	19	2292	c.2272C>T	c.(2272-2274)Cga>Tga	p.R758*	CHD1L_ENST00000467213.1_3'UTR|CHD1L_ENST00000361293.5_Nonsense_Mutation_p.R477*|CHD1L_ENST00000431239.1_Nonsense_Mutation_p.R664*|CHD1L_ENST00000369259.3_Nonsense_Mutation_p.R554*	NM_001256336.1|NM_004284.4|NM_024568.2	NP_001243265.1|NP_004275.4|NP_078844.2	Q86WJ1	CHD1L_HUMAN	chromodomain helicase DNA binding protein 1-like	758	Macro. {ECO:0000255|PROSITE- ProRule:PRU00490}.				ATP catabolic process (GO:0006200)|cellular response to DNA damage stimulus (GO:0006974)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA repair (GO:0006281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|nucleotide binding (GO:0000166)	p.R758*(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	33	all_hematologic(923;0.0487)					TCTGGAAAAGCGATCCGCTGA	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		18623	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Nonsense(1)	breast(1)											65.0	67.0	67.0					1																	146759364		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF054177	CCDS927.1, CCDS58021.1, CCDS58022.1, CCDS72882.1	1q21.1	2008-02-05			ENSG00000131778	ENSG00000131778			1916	protein-coding gene	gene with protein product		613039				9653160	Standard	NM_004284		Approved	ALC1	uc001epm.5	Q86WJ1	OTTHUMG00000150271	ENST00000369258.4:c.2272C>T	1.37:g.146759364C>T	ENSP00000358262:p.Arg758*	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM64|B4DDE1|B5MDZ7|Q53EZ3|Q5VXX7|Q6DD94|Q6PK83|Q86XH3|Q96HF7|Q96SP3|Q9BVJ1|Q9NVV8	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_A1pp,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.R758*	ENST00000369258.4	37	c.2272	CCDS927.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	36	5.722685	0.96847	.	.	ENSG00000131778	ENST00000431239;ENST00000369259;ENST00000369258;ENST00000361293	.	.	.	5.52	4.6	0.57074	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.5084	0.50481	0.189:0.811:0.0:0.0	.	.	.	.	X	664;554;758;477	.	ENSP00000355100:R477X	R	+	1	2	CHD1L	145225988	0.977000	0.34250	0.883000	0.34634	0.622000	0.37654	2.434000	0.44802	1.304000	0.44892	0.561000	0.74099	CGA	CHD1L	-	pfscan_A1pp	ENSG00000131778		0.443	CHD1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD1L	HGNC	protein_coding	OTTHUMT00000040377.1	124	0.80	1	C	NM_004284		146759364	146759364	+1	no_errors	ENST00000369258	ensembl	human	known	69_37n	nonsense	296	18.68	68	SNP	0.948	T
CFH	3075	genome.wustl.edu	37	1	196695948	196695948	+	Missense_Mutation	SNP	C	C	T	rs548410144		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:196695948C>T	ENST00000367429.4	+	14	2354	c.2114C>T	c.(2113-2115)tCt>tTt	p.S705F		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	705	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.S705F(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GCCCAGCTTTCTTCCCCTCCT	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		14714	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	115.0	115.0					1																	196695948		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2114C>T	1.37:g.196695948C>T	ENSP00000356399:p.Ser705Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S705F	ENST00000367429.4	37	c.2114	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103070	0.76983	.	.	ENSG00000000971	ENST00000367429	T	0.65364	-0.15	5.8	5.8	0.92144	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.77658	0.4163	M	0.70787	2.145	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.77608	-0.2524	9	0.51188	T	0.08	.	15.5488	0.76129	0.0:1.0:0.0:0.0	.	705	P08603	CFAH_HUMAN	F	705	ENSP00000356399:S705F	ENSP00000356399:S705F	S	+	2	0	CFH	194962571	0.000000	0.05858	0.124000	0.21820	0.423000	0.31445	0.384000	0.20668	2.742000	0.94016	0.655000	0.94253	TCT	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.378	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	127	0.00	0	C	NM_000186		196695948	196695948	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	missense	127	15.89	24	SNP	0.256	T
CFH	3075	genome.wustl.edu	37	1	196695948	196695948	+	Missense_Mutation	SNP	C	C	T	rs548410144		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:196695948C>T	ENST00000367429.4	+	14	2354	c.2114C>T	c.(2113-2115)tCt>tTt	p.S705F		NM_000186.3	NP_000177.2	P08603	CFAH_HUMAN	complement factor H	705	Sushi 12. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)	p.S705F(1)		NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						GCCCAGCTTTCTTCCCCTCCT	0.378													C|||	1	0.000199681	0.0	0.0	5008	,	,		14714	0.001		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	115.0	115.0					1																	196695948		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000367429.4:c.2114C>T	1.37:g.196695948C>T	ENSP00000356399:p.Ser705Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.S705F	ENST00000367429.4	37	c.2114	CCDS1385.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.103070	0.76983	.	.	ENSG00000000971	ENST00000367429	T	0.65364	-0.15	5.8	5.8	0.92144	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.77658	0.4163	M	0.70787	2.145	0.80722	D	1	D	0.89917	1.0	D	0.75020	0.985	T	0.77608	-0.2524	9	0.51188	T	0.08	.	15.5488	0.76129	0.0:1.0:0.0:0.0	.	705	P08603	CFAH_HUMAN	F	705	ENSP00000356399:S705F	ENSP00000356399:S705F	S	+	2	0	CFH	194962571	0.000000	0.05858	0.124000	0.21820	0.423000	0.31445	0.384000	0.20668	2.742000	0.94016	0.655000	0.94253	TCT	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.378	CFH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000086412.2	127	0.00	0	C	NM_000186		196695948	196695948	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	missense	210	15.32	38	SNP	0.256	T
CHRNA9	55584	genome.wustl.edu	37	4	40351124	40351124	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:40351124C>T	ENST00000310169.2	+	4	730	c.591C>T	c.(589-591)ttC>ttT	p.F197F		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	197					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)	p.F197F(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	TCTCTGACTTCATTGAAGATG	0.512																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)	dbGAP											1	Substitution - coding silent(1)	breast(1)											224.0	195.0	205.0					4																	40351124		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.591C>T	4.37:g.40351124C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CY7|Q4W5A2|Q9NYV2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F197	ENST00000310169.2	37	c.591	CCDS3459.1	4																																																																																			CHRNA9	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000174343		0.512	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA9	HGNC	protein_coding	OTTHUMT00000216822.1	140	0.00	0	C			40351124	40351124	+1	no_errors	ENST00000310169	ensembl	human	known	69_37n	silent	57	25.00	19	SNP	1.000	T
CHRNA9	55584	genome.wustl.edu	37	4	40351124	40351124	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:40351124C>T	ENST00000310169.2	+	4	730	c.591C>T	c.(589-591)ttC>ttT	p.F197F		NM_017581.3	NP_060051.2	Q9UGM1	ACHA9_HUMAN	cholinergic receptor, nicotinic, alpha 9 (neuronal)	197					detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|inner ear morphogenesis (GO:0042472)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine-activated cation-selective channel activity (GO:0004889)|calcium channel activity (GO:0005262)	p.F197F(1)		breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(4)|stomach(1)	33					Galantamine(DB00674)|Nicotine(DB00184)	TCTCTGACTTCATTGAAGATG	0.512																																					Esophageal Squamous(115;1297 1602 22235 25158 43327)	dbGAP											1	Substitution - coding silent(1)	breast(1)											224.0	195.0	205.0					4																	40351124		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227732	CCDS3459.1	4p14	2012-02-11	2012-02-07		ENSG00000174343	ENSG00000174343		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	14079	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 9 (neuronal)"""	605116	"""cholinergic receptor, nicotinic, alpha polypeptide 9"""				Standard	NM_017581		Approved	NACHRA9	uc003gva.2	Q9UGM1	OTTHUMG00000099375	ENST00000310169.2:c.591C>T	4.37:g.40351124C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CY7|Q4W5A2|Q9NYV2	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F197	ENST00000310169.2	37	c.591	CCDS3459.1	4																																																																																			CHRNA9	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000174343		0.512	CHRNA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA9	HGNC	protein_coding	OTTHUMT00000216822.1	140	0.00	0	C			40351124	40351124	+1	no_errors	ENST00000310169	ensembl	human	known	69_37n	silent	76	28.30	30	SNP	1.000	T
CNNM2	54805	genome.wustl.edu	37	10	104836880	104836880	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:104836880G>A	ENST00000369878.4	+	8	2759	c.2571G>A	c.(2569-2571)caG>caA	p.Q857Q	CNNM2_ENST00000433628.2_Silent_p.Q835Q	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	857					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.Q857Q(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCAACGAACAGAACTGTGTGA	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											90.0	97.0	95.0					10																	104836880		2135	4235	6370	-	-	-	SO:0001819	synonymous_variant	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2571G>A	10.37:g.104836880G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.Q858	ENST00000369878.4	37	c.2574	CCDS44474.1	10																																																																																			CNNM2	-	NULL	ENSG00000148842		0.597	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	59	0.00	0	G	NM_017649		104836880	104836880	+1	no_errors	ENST00000457502	ensembl	human	known	69_37n	silent	23	28.12	9	SNP	1.000	A
CNNM2	54805	genome.wustl.edu	37	10	104836880	104836880	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:104836880G>A	ENST00000369878.4	+	8	2759	c.2571G>A	c.(2569-2571)caG>caA	p.Q857Q	CNNM2_ENST00000433628.2_Silent_p.Q835Q	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	857					magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)	p.Q857Q(1)		central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		TCAACGAACAGAACTGTGTGA	0.597																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											90.0	97.0	95.0					10																	104836880		2135	4235	6370	-	-	-	SO:0001819	synonymous_variant	0			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.2571G>A	10.37:g.104836880G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Silent	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.Q858	ENST00000369878.4	37	c.2574	CCDS44474.1	10																																																																																			CNNM2	-	NULL	ENSG00000148842		0.597	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	59	0.00	0	G	NM_017649		104836880	104836880	+1	no_errors	ENST00000457502	ensembl	human	known	69_37n	silent	40	20.00	10	SNP	1.000	A
CREB3L1	90993	genome.wustl.edu	37	11	46334219	46334219	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:46334219G>C	ENST00000529193.1	+	7	1411	c.960G>C	c.(958-960)aaG>aaC	p.K320N	CREB3L1_ENST00000288400.3_Missense_Mutation_p.K320N			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	320	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.K320N(1)	FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GTCTAGAAAAGAAGTAAGGGG	0.597			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)	dbGAP		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	1	Substitution - Missense(1)	breast(1)											35.0	36.0	36.0					11																	46334219		1908	4114	6022	-	-	-	SO:0001583	missense	0				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.960G>C	11.37:g.46334219G>C	ENSP00000434939:p.Lys320Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2D5|Q96CP0	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	p.K320N	ENST00000529193.1	37	c.960	CCDS53620.1	11	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496673	0.26861	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415;ENST00000530518	T;T;T	0.54071	0.59;0.59;0.59	4.69	3.78	0.43462	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.048161	0.85682	D	0.000000	T	0.59702	0.2213	L	0.45228	1.405	0.45747	D	0.998641	D	0.89917	1.0	D	0.87578	0.998	T	0.56595	-0.7953	10	0.36615	T	0.2	-22.0573	7.8289	0.29332	0.2379:0.0:0.7621:0.0	.	320	Q96BA8	CR3L1_HUMAN	N	320;320;232;80	ENSP00000434939:K320N;ENSP00000288400:K320N;ENSP00000436574:K80N	ENSP00000288400:K320N	K	+	3	2	CREB3L1	46290795	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	1.408000	0.34668	1.208000	0.43306	-0.379000	0.06801	AAG	CREB3L1	-	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	ENSG00000157613		0.597	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CREB3L1	HGNC	protein_coding	OTTHUMT00000389702.1	84	0.00	0	G	NM_052854		46334219	46334219	+1	no_errors	ENST00000288400	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	1.000	C
CREB3L1	90993	genome.wustl.edu	37	11	46334219	46334219	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:46334219G>C	ENST00000529193.1	+	7	1411	c.960G>C	c.(958-960)aaG>aaC	p.K320N	CREB3L1_ENST00000288400.3_Missense_Mutation_p.K320N			Q96BA8	CR3L1_HUMAN	cAMP responsive element binding protein 3-like 1	320	Basic motif. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				regulation of bone mineralization (GO:0030500)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)	p.K320N(1)	FUS/CREB3L1(6)	NS(2)|breast(1)|large_intestine(4)|lung(2)|ovary(3)	12				GBM - Glioblastoma multiforme(35;0.0285)		GTCTAGAAAAGAAGTAAGGGG	0.597			T	FUS	myxofibrosarcoma																																Pancreas(3;159 194 19597 26278 47995)	dbGAP		Dom	yes		11	11p11.2	90993	cAMP responsive element binding protein 3-like 1		M	1	Substitution - Missense(1)	breast(1)											35.0	36.0	36.0					11																	46334219		1908	4114	6022	-	-	-	SO:0001583	missense	0				CCDS53620.1	11q11	2013-01-10				ENSG00000157613		"""basic leucine zipper proteins"""	18856	protein-coding gene	gene with protein product	"""BBF-2 homolog (drosophila)"""						Standard	NM_052854		Approved	OASIS	uc021qil.1	Q96BA8		ENST00000529193.1:c.960G>C	11.37:g.46334219G>C	ENSP00000434939:p.Lys320Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2D5|Q96CP0	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	p.K320N	ENST00000529193.1	37	c.960	CCDS53620.1	11	.	.	.	.	.	.	.	.	.	.	G	10.95	1.496673	0.26861	.	.	ENSG00000157613	ENST00000529193;ENST00000288400;ENST00000446415;ENST00000530518	T;T;T	0.54071	0.59;0.59;0.59	4.69	3.78	0.43462	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.048161	0.85682	D	0.000000	T	0.59702	0.2213	L	0.45228	1.405	0.45747	D	0.998641	D	0.89917	1.0	D	0.87578	0.998	T	0.56595	-0.7953	10	0.36615	T	0.2	-22.0573	7.8289	0.29332	0.2379:0.0:0.7621:0.0	.	320	Q96BA8	CR3L1_HUMAN	N	320;320;232;80	ENSP00000434939:K320N;ENSP00000288400:K320N;ENSP00000436574:K80N	ENSP00000288400:K320N	K	+	3	2	CREB3L1	46290795	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	1.408000	0.34668	1.208000	0.43306	-0.379000	0.06801	AAG	CREB3L1	-	pfam_bZIP_1,pfam_bZIP_2,smart_bZIP,pfscan_bZIP,prints_Leuzip_CREB	ENSG00000157613		0.597	CREB3L1-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	CREB3L1	HGNC	protein_coding	OTTHUMT00000389702.1	84	0.00	0	G	NM_052854		46334219	46334219	+1	no_errors	ENST00000288400	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	1.000	C
CSF2RB	1439	genome.wustl.edu	37	22	37334464	37334464	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr22:37334464C>A	ENST00000403662.3	+	14	2836	c.2614C>A	c.(2614-2616)Cag>Aag	p.Q872K	CSF2RB_ENST00000406230.1_Missense_Mutation_p.Q878K|CSF2RB_ENST00000536485.1_Missense_Mutation_p.Q819K|CSF2RB_ENST00000262825.5_Missense_Mutation_p.Q878K			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	872					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.Q872K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GCCCGTCATTCAGCTCTTCAA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	77.0	74.0					22																	37334464		2203	4300	6503	-	-	-	SO:0001583	missense	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2614C>A	22.37:g.37334464C>A	ENSP00000384053:p.Gln872Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q878K	ENST00000403662.3	37	c.2632	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890490	0.33348	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.95171	-3.09;-3.62;-3.62;-3.63	5.01	5.01	0.66863	.	0.920206	0.08966	N	0.868005	D	0.92645	0.7663	L	0.52573	1.65	0.31439	N	0.672177	P;P	0.51537	0.946;0.91	B;B	0.41271	0.352;0.192	D	0.90372	0.4381	10	0.54805	T	0.06	-15.4755	13.6914	0.62549	0.0:1.0:0.0:0.0	.	878;872	P32927-2;P32927	.;IL3RB_HUMAN	K	872;872;878;878;819	ENSP00000384053:Q872K;ENSP00000262825:Q878K;ENSP00000385271:Q878K;ENSP00000440003:Q819K	ENSP00000262825:Q878K	Q	+	1	0	CSF2RB	35664410	0.999000	0.42202	0.988000	0.46212	0.036000	0.12997	1.579000	0.36536	2.592000	0.87571	0.650000	0.86243	CAG	CSF2RB	-	pirsf_IL3_rcpt_beta	ENSG00000100368		0.602	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	61	0.00	0	C	NM_000395		37334464	37334464	+1	no_errors	ENST00000262825	ensembl	human	known	69_37n	missense	16	33.33	8	SNP	0.998	A
CSF2RB	1439	genome.wustl.edu	37	22	37334464	37334464	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr22:37334464C>A	ENST00000403662.3	+	14	2836	c.2614C>A	c.(2614-2616)Cag>Aag	p.Q872K	CSF2RB_ENST00000406230.1_Missense_Mutation_p.Q878K|CSF2RB_ENST00000536485.1_Missense_Mutation_p.Q819K|CSF2RB_ENST00000262825.5_Missense_Mutation_p.Q878K			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	872					cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)	p.Q872K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	GCCCGTCATTCAGCTCTTCAA	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	77.0	74.0					22																	37334464		2203	4300	6503	-	-	-	SO:0001583	missense	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.2614C>A	22.37:g.37334464C>A	ENSP00000384053:p.Gln872Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZI1|Q6ICE0	Missense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.Q878K	ENST00000403662.3	37	c.2632	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	C	12.28	1.890490	0.33348	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000536485	D;D;D;D	0.95171	-3.09;-3.62;-3.62;-3.63	5.01	5.01	0.66863	.	0.920206	0.08966	N	0.868005	D	0.92645	0.7663	L	0.52573	1.65	0.31439	N	0.672177	P;P	0.51537	0.946;0.91	B;B	0.41271	0.352;0.192	D	0.90372	0.4381	10	0.54805	T	0.06	-15.4755	13.6914	0.62549	0.0:1.0:0.0:0.0	.	878;872	P32927-2;P32927	.;IL3RB_HUMAN	K	872;872;878;878;819	ENSP00000384053:Q872K;ENSP00000262825:Q878K;ENSP00000385271:Q878K;ENSP00000440003:Q819K	ENSP00000262825:Q878K	Q	+	1	0	CSF2RB	35664410	0.999000	0.42202	0.988000	0.46212	0.036000	0.12997	1.579000	0.36536	2.592000	0.87571	0.650000	0.86243	CAG	CSF2RB	-	pirsf_IL3_rcpt_beta	ENSG00000100368		0.602	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	61	0.00	0	C	NM_000395		37334464	37334464	+1	no_errors	ENST00000262825	ensembl	human	known	69_37n	missense	7	41.67	5	SNP	0.998	A
CSTF3	1479	genome.wustl.edu	37	11	33107491	33107491	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:33107491G>A	ENST00000323959.4	-	19	1979	c.1840C>T	c.(1840-1842)Cct>Tct	p.P614S	TCP11L1_ENST00000324357.9_Intron	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	614	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P614S(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						ACAGCTGCAGGAGGGACTGGG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	67.0	68.0					11																	33107491		2202	4298	6500	-	-	-	SO:0001583	missense	0			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.1840C>T	11.37:g.33107491G>A	ENSP00000315791:p.Pro614Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	pfam_Suf,smart_HAT	p.P614S	ENST00000323959.4	37	c.1840	CCDS7883.1	11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084175	0.76642	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	.	.	.	6.17	6.17	0.99709	Suppressor of forked (1);	0.000000	0.85682	D	0.000000	T	0.76154	0.3948	M	0.71036	2.16	0.80722	D	1	B	0.31227	0.314	B	0.43360	0.417	T	0.69483	-0.5133	8	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	614	Q12996	CSTF3_HUMAN	S	614;547	.	.	P	-	1	0	CSTF3	33064067	1.000000	0.71417	0.974000	0.42286	0.897000	0.52465	9.675000	0.98638	2.941000	0.99782	0.655000	0.94253	CCT	CSTF3	-	pfam_Suf	ENSG00000176102		0.433	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF3	HGNC	protein_coding	OTTHUMT00000388801.1	164	0.00	0	G	NM_001326		33107491	33107491	-1	no_errors	ENST00000323959	ensembl	human	known	69_37n	missense	145	24.08	46	SNP	1.000	A
CSTF3	1479	genome.wustl.edu	37	11	33107491	33107491	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:33107491G>A	ENST00000323959.4	-	19	1979	c.1840C>T	c.(1840-1842)Cct>Tct	p.P614S	TCP11L1_ENST00000324357.9_Intron	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	614	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.P614S(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						ACAGCTGCAGGAGGGACTGGG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											69.0	67.0	68.0					11																	33107491		2202	4298	6500	-	-	-	SO:0001583	missense	0			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.1840C>T	11.37:g.33107491G>A	ENSP00000315791:p.Pro614Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	pfam_Suf,smart_HAT	p.P614S	ENST00000323959.4	37	c.1840	CCDS7883.1	11	.	.	.	.	.	.	.	.	.	.	G	21.0	4.084175	0.76642	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	.	.	.	6.17	6.17	0.99709	Suppressor of forked (1);	0.000000	0.85682	D	0.000000	T	0.76154	0.3948	M	0.71036	2.16	0.80722	D	1	B	0.31227	0.314	B	0.43360	0.417	T	0.69483	-0.5133	8	.	.	.	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	614	Q12996	CSTF3_HUMAN	S	614;547	.	.	P	-	1	0	CSTF3	33064067	1.000000	0.71417	0.974000	0.42286	0.897000	0.52465	9.675000	0.98638	2.941000	0.99782	0.655000	0.94253	CCT	CSTF3	-	pfam_Suf	ENSG00000176102		0.433	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF3	HGNC	protein_coding	OTTHUMT00000388801.1	164	0.00	0	G	NM_001326		33107491	33107491	-1	no_errors	ENST00000323959	ensembl	human	known	69_37n	missense	86	26.50	31	SNP	1.000	A
CTDSPL	10217	genome.wustl.edu	37	3	38006086	38006086	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:38006086G>A	ENST00000273179.5	+	4	318	c.292G>A	c.(292-294)Gag>Aag	p.E98K	CTDSPL_ENST00000310189.3_3'UTR|CTDSPL_ENST00000443503.2_Missense_Mutation_p.E87K	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	98						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.E98K(1)		breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		CCTTCTTCCAGAGGTGACGGT	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	115.0	117.0					3																	38006086		2203	4300	6503	-	-	-	SO:0001583	missense	0			D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.292G>A	3.37:g.38006086G>A	ENSP00000273179:p.Glu98Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.E98K	ENST00000273179.5	37	c.292	CCDS33734.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.069307|4.069307	0.76301|0.76301	.|.	.|.	ENSG00000144677|ENSG00000144677	ENST00000443503;ENST00000273179|ENST00000416688	T;T|.	0.16597|.	2.33;2.33|.	4.96|4.96	4.96|4.96	0.65561|0.65561	HAD-like domain (2);|.	0.091153|.	0.85682|.	D|.	0.000000|.	T|T	0.78278|0.78278	0.4258|0.4258	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	B;B|.	0.28233|.	0.134;0.204|.	B;B|.	0.34873|.	0.191;0.093|.	T|T	0.79313|0.79313	-0.1855|-0.1855	10|5	0.41790|.	T|.	0.15|.	-4.696|-4.696	17.8521|17.8521	0.88750|0.88750	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	87;98|.	O15194-2;O15194|.	.;CTDSL_HUMAN|.	K|K	87;98|6	ENSP00000398288:E87K;ENSP00000273179:E98K|.	ENSP00000273179:E98K|.	E|R	+|+	1|2	0|0	CTDSPL|CTDSPL	37981090|37981090	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	7.371000|7.371000	0.79600|0.79600	2.693000|2.693000	0.91896|0.91896	0.563000|0.563000	0.77884|0.77884	GAG|AGA	CTDSPL	-	superfamily_HAD-like_dom	ENSG00000144677		0.333	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL	HGNC	protein_coding	OTTHUMT00000342392.1	146	0.00	0	G	NM_005808		38006086	38006086	+1	no_errors	ENST00000273179	ensembl	human	known	69_37n	missense	127	23.49	39	SNP	1.000	A
CTDSPL	10217	genome.wustl.edu	37	3	38006086	38006086	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:38006086G>A	ENST00000273179.5	+	4	318	c.292G>A	c.(292-294)Gag>Aag	p.E98K	CTDSPL_ENST00000310189.3_3'UTR|CTDSPL_ENST00000443503.2_Missense_Mutation_p.E87K	NM_001008392.1	NP_001008393.1	O15194	CTDSL_HUMAN	CTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase-like	98						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)	p.E98K(1)		breast(1)|endometrium(2)|large_intestine(4)|skin(1)	8		Melanoma(1037;0.0122)		KIRC - Kidney renal clear cell carcinoma(284;0.0729)|Kidney(284;0.0902)		CCTTCTTCCAGAGGTGACGGT	0.333																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	115.0	117.0					3																	38006086		2203	4300	6503	-	-	-	SO:0001583	missense	0			D88153	CCDS33734.1, CCDS33735.1	3p21.3	2010-06-21	2003-10-27	2003-10-29	ENSG00000144677	ENSG00000144677	3.1.3.16	"""Serine/threonine phosphatases / CTD aspartate-based phosphatases"""	16890	protein-coding gene	gene with protein product	"""small CTD phosphatase 3"", ""HYA22 protein"", ""RB protein serine phosphatase from chromosome 3"""	608592	"""chromosome 3 open reading frame 8"""	C3orf8		9179494, 12543795	Standard	NM_005808		Approved	HYA22, SCP3, PSR1, RBSP3	uc003chg.3	O15194	OTTHUMG00000155942	ENST00000273179.5:c.292G>A	3.37:g.38006086G>A	ENSP00000273179:p.Glu98Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZTU0|Q70KI4|Q7Z5Q2	Missense_Mutation	SNP	pfam_NIF,superfamily_HAD-like_dom,smart_NIF,pfscan_NIF,tigrfam_Dullard_phosphatase	p.E98K	ENST00000273179.5	37	c.292	CCDS33734.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.069307|4.069307	0.76301|0.76301	.|.	.|.	ENSG00000144677|ENSG00000144677	ENST00000443503;ENST00000273179|ENST00000416688	T;T|.	0.16597|.	2.33;2.33|.	4.96|4.96	4.96|4.96	0.65561|0.65561	HAD-like domain (2);|.	0.091153|.	0.85682|.	D|.	0.000000|.	T|T	0.78278|0.78278	0.4258|0.4258	M|M	0.82056|0.82056	2.57|2.57	0.80722|0.80722	D|D	1|1	B;B|.	0.28233|.	0.134;0.204|.	B;B|.	0.34873|.	0.191;0.093|.	T|T	0.79313|0.79313	-0.1855|-0.1855	10|5	0.41790|.	T|.	0.15|.	-4.696|-4.696	17.8521|17.8521	0.88750|0.88750	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	87;98|.	O15194-2;O15194|.	.;CTDSL_HUMAN|.	K|K	87;98|6	ENSP00000398288:E87K;ENSP00000273179:E98K|.	ENSP00000273179:E98K|.	E|R	+|+	1|2	0|0	CTDSPL|CTDSPL	37981090|37981090	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	7.371000|7.371000	0.79600|0.79600	2.693000|2.693000	0.91896|0.91896	0.563000|0.563000	0.77884|0.77884	GAG|AGA	CTDSPL	-	superfamily_HAD-like_dom	ENSG00000144677		0.333	CTDSPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTDSPL	HGNC	protein_coding	OTTHUMT00000342392.1	146	0.00	0	G	NM_005808		38006086	38006086	+1	no_errors	ENST00000273179	ensembl	human	known	69_37n	missense	208	22.68	61	SNP	1.000	A
CYP2C18	1562	genome.wustl.edu	37	10	96447986	96447986	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:96447986C>T	ENST00000285979.6	+	3	635	c.436C>T	c.(436-438)Caa>Taa	p.Q146*	CYP2C19_ENST00000464755.1_3'UTR|CYP2C18_ENST00000339022.5_Nonsense_Mutation_p.Q146*	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	146					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.Q146*(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GGACCGTGTTCAAGAGGAAGC	0.433																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											120.0	116.0	117.0					10																	96447986		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.436C>T	10.37:g.96447986C>T	ENSP00000285979:p.Gln146*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.Q146*	ENST00000285979.6	37	c.436	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	c	32	5.136250	0.94517	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	.	.	.	4.63	3.72	0.42706	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.1567	0.42827	0.3626:0.6374:0.0:0.0	.	.	.	.	X	146	.	ENSP00000285979:Q146X	Q	+	1	0	CYP2C18	96437976	0.000000	0.05858	0.762000	0.31397	0.103000	0.19146	0.583000	0.23849	0.941000	0.37499	-0.687000	0.03738	CAA	CYP2C18	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000108242		0.433	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	281	0.00	0	C	NM_000772		96447986	96447986	+1	no_errors	ENST00000285979	ensembl	human	known	69_37n	nonsense	226	11.37	29	SNP	0.118	T
CYP2C18	1562	genome.wustl.edu	37	10	96447986	96447986	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:96447986C>T	ENST00000285979.6	+	3	635	c.436C>T	c.(436-438)Caa>Taa	p.Q146*	CYP2C19_ENST00000464755.1_3'UTR|CYP2C18_ENST00000339022.5_Nonsense_Mutation_p.Q146*	NM_000772.2	NP_000763.1	P33260	CP2CI_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 18	146					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxygen binding (GO:0019825)	p.Q146*(1)		NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	26		Colorectal(252;0.09)		all cancers(201;2.8e-06)|KIRC - Kidney renal clear cell carcinoma(50;0.0646)|Kidney(138;0.0805)	Aminophenazone(DB01424)|Antipyrine(DB01435)|Buprenorphine(DB00921)|Clobazam(DB00349)|Clotiazepam(DB01559)|Cyclophosphamide(DB00531)|Dapsone(DB00250)|Desipramine(DB01151)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Ifosfamide(DB01181)|Imipramine(DB00458)|Lansoprazole(DB00448)|Lidocaine(DB00281)|Methadone(DB00333)|Omeprazole(DB00338)|Pegvisomant(DB00082)|Perphenazine(DB00850)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Propofol(DB00818)|Tolbutamide(DB01124)|Tretinoin(DB00755)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vilazodone(DB06684)|Warfarin(DB00682)	GGACCGTGTTCAAGAGGAAGC	0.433																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											120.0	116.0	117.0					10																	96447986		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M61853	CCDS7435.1, CCDS44460.1	10q24	2003-11-12	2003-01-14		ENSG00000108242	ENSG00000108242		"""Cytochrome P450s"""	2620	protein-coding gene	gene with protein product		601131	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 18"""	CYP2C17		1896026, 2009263	Standard	NM_000772		Approved	P450IIC17, CPCI, CYP2C		P33260	OTTHUMG00000018796	ENST00000285979.6:c.436C>T	10.37:g.96447986C>T	ENSP00000285979:p.Gln146*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8K2|Q16703|Q16751|Q4VAT5|Q6GRG1	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.Q146*	ENST00000285979.6	37	c.436	CCDS7435.1	10	.	.	.	.	.	.	.	.	.	.	c	32	5.136250	0.94517	.	.	ENSG00000108242	ENST00000339022;ENST00000285979	.	.	.	4.63	3.72	0.42706	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	.	10.1567	0.42827	0.3626:0.6374:0.0:0.0	.	.	.	.	X	146	.	ENSP00000285979:Q146X	Q	+	1	0	CYP2C18	96437976	0.000000	0.05858	0.762000	0.31397	0.103000	0.19146	0.583000	0.23849	0.941000	0.37499	-0.687000	0.03738	CAA	CYP2C18	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000108242		0.433	CYP2C18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C18	HGNC	protein_coding	OTTHUMT00000049486.1	281	0.00	0	C	NM_000772		96447986	96447986	+1	no_errors	ENST00000285979	ensembl	human	known	69_37n	nonsense	335	12.53	48	SNP	0.118	T
CYP4B1	1580	genome.wustl.edu	37	1	47283813	47283813	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:47283813C>T	ENST00000271153.4	+	11	1316	c.1280C>T	c.(1279-1281)tCt>tTt	p.S427F	CYP4B1_ENST00000371923.4_Missense_Mutation_p.S428F|CYP4B1_ENST00000371919.4_Missense_Mutation_p.S413F|CYP4B1_ENST00000452782.2_Missense_Mutation_p.S265F			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	427					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.S427F(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GTCTTTGACTCTCTGCGCTTT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	136.0	140.0					1																	47283813		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1280C>T	1.37:g.47283813C>T	ENSP00000271153:p.Ser427Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.S428F	ENST00000271153.4	37	c.1283	CCDS542.1	1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657643	0.29425	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000452782	T;T;T;T	0.79033	-1.23;-1.23;-0.3;-1.23	6.17	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	N	0.19112	0.55	0.24224	N	0.995423	B;B;B	0.16603	0.016;0.014;0.018	B;B;B	0.17433	0.008;0.01;0.018	T	0.62699	-0.6799	10	0.87932	D	0	.	17.2552	0.87053	0.0:0.8741:0.1259:0.0	.	413;428;427	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	F	428;427;413;265	ENSP00000360991:S428F;ENSP00000271153:S427F;ENSP00000360987:S413F;ENSP00000400413:S265F	ENSP00000271153:S427F	S	+	2	0	CYP4B1	47056400	1.000000	0.71417	0.978000	0.43139	0.021000	0.10359	5.767000	0.68850	1.609000	0.50190	-0.175000	0.13238	TCT	CYP4B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000142973		0.582	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4B1	HGNC	protein_coding	OTTHUMT00000021911.1	139	0.00	0	C	NM_000779		47283813	47283813	+1	no_errors	ENST00000371923	ensembl	human	known	69_37n	missense	116	27.04	43	SNP	0.999	T
CYP4B1	1580	genome.wustl.edu	37	1	47283813	47283813	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:47283813C>T	ENST00000271153.4	+	11	1316	c.1280C>T	c.(1279-1281)tCt>tTt	p.S427F	CYP4B1_ENST00000371923.4_Missense_Mutation_p.S428F|CYP4B1_ENST00000371919.4_Missense_Mutation_p.S413F|CYP4B1_ENST00000452782.2_Missense_Mutation_p.S265F			P13584	CP4B1_HUMAN	cytochrome P450, family 4, subfamily B, polypeptide 1	427					biphenyl metabolic process (GO:0018879)|exogenous drug catabolic process (GO:0042738)|fluorene metabolic process (GO:0018917)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|drug binding (GO:0008144)|fluorene oxygenase activity (GO:0018585)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)	p.S427F(1)		NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(12)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	36	Acute lymphoblastic leukemia(166;0.155)				Midazolam(DB00683)|Phenobarbital(DB01174)|Thiamine(DB00152)	GTCTTTGACTCTCTGCGCTTT	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	136.0	140.0					1																	47283813		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017758	CCDS542.1, CCDS41328.1	1p33	2013-11-11	2003-01-14		ENSG00000142973	ENSG00000142973		"""Cytochrome P450s"""	2644	protein-coding gene	gene with protein product		124075	"""cytochrome P450, subfamily IVB, polypeptide 1"""				Standard	NM_000779		Approved		uc001cqn.4	P13584	OTTHUMG00000007984	ENST00000271153.4:c.1280C>T	1.37:g.47283813C>T	ENSP00000271153:p.Ser427Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1HBI2|Q8TD85|Q8WWF2|Q8WWU9|Q8WWV0	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_E_grp-II	p.S428F	ENST00000271153.4	37	c.1283	CCDS542.1	1	.	.	.	.	.	.	.	.	.	.	C	11.50	1.657643	0.29425	.	.	ENSG00000142973	ENST00000371923;ENST00000271153;ENST00000371919;ENST00000452782	T;T;T;T	0.79033	-1.23;-1.23;-0.3;-1.23	6.17	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.68100	0.2964	N	0.19112	0.55	0.24224	N	0.995423	B;B;B	0.16603	0.016;0.014;0.018	B;B;B	0.17433	0.008;0.01;0.018	T	0.62699	-0.6799	10	0.87932	D	0	.	17.2552	0.87053	0.0:0.8741:0.1259:0.0	.	413;428;427	Q8IZB0;P13584-2;P13584	.;.;CP4B1_HUMAN	F	428;427;413;265	ENSP00000360991:S428F;ENSP00000271153:S427F;ENSP00000360987:S413F;ENSP00000400413:S265F	ENSP00000271153:S427F	S	+	2	0	CYP4B1	47056400	1.000000	0.71417	0.978000	0.43139	0.021000	0.10359	5.767000	0.68850	1.609000	0.50190	-0.175000	0.13238	TCT	CYP4B1	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000142973		0.582	CYP4B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CYP4B1	HGNC	protein_coding	OTTHUMT00000021911.1	139	0.00	0	C	NM_000779		47283813	47283813	+1	no_errors	ENST00000371923	ensembl	human	known	69_37n	missense	77	23.76	24	SNP	0.999	T
DDX11	1663	genome.wustl.edu	37	12	31249282	31249282	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:31249282G>A	ENST00000407793.2	+	15	1741	c.1490G>A	c.(1489-1491)cGa>cAa	p.R497Q	DDX11_ENST00000542838.1_Missense_Mutation_p.R497Q|DDX11_ENST00000545668.1_Missense_Mutation_p.R497Q|DDX11_ENST00000228264.6_Missense_Mutation_p.R471Q|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000350437.4_Missense_Mutation_p.R497Q	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	497					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R497Q(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGGTGCAGCGATACTGTGAG	0.493										Multiple Myeloma(12;0.14)																												dbGAP											2	Substitution - Missense(2)	breast(2)											46.0	67.0	60.0					12																	31249282		2202	4297	6499	-	-	-	SO:0001583	missense	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1490G>A	12.37:g.31249282G>A	ENSP00000384703:p.Arg497Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.R497Q	ENST00000407793.2	37	c.1490	CCDS44856.1	12	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988496	0.35036	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	3.16	2.27	0.28462	.	0.186185	0.45867	D	0.000331	T	0.44307	0.1287	M	0.70903	2.155	0.80722	D	1	B;B;B;B	0.31705	0.209;0.336;0.108;0.209	B;B;B;B	0.24701	0.055;0.036;0.039;0.055	T	0.25293	-1.0136	10	0.26408	T	0.33	.	7.9363	0.29931	0.1279:0.0:0.8721:0.0	.	471;497;497;497	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	Q	497;497;222;471;497;497	ENSP00000443426:R497Q;ENSP00000384703:R497Q;ENSP00000228264:R471Q;ENSP00000440402:R497Q;ENSP00000309965:R497Q	ENSP00000228264:R471Q	R	+	2	0	DDX11	31140549	1.000000	0.71417	0.958000	0.39756	0.907000	0.53573	3.311000	0.51919	0.534000	0.28695	0.505000	0.49811	CGA	DDX11	-	tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000013573		0.493	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	211	0.00	0	G	NM_030653		31249282	31249282	+1	no_errors	ENST00000407793	ensembl	human	known	69_37n	missense	120	16.67	24	SNP	0.999	A
DDX11	1663	genome.wustl.edu	37	12	31249282	31249282	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:31249282G>A	ENST00000407793.2	+	15	1741	c.1490G>A	c.(1489-1491)cGa>cAa	p.R497Q	DDX11_ENST00000542838.1_Missense_Mutation_p.R497Q|DDX11_ENST00000545668.1_Missense_Mutation_p.R497Q|DDX11_ENST00000228264.6_Missense_Mutation_p.R471Q|DDX11_ENST00000251758.5_3'UTR|DDX11_ENST00000539673.1_3'UTR|DDX11_ENST00000350437.4_Missense_Mutation_p.R497Q	NM_030653.3|NM_152438.1	NP_085911.2|NP_689651.1	Q96FC9	DDX11_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11	497					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)	p.R497Q(2)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(11)|large_intestine(5)|lung(23)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	57	all_cancers(9;1.77e-11)|all_lung(12;6.21e-11)|all_epithelial(9;6.49e-11)|Lung NSC(12;1.06e-08)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Lung SC(12;0.0592)|Esophageal squamous(101;0.233)					CAGGTGCAGCGATACTGTGAG	0.493										Multiple Myeloma(12;0.14)																												dbGAP											2	Substitution - Missense(2)	breast(2)											46.0	67.0	60.0					12																	31249282		2202	4297	6499	-	-	-	SO:0001583	missense	0			U75969	CCDS8721.1, CCDS41767.1, CCDS44856.1, CCDS58224.1	12p11.21	2012-02-23	2012-02-23		ENSG00000013573	ENSG00000013573		"""DEAD-boxes"""	2736	protein-coding gene	gene with protein product	"""CHL1-like helicase homolog (S. cerevisiae)"""	601150	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (S.cerevisiae CHL1-like helicase)"", ""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11"""				Standard	NM_030653		Approved	CHLR1, KRG2, CHL1, ChlR1, WABS	uc001rjv.2	Q96FC9	OTTHUMG00000168435	ENST00000407793.2:c.1490G>A	12.37:g.31249282G>A	ENSP00000384703:p.Arg497Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_DEAD_2,smart_Helicase-like_DEXD_c2,smart_ATP-dep_Helicase_C,pfscan_Helic_SF1/SF2_ATP-bd_DinG/Rad3,tigrfam_DNA_helicase_DNA-repair_Rad3	p.R497Q	ENST00000407793.2	37	c.1490	CCDS44856.1	12	.	.	.	.	.	.	.	.	.	.	G	12.61	1.988496	0.35036	.	.	ENSG00000013573	ENST00000542838;ENST00000407793;ENST00000404673;ENST00000228264;ENST00000545668;ENST00000350437	T;T;T;T;T	0.57107	0.42;0.42;0.42;0.42;0.42	3.16	2.27	0.28462	.	0.186185	0.45867	D	0.000331	T	0.44307	0.1287	M	0.70903	2.155	0.80722	D	1	B;B;B;B	0.31705	0.209;0.336;0.108;0.209	B;B;B;B	0.24701	0.055;0.036;0.039;0.055	T	0.25293	-1.0136	10	0.26408	T	0.33	.	7.9363	0.29931	0.1279:0.0:0.8721:0.0	.	471;497;497;497	Q96FC9-3;Q96FC9;Q96FC9-4;Q96FC9-2	.;DDX11_HUMAN;.;.	Q	497;497;222;471;497;497	ENSP00000443426:R497Q;ENSP00000384703:R497Q;ENSP00000228264:R471Q;ENSP00000440402:R497Q;ENSP00000309965:R497Q	ENSP00000228264:R471Q	R	+	2	0	DDX11	31140549	1.000000	0.71417	0.958000	0.39756	0.907000	0.53573	3.311000	0.51919	0.534000	0.28695	0.505000	0.49811	CGA	DDX11	-	tigrfam_DNA_helicase_DNA-repair_Rad3	ENSG00000013573		0.493	DDX11-202	KNOWN	basic|CCDS	protein_coding	DDX11	HGNC	protein_coding	OTTHUMT00000399728.1	211	0.00	0	G	NM_030653		31249282	31249282	+1	no_errors	ENST00000407793	ensembl	human	known	69_37n	missense	176	17.37	37	SNP	0.999	A
DMXL1	1657	genome.wustl.edu	37	5	118468832	118468832	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:118468832G>A	ENST00000311085.8	+	11	1401	c.1321G>A	c.(1321-1323)Gat>Aat	p.D441N	DMXL1_ENST00000539542.1_Missense_Mutation_p.D441N	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	441								p.D441N(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATAGAAACTGATGATGGTGT	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	56.0	57.0					5																	118468832		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1321G>A	5.37:g.118468832G>A	ENSP00000309690:p.Asp441Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D441N	ENST00000311085.8	37	c.1321	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859768	0.71834	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.47177	0.85;0.85;0.85	5.42	5.42	0.78866	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.294307	0.37809	N	0.001929	T	0.58977	0.2160	M	0.71581	2.175	0.53005	D	0.99996	P;D	0.57571	0.914;0.98	P;P	0.49853	0.52;0.624	T	0.59783	-0.7389	10	0.39692	T	0.17	-12.6572	19.2211	0.93797	0.0:0.0:1.0:0.0	.	441;441	F5H269;Q9Y485	.;DMXL1_HUMAN	N	441	ENSP00000427692:D441N;ENSP00000309690:D441N;ENSP00000439479:D441N	ENSP00000309690:D441N	D	+	1	0	DMXL1	118496731	1.000000	0.71417	0.992000	0.48379	0.736000	0.42039	5.391000	0.66266	2.572000	0.86782	0.591000	0.81541	GAT	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.348	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	87	0.00	0	G	NM_005509		118468832	118468832	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	127	22.56	37	SNP	1.000	A
DMXL1	1657	genome.wustl.edu	37	5	118468832	118468832	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:118468832G>A	ENST00000311085.8	+	11	1401	c.1321G>A	c.(1321-1323)Gat>Aat	p.D441N	DMXL1_ENST00000539542.1_Missense_Mutation_p.D441N	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	441								p.D441N(1)		breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TATAGAAACTGATGATGGTGT	0.348																																						dbGAP											1	Substitution - Missense(1)	breast(1)											58.0	56.0	57.0					5																	118468832		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1321G>A	5.37:g.118468832G>A	ENSP00000309690:p.Asp441Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D441N	ENST00000311085.8	37	c.1321	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859768	0.71834	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.47177	0.85;0.85;0.85	5.42	5.42	0.78866	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.294307	0.37809	N	0.001929	T	0.58977	0.2160	M	0.71581	2.175	0.53005	D	0.99996	P;D	0.57571	0.914;0.98	P;P	0.49853	0.52;0.624	T	0.59783	-0.7389	10	0.39692	T	0.17	-12.6572	19.2211	0.93797	0.0:0.0:1.0:0.0	.	441;441	F5H269;Q9Y485	.;DMXL1_HUMAN	N	441	ENSP00000427692:D441N;ENSP00000309690:D441N;ENSP00000439479:D441N	ENSP00000309690:D441N	D	+	1	0	DMXL1	118496731	1.000000	0.71417	0.992000	0.48379	0.736000	0.42039	5.391000	0.66266	2.572000	0.86782	0.591000	0.81541	GAT	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.348	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	87	0.00	0	G	NM_005509		118468832	118468832	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	81	24.30	26	SNP	1.000	A
DNAH3	55567	genome.wustl.edu	37	16	20975814	20975814	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:20975814C>G	ENST00000261383.3	-	53	9391	c.9392G>C	c.(9391-9393)gGa>gCa	p.G3131A	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3131	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.G3131A(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGCTCTTCTCCAATGTTTTC	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											174.0	168.0	170.0					16																	20975814		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9392G>C	16.37:g.20975814C>G	ENSP00000261383:p.Gly3131Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.G3131A	ENST00000261383.3	37	c.9392	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223677	0.39300	.	.	ENSG00000158486	ENST00000261383	T	0.22539	1.95	5.81	5.81	0.92471	.	0.057985	0.64402	D	0.000002	T	0.42921	0.1224	M	0.84433	2.695	0.80722	D	1	D	0.56521	0.976	P	0.49853	0.624	T	0.43507	-0.9387	10	0.48119	T	0.1	.	20.0758	0.97742	0.0:1.0:0.0:0.0	.	3131	Q8TD57	DYH3_HUMAN	A	3131	ENSP00000261383:G3131A	ENSP00000261383:G3131A	G	-	2	0	DNAH3	20883315	1.000000	0.71417	0.515000	0.27774	0.448000	0.32197	4.785000	0.62418	2.757000	0.94681	0.555000	0.69702	GGA	DNAH3	-	NULL	ENSG00000158486		0.443	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	105	0.00	0	C	NM_017539		20975814	20975814	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	132	25.00	44	SNP	1.000	G
DNAH3	55567	genome.wustl.edu	37	16	20975814	20975814	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:20975814C>G	ENST00000261383.3	-	53	9391	c.9392G>C	c.(9391-9393)gGa>gCa	p.G3131A	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3131	AAA 5. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.G3131A(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		CAGCTCTTCTCCAATGTTTTC	0.443																																						dbGAP											2	Substitution - Missense(2)	breast(2)											174.0	168.0	170.0					16																	20975814		2201	4300	6501	-	-	-	SO:0001583	missense	0			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.9392G>C	16.37:g.20975814C>G	ENSP00000261383:p.Gly3131Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.G3131A	ENST00000261383.3	37	c.9392	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223677	0.39300	.	.	ENSG00000158486	ENST00000261383	T	0.22539	1.95	5.81	5.81	0.92471	.	0.057985	0.64402	D	0.000002	T	0.42921	0.1224	M	0.84433	2.695	0.80722	D	1	D	0.56521	0.976	P	0.49853	0.624	T	0.43507	-0.9387	10	0.48119	T	0.1	.	20.0758	0.97742	0.0:1.0:0.0:0.0	.	3131	Q8TD57	DYH3_HUMAN	A	3131	ENSP00000261383:G3131A	ENSP00000261383:G3131A	G	-	2	0	DNAH3	20883315	1.000000	0.71417	0.515000	0.27774	0.448000	0.32197	4.785000	0.62418	2.757000	0.94681	0.555000	0.69702	GGA	DNAH3	-	NULL	ENSG00000158486		0.443	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	105	0.00	0	C	NM_017539		20975814	20975814	-1	no_errors	ENST00000261383	ensembl	human	known	69_37n	missense	92	21.37	25	SNP	1.000	G
DNAJC11	55735	genome.wustl.edu	37	1	6727831	6727831	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:6727831C>G	ENST00000377577.5	-	4	439	c.316G>C	c.(316-318)Gag>Cag	p.E106Q	DNAJC11_ENST00000349363.6_Missense_Mutation_p.E68Q|DNAJC11_ENST00000294401.7_Missense_Mutation_p.E106Q|DNAJC11_ENST00000542246.1_Missense_Mutation_p.E68Q|DNAJC11_ENST00000377573.5_Missense_Mutation_p.E16Q	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	106						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.E106Q(2)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CGCTCAAACTCCTCTCGAATT	0.517																																						dbGAP											2	Substitution - Missense(2)	breast(2)											66.0	63.0	64.0					1																	6727831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.316G>C	1.37:g.6727831C>G	ENSP00000366800:p.Glu106Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	pfam_DnaJ-like_C11_C,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E106Q	ENST00000377577.5	37	c.316	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626181	0.87560	.	.	ENSG00000007923	ENST00000377577;ENST00000451196;ENST00000349363;ENST00000294401;ENST00000542246;ENST00000377573;ENST00000426784	T;T;T;T;T;T;T	0.37058	2.27;1.66;1.22;2.28;1.97;1.45;2.36	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.63402	0.2508	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.99;0.997;0.992	T	0.68383	-0.5423	10	0.51188	T	0.08	-11.5554	13.9875	0.64345	0.0:0.9276:0.0:0.0724	.	16;82;106;106	B4DGD5;Q5TH61;Q9NVH1-3;Q9NVH1	.;.;.;DJC11_HUMAN	Q	106;82;68;106;68;16;106	ENSP00000366800:E106Q;ENSP00000415871:E82Q;ENSP00000326304:E68Q;ENSP00000294401:E106Q;ENSP00000444020:E68Q;ENSP00000366796:E16Q;ENSP00000410194:E106Q	ENSP00000294401:E106Q	E	-	1	0	DNAJC11	6650418	1.000000	0.71417	0.993000	0.49108	0.943000	0.58893	7.093000	0.76937	1.415000	0.47037	-0.150000	0.13652	GAG	DNAJC11	-	NULL	ENSG00000007923		0.517	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	65	0.00	0	C	NM_018198		6727831	6727831	-1	no_errors	ENST00000377577	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	G
DNAJC11	55735	genome.wustl.edu	37	1	6727831	6727831	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:6727831C>G	ENST00000377577.5	-	4	439	c.316G>C	c.(316-318)Gag>Cag	p.E106Q	DNAJC11_ENST00000349363.6_Missense_Mutation_p.E68Q|DNAJC11_ENST00000294401.7_Missense_Mutation_p.E106Q|DNAJC11_ENST00000542246.1_Missense_Mutation_p.E68Q|DNAJC11_ENST00000377573.5_Missense_Mutation_p.E16Q	NM_018198.3	NP_060668.2	Q9NVH1	DJC11_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 11	106						extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)		p.E106Q(2)		NS(1)|breast(2)|endometrium(4)|kidney(2)|large_intestine(11)|lung(8)|ovary(2)|skin(1)|urinary_tract(1)	32	Ovarian(185;0.0265)|all_lung(157;0.154)	all_cancers(23;1.97e-27)|all_epithelial(116;1.76e-17)|all_lung(118;2.27e-05)|Lung NSC(185;9.97e-05)|Renal(390;0.00188)|Breast(487;0.00289)|Colorectal(325;0.00342)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.156)		Colorectal(212;2.34e-07)|COAD - Colon adenocarcinoma(227;2.05e-05)|Kidney(185;7.67e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000639)|KIRC - Kidney renal clear cell carcinoma(229;0.00128)|STAD - Stomach adenocarcinoma(132;0.00179)|READ - Rectum adenocarcinoma(331;0.0649)		CGCTCAAACTCCTCTCGAATT	0.517																																						dbGAP											2	Substitution - Missense(2)	breast(2)											66.0	63.0	64.0					1																	6727831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF306695	CCDS87.1	1p36.23	2011-09-02			ENSG00000007923	ENSG00000007923		"""Heat shock proteins / DNAJ (HSP40)"""	25570	protein-coding gene	gene with protein product		614827				12964007	Standard	NM_018198		Approved	FLJ10737	uc001aof.2	Q9NVH1	OTTHUMG00000001443	ENST00000377577.5:c.316G>C	1.37:g.6727831C>G	ENSP00000366800:p.Glu106Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VWF5|Q5VZN0|Q6PK20|Q6PK70|Q8NDM2|Q96CL7	Missense_Mutation	SNP	pfam_DnaJ-like_C11_C,pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E106Q	ENST00000377577.5	37	c.316	CCDS87.1	1	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626181	0.87560	.	.	ENSG00000007923	ENST00000377577;ENST00000451196;ENST00000349363;ENST00000294401;ENST00000542246;ENST00000377573;ENST00000426784	T;T;T;T;T;T;T	0.37058	2.27;1.66;1.22;2.28;1.97;1.45;2.36	5.72	4.81	0.61882	.	0.000000	0.85682	D	0.000000	T	0.63402	0.2508	M	0.84683	2.71	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.99;0.997;0.992	T	0.68383	-0.5423	10	0.51188	T	0.08	-11.5554	13.9875	0.64345	0.0:0.9276:0.0:0.0724	.	16;82;106;106	B4DGD5;Q5TH61;Q9NVH1-3;Q9NVH1	.;.;.;DJC11_HUMAN	Q	106;82;68;106;68;16;106	ENSP00000366800:E106Q;ENSP00000415871:E82Q;ENSP00000326304:E68Q;ENSP00000294401:E106Q;ENSP00000444020:E68Q;ENSP00000366796:E16Q;ENSP00000410194:E106Q	ENSP00000294401:E106Q	E	-	1	0	DNAJC11	6650418	1.000000	0.71417	0.993000	0.49108	0.943000	0.58893	7.093000	0.76937	1.415000	0.47037	-0.150000	0.13652	GAG	DNAJC11	-	NULL	ENSG00000007923		0.517	DNAJC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC11	HGNC	protein_coding	OTTHUMT00000004216.3	65	0.00	0	C	NM_018198		6727831	6727831	-1	no_errors	ENST00000377577	ensembl	human	known	69_37n	missense	82	21.15	22	SNP	1.000	G
DNAJC6	9829	genome.wustl.edu	37	1	65878608	65878608	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:65878608C>G	ENST00000395325.3	+	19	2799	c.2642C>G	c.(2641-2643)gCt>gGt	p.A881G	DNAJC6_ENST00000371069.4_Splice_Site_p.A938G|DNAJC6_ENST00000263441.7_Splice_Site_p.A868G|RNU2-15P_ENST00000410692.1_RNA	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	881	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)	p.A881G(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCTCTACAGGCTACTGGGCAA	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	170.0	169.0					1																	65878608		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2641-1C>G	1.37:g.65878608C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DnaJ_N,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_N	p.A938G	ENST00000395325.3	37	c.2813	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048243	0.75846	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	T;T;T	0.32753	1.44;1.44;1.44	5.76	5.76	0.90799	Heat shock protein DnaJ, N-terminal (5);	0.050656	0.85682	D	0.000000	T	0.34890	0.0913	N	0.20807	0.61	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.91635	0.999;0.999	T	0.11891	-1.0569	10	0.42905	T	0.14	.	20.3316	0.98722	0.0:1.0:0.0:0.0	.	938;881	O75061-2;O75061	.;AUXI_HUMAN	G	868;881;938	ENSP00000263441:A868G;ENSP00000378735:A881G;ENSP00000360108:A938G	ENSP00000263441:A868G	A	+	2	0	DNAJC6	65651196	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	7.442000	0.80503	2.871000	0.98454	0.655000	0.94253	GCT	DNAJC6	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	ENSG00000116675		0.358	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1	167	0.00	0	C		Missense_Mutation	65878608	65878608	+1	no_errors	ENST00000371069	ensembl	human	known	69_37n	missense	220	18.52	50	SNP	1.000	G
DNAJC6	9829	genome.wustl.edu	37	1	65878608	65878608	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:65878608C>G	ENST00000395325.3	+	19	2799	c.2642C>G	c.(2641-2643)gCt>gGt	p.A881G	DNAJC6_ENST00000371069.4_Splice_Site_p.A938G|DNAJC6_ENST00000263441.7_Splice_Site_p.A868G|RNU2-15P_ENST00000410692.1_RNA	NM_014787.3	NP_055602.1	O75061	AUXI_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 6	881	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|clathrin coat disassembly (GO:0072318)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytosol (GO:0005829)|synapse (GO:0045202)	protein tyrosine phosphatase activity (GO:0004725)	p.A881G(1)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(22)|ovary(1)|prostate(2)|skin(1)	39						TCTCTACAGGCTACTGGGCAA	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	170.0	169.0					1																	65878608		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB007942	CCDS30739.1, CCDS58004.1, CCDS58005.1	1p31.3	2011-09-02			ENSG00000116675	ENSG00000116675		"""Heat shock proteins / DNAJ (HSP40)"""	15469	protein-coding gene	gene with protein product	"""auxilin"""	608375				9455484, 11147971	Standard	NM_001256864		Approved	KIAA0473	uc001dce.2	O75061	OTTHUMG00000009066	ENST00000395325.3:c.2641-1C>G	1.37:g.65878608C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3V8|D3DQ65|D3DQ66|Q32M66|Q4G0K1|Q5T614|Q5T615	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DnaJ_N,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom,pfscan_DnaJ_N	p.A938G	ENST00000395325.3	37	c.2813	CCDS30739.1	1	.	.	.	.	.	.	.	.	.	.	C	20.8	4.048243	0.75846	.	.	ENSG00000116675	ENST00000263441;ENST00000395325;ENST00000371069	T;T;T	0.32753	1.44;1.44;1.44	5.76	5.76	0.90799	Heat shock protein DnaJ, N-terminal (5);	0.050656	0.85682	D	0.000000	T	0.34890	0.0913	N	0.20807	0.61	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.91635	0.999;0.999	T	0.11891	-1.0569	10	0.42905	T	0.14	.	20.3316	0.98722	0.0:1.0:0.0:0.0	.	938;881	O75061-2;O75061	.;AUXI_HUMAN	G	868;881;938	ENSP00000263441:A868G;ENSP00000378735:A881G;ENSP00000360108:A938G	ENSP00000263441:A868G	A	+	2	0	DNAJC6	65651196	1.000000	0.71417	1.000000	0.80357	0.308000	0.27856	7.442000	0.80503	2.871000	0.98454	0.655000	0.94253	GCT	DNAJC6	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N	ENSG00000116675		0.358	DNAJC6-001	KNOWN	basic|CCDS	protein_coding	DNAJC6	HGNC	protein_coding	OTTHUMT00000025134.1	167	0.00	0	C		Missense_Mutation	65878608	65878608	+1	no_errors	ENST00000371069	ensembl	human	known	69_37n	missense	337	19.76	83	SNP	1.000	G
DNPEP	23549	genome.wustl.edu	37	2	220251466	220251466	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:220251466G>T	ENST00000273075.4	-	4	474	c.254C>A	c.(253-255)gCt>gAt	p.A85D	DNPEP_ENST00000523282.1_Missense_Mutation_p.A93D|DNPEP_ENST00000373972.1_Missense_Mutation_p.A10D|AC053503.4_ENST00000420563.1_RNA	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	75					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A85D(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TACAGCAAAAGCTATGATGGT	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	43.0	41.0					2																	220251466		2080	4207	6287	-	-	-	SO:0001583	missense	0				CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.254C>A	2.37:g.220251466G>T	ENSP00000273075:p.Ala85Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BW44|Q9NUV5	Missense_Mutation	SNP	pfam_Peptidase_M18,pfam_Peptidase_M42,prints_Peptidase_M18	p.A85D	ENST00000273075.4	37	c.254	CCDS42823.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915650	0.92178	.	.	ENSG00000123992	ENST00000273075;ENST00000337010;ENST00000373972;ENST00000523282;ENST00000457935;ENST00000429013;ENST00000521459;ENST00000322176;ENST00000434339;ENST00000430206;ENST00000519905	.	.	.	4.98	4.98	0.66077	.	0.112837	0.64402	D	0.000013	D	0.90376	0.6988	H	0.98111	4.15	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.94165	0.7418	9	0.87932	D	0	-3.7249	17.8432	0.88721	0.0:0.0:1.0:0.0	.	93;85;93;75;85	E7ETB3;B7Z822;B7Z7F0;Q9ULA0;Q53SB6	.;.;.;DNPEP_HUMAN;.	D	85;85;10;93;93;71;85;85;10;10;71	.	ENSP00000273075:A85D	A	-	2	0	DNPEP	219959710	1.000000	0.71417	0.997000	0.53966	0.659000	0.38960	9.403000	0.97302	2.305000	0.77605	0.491000	0.48974	GCT	DNPEP	-	pfam_Peptidase_M18	ENSG00000123992		0.577	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DNPEP	HGNC	protein_coding	OTTHUMT00000130212.1	107	0.00	0	G	NM_012100		220251466	220251466	-1	no_errors	ENST00000273075	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	T
DNPEP	23549	genome.wustl.edu	37	2	220251466	220251466	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:220251466G>T	ENST00000273075.4	-	4	474	c.254C>A	c.(253-255)gCt>gAt	p.A85D	DNPEP_ENST00000523282.1_Missense_Mutation_p.A93D|DNPEP_ENST00000373972.1_Missense_Mutation_p.A10D|AC053503.4_ENST00000420563.1_RNA	NM_012100.2	NP_036232	Q9ULA0	DNPEP_HUMAN	aspartyl aminopeptidase	75					peptide metabolic process (GO:0006518)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.A85D(1)		breast(3)|endometrium(2)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17		Renal(207;0.0474)		Epithelial(149;1.09e-06)|all cancers(144;0.000179)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		TACAGCAAAAGCTATGATGGT	0.577																																						dbGAP											1	Substitution - Missense(1)	breast(1)											38.0	43.0	41.0					2																	220251466		2080	4207	6287	-	-	-	SO:0001583	missense	0				CCDS42823.1	2q36.1	2008-05-22			ENSG00000123992	ENSG00000123992			2981	protein-coding gene	gene with protein product		611367				9632644	Standard	NM_012100		Approved	DAP, ASPEP	uc002vle.2	Q9ULA0	OTTHUMG00000058919	ENST00000273075.4:c.254C>A	2.37:g.220251466G>T	ENSP00000273075:p.Ala85Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BW44|Q9NUV5	Missense_Mutation	SNP	pfam_Peptidase_M18,pfam_Peptidase_M42,prints_Peptidase_M18	p.A85D	ENST00000273075.4	37	c.254	CCDS42823.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.915650	0.92178	.	.	ENSG00000123992	ENST00000273075;ENST00000337010;ENST00000373972;ENST00000523282;ENST00000457935;ENST00000429013;ENST00000521459;ENST00000322176;ENST00000434339;ENST00000430206;ENST00000519905	.	.	.	4.98	4.98	0.66077	.	0.112837	0.64402	D	0.000013	D	0.90376	0.6988	H	0.98111	4.15	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.94165	0.7418	9	0.87932	D	0	-3.7249	17.8432	0.88721	0.0:0.0:1.0:0.0	.	93;85;93;75;85	E7ETB3;B7Z822;B7Z7F0;Q9ULA0;Q53SB6	.;.;.;DNPEP_HUMAN;.	D	85;85;10;93;93;71;85;85;10;10;71	.	ENSP00000273075:A85D	A	-	2	0	DNPEP	219959710	1.000000	0.71417	0.997000	0.53966	0.659000	0.38960	9.403000	0.97302	2.305000	0.77605	0.491000	0.48974	GCT	DNPEP	-	pfam_Peptidase_M18	ENSG00000123992		0.577	DNPEP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DNPEP	HGNC	protein_coding	OTTHUMT00000130212.1	107	0.00	0	G	NM_012100		220251466	220251466	-1	no_errors	ENST00000273075	ensembl	human	known	69_37n	missense	33	34.00	17	SNP	1.000	T
DROSHA	29102	genome.wustl.edu	37	5	31401613	31401613	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:31401613C>G	ENST00000511367.2	-	35	4295	c.4051G>C	c.(4051-4053)Gag>Cag	p.E1351Q	DROSHA_ENST00000344624.3_Missense_Mutation_p.E1351Q|DROSHA_ENST00000442743.1_Missense_Mutation_p.E1314Q|DROSHA_ENST00000513349.1_Missense_Mutation_p.E1314Q	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1351	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.E1351Q(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TCTTTTAACTCTTGTCTGTAC	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											198.0	184.0	188.0					5																	31401613		1870	4106	5976	-	-	-	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.4051G>C	5.37:g.31401613C>G	ENSP00000425979:p.Glu1351Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.E1351Q	ENST00000511367.2	37	c.4051	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303726	0.40795	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	T;T;T;T	0.43294	1.51;1.51;0.95;0.95	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.27663	0.0680	N	0.14661	0.345	0.80722	D	1	B;B	0.18968	0.032;0.023	B;B	0.17722	0.019;0.018	T	0.14811	-1.0459	10	0.06099	T	0.92	-20.4734	20.181	0.98201	0.0:1.0:0.0:0.0	.	1314;1351	E7EMP9;Q9NRR4	.;RNC_HUMAN	Q	1351;1351;1314;1314;1276	ENSP00000425979:E1351Q;ENSP00000339845:E1351Q;ENSP00000409335:E1314Q;ENSP00000424161:E1314Q	ENSP00000265075:E1276Q	E	-	1	0	DROSHA	31437370	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.232000	0.78116	2.840000	0.97914	0.655000	0.94253	GAG	DROSHA	-	NULL	ENSG00000113360		0.373	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	145	0.00	0	C	NM_013235		31401613	31401613	-1	no_errors	ENST00000344624	ensembl	human	known	69_37n	missense	274	15.95	52	SNP	1.000	G
DROSHA	29102	genome.wustl.edu	37	5	31401613	31401613	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:31401613C>G	ENST00000511367.2	-	35	4295	c.4051G>C	c.(4051-4053)Gag>Cag	p.E1351Q	DROSHA_ENST00000344624.3_Missense_Mutation_p.E1351Q|DROSHA_ENST00000442743.1_Missense_Mutation_p.E1314Q|DROSHA_ENST00000513349.1_Missense_Mutation_p.E1314Q	NM_013235.4	NP_037367.3	Q9NRR4	RNC_HUMAN	drosha, ribonuclease type III	1351	Necessary for interaction with DGCR8 and pri-miRNA processing activity.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|gene expression (GO:0010467)|miRNA metabolic process (GO:0010586)|pre-miRNA processing (GO:0031054)|primary miRNA processing (GO:0031053)|ribosome biogenesis (GO:0042254)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|rRNA catabolic process (GO:0016075)	nucleoplasm (GO:0005654)	lipopolysaccharide binding (GO:0001530)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|ribonuclease III activity (GO:0004525)	p.E1351Q(1)		breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(19)|lung(33)|ovary(2)|skin(1)	66						TCTTTTAACTCTTGTCTGTAC	0.373																																						dbGAP											1	Substitution - Missense(1)	breast(1)											198.0	184.0	188.0					5																	31401613		1870	4106	5976	-	-	-	SO:0001583	missense	0			AF116910	CCDS47194.1, CCDS47195.1	5q11.2	2010-11-17	2010-10-28	2010-10-28	ENSG00000113360	ENSG00000113360	3.1.26.3		17904	protein-coding gene	gene with protein product	"""drosha, ribonuclease type III"", ""drosha, double-stranded RNA-specific endoribonuclease"""	608828	"""ribonuclease type III, nuclear"""	RNASEN		10713462, 10948199	Standard	NM_013235		Approved	RNASE3L, Etohi2, HSA242976, RN3	uc003jhg.2	Q9NRR4	OTTHUMG00000161976	ENST00000511367.2:c.4051G>C	5.37:g.31401613C>G	ENSP00000425979:p.Glu1351Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMP9|Q7Z5V2|Q86YH0|Q9NW73|Q9Y2V9|Q9Y4Y0	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_Ds-RNA-bd,superfamily_RNase_III_dom,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.E1351Q	ENST00000511367.2	37	c.4051	CCDS47195.1	5	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303726	0.40795	.	.	ENSG00000113360	ENST00000511367;ENST00000344624;ENST00000442743;ENST00000513349;ENST00000265075	T;T;T;T	0.43294	1.51;1.51;0.95;0.95	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.27663	0.0680	N	0.14661	0.345	0.80722	D	1	B;B	0.18968	0.032;0.023	B;B	0.17722	0.019;0.018	T	0.14811	-1.0459	10	0.06099	T	0.92	-20.4734	20.181	0.98201	0.0:1.0:0.0:0.0	.	1314;1351	E7EMP9;Q9NRR4	.;RNC_HUMAN	Q	1351;1351;1314;1314;1276	ENSP00000425979:E1351Q;ENSP00000339845:E1351Q;ENSP00000409335:E1314Q;ENSP00000424161:E1314Q	ENSP00000265075:E1276Q	E	-	1	0	DROSHA	31437370	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.232000	0.78116	2.840000	0.97914	0.655000	0.94253	GAG	DROSHA	-	NULL	ENSG00000113360		0.373	DROSHA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DROSHA	HGNC	protein_coding	OTTHUMT00000366561.3	145	0.00	0	C	NM_013235		31401613	31401613	-1	no_errors	ENST00000344624	ensembl	human	known	69_37n	missense	416	15.96	79	SNP	1.000	G
DSPP	1834	genome.wustl.edu	37	4	88537602	88537602	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:88537602C>T	ENST00000282478.7	+	4	3821	c.3788C>T	c.(3787-3789)tCt>tTt	p.S1263F	DSPP_ENST00000399271.1_Missense_Mutation_p.S1263F|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1263	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S1263F(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcaCATCTGACAGCAAT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	121.0	116.0					4																	88537602		1681	3015	4696	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3788C>T	4.37:g.88537602C>T	ENSP00000282478:p.Ser1263Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.S1263F	ENST00000282478.7	37	c.3788	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	C	4.338	0.062156	0.08388	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88664	-2.41;-2.41	3.16	2.29	0.28610	.	1.880610	0.03480	N	0.214973	D	0.90338	0.6977	N	0.24115	0.695	0.22112	N	0.999354	D	0.71674	0.998	D	0.74023	0.982	T	0.79196	-0.1903	10	0.72032	D	0.01	-2.4455	8.2501	0.31712	0.0:0.7538:0.2462:0.0	.	1263	Q9NZW4	DSPP_HUMAN	F	1263	ENSP00000382213:S1263F;ENSP00000282478:S1263F	ENSP00000282478:S1263F	S	+	2	0	DSPP	88756626	0.997000	0.39634	0.956000	0.39512	0.412000	0.31113	3.100000	0.50275	0.876000	0.35872	-0.515000	0.04445	TCT	DSPP	-	NULL	ENSG00000152591		0.512	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	232	0.00	0	C	NM_014208		88537602	88537602	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	117	23.03	35	SNP	0.993	T
DSPP	1834	genome.wustl.edu	37	4	88537602	88537602	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:88537602C>T	ENST00000282478.7	+	4	3821	c.3788C>T	c.(3787-3789)tCt>tTt	p.S1263F	DSPP_ENST00000399271.1_Missense_Mutation_p.S1263F|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1263	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)	p.S1263F(1)		breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		gacagcaCATCTGACAGCAAT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	121.0	116.0					4																	88537602		1681	3015	4696	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3788C>T	4.37:g.88537602C>T	ENSP00000282478:p.Ser1263Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.S1263F	ENST00000282478.7	37	c.3788	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	C	4.338	0.062156	0.08388	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.88664	-2.41;-2.41	3.16	2.29	0.28610	.	1.880610	0.03480	N	0.214973	D	0.90338	0.6977	N	0.24115	0.695	0.22112	N	0.999354	D	0.71674	0.998	D	0.74023	0.982	T	0.79196	-0.1903	10	0.72032	D	0.01	-2.4455	8.2501	0.31712	0.0:0.7538:0.2462:0.0	.	1263	Q9NZW4	DSPP_HUMAN	F	1263	ENSP00000382213:S1263F;ENSP00000282478:S1263F	ENSP00000282478:S1263F	S	+	2	0	DSPP	88756626	0.997000	0.39634	0.956000	0.39512	0.412000	0.31113	3.100000	0.50275	0.876000	0.35872	-0.515000	0.04445	TCT	DSPP	-	NULL	ENSG00000152591		0.512	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	232	0.00	0	C	NM_014208		88537602	88537602	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	76	27.62	29	SNP	0.993	T
DSTYK	25778	genome.wustl.edu	37	1	205130512	205130512	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:205130512C>T	ENST00000367162.3	-	7	1852	c.1822G>A	c.(1822-1824)Gaa>Aaa	p.E608K	DSTYK_ENST00000367161.3_Missense_Mutation_p.E608K|DSTYK_ENST00000367160.4_Intron	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	608					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.E69K(1)|p.E608K(1)		breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TGGCCAGCTTCCAGCTGGGAG	0.473																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	60.0	63.0					1																	205130512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1822G>A	1.37:g.205130512C>T	ENSP00000356130:p.Glu608Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E608K	ENST00000367162.3	37	c.1822	CCDS1451.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.358872	0.95854	.	.	ENSG00000133059	ENST00000367161;ENST00000367162	T;D	0.81996	-1.46;-1.56	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.90648	0.7067	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.995	D;D;D	0.85130	0.994;0.997;0.948	D	0.90606	0.4548	10	0.59425	D	0.04	-17.3768	19.302	0.94148	0.0:1.0:0.0:0.0	.	69;608;608	Q6XUX3-4;Q6XUX3-2;Q6XUX3	.;.;DUSTY_HUMAN	K	608	ENSP00000356129:E608K;ENSP00000356130:E608K	ENSP00000356129:E608K	E	-	1	0	DSTYK	203397135	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.707000	0.84623	2.654000	0.90174	0.563000	0.77884	GAA	DSTYK	-	NULL	ENSG00000133059		0.473	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSTYK	HGNC	protein_coding	OTTHUMT00000090345.1	79	0.00	0	C	NM_015375		205130512	205130512	-1	no_errors	ENST00000367162	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	1.000	T
DSTYK	25778	genome.wustl.edu	37	1	205130512	205130512	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:205130512C>T	ENST00000367162.3	-	7	1852	c.1822G>A	c.(1822-1824)Gaa>Aaa	p.E608K	DSTYK_ENST00000367161.3_Missense_Mutation_p.E608K|DSTYK_ENST00000367160.4_Intron	NM_015375.2	NP_056190.1	Q6XUX3	DUSTY_HUMAN	dual serine/threonine and tyrosine protein kinase	608					cellular response to fibroblast growth factor stimulus (GO:0044344)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of kinase activity (GO:0033674)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)	p.E69K(1)|p.E608K(1)		breast(2)|kidney(1)|large_intestine(1)|lung(7)|prostate(1)|skin(2)	14						TGGCCAGCTTCCAGCTGGGAG	0.473																																						dbGAP											2	Substitution - Missense(2)	breast(2)											67.0	60.0	63.0					1																	205130512		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF068286	CCDS1451.1, CCDS1452.1	1q32	2008-12-18	2008-12-18	2008-12-18	ENSG00000133059	ENSG00000133059			29043	protein-coding gene	gene with protein product		612666	"""receptor interacting protein kinase 5"""	RIPK5		15178406	Standard	NM_015375		Approved	KIAA0472, DustyPK, RIP5	uc001hbw.3	Q6XUX3	OTTHUMG00000037102	ENST00000367162.3:c.1822G>A	1.37:g.205130512C>T	ENSP00000356130:p.Glu608Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL64|O75060|Q17R94|Q5RKT0|Q6IN87|Q6P997|Q86Y03|Q9P1S5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E608K	ENST00000367162.3	37	c.1822	CCDS1451.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.358872	0.95854	.	.	ENSG00000133059	ENST00000367161;ENST00000367162	T;D	0.81996	-1.46;-1.56	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.90648	0.7067	M	0.66939	2.045	0.80722	D	1	D;D;D	0.89917	0.998;1.0;0.995	D;D;D	0.85130	0.994;0.997;0.948	D	0.90606	0.4548	10	0.59425	D	0.04	-17.3768	19.302	0.94148	0.0:1.0:0.0:0.0	.	69;608;608	Q6XUX3-4;Q6XUX3-2;Q6XUX3	.;.;DUSTY_HUMAN	K	608	ENSP00000356129:E608K;ENSP00000356130:E608K	ENSP00000356129:E608K	E	-	1	0	DSTYK	203397135	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.707000	0.84623	2.654000	0.90174	0.563000	0.77884	GAA	DSTYK	-	NULL	ENSG00000133059		0.473	DSTYK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSTYK	HGNC	protein_coding	OTTHUMT00000090345.1	79	0.00	0	C	NM_015375		205130512	205130512	-1	no_errors	ENST00000367162	ensembl	human	known	69_37n	missense	56	21.13	15	SNP	1.000	T
DYRK1A	1859	genome.wustl.edu	37	21	38845021	38845021	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr21:38845021C>T	ENST00000398960.2	+	2	121	c.46C>T	c.(46-48)Cgg>Tgg	p.R16W	DYRK1A_ENST00000321219.8_Missense_Mutation_p.R16W|DYRK1A_ENST00000339659.4_Missense_Mutation_p.R16W|DYRK1A_ENST00000398956.2_Missense_Mutation_p.R16W|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000451934.1_Missense_Mutation_p.R16W|DYRK1A_ENST00000338785.3_Missense_Mutation_p.R16W	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	16					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)	p.R16W(1)		breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TTCATCTGTTCGGCTTGCACC	0.438																																					Melanoma(114;464 1602 31203 43785 45765)	dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	109.0	110.0					21																	38845021		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.46C>T	21.37:g.38845021C>T	ENSP00000381932:p.Arg16Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R16W	ENST00000398960.2	37	c.46	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	C	37	6.047780	0.97236	.	.	ENSG00000157540	ENST00000338785;ENST00000455097;ENST00000426672;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	T;T;T;T;T;T;T	0.60424	0.29;0.37;0.19;0.32;0.29;0.19;0.33	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.998;0.997;0.998;0.998	P;P;P;P;P	0.53954	0.738;0.738;0.454;0.656;0.738	T	0.66460	-0.5918	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	16;16;16;16;16	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	W	16	ENSP00000342690:R16W;ENSP00000412269:R16W;ENSP00000340373:R16W;ENSP00000319032:R16W;ENSP00000416089:R16W;ENSP00000381932:R16W;ENSP00000381929:R16W	ENSP00000319032:R16W	R	+	1	2	DYRK1A	37766891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	CGG	DYRK1A	-	NULL	ENSG00000157540		0.438	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	93	0.00	0	C	NM_001396		38845021	38845021	+1	no_errors	ENST00000398960	ensembl	human	known	69_37n	missense	46	26.98	17	SNP	1.000	T
DYRK1A	1859	genome.wustl.edu	37	21	38845021	38845021	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr21:38845021C>T	ENST00000398960.2	+	2	121	c.46C>T	c.(46-48)Cgg>Tgg	p.R16W	DYRK1A_ENST00000321219.8_Missense_Mutation_p.R16W|DYRK1A_ENST00000339659.4_Missense_Mutation_p.R16W|DYRK1A_ENST00000398956.2_Missense_Mutation_p.R16W|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000451934.1_Missense_Mutation_p.R16W|DYRK1A_ENST00000338785.3_Missense_Mutation_p.R16W	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	16					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)	p.R16W(1)		breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TTCATCTGTTCGGCTTGCACC	0.438																																					Melanoma(114;464 1602 31203 43785 45765)	dbGAP											1	Substitution - Missense(1)	breast(1)											114.0	109.0	110.0					21																	38845021		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.46C>T	21.37:g.38845021C>T	ENSP00000381932:p.Arg16Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R16W	ENST00000398960.2	37	c.46	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	C	37	6.047780	0.97236	.	.	ENSG00000157540	ENST00000338785;ENST00000455097;ENST00000426672;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	T;T;T;T;T;T;T	0.60424	0.29;0.37;0.19;0.32;0.29;0.19;0.33	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	L	0.43152	1.355	0.80722	D	1	D;D;D;D;D	0.71674	0.998;0.998;0.997;0.998;0.998	P;P;P;P;P	0.53954	0.738;0.738;0.454;0.656;0.738	T	0.66460	-0.5918	10	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	16;16;16;16;16	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	W	16	ENSP00000342690:R16W;ENSP00000412269:R16W;ENSP00000340373:R16W;ENSP00000319032:R16W;ENSP00000416089:R16W;ENSP00000381932:R16W;ENSP00000381929:R16W	ENSP00000319032:R16W	R	+	1	2	DYRK1A	37766891	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	CGG	DYRK1A	-	NULL	ENSG00000157540		0.438	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	93	0.00	0	C	NM_001396		38845021	38845021	+1	no_errors	ENST00000398960	ensembl	human	known	69_37n	missense	66	30.53	29	SNP	1.000	T
DYRK1A	1859	genome.wustl.edu	37	21	38853104	38853104	+	Missense_Mutation	SNP	G	G	C	rs1049775		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr21:38853104G>C	ENST00000398960.2	+	4	567	c.492G>C	c.(490-492)ttG>ttC	p.L164F	DYRK1A_ENST00000321219.8_Missense_Mutation_p.L164F|DYRK1A_ENST00000339659.4_Missense_Mutation_p.L155F|DYRK1A_ENST00000398956.2_Missense_Mutation_p.L164F|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000451934.1_Missense_Mutation_p.L164F|DYRK1A_ENST00000338785.3_Missense_Mutation_p.L164F	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	164	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TTGACTCCTTGATAGGCAAAG	0.348																																					Melanoma(114;464 1602 31203 43785 45765)	dbGAP											0													105.0	106.0	106.0					21																	38853104		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.492G>C	21.37:g.38853104G>C	ENSP00000381932:p.Leu164Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L164F	ENST00000398960.2	37	c.492	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234521	0.79800	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	5.24	-2.37	0.06643	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.28797	0.0714	L	0.31926	0.97	0.80722	D	1	D;D;D;D;D	0.69078	0.979;0.979;0.997;0.997;0.979	P;P;D;D;P	0.68765	0.847;0.847;0.96;0.933;0.847	T	0.02232	-1.1191	10	0.87932	D	0	.	12.5711	0.56337	0.8327:0.0:0.1673:0.0	.	164;164;164;155;164	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	F	164;155;164;164;164;164	ENSP00000342690:L164F;ENSP00000340373:L155F;ENSP00000319032:L164F;ENSP00000416089:L164F;ENSP00000381932:L164F;ENSP00000381929:L164F	ENSP00000319032:L164F	L	+	3	2	DYRK1A	37774974	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	0.801000	0.27055	-0.290000	0.09025	0.655000	0.94253	TTG	DYRK1A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000157540		0.348	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	150	0.00	0	G	NM_001396		38853104	38853104	+1	no_errors	ENST00000398960	ensembl	human	known	69_37n	missense	169	13.78	27	SNP	0.982	C
DYRK1A	1859	genome.wustl.edu	37	21	38853104	38853104	+	Missense_Mutation	SNP	G	G	C	rs1049775		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr21:38853104G>C	ENST00000398960.2	+	4	567	c.492G>C	c.(490-492)ttG>ttC	p.L164F	DYRK1A_ENST00000321219.8_Missense_Mutation_p.L164F|DYRK1A_ENST00000339659.4_Missense_Mutation_p.L155F|DYRK1A_ENST00000398956.2_Missense_Mutation_p.L164F|DYRK1A_ENST00000462274.1_3'UTR|DYRK1A_ENST00000451934.1_Missense_Mutation_p.L164F|DYRK1A_ENST00000338785.3_Missense_Mutation_p.L164F	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	164	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						TTGACTCCTTGATAGGCAAAG	0.348																																					Melanoma(114;464 1602 31203 43785 45765)	dbGAP											0													105.0	106.0	106.0					21																	38853104		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.492G>C	21.37:g.38853104G>C	ENSP00000381932:p.Leu164Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L164F	ENST00000398960.2	37	c.492	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	G	22.0	4.234521	0.79800	.	.	ENSG00000157540	ENST00000338785;ENST00000339659;ENST00000321219;ENST00000451934;ENST00000398960;ENST00000398956	T;T;T;T;T;T	0.21932	1.98;1.98;1.98;1.98;1.98;1.98	5.24	-2.37	0.06643	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.28797	0.0714	L	0.31926	0.97	0.80722	D	1	D;D;D;D;D	0.69078	0.979;0.979;0.997;0.997;0.979	P;P;D;D;P	0.68765	0.847;0.847;0.96;0.933;0.847	T	0.02232	-1.1191	10	0.87932	D	0	.	12.5711	0.56337	0.8327:0.0:0.1673:0.0	.	164;164;164;155;164	Q13627-3;Q13627-4;Q13627;Q13627-2;Q13627-5	.;.;DYR1A_HUMAN;.;.	F	164;155;164;164;164;164	ENSP00000342690:L164F;ENSP00000340373:L155F;ENSP00000319032:L164F;ENSP00000416089:L164F;ENSP00000381932:L164F;ENSP00000381929:L164F	ENSP00000319032:L164F	L	+	3	2	DYRK1A	37774974	1.000000	0.71417	0.992000	0.48379	0.998000	0.95712	0.801000	0.27055	-0.290000	0.09025	0.655000	0.94253	TTG	DYRK1A	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000157540		0.348	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	150	0.00	0	G	NM_001396		38853104	38853104	+1	no_errors	ENST00000398960	ensembl	human	known	69_37n	missense	99	13.91	16	SNP	0.982	C
EDDM3A	10876	genome.wustl.edu	37	14	21216085	21216085	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:21216085G>A	ENST00000326842.2	+	2	473	c.346G>A	c.(346-348)Gag>Aag	p.E116K		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	116					sperm displacement (GO:0007321)	extracellular space (GO:0005615)		p.E116K(1)		breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						TAGGTACACAGAGAGCAGAAG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	75.0	81.0					14																	21216085		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.346G>A	14.37:g.21216085G>A	ENSP00000315098:p.Glu116Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN33	Missense_Mutation	SNP	superfamily_RNaseA_domain	p.E116K	ENST00000326842.2	37	c.346	CCDS9556.1	14	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992351	0.54041	.	.	ENSG00000181562	ENST00000326842	T	0.72725	-0.68	2.46	1.53	0.23141	Ribonuclease A, domain (2);	0.558727	0.15752	N	0.246383	T	0.70386	0.3218	L	0.55481	1.735	0.09310	N	1	P	0.49961	0.93	P	0.54372	0.75	T	0.59590	-0.7426	10	0.72032	D	0.01	.	4.4368	0.11554	0.1964:0.0:0.8036:0.0	.	116	Q14507	EP3A_HUMAN	K	116	ENSP00000315098:E116K	ENSP00000315098:E116K	E	+	1	0	EDDM3A	20285925	0.707000	0.27866	0.008000	0.14137	0.155000	0.21991	2.423000	0.44705	1.360000	0.45960	0.313000	0.20887	GAG	EDDM3A	-	superfamily_RNaseA_domain	ENSG00000181562		0.443	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDDM3A	HGNC	protein_coding	OTTHUMT00000073742.3	106	0.00	0	G			21216085	21216085	+1	no_errors	ENST00000326842	ensembl	human	known	69_37n	missense	101	15.83	19	SNP	0.001	A
EDDM3A	10876	genome.wustl.edu	37	14	21216085	21216085	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:21216085G>A	ENST00000326842.2	+	2	473	c.346G>A	c.(346-348)Gag>Aag	p.E116K		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	116					sperm displacement (GO:0007321)	extracellular space (GO:0005615)		p.E116K(1)		breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						TAGGTACACAGAGAGCAGAAG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											91.0	75.0	81.0					14																	21216085		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.346G>A	14.37:g.21216085G>A	ENSP00000315098:p.Glu116Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN33	Missense_Mutation	SNP	superfamily_RNaseA_domain	p.E116K	ENST00000326842.2	37	c.346	CCDS9556.1	14	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992351	0.54041	.	.	ENSG00000181562	ENST00000326842	T	0.72725	-0.68	2.46	1.53	0.23141	Ribonuclease A, domain (2);	0.558727	0.15752	N	0.246383	T	0.70386	0.3218	L	0.55481	1.735	0.09310	N	1	P	0.49961	0.93	P	0.54372	0.75	T	0.59590	-0.7426	10	0.72032	D	0.01	.	4.4368	0.11554	0.1964:0.0:0.8036:0.0	.	116	Q14507	EP3A_HUMAN	K	116	ENSP00000315098:E116K	ENSP00000315098:E116K	E	+	1	0	EDDM3A	20285925	0.707000	0.27866	0.008000	0.14137	0.155000	0.21991	2.423000	0.44705	1.360000	0.45960	0.313000	0.20887	GAG	EDDM3A	-	superfamily_RNaseA_domain	ENSG00000181562		0.443	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDDM3A	HGNC	protein_coding	OTTHUMT00000073742.3	106	0.00	0	G			21216085	21216085	+1	no_errors	ENST00000326842	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	0.001	A
EFTUD1P1	648809	genome.wustl.edu	37	15	84782452	84782452	+	RNA	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:84782452G>T	ENST00000558187.1	+	0	596									elongation factor Tu GTP binding domain containing 1 pseudogene 1																		CTCAAGCACTGAAAGCAGGTG	0.458																																						dbGAP											0																																										-	-	-			0					15q25.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000259404	ENSG00000259404			31739	pseudogene	pseudogene	"""similar to hypothetical protein FLJ13119"""		"""family with sequence similarity 42, member B"""	FAM42B			Standard	NR_036652		Approved	HsT19321	uc021stg.1		OTTHUMG00000172493		15.37:g.84782452G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000558187.1	37	NULL		15																																																																																			EFTUD1P1	-	-	ENSG00000259404		0.458	EFTUD1P1-001	KNOWN	basic	processed_transcript	EFTUD1P1	HGNC	pseudogene	OTTHUMT00000418794.1	122	0.00	0	G	NR_036652		84782452	84782452	+1	no_errors	ENST00000560381	ensembl	human	known	69_37n	rna	141	29.85	60	SNP	1.000	T
EFTUD1P1	648809	genome.wustl.edu	37	15	84782452	84782452	+	RNA	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:84782452G>T	ENST00000558187.1	+	0	596									elongation factor Tu GTP binding domain containing 1 pseudogene 1																		CTCAAGCACTGAAAGCAGGTG	0.458																																						dbGAP											0																																										-	-	-			0					15q25.2	2012-07-04	2012-07-04	2012-07-04	ENSG00000259404	ENSG00000259404			31739	pseudogene	pseudogene	"""similar to hypothetical protein FLJ13119"""		"""family with sequence similarity 42, member B"""	FAM42B			Standard	NR_036652		Approved	HsT19321	uc021stg.1		OTTHUMG00000172493		15.37:g.84782452G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000558187.1	37	NULL		15																																																																																			EFTUD1P1	-	-	ENSG00000259404		0.458	EFTUD1P1-001	KNOWN	basic	processed_transcript	EFTUD1P1	HGNC	pseudogene	OTTHUMT00000418794.1	122	0.00	0	G	NR_036652		84782452	84782452	+1	no_errors	ENST00000560381	ensembl	human	known	69_37n	rna	82	33.33	41	SNP	1.000	T
EIF2D	1939	genome.wustl.edu	37	1	206776375	206776375	+	Silent	SNP	G	G	C	rs543476235		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:206776375G>C	ENST00000271764.2	-	6	922	c.714C>G	c.(712-714)ctC>ctG	p.L238L	EIF2D_ENST00000367114.3_Intron	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	238					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)	p.L238L(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGGCTTCTGAGAGAGACTTGT	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											180.0	159.0	166.0					1																	206776375		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.714C>G	1.37:g.206776375G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Silent	SNP	pfam_TIF_SUI1,superfamily_TIF_SUI1,superfamily_SWIB_MDM2_domain,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,pfscan_TIF_SUI1	p.L238	ENST00000271764.2	37	c.714	CCDS1465.1	1																																																																																			EIF2D	-	NULL	ENSG00000143486		0.552	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2D	HGNC	protein_coding	OTTHUMT00000088475.1	201	0.00	0	G	NM_006893		206776375	206776375	-1	no_errors	ENST00000271764	ensembl	human	known	69_37n	silent	191	17.32	40	SNP	0.000	C
EIF2D	1939	genome.wustl.edu	37	1	206776375	206776375	+	Silent	SNP	G	G	C	rs543476235		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:206776375G>C	ENST00000271764.2	-	6	922	c.714C>G	c.(712-714)ctC>ctG	p.L238L	EIF2D_ENST00000367114.3_Intron	NM_006893.2	NP_008824.2	P41214	EIF2D_HUMAN	eukaryotic translation initiation factor 2D	238					formation of translation preinitiation complex (GO:0001731)|intracellular protein transport (GO:0006886)|IRES-dependent translational initiation (GO:0002192)|ribosome disassembly (GO:0032790)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor activity (GO:0004872)|translation initiation factor activity (GO:0003743)	p.L238L(1)		autonomic_ganglia(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(3)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	23						GGGCTTCTGAGAGAGACTTGT	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											180.0	159.0	166.0					1																	206776375		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001585	CCDS1465.1, CCDS55680.1	1q32.1	2014-05-06	2011-01-19	2011-01-19	ENSG00000143486	ENSG00000143486			6583	protein-coding gene	gene with protein product		613709				20566627	Standard	NM_001201478		Approved	LGTN	uc001heh.2	P41214	OTTHUMG00000184619	ENST00000271764.2:c.714C>G	1.37:g.206776375G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SY40|Q8IXV3|Q96DG3|Q96TG7|Q9NR27|Q9NSN0|Q9NV18|Q9NZ21	Silent	SNP	pfam_TIF_SUI1,superfamily_TIF_SUI1,superfamily_SWIB_MDM2_domain,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,pfscan_TIF_SUI1	p.L238	ENST00000271764.2	37	c.714	CCDS1465.1	1																																																																																			EIF2D	-	NULL	ENSG00000143486		0.552	EIF2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2D	HGNC	protein_coding	OTTHUMT00000088475.1	201	0.00	0	G	NM_006893		206776375	206776375	-1	no_errors	ENST00000271764	ensembl	human	known	69_37n	silent	295	15.71	55	SNP	0.000	C
EIF2S2	8894	genome.wustl.edu	37	20	32685285	32685285	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:32685285G>C	ENST00000374980.2	-	5	692	c.471C>G	c.(469-471)atC>atG	p.I157M		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	157					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.I157M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						TACTGAATGAGATACCATCAT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	98.0	102.0					20																	32685285		2203	4299	6502	-	-	-	SO:0001583	missense	0			M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.471C>G	20.37:g.32685285G>C	ENSP00000364119:p.Ile157Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5	p.I157M	ENST00000374980.2	37	c.471	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567910	0.45798	.	.	ENSG00000125977	ENST00000374980	T	0.46451	0.87	6.16	2.02	0.26589	.	0.000000	0.85682	D	0.000000	T	0.48696	0.1514	M	0.62016	1.91	0.50632	D	0.999886	D;D;D	0.61080	0.978;0.989;0.989	P;P;P	0.56916	0.736;0.809;0.809	T	0.38112	-0.9676	10	0.48119	T	0.1	-8.5359	6.0166	0.19607	0.2791:0.0:0.5976:0.1234	.	157;157;157	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	M	157	ENSP00000364119:I157M	ENSP00000364119:I157M	I	-	3	3	EIF2S2	32148946	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	1.691000	0.37721	0.155000	0.19261	0.650000	0.86243	ATC	EIF2S2	-	NULL	ENSG00000125977		0.423	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	HGNC	protein_coding	OTTHUMT00000078765.2	139	0.00	0	G	NM_003908		32685285	32685285	-1	no_errors	ENST00000374980	ensembl	human	known	69_37n	missense	128	26.44	46	SNP	1.000	C
EIF2S2	8894	genome.wustl.edu	37	20	32685285	32685285	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:32685285G>C	ENST00000374980.2	-	5	692	c.471C>G	c.(469-471)atC>atG	p.I157M		NM_003908.3	NP_003899.2	P20042	IF2B_HUMAN	eukaryotic translation initiation factor 2, subunit 2 beta, 38kDa	157					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|male germ cell proliferation (GO:0002176)|male gonad development (GO:0008584)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)|eukaryotic translation initiation factor 2 complex (GO:0005850)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)	p.I157M(1)		breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(1)|prostate(3)|upper_aerodigestive_tract(1)	11						TACTGAATGAGATACCATCAT	0.423																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	98.0	102.0					20																	32685285		2203	4299	6502	-	-	-	SO:0001583	missense	0			M29536	CCDS13231.1	20q11.2	2012-04-17	2002-08-29		ENSG00000125977	ENSG00000125977		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	3266	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 67"""	603908	"""eukaryotic translation initiation factor 2, subunit 2 (beta, 38kD )"""	EIF2		3044606	Standard	XM_005260605		Approved	EIF2beta, PPP1R67	uc031rsu.1	P20042	OTTHUMG00000032287	ENST00000374980.2:c.471C>G	20.37:g.32685285G>C	ENSP00000364119:p.Ile157Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BVU0|Q9UJE4	Missense_Mutation	SNP	pfam_Transl_init_fac_IF2/IF5,superfamily_Transl_init_fac_IF2/IF5_N,superfamily_Transl_init_fac_IF2/IF5_Zn-bd,smart_Transl_init_fac_IF2/IF5	p.I157M	ENST00000374980.2	37	c.471	CCDS13231.1	20	.	.	.	.	.	.	.	.	.	.	G	14.55	2.567910	0.45798	.	.	ENSG00000125977	ENST00000374980	T	0.46451	0.87	6.16	2.02	0.26589	.	0.000000	0.85682	D	0.000000	T	0.48696	0.1514	M	0.62016	1.91	0.50632	D	0.999886	D;D;D	0.61080	0.978;0.989;0.989	P;P;P	0.56916	0.736;0.809;0.809	T	0.38112	-0.9676	10	0.48119	T	0.1	-8.5359	6.0166	0.19607	0.2791:0.0:0.5976:0.1234	.	157;157;157	B5BU01;Q6IBR8;P20042	.;.;IF2B_HUMAN	M	157	ENSP00000364119:I157M	ENSP00000364119:I157M	I	-	3	3	EIF2S2	32148946	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	1.691000	0.37721	0.155000	0.19261	0.650000	0.86243	ATC	EIF2S2	-	NULL	ENSG00000125977		0.423	EIF2S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2S2	HGNC	protein_coding	OTTHUMT00000078765.2	139	0.00	0	G	NM_003908		32685285	32685285	-1	no_errors	ENST00000374980	ensembl	human	known	69_37n	missense	191	25.87	67	SNP	1.000	C
EML2	24139	genome.wustl.edu	37	19	46116900	46116900	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:46116900C>G	ENST00000245925.3	-	18	1773	c.1723G>C	c.(1723-1725)Gat>Cat	p.D575H	EML2_ENST00000589876.1_Missense_Mutation_p.D575H|EML2_ENST00000587152.1_Missense_Mutation_p.D776H|EML2_ENST00000536630.1_Missense_Mutation_p.D722H	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	575	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.D575H(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCGTTGATATCAGTGCCGTCC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	108.0	116.0					19																	46116900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1723G>C	19.37:g.46116900C>G	ENSP00000245925:p.Asp575His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D776H	ENST00000245925.3	37	c.2326	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327806	0.41197	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	T;T	0.29655	1.56;2.78	4.75	3.64	0.41730	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.048724	0.85682	D	0.000000	T	0.58337	0.2115	M	0.86864	2.845	0.53005	D	0.999963	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.996	T	0.64266	-0.6448	10	0.59425	D	0.04	-34.0828	12.9473	0.58379	0.0:0.8353:0.1647:0.0	.	741;722;575	B7Z3Q9;B7Z3I2;O95834	.;.;EMAL2_HUMAN	H	722;575;733	ENSP00000442365:D722H;ENSP00000245925:D575H	ENSP00000245925:D575H	D	-	1	0	EML2	50808740	1.000000	0.71417	0.923000	0.36655	0.002000	0.02628	7.251000	0.78297	2.653000	0.90120	0.563000	0.77884	GAT	EML2	-	superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000125746		0.572	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	111	0.00	0	C	NM_012155		46116900	46116900	-1	no_errors	ENST00000587152	ensembl	human	known	69_37n	missense	24	46.67	21	SNP	0.991	G
EML2	24139	genome.wustl.edu	37	19	46116900	46116900	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:46116900C>G	ENST00000245925.3	-	18	1773	c.1723G>C	c.(1723-1725)Gat>Cat	p.D575H	EML2_ENST00000589876.1_Missense_Mutation_p.D575H|EML2_ENST00000587152.1_Missense_Mutation_p.D776H|EML2_ENST00000536630.1_Missense_Mutation_p.D722H	NM_012155.2	NP_036287.1	O95834	EMAL2_HUMAN	echinoderm microtubule associated protein like 2	575	Tandem atypical propeller in EMLs. {ECO:0000250}.				negative regulation of microtubule polymerization (GO:0031115)|regulation of microtubule nucleation (GO:0010968)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	microtubule binding (GO:0008017)|tubulin binding (GO:0015631)	p.D575H(1)		NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(13)|ovary(1)|urinary_tract(1)	31		Ovarian(192;0.179)|all_neural(266;0.224)		OV - Ovarian serous cystadenocarcinoma(262;0.00553)|GBM - Glioblastoma multiforme(486;0.131)|Epithelial(262;0.197)		GCGTTGATATCAGTGCCGTCC	0.572																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	108.0	116.0					19																	46116900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF103939	CCDS12670.1, CCDS54280.1, CCDS59399.1	19q13.32	2013-01-10				ENSG00000125746		"""WD repeat domain containing"""	18035	protein-coding gene	gene with protein product	"""echinoderm MT-associated protein (EMAP)-like protein 70"", ""microtubule-associated protein like echinoderm EMAP"""					11694528, 10521658	Standard	NM_012155		Approved	EMAP2, ELP70, EMAP-2	uc010xxm.2	O95834		ENST00000245925.3:c.1723G>C	19.37:g.46116900C>G	ENSP00000245925:p.Asp575His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3I2|B7Z3Q9|K7ERL7|Q59EN8|Q8N5A2|Q9UG50	Missense_Mutation	SNP	pfam_HELP,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D776H	ENST00000245925.3	37	c.2326	CCDS12670.1	19	.	.	.	.	.	.	.	.	.	.	C	13.74	2.327806	0.41197	.	.	ENSG00000125746	ENST00000536630;ENST00000245925;ENST00000448055	T;T	0.29655	1.56;2.78	4.75	3.64	0.41730	WD40/YVTN repeat-like-containing domain (1);Soluble quinoprotein glucose/sorbosone dehydrogenase (1);WD40-repeat-containing domain (1);	0.048724	0.85682	D	0.000000	T	0.58337	0.2115	M	0.86864	2.845	0.53005	D	0.999963	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.996;0.998;0.996	T	0.64266	-0.6448	10	0.59425	D	0.04	-34.0828	12.9473	0.58379	0.0:0.8353:0.1647:0.0	.	741;722;575	B7Z3Q9;B7Z3I2;O95834	.;.;EMAL2_HUMAN	H	722;575;733	ENSP00000442365:D722H;ENSP00000245925:D575H	ENSP00000245925:D575H	D	-	1	0	EML2	50808740	1.000000	0.71417	0.923000	0.36655	0.002000	0.02628	7.251000	0.78297	2.653000	0.90120	0.563000	0.77884	GAT	EML2	-	superfamily_Quinoprot_gluc/sorb_DH,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000125746		0.572	EML2-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	EML2	HGNC	protein_coding	OTTHUMT00000459608.1	111	0.00	0	C	NM_012155		46116900	46116900	-1	no_errors	ENST00000587152	ensembl	human	known	69_37n	missense	42	38.24	26	SNP	0.991	G
ENAH	55740	genome.wustl.edu	37	1	225742783	225742783	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:225742783G>A	ENST00000366844.3	-	3	625	c.174C>T	c.(172-174)gtC>gtT	p.V58V	ENAH_ENST00000391874.2_5'UTR|ENAH_ENST00000284563.6_Silent_p.V58V|ENAH_ENST00000366843.2_Silent_p.V58V	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	58	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)	p.V58V(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		AGTTTATCACGACCTAAAAAA	0.363																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	77.0	80.0					1																	225742783		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.174C>T	1.37:g.225742783G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Silent	SNP	pfam_EVH1,pfam_VASP_tetra,smart_EVH1,pfscan_EVH1	p.V58	ENST00000366844.3	37	c.174	CCDS31041.1	1																																																																																			ENAH	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000154380		0.363	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	HGNC	protein_coding	OTTHUMT00000357426.2	95	0.00	0	G	NM_018212		225742783	225742783	-1	no_errors	ENST00000366844	ensembl	human	known	69_37n	silent	100	17.36	21	SNP	0.925	A
ENAH	55740	genome.wustl.edu	37	1	225742783	225742783	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:225742783G>A	ENST00000366844.3	-	3	625	c.174C>T	c.(172-174)gtC>gtT	p.V58V	ENAH_ENST00000391874.2_5'UTR|ENAH_ENST00000284563.6_Silent_p.V58V|ENAH_ENST00000366843.2_Silent_p.V58V	NM_001008493.1|NM_018212.4	NP_001008493.1|NP_060682.2	Q8N8S7	ENAH_HUMAN	enabled homolog (Drosophila)	58	WH1. {ECO:0000255|PROSITE- ProRule:PRU00410}.				actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|intracellular transport (GO:0046907)|neural tube closure (GO:0001843)|T cell receptor signaling pathway (GO:0050852)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)|synapse (GO:0045202)	WW domain binding (GO:0050699)	p.V58V(1)		NS(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	23	Breast(184;0.206)			GBM - Glioblastoma multiforme(131;0.19)		AGTTTATCACGACCTAAAAAA	0.363																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											87.0	77.0	80.0					1																	225742783		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001635	CCDS31040.1, CCDS31041.1	1q32.2	2013-08-06			ENSG00000154380	ENSG00000154380			18271	protein-coding gene	gene with protein product	"""mammalian enabled"""	609061				1420303	Standard	XM_005273182		Approved	FLJ10773, NDPP1, MENA	uc001hpc.1	Q8N8S7	OTTHUMG00000037742	ENST00000366844.3:c.174C>T	1.37:g.225742783G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D0PQI2|Q502W5|Q5T5M7|Q5VTQ9|Q5VTR0|Q9NVF3|Q9UFB8	Silent	SNP	pfam_EVH1,pfam_VASP_tetra,smart_EVH1,pfscan_EVH1	p.V58	ENST00000366844.3	37	c.174	CCDS31041.1	1																																																																																			ENAH	-	pfam_EVH1,smart_EVH1,pfscan_EVH1	ENSG00000154380		0.363	ENAH-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENAH	HGNC	protein_coding	OTTHUMT00000357426.2	95	0.00	0	G	NM_018212		225742783	225742783	-1	no_errors	ENST00000366844	ensembl	human	known	69_37n	silent	158	18.56	36	SNP	0.925	A
ENPP2	5168	genome.wustl.edu	37	8	120598503	120598503	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:120598503G>C	ENST00000075322.6	-	15	1348	c.1290C>G	c.(1288-1290)ccC>ccG	p.P430P	ENPP2_ENST00000427067.2_Silent_p.P426P|ENPP2_ENST00000259486.6_Silent_p.P482P|ENPP2_ENST00000522167.1_Silent_p.P69P|ENPP2_ENST00000522826.1_Silent_p.P430P	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	430					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P430P(1)|p.P482P(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCAAACGTTTGGGAAGGTGCT	0.388																																					Melanoma(20;305 879 2501 4818 31020)	dbGAP											2	Substitution - coding silent(2)	breast(2)											209.0	181.0	190.0					8																	120598503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1290C>G	8.37:g.120598503G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.P482	ENST00000075322.6	37	c.1446	CCDS34936.1	8																																																																																			ENPP2	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000136960		0.388	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENPP2	HGNC	protein_coding	OTTHUMT00000381390.1	217	0.00	0	G			120598503	120598503	-1	no_errors	ENST00000259486	ensembl	human	known	69_37n	silent	169	20.66	44	SNP	1.000	C
ENPP2	5168	genome.wustl.edu	37	8	120598503	120598503	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:120598503G>C	ENST00000075322.6	-	15	1348	c.1290C>G	c.(1288-1290)ccC>ccG	p.P430P	ENPP2_ENST00000427067.2_Silent_p.P426P|ENPP2_ENST00000259486.6_Silent_p.P482P|ENPP2_ENST00000522167.1_Silent_p.P69P|ENPP2_ENST00000522826.1_Silent_p.P430P	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	430					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.P430P(1)|p.P482P(1)		breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCAAACGTTTGGGAAGGTGCT	0.388																																					Melanoma(20;305 879 2501 4818 31020)	dbGAP											2	Substitution - coding silent(2)	breast(2)											209.0	181.0	190.0					8																	120598503		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1290C>G	8.37:g.120598503G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Silent	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.P482	ENST00000075322.6	37	c.1446	CCDS34936.1	8																																																																																			ENPP2	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000136960		0.388	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENPP2	HGNC	protein_coding	OTTHUMT00000381390.1	217	0.00	0	G			120598503	120598503	-1	no_errors	ENST00000259486	ensembl	human	known	69_37n	silent	275	21.20	74	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	1	146244578	146244578	+	IGR	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:146244578G>A								RP4-565E6.1 (95244 upstream) : HYDIN2 (89599 downstream)																							TGAGGCTTCTGAACTGCTGTT	0.468																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0																															1.37:g.146244578G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NBPF_dom	p.S413L		37	c.1238		1	.	.	.	.	.	.	.	.	.	.	.	0.311	-0.967881	0.02232	.	.	ENSG00000232637	ENST00000491285	.	.	.	0.846	-0.221	0.13126	.	.	.	.	.	T	0.11537	0.0281	.	.	.	.	.	.	.	.	.	.	.	.	T	0.24764	-1.0151	3	.	.	.	.	3.1059	0.06341	0.35:0.0:0.65:0.0	.	.	.	.	L	413	.	.	S	-	2	0	WI2-3658N16.1	146059478	0.004000	0.15560	0.001000	0.08648	0.151000	0.21798	0.731000	0.26058	-0.052000	0.13311	0.074000	0.15403	TCA	WI2-3658N16.1	-	NULL	ENSG00000232637	0	0.468					ENSG00000232637	Clone_based_vega_gene			17	0.00	0	G			146244578	146244578	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000491285	ensembl	human	novel	69_37n	missense	7	36.36	4	SNP	0.001	A
ERBB4	2066	genome.wustl.edu	37	2	212285277	212285277	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:212285277C>T	ENST00000342788.4	-	25	3334	c.3024G>A	c.(3022-3024)ttG>ttA	p.L1008L	ERBB4_ENST00000436443.1_Silent_p.L1008L|ERBB4_ENST00000402597.1_Silent_p.L998L	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1008					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L1008L(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CCTCTTCATCCAAGAGATTCT	0.423										TSP Lung(8;0.080)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											96.0	88.0	91.0					2																	212285277		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3024G>A	2.37:g.212285277C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L1008	ENST00000342788.4	37	c.3024	CCDS2394.1	2																																																																																			ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Kinase-like_dom	ENSG00000178568		0.423	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	123	0.00	0	C	NM_001042599		212285277	212285277	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	silent	145	26.02	51	SNP	1.000	T
ERBB4	2066	genome.wustl.edu	37	2	212285277	212285277	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:212285277C>T	ENST00000342788.4	-	25	3334	c.3024G>A	c.(3022-3024)ttG>ttA	p.L1008L	ERBB4_ENST00000436443.1_Silent_p.L1008L|ERBB4_ENST00000402597.1_Silent_p.L998L	NM_005235.2	NP_005226.1	Q15303	ERBB4_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 4	1008					cardiac muscle tissue regeneration (GO:0061026)|cell fate commitment (GO:0045165)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system morphogenesis (GO:0021551)|embryonic pattern specification (GO:0009880)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell differentiation (GO:0060644)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neural crest cell migration (GO:0001755)|neurotrophin TRK receptor signaling pathway (GO:0048011)|olfactory bulb interneuron differentiation (GO:0021889)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell migration (GO:0030334)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	basolateral plasma membrane (GO:0016323)|cytosol (GO:0005829)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transcription regulatory region DNA binding (GO:0044212)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.L1008L(1)		NS(1)|breast(7)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(31)|lung(71)|pancreas(1)|prostate(3)|skin(39)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	179		Renal(323;0.06)|Lung NSC(271;0.197)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;5.86e-06)|all cancers(144;2.95e-05)|Lung(261;0.00244)|LUSC - Lung squamous cell carcinoma(224;0.00266)	Afatinib(DB08916)	CCTCTTCATCCAAGAGATTCT	0.423										TSP Lung(8;0.080)																												dbGAP											1	Substitution - coding silent(1)	breast(1)											96.0	88.0	91.0					2																	212285277		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L07868	CCDS2394.1, CCDS42811.1	2q33.3-q34	2013-10-11	2013-07-09		ENSG00000178568	ENSG00000178568			3432	protein-coding gene	gene with protein product		600543	"""v-erb-a avian erythroblastic leukemia viral oncogene homolog-like 4"""			7700649, 17018285	Standard	NM_001042599		Approved	ALS19	uc002veg.1	Q15303	OTTHUMG00000133012	ENST00000342788.4:c.3024G>A	2.37:g.212285277C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLD7|B7ZLE2|B7ZLE3|Q2M1W1|Q59EW4	Silent	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L1008	ENST00000342788.4	37	c.3024	CCDS2394.1	2																																																																																			ERBB4	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Kinase-like_dom	ENSG00000178568		0.423	ERBB4-001	KNOWN	basic|CCDS	protein_coding	ERBB4	HGNC	protein_coding	OTTHUMT00000256597.1	123	0.00	0	C	NM_001042599		212285277	212285277	-1	no_errors	ENST00000342788	ensembl	human	known	69_37n	silent	82	26.13	29	SNP	1.000	T
PLK1	5347	genome.wustl.edu	37	16	23702689	23702689	+	IGR	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:23702689C>T	ENST00000300093.4	+	0	2227				ERN2_ENST00000457008.2_Missense_Mutation_p.E760K|ERN2_ENST00000256797.4_Missense_Mutation_p.E860K	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E860K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		CCTCCCGCCTCCAGTGCCCTC	0.672																																					Colon(12;240 564 27038 33155)	dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	28.0	28.0					16																	23702689		2195	4300	6495	-	-	-	SO:0001628	intergenic_variant	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23702689C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15153|Q99746	Nonsense_Mutation	SNP	pfam_KEN_RNase_activator,superfamily_Kinase-like_dom,smart_PUG-dom	p.W73*	ENST00000300093.4	37	c.219	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	C	33	5.251498	0.95305	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.36340	1.26;1.26	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.70945	0.3282	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78425	-0.2209	10	0.87932	D	0	.	17.5566	0.87892	0.0:1.0:0.0:0.0	.	760;812	E7ETG2;A5YM65	.;.	K	860;760	ENSP00000256797:E860K;ENSP00000413812:E760K	ENSP00000256797:E860K	E	-	1	0	ERN2	23610190	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	5.735000	0.68587	2.745000	0.94114	0.655000	0.94253	GAG	ERN2	-	pfam_KEN_RNase_activator,superfamily_Kinase-like_dom	ENSG00000134398		0.672	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000214057.2	61	0.00	0	C	NM_005030		23702689	23702689	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000562458	ensembl	human	putative	69_37n	nonsense	16	23.81	5	SNP	1.000	T
PLK1	5347	genome.wustl.edu	37	16	23702689	23702689	+	IGR	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:23702689C>T	ENST00000300093.4	+	0	2227				ERN2_ENST00000457008.2_Missense_Mutation_p.E760K|ERN2_ENST00000256797.4_Missense_Mutation_p.E860K	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1						activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)	p.E860K(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		CCTCCCGCCTCCAGTGCCCTC	0.672																																					Colon(12;240 564 27038 33155)	dbGAP											1	Substitution - Missense(1)	breast(1)											27.0	28.0	28.0					16																	23702689		2195	4300	6495	-	-	-	SO:0001628	intergenic_variant	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984		16.37:g.23702689C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15153|Q99746	Nonsense_Mutation	SNP	pfam_KEN_RNase_activator,superfamily_Kinase-like_dom,smart_PUG-dom	p.W73*	ENST00000300093.4	37	c.219	CCDS10616.1	16	.	.	.	.	.	.	.	.	.	.	C	33	5.251498	0.95305	.	.	ENSG00000134398	ENST00000256797;ENST00000457008	T;T	0.36340	1.26;1.26	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.70945	0.3282	M	0.93241	3.395	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.78425	-0.2209	10	0.87932	D	0	.	17.5566	0.87892	0.0:1.0:0.0:0.0	.	760;812	E7ETG2;A5YM65	.;.	K	860;760	ENSP00000256797:E860K;ENSP00000413812:E760K	ENSP00000256797:E860K	E	-	1	0	ERN2	23610190	1.000000	0.71417	1.000000	0.80357	0.627000	0.37826	5.735000	0.68587	2.745000	0.94114	0.655000	0.94253	GAG	ERN2	-	pfam_KEN_RNase_activator,superfamily_Kinase-like_dom	ENSG00000134398		0.672	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000214057.2	61	0.00	0	C	NM_005030		23702689	23702689	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000562458	ensembl	human	putative	69_37n	nonsense	19	29.63	8	SNP	1.000	T
ESPN	83715	genome.wustl.edu	37	1	6504709	6504709	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:6504709C>A	ENST00000377828.1	+	6	1327	c.1159C>A	c.(1159-1161)Cac>Aac	p.H387N	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	387					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)	p.H387N(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CTCCTCCAGCCACTCCAGCAT	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	72.0	77.0					1																	6504709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1159C>A	1.37:g.6504709C>A	ENSP00000367059:p.His387Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_WH2_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_WH2_dom	p.H387N	ENST00000377828.1	37	c.1159	CCDS70.1	1	.	.	.	.	.	.	.	.	.	.	c	15.62	2.888610	0.52014	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	T;T	0.40756	1.02;1.02	3.6	3.6	0.41247	.	0.093817	0.43260	D	0.000597	T	0.31358	0.0794	L	0.27053	0.805	0.80722	D	1	P	0.44627	0.839	B	0.41813	0.367	T	0.07481	-1.0770	10	0.29301	T	0.29	-15.4965	13.9725	0.64250	0.0:1.0:0.0:0.0	.	387	B1AK53	ESPN_HUMAN	N	387;172	ENSP00000367059:H387N;ENSP00000401793:H172N	ENSP00000367059:H387N	H	+	1	0	ESPN	6427296	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	5.213000	0.65230	1.857000	0.53885	0.486000	0.48141	CAC	ESPN	-	NULL	ENSG00000187017		0.612	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	HGNC	protein_coding	OTTHUMT00000001887.3	64	0.00	0	C	NM_031475		6504709	6504709	+1	no_errors	ENST00000377828	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	A
ESPN	83715	genome.wustl.edu	37	1	6504709	6504709	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:6504709C>A	ENST00000377828.1	+	6	1327	c.1159C>A	c.(1159-1161)Cac>Aac	p.H387N	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	387					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)	p.H387N(1)		NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		CTCCTCCAGCCACTCCAGCAT	0.612																																						dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	72.0	77.0					1																	6504709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1159C>A	1.37:g.6504709C>A	ENSP00000367059:p.His387Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_WH2_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_WH2_dom	p.H387N	ENST00000377828.1	37	c.1159	CCDS70.1	1	.	.	.	.	.	.	.	.	.	.	c	15.62	2.888610	0.52014	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	T;T	0.40756	1.02;1.02	3.6	3.6	0.41247	.	0.093817	0.43260	D	0.000597	T	0.31358	0.0794	L	0.27053	0.805	0.80722	D	1	P	0.44627	0.839	B	0.41813	0.367	T	0.07481	-1.0770	10	0.29301	T	0.29	-15.4965	13.9725	0.64250	0.0:1.0:0.0:0.0	.	387	B1AK53	ESPN_HUMAN	N	387;172	ENSP00000367059:H387N;ENSP00000401793:H172N	ENSP00000367059:H387N	H	+	1	0	ESPN	6427296	1.000000	0.71417	1.000000	0.80357	0.581000	0.36288	5.213000	0.65230	1.857000	0.53885	0.486000	0.48141	CAC	ESPN	-	NULL	ENSG00000187017		0.612	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	HGNC	protein_coding	OTTHUMT00000001887.3	64	0.00	0	C	NM_031475		6504709	6504709	+1	no_errors	ENST00000377828	ensembl	human	known	69_37n	missense	31	18.42	7	SNP	1.000	A
EVI5L	115704	genome.wustl.edu	37	19	7918195	7918195	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:7918195G>A	ENST00000270530.4	+	10	1318	c.1122G>A	c.(1120-1122)gaG>gaA	p.E374E	EVI5L_ENST00000538904.2_Silent_p.E374E	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	374					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.E374E(1)		breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						AGAGCAAGGAGATGGAGGAGC	0.622											OREG0025211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	49.0	51.0					19																	7918195		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1122G>A	19.37:g.7918195G>A		Somatic	645	WXS	Illumina GAIIx	Phase_IV	B9A6I9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E374	ENST00000270530.4	37	c.1122	CCDS12188.1	19																																																																																			EVI5L	-	NULL	ENSG00000142459		0.622	EVI5L-001	KNOWN	basic|CCDS	protein_coding	EVI5L	HGNC	protein_coding	OTTHUMT00000461347.1	67	0.00	0	G	NM_145245		7918195	7918195	+1	no_errors	ENST00000538904	ensembl	human	known	69_37n	silent	13	31.58	6	SNP	0.997	A
EVI5L	115704	genome.wustl.edu	37	19	7918195	7918195	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:7918195G>A	ENST00000270530.4	+	10	1318	c.1122G>A	c.(1120-1122)gaG>gaA	p.E374E	EVI5L_ENST00000538904.2_Silent_p.E374E	NM_145245.3	NP_660288.1	Q96CN4	EVI5L_HUMAN	ecotropic viral integration site 5-like	374					negative regulation of cilium assembly (GO:1902018)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)		Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)	p.E374E(1)		breast(1)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	12						AGAGCAAGGAGATGGAGGAGC	0.622											OREG0025211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	49.0	51.0					19																	7918195		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0			BC014111	CCDS12188.1, CCDS54209.1	19p13	2013-07-09				ENSG00000142459			30464	protein-coding gene	gene with protein product						23669355	Standard	NM_001159944		Approved		uc010xjz.2	Q96CN4		ENST00000270530.4:c.1122G>A	19.37:g.7918195G>A		Somatic	645	WXS	Illumina GAIIx	Phase_IV	B9A6I9	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E374	ENST00000270530.4	37	c.1122	CCDS12188.1	19																																																																																			EVI5L	-	NULL	ENSG00000142459		0.622	EVI5L-001	KNOWN	basic|CCDS	protein_coding	EVI5L	HGNC	protein_coding	OTTHUMT00000461347.1	67	0.00	0	G	NM_145245		7918195	7918195	+1	no_errors	ENST00000538904	ensembl	human	known	69_37n	silent	19	32.14	9	SNP	0.997	A
EXOC5	10640	genome.wustl.edu	37	14	57696455	57696455	+	Silent	SNP	A	A	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:57696455A>G	ENST00000413566.2	-	12	1652	c.1293T>C	c.(1291-1293)caT>caC	p.H431H	EXOC5_ENST00000340918.7_Silent_p.H366H	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	431					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.H433H(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						CTCTTACCCTATGACATCTTT	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	54.0	55.0					14																	57696455		1613	3444	5057	-	-	-	SO:0001819	synonymous_variant	0			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1293T>C	14.37:g.57696455A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6C5	Silent	SNP	pfam_Sec10-like	p.H431	ENST00000413566.2	37	c.1293	CCDS45111.1	14																																																																																			EXOC5	-	pfam_Sec10-like	ENSG00000070367		0.393	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EXOC5	HGNC	protein_coding	OTTHUMT00000412905.1	132	0.00	0	A	NM_006544		57696455	57696455	-1	no_errors	ENST00000413566	ensembl	human	known	69_37n	silent	140	21.35	38	SNP	1.000	G
EXOC5	10640	genome.wustl.edu	37	14	57696455	57696455	+	Silent	SNP	A	A	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:57696455A>G	ENST00000413566.2	-	12	1652	c.1293T>C	c.(1291-1293)caT>caC	p.H431H	EXOC5_ENST00000340918.7_Silent_p.H366H	NM_006544.3	NP_006535.1	O00471	EXOC5_HUMAN	exocyst complex component 5	431					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|vesicle docking (GO:0048278)	cytoplasm (GO:0005737)|cytosol (GO:0005829)		p.H433H(1)		breast(3)|endometrium(1)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	22						CTCTTACCCTATGACATCTTT	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	54.0	55.0					14																	57696455		1613	3444	5057	-	-	-	SO:0001819	synonymous_variant	0			U85946	CCDS45111.1	14q22.3	2013-01-22	2005-11-01	2005-11-01	ENSG00000070367	ENSG00000070367			10696	protein-coding gene	gene with protein product		604469	"""SEC10 (S. cerevisiae)-like 1"", ""SEC10-like 1 (S. cerevisiae)"""	SEC10L1		9119050	Standard	XM_005267272		Approved	SEC10, SEC10P	uc001xct.3	O00471	OTTHUMG00000171309	ENST00000413566.2:c.1293T>C	14.37:g.57696455A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6C5	Silent	SNP	pfam_Sec10-like	p.H431	ENST00000413566.2	37	c.1293	CCDS45111.1	14																																																																																			EXOC5	-	pfam_Sec10-like	ENSG00000070367		0.393	EXOC5-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	EXOC5	HGNC	protein_coding	OTTHUMT00000412905.1	132	0.00	0	A	NM_006544		57696455	57696455	-1	no_errors	ENST00000413566	ensembl	human	known	69_37n	silent	85	18.27	19	SNP	1.000	G
FAM126B	285172	genome.wustl.edu	37	2	201887608	201887608	+	Silent	SNP	C	C	G	rs17853917	byFrequency	TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:201887608C>G	ENST00000418596.3	-	4	286	c.99G>C	c.(97-99)cgG>cgC	p.R33R	FAM126B_ENST00000485144.1_5'Flank	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	33						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						GTGTTTTTTTCCGGTGTAAAG	0.353																																						dbGAP											0													117.0	115.0	116.0					2																	201887608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.99G>C	2.37:g.201887608C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG7|Q4ZG87|Q53TX6	Silent	SNP	pfam_Hyccin	p.R33	ENST00000418596.3	37	c.99	CCDS2335.1	2																																																																																			FAM126B	-	pfam_Hyccin	ENSG00000155744		0.353	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3	113	0.00	0	C	NM_173822		201887608	201887608	-1	no_errors	ENST00000418596	ensembl	human	known	69_37n	silent	211	24.91	70	SNP	1.000	G
FAM126B	285172	genome.wustl.edu	37	2	201887608	201887608	+	Silent	SNP	C	C	G	rs17853917	byFrequency	TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:201887608C>G	ENST00000418596.3	-	4	286	c.99G>C	c.(97-99)cgG>cgC	p.R33R	FAM126B_ENST00000485144.1_5'Flank	NM_173822.3	NP_776183.1	Q8IXS8	F126B_HUMAN	family with sequence similarity 126, member B	33						intracellular (GO:0005622)				endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	16						GTGTTTTTTTCCGGTGTAAAG	0.353																																						dbGAP											0													117.0	115.0	116.0					2																	201887608		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC039295	CCDS2335.1	2q33.1	2008-10-02			ENSG00000155744	ENSG00000155744			28593	protein-coding gene	gene with protein product						12477932	Standard	NM_173822		Approved	MGC39518, HYCC2	uc002uws.4	Q8IXS8	OTTHUMG00000132823	ENST00000418596.3:c.99G>C	2.37:g.201887608C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCG7|Q4ZG87|Q53TX6	Silent	SNP	pfam_Hyccin	p.R33	ENST00000418596.3	37	c.99	CCDS2335.1	2																																																																																			FAM126B	-	pfam_Hyccin	ENSG00000155744		0.353	FAM126B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM126B	HGNC	protein_coding	OTTHUMT00000256285.3	113	0.00	0	C	NM_173822		201887608	201887608	-1	no_errors	ENST00000418596	ensembl	human	known	69_37n	silent	338	26.04	119	SNP	1.000	G
FAM160B2	64760	genome.wustl.edu	37	8	21957402	21957402	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:21957402G>A	ENST00000289921.7	+	10	1385	c.1339G>A	c.(1339-1341)Gag>Aag	p.E447K		NM_022749.5	NP_073586.5	Q86V87	F16B2_HUMAN	family with sequence similarity 160, member B2	447										endometrium(2)|kidney(1)|lung(2)|prostate(3)|urinary_tract(1)	9						CCTCTCTGATGAGGTACAGTG	0.577																																						dbGAP											0													33.0	38.0	36.0					8																	21957402		1966	4165	6131	-	-	-	SO:0001583	missense	0			AK025454	CCDS6021.2	8p21.3	2012-11-30	2008-06-05	2008-06-05	ENSG00000158863	ENSG00000158863			16492	protein-coding gene	gene with protein product			"""retinoic acid induced 16"""	RAI16		22971576, 15626329	Standard	XR_247128		Approved	FLJ21801	uc011kyx.2	Q86V87	OTTHUMG00000097088	ENST00000289921.7:c.1339G>A	8.37:g.21957402G>A	ENSP00000289921:p.Glu447Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDQ5|B3KNX1|Q2M211|Q71JB5|Q7L3J6|Q969T0|Q9H6W4	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.E447K	ENST00000289921.7	37	c.1339	CCDS6021.2	8	.	.	.	.	.	.	.	.	.	.	.	27.3	4.821350	0.90873	.	.	ENSG00000158863	ENST00000289921	T	0.31769	1.48	5.64	5.64	0.86602	.	0.053237	0.64402	D	0.000001	T	0.53270	0.1786	M	0.67953	2.075	0.80722	D	1	D	0.60575	0.988	D	0.65323	0.934	T	0.50996	-0.8761	10	0.52906	T	0.07	-28.2299	17.2093	0.86926	0.0:0.0:1.0:0.0	.	447	Q86V87	F16B2_HUMAN	K	447	ENSP00000289921:E447K	ENSP00000289921:E447K	E	+	1	0	FAM160B2	22013347	1.000000	0.71417	1.000000	0.80357	0.605000	0.37080	9.231000	0.95317	2.664000	0.90586	0.655000	0.94253	GAG	FAM160B2	-	pfam_RetinoicA-induced_16-like	ENSG00000158863		0.577	FAM160B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160B2	HGNC	protein_coding	OTTHUMT00000375334.2	37	0.00	0	G			21957402	21957402	+1	no_errors	ENST00000289921	ensembl	human	known	69_37n	missense	15	16.67	3	SNP	1.000	A
FBXO21	23014	genome.wustl.edu	37	12	117583909	117583909	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:117583909C>T	ENST00000330622.5	-	12	1869	c.1870G>A	c.(1870-1872)Gag>Aag	p.E624K	FBXO21_ENST00000427718.2_Missense_Mutation_p.E617K			O94952	FBX21_HUMAN	F-box protein 21	624					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)	p.E624K(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TCTATGTTCTCTTTCTTTGCA	0.478																																					GBM(168;452 2038 13535 17701 43680)	dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	131.0	136.0					12																	117583909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1870G>A	12.37:g.117583909C>T	ENSP00000328187:p.Glu624Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	pfam_Hemimethylated_DNA-bd_dom,superfamily_Hemimethylated_DNA-bd_dom,superfamily_F-box_dom_cyclin-like,tigrfam_Hemimethylated_DNA-bd_dom	p.E624K	ENST00000330622.5	37	c.1870	CCDS9184.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.36|16.36	3.101102|3.101102	0.56183|0.56183	.|.	.|.	ENSG00000135108|ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622|ENST00000550180	T;T|.	0.42900|.	0.96;0.96|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.364007|.	0.29473|.	N|.	0.012045|.	T|T	0.34745|0.34745	0.0908|0.0908	N|N	0.14661|0.14661	0.345|0.345	0.32446|0.32446	N|N	0.546093|0.546093	B;B;B|.	0.21606|.	0.058;0.0;0.0|.	B;B;B|.	0.14578|.	0.011;0.001;0.002|.	T|T	0.42430|0.42430	-0.9452|-0.9452	10|5	0.33940|.	T|.	0.23|.	-16.5305|-16.5305	11.3651|11.3651	0.49666|0.49666	0.0:0.9168:0.0:0.0832|0.0:0.9168:0.0:0.0832	.|.	473;624;617|.	Q8IUQ5;O94952;O94952-1|.	.;FBX21_HUMAN;.|.	K|K	617;533;473;624|500	ENSP00000414468:E617K;ENSP00000328187:E624K|.	ENSP00000257563:E533K|.	E|R	-|-	1|2	0|0	FBXO21|FBXO21	116068292|116068292	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.198000|5.198000	0.65147|0.65147	2.410000|2.410000	0.81850|0.81850	0.561000|0.561000	0.74099|0.74099	GAG|AGA	FBXO21	-	NULL	ENSG00000135108		0.478	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXO21	HGNC	protein_coding	OTTHUMT00000404409.1	137	0.00	0	C	NM_033624		117583909	117583909	-1	no_errors	ENST00000330622	ensembl	human	known	69_37n	missense	158	22.17	45	SNP	0.995	T
FBXO21	23014	genome.wustl.edu	37	12	117583909	117583909	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:117583909C>T	ENST00000330622.5	-	12	1869	c.1870G>A	c.(1870-1872)Gag>Aag	p.E624K	FBXO21_ENST00000427718.2_Missense_Mutation_p.E617K			O94952	FBX21_HUMAN	F-box protein 21	624					protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	ubiquitin ligase complex (GO:0000151)	DNA binding (GO:0003677)|ubiquitin-protein transferase activity (GO:0004842)	p.E624K(1)		breast(4)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|pancreas(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	29	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)			BRCA - Breast invasive adenocarcinoma(302;0.0291)		TCTATGTTCTCTTTCTTTGCA	0.478																																					GBM(168;452 2038 13535 17701 43680)	dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	131.0	136.0					12																	117583909		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020682	CCDS9184.1, CCDS44989.1	12q24.23	2004-06-15	2004-06-15					"""F-boxes /  ""other"""""	13592	protein-coding gene	gene with protein product		609095	"""F-box only protein 21"""			10048485, 10531035	Standard	NM_033624		Approved	FBX21, KIAA0875	uc001twk.3	O94952	OTTHUMG00000169495	ENST00000330622.5:c.1870G>A	12.37:g.117583909C>T	ENSP00000328187:p.Glu624Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMF0|Q5BJG0|Q9H087	Missense_Mutation	SNP	pfam_Hemimethylated_DNA-bd_dom,superfamily_Hemimethylated_DNA-bd_dom,superfamily_F-box_dom_cyclin-like,tigrfam_Hemimethylated_DNA-bd_dom	p.E624K	ENST00000330622.5	37	c.1870	CCDS9184.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.36|16.36	3.101102|3.101102	0.56183|0.56183	.|.	.|.	ENSG00000135108|ENSG00000135108	ENST00000427718;ENST00000257563;ENST00000535590;ENST00000330622|ENST00000550180	T;T|.	0.42900|.	0.96;0.96|.	5.18|5.18	5.18|5.18	0.71444|0.71444	.|.	0.364007|.	0.29473|.	N|.	0.012045|.	T|T	0.34745|0.34745	0.0908|0.0908	N|N	0.14661|0.14661	0.345|0.345	0.32446|0.32446	N|N	0.546093|0.546093	B;B;B|.	0.21606|.	0.058;0.0;0.0|.	B;B;B|.	0.14578|.	0.011;0.001;0.002|.	T|T	0.42430|0.42430	-0.9452|-0.9452	10|5	0.33940|.	T|.	0.23|.	-16.5305|-16.5305	11.3651|11.3651	0.49666|0.49666	0.0:0.9168:0.0:0.0832|0.0:0.9168:0.0:0.0832	.|.	473;624;617|.	Q8IUQ5;O94952;O94952-1|.	.;FBX21_HUMAN;.|.	K|K	617;533;473;624|500	ENSP00000414468:E617K;ENSP00000328187:E624K|.	ENSP00000257563:E533K|.	E|R	-|-	1|2	0|0	FBXO21|FBXO21	116068292|116068292	0.991000|0.991000	0.36638|0.36638	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	5.198000|5.198000	0.65147|0.65147	2.410000|2.410000	0.81850|0.81850	0.561000|0.561000	0.74099|0.74099	GAG|AGA	FBXO21	-	NULL	ENSG00000135108		0.478	FBXO21-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FBXO21	HGNC	protein_coding	OTTHUMT00000404409.1	137	0.00	0	C	NM_033624		117583909	117583909	-1	no_errors	ENST00000330622	ensembl	human	known	69_37n	missense	234	22.77	69	SNP	0.995	T
FMO1	2326	genome.wustl.edu	37	1	171251126	171251126	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:171251126G>A	ENST00000354841.4	+	6	968	c.837G>A	c.(835-837)ctG>ctA	p.L279L	FMO1_ENST00000367750.3_Silent_p.L279L|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Silent_p.L216L	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	279					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.L279L(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GGACTCAGCTGAAAGAGTTTG	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											50.0	46.0	48.0					1																	171251126		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.837G>A	1.37:g.171251126G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.L279	ENST00000354841.4	37	c.837	CCDS1294.1	1																																																																																			FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000010932		0.453	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	44	0.00	0	G	NM_002021		171251126	171251126	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	silent	108	14.29	18	SNP	0.005	A
FMO1	2326	genome.wustl.edu	37	1	171251126	171251126	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:171251126G>A	ENST00000354841.4	+	6	968	c.837G>A	c.(835-837)ctG>ctA	p.L279L	FMO1_ENST00000367750.3_Silent_p.L279L|FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000402921.2_Silent_p.L216L	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	279					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)	p.L279L(1)		NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	GGACTCAGCTGAAAGAGTTTG	0.453																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											50.0	46.0	48.0					1																	171251126		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.837G>A	1.37:g.171251126G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Silent	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.L279	ENST00000354841.4	37	c.837	CCDS1294.1	1																																																																																			FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase	ENSG00000010932		0.453	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	44	0.00	0	G	NM_002021		171251126	171251126	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	silent	72	14.29	12	SNP	0.005	A
FOPNL	123811	genome.wustl.edu	37	16	15973705	15973705	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:15973705G>C	ENST00000255759.6	-	3	296	c.267C>G	c.(265-267)ctC>ctG	p.L89L	FOPNL_ENST00000573968.1_Intron|FOPNL_ENST00000573396.1_Silent_p.L113L|RNU6-213P_ENST00000384051.1_RNA|FOPNL_ENST00000573429.1_Silent_p.L113L|FOPNL_ENST00000575744.1_Silent_p.L23L|FOPNL_ENST00000575073.1_Silent_p.L89L	NM_144600.2	NP_653201.1	Q96NB1	FOPNL_HUMAN	FGFR1OP N-terminal like	89	Necessary and sufficient for homooligomerization and localization to centrosomes and pericentriolar satellites.				cilium assembly (GO:0042384)|microtubule anchoring (GO:0034453)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.L89L(1)		breast(1)|large_intestine(1)|lung(5)|stomach(4)	11						GTTCATGGATGAGAAACTGTC	0.318																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	56.0	56.0					16																	15973705		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AL832498	CCDS10567.1	16p13.11	2011-03-18	2011-03-18	2011-03-18	ENSG00000133393	ENSG00000133393			26435	protein-coding gene	gene with protein product	"""pluripotent embryonic stem cell-related protein"", ""FOP-related protein of 20 kDa"""		"""chromosome 16 open reading frame 63"""	C16orf63		12477932	Standard	NM_144600		Approved	DKFZp686N1651, FLJ31153, PHSECRG2, FOR20	uc002dec.1	Q96NB1	OTTHUMG00000129923	ENST00000255759.6:c.267C>G	16.37:g.15973705G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPU9	Missense_Mutation	SNP	NULL	p.H123D	ENST00000255759.6	37	c.367	CCDS10567.1	16																																																																																			FOPNL	-	NULL	ENSG00000133393		0.318	FOPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOPNL	HGNC	protein_coding	OTTHUMT00000252177.2	101	0.00	0	G	NM_144600		15973705	15973705	-1	no_errors	ENST00000572415	ensembl	human	known	69_37n	missense	103	16.13	20	SNP	1.000	C
FOPNL	123811	genome.wustl.edu	37	16	15973705	15973705	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:15973705G>C	ENST00000255759.6	-	3	296	c.267C>G	c.(265-267)ctC>ctG	p.L89L	FOPNL_ENST00000573968.1_Intron|FOPNL_ENST00000573396.1_Silent_p.L113L|RNU6-213P_ENST00000384051.1_RNA|FOPNL_ENST00000573429.1_Silent_p.L113L|FOPNL_ENST00000575744.1_Silent_p.L23L|FOPNL_ENST00000575073.1_Silent_p.L89L	NM_144600.2	NP_653201.1	Q96NB1	FOPNL_HUMAN	FGFR1OP N-terminal like	89	Necessary and sufficient for homooligomerization and localization to centrosomes and pericentriolar satellites.				cilium assembly (GO:0042384)|microtubule anchoring (GO:0034453)	centriolar satellite (GO:0034451)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|motile cilium (GO:0031514)|nucleus (GO:0005634)		p.L89L(1)		breast(1)|large_intestine(1)|lung(5)|stomach(4)	11						GTTCATGGATGAGAAACTGTC	0.318																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	56.0	56.0					16																	15973705		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AL832498	CCDS10567.1	16p13.11	2011-03-18	2011-03-18	2011-03-18	ENSG00000133393	ENSG00000133393			26435	protein-coding gene	gene with protein product	"""pluripotent embryonic stem cell-related protein"", ""FOP-related protein of 20 kDa"""		"""chromosome 16 open reading frame 63"""	C16orf63		12477932	Standard	NM_144600		Approved	DKFZp686N1651, FLJ31153, PHSECRG2, FOR20	uc002dec.1	Q96NB1	OTTHUMG00000129923	ENST00000255759.6:c.267C>G	16.37:g.15973705G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPU9	Missense_Mutation	SNP	NULL	p.H123D	ENST00000255759.6	37	c.367	CCDS10567.1	16																																																																																			FOPNL	-	NULL	ENSG00000133393		0.318	FOPNL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOPNL	HGNC	protein_coding	OTTHUMT00000252177.2	101	0.00	0	G	NM_144600		15973705	15973705	-1	no_errors	ENST00000572415	ensembl	human	known	69_37n	missense	148	21.58	41	SNP	1.000	C
FRMD4A	55691	genome.wustl.edu	37	10	13838563	13838563	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:13838563C>A	ENST00000357447.2	-	5	600	c.232G>T	c.(232-234)Gat>Tat	p.D78Y	FRMD4A_ENST00000342409.2_Missense_Mutation_p.D94Y|FRMD4A_ENST00000358621.4_Missense_Mutation_p.D63Y|FRMD4A_ENST00000378503.1_Missense_Mutation_p.D78Y	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	78	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.D78Y(2)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						ACTCTTCGATCTAGCTGAAGC	0.393																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											136.0	134.0	134.0					10																	13838563		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.232G>T	10.37:g.13838563C>A	ENSP00000350032:p.Asp78Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.D78Y	ENST00000357447.2	37	c.232	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865150	0.71949	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	4.87	4.87	0.63330	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.90352	0.6981	M	0.86864	2.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	D	0.91116	0.4926	10	0.48119	T	0.1	-16.1395	14.9407	0.70992	0.0:1.0:0.0:0.0	.	94;111;78	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	Y	63;78;78;111;94	ENSP00000351438:D63Y;ENSP00000350032:D78Y;ENSP00000367764:D78Y;ENSP00000264546:D111Y;ENSP00000344237:D94Y	ENSP00000264546:D111Y	D	-	1	0	FRMD4A	13878569	1.000000	0.71417	0.812000	0.32479	0.937000	0.57800	6.725000	0.74752	2.244000	0.73946	0.462000	0.41574	GAT	FRMD4A	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000151474		0.393	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	147	0.00	0	C	NM_018027		13838563	13838563	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	missense	126	24.55	41	SNP	1.000	A
FRMD4A	55691	genome.wustl.edu	37	10	13838563	13838563	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:13838563C>A	ENST00000357447.2	-	5	600	c.232G>T	c.(232-234)Gat>Tat	p.D78Y	FRMD4A_ENST00000342409.2_Missense_Mutation_p.D94Y|FRMD4A_ENST00000358621.4_Missense_Mutation_p.D63Y|FRMD4A_ENST00000378503.1_Missense_Mutation_p.D78Y	NM_018027.3	NP_060497.3	Q9P2Q2	FRM4A_HUMAN	FERM domain containing 4A	78	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				establishment of epithelial cell polarity (GO:0090162)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)		p.D78Y(2)		breast(4)|endometrium(9)|kidney(2)|large_intestine(11)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	41						ACTCTTCGATCTAGCTGAAGC	0.393																																						dbGAP											2	Substitution - Missense(2)	lung(1)|breast(1)											136.0	134.0	134.0					10																	13838563		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037715	CCDS7101.1	10p14	2004-07-15	2004-07-15	2004-07-15	ENSG00000151474	ENSG00000151474			25491	protein-coding gene	gene with protein product			"""FERM domain containing 4"""	FRMD4		10718198	Standard	NM_018027		Approved	FLJ10210, KIAA1294, bA295P9.4	uc001ims.3	Q9P2Q2	OTTHUMG00000017708	ENST00000357447.2:c.232G>T	10.37:g.13838563C>A	ENSP00000350032:p.Asp78Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2Y3|Q5T377	Missense_Mutation	SNP	pfam_DUF3338,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain,prints_Band_41_fam	p.D78Y	ENST00000357447.2	37	c.232	CCDS7101.1	10	.	.	.	.	.	.	.	.	.	.	C	19.64	3.865150	0.71949	.	.	ENSG00000151474	ENST00000358621;ENST00000357447;ENST00000378503;ENST00000264546;ENST00000342409	T;T;T;T;T	0.79653	-1.29;-1.29;-1.29;-1.29;-1.29	4.87	4.87	0.63330	FERM, N-terminal (1);Band 4.1 domain (1);FERM domain (1);FERM conserved site (1);	0.000000	0.85682	D	0.000000	D	0.90352	0.6981	M	0.86864	2.845	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.995;0.998	D	0.91116	0.4926	10	0.48119	T	0.1	-16.1395	14.9407	0.70992	0.0:1.0:0.0:0.0	.	94;111;78	Q5T378;Q5T376;Q9P2Q2	.;.;FRM4A_HUMAN	Y	63;78;78;111;94	ENSP00000351438:D63Y;ENSP00000350032:D78Y;ENSP00000367764:D78Y;ENSP00000264546:D111Y;ENSP00000344237:D94Y	ENSP00000264546:D111Y	D	-	1	0	FRMD4A	13878569	1.000000	0.71417	0.812000	0.32479	0.937000	0.57800	6.725000	0.74752	2.244000	0.73946	0.462000	0.41574	GAT	FRMD4A	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000151474		0.393	FRMD4A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRMD4A	HGNC	protein_coding	OTTHUMT00000046889.1	147	0.00	0	C	NM_018027		13838563	13838563	-1	no_errors	ENST00000357447	ensembl	human	known	69_37n	missense	212	22.06	60	SNP	1.000	A
FRRS1	391059	genome.wustl.edu	37	1	100174482	100174482	+	3'UTR	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:100174482G>A	ENST00000414213.1	-	0	2482				FRRS1_ENST00000287474.5_Missense_Mutation_p.S618L|FRRS1_ENST00000492943.1_5'Flank			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1							integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)	p.S618L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		TCTTCCAAGTGAGAATTCACA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	61.0	61.0					1																	100174482		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.*102C>T	1.37:g.100174482G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLN7	Missense_Mutation	SNP	pfam_Reeler_dom,pfam_DOMON_domain,smart_DOMON_domain,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_DOMON_domain,pfscan_Reeler_dom,pfscan_Cyt_b561/ferric_Rdtase_TM	p.S618L	ENST00000414213.1	37	c.1853		1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208799	0.39003	.	.	ENSG00000156869	ENST00000287474	.	.	.	5.63	-3.15	0.05233	.	6.374860	0.00166	N	0.000000	T	0.10465	0.0256	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16364	-1.0405	8	0.87932	D	0	.	0.8449	0.01159	0.235:0.2962:0.1292:0.3396	.	618	Q6ZNA5-2	.	L	618	.	ENSP00000287474:S618L	S	-	2	0	FRRS1	99947070	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-1.267000	0.02839	-0.909000	0.03852	-0.410000	0.06199	TCA	FRRS1	-	NULL	ENSG00000156869		0.413	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	HGNC	protein_coding		78	0.00	0	G	NM_001013660		100174482	100174482	-1	no_errors	ENST00000287474	ensembl	human	known	69_37n	missense	56	25.33	19	SNP	0.000	A
FRRS1	391059	genome.wustl.edu	37	1	100174482	100174482	+	3'UTR	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:100174482G>A	ENST00000414213.1	-	0	2482				FRRS1_ENST00000287474.5_Missense_Mutation_p.S618L|FRRS1_ENST00000492943.1_5'Flank			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1							integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)	p.S618L(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		TCTTCCAAGTGAGAATTCACA	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	61.0	61.0					1																	100174482		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.*102C>T	1.37:g.100174482G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLN7	Missense_Mutation	SNP	pfam_Reeler_dom,pfam_DOMON_domain,smart_DOMON_domain,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_DOMON_domain,pfscan_Reeler_dom,pfscan_Cyt_b561/ferric_Rdtase_TM	p.S618L	ENST00000414213.1	37	c.1853		1	.	.	.	.	.	.	.	.	.	.	G	13.34	2.208799	0.39003	.	.	ENSG00000156869	ENST00000287474	.	.	.	5.63	-3.15	0.05233	.	6.374860	0.00166	N	0.000000	T	0.10465	0.0256	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.16364	-1.0405	8	0.87932	D	0	.	0.8449	0.01159	0.235:0.2962:0.1292:0.3396	.	618	Q6ZNA5-2	.	L	618	.	ENSP00000287474:S618L	S	-	2	0	FRRS1	99947070	0.000000	0.05858	0.000000	0.03702	0.094000	0.18550	-1.267000	0.02839	-0.909000	0.03852	-0.410000	0.06199	TCA	FRRS1	-	NULL	ENSG00000156869		0.413	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	HGNC	protein_coding		78	0.00	0	G	NM_001013660		100174482	100174482	-1	no_errors	ENST00000287474	ensembl	human	known	69_37n	missense	91	26.61	33	SNP	0.000	A
GATA3	2625	genome.wustl.edu	37	10	8106058	8106058	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:8106058T>A	ENST00000346208.3	+	4	1333	c.878T>A	c.(877-879)aTg>aAg	p.M293K	GATA3_ENST00000379328.3_Missense_Mutation_p.M294K|GATA3_ENST00000461472.1_Intron			P23771	GATA3_HUMAN	GATA binding protein 3	293	Flexible linker.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M294K(2)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TATCACAAAATGAACGGACAG	0.572			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	2	Substitution - Missense(2)	breast(2)											118.0	106.0	110.0					10																	8106058		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.878T>A	10.37:g.8106058T>A	ENSP00000341619:p.Met293Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.M294K	ENST00000346208.3	37	c.881	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	T	28.8	4.954454	0.92726	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99150	-5.49;-5.49	5.59	5.59	0.84812	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (4);	0.000000	0.85682	D	0.000000	D	0.98134	0.9384	N	0.11673	0.155	0.80722	D	1	D;P	0.89917	1.0;0.723	D;P	0.91635	0.999;0.692	D	0.99945	1.1461	10	0.87932	D	0	-15.2486	15.7811	0.78260	0.0:0.0:0.0:1.0	.	293;294	P23771;P23771-2	GATA3_HUMAN;.	K	294;293	ENSP00000368632:M294K;ENSP00000341619:M293K	ENSP00000341619:M293K	M	+	2	0	GATA3	8146064	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.123000	0.65237	0.533000	0.62120	ATG	GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000107485		0.572	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	116	0.00	0	T	NM_001002295		8106058	8106058	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	missense	57	25.00	19	SNP	1.000	A
GATA3	2625	genome.wustl.edu	37	10	8106058	8106058	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:8106058T>A	ENST00000346208.3	+	4	1333	c.878T>A	c.(877-879)aTg>aAg	p.M293K	GATA3_ENST00000379328.3_Missense_Mutation_p.M294K|GATA3_ENST00000461472.1_Intron			P23771	GATA3_HUMAN	GATA binding protein 3	293	Flexible linker.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M294K(2)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TATCACAAAATGAACGGACAG	0.572			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	2	Substitution - Missense(2)	breast(2)											118.0	106.0	110.0					10																	8106058		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.878T>A	10.37:g.8106058T>A	ENSP00000341619:p.Met293Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.M294K	ENST00000346208.3	37	c.881	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	T	28.8	4.954454	0.92726	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99150	-5.49;-5.49	5.59	5.59	0.84812	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (4);	0.000000	0.85682	D	0.000000	D	0.98134	0.9384	N	0.11673	0.155	0.80722	D	1	D;P	0.89917	1.0;0.723	D;P	0.91635	0.999;0.692	D	0.99945	1.1461	10	0.87932	D	0	-15.2486	15.7811	0.78260	0.0:0.0:0.0:1.0	.	293;294	P23771;P23771-2	GATA3_HUMAN;.	K	294;293	ENSP00000368632:M294K;ENSP00000341619:M293K	ENSP00000341619:M293K	M	+	2	0	GATA3	8146064	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.123000	0.65237	0.533000	0.62120	ATG	GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000107485		0.572	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	116	0.00	0	T	NM_001002295		8106058	8106058	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	missense	85	25.44	29	SNP	1.000	A
GDPD2	54857	genome.wustl.edu	37	X	69652507	69652507	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:69652507C>T	ENST00000374382.3	+	14	1785	c.1534C>T	c.(1534-1536)Caa>Taa	p.Q512*	GDPD2_ENST00000538649.1_Nonsense_Mutation_p.Q433*|GDPD2_ENST00000536730.1_Nonsense_Mutation_p.Q433*|GDPD2_ENST00000453994.2_Nonsense_Mutation_p.Q563*|GDPD2_ENST00000472623.1_3'UTR	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	512					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.Q512*(1)|p.Q563*(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					CTTCCTCCTCCAAAGGTGAGT	0.502																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											153.0	127.0	136.0					X																	69652507		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.1534C>T	X.37:g.69652507C>T	ENSP00000363503:p.Gln512*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRH4|B4DVC9|Q9NXJ6	Nonsense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.Q563*	ENST00000374382.3	37	c.1687	CCDS14402.1	X	.	.	.	.	.	.	.	.	.	.	C	38	7.228956	0.98150	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	.	.	.	4.77	4.77	0.60923	.	0.562318	0.17491	N	0.172340	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	0.0421	11.4078	0.49908	0.1809:0.8191:0.0:0.0	.	.	.	.	X	563;433;433;512	.	.	Q	+	1	0	GDPD2	69569232	0.015000	0.18098	0.298000	0.25002	0.657000	0.38888	1.679000	0.37597	2.214000	0.71695	0.468000	0.43344	CAA	GDPD2	-	NULL	ENSG00000130055		0.502	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD2	HGNC	protein_coding	OTTHUMT00000057070.1	205	0.49	1	C	NM_017711		69652507	69652507	+1	no_errors	ENST00000453994	ensembl	human	known	69_37n	nonsense	172	27.12	64	SNP	0.022	T
GDPD2	54857	genome.wustl.edu	37	X	69652507	69652507	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:69652507C>T	ENST00000374382.3	+	14	1785	c.1534C>T	c.(1534-1536)Caa>Taa	p.Q512*	GDPD2_ENST00000538649.1_Nonsense_Mutation_p.Q433*|GDPD2_ENST00000536730.1_Nonsense_Mutation_p.Q433*|GDPD2_ENST00000453994.2_Nonsense_Mutation_p.Q563*|GDPD2_ENST00000472623.1_3'UTR	NM_017711.3	NP_060181.2	Q9HCC8	GDPD2_HUMAN	glycerophosphodiester phosphodiesterase domain containing 2	512					glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|glycerophosphoinositol inositolphosphodiesterase activity (GO:0047394)|metal ion binding (GO:0046872)	p.Q512*(1)|p.Q563*(1)		NS(1)|breast(1)|cervix(1)|endometrium(6)|large_intestine(8)|lung(3)|ovary(2)	22	Renal(35;0.156)					CTTCCTCCTCCAAAGGTGAGT	0.502																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											153.0	127.0	136.0					X																	69652507		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000214	CCDS14402.1, CCDS55437.1, CCDS55438.1	Xq13.1	2011-01-25			ENSG00000130055	ENSG00000130055			25974	protein-coding gene	gene with protein product	"""osteoblast differentiation promoting factor"""					12975309	Standard	NM_017711		Approved	OBDPF, FLJ20207, GDE3	uc011mpk.2	Q9HCC8	OTTHUMG00000021776	ENST00000374382.3:c.1534C>T	X.37:g.69652507C>T	ENSP00000363503:p.Gln512*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRH4|B4DVC9|Q9NXJ6	Nonsense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.Q563*	ENST00000374382.3	37	c.1687	CCDS14402.1	X	.	.	.	.	.	.	.	.	.	.	C	38	7.228956	0.98150	.	.	ENSG00000130055	ENST00000453994;ENST00000536730;ENST00000538649;ENST00000374382	.	.	.	4.77	4.77	0.60923	.	0.562318	0.17491	N	0.172340	.	.	.	.	.	.	0.58432	D	0.999995	.	.	.	.	.	.	.	.	.	.	.	.	.	0.0421	11.4078	0.49908	0.1809:0.8191:0.0:0.0	.	.	.	.	X	563;433;433;512	.	.	Q	+	1	0	GDPD2	69569232	0.015000	0.18098	0.298000	0.25002	0.657000	0.38888	1.679000	0.37597	2.214000	0.71695	0.468000	0.43344	CAA	GDPD2	-	NULL	ENSG00000130055		0.502	GDPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD2	HGNC	protein_coding	OTTHUMT00000057070.1	205	0.49	1	C	NM_017711		69652507	69652507	+1	no_errors	ENST00000453994	ensembl	human	known	69_37n	nonsense	284	26.04	100	SNP	0.022	T
GLB1	2720	genome.wustl.edu	37	3	33059951	33059951	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:33059951C>G	ENST00000399402.3	-	13	1377	c.1246G>C	c.(1246-1248)Gct>Cct	p.A416P	GLB1_ENST00000307363.5_Missense_Mutation_p.A446P|GLB1_ENST00000497796.1_5'UTR|GLB1_ENST00000307377.8_Missense_Mutation_p.A315P|GLB1_ENST00000445488.2_Missense_Mutation_p.A494P	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	446					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)	p.A446P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				CCATCCACAGCAACATATGCT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	145.0	147.0					3																	33059951		1986	4174	6160	-	-	-	SO:0001583	missense	0			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.1246G>C	3.37:g.33059951C>G	ENSP00000382333:p.Ala416Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.A494P	ENST00000399402.3	37	c.1480	CCDS43062.1	3	.	.	.	.	.	.	.	.	.	.	C	12.31	1.901008	0.33535	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13	5.35	-5.87	0.02297	.	0.370547	0.33610	N	0.004730	D	0.82958	0.5150	N	0.22421	0.69	0.09310	N	0.999995	P;P;P;P	0.47484	0.802;0.896;0.802;0.896	B;P;B;B	0.44359	0.367;0.447;0.367;0.367	T	0.79303	-0.1859	10	0.51188	T	0.08	-7.5411	9.0927	0.36621	0.3544:0.4852:0.0:0.1604	.	446;315;446;494	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	P	416;446;494;315	ENSP00000382333:A416P;ENSP00000306920:A446P;ENSP00000393377:A494P;ENSP00000305920:A315P	ENSP00000306920:A446P	A	-	1	0	GLB1	33034955	0.002000	0.14202	0.001000	0.08648	0.136000	0.21042	-0.003000	0.12901	-0.898000	0.03906	-0.302000	0.09304	GCT	GLB1	-	NULL	ENSG00000170266		0.512	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	113	0.00	0	C	NM_000404		33059951	33059951	-1	no_errors	ENST00000445488	ensembl	human	known	69_37n	missense	51	32.00	24	SNP	0.056	G
GLB1	2720	genome.wustl.edu	37	3	33059951	33059951	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:33059951C>G	ENST00000399402.3	-	13	1377	c.1246G>C	c.(1246-1248)Gct>Cct	p.A416P	GLB1_ENST00000307363.5_Missense_Mutation_p.A446P|GLB1_ENST00000497796.1_5'UTR|GLB1_ENST00000307377.8_Missense_Mutation_p.A315P|GLB1_ENST00000445488.2_Missense_Mutation_p.A494P	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	446					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)	p.A446P(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				CCATCCACAGCAACATATGCT	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											151.0	145.0	147.0					3																	33059951		1986	4174	6160	-	-	-	SO:0001583	missense	0			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.1246G>C	3.37:g.33059951C>G	ENSP00000382333:p.Ala416Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.A494P	ENST00000399402.3	37	c.1480	CCDS43062.1	3	.	.	.	.	.	.	.	.	.	.	C	12.31	1.901008	0.33535	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377	D;D;D;D	0.92911	-3.13;-3.13;-3.13;-3.13	5.35	-5.87	0.02297	.	0.370547	0.33610	N	0.004730	D	0.82958	0.5150	N	0.22421	0.69	0.09310	N	0.999995	P;P;P;P	0.47484	0.802;0.896;0.802;0.896	B;P;B;B	0.44359	0.367;0.447;0.367;0.367	T	0.79303	-0.1859	10	0.51188	T	0.08	-7.5411	9.0927	0.36621	0.3544:0.4852:0.0:0.1604	.	446;315;446;494	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	P	416;446;494;315	ENSP00000382333:A416P;ENSP00000306920:A446P;ENSP00000393377:A494P;ENSP00000305920:A315P	ENSP00000306920:A446P	A	-	1	0	GLB1	33034955	0.002000	0.14202	0.001000	0.08648	0.136000	0.21042	-0.003000	0.12901	-0.898000	0.03906	-0.302000	0.09304	GCT	GLB1	-	NULL	ENSG00000170266		0.512	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	113	0.00	0	C	NM_000404		33059951	33059951	-1	no_errors	ENST00000445488	ensembl	human	known	69_37n	missense	83	30.25	36	SNP	0.056	G
COLGALT1	79709	genome.wustl.edu	37	19	17690311	17690311	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:17690311G>C	ENST00000252599.4	+	10	1407	c.1287G>C	c.(1285-1287)caG>caC	p.Q429H		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	429					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)	p.Q429H(1)									GGGGGCTGCAGAAATCGCTTG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	103.0	109.0					19																	17690311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1287G>C	19.37:g.17690311G>C	ENSP00000252599:p.Gln429His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC64	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.Q429H	ENST00000252599.4	37	c.1287	CCDS12363.1	19	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637530	0.29157	.	.	ENSG00000130309	ENST00000379714;ENST00000252599	T	0.77620	-1.11	5.08	5.08	0.68730	.	0.371275	0.30201	N	0.010162	T	0.66187	0.2764	L	0.27053	0.805	0.46317	D	0.998987	B;B	0.09022	0.0;0.002	B;B	0.10450	0.003;0.005	T	0.64407	-0.6415	10	0.62326	D	0.03	-22.0133	11.1601	0.48509	0.0:0.0:0.8157:0.1843	.	157;429	E9PC06;Q8NBJ5	.;GT251_HUMAN	H	157;429	ENSP00000252599:Q429H	ENSP00000252599:Q429H	Q	+	3	2	GLT25D1	17551311	0.978000	0.34361	0.995000	0.50966	0.608000	0.37181	2.111000	0.41883	2.388000	0.81334	0.306000	0.20318	CAG	GLT25D1	-	pfam_Glyco_trans_25	ENSG00000130309		0.582	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D1	HGNC	protein_coding	OTTHUMT00000464216.1	101	0.00	0	G	NM_024656		17690311	17690311	+1	no_errors	ENST00000252599	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	1.000	C
COLGALT1	79709	genome.wustl.edu	37	19	17690311	17690311	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:17690311G>C	ENST00000252599.4	+	10	1407	c.1287G>C	c.(1285-1287)caG>caC	p.Q429H		NM_024656.2	NP_078932.2	Q8NBJ5	GT251_HUMAN	collagen beta(1-O)galactosyltransferase 1	429					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)	procollagen galactosyltransferase activity (GO:0050211)	p.Q429H(1)									GGGGGCTGCAGAAATCGCTTG	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											119.0	103.0	109.0					19																	17690311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075541	CCDS12363.1	19p13.11	2013-02-27	2013-02-27	2013-02-27	ENSG00000130309	ENSG00000130309			26182	protein-coding gene	gene with protein product			"""glycosyltransferase 25 domain containing 1"""	GLT25D1		19075007	Standard	NM_024656		Approved	FLJ22329	uc002nhc.1	Q8NBJ5		ENST00000252599.4:c.1287G>C	19.37:g.17690311G>C	ENSP00000252599:p.Gln429His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC64	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.Q429H	ENST00000252599.4	37	c.1287	CCDS12363.1	19	.	.	.	.	.	.	.	.	.	.	G	11.43	1.637530	0.29157	.	.	ENSG00000130309	ENST00000379714;ENST00000252599	T	0.77620	-1.11	5.08	5.08	0.68730	.	0.371275	0.30201	N	0.010162	T	0.66187	0.2764	L	0.27053	0.805	0.46317	D	0.998987	B;B	0.09022	0.0;0.002	B;B	0.10450	0.003;0.005	T	0.64407	-0.6415	10	0.62326	D	0.03	-22.0133	11.1601	0.48509	0.0:0.0:0.8157:0.1843	.	157;429	E9PC06;Q8NBJ5	.;GT251_HUMAN	H	157;429	ENSP00000252599:Q429H	ENSP00000252599:Q429H	Q	+	3	2	GLT25D1	17551311	0.978000	0.34361	0.995000	0.50966	0.608000	0.37181	2.111000	0.41883	2.388000	0.81334	0.306000	0.20318	CAG	GLT25D1	-	pfam_Glyco_trans_25	ENSG00000130309		0.582	COLGALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D1	HGNC	protein_coding	OTTHUMT00000464216.1	101	0.00	0	G	NM_024656		17690311	17690311	+1	no_errors	ENST00000252599	ensembl	human	known	69_37n	missense	72	19.10	17	SNP	1.000	C
GOLGA4	2803	genome.wustl.edu	37	3	37369998	37369998	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:37369998G>A	ENST00000361924.2	+	15	6405	c.6031G>A	c.(6031-6033)Gag>Aag	p.E2011K	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.E2033K	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	2011	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.E2011K(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AAAGGAACAAGAGCTGGAAAT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	82.0	83.0					3																	37369998		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6031G>A	3.37:g.37369998G>A	ENSP00000354486:p.Glu2011Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.E2011K	ENST00000361924.2	37	c.6031	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659262	0.88154	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.50277	0.76;0.89;0.75	5.39	5.39	0.77823	.	0.000000	0.32548	N	0.005947	T	0.68796	0.3040	M	0.77103	2.36	0.58432	D	0.999995	D;D;P	0.71674	0.998;0.998;0.802	D;D;B	0.63113	0.911;0.911;0.272	T	0.70317	-0.4905	10	0.48119	T	0.1	.	19.1331	0.93415	0.0:0.0:1.0:0.0	.	2011;2033;2011	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	K	2011;2033;1882	ENSP00000354486:E2011K;ENSP00000349305:E2033K;ENSP00000405842:E1882K	ENSP00000349305:E2033K	E	+	1	0	GOLGA4	37345002	1.000000	0.71417	0.943000	0.38184	0.461000	0.32589	9.296000	0.96104	2.511000	0.84671	0.650000	0.86243	GAG	GOLGA4	-	NULL	ENSG00000144674		0.353	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	135	0.00	0	G	NM_002078		37369998	37369998	+1	no_errors	ENST00000361924	ensembl	human	known	69_37n	missense	150	21.05	40	SNP	1.000	A
GOLGA4	2803	genome.wustl.edu	37	3	37369998	37369998	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:37369998G>A	ENST00000361924.2	+	15	6405	c.6031G>A	c.(6031-6033)Gag>Aag	p.E2011K	GOLGA4_ENST00000444882.1_Intron|GOLGA4_ENST00000356847.4_Missense_Mutation_p.E2033K	NM_002078.4	NP_002069.2	Q13439	GOGA4_HUMAN	golgin A4	2011	Glu-rich.				Golgi to plasma membrane protein transport (GO:0043001)|protein targeting to Golgi (GO:0000042)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	GTPase binding (GO:0051020)	p.E2011K(1)		NS(2)|breast(3)|central_nervous_system(3)|endometrium(6)|kidney(2)|large_intestine(17)|liver(2)|lung(16)|ovary(4)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						AAAGGAACAAGAGCTGGAAAT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											84.0	82.0	83.0					3																	37369998		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31906	CCDS2666.1, CCDS54564.1	3p22-p21.3	2010-02-12	2010-02-12		ENSG00000144674	ENSG00000144674			4427	protein-coding gene	gene with protein product	"""golgin 245"""	602509	"""golgi autoantigen, golgin subfamily a, 4"""			8626529	Standard	NM_002078		Approved	GOLG, GCP2, p230, golgin-240	uc003cgw.3	Q13439	OTTHUMG00000130799	ENST00000361924.2:c.6031G>A	3.37:g.37369998G>A	ENSP00000354486:p.Glu2011Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W8Q7|Q13270|Q13654|Q14436|Q59EW8	Missense_Mutation	SNP	pfam_GRIP,superfamily_GRIP,superfamily_tRNA-bd_arm,superfamily_t-SNARE,superfamily_Prefoldin,smart_GRIP,pfscan_GRIP	p.E2011K	ENST00000361924.2	37	c.6031	CCDS2666.1	3	.	.	.	.	.	.	.	.	.	.	G	25.6	4.659262	0.88154	.	.	ENSG00000144674	ENST00000361924;ENST00000356847;ENST00000437131	T;T;T	0.50277	0.76;0.89;0.75	5.39	5.39	0.77823	.	0.000000	0.32548	N	0.005947	T	0.68796	0.3040	M	0.77103	2.36	0.58432	D	0.999995	D;D;P	0.71674	0.998;0.998;0.802	D;D;B	0.63113	0.911;0.911;0.272	T	0.70317	-0.4905	10	0.48119	T	0.1	.	19.1331	0.93415	0.0:0.0:1.0:0.0	.	2011;2033;2011	Q13439-4;F8W8Q7;Q13439	.;.;GOGA4_HUMAN	K	2011;2033;1882	ENSP00000354486:E2011K;ENSP00000349305:E2033K;ENSP00000405842:E1882K	ENSP00000349305:E2033K	E	+	1	0	GOLGA4	37345002	1.000000	0.71417	0.943000	0.38184	0.461000	0.32589	9.296000	0.96104	2.511000	0.84671	0.650000	0.86243	GAG	GOLGA4	-	NULL	ENSG00000144674		0.353	GOLGA4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGA4	HGNC	protein_coding	OTTHUMT00000253339.2	135	0.00	0	G	NM_002078		37369998	37369998	+1	no_errors	ENST00000361924	ensembl	human	known	69_37n	missense	87	22.32	25	SNP	1.000	A
GRIK2	2898	genome.wustl.edu	37	6	102124653	102124653	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:102124653G>A	ENST00000421544.1	+	4	1187	c.697G>A	c.(697-699)Gaa>Aaa	p.E233K	GRIK2_ENST00000369134.4_Missense_Mutation_p.E184K|GRIK2_ENST00000358361.3_Missense_Mutation_p.E233K|GRIK2_ENST00000318991.6_Missense_Mutation_p.E233K|GRIK2_ENST00000413795.1_Missense_Mutation_p.E233K|GRIK2_ENST00000369137.3_Missense_Mutation_p.E233K|GRIK2_ENST00000369138.1_Missense_Mutation_p.E233K	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	233					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.E233K(4)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTGTAGCCATGAAATGGCAGC	0.323																																						dbGAP											4	Substitution - Missense(4)	upper_aerodigestive_tract(2)|breast(2)											74.0	76.0	75.0					6																	102124653		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.697G>A	6.37:g.102124653G>A	ENSP00000397026:p.Glu233Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E233K	ENST00000421544.1	37	c.697	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523882	0.64747	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610	D;D;D;D;D;D;D;T	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;1.82	5.77	5.77	0.91146	Extracellular ligand-binding receptor (1);	0.118288	0.64402	D	0.000017	T	0.77170	0.4091	L	0.42686	1.345	0.50632	D	0.999882	B;B;B	0.15719	0.004;0.014;0.004	B;B;B	0.18263	0.008;0.021;0.005	T	0.71981	-0.4428	10	0.52906	T	0.07	.	19.9928	0.97374	0.0:0.0:1.0:0.0	.	233;233;233	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	K	233;233;233;233;233;233;233;184;195;4	ENSP00000397026:E233K;ENSP00000405596:E233K;ENSP00000358134:E233K;ENSP00000351128:E233K;ENSP00000358133:E233K;ENSP00000313276:E233K;ENSP00000358130:E184K;ENSP00000391988:E4K	ENSP00000313276:E233K	E	+	1	0	GRIK2	102231346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.541000	0.73865	2.745000	0.94114	0.650000	0.86243	GAA	GRIK2	-	pfam_ANF_lig-bd_rcpt	ENSG00000164418		0.323	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	121	0.00	0	G			102124653	102124653	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	missense	121	20.39	31	SNP	1.000	A
GRIK2	2898	genome.wustl.edu	37	6	102124653	102124653	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:102124653G>A	ENST00000421544.1	+	4	1187	c.697G>A	c.(697-699)Gaa>Aaa	p.E233K	GRIK2_ENST00000369134.4_Missense_Mutation_p.E184K|GRIK2_ENST00000358361.3_Missense_Mutation_p.E233K|GRIK2_ENST00000318991.6_Missense_Mutation_p.E233K|GRIK2_ENST00000413795.1_Missense_Mutation_p.E233K|GRIK2_ENST00000369137.3_Missense_Mutation_p.E233K|GRIK2_ENST00000369138.1_Missense_Mutation_p.E233K	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	233					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)	p.E233K(4)		NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TTGTAGCCATGAAATGGCAGC	0.323																																						dbGAP											4	Substitution - Missense(4)	upper_aerodigestive_tract(2)|breast(2)											74.0	76.0	75.0					6																	102124653		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.697G>A	6.37:g.102124653G>A	ENSP00000397026:p.Glu233Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E233K	ENST00000421544.1	37	c.697	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	G	17.99	3.523882	0.64747	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000358361;ENST00000369137;ENST00000318991;ENST00000403289;ENST00000369134;ENST00000540076;ENST00000455610	D;D;D;D;D;D;D;T	0.84223	-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;-1.82;1.82	5.77	5.77	0.91146	Extracellular ligand-binding receptor (1);	0.118288	0.64402	D	0.000017	T	0.77170	0.4091	L	0.42686	1.345	0.50632	D	0.999882	B;B;B	0.15719	0.004;0.014;0.004	B;B;B	0.18263	0.008;0.021;0.005	T	0.71981	-0.4428	10	0.52906	T	0.07	.	19.9928	0.97374	0.0:0.0:1.0:0.0	.	233;233;233	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	K	233;233;233;233;233;233;233;184;195;4	ENSP00000397026:E233K;ENSP00000405596:E233K;ENSP00000358134:E233K;ENSP00000351128:E233K;ENSP00000358133:E233K;ENSP00000313276:E233K;ENSP00000358130:E184K;ENSP00000391988:E4K	ENSP00000313276:E233K	E	+	1	0	GRIK2	102231346	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.541000	0.73865	2.745000	0.94114	0.650000	0.86243	GAA	GRIK2	-	pfam_ANF_lig-bd_rcpt	ENSG00000164418		0.323	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	121	0.00	0	G			102124653	102124653	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	missense	182	21.21	49	SNP	1.000	A
HAAO	23498	genome.wustl.edu	37	2	42997320	42997320	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:42997320G>A	ENST00000294973.6	-	6	502	c.447C>T	c.(445-447)ttC>ttT	p.F149F		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase									p.F149F(1)		breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						GCTCAGAGCTGAAGAACCTGC	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	52.0	53.0					2																	42997320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.447C>T	2.37:g.42997320G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_3hydroanth_dOase,pfam_Cupin_2,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	p.F149	ENST00000294973.6	37	c.447	CCDS33187.1	2																																																																																			HAAO	-	pfam_3hydroanth_dOase,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	ENSG00000162882		0.582	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAAO	HGNC	protein_coding	OTTHUMT00000325948.2	104	0.00	0	G			42997320	42997320	-1	no_errors	ENST00000294973	ensembl	human	known	69_37n	silent	24	20.00	6	SNP	1.000	A
HAAO	23498	genome.wustl.edu	37	2	42997320	42997320	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:42997320G>A	ENST00000294973.6	-	6	502	c.447C>T	c.(445-447)ttC>ttT	p.F149F		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase									p.F149F(1)		breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						GCTCAGAGCTGAAGAACCTGC	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											55.0	52.0	53.0					2																	42997320		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.447C>T	2.37:g.42997320G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_3hydroanth_dOase,pfam_Cupin_2,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	p.F149	ENST00000294973.6	37	c.447	CCDS33187.1	2																																																																																			HAAO	-	pfam_3hydroanth_dOase,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	ENSG00000162882		0.582	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAAO	HGNC	protein_coding	OTTHUMT00000325948.2	104	0.00	0	G			42997320	42997320	-1	no_errors	ENST00000294973	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	A
HCAR1	27198	genome.wustl.edu	37	12	123214164	123214164	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:123214164G>A	ENST00000436083.2	-	1	1226	c.723C>T	c.(721-723)ctC>ctT	p.L241L	HCAR1_ENST00000356987.2_Silent_p.L241L|HCAR1_ENST00000432564.1_Silent_p.L241L			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	241					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L241L(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						AGAGGAAATAGAGTCTAGCAG	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	64.0	66.0					12																	123214164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.723C>T	12.37:g.123214164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L241	ENST00000436083.2	37	c.723	CCDS9236.1	12																																																																																			HCAR1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196917		0.567	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR1	HGNC	protein_coding	OTTHUMT00000401415.1	86	0.00	0	G			123214164	123214164	-1	no_errors	ENST00000356987	ensembl	human	known	69_37n	silent	41	24.07	13	SNP	0.139	A
HCAR1	27198	genome.wustl.edu	37	12	123214164	123214164	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:123214164G>A	ENST00000436083.2	-	1	1226	c.723C>T	c.(721-723)ctC>ctT	p.L241L	HCAR1_ENST00000356987.2_Silent_p.L241L|HCAR1_ENST00000432564.1_Silent_p.L241L			Q9BXC0	HCAR1_HUMAN	hydroxycarboxylic acid receptor 1	241					response to estradiol (GO:0032355)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.L241L(1)		NS(1)|breast(3)|endometrium(1)|kidney(1)|lung(1)|ovary(1)|pancreas(1)|skin(1)	10						AGAGGAAATAGAGTCTAGCAG	0.567																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	64.0	66.0					12																	123214164		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF411110	CCDS9236.1	12q24.31	2012-08-08	2011-05-30	2011-05-30	ENSG00000196917	ENSG00000196917		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	4532	protein-coding gene	gene with protein product	"""lactate receptor 1"""	606923	"""G protein-coupled receptor 104"", ""G protein-coupled receptor 81"""	GPR104, GPR81		11574155, 19047060, 18952058, 21454438	Standard	NM_032554		Approved	HCA1, FKSG80, TA-GPCR, LACR1	uc001ucz.3	Q9BXC0		ENST00000436083.2:c.723C>T	12.37:g.123214164G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9X4|Q3Y5J3|Q4VBN1|Q6NXU5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L241	ENST00000436083.2	37	c.723	CCDS9236.1	12																																																																																			HCAR1	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196917		0.567	HCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR1	HGNC	protein_coding	OTTHUMT00000401415.1	86	0.00	0	G			123214164	123214164	-1	no_errors	ENST00000356987	ensembl	human	known	69_37n	silent	57	25.00	19	SNP	0.139	A
MROH7	374977	genome.wustl.edu	37	1	55118580	55118580	+	5'UTR	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:55118580G>A	ENST00000421030.2	+	0	266				MROH7_ENST00000409996.1_Intron|MROH7_ENST00000395690.2_5'UTR|MROH7-TTC4_ENST00000414150.2_5'UTR|MROH7_ENST00000339553.5_5'UTR|MROH7_ENST00000472987.1_3'UTR|MROH7_ENST00000545244.1_Intron|MROH7_ENST00000454855.2_Intron	NM_001039464.2	NP_001034553	Q68CQ1	MROH7_HUMAN	maestro heat-like repeat family member 7							extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CACTGGCATTGAGAGACCTCC	0.562																																						dbGAP											0													65.0	63.0	63.0					1																	55118580		2002	4163	6165	-	-	-	SO:0001623	5_prime_UTR_variant	0			AL832492	CCDS41342.2	1p32.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000184313	ENSG00000184313		"""maestro heat-like repeat containing"""	24802	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 175"", ""HEAT repeat containing 8"""	C1orf175, HEATR8		12477932	Standard	NM_001039464		Approved	FLJ46354	uc010ooe.1	Q68CQ1	OTTHUMG00000009890	ENST00000421030.2:c.-20G>A	1.37:g.55118580G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUX8|Q5TA99|Q6ZP40|Q6ZRH6|Q8N311|Q8NA14	RNA	SNP	-	NULL	ENST00000421030.2	37	NULL	CCDS41342.2	1																																																																																			HEATR8	-	-	ENSG00000184313		0.562	MROH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR8	HGNC	protein_coding	OTTHUMT00000346978.1	37	0.00	0	G	NM_198547		55118580	55118580	+1	no_errors	ENST00000472987	ensembl	human	known	69_37n	rna	13	23.53	4	SNP	0.844	A
HMCN1	83872	genome.wustl.edu	37	1	186014856	186014856	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:186014856C>T	ENST00000271588.4	+	41	6570	c.6341C>T	c.(6340-6342)tCt>tTt	p.S2114F	HMCN1_ENST00000367492.2_Missense_Mutation_p.S2114F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2114	Ig-like C2-type 19.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S2114F(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGAATGTCTCTGTCCTCATT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	128.0	134.0					1																	186014856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6341C>T	1.37:g.186014856C>T	ENSP00000271588:p.Ser2114Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.S2114F	ENST00000271588.4	37	c.6341	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810992	0.90707	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68025	-0.3;-0.3	5.35	5.35	0.76521	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.050554	0.85682	D	0.000000	T	0.80171	0.4574	L	0.59967	1.855	0.58432	D	0.999997	D	0.76494	0.999	D	0.87578	0.998	T	0.79911	-0.1603	10	0.49607	T	0.09	.	19.1002	0.93270	0.0:1.0:0.0:0.0	.	2114	Q96RW7	HMCN1_HUMAN	F	2114	ENSP00000271588:S2114F;ENSP00000356462:S2114F	ENSP00000271588:S2114F	S	+	2	0	HMCN1	184281479	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.294000	0.78760	2.500000	0.84329	0.650000	0.86243	TCT	HMCN1	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,pfscan_Ig-like	ENSG00000143341		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	204	0.00	0	C	NM_031935		186014856	186014856	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	147	19.23	35	SNP	0.999	T
HMCN1	83872	genome.wustl.edu	37	1	186014856	186014856	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:186014856C>T	ENST00000271588.4	+	41	6570	c.6341C>T	c.(6340-6342)tCt>tTt	p.S2114F	HMCN1_ENST00000367492.2_Missense_Mutation_p.S2114F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	2114	Ig-like C2-type 19.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)	p.S2114F(1)		NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CAGAATGTCTCTGTCCTCATT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	128.0	134.0					1																	186014856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.6341C>T	1.37:g.186014856C>T	ENSP00000271588:p.Ser2114Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.S2114F	ENST00000271588.4	37	c.6341	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	C	27.2	4.810992	0.90707	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68025	-0.3;-0.3	5.35	5.35	0.76521	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.050554	0.85682	D	0.000000	T	0.80171	0.4574	L	0.59967	1.855	0.58432	D	0.999997	D	0.76494	0.999	D	0.87578	0.998	T	0.79911	-0.1603	10	0.49607	T	0.09	.	19.1002	0.93270	0.0:1.0:0.0:0.0	.	2114	Q96RW7	HMCN1_HUMAN	F	2114	ENSP00000271588:S2114F;ENSP00000356462:S2114F	ENSP00000271588:S2114F	S	+	2	0	HMCN1	184281479	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.294000	0.78760	2.500000	0.84329	0.650000	0.86243	TCT	HMCN1	-	pfam_Ig_I-set,smart_Ig_V-set_subgr,smart_Ig_sub,pfscan_Ig-like	ENSG00000143341		0.418	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	204	0.00	0	C	NM_031935		186014856	186014856	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	217	19.33	52	SNP	0.999	T
HNRNPA2B1	3181	genome.wustl.edu	37	7	26237271	26237271	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:26237271C>G	ENST00000354667.4	-	3	292	c.124G>C	c.(124-126)Gaa>Caa	p.E42Q	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.E30Q	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	42	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)	p.E30Q(1)|p.E42Q(1)	HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						CCCCATTGTTCGTAGTAGTTC	0.368			T	ETV1	prostate																																	dbGAP		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	2	Substitution - Missense(2)	breast(2)											87.0	83.0	84.0					7																	26237271		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.124G>C	7.37:g.26237271C>G	ENSP00000346694:p.Glu42Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.E42Q	ENST00000354667.4	37	c.124	CCDS43557.1	7	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221794	0.39300	.	.	ENSG00000122566	ENST00000354667;ENST00000356674;ENST00000409814	D;D	0.87491	-2.26;-2.26	5.81	4.02	0.46733	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000002	D	0.87684	0.6239	L	0.39898	1.24	0.40400	D	0.979633	D;B	0.67145	0.996;0.179	P;B	0.57057	0.812;0.131	D	0.87250	0.2272	10	0.51188	T	0.08	.	12.4833	0.55856	0.0:0.8652:0.0:0.1348	.	30;42	P22626-2;P22626	.;ROA2_HUMAN	Q	42;30;30	ENSP00000346694:E42Q;ENSP00000349101:E30Q	ENSP00000346694:E42Q	E	-	1	0	HNRNPA2B1	26203796	1.000000	0.71417	0.939000	0.37840	0.275000	0.26752	6.001000	0.70685	0.807000	0.34208	-0.140000	0.14226	GAA	HNRNPA2B1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122566		0.368	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	HNRNPA2B1	HGNC	protein_coding	OTTHUMT00000214109.1	182	0.00	0	C	NM_002137		26237271	26237271	-1	no_errors	ENST00000354667	ensembl	human	known	69_37n	missense	250	15.54	46	SNP	1.000	G
HNRNPA2B1	3181	genome.wustl.edu	37	7	26237271	26237271	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:26237271C>G	ENST00000354667.4	-	3	292	c.124G>C	c.(124-126)Gaa>Caa	p.E42Q	HNRNPA2B1_ENST00000356674.7_Missense_Mutation_p.E30Q	NM_031243.2	NP_112533.1	P22626	ROA2_HUMAN	heterogeneous nuclear ribonucleoprotein A2/B1	42	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|pre-mRNA intronic binding (GO:0097157)|RNA binding (GO:0003723)|single-stranded telomeric DNA binding (GO:0043047)	p.E30Q(1)|p.E42Q(1)	HNRNPA2B1/ETV1(8)	breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22						CCCCATTGTTCGTAGTAGTTC	0.368			T	ETV1	prostate																																	dbGAP		Dom	yes		7	7p15	3181	heterogeneous nuclear ribonucleoprotein A2/B1		E	2	Substitution - Missense(2)	breast(2)											87.0	83.0	84.0					7																	26237271		2203	4300	6503	-	-	-	SO:0001583	missense	0			D28877	CCDS5397.1, CCDS43557.1	7p15	2013-02-12		2007-08-16	ENSG00000122566	ENSG00000122566		"""RNA binding motif (RRM) containing"""	5033	protein-coding gene	gene with protein product		600124		HNRPA2B1		8029005	Standard	NM_002137		Approved		uc003sxr.4	P22626	OTTHUMG00000023471	ENST00000354667.4:c.124G>C	7.37:g.26237271C>G	ENSP00000346694:p.Glu42Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K064|P22627|Q9UC98|Q9UDJ2	Missense_Mutation	SNP	pfam_RRM_dom,pfam_HnRNPA1,smart_RRM_dom,pfscan_RRM_dom	p.E42Q	ENST00000354667.4	37	c.124	CCDS43557.1	7	.	.	.	.	.	.	.	.	.	.	C	13.39	2.221794	0.39300	.	.	ENSG00000122566	ENST00000354667;ENST00000356674;ENST00000409814	D;D	0.87491	-2.26;-2.26	5.81	4.02	0.46733	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000002	D	0.87684	0.6239	L	0.39898	1.24	0.40400	D	0.979633	D;B	0.67145	0.996;0.179	P;B	0.57057	0.812;0.131	D	0.87250	0.2272	10	0.51188	T	0.08	.	12.4833	0.55856	0.0:0.8652:0.0:0.1348	.	30;42	P22626-2;P22626	.;ROA2_HUMAN	Q	42;30;30	ENSP00000346694:E42Q;ENSP00000349101:E30Q	ENSP00000346694:E42Q	E	-	1	0	HNRNPA2B1	26203796	1.000000	0.71417	0.939000	0.37840	0.275000	0.26752	6.001000	0.70685	0.807000	0.34208	-0.140000	0.14226	GAA	HNRNPA2B1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000122566		0.368	HNRNPA2B1-001	KNOWN	basic|CCDS	protein_coding	HNRNPA2B1	HGNC	protein_coding	OTTHUMT00000214109.1	182	0.00	0	C	NM_002137		26237271	26237271	-1	no_errors	ENST00000354667	ensembl	human	known	69_37n	missense	397	15.53	73	SNP	1.000	G
HS3ST4	9951	genome.wustl.edu	37	16	26147248	26147248	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:26147248C>T	ENST00000331351.5	+	2	1442	c.1050C>T	c.(1048-1050)tcC>tcT	p.S350S	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	350					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.S350S(2)		breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		TCCCCCTCTCCCAGATCCTCT	0.532																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											123.0	118.0	120.0					16																	26147248		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.1050C>T	16.37:g.26147248C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QI42|Q8NDC2	Silent	SNP	pfam_Sulfotransferase_dom	p.S350	ENST00000331351.5	37	c.1050	CCDS53995.1	16																																																																																			HS3ST4	-	pfam_Sulfotransferase_dom	ENSG00000182601		0.532	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST4	HGNC	protein_coding	OTTHUMT00000133286.2	91	0.00	0	C	NM_006040		26147248	26147248	+1	no_errors	ENST00000331351	ensembl	human	known	69_37n	silent	45	21.05	12	SNP	0.937	T
HS3ST4	9951	genome.wustl.edu	37	16	26147248	26147248	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:26147248C>T	ENST00000331351.5	+	2	1442	c.1050C>T	c.(1048-1050)tcC>tcT	p.S350S	HS3ST4_ENST00000475436.1_3'UTR	NM_006040.2	NP_006031.2	Q9Y661	HS3S4_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 4	350					heparan sulfate proteoglycan metabolic process (GO:0030201)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)	p.S350S(2)		breast(2)|endometrium(3)|large_intestine(1)|lung(9)	15				GBM - Glioblastoma multiforme(48;0.0988)		TCCCCCTCTCCCAGATCCTCT	0.532																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											123.0	118.0	120.0					16																	26147248		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			AF105378	CCDS53995.1	16p11.2	2008-03-12			ENSG00000182601	ENSG00000182601	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5200	protein-coding gene	gene with protein product		604059				9988767	Standard	NM_006040		Approved	3OST4	uc002dof.3	Q9Y661	OTTHUMG00000059978	ENST00000331351.5:c.1050C>T	16.37:g.26147248C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QI42|Q8NDC2	Silent	SNP	pfam_Sulfotransferase_dom	p.S350	ENST00000331351.5	37	c.1050	CCDS53995.1	16																																																																																			HS3ST4	-	pfam_Sulfotransferase_dom	ENSG00000182601		0.532	HS3ST4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST4	HGNC	protein_coding	OTTHUMT00000133286.2	91	0.00	0	C	NM_006040		26147248	26147248	+1	no_errors	ENST00000331351	ensembl	human	known	69_37n	silent	69	16.87	14	SNP	0.937	T
HSPB7	27129	genome.wustl.edu	37	1	16342076	16342076	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:16342076C>T	ENST00000311890.9	-	3	1338	c.512G>A	c.(511-513)tGa>tAa	p.*171*	HSPB7_ENST00000406363.2_Silent_p.*175*|HSPB7_ENST00000411503.1_Silent_p.*166*|HSPB7_ENST00000487046.1_Silent_p.*176*|HSPB7_ENST00000375718.4_Silent_p.*246*	NM_014424.4	NP_055239.1	Q9UBY9	HSPB7_HUMAN	heat shock 27kDa protein family, member 7 (cardiovascular)	0					regulation of heart contraction (GO:0008016)|response to unfolded protein (GO:0006986)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)	p.*171*(1)		breast(1)|large_intestine(1)|liver(1)|lung(6)|skin(1)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GAGAGGCACTCAGATTTTGAT	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											120.0	93.0	102.0					1																	16342076		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155908	CCDS30611.1	1p36.23-p34.3	2011-09-02	2002-08-29		ENSG00000173641	ENSG00000173641		"""Heat shock proteins / HSPB"""	5249	protein-coding gene	gene with protein product		610692	"""heat shock 27kD protein family, member 7 (cardiovascular)"""			10593960	Standard	NM_014424		Approved	cvHSP	uc001axo.2	Q9UBY9	OTTHUMG00000009531	ENST00000311890.9:c.512G>A	1.37:g.16342076C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ37|C9K0Y0|Q9NU17	Silent	SNP	pfam_Hsp20,superfamily_HSP20-like_chaperone,pfscan_Hsp20,prints_Alpha-crystallin/HSP	p.*176	ENST00000311890.9	37	c.527	CCDS30611.1	1																																																																																			HSPB7	-	NULL	ENSG00000173641		0.622	HSPB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HSPB7	HGNC	protein_coding	OTTHUMT00000026334.2	107	0.00	0	C	NM_014424		16342076	16342076	-1	no_errors	ENST00000487046	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	1.000	T
HSPB7	27129	genome.wustl.edu	37	1	16342076	16342076	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:16342076C>T	ENST00000311890.9	-	3	1338	c.512G>A	c.(511-513)tGa>tAa	p.*171*	HSPB7_ENST00000406363.2_Silent_p.*175*|HSPB7_ENST00000411503.1_Silent_p.*166*|HSPB7_ENST00000487046.1_Silent_p.*176*|HSPB7_ENST00000375718.4_Silent_p.*246*	NM_014424.4	NP_055239.1	Q9UBY9	HSPB7_HUMAN	heat shock 27kDa protein family, member 7 (cardiovascular)	0					regulation of heart contraction (GO:0008016)|response to unfolded protein (GO:0006986)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)	p.*171*(1)		breast(1)|large_intestine(1)|liver(1)|lung(6)|skin(1)	10		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Colorectal(212;8.21e-08)|COAD - Colon adenocarcinoma(227;5.5e-06)|BRCA - Breast invasive adenocarcinoma(304;9.08e-05)|Kidney(64;0.000162)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.00656)|READ - Rectum adenocarcinoma(331;0.0649)		GAGAGGCACTCAGATTTTGAT	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											120.0	93.0	102.0					1																	16342076		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF155908	CCDS30611.1	1p36.23-p34.3	2011-09-02	2002-08-29		ENSG00000173641	ENSG00000173641		"""Heat shock proteins / HSPB"""	5249	protein-coding gene	gene with protein product		610692	"""heat shock 27kD protein family, member 7 (cardiovascular)"""			10593960	Standard	NM_014424		Approved	cvHSP	uc001axo.2	Q9UBY9	OTTHUMG00000009531	ENST00000311890.9:c.512G>A	1.37:g.16342076C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ37|C9K0Y0|Q9NU17	Silent	SNP	pfam_Hsp20,superfamily_HSP20-like_chaperone,pfscan_Hsp20,prints_Alpha-crystallin/HSP	p.*176	ENST00000311890.9	37	c.527	CCDS30611.1	1																																																																																			HSPB7	-	NULL	ENSG00000173641		0.622	HSPB7-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HSPB7	HGNC	protein_coding	OTTHUMT00000026334.2	107	0.00	0	C	NM_014424		16342076	16342076	-1	no_errors	ENST00000487046	ensembl	human	known	69_37n	silent	18	35.71	10	SNP	1.000	T
IDE	3416	genome.wustl.edu	37	10	94230067	94230067	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:94230067G>C	ENST00000265986.6	-	18	2208	c.2152C>G	c.(2152-2154)Cag>Gag	p.Q718E	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.Q163E	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	718					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.Q718E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	GACAGGAGCTGAGGTATGAAG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											173.0	166.0	168.0					10																	94230067		2203	4300	6503	-	-	-	SO:0001583	missense	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2152C>G	10.37:g.94230067G>C	ENSP00000265986:p.Gln718Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.Q718E	ENST00000265986.6	37	c.2152	CCDS7421.1	10	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805458	0.50315	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.07216	3.21;3.21	4.94	4.94	0.65067	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.135413	0.50627	D	0.000115	T	0.07728	0.0194	L	0.33093	0.98	0.80722	D	1	B;B	0.22414	0.011;0.069	B;B	0.26864	0.012;0.074	T	0.07271	-1.0781	10	0.02654	T	1	-9.3047	17.7655	0.88476	0.0:0.0:1.0:0.0	.	718;163	P14735;B3KSB8	IDE_HUMAN;.	E	718;163	ENSP00000265986:Q718E;ENSP00000360637:Q163E	ENSP00000265986:Q718E	Q	-	1	0	IDE	94220047	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.822000	0.99363	2.256000	0.74724	0.563000	0.77884	CAG	IDE	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	ENSG00000119912		0.448	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	211	0.47	1	G	NM_004969		94230067	94230067	-1	no_errors	ENST00000265986	ensembl	human	known	69_37n	missense	216	10.37	25	SNP	1.000	C
IDE	3416	genome.wustl.edu	37	10	94230067	94230067	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:94230067G>C	ENST00000265986.6	-	18	2208	c.2152C>G	c.(2152-2154)Cag>Gag	p.Q718E	IDE_ENST00000496903.1_5'UTR|IDE_ENST00000371581.5_Missense_Mutation_p.Q163E	NM_004969.3	NP_004960.2	P14735	IDE_HUMAN	insulin-degrading enzyme	718					beta-amyloid metabolic process (GO:0050435)|bradykinin catabolic process (GO:0010815)|determination of adult lifespan (GO:0008340)|hormone catabolic process (GO:0042447)|insulin catabolic process (GO:1901143)|insulin metabolic process (GO:1901142)|insulin receptor signaling pathway (GO:0008286)|negative regulation of proteolysis (GO:0045861)|positive regulation of protein oligomerization (GO:0032461)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|protein homotetramerization (GO:0051289)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|ubiquitin homeostasis (GO:0010992)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic proteasome complex (GO:0031597)|extracellular space (GO:0005615)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|beta-amyloid binding (GO:0001540)|beta-endorphin binding (GO:0031626)|glycoprotein binding (GO:0001948)|insulin binding (GO:0043559)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)	p.Q718E(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(10)|ovary(2)|urinary_tract(2)	33					"""""""Insulin(DB00071)|Bacitracin(DB00626)|Insulin Regular(DB00030)"""	GACAGGAGCTGAGGTATGAAG	0.448																																						dbGAP											1	Substitution - Missense(1)	breast(1)											173.0	166.0	168.0					10																	94230067		2203	4300	6503	-	-	-	SO:0001583	missense	0			M21188	CCDS7421.1, CCDS53554.1	10q23-q25	2007-03-27			ENSG00000119912	ENSG00000119912			5381	protein-coding gene	gene with protein product	"""insulysin"""	146680				2293021	Standard	NM_004969		Approved		uc001kia.3	P14735	OTTHUMG00000018759	ENST00000265986.6:c.2152C>G	10.37:g.94230067G>C	ENSP00000265986:p.Gln718Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R721|B7ZAU2|D3DR35|Q5T5N2	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.Q718E	ENST00000265986.6	37	c.2152	CCDS7421.1	10	.	.	.	.	.	.	.	.	.	.	G	15.34	2.805458	0.50315	.	.	ENSG00000119912	ENST00000265986;ENST00000371581	T;T	0.07216	3.21;3.21	4.94	4.94	0.65067	Peptidase M16, C-terminal (1);Peptidase M16, core (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.135413	0.50627	D	0.000115	T	0.07728	0.0194	L	0.33093	0.98	0.80722	D	1	B;B	0.22414	0.011;0.069	B;B	0.26864	0.012;0.074	T	0.07271	-1.0781	10	0.02654	T	1	-9.3047	17.7655	0.88476	0.0:0.0:1.0:0.0	.	718;163	P14735;B3KSB8	IDE_HUMAN;.	E	718;163	ENSP00000265986:Q718E;ENSP00000360637:Q163E	ENSP00000265986:Q718E	Q	-	1	0	IDE	94220047	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	9.822000	0.99363	2.256000	0.74724	0.563000	0.77884	CAG	IDE	-	pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	ENSG00000119912		0.448	IDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDE	HGNC	protein_coding	OTTHUMT00000049393.1	211	0.47	1	G	NM_004969		94230067	94230067	-1	no_errors	ENST00000265986	ensembl	human	known	69_37n	missense	339	10.55	40	SNP	1.000	C
INPP4A	3631	genome.wustl.edu	37	2	99203969	99203969	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:99203969G>C	ENST00000523221.1	+	24	2832	c.2832G>C	c.(2830-2832)aaG>aaC	p.K944N	INPP4A_ENST00000409016.4_Missense_Mutation_p.K905N|INPP4A_ENST00000545415.1_Missense_Mutation_p.K905N|INPP4A_ENST00000409851.3_Missense_Mutation_p.K939N|INPP4A_ENST00000409463.1_Missense_Mutation_p.K273N|INPP4A_ENST00000074304.5_Missense_Mutation_p.K944N			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	944					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.K944N(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						ATACAATGAAGAATGTTGGAA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	78.0	79.0					2																	99203969		1849	4083	5932	-	-	-	SO:0001583	missense	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2832G>C	2.37:g.99203969G>C	ENSP00000427722:p.Lys944Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.K944N	ENST00000523221.1	37	c.2832	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584406	0.86748	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000523221	T;T;T;T;T;T	0.58940	1.04;1.4;0.3;1.4;1.04;1.4	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.80237	0.4586	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.998;0.999;0.999	T	0.83017	-0.0169	10	0.87932	D	0	-37.9723	18.4048	0.90532	0.0:0.0:1.0:0.0	.	905;273;944;939	Q96PE3-2;B8ZZB2;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	N	905;939;273;944;905;944	ENSP00000386704:K905N;ENSP00000386777:K939N;ENSP00000386329:K273N;ENSP00000074304:K944N;ENSP00000442149:K905N;ENSP00000427722:K944N	ENSP00000074304:K944N	K	+	3	2	INPP4A	98570401	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.781000	0.85668	2.824000	0.97209	0.655000	0.94253	AAG	INPP4A	-	NULL	ENSG00000040933		0.408	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	141	0.00	0	G	NM_001566		99203969	99203969	+1	no_errors	ENST00000074304	ensembl	human	known	69_37n	missense	141	11.32	18	SNP	1.000	C
INPP4A	3631	genome.wustl.edu	37	2	99203969	99203969	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:99203969G>C	ENST00000523221.1	+	24	2832	c.2832G>C	c.(2830-2832)aaG>aaC	p.K944N	INPP4A_ENST00000409016.4_Missense_Mutation_p.K905N|INPP4A_ENST00000545415.1_Missense_Mutation_p.K905N|INPP4A_ENST00000409851.3_Missense_Mutation_p.K939N|INPP4A_ENST00000409463.1_Missense_Mutation_p.K273N|INPP4A_ENST00000074304.5_Missense_Mutation_p.K944N			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa	944					inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)	p.K944N(1)		breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						ATACAATGAAGAATGTTGGAA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	78.0	79.0					2																	99203969		1849	4083	5932	-	-	-	SO:0001583	missense	0			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2832G>C	2.37:g.99203969G>C	ENSP00000427722:p.Lys944Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15326|Q13187|Q53TD8|Q8TC02	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.K944N	ENST00000523221.1	37	c.2832	CCDS46369.1	2	.	.	.	.	.	.	.	.	.	.	G	24.9	4.584406	0.86748	.	.	ENSG00000040933	ENST00000409016;ENST00000409851;ENST00000409463;ENST00000074304;ENST00000545415;ENST00000523221	T;T;T;T;T;T	0.58940	1.04;1.4;0.3;1.4;1.04;1.4	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.80237	0.4586	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.997;0.998;0.999;0.999	T	0.83017	-0.0169	10	0.87932	D	0	-37.9723	18.4048	0.90532	0.0:0.0:1.0:0.0	.	905;273;944;939	Q96PE3-2;B8ZZB2;Q96PE3;Q96PE3-3	.;.;INP4A_HUMAN;.	N	905;939;273;944;905;944	ENSP00000386704:K905N;ENSP00000386777:K939N;ENSP00000386329:K273N;ENSP00000074304:K944N;ENSP00000442149:K905N;ENSP00000427722:K944N	ENSP00000074304:K944N	K	+	3	2	INPP4A	98570401	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.781000	0.85668	2.824000	0.97209	0.655000	0.94253	AAG	INPP4A	-	NULL	ENSG00000040933		0.408	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	141	0.00	0	G	NM_001566		99203969	99203969	+1	no_errors	ENST00000074304	ensembl	human	known	69_37n	missense	218	12.45	31	SNP	1.000	C
ITK	3702	genome.wustl.edu	37	5	156672782	156672782	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:156672782C>T	ENST00000422843.3	+	14	1648	c.1496C>T	c.(1495-1497)tCt>tTt	p.S499F	ITK_ENST00000519749.1_Intron	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	499	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.S499F(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	ATCAAGGTGTCTGACTTTGGG	0.512			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	dbGAP		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	breast(1)											106.0	101.0	103.0					5																	156672782		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1496C>T	5.37:g.156672782C>T	ENSP00000398655:p.Ser499Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.S499F	ENST00000422843.3	37	c.1496	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911650	0.92178	.	.	ENSG00000113263	ENST00000422843	D	0.84944	-1.92	6.02	6.02	0.97574	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.053543	0.85682	D	0.000000	D	0.95564	0.8558	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96176	0.9127	10	0.87932	D	0	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	499	Q08881	ITK_HUMAN	F	499	ENSP00000398655:S499F	ENSP00000398655:S499F	S	+	2	0	ITK	156605360	1.000000	0.71417	0.970000	0.41538	0.793000	0.44817	5.862000	0.69560	2.865000	0.98341	0.655000	0.94253	TCT	ITK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000113263		0.512	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	185	0.00	0	C			156672782	156672782	+1	no_errors	ENST00000422843	ensembl	human	known	69_37n	missense	102	26.09	36	SNP	1.000	T
ITK	3702	genome.wustl.edu	37	5	156672782	156672782	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:156672782C>T	ENST00000422843.3	+	14	1648	c.1496C>T	c.(1495-1497)tCt>tTt	p.S499F	ITK_ENST00000519749.1_Intron	NM_005546.3	NP_005537.3	Q08881	ITK_HUMAN	IL2-inducible T-cell kinase	499	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|adaptive immune response (GO:0002250)|cellular defense response (GO:0006968)|cytokine production (GO:0001816)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|interleukin-4 production (GO:0032633)|intracellular signal transduction (GO:0035556)|NK T cell differentiation (GO:0001865)|peptidyl-tyrosine phosphorylation (GO:0018108)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.S499F(1)		breast(4)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(25)|ovary(8)|prostate(2)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	70	Renal(175;0.00212)	Medulloblastoma(196;0.0354)|all_neural(177;0.1)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)		Pazopanib(DB06589)	ATCAAGGTGTCTGACTTTGGG	0.512			T	SYK	peripheral T-cell lymphoma																																Esophageal Squamous(70;1378 1469 8785 19883)	dbGAP		Dom	yes		5	5q31-q32	3702	IL2-inducible T-cell kinase		L	1	Substitution - Missense(1)	breast(1)											106.0	101.0	103.0					5																	156672782		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13720	CCDS4336.1	5q31-q32	2014-09-17			ENSG00000113263	ENSG00000113263		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	6171	protein-coding gene	gene with protein product		186973				8364206	Standard	NM_005546		Approved	EMT, PSCTK2, LYK	uc003lwo.1	Q08881	OTTHUMG00000130245	ENST00000422843.3:c.1496C>T	5.37:g.156672782C>T	ENSP00000398655:p.Ser499Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R752|Q32ML7	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_Znf_Btk_motif,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.S499F	ENST00000422843.3	37	c.1496	CCDS4336.1	5	.	.	.	.	.	.	.	.	.	.	C	28.3	4.911650	0.92178	.	.	ENSG00000113263	ENST00000422843	D	0.84944	-1.92	6.02	6.02	0.97574	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.053543	0.85682	D	0.000000	D	0.95564	0.8558	H	0.96861	3.895	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	D	0.96176	0.9127	10	0.87932	D	0	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	499	Q08881	ITK_HUMAN	F	499	ENSP00000398655:S499F	ENSP00000398655:S499F	S	+	2	0	ITK	156605360	1.000000	0.71417	0.970000	0.41538	0.793000	0.44817	5.862000	0.69560	2.865000	0.98341	0.655000	0.94253	TCT	ITK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000113263		0.512	ITK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITK	HGNC	protein_coding	OTTHUMT00000252569.2	185	0.00	0	C			156672782	156672782	+1	no_errors	ENST00000422843	ensembl	human	known	69_37n	missense	147	26.13	52	SNP	1.000	T
KAT2B	8850	genome.wustl.edu	37	3	20161094	20161094	+	Silent	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:20161094C>A	ENST00000263754.4	+	8	1610	c.1155C>A	c.(1153-1155)atC>atA	p.I385I		NM_003884.4	NP_003875.3	Q92831	KAT2B_HUMAN	K(lysine) acetyltransferase 2B	385					cell cycle arrest (GO:0007050)|cellular response to insulin stimulus (GO:0032869)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|gene expression (GO:0010467)|histone H3 acetylation (GO:0043966)|histone H3-K9 acetylation (GO:0043970)|internal peptidyl-lysine acetylation (GO:0018393)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|Notch signaling pathway (GO:0007219)|peptidyl-lysine acetylation (GO:0018394)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein acetylation (GO:0006473)|regulation of protein ADP-ribosylation (GO:0010835)|rhythmic process (GO:0048511)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	A band (GO:0031672)|actomyosin (GO:0042641)|Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|I band (GO:0031674)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	acetyltransferase activity (GO:0016407)|cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|histone acetyltransferase activity (GO:0004402)|histone deacetylase binding (GO:0042826)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|protein complex binding (GO:0032403)|protein kinase binding (GO:0019901)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.I385I(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	40						GGGCAGTTATCAATCCACCTC	0.512																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											116.0	108.0	111.0					3																	20161094		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U57316	CCDS2634.1	3p24	2011-07-01	2008-07-04	2008-07-04	ENSG00000114166	ENSG00000114166		"""Chromatin-modifying enzymes / K-acetyltransferases"""	8638	protein-coding gene	gene with protein product		602303	"""p300/CBP-associated factor"""	PCAF		8684459, 9722949	Standard	NM_003884		Approved	P/CAF, GCN5, GCN5L	uc003cbq.3	Q92831	OTTHUMG00000130481	ENST00000263754.4:c.1155C>A	3.37:g.20161094C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NSK1	Silent	SNP	pirsf_Hist_acetylase_PCAF,pfam_PCAF_N,pfam_Bromodomain,pfam_GNAT_dom,superfamily_Bromodomain,superfamily_Acyl_CoA_acyltransferase,smart_Bromodomain,pfscan_Bromodomain,pfscan_GNAT_dom,prints_Bromodomain	p.I385	ENST00000263754.4	37	c.1155	CCDS2634.1	3																																																																																			KAT2B	-	pirsf_Hist_acetylase_PCAF	ENSG00000114166		0.512	KAT2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KAT2B	HGNC	protein_coding	OTTHUMT00000252880.1	117	0.00	0	C	NM_003884		20161094	20161094	+1	no_errors	ENST00000263754	ensembl	human	known	69_37n	silent	130	10.96	16	SNP	1.000	A
KDM3B	51780	genome.wustl.edu	37	5	137721882	137721882	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:137721882G>A	ENST00000314358.5	+	7	1152	c.952G>A	c.(952-954)Gag>Aag	p.E318K	KDM3B_ENST00000394866.1_Intron|KDM3B_ENST00000542866.1_5'Flank	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	318					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.E318K(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CGATGGAGGTGAGGCAAGCCG	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	106.0	105.0					5																	137721882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.952G>A	5.37:g.137721882G>A	ENSP00000326563:p.Glu318Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.E318K	ENST00000314358.5	37	c.952	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026836	0.93518	.	.	ENSG00000120733	ENST00000314358;ENST00000545151	T	0.64803	-0.12	5.59	5.59	0.84812	.	0.268537	0.37136	N	0.002227	T	0.54565	0.1866	L	0.29908	0.895	0.80722	D	1	P	0.40970	0.734	B	0.37731	0.257	T	0.60835	-0.7184	10	0.72032	D	0.01	-6.7679	19.5692	0.95405	0.0:0.0:1.0:0.0	.	318	Q7LBC6	KDM3B_HUMAN	K	318;108	ENSP00000326563:E318K	ENSP00000326563:E318K	E	+	1	0	KDM3B	137749781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.911000	0.69939	2.614000	0.88457	0.557000	0.71058	GAG	KDM3B	-	NULL	ENSG00000120733		0.552	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	175	0.00	0	G	NM_016604		137721882	137721882	+1	no_errors	ENST00000314358	ensembl	human	known	69_37n	missense	100	23.08	30	SNP	1.000	A
KDM3B	51780	genome.wustl.edu	37	5	137721882	137721882	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:137721882G>A	ENST00000314358.5	+	7	1152	c.952G>A	c.(952-954)Gag>Aag	p.E318K	KDM3B_ENST00000394866.1_Intron|KDM3B_ENST00000542866.1_5'Flank	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	318					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.E318K(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						CGATGGAGGTGAGGCAAGCCG	0.552																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	106.0	105.0					5																	137721882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.952G>A	5.37:g.137721882G>A	ENSP00000326563:p.Glu318Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.E318K	ENST00000314358.5	37	c.952	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	29.7	5.026836	0.93518	.	.	ENSG00000120733	ENST00000314358;ENST00000545151	T	0.64803	-0.12	5.59	5.59	0.84812	.	0.268537	0.37136	N	0.002227	T	0.54565	0.1866	L	0.29908	0.895	0.80722	D	1	P	0.40970	0.734	B	0.37731	0.257	T	0.60835	-0.7184	10	0.72032	D	0.01	-6.7679	19.5692	0.95405	0.0:0.0:1.0:0.0	.	318	Q7LBC6	KDM3B_HUMAN	K	318;108	ENSP00000326563:E318K	ENSP00000326563:E318K	E	+	1	0	KDM3B	137749781	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.911000	0.69939	2.614000	0.88457	0.557000	0.71058	GAG	KDM3B	-	NULL	ENSG00000120733		0.552	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	175	0.00	0	G	NM_016604		137721882	137721882	+1	no_errors	ENST00000314358	ensembl	human	known	69_37n	missense	63	23.17	19	SNP	1.000	A
KIAA0754	643314	genome.wustl.edu	37	1	39877483	39877483	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:39877483G>C	ENST00000530275.1	+	1	1333	c.1138G>C	c.(1138-1140)Gaa>Caa	p.E380Q	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	380										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGCTGCCTTAGAAAAGGAACA	0.403																																						dbGAP											0													77.0	74.0	75.0					1																	39877483		1834	4091	5925	-	-	-	SO:0001583	missense	0					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1138G>C	1.37:g.39877483G>C	ENSP00000431179:p.Glu380Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.E380Q	ENST00000530275.1	37	c.1138		1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179795	0.78564	.	.	ENSG00000255103	ENST00000530275	D	0.86097	-2.07	5.2	5.2	0.72013	.	.	.	.	.	D	0.87771	0.6261	N	0.24115	0.695	0.22424	N	0.99911	D	0.89917	1.0	D	0.74023	0.982	T	0.81922	-0.0711	9	0.87932	D	0	.	16.9377	0.86207	0.0:0.0:1.0:0.0	.	380	O94854	K0754_HUMAN	Q	380	ENSP00000431179:E380Q	ENSP00000431179:E380Q	E	+	1	0	RP4-562N20.1	39650070	0.998000	0.40836	1.000000	0.80357	0.808000	0.45660	2.819000	0.48049	2.429000	0.82318	0.655000	0.94253	GAA	KIAA0754	-	NULL	ENSG00000255103		0.403	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	115	0.00	0	G	NM_015038		39877483	39877483	+1	no_errors	ENST00000530275	ensembl	human	known	69_37n	missense	120	31.82	56	SNP	0.933	C
KIAA0754	643314	genome.wustl.edu	37	1	39877483	39877483	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:39877483G>C	ENST00000530275.1	+	1	1333	c.1138G>C	c.(1138-1140)Gaa>Caa	p.E380Q	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	380										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GGCTGCCTTAGAAAAGGAACA	0.403																																						dbGAP											0													77.0	74.0	75.0					1																	39877483		1834	4091	5925	-	-	-	SO:0001583	missense	0					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1138G>C	1.37:g.39877483G>C	ENSP00000431179:p.Glu380Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.E380Q	ENST00000530275.1	37	c.1138		1	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179795	0.78564	.	.	ENSG00000255103	ENST00000530275	D	0.86097	-2.07	5.2	5.2	0.72013	.	.	.	.	.	D	0.87771	0.6261	N	0.24115	0.695	0.22424	N	0.99911	D	0.89917	1.0	D	0.74023	0.982	T	0.81922	-0.0711	9	0.87932	D	0	.	16.9377	0.86207	0.0:0.0:1.0:0.0	.	380	O94854	K0754_HUMAN	Q	380	ENSP00000431179:E380Q	ENSP00000431179:E380Q	E	+	1	0	RP4-562N20.1	39650070	0.998000	0.40836	1.000000	0.80357	0.808000	0.45660	2.819000	0.48049	2.429000	0.82318	0.655000	0.94253	GAA	KIAA0754	-	NULL	ENSG00000255103		0.403	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	115	0.00	0	G	NM_015038		39877483	39877483	+1	no_errors	ENST00000530275	ensembl	human	known	69_37n	missense	77	30.63	34	SNP	0.933	C
KIAA0754	643314	genome.wustl.edu	37	1	39877816	39877816	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:39877816G>C	ENST00000530275.1	+	1	1666	c.1471G>C	c.(1471-1473)Gac>Cac	p.D491H	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	491										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCTGGCCAAAGACAATGGCAG	0.468																																						dbGAP											0													164.0	157.0	159.0					1																	39877816		1899	4114	6013	-	-	-	SO:0001583	missense	0					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1471G>C	1.37:g.39877816G>C	ENSP00000431179:p.Asp491His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.D491H	ENST00000530275.1	37	c.1471		1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.348821	0.41599	.	.	ENSG00000255103	ENST00000530275	D	0.86297	-2.1	5.41	3.35	0.38373	.	.	.	.	.	T	0.75693	0.3884	N	0.08118	0	0.22819	N	0.998699	B	0.21225	0.053	B	0.20955	0.032	T	0.68202	-0.5471	9	0.87932	D	0	.	12.0314	0.53399	0.0:0.2652:0.7348:0.0	.	491	O94854	K0754_HUMAN	H	491	ENSP00000431179:D491H	ENSP00000431179:D491H	D	+	1	0	RP4-562N20.1	39650403	0.115000	0.22152	1.000000	0.80357	0.985000	0.73830	0.568000	0.23623	2.543000	0.85770	0.655000	0.94253	GAC	KIAA0754	-	NULL	ENSG00000255103		0.468	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	133	0.00	0	G	NM_015038		39877816	39877816	+1	no_errors	ENST00000530275	ensembl	human	known	69_37n	missense	111	30.63	49	SNP	1.000	C
KIAA0754	643314	genome.wustl.edu	37	1	39877816	39877816	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:39877816G>C	ENST00000530275.1	+	1	1666	c.1471G>C	c.(1471-1473)Gac>Cac	p.D491H	MACF1_ENST00000545844.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000567887.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	491										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GCTGGCCAAAGACAATGGCAG	0.468																																						dbGAP											0													164.0	157.0	159.0					1																	39877816		1899	4114	6013	-	-	-	SO:0001583	missense	0					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.1471G>C	1.37:g.39877816G>C	ENSP00000431179:p.Asp491His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.D491H	ENST00000530275.1	37	c.1471		1	.	.	.	.	.	.	.	.	.	.	G	13.81	2.348821	0.41599	.	.	ENSG00000255103	ENST00000530275	D	0.86297	-2.1	5.41	3.35	0.38373	.	.	.	.	.	T	0.75693	0.3884	N	0.08118	0	0.22819	N	0.998699	B	0.21225	0.053	B	0.20955	0.032	T	0.68202	-0.5471	9	0.87932	D	0	.	12.0314	0.53399	0.0:0.2652:0.7348:0.0	.	491	O94854	K0754_HUMAN	H	491	ENSP00000431179:D491H	ENSP00000431179:D491H	D	+	1	0	RP4-562N20.1	39650403	0.115000	0.22152	1.000000	0.80357	0.985000	0.73830	0.568000	0.23623	2.543000	0.85770	0.655000	0.94253	GAC	KIAA0754	-	NULL	ENSG00000255103		0.468	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	133	0.00	0	G	NM_015038		39877816	39877816	+1	no_errors	ENST00000530275	ensembl	human	known	69_37n	missense	77	28.70	31	SNP	1.000	C
NWD2	57495	genome.wustl.edu	37	4	37445636	37445636	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:37445636G>A	ENST00000309447.5	+	7	2874	c.2026G>A	c.(2026-2028)Gaa>Aaa	p.E676K		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		676	NACHT.							p.E676K(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						GAGTGAAATGGAACTGGAGGA	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	64.0	66.0					4																	37445636		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000309447.5:c.2026G>A	4.37:g.37445636G>A	ENSP00000309501:p.Glu676Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E676K	ENST00000309447.5	37	c.2026	CCDS47040.1	4	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411781	0.83340	.	.	ENSG00000174145	ENST00000309447	D	0.94650	-3.48	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.97639	0.9226	M	0.84683	2.71	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.97604	1.0125	10	0.87932	D	0	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	676	Q9ULI1	K1239_HUMAN	K	676	ENSP00000309501:E676K	ENSP00000309501:E676K	E	+	1	0	KIAA1239	37122031	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	GAA	KIAA1239	-	NULL	ENSG00000174145		0.468	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	101	0.00	0	G			37445636	37445636	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	missense	35	20.45	9	SNP	1.000	A
NWD2	57495	genome.wustl.edu	37	4	37445636	37445636	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:37445636G>A	ENST00000309447.5	+	7	2874	c.2026G>A	c.(2026-2028)Gaa>Aaa	p.E676K		NM_001144990.1	NP_001138462.1	Q9ULI1	NWD2_HUMAN		676	NACHT.							p.E676K(1)		breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(2)|skin(2)	16						GAGTGAAATGGAACTGGAGGA	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	64.0	66.0					4																	37445636		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000309447.5:c.2026G>A	4.37:g.37445636G>A	ENSP00000309501:p.Glu676Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRU1	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E676K	ENST00000309447.5	37	c.2026	CCDS47040.1	4	.	.	.	.	.	.	.	.	.	.	G	23.4	4.411781	0.83340	.	.	ENSG00000174145	ENST00000309447	D	0.94650	-3.48	6.05	6.05	0.98169	.	0.000000	0.85682	D	0.000000	D	0.97639	0.9226	M	0.84683	2.71	0.80722	D	1	D	0.69078	0.997	D	0.75020	0.985	D	0.97604	1.0125	10	0.87932	D	0	.	20.6013	0.99457	0.0:0.0:1.0:0.0	.	676	Q9ULI1	K1239_HUMAN	K	676	ENSP00000309501:E676K	ENSP00000309501:E676K	E	+	1	0	KIAA1239	37122031	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.476000	0.97823	2.878000	0.98634	0.650000	0.86243	GAA	KIAA1239	-	NULL	ENSG00000174145		0.468	KIAA1239-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1239	HGNC	protein_coding	OTTHUMT00000347551.2	101	0.00	0	G			37445636	37445636	+1	no_errors	ENST00000309447	ensembl	human	known	69_37n	missense	63	20.25	16	SNP	1.000	A
RIC1	57589	genome.wustl.edu	37	9	5762597	5762597	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:5762597G>A	ENST00000414202.2	+	18	2240	c.2049G>A	c.(2047-2049)caG>caA	p.Q683Q	KIAA1432_ENST00000381532.2_Silent_p.Q604Q|KIAA1432_ENST00000449720.2_Silent_p.Q567Q|KIAA1432_ENST00000418622.3_Silent_p.Q604Q|KIAA1432_ENST00000251879.6_Silent_p.Q683Q	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.Q604Q(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCATGATGCAGAGGGACAGGT	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											112.0	99.0	103.0					9																	5762597		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000414202.2:c.2049G>A	9.37:g.5762597G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.E575K	ENST00000414202.2	37	c.1723	CCDS34982.2	9	.	.	.	.	.	.	.	.	.	.	G	6.930	0.541329	0.13250	.	.	ENSG00000107036	ENST00000545641	.	.	.	5.92	5.03	0.67393	.	.	.	.	.	T	0.56992	0.2023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55995	-0.8052	4	.	.	.	-14.3843	7.1506	0.25608	0.2799:0.0:0.7201:0.0	.	.	.	.	K	575	.	.	E	+	1	0	KIAA1432	5752597	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.662000	0.54510	1.527000	0.49086	0.561000	0.74099	GAG	KIAA1432	-	NULL	ENSG00000107036		0.423	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	138	0.00	0	G			5762597	5762597	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000545641	ensembl	human	novel	69_37n	missense	68	20.00	17	SNP	1.000	A
RIC1	57589	genome.wustl.edu	37	9	5762597	5762597	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:5762597G>A	ENST00000414202.2	+	18	2240	c.2049G>A	c.(2047-2049)caG>caA	p.Q683Q	KIAA1432_ENST00000381532.2_Silent_p.Q604Q|KIAA1432_ENST00000449720.2_Silent_p.Q567Q|KIAA1432_ENST00000418622.3_Silent_p.Q604Q|KIAA1432_ENST00000251879.6_Silent_p.Q683Q	NM_001206557.1|NM_020829.3	NP_001193486.1|NP_065880.2												p.Q604Q(1)		breast(2)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(23)|prostate(1)|upper_aerodigestive_tract(1)	45		Acute lymphoblastic leukemia(23;0.154)		GBM - Glioblastoma multiforme(50;0.000525)|Lung(218;0.122)		TCATGATGCAGAGGGACAGGT	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											112.0	99.0	103.0					9																	5762597		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000414202.2:c.2049G>A	9.37:g.5762597G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosome_control_1,superfamily_WD40_repeat_dom	p.E575K	ENST00000414202.2	37	c.1723	CCDS34982.2	9	.	.	.	.	.	.	.	.	.	.	G	6.930	0.541329	0.13250	.	.	ENSG00000107036	ENST00000545641	.	.	.	5.92	5.03	0.67393	.	.	.	.	.	T	0.56992	0.2023	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.55995	-0.8052	4	.	.	.	-14.3843	7.1506	0.25608	0.2799:0.0:0.7201:0.0	.	.	.	.	K	575	.	.	E	+	1	0	KIAA1432	5752597	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.662000	0.54510	1.527000	0.49086	0.561000	0.74099	GAG	KIAA1432	-	NULL	ENSG00000107036		0.423	KIAA1432-002	NOVEL	basic|appris_principal|CCDS	protein_coding	KIAA1432	HGNC	protein_coding	OTTHUMT00000051636.3	138	0.00	0	G			5762597	5762597	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000545641	ensembl	human	novel	69_37n	missense	96	23.20	29	SNP	1.000	A
KIF3C	3797	genome.wustl.edu	37	2	26203692	26203692	+	Silent	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:26203692G>T	ENST00000264712.3	-	1	1674	c.1095C>A	c.(1093-1095)atC>atA	p.I365I	KIF3C_ENST00000405914.1_Silent_p.I365I	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	365	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.I365I(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTTGTTCTTGATGTTCTTGG	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	85.0	88.0					2																	26203692		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1095C>A	2.37:g.26203692G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43544|Q4ZG18|Q53SX5|Q562F7	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I365	ENST00000264712.3	37	c.1095	CCDS1719.1	2																																																																																			KIF3C	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000084731		0.582	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3C	HGNC	protein_coding	OTTHUMT00000211611.1	145	0.00	0	G			26203692	26203692	-1	no_errors	ENST00000264712	ensembl	human	known	69_37n	silent	46	20.69	12	SNP	0.999	T
KIF3C	3797	genome.wustl.edu	37	2	26203692	26203692	+	Silent	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:26203692G>T	ENST00000264712.3	-	1	1674	c.1095C>A	c.(1093-1095)atC>atA	p.I365I	KIF3C_ENST00000405914.1_Silent_p.I365I	NM_002254.6	NP_002245	O14782	KIF3C_HUMAN	kinesin family member 3C	365	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle transport along microtubule (GO:0072384)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)	p.I365I(1)		breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GCTTGTTCTTGATGTTCTTGG	0.582																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											95.0	85.0	88.0					2																	26203692		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1719.1	2p23	2008-02-05			ENSG00000084731	ENSG00000084731		"""Kinesins"""	6321	protein-coding gene	gene with protein product		602845				9480755	Standard	NM_002254		Approved		uc002rgu.2	O14782	OTTHUMG00000094797	ENST00000264712.3:c.1095C>A	2.37:g.26203692G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43544|Q4ZG18|Q53SX5|Q562F7	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.I365	ENST00000264712.3	37	c.1095	CCDS1719.1	2																																																																																			KIF3C	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000084731		0.582	KIF3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3C	HGNC	protein_coding	OTTHUMT00000211611.1	145	0.00	0	G			26203692	26203692	-1	no_errors	ENST00000264712	ensembl	human	known	69_37n	silent	65	23.53	20	SNP	0.999	T
KIF5B	3799	genome.wustl.edu	37	10	32344886	32344886	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:32344886C>T	ENST00000302418.4	-	1	473	c.16G>A	c.(16-18)Gag>Aag	p.E6K	Y_RNA_ENST00000383933.1_RNA	NM_004521.2	NP_004512.1	P33176	KINH_HUMAN	kinesin family member 5B	6					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cellular protein metabolic process (GO:0044267)|cytoplasm organization (GO:0007028)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|regulation of membrane potential (GO:0042391)|stress granule disassembly (GO:0035617)|vesicle transport along microtubule (GO:0047496)	ciliary rootlet (GO:0035253)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule organizing center (GO:0005815)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|vesicle (GO:0031982)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule binding (GO:0008017)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)		KIF5B/ALK(8)|KIF5B/RET(79)	NS(2)|breast(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(11)|ovary(1)|prostate(1)	35		Prostate(175;0.0137)				ATGTTGCACTCGGCCAGGTCC	0.627			T	"""RET, ALK"""	NSCLC																																	dbGAP		Dom	yes		10	10p11.22	3799	kinesin family member 5B		E	0													55.0	48.0	50.0					10																	32344886		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65873	CCDS7171.1	10p11.22	2007-02-13			ENSG00000170759	ENSG00000170759		"""Kinesins"""	6324	protein-coding gene	gene with protein product		602809		KNS1		1607388	Standard	NM_004521		Approved	KNS	uc001iwe.4	P33176	OTTHUMG00000017913	ENST00000302418.4:c.16G>A	10.37:g.32344886C>T	ENSP00000307078:p.Glu6Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVB2|Q5VZ85	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E6K	ENST00000302418.4	37	c.16	CCDS7171.1	10	.	.	.	.	.	.	.	.	.	.	C	37	6.238484	0.97403	.	.	ENSG00000170759	ENST00000302418	T	0.75821	-0.97	5.03	5.03	0.67393	Kinesin, motor domain (2);	0.000000	0.85682	D	0.000000	T	0.58509	0.2127	N	0.02169	-0.655	0.80722	D	1	D	0.64830	0.994	P	0.47603	0.551	T	0.72571	-0.4253	10	0.56958	D	0.05	.	18.3792	0.90444	0.0:1.0:0.0:0.0	.	6	P33176	KINH_HUMAN	K	6	ENSP00000307078:E6K	ENSP00000307078:E6K	E	-	1	0	KIF5B	32384892	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.408000	0.80041	2.334000	0.79466	0.655000	0.94253	GAG	KIF5B	-	smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	ENSG00000170759		0.627	KIF5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5B	HGNC	protein_coding	OTTHUMT00000047467.1	17	0.00	0	C	NM_004521		32344886	32344886	-1	no_errors	ENST00000302418	ensembl	human	known	69_37n	missense	3	50.00	3	SNP	1.000	T
KPNA4	3840	genome.wustl.edu	37	3	160225904	160225904	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:160225904C>G	ENST00000334256.4	-	15	1668	c.1363G>C	c.(1363-1365)Gaa>Caa	p.E455Q		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	455					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)	p.E455Q(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CCTCCACATTCTTCTATAAGA	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	125.0	126.0					3																	160225904		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.1363G>C	3.37:g.160225904C>G	ENSP00000334373:p.Glu455Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.E455Q	ENST00000334256.4	37	c.1363	CCDS3191.1	3	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667396	0.88348	.	.	ENSG00000186432	ENST00000334256;ENST00000483437	T;T	0.65364	-0.15;-0.15	5.22	5.22	0.72569	Armadillo-like helical (1);Armadillo-type fold (1);	0.049578	0.85682	D	0.000000	T	0.68677	0.3027	M	0.79011	2.435	0.80722	D	1	P	0.40638	0.725	B	0.41135	0.348	T	0.74928	-0.3497	10	0.72032	D	0.01	-4.9881	18.7817	0.91934	0.0:1.0:0.0:0.0	.	455	O00629	IMA4_HUMAN	Q	455;136	ENSP00000334373:E455Q;ENSP00000417172:E136Q	ENSP00000334373:E455Q	E	-	1	0	KPNA4	161708598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.725000	0.84808	2.440000	0.82611	0.555000	0.69702	GAA	KPNA4	-	superfamily_ARM-type_fold	ENSG00000186432		0.328	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA4	HGNC	protein_coding	OTTHUMT00000352960.1	124	0.00	0	C	NM_002268		160225904	160225904	-1	no_errors	ENST00000334256	ensembl	human	known	69_37n	missense	196	18.33	44	SNP	1.000	G
KPNA4	3840	genome.wustl.edu	37	3	160225904	160225904	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:160225904C>G	ENST00000334256.4	-	15	1668	c.1363G>C	c.(1363-1365)Gaa>Caa	p.E455Q		NM_002268.4	NP_002259.1	O00629	IMA3_HUMAN	karyopherin alpha 4 (importin alpha 3)	455					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)	protein transporter activity (GO:0008565)	p.E455Q(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(10)|prostate(2)	22			Lung(72;0.00149)|LUSC - Lung squamous cell carcinoma(72;0.00216)			CCTCCACATTCTTCTATAAGA	0.328																																						dbGAP											1	Substitution - Missense(1)	breast(1)											129.0	125.0	126.0					3																	160225904		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002533	CCDS3191.1	3q25.33	2013-02-14			ENSG00000186432	ENSG00000186432		"""Importins"", ""Armadillo repeat containing"""	6397	protein-coding gene	gene with protein product		602970				9168958, 9395085	Standard	NM_002268		Approved	QIP1, SRP3, IPOA3, MGC12217, MGC26703	uc003fdn.3	O00629	OTTHUMG00000159033	ENST00000334256.4:c.1363G>C	3.37:g.160225904C>G	ENSP00000334373:p.Glu455Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S6|D3DNM2|O00190	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.E455Q	ENST00000334256.4	37	c.1363	CCDS3191.1	3	.	.	.	.	.	.	.	.	.	.	C	25.7	4.667396	0.88348	.	.	ENSG00000186432	ENST00000334256;ENST00000483437	T;T	0.65364	-0.15;-0.15	5.22	5.22	0.72569	Armadillo-like helical (1);Armadillo-type fold (1);	0.049578	0.85682	D	0.000000	T	0.68677	0.3027	M	0.79011	2.435	0.80722	D	1	P	0.40638	0.725	B	0.41135	0.348	T	0.74928	-0.3497	10	0.72032	D	0.01	-4.9881	18.7817	0.91934	0.0:1.0:0.0:0.0	.	455	O00629	IMA4_HUMAN	Q	455;136	ENSP00000334373:E455Q;ENSP00000417172:E136Q	ENSP00000334373:E455Q	E	-	1	0	KPNA4	161708598	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.725000	0.84808	2.440000	0.82611	0.555000	0.69702	GAA	KPNA4	-	superfamily_ARM-type_fold	ENSG00000186432		0.328	KPNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA4	HGNC	protein_coding	OTTHUMT00000352960.1	124	0.00	0	C	NM_002268		160225904	160225904	-1	no_errors	ENST00000334256	ensembl	human	known	69_37n	missense	316	20.00	79	SNP	1.000	G
LAG3	3902	genome.wustl.edu	37	12	6886451	6886451	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:6886451C>T	ENST00000203629.2	+	6	1412	c.1079C>T	c.(1078-1080)tCa>tTa	p.S360L		NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	360	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)	p.S360L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TCCTTTGGGTCACCTGGATCC	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	109.0	109.0					12																	6886451		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.1079C>T	12.37:g.6886451C>T	ENSP00000203629:p.Ser360Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7T9|Q7Z643	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.S360L	ENST00000203629.2	37	c.1079	CCDS8561.1	12	.	.	.	.	.	.	.	.	.	.	C	1.173	-0.640327	0.03557	.	.	ENSG00000089692	ENST00000203629	T	0.12255	2.7	4.55	-3.98	0.04082	.	1.990140	0.02077	N	0.052032	T	0.06371	0.0164	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38908	-0.9639	10	0.07990	T	0.79	5.0634	12.0153	0.53311	0.0:0.6838:0.0:0.3162	.	360	P18627	LAG3_HUMAN	L	360	ENSP00000203629:S360L	ENSP00000203629:S360L	S	+	2	0	LAG3	6756712	0.013000	0.17824	0.019000	0.16419	0.915000	0.54546	-0.222000	0.09190	-0.649000	0.05430	-0.258000	0.10820	TCA	LAG3	-	NULL	ENSG00000089692		0.507	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAG3	HGNC	protein_coding	OTTHUMT00000402846.1	65	0.00	0	C			6886451	6886451	+1	no_errors	ENST00000203629	ensembl	human	known	69_37n	missense	33	36.54	19	SNP	0.001	T
LAG3	3902	genome.wustl.edu	37	12	6886451	6886451	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:6886451C>T	ENST00000203629.2	+	6	1412	c.1079C>T	c.(1078-1080)tCa>tTa	p.S360L		NM_002286.5	NP_002277.4	P18627	LAG3_HUMAN	lymphocyte-activation gene 3	360	Ig-like C2-type 3.				cell surface receptor signaling pathway (GO:0007166)|negative regulation of interleukin-2 biosynthetic process (GO:0045085)|negative regulation of T cell activation (GO:0050868)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|MHC class II protein binding (GO:0042289)|transmembrane signaling receptor activity (GO:0004888)	p.S360L(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TCCTTTGGGTCACCTGGATCC	0.507																																						dbGAP											1	Substitution - Missense(1)	breast(1)											109.0	109.0	109.0					12																	6886451		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8561.1	12p13.3	2013-01-11			ENSG00000089692	ENSG00000089692		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6476	protein-coding gene	gene with protein product		153337					Standard	NM_002286		Approved	CD223	uc001qqt.4	P18627	OTTHUMG00000169197	ENST00000203629.2:c.1079C>T	12.37:g.6886451C>T	ENSP00000203629:p.Ser360Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7T9|Q7Z643	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.S360L	ENST00000203629.2	37	c.1079	CCDS8561.1	12	.	.	.	.	.	.	.	.	.	.	C	1.173	-0.640327	0.03557	.	.	ENSG00000089692	ENST00000203629	T	0.12255	2.7	4.55	-3.98	0.04082	.	1.990140	0.02077	N	0.052032	T	0.06371	0.0164	N	0.04203	-0.255	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.38908	-0.9639	10	0.07990	T	0.79	5.0634	12.0153	0.53311	0.0:0.6838:0.0:0.3162	.	360	P18627	LAG3_HUMAN	L	360	ENSP00000203629:S360L	ENSP00000203629:S360L	S	+	2	0	LAG3	6756712	0.013000	0.17824	0.019000	0.16419	0.915000	0.54546	-0.222000	0.09190	-0.649000	0.05430	-0.258000	0.10820	TCA	LAG3	-	NULL	ENSG00000089692		0.507	LAG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAG3	HGNC	protein_coding	OTTHUMT00000402846.1	65	0.00	0	C			6886451	6886451	+1	no_errors	ENST00000203629	ensembl	human	known	69_37n	missense	58	31.76	27	SNP	0.001	T
LARGE	9215	genome.wustl.edu	37	22	33960864	33960864	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr22:33960864C>G	ENST00000354992.2	-	7	1328	c.757G>C	c.(757-759)Gag>Cag	p.E253Q	LARGE_ENST00000397394.2_Missense_Mutation_p.E253Q|LARGE_ENST00000437602.2_Missense_Mutation_p.E253Q|LARGE_ENST00000452586.2_Missense_Mutation_p.E52Q|LARGE_ENST00000337431.2_Missense_Mutation_p.E253Q|LARGE_ENST00000402320.1_Missense_Mutation_p.E253Q	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	253					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.E253Q(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				GCCCACAGCTCTGCAATGTCA	0.483																																					Colon(70;397 1175 4573 19089 45288)	dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	121.0	128.0					22																	33960864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.757G>C	22.37:g.33960864C>G	ENSP00000347088:p.Glu253Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.E253Q	ENST00000354992.2	37	c.757	CCDS13912.1	22	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039040	0.75617	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602;ENST00000421768	T;T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67;1.67	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.48114	0.1482	M	0.71581	2.175	0.80722	D	1	P;B;P;P	0.47106	0.89;0.138;0.86;0.78	P;B;P;P	0.49528	0.596;0.177;0.614;0.474	T	0.28586	-1.0039	10	0.45353	T	0.12	-1.144	20.8598	0.99761	0.0:1.0:0.0:0.0	.	253;52;253;253	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	Q	253;253;253;253;52;253;52	ENSP00000347088:E253Q;ENSP00000336636:E253Q;ENSP00000380549:E253Q;ENSP00000385223:E253Q;ENSP00000407917:E52Q;ENSP00000388544:E253Q;ENSP00000403841:E52Q	ENSP00000336636:E253Q	E	-	1	0	LARGE	32290864	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	7.414000	0.80117	2.937000	0.99478	0.650000	0.86243	GAG	LARGE	-	pfam_Glyco_trans_8	ENSG00000133424		0.483	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	78	0.00	0	C	NM_133642		33960864	33960864	-1	no_errors	ENST00000354992	ensembl	human	known	69_37n	missense	38	24.00	12	SNP	1.000	G
LARGE	9215	genome.wustl.edu	37	22	33960864	33960864	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr22:33960864C>G	ENST00000354992.2	-	7	1328	c.757G>C	c.(757-759)Gag>Cag	p.E253Q	LARGE_ENST00000397394.2_Missense_Mutation_p.E253Q|LARGE_ENST00000437602.2_Missense_Mutation_p.E253Q|LARGE_ENST00000452586.2_Missense_Mutation_p.E52Q|LARGE_ENST00000337431.2_Missense_Mutation_p.E253Q|LARGE_ENST00000402320.1_Missense_Mutation_p.E253Q	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	253					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)	p.E253Q(1)		breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				GCCCACAGCTCTGCAATGTCA	0.483																																					Colon(70;397 1175 4573 19089 45288)	dbGAP											1	Substitution - Missense(1)	breast(1)											140.0	121.0	128.0					22																	33960864		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.757G>C	22.37:g.33960864C>G	ENSP00000347088:p.Glu253Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.E253Q	ENST00000354992.2	37	c.757	CCDS13912.1	22	.	.	.	.	.	.	.	.	.	.	C	20.7	4.039040	0.75617	.	.	ENSG00000133424	ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602;ENST00000421768	T;T;T;T;T;T;T	0.27402	1.67;1.67;1.67;1.67;1.67;1.67;1.67	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.48114	0.1482	M	0.71581	2.175	0.80722	D	1	P;B;P;P	0.47106	0.89;0.138;0.86;0.78	P;B;P;P	0.49528	0.596;0.177;0.614;0.474	T	0.28586	-1.0039	10	0.45353	T	0.12	-1.144	20.8598	0.99761	0.0:1.0:0.0:0.0	.	253;52;253;253	B7Z2I9;E9PH73;O95461-2;O95461	.;.;.;LARGE_HUMAN	Q	253;253;253;253;52;253;52	ENSP00000347088:E253Q;ENSP00000336636:E253Q;ENSP00000380549:E253Q;ENSP00000385223:E253Q;ENSP00000407917:E52Q;ENSP00000388544:E253Q;ENSP00000403841:E52Q	ENSP00000336636:E253Q	E	-	1	0	LARGE	32290864	1.000000	0.71417	0.996000	0.52242	0.965000	0.64279	7.414000	0.80117	2.937000	0.99478	0.650000	0.86243	GAG	LARGE	-	pfam_Glyco_trans_8	ENSG00000133424		0.483	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	78	0.00	0	C	NM_133642		33960864	33960864	-1	no_errors	ENST00000354992	ensembl	human	known	69_37n	missense	60	25.93	21	SNP	1.000	G
LIFR	3977	genome.wustl.edu	37	5	38493737	38493737	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:38493737G>A	ENST00000263409.4	-	14	2198	c.2036C>T	c.(2035-2037)tCa>tTa	p.S679L	LIFR_ENST00000453190.2_Missense_Mutation_p.S679L|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	679	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.S679L(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AGTGCTGTTTGAGGGAACTTT	0.418			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	2	Substitution - Missense(2)	breast(2)											148.0	137.0	141.0					5																	38493737		2203	4300	6503	-	-	-	SO:0001583	missense	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2036C>T	5.37:g.38493737G>A	ENSP00000263409:p.Ser679Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S679L	ENST00000263409.4	37	c.2036	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587906	0.46110	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.58210	0.35;0.35	5.68	4.82	0.62117	Fibronectin, type III (1);	0.761642	0.13156	N	0.409451	T	0.50292	0.1607	L	0.56769	1.78	0.38855	D	0.956357	B	0.31680	0.335	B	0.28139	0.086	T	0.52503	-0.8567	10	0.48119	T	0.1	-3.2135	13.9182	0.63914	0.073:0.0:0.927:0.0	.	679	P42702	LIFR_HUMAN	L	679	ENSP00000263409:S679L;ENSP00000398368:S679L	ENSP00000263409:S679L	S	-	2	0	LIFR	38529494	0.998000	0.40836	0.496000	0.27539	0.571000	0.35966	2.913000	0.48790	1.544000	0.49359	0.591000	0.81541	TCA	LIFR	-	superfamily_Fibronectin_type3	ENSG00000113594		0.418	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	108	0.00	0	G	NM_002310		38493737	38493737	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	missense	104	16.13	20	SNP	0.982	A
LIFR	3977	genome.wustl.edu	37	5	38493737	38493737	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:38493737G>A	ENST00000263409.4	-	14	2198	c.2036C>T	c.(2035-2037)tCa>tTa	p.S679L	LIFR_ENST00000453190.2_Missense_Mutation_p.S679L|LIFR_ENST00000503088.1_5'UTR	NM_002310.5	NP_002301.1	P42702	LIFR_HUMAN	leukemia inhibitory factor receptor alpha	679	Fibronectin type-III 5. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|leukemia inhibitory factor signaling pathway (GO:0048861)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of cell proliferation (GO:0008284)|response to cytokine (GO:0034097)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|leukemia inhibitory factor receptor activity (GO:0004923)	p.S679L(2)		NS(2)|breast(4)|endometrium(6)|kidney(2)|large_intestine(30)|liver(2)|lung(21)|ovary(3)|skin(5)|stomach(1)|urinary_tract(2)	78	all_lung(31;0.00021)					AGTGCTGTTTGAGGGAACTTT	0.418			T	PLAG1	salivary adenoma																																Melanoma(13;4 730 6426 9861 34751)	dbGAP		Dom	yes		5	5p13-p12	3977	leukemia inhibitory factor receptor		E	2	Substitution - Missense(2)	breast(2)											148.0	137.0	141.0					5																	38493737		2203	4300	6503	-	-	-	SO:0001583	missense	0			X61615	CCDS3927.1	5p13-p12	2013-02-11	2006-05-17		ENSG00000113594	ENSG00000113594		"""CD molecules"", ""Fibronectin type III domain containing"""	6597	protein-coding gene	gene with protein product		151443	"""leukemia inhibitory factor receptor"""			1915266	Standard	NM_001127671		Approved	CD118	uc003jli.2	P42702	OTTHUMG00000131138	ENST00000263409.4:c.2036C>T	5.37:g.38493737G>A	ENSP00000263409:p.Ser679Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6LCD9	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.S679L	ENST00000263409.4	37	c.2036	CCDS3927.1	5	.	.	.	.	.	.	.	.	.	.	G	14.61	2.587906	0.46110	.	.	ENSG00000113594	ENST00000263409;ENST00000453190	T;T	0.58210	0.35;0.35	5.68	4.82	0.62117	Fibronectin, type III (1);	0.761642	0.13156	N	0.409451	T	0.50292	0.1607	L	0.56769	1.78	0.38855	D	0.956357	B	0.31680	0.335	B	0.28139	0.086	T	0.52503	-0.8567	10	0.48119	T	0.1	-3.2135	13.9182	0.63914	0.073:0.0:0.927:0.0	.	679	P42702	LIFR_HUMAN	L	679	ENSP00000263409:S679L;ENSP00000398368:S679L	ENSP00000263409:S679L	S	-	2	0	LIFR	38529494	0.998000	0.40836	0.496000	0.27539	0.571000	0.35966	2.913000	0.48790	1.544000	0.49359	0.591000	0.81541	TCA	LIFR	-	superfamily_Fibronectin_type3	ENSG00000113594		0.418	LIFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIFR	HGNC	protein_coding	OTTHUMT00000253823.1	108	0.00	0	G	NM_002310		38493737	38493737	-1	no_errors	ENST00000263409	ensembl	human	known	69_37n	missense	149	14.86	26	SNP	0.982	A
LILRB5	10990	genome.wustl.edu	37	19	54756786	54756786	+	Silent	SNP	G	G	T	rs202180745		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:54756786G>T	ENST00000316219.5	-	9	1526	c.1419C>A	c.(1417-1419)ctC>ctA	p.L473L	LILRB5_ENST00000450632.1_Silent_p.L465L|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000345866.6_Silent_p.L374L|LILRB5_ENST00000449561.2_Silent_p.L474L	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	473					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.L465L(1)|p.L473L(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ggaagaggaggaggaACAGCA	0.622																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											174.0	125.0	142.0					19																	54756786		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1419C>A	19.37:g.54756786G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N760	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L465	ENST00000316219.5	37	c.1395	CCDS12885.1	19																																																																																			LILRB5	-	NULL	ENSG00000105609		0.622	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	219	0.45	1	G			54756786	54756786	-1	no_errors	ENST00000450632	ensembl	human	known	69_37n	silent	39	26.42	14	SNP	0.015	T
LILRB5	10990	genome.wustl.edu	37	19	54756786	54756786	+	Silent	SNP	G	G	T	rs202180745		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:54756786G>T	ENST00000316219.5	-	9	1526	c.1419C>A	c.(1417-1419)ctC>ctA	p.L473L	LILRB5_ENST00000450632.1_Silent_p.L465L|CTD-2337J16.1_ENST00000595133.1_lincRNA|LILRB5_ENST00000345866.6_Silent_p.L374L|LILRB5_ENST00000449561.2_Silent_p.L474L	NM_001081442.1|NM_006840.3	NP_001074911.1|NP_006831.1	O75023	LIRB5_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 5	473					cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)	integral component of membrane (GO:0016021)	transmembrane signaling receptor activity (GO:0004888)	p.L465L(1)|p.L473L(1)		NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(12)|lung(25)|ovary(1)|pancreas(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	56	all_cancers(19;0.00681)|all_epithelial(19;0.00368)|all_lung(19;0.016)|Lung NSC(19;0.0296)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		ggaagaggaggaggaACAGCA	0.622																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											174.0	125.0	142.0					19																	54756786		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF025534	CCDS12885.1, CCDS42611.1, CCDS46176.1	19q13.4	2013-01-11			ENSG00000105609	ENSG00000105609		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6609	protein-coding gene	gene with protein product		604814				9548455	Standard	NM_006840		Approved	LIR-8, LIR8, CD85c	uc002qey.3	O75023	OTTHUMG00000066636	ENST00000316219.5:c.1419C>A	19.37:g.54756786G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N760	Silent	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L465	ENST00000316219.5	37	c.1395	CCDS12885.1	19																																																																																			LILRB5	-	NULL	ENSG00000105609		0.622	LILRB5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB5	HGNC	protein_coding	OTTHUMT00000142877.2	219	0.45	1	G			54756786	54756786	-1	no_errors	ENST00000450632	ensembl	human	known	69_37n	silent	60	23.08	18	SNP	0.015	T
LIMA1	51474	genome.wustl.edu	37	12	50616256	50616256	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:50616256G>C	ENST00000341247.4	-	4	327	c.178C>G	c.(178-180)Ctc>Gtc	p.L60V	LIMA1_ENST00000552783.1_De_novo_Start_OutOfFrame|LIMA1_ENST00000394943.3_Missense_Mutation_p.L60V|LIMA1_ENST00000552823.1_5'Flank|LIMA1_ENST00000552008.1_5'Flank|RP3-405J10.4_ENST00000551284.1_RNA|LIMA1_ENST00000552909.1_5'Flank	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	60					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.L60V(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						TGCTGGGAGAGATTTTCGGTG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	53.0	52.0					12																	50616256		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.178C>G	12.37:g.50616256G>C	ENSP00000340184:p.Leu60Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L60V	ENST00000341247.4	37	c.178	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079662	0.36662	.	.	ENSG00000050405	ENST00000394943;ENST00000341247;ENST00000551691;ENST00000550592	D;T	0.83755	-1.76;-1.03	6.17	3.97	0.46021	.	0.674789	0.15005	N	0.285863	T	0.80481	0.4631	M	0.69823	2.125	0.80722	D	1	P;B	0.39665	0.682;0.418	B;B	0.32980	0.156;0.109	T	0.82323	-0.0514	10	0.66056	D	0.02	.	12.9878	0.58602	0.1588:0.0:0.8412:0.0	.	69;60	Q59FE8;Q9UHB6	.;LIMA1_HUMAN	V	60	ENSP00000378400:L60V;ENSP00000340184:L60V	ENSP00000340184:L60V	L	-	1	0	LIMA1	48902523	1.000000	0.71417	0.995000	0.50966	0.821000	0.46438	2.471000	0.45127	1.543000	0.49345	0.655000	0.94253	CTC	LIMA1	-	NULL	ENSG00000050405		0.433	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	54	0.00	0	G	NM_016357		50616256	50616256	-1	no_errors	ENST00000394943	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	0.980	C
LIMA1	51474	genome.wustl.edu	37	12	50616256	50616256	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:50616256G>C	ENST00000341247.4	-	4	327	c.178C>G	c.(178-180)Ctc>Gtc	p.L60V	LIMA1_ENST00000552783.1_De_novo_Start_OutOfFrame|LIMA1_ENST00000394943.3_Missense_Mutation_p.L60V|LIMA1_ENST00000552823.1_5'Flank|LIMA1_ENST00000552008.1_5'Flank|RP3-405J10.4_ENST00000551284.1_RNA|LIMA1_ENST00000552909.1_5'Flank	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	60					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)	p.L60V(1)		NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						TGCTGGGAGAGATTTTCGGTG	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											50.0	53.0	52.0					12																	50616256		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.178C>G	12.37:g.50616256G>C	ENSP00000340184:p.Leu60Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L60V	ENST00000341247.4	37	c.178	CCDS8802.1	12	.	.	.	.	.	.	.	.	.	.	G	12.91	2.079662	0.36662	.	.	ENSG00000050405	ENST00000394943;ENST00000341247;ENST00000551691;ENST00000550592	D;T	0.83755	-1.76;-1.03	6.17	3.97	0.46021	.	0.674789	0.15005	N	0.285863	T	0.80481	0.4631	M	0.69823	2.125	0.80722	D	1	P;B	0.39665	0.682;0.418	B;B	0.32980	0.156;0.109	T	0.82323	-0.0514	10	0.66056	D	0.02	.	12.9878	0.58602	0.1588:0.0:0.8412:0.0	.	69;60	Q59FE8;Q9UHB6	.;LIMA1_HUMAN	V	60	ENSP00000378400:L60V;ENSP00000340184:L60V	ENSP00000340184:L60V	L	-	1	0	LIMA1	48902523	1.000000	0.71417	0.995000	0.50966	0.821000	0.46438	2.471000	0.45127	1.543000	0.49345	0.655000	0.94253	CTC	LIMA1	-	NULL	ENSG00000050405		0.433	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	54	0.00	0	G	NM_016357		50616256	50616256	-1	no_errors	ENST00000394943	ensembl	human	known	69_37n	missense	39	22.00	11	SNP	0.980	C
KRTAP5-2	440021	genome.wustl.edu	37	11	1618885	1618885	+	3'UTR	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:1618885C>T	ENST00000412090.1	-	0	639				KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2							keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CGAACTGACTCAGGGAACCAT	0.547																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.*62G>A	11.37:g.1618885C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A9JTZ1	RNA	SNP	-	NULL	ENST00000412090.1	37	NULL	CCDS31331.1	11																																																																																			RP13-25N22.1	-	-	ENSG00000233930		0.547	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC338651	Clone_based_vega_gene	protein_coding	OTTHUMT00000384775.1	83	0.00	0	C	NM_001004325		1618885	1618885	+1	no_errors	ENST00000424148	ensembl	human	known	69_37n	rna	19	20.83	5	SNP	0.007	T
KRTAP5-2	440021	genome.wustl.edu	37	11	1618885	1618885	+	3'UTR	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:1618885C>T	ENST00000412090.1	-	0	639				KRTAP5-AS1_ENST00000424148.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000532922.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2							keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CGAACTGACTCAGGGAACCAT	0.547																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.*62G>A	11.37:g.1618885C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A9JTZ1	RNA	SNP	-	NULL	ENST00000412090.1	37	NULL	CCDS31331.1	11																																																																																			RP13-25N22.1	-	-	ENSG00000233930		0.547	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC338651	Clone_based_vega_gene	protein_coding	OTTHUMT00000384775.1	83	0.00	0	C	NM_001004325		1618885	1618885	+1	no_errors	ENST00000424148	ensembl	human	known	69_37n	rna	26	23.53	8	SNP	0.007	T
LRP12	29967	genome.wustl.edu	37	8	105503585	105503585	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:105503585C>T	ENST00000276654.5	-	7	2004	c.1896G>A	c.(1894-1896)caG>caA	p.Q632Q	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Silent_p.Q613Q	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	632					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.Q632Q(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TACTGGTACTCTGACTAGGGA	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	77.0	78.0					8																	105503585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1896G>A	8.37:g.105503585C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Silent	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.Q613	ENST00000276654.5	37	c.1839	CCDS6303.1	8																																																																																			LRP12	-	NULL	ENSG00000147650		0.423	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	97	0.00	0	C	NM_013437		105503585	105503585	-1	no_errors	ENST00000424843	ensembl	human	known	69_37n	silent	110	25.17	37	SNP	0.938	T
LRP12	29967	genome.wustl.edu	37	8	105503585	105503585	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:105503585C>T	ENST00000276654.5	-	7	2004	c.1896G>A	c.(1894-1896)caG>caA	p.Q632Q	LRP12_ENST00000518375.1_5'UTR|LRP12_ENST00000424843.2_Silent_p.Q613Q	NM_013437.4	NP_038465.1	Q9Y561	LRP12_HUMAN	low density lipoprotein receptor-related protein 12	632					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)	p.Q632Q(1)		NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	48			OV - Ovarian serous cystadenocarcinoma(57;1.21e-06)|STAD - Stomach adenocarcinoma(118;0.229)			TACTGGTACTCTGACTAGGGA	0.423																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											80.0	77.0	78.0					8																	105503585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF166350	CCDS6303.1, CCDS47907.1	8q22.2	2013-02-27	2010-01-26		ENSG00000147650	ENSG00000147650		"""Low density lipoprotein receptors"""	31708	protein-coding gene	gene with protein product						12809483, 14676824	Standard	NM_013437		Approved	ST7, FLJ12929	uc003yma.3	Q9Y561	OTTHUMG00000164892	ENST00000276654.5:c.1896G>A	8.37:g.105503585C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Silent	SNP	pfam_CUB,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt	p.Q613	ENST00000276654.5	37	c.1839	CCDS6303.1	8																																																																																			LRP12	-	NULL	ENSG00000147650		0.423	LRP12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	LRP12	HGNC	protein_coding	OTTHUMT00000380821.1	97	0.00	0	C	NM_013437		105503585	105503585	-1	no_errors	ENST00000424843	ensembl	human	known	69_37n	silent	66	25.00	22	SNP	0.938	T
LRRC6	23639	genome.wustl.edu	37	8	133637540	133637540	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:133637540G>C	ENST00000519595.1	-	6	912	c.814C>G	c.(814-816)Cgg>Ggg	p.R272G	LRRC6_ENST00000250173.1_Missense_Mutation_p.R272G|LRRC6_ENST00000520446.1_5'UTR|LRRC6_ENST00000518642.1_Missense_Mutation_p.R272G			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	272					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.R272G(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGTTTCTTCCGTTGTTTTTCC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	130.0	133.0					8																	133637540		2203	4299	6502	-	-	-	SO:0001583	missense	0			U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.814C>G	8.37:g.133637540G>C	ENSP00000429791:p.Arg272Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13648|Q4G183	Missense_Mutation	SNP	superfamily_HSP20-like_chaperone,smart_U2A'_phosphoprotein32A_C,pfscan_CS-like_domain	p.R272G	ENST00000519595.1	37	c.814		8	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839857	0.32513	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000518642;ENST00000250173;ENST00000395414	T;T;T;T	0.57595	0.58;0.71;0.39;0.58	5.07	3.0	0.34707	.	0.104365	0.64402	D	0.000013	T	0.67906	0.2943	M	0.88310	2.945	0.52501	D	0.999956	P	0.52692	0.955	P	0.53401	0.725	T	0.73751	-0.3884	10	0.48119	T	0.1	-15.2791	12.5794	0.56381	0.0:0.0:0.6657:0.3343	.	272	Q86X45	LRRC6_HUMAN	G	272;32;272;272;272	ENSP00000429791:R272G;ENSP00000428015:R32G;ENSP00000428610:R272G;ENSP00000250173:R272G	ENSP00000250173:R272G	R	-	1	2	LRRC6	133706722	0.994000	0.37717	0.985000	0.45067	0.082000	0.17680	2.121000	0.41977	1.094000	0.41399	-0.294000	0.09567	CGG	LRRC6	-	NULL	ENSG00000129295		0.363	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	LRRC6	HGNC	protein_coding	OTTHUMT00000379578.1	349	0.00	0	G	NM_012472		133637540	133637540	-1	no_errors	ENST00000250173	ensembl	human	known	69_37n	missense	350	20.09	88	SNP	0.992	C
LRRC6	23639	genome.wustl.edu	37	8	133637540	133637540	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:133637540G>C	ENST00000519595.1	-	6	912	c.814C>G	c.(814-816)Cgg>Ggg	p.R272G	LRRC6_ENST00000250173.1_Missense_Mutation_p.R272G|LRRC6_ENST00000520446.1_5'UTR|LRRC6_ENST00000518642.1_Missense_Mutation_p.R272G			Q86X45	TILB_HUMAN	leucine rich repeat containing 6	272					cilium movement (GO:0003341)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|inner dynein arm assembly (GO:0036159)|male gonad development (GO:0008584)|motile cilium assembly (GO:0044458)|outer dynein arm assembly (GO:0036158)|reproductive system development (GO:0061458)|sperm motility (GO:0030317)	cilium (GO:0005929)|cytoplasm (GO:0005737)		p.R272G(1)		breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(18)|ovary(1)|prostate(1)|urinary_tract(2)	34	Ovarian(258;0.00352)|Esophageal squamous(12;0.00507)|all_neural(3;0.0052)|Medulloblastoma(3;0.0922)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)			TGTTTCTTCCGTTGTTTTTCC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											138.0	130.0	133.0					8																	133637540		2203	4299	6502	-	-	-	SO:0001583	missense	0			U60666	CCDS6365.1	8q24	2013-02-22			ENSG00000129295	ENSG00000129295			16725	protein-coding gene	gene with protein product	"""leucine rich testes protein"""	614930				10775177, 23122586	Standard	NM_012472		Approved	TSLRP, LRTP, CILD19	uc003ytk.4	Q86X45	OTTHUMG00000164646	ENST00000519595.1:c.814C>G	8.37:g.133637540G>C	ENSP00000429791:p.Arg272Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13648|Q4G183	Missense_Mutation	SNP	superfamily_HSP20-like_chaperone,smart_U2A'_phosphoprotein32A_C,pfscan_CS-like_domain	p.R272G	ENST00000519595.1	37	c.814		8	.	.	.	.	.	.	.	.	.	.	G	12.11	1.839857	0.32513	.	.	ENSG00000129295	ENST00000519595;ENST00000522789;ENST00000518642;ENST00000250173;ENST00000395414	T;T;T;T	0.57595	0.58;0.71;0.39;0.58	5.07	3.0	0.34707	.	0.104365	0.64402	D	0.000013	T	0.67906	0.2943	M	0.88310	2.945	0.52501	D	0.999956	P	0.52692	0.955	P	0.53401	0.725	T	0.73751	-0.3884	10	0.48119	T	0.1	-15.2791	12.5794	0.56381	0.0:0.0:0.6657:0.3343	.	272	Q86X45	LRRC6_HUMAN	G	272;32;272;272;272	ENSP00000429791:R272G;ENSP00000428015:R32G;ENSP00000428610:R272G;ENSP00000250173:R272G	ENSP00000250173:R272G	R	-	1	2	LRRC6	133706722	0.994000	0.37717	0.985000	0.45067	0.082000	0.17680	2.121000	0.41977	1.094000	0.41399	-0.294000	0.09567	CGG	LRRC6	-	NULL	ENSG00000129295		0.363	LRRC6-001	KNOWN	basic|appris_principal	protein_coding	LRRC6	HGNC	protein_coding	OTTHUMT00000379578.1	349	0.00	0	G	NM_012472		133637540	133637540	-1	no_errors	ENST00000250173	ensembl	human	known	69_37n	missense	528	22.01	149	SNP	0.992	C
LTBP4	8425	genome.wustl.edu	37	19	41114263	41114263	+	Missense_Mutation	SNP	C	C	G	rs564267463		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:41114263C>G	ENST00000308370.7	+	11	1495	c.1495C>G	c.(1495-1497)Cgg>Ggg	p.R499G	LTBP4_ENST00000204005.9_Missense_Mutation_p.R462G|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000396819.3_Missense_Mutation_p.R432G	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	499	Pro-rich.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.R499G(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCCACCTCTCGGCCATCTGC	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											25.0	28.0	27.0					19																	41114263		1998	4147	6145	-	-	-	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1495C>G	19.37:g.41114263C>G	ENSP00000311905:p.Arg499Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R499G	ENST00000308370.7	37	c.1495		19	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045438	0.55110	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819	T;T;T	0.80480	-1.37;-1.38;-1.36	5.27	-1.75	0.08031	.	0.580542	0.12914	U	0.428734	T	0.66317	0.2777	L	0.50333	1.59	0.09310	N	0.999999	B;B;B	0.30605	0.287;0.287;0.166	B;B;B	0.24848	0.056;0.056;0.056	T	0.51325	-0.8720	10	0.25751	T	0.34	.	3.695	0.08361	0.3913:0.3946:0.1281:0.086	.	432;499;462	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	G	462;499;432	ENSP00000204005:R462G;ENSP00000311905:R499G;ENSP00000380031:R432G	ENSP00000204005:R462G	R	+	1	2	LTBP4	45806103	0.000000	0.05858	0.034000	0.17996	0.853000	0.48598	-0.569000	0.05902	0.154000	0.19237	0.650000	0.86243	CGG	LTBP4	-	NULL	ENSG00000090006		0.642	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		58	0.00	0	C	NM_003573		41114263	41114263	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.000	G
LTBP4	8425	genome.wustl.edu	37	19	41114263	41114263	+	Missense_Mutation	SNP	C	C	G	rs564267463		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:41114263C>G	ENST00000308370.7	+	11	1495	c.1495C>G	c.(1495-1497)Cgg>Ggg	p.R499G	LTBP4_ENST00000204005.9_Missense_Mutation_p.R462G|RN7SL758P_ENST00000580450.1_RNA|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_5'UTR|LTBP4_ENST00000396819.3_Missense_Mutation_p.R432G	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	499	Pro-rich.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)	p.R499G(1)		central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AGCCACCTCTCGGCCATCTGC	0.642																																						dbGAP											1	Substitution - Missense(1)	breast(1)											25.0	28.0	27.0					19																	41114263		1998	4147	6145	-	-	-	SO:0001583	missense	0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.1495C>G	19.37:g.41114263C>G	ENSP00000311905:p.Arg499Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R499G	ENST00000308370.7	37	c.1495		19	.	.	.	.	.	.	.	.	.	.	C	16.16	3.045438	0.55110	.	.	ENSG00000090006	ENST00000204005;ENST00000308370;ENST00000396819	T;T;T	0.80480	-1.37;-1.38;-1.36	5.27	-1.75	0.08031	.	0.580542	0.12914	U	0.428734	T	0.66317	0.2777	L	0.50333	1.59	0.09310	N	0.999999	B;B;B	0.30605	0.287;0.287;0.166	B;B;B	0.24848	0.056;0.056;0.056	T	0.51325	-0.8720	10	0.25751	T	0.34	.	3.695	0.08361	0.3913:0.3946:0.1281:0.086	.	432;499;462	E7EUU1;Q8N2S1;E7ENG9	.;LTBP4_HUMAN;.	G	462;499;432	ENSP00000204005:R462G;ENSP00000311905:R499G;ENSP00000380031:R432G	ENSP00000204005:R462G	R	+	1	2	LTBP4	45806103	0.000000	0.05858	0.034000	0.17996	0.853000	0.48598	-0.569000	0.05902	0.154000	0.19237	0.650000	0.86243	CGG	LTBP4	-	NULL	ENSG00000090006		0.642	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		58	0.00	0	C	NM_003573		41114263	41114263	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.000	G
LZIC	84328	genome.wustl.edu	37	1	9995660	9995660	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:9995660C>T	ENST00000377223.1	-	4	374	c.127G>A	c.(127-129)Gaa>Aaa	p.E43K	LZIC_ENST00000541052.1_Missense_Mutation_p.E64K|LZIC_ENST00000400903.2_Missense_Mutation_p.E43K|LZIC_ENST00000377213.1_Missense_Mutation_p.E43K	NM_032368.3	NP_115744.2	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing	43					response to ionizing radiation (GO:0010212)			p.E43K(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		TTGGTTTCTTCATATTCATCT	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	140.0	139.0					1																	9995660		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB060688	CCDS107.1	1p36.22	2008-02-05			ENSG00000162441	ENSG00000162441			17497	protein-coding gene	gene with protein product		610458				11712074	Standard	NM_032368		Approved	MGC15436	uc001aqm.3	Q8WZA0	OTTHUMG00000001804	ENST00000377223.1:c.127G>A	1.37:g.9995660C>T	ENSP00000366430:p.Glu43Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6F0|B4E2N0|Q96IU1	Missense_Mutation	SNP	pfam_ICAT,superfamily_ICAT	p.E64K	ENST00000377223.1	37	c.190	CCDS107.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.363164	0.95877	.	.	ENSG00000162441	ENST00000377223;ENST00000400903;ENST00000541052;ENST00000377213	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	L	0.61218	1.895	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.67548	0.952;0.914	T	0.45687	-0.9244	9	.	.	.	-1.0625	19.6655	0.95891	0.0:1.0:0.0:0.0	.	64;43	B4E2N0;Q8WZA0	.;LZIC_HUMAN	K	43;43;64;43	ENSP00000366430:E43K;ENSP00000383695:E43K;ENSP00000437432:E64K;ENSP00000366418:E43K	.	E	-	1	0	LZIC	9918247	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	7.700000	0.84556	2.652000	0.90054	0.491000	0.48974	GAA	LZIC	-	NULL	ENSG00000162441		0.318	LZIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZIC	HGNC	protein_coding	OTTHUMT00000005037.1	146	0.00	0	C	NM_032368		9995660	9995660	-1	no_errors	ENST00000541052	ensembl	human	known	69_37n	missense	252	17.05	52	SNP	1.000	T
LZIC	84328	genome.wustl.edu	37	1	9995660	9995660	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:9995660C>T	ENST00000377223.1	-	4	374	c.127G>A	c.(127-129)Gaa>Aaa	p.E43K	LZIC_ENST00000541052.1_Missense_Mutation_p.E64K|LZIC_ENST00000400903.2_Missense_Mutation_p.E43K|LZIC_ENST00000377213.1_Missense_Mutation_p.E43K	NM_032368.3	NP_115744.2	Q8WZA0	LZIC_HUMAN	leucine zipper and CTNNBIP1 domain containing	43					response to ionizing radiation (GO:0010212)			p.E43K(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(1)|skin(1)	7		all_lung(284;0.000407)|Renal(390;0.000469)|Lung NSC(185;0.000577)|Colorectal(325;0.0062)|Breast(348;0.00686)|Hepatocellular(190;0.0305)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.104)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.29e-08)|COAD - Colon adenocarcinoma(227;1.33e-05)|Kidney(185;0.000242)|BRCA - Breast invasive adenocarcinoma(304;0.000299)|KIRC - Kidney renal clear cell carcinoma(229;0.000896)|STAD - Stomach adenocarcinoma(132;0.00842)|READ - Rectum adenocarcinoma(331;0.0419)		TTGGTTTCTTCATATTCATCT	0.318																																						dbGAP											1	Substitution - Missense(1)	breast(1)											136.0	140.0	139.0					1																	9995660		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB060688	CCDS107.1	1p36.22	2008-02-05			ENSG00000162441	ENSG00000162441			17497	protein-coding gene	gene with protein product		610458				11712074	Standard	NM_032368		Approved	MGC15436	uc001aqm.3	Q8WZA0	OTTHUMG00000001804	ENST00000377223.1:c.127G>A	1.37:g.9995660C>T	ENSP00000366430:p.Glu43Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6F0|B4E2N0|Q96IU1	Missense_Mutation	SNP	pfam_ICAT,superfamily_ICAT	p.E64K	ENST00000377223.1	37	c.190	CCDS107.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.363164	0.95877	.	.	ENSG00000162441	ENST00000377223;ENST00000400903;ENST00000541052;ENST00000377213	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	T	0.53738	0.1815	L	0.61218	1.895	0.80722	D	1	D;D	0.76494	0.999;0.995	D;D	0.67548	0.952;0.914	T	0.45687	-0.9244	9	.	.	.	-1.0625	19.6655	0.95891	0.0:1.0:0.0:0.0	.	64;43	B4E2N0;Q8WZA0	.;LZIC_HUMAN	K	43;43;64;43	ENSP00000366430:E43K;ENSP00000383695:E43K;ENSP00000437432:E64K;ENSP00000366418:E43K	.	E	-	1	0	LZIC	9918247	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	7.700000	0.84556	2.652000	0.90054	0.491000	0.48974	GAA	LZIC	-	NULL	ENSG00000162441		0.318	LZIC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LZIC	HGNC	protein_coding	OTTHUMT00000005037.1	146	0.00	0	C	NM_032368		9995660	9995660	-1	no_errors	ENST00000541052	ensembl	human	known	69_37n	missense	400	19.96	100	SNP	1.000	T
MAGI2	9863	genome.wustl.edu	37	7	77789382	77789382	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:77789382G>A	ENST00000354212.4	-	16	3058	c.2805C>T	c.(2803-2805)atC>atT	p.I935I	MAGI2_ENST00000522391.1_Silent_p.I935I|MAGI2_ENST00000419488.1_Silent_p.I921I	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	935	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.I935I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GGGAGCTGATGATGACAAAGC	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											96.0	91.0	92.0					7																	77789382		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2805C>T	7.37:g.77789382G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.I935	ENST00000354212.4	37	c.2805	CCDS5594.1	7																																																																																			MAGI2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000187391		0.498	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	100	0.00	0	G	NM_012301		77789382	77789382	-1	no_errors	ENST00000354212	ensembl	human	known	69_37n	silent	46	13.21	7	SNP	1.000	A
MAGI2	9863	genome.wustl.edu	37	7	77789382	77789382	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:77789382G>A	ENST00000354212.4	-	16	3058	c.2805C>T	c.(2803-2805)atC>atT	p.I935I	MAGI2_ENST00000522391.1_Silent_p.I935I|MAGI2_ENST00000419488.1_Silent_p.I921I	NM_012301.3	NP_036433.2	Q86UL8	MAGI2_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 2	935	PDZ 5. {ECO:0000255|PROSITE- ProRule:PRU00143}.				cellular response to nerve growth factor stimulus (GO:1990090)|cytoplasmic transport (GO:0016482)|glomerular visceral epithelial cell development (GO:0072015)|mitotic cell cycle arrest (GO:0071850)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of protein kinase B signaling (GO:0051898)|nerve growth factor signaling pathway (GO:0038180)|planar cell polarity pathway involved in axis elongation (GO:0003402)|positive regulation of neuron projection development (GO:0010976)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of receptor internalization (GO:0002092)|protein heterooligomerization (GO:0051291)|receptor clustering (GO:0043113)|SMAD protein signal transduction (GO:0060395)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|late endosome (GO:0005770)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)|synapse (GO:0045202)|tight junction (GO:0005923)	beta-1 adrenergic receptor binding (GO:0031697)|phosphatase binding (GO:0019902)|receptor signaling complex scaffold activity (GO:0030159)|signal transducer activity (GO:0004871)|SMAD binding (GO:0046332)|type II activin receptor binding (GO:0070699)	p.I935I(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(37)|ovary(5)|prostate(1)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(3)	84		all_cancers(73;0.0064)|all_epithelial(88;0.087)|all_neural(109;0.0936)|Medulloblastoma(109;0.166)|Melanoma(862;0.236)				GGGAGCTGATGATGACAAAGC	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											96.0	91.0	92.0					7																	77789382		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014605	CCDS5594.1, CCDS75623.1	7q21	2005-08-09			ENSG00000187391	ENSG00000187391			18957	protein-coding gene	gene with protein product		606382				10681527, 9734811	Standard	XM_005250725		Approved	AIP1, ARIP1, KIAA0705, ACVRIP1, MAGI-2	uc003ugx.3	Q86UL8	OTTHUMG00000130697	ENST00000354212.4:c.2805C>T	7.37:g.77789382G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C1|A7E2C3|O60434|O60510|Q86UI7|Q9NP44|Q9UDQ5|Q9UDU1	Silent	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.I935	ENST00000354212.4	37	c.2805	CCDS5594.1	7																																																																																			MAGI2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000187391		0.498	MAGI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGI2	HGNC	protein_coding	OTTHUMT00000253197.3	100	0.00	0	G	NM_012301		77789382	77789382	-1	no_errors	ENST00000354212	ensembl	human	known	69_37n	silent	73	14.12	12	SNP	1.000	A
MAP2	4133	genome.wustl.edu	37	2	210557864	210557864	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:210557864C>G	ENST00000360351.4	+	7	1476	c.970C>G	c.(970-972)Ctt>Gtt	p.L324V	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.L320V|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	324					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.L324V(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGCTTCACTCTTCCTTTAGA	0.423																																					Pancreas(27;423 979 28787 29963)	dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	72.0	70.0					2																	210557864		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.970C>G	2.37:g.210557864C>G	ENSP00000353508:p.Leu324Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.L324V	ENST00000360351.4	37	c.970	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790287	0.50102	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	T;T;T	0.26518	1.73;1.73;1.73	5.8	4.74	0.60224	.	0.000000	0.44285	D	0.000475	T	0.41511	0.1162	M	0.64997	1.995	0.33418	D	0.579472	D;D	0.69078	0.997;0.996	D;P	0.66084	0.941;0.875	T	0.53121	-0.8483	10	0.51188	T	0.08	-14.5753	7.8615	0.29511	0.0:0.8349:0.0:0.1651	.	320;324	P11137-3;P11137	.;MAP2_HUMAN	V	324;406;320	ENSP00000353508:L324V;ENSP00000409969:L406V;ENSP00000392164:L320V	ENSP00000353508:L324V	L	+	1	0	MAP2	210266109	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.583000	0.36579	2.775000	0.95449	0.650000	0.86243	CTT	MAP2	-	NULL	ENSG00000078018		0.423	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	84	0.00	0	C	NM_001039538		210557864	210557864	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	47	20.34	12	SNP	1.000	G
MAP2	4133	genome.wustl.edu	37	2	210557864	210557864	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:210557864C>G	ENST00000360351.4	+	7	1476	c.970C>G	c.(970-972)Ctt>Gtt	p.L324V	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.L320V|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	324					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)	p.L324V(1)		breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAGCTTCACTCTTCCTTTAGA	0.423																																					Pancreas(27;423 979 28787 29963)	dbGAP											1	Substitution - Missense(1)	breast(1)											68.0	72.0	70.0					2																	210557864		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.970C>G	2.37:g.210557864C>G	ENSP00000353508:p.Leu324Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.L324V	ENST00000360351.4	37	c.970	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	C	15.29	2.790287	0.50102	.	.	ENSG00000078018	ENST00000360351;ENST00000445941;ENST00000447185	T;T;T	0.26518	1.73;1.73;1.73	5.8	4.74	0.60224	.	0.000000	0.44285	D	0.000475	T	0.41511	0.1162	M	0.64997	1.995	0.33418	D	0.579472	D;D	0.69078	0.997;0.996	D;P	0.66084	0.941;0.875	T	0.53121	-0.8483	10	0.51188	T	0.08	-14.5753	7.8615	0.29511	0.0:0.8349:0.0:0.1651	.	320;324	P11137-3;P11137	.;MAP2_HUMAN	V	324;406;320	ENSP00000353508:L324V;ENSP00000409969:L406V;ENSP00000392164:L320V	ENSP00000353508:L324V	L	+	1	0	MAP2	210266109	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.583000	0.36579	2.775000	0.95449	0.650000	0.86243	CTT	MAP2	-	NULL	ENSG00000078018		0.423	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	84	0.00	0	C	NM_001039538		210557864	210557864	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	80	18.37	18	SNP	1.000	G
MDC1	9656	genome.wustl.edu	37	6	30671702	30671702	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:30671702G>C	ENST00000376406.3	-	10	5905	c.5258C>G	c.(5257-5259)tCa>tGa	p.S1753*	MDC1_ENST00000376405.2_Nonsense_Mutation_p.S1489*|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1753	Required for nuclear localization (NLS2).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.S1753*(1)		breast(2)|kidney(1)|ovary(1)	4						TTGGTTCCTTGAGGCCTGGGA	0.567								Other conserved DNA damage response genes																														dbGAP											1	Substitution - Nonsense(1)	breast(1)											58.0	58.0	58.0					6																	30671702		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5258C>G	6.37:g.30671702G>C	ENSP00000365588:p.Ser1753*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Nonsense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.S1753*	ENST00000376406.3	37	c.5258	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	49	15.276257	0.99828	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	.	.	.	5.48	-0.986	0.10252	.	0.672928	0.11645	N	0.543398	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-0.4843	0.9567	0.01387	0.3505:0.1507:0.3439:0.155	.	.	.	.	X	1753;1489;1466;1319	.	ENSP00000365587:S1489X	S	-	2	0	MDC1	30779681	0.000000	0.05858	0.000000	0.03702	0.253000	0.25986	0.359000	0.20233	0.083000	0.17047	-0.300000	0.09419	TCA	MDC1	-	NULL	ENSG00000137337		0.567	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	92	0.00	0	G	NM_014641		30671702	30671702	-1	no_errors	ENST00000376406	ensembl	human	known	69_37n	nonsense	67	10.53	8	SNP	0.000	C
MDC1	9656	genome.wustl.edu	37	6	30671702	30671702	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:30671702G>C	ENST00000376406.3	-	10	5905	c.5258C>G	c.(5257-5259)tCa>tGa	p.S1753*	MDC1_ENST00000376405.2_Nonsense_Mutation_p.S1489*|MDC1-AS1_ENST00000442150.1_RNA	NM_014641.2	NP_055456.2	Q14676	MDC1_HUMAN	mediator of DNA-damage checkpoint 1	1753	Required for nuclear localization (NLS2).				DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|intra-S DNA damage checkpoint (GO:0031573)	chromosome (GO:0005694)|focal adhesion (GO:0005925)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	FHA domain binding (GO:0070975)|protein C-terminus binding (GO:0008022)	p.S1753*(1)		breast(2)|kidney(1)|ovary(1)	4						TTGGTTCCTTGAGGCCTGGGA	0.567								Other conserved DNA damage response genes																														dbGAP											1	Substitution - Nonsense(1)	breast(1)											58.0	58.0	58.0					6																	30671702		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D79992	CCDS34384.1	6p21.3	2010-02-17	2009-06-12		ENSG00000137337	ENSG00000137337			21163	protein-coding gene	gene with protein product		607593				10975465, 12607005	Standard	NM_014641		Approved	NFBD1, KIAA0170, Em:AB023051.5	uc003nrg.4	Q14676	OTTHUMG00000031075	ENST00000376406.3:c.5258C>G	6.37:g.30671702G>C	ENSP00000365588:p.Ser1753*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2AB04|A2BF04|A2RRA8|A7YY86|B0S8A2|Q0EFC2|Q2L6H7|Q2TAZ4|Q5JP55|Q5JP56|Q5ST83|Q68CQ3|Q86Z06|Q96QC2	Nonsense_Mutation	SNP	pfam_FHA_dom,superfamily_BRCT_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_BRCT_dom,pfscan_FHA_dom	p.S1753*	ENST00000376406.3	37	c.5258	CCDS34384.1	6	.	.	.	.	.	.	.	.	.	.	G	49	15.276257	0.99828	.	.	ENSG00000137337	ENST00000376406;ENST00000376405;ENST00000429610;ENST00000422104	.	.	.	5.48	-0.986	0.10252	.	0.672928	0.11645	N	0.543398	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	-0.4843	0.9567	0.01387	0.3505:0.1507:0.3439:0.155	.	.	.	.	X	1753;1489;1466;1319	.	ENSP00000365587:S1489X	S	-	2	0	MDC1	30779681	0.000000	0.05858	0.000000	0.03702	0.253000	0.25986	0.359000	0.20233	0.083000	0.17047	-0.300000	0.09419	TCA	MDC1	-	NULL	ENSG00000137337		0.567	MDC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MDC1	HGNC	protein_coding	OTTHUMT00000076103.1	92	0.00	0	G	NM_014641		30671702	30671702	-1	no_errors	ENST00000376406	ensembl	human	known	69_37n	nonsense	90	11.65	12	SNP	0.000	C
METTL8	79828	genome.wustl.edu	37	2	172196014	172196014	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:172196014G>C	ENST00000375258.4	-	4	501	c.286C>G	c.(286-288)Cat>Gat	p.H96D		NM_024770.3	NP_079046.2	Q9H825	METL8_HUMAN	methyltransferase like 8	96						cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.H46N(1)|p.H96N(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	11						TTATTCTTATGAATCTTGTAA	0.313																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											50.0	50.0	50.0					2																	172196014		2202	4296	6498	-	-	-	SO:0001583	missense	0			AK024046	CCDS2242.1, CCDS2242.2	2q31.1	2012-06-12			ENSG00000123600	ENSG00000123600			25856	protein-coding gene	gene with protein product	"""tension-induced/inhibited protein"""	609525				15992539	Standard	NM_024770		Approved	FLJ13984, TIP	uc010zdo.2	Q9H825	OTTHUMG00000132261	ENST00000375258.4:c.286C>G	2.37:g.172196014G>C	ENSP00000364407:p.His96Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TM9|Q53TQ0	Missense_Mutation	SNP	pfam_Methyltransf_11	p.H96D	ENST00000375258.4	37	c.286		2	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831795	0.91036	.	.	ENSG00000123600	ENST00000375258;ENST00000392599;ENST00000442778;ENST00000453846	T;T;T;T	0.52754	3.83;2.05;0.65;0.73	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.72906	0.3519	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	0.999;0.987;1.0	D;P;D	0.70227	0.945;0.776;0.968	T	0.73981	-0.3811	10	0.56958	D	0.05	-4.8651	20.33	0.98713	0.0:0.0:1.0:0.0	.	51;96;96	B4DLT0;B3KW44;Q9H825	.;.;METL8_HUMAN	D	96	ENSP00000364407:H96D;ENSP00000376377:H96D;ENSP00000404646:H96D;ENSP00000411589:H96D	ENSP00000364407:H96D	H	-	1	0	METTL8	171904260	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.389000	0.79806	2.810000	0.96702	0.585000	0.79938	CAT	METTL8	-	NULL	ENSG00000123600		0.313	METTL8-001	PUTATIVE	basic|appris_principal	protein_coding	METTL8	HGNC	protein_coding	OTTHUMT00000255345.3	59	0.00	0	G	NM_024770		172196014	172196014	-1	no_errors	ENST00000392604	ensembl	human	known	69_37n	missense	111	13.28	17	SNP	1.000	C
METTL8	79828	genome.wustl.edu	37	2	172196014	172196014	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:172196014G>C	ENST00000375258.4	-	4	501	c.286C>G	c.(286-288)Cat>Gat	p.H96D		NM_024770.3	NP_079046.2	Q9H825	METL8_HUMAN	methyltransferase like 8	96						cytoplasm (GO:0005737)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)	p.H46N(1)|p.H96N(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)	11						TTATTCTTATGAATCTTGTAA	0.313																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											50.0	50.0	50.0					2																	172196014		2202	4296	6498	-	-	-	SO:0001583	missense	0			AK024046	CCDS2242.1, CCDS2242.2	2q31.1	2012-06-12			ENSG00000123600	ENSG00000123600			25856	protein-coding gene	gene with protein product	"""tension-induced/inhibited protein"""	609525				15992539	Standard	NM_024770		Approved	FLJ13984, TIP	uc010zdo.2	Q9H825	OTTHUMG00000132261	ENST00000375258.4:c.286C>G	2.37:g.172196014G>C	ENSP00000364407:p.His96Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TM9|Q53TQ0	Missense_Mutation	SNP	pfam_Methyltransf_11	p.H96D	ENST00000375258.4	37	c.286		2	.	.	.	.	.	.	.	.	.	.	G	27.4	4.831795	0.91036	.	.	ENSG00000123600	ENST00000375258;ENST00000392599;ENST00000442778;ENST00000453846	T;T;T;T	0.52754	3.83;2.05;0.65;0.73	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.72906	0.3519	M	0.84082	2.675	0.80722	D	1	D;D;D	0.89917	0.999;0.987;1.0	D;P;D	0.70227	0.945;0.776;0.968	T	0.73981	-0.3811	10	0.56958	D	0.05	-4.8651	20.33	0.98713	0.0:0.0:1.0:0.0	.	51;96;96	B4DLT0;B3KW44;Q9H825	.;.;METL8_HUMAN	D	96	ENSP00000364407:H96D;ENSP00000376377:H96D;ENSP00000404646:H96D;ENSP00000411589:H96D	ENSP00000364407:H96D	H	-	1	0	METTL8	171904260	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.389000	0.79806	2.810000	0.96702	0.585000	0.79938	CAT	METTL8	-	NULL	ENSG00000123600		0.313	METTL8-001	PUTATIVE	basic|appris_principal	protein_coding	METTL8	HGNC	protein_coding	OTTHUMT00000255345.3	59	0.00	0	G	NM_024770		172196014	172196014	-1	no_errors	ENST00000392604	ensembl	human	known	69_37n	missense	163	13.76	26	SNP	1.000	C
MFI2	4241	genome.wustl.edu	37	3	196736612	196736612	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:196736612C>A	ENST00000296350.5	-	11	1515	c.1402G>T	c.(1402-1404)Gat>Tat	p.D468Y		NM_005929.5	NP_005920.2	P08582	TRFM_HUMAN	antigen p97 (melanoma associated) identified by monoclonal antibodies 133.2 and 96.5	468	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				cellular iron ion homeostasis (GO:0006879)|iron ion import (GO:0097286)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of extracellular matrix disassembly (GO:0090091)|positive regulation of plasminogen activation (GO:0010756)	anchored component of plasma membrane (GO:0046658)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	ferric iron binding (GO:0008199)|iron ion binding (GO:0005506)			breast(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(1)	20	all_cancers(143;3.95e-09)|Ovarian(172;0.0634)|Breast(254;0.0838)		Epithelial(36;4.55e-24)|all cancers(36;2.87e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.76e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00536)		CGAAGCTCATCCAAGGTGAAG	0.652																																						dbGAP											0													54.0	57.0	56.0					3																	196736612		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3325.1, CCDS3326.1	3q28-q29	2012-10-02			ENSG00000163975	ENSG00000163975		"""CD molecules"""	7037	protein-coding gene	gene with protein product	"""melanotransferrin"", ""membrane-bound transferrin-like protein"""	155750					Standard	NM_033316		Approved	CD228, FLJ38863, MAP97, MGC4856, MTF1	uc003fxk.4	P08582	OTTHUMG00000155518	ENST00000296350.5:c.1402G>T	3.37:g.196736612C>A	ENSP00000296350:p.Asp468Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQE2	Missense_Mutation	SNP	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin,prints_Peptidase_S60	p.D468Y	ENST00000296350.5	37	c.1402	CCDS3325.1	3	.	.	.	.	.	.	.	.	.	.	C	17.67	3.446829	0.63178	.	.	ENSG00000163975	ENST00000296350	T	0.37235	1.21	5.29	3.49	0.39957	.	0.220767	0.46145	D	0.000315	T	0.39733	0.1089	L	0.49513	1.565	0.53005	D	0.999962	P	0.44690	0.841	P	0.53224	0.721	T	0.24119	-1.0169	10	0.46703	T	0.11	-25.0338	4.1425	0.10200	0.0:0.5685:0.18:0.2516	.	468	P08582	TRFM_HUMAN	Y	468	ENSP00000296350:D468Y	ENSP00000296350:D468Y	D	-	1	0	MFI2	198221009	0.932000	0.31603	0.987000	0.45799	0.853000	0.48598	0.444000	0.21661	1.223000	0.43536	0.563000	0.77884	GAT	MFI2	-	pfam_Peptidase_S60,smart_Peptidase_S60,pirsf_Transferrin	ENSG00000163975		0.652	MFI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MFI2	HGNC	protein_coding	OTTHUMT00000340458.1	33	0.00	0	C			196736612	196736612	-1	no_errors	ENST00000296350	ensembl	human	known	69_37n	missense	13	18.75	3	SNP	0.810	A
MFSD6	54842	genome.wustl.edu	37	2	191301691	191301691	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:191301691C>T	ENST00000392328.1	+	3	1260	c.936C>T	c.(934-936)gtC>gtT	p.V312V	MFSD6_ENST00000281416.7_Silent_p.V312V	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	312					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.V312V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TAGACACGGTCACACTCCAGT	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											159.0	156.0	157.0					2																	191301691		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.936C>T	2.37:g.191301691C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3KSZ4|Q86TH2|Q9NXM3	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.V312	ENST00000392328.1	37	c.936	CCDS2306.1	2																																																																																			MFSD6	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000151690		0.498	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	126	0.00	0	C			191301691	191301691	+1	no_errors	ENST00000281416	ensembl	human	known	69_37n	silent	143	20.99	38	SNP	0.103	T
MFSD6	54842	genome.wustl.edu	37	2	191301691	191301691	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:191301691C>T	ENST00000392328.1	+	3	1260	c.936C>T	c.(934-936)gtC>gtT	p.V312V	MFSD6_ENST00000281416.7_Silent_p.V312V	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	312					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.V312V(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TAGACACGGTCACACTCCAGT	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											159.0	156.0	157.0					2																	191301691		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.936C>T	2.37:g.191301691C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3KSZ4|Q86TH2|Q9NXM3	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.V312	ENST00000392328.1	37	c.936	CCDS2306.1	2																																																																																			MFSD6	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000151690		0.498	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	126	0.00	0	C			191301691	191301691	+1	no_errors	ENST00000281416	ensembl	human	known	69_37n	silent	98	20.97	26	SNP	0.103	T
MGA	23269	genome.wustl.edu	37	15	42052536	42052536	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:42052536C>G	ENST00000570161.1	+	19	7207	c.7207C>G	c.(7207-7209)Cta>Gta	p.L2403V	MGA_ENST00000219905.7_Missense_Mutation_p.L2403V|MGA_ENST00000566586.1_Missense_Mutation_p.L2194V|MGA_ENST00000545763.1_Missense_Mutation_p.L2194V|MGA_ENST00000389936.4_Missense_Mutation_p.L2364V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.L2452V(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACCAATTCCTCTAAAACTGAA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	89.0	89.0					15																	42052536		1911	4125	6036	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7207C>G	15.37:g.42052536C>G	ENSP00000457035:p.Leu2403Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.L2403V	ENST00000570161.1	37	c.7207	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	4.840	0.156131	0.09236	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.83755	-1.76;-1.74;-1.75	5.53	-3.22	0.05125	.	1.188580	0.06414	N	0.721140	T	0.66915	0.2838	N	0.14661	0.345	0.09310	N	1	B;B;B	0.16603	0.0;0.0;0.018	B;B;B	0.12837	0.001;0.003;0.008	T	0.51482	-0.8700	10	0.34782	T	0.22	.	7.709	0.28667	0.0:0.2816:0.3292:0.3892	.	1019;2194;2403	B4DVS1;F5H7K2;E7ENI0	.;.;.	V	2403;2364;2194	ENSP00000219905:L2403V;ENSP00000374586:L2364V;ENSP00000442467:L2194V	ENSP00000219905:L2403V	L	+	1	2	MGA	39839828	0.001000	0.12720	0.378000	0.26068	0.077000	0.17291	-0.986000	0.03747	-0.482000	0.06782	-2.047000	0.00414	CTA	MGA	-	NULL	ENSG00000174197		0.473	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	94	0.00	0	C	NM_001164273.1		42052536	42052536	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	50	26.47	18	SNP	0.003	G
MGA	23269	genome.wustl.edu	37	15	42052536	42052536	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:42052536C>G	ENST00000570161.1	+	19	7207	c.7207C>G	c.(7207-7209)Cta>Gta	p.L2403V	MGA_ENST00000219905.7_Missense_Mutation_p.L2403V|MGA_ENST00000566586.1_Missense_Mutation_p.L2194V|MGA_ENST00000545763.1_Missense_Mutation_p.L2194V|MGA_ENST00000389936.4_Missense_Mutation_p.L2364V			O43451	MGA_HUMAN	MGA, MAX dimerization protein	0					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.L2452V(1)		NS(1)|breast(4)|central_nervous_system(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(18)|lung(33)|ovary(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_cancers(109;0.00356)|all_epithelial(112;0.0413)|all_lung(180;0.18)|Ovarian(310;0.238)		OV - Ovarian serous cystadenocarcinoma(18;1.41e-18)|GBM - Glioblastoma multiforme(113;2.15e-06)|COAD - Colon adenocarcinoma(120;0.031)|Lung(196;0.0721)|BRCA - Breast invasive adenocarcinoma(123;0.0964)|Colorectal(105;0.0998)|LUSC - Lung squamous cell carcinoma(244;0.235)	Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	ACCAATTCCTCTAAAACTGAA	0.473																																						dbGAP											1	Substitution - Missense(1)	breast(1)											89.0	89.0	89.0					15																	42052536		1911	4125	6036	-	-	-	SO:0001583	missense	0			AB011090	CCDS55959.1, CCDS55960.1	15q15	2012-11-15	2012-11-15		ENSG00000174197	ENSG00000174197		"""MAX dimerization proteins"", ""T-boxes"""	14010	protein-coding gene	gene with protein product			"""MAX gene associated"""				Standard	NM_001080541		Approved	KIAA0518, MAD5, MXD5, FLJ12634	uc010ucy.2	Q8IWI9		ENST00000570161.1:c.7207C>G	15.37:g.42052536C>G	ENSP00000457035:p.Leu2403Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_TF_T-box,pfam_HLH_DNA-bd,superfamily_p53-like_TF_DNA-bd,superfamily_HLH_DNA-bd,smart_TF_T-box,smart_HLH_DNA-bd,prints_TF_T-box,pfscan_HLH_DNA-bd,pfscan_TF_T-box	p.L2403V	ENST00000570161.1	37	c.7207	CCDS55959.1	15	.	.	.	.	.	.	.	.	.	.	C	4.840	0.156131	0.09236	.	.	ENSG00000174197	ENST00000219905;ENST00000389936;ENST00000545763	D;D;D	0.83755	-1.76;-1.74;-1.75	5.53	-3.22	0.05125	.	1.188580	0.06414	N	0.721140	T	0.66915	0.2838	N	0.14661	0.345	0.09310	N	1	B;B;B	0.16603	0.0;0.0;0.018	B;B;B	0.12837	0.001;0.003;0.008	T	0.51482	-0.8700	10	0.34782	T	0.22	.	7.709	0.28667	0.0:0.2816:0.3292:0.3892	.	1019;2194;2403	B4DVS1;F5H7K2;E7ENI0	.;.;.	V	2403;2364;2194	ENSP00000219905:L2403V;ENSP00000374586:L2364V;ENSP00000442467:L2194V	ENSP00000219905:L2403V	L	+	1	2	MGA	39839828	0.001000	0.12720	0.378000	0.26068	0.077000	0.17291	-0.986000	0.03747	-0.482000	0.06782	-2.047000	0.00414	CTA	MGA	-	NULL	ENSG00000174197		0.473	MGA-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MGA	HGNC	protein_coding	OTTHUMT00000420229.1	94	0.00	0	C	NM_001164273.1		42052536	42052536	+1	no_errors	ENST00000219905	ensembl	human	known	69_37n	missense	80	27.93	31	SNP	0.003	G
MGAT4C	25834	genome.wustl.edu	37	12	86383282	86383282	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:86383282C>G	ENST00000604798.1	-	6	1247	c.43G>C	c.(43-45)Gat>Cat	p.D15H	MGAT4C_ENST00000548651.1_Missense_Mutation_p.D15H|MGAT4C_ENST00000552435.2_Missense_Mutation_p.D15H|MGAT4C_ENST00000332156.1_Missense_Mutation_p.D15H|MGAT4C_ENST00000393205.2_Missense_Mutation_p.D44H|MGAT4C_ENST00000552808.2_Missense_Mutation_p.D15H|MGAT4C_ENST00000549405.2_Missense_Mutation_p.D15H			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	15					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.D15H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CTCATTTTATCAAGTATTTCA	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	55.0	57.0					12																	86383282		2202	4297	6499	-	-	-	SO:0001583	missense	0				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.43G>C	12.37:g.86383282C>G	ENSP00000474896:p.Asp15His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.D44H	ENST00000604798.1	37	c.130	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165426	0.57476	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225;ENST00000552435	T;T;T;T;T;T	0.47528	1.42;1.38;1.42;1.42;1.42;0.84	5.69	5.69	0.88448	.	0.054833	0.64402	D	0.000002	T	0.52629	0.1746	L	0.32530	0.975	0.54753	D	0.99998	D;D	0.71674	0.998;0.995	P;P	0.58520	0.84;0.688	T	0.54282	-0.8317	10	0.72032	D	0.01	-19.1531	13.0584	0.58994	0.0:0.9267:0.0:0.0733	.	44;15	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	H	15;44;15;15;15;15;15;15	ENSP00000331664:D15H;ENSP00000376900:D44H;ENSP00000449022:D15H;ENSP00000446647:D15H;ENSP00000447253:D15H;ENSP00000449172:D15H	ENSP00000331664:D15H	D	-	1	0	MGAT4C	84907413	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.491000	0.66887	2.669000	0.90835	0.655000	0.94253	GAT	MGAT4C	-	superfamily_LSM_dom	ENSG00000182050		0.313	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2	87	0.00	0	C	NM_013244		86383282	86383282	-1	no_errors	ENST00000393205	ensembl	human	known	69_37n	missense	151	18.82	35	SNP	1.000	G
MGAT4C	25834	genome.wustl.edu	37	12	86383282	86383282	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:86383282C>G	ENST00000604798.1	-	6	1247	c.43G>C	c.(43-45)Gat>Cat	p.D15H	MGAT4C_ENST00000548651.1_Missense_Mutation_p.D15H|MGAT4C_ENST00000552435.2_Missense_Mutation_p.D15H|MGAT4C_ENST00000332156.1_Missense_Mutation_p.D15H|MGAT4C_ENST00000393205.2_Missense_Mutation_p.D44H|MGAT4C_ENST00000552808.2_Missense_Mutation_p.D15H|MGAT4C_ENST00000549405.2_Missense_Mutation_p.D15H			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	15					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.D15H(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						CTCATTTTATCAAGTATTTCA	0.313																																						dbGAP											1	Substitution - Missense(1)	breast(1)											61.0	55.0	57.0					12																	86383282		2202	4297	6499	-	-	-	SO:0001583	missense	0				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.43G>C	12.37:g.86383282C>G	ENSP00000474896:p.Asp15His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRH2|Q4G199|Q9UIU5	Missense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.D44H	ENST00000604798.1	37	c.130	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	C	16.59	3.165426	0.57476	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651;ENST00000547225;ENST00000552435	T;T;T;T;T;T	0.47528	1.42;1.38;1.42;1.42;1.42;0.84	5.69	5.69	0.88448	.	0.054833	0.64402	D	0.000002	T	0.52629	0.1746	L	0.32530	0.975	0.54753	D	0.99998	D;D	0.71674	0.998;0.995	P;P	0.58520	0.84;0.688	T	0.54282	-0.8317	10	0.72032	D	0.01	-19.1531	13.0584	0.58994	0.0:0.9267:0.0:0.0733	.	44;15	B4DRH2;Q9UBM8	.;MGT4C_HUMAN	H	15;44;15;15;15;15;15;15	ENSP00000331664:D15H;ENSP00000376900:D44H;ENSP00000449022:D15H;ENSP00000446647:D15H;ENSP00000447253:D15H;ENSP00000449172:D15H	ENSP00000331664:D15H	D	-	1	0	MGAT4C	84907413	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.491000	0.66887	2.669000	0.90835	0.655000	0.94253	GAT	MGAT4C	-	superfamily_LSM_dom	ENSG00000182050		0.313	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2	87	0.00	0	C	NM_013244		86383282	86383282	-1	no_errors	ENST00000393205	ensembl	human	known	69_37n	missense	96	17.24	20	SNP	1.000	G
MMP28	79148	genome.wustl.edu	37	17	34105959	34105959	+	Missense_Mutation	SNP	C	C	G	rs573447178		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:34105959C>G	ENST00000250144.8	-	3	641	c.312G>C	c.(310-312)gaG>gaC	p.E104D		NM_001032278.1	NP_001027449.1	Q9H239	MMP28_HUMAN	matrix metallopeptidase 28	104					negative regulation of macrophage chemotaxis (GO:0010760)	cytoplasm (GO:0005737)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(2)|lung(7)|ovary(1)|skin(5)	16		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)	Marimastat(DB00786)	CACTGATCCTCTCAGCCCAGG	0.557													C|||	1	0.000199681	0.0	0.0014	5008	,	,		22848	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													92.0	96.0	95.0					17																	34105959		2095	4213	6308	-	-	-	SO:0001583	missense	0			AF315683	CCDS45651.1, CCDS74036.1	17q12	2014-08-12	2005-08-08		ENSG00000271447	ENSG00000271447			14366	protein-coding gene	gene with protein product		608417	"""matrix metalloproteinase 28"""			11121398, 11255011	Standard	NM_024302		Approved	MMP-25, MM28, EPILYSIN, MMP-28	uc002hjy.1	Q9H239	OTTHUMG00000188387	ENST00000250144.8:c.312G>C	17.37:g.34105959C>G	ENSP00000250144:p.Glu104Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96F04|Q96TE2	Missense_Mutation	SNP	pfam_Peptidoglycan-bd-like,superfamily_Peptidoglycan-bd-like	p.E104D	ENST00000250144.8	37	c.312	CCDS45651.1	17	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781657	0.49891	.	.	ENSG00000129270	ENST00000338839;ENST00000538544;ENST00000250144	T	0.64991	-0.13	5.47	4.49	0.54785	Metallopeptidase, catalytic domain (1);	0.883730	0.09508	N	0.792789	T	0.50069	0.1594	.	.	.	0.21553	N	0.999649	B;B	0.24721	0.11;0.003	B;B	0.24006	0.05;0.003	T	0.29274	-1.0017	9	0.31617	T	0.26	.	11.6238	0.51134	0.0:0.9156:0.0:0.0844	.	104;104	Q9H239-2;Q9H239	.;MMP28_HUMAN	D	104	ENSP00000250144:E104D	ENSP00000250144:E104D	E	-	3	2	MMP28	31130072	1.000000	0.71417	0.983000	0.44433	0.750000	0.42670	1.254000	0.32897	2.570000	0.86706	0.655000	0.94253	GAG	MMP28	-	NULL	ENSG00000129270		0.557	MMP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP28	HGNC	protein_coding	OTTHUMT00000449269.1	116	0.00	0	C	NM_024302		34105959	34105959	-1	no_errors	ENST00000587639	ensembl	human	known	69_37n	missense	20	13.04	3	SNP	0.987	G
MON2	23041	genome.wustl.edu	37	12	62954645	62954645	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:62954645G>C	ENST00000393632.2	+	26	4175	c.3784G>C	c.(3784-3786)Gat>Cat	p.D1262H	MON2_ENST00000393630.3_Missense_Mutation_p.D1263H|MON2_ENST00000552738.1_Missense_Mutation_p.D1239H|MON2_ENST00000546600.1_Missense_Mutation_p.D1262H|MON2_ENST00000280379.6_Missense_Mutation_p.D1263H|MON2_ENST00000393629.2_Missense_Mutation_p.D1262H	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1262					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.D1262H(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TATTACTTTTGATAAACTAAC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	106.0	107.0					12																	62954645		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3784G>C	12.37:g.62954645G>C	ENSP00000377252:p.Asp1262His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.D1263H	ENST00000393632.2	37	c.3787	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966049	0.74131	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.59224	0.28;0.28;0.29;0.28;0.29;0.3	5.03	5.03	0.67393	.	0.112961	0.64402	D	0.000016	T	0.67126	0.2860	L	0.56769	1.78	0.80722	D	1	P;P;P;P;P	0.47409	0.694;0.797;0.895;0.804;0.755	B;P;P;P;P	0.52856	0.246;0.711;0.652;0.451;0.465	T	0.65627	-0.6122	9	.	.	.	-16.8373	18.7301	0.91731	0.0:0.0:1.0:0.0	.	1262;1239;1262;137;1262	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	H	1262;1263;1263;1262;1239;1262	ENSP00000377252:D1262H;ENSP00000377250:D1263H;ENSP00000280379:D1263H;ENSP00000447407:D1262H;ENSP00000449215:D1239H;ENSP00000377249:D1262H	.	D	+	1	0	MON2	61240912	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.554000	0.98121	2.510000	0.84645	0.460000	0.39030	GAT	MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.363	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	235	0.00	0	G	NM_015026		62954645	62954645	+1	no_errors	ENST00000393630	ensembl	human	known	69_37n	missense	180	21.65	50	SNP	1.000	C
MON2	23041	genome.wustl.edu	37	12	62954645	62954645	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:62954645G>C	ENST00000393632.2	+	26	4175	c.3784G>C	c.(3784-3786)Gat>Cat	p.D1262H	MON2_ENST00000393630.3_Missense_Mutation_p.D1263H|MON2_ENST00000552738.1_Missense_Mutation_p.D1239H|MON2_ENST00000546600.1_Missense_Mutation_p.D1262H|MON2_ENST00000280379.6_Missense_Mutation_p.D1263H|MON2_ENST00000393629.2_Missense_Mutation_p.D1262H	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1262					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.D1262H(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TATTACTTTTGATAAACTAAC	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											108.0	106.0	107.0					12																	62954645		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3784G>C	12.37:g.62954645G>C	ENSP00000377252:p.Asp1262His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.D1263H	ENST00000393632.2	37	c.3787	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966049	0.74131	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.59224	0.28;0.28;0.29;0.28;0.29;0.3	5.03	5.03	0.67393	.	0.112961	0.64402	D	0.000016	T	0.67126	0.2860	L	0.56769	1.78	0.80722	D	1	P;P;P;P;P	0.47409	0.694;0.797;0.895;0.804;0.755	B;P;P;P;P	0.52856	0.246;0.711;0.652;0.451;0.465	T	0.65627	-0.6122	9	.	.	.	-16.8373	18.7301	0.91731	0.0:0.0:1.0:0.0	.	1262;1239;1262;137;1262	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	H	1262;1263;1263;1262;1239;1262	ENSP00000377252:D1262H;ENSP00000377250:D1263H;ENSP00000280379:D1263H;ENSP00000447407:D1262H;ENSP00000449215:D1239H;ENSP00000377249:D1262H	.	D	+	1	0	MON2	61240912	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.554000	0.98121	2.510000	0.84645	0.460000	0.39030	GAT	MON2	-	superfamily_ARM-type_fold	ENSG00000061987		0.363	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	235	0.00	0	G	NM_015026		62954645	62954645	+1	no_errors	ENST00000393630	ensembl	human	known	69_37n	missense	289	21.20	78	SNP	1.000	C
MTOR	2475	genome.wustl.edu	37	1	11174872	11174872	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:11174872C>G	ENST00000361445.4	-	52	7238	c.7162G>C	c.(7162-7164)Gag>Cag	p.E2388Q	MTOR_ENST00000376838.1_Missense_Mutation_p.E593Q	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2388	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E2388Q(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCACTCACCTCCATAGCATTG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											158.0	130.0	140.0					1																	11174872		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7162G>C	1.37:g.11174872C>G	ENSP00000354558:p.Glu2388Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E2388Q	ENST00000361445.4	37	c.7162	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293184	0.80914	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	D;D;D	0.81659	-1.52;-1.52;-1.52	5.71	5.71	0.89125	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.91666	0.7366	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92655	0.6136	10	0.87932	D	0	-11.3863	18.8382	0.92171	0.0:1.0:0.0:0.0	.	2388	P42345	MTOR_HUMAN	Q	2388;593;44	ENSP00000354558:E2388Q;ENSP00000366034:E593Q;ENSP00000398745:E44Q	ENSP00000354558:E2388Q	E	-	1	0	MTOR	11097459	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	7.365000	0.79537	2.697000	0.92050	0.563000	0.77884	GAG	MTOR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000198793		0.443	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	89	0.00	0	C	NM_004958		11174872	11174872	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	155	14.84	27	SNP	1.000	G
MTOR	2475	genome.wustl.edu	37	1	11174872	11174872	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:11174872C>G	ENST00000361445.4	-	52	7238	c.7162G>C	c.(7162-7164)Gag>Cag	p.E2388Q	MTOR_ENST00000376838.1_Missense_Mutation_p.E593Q	NM_004958.3	NP_004949.1	P42345	MTOR_HUMAN	mechanistic target of rapamycin (serine/threonine kinase)	2388	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				cell growth (GO:0016049)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell development (GO:0007281)|growth (GO:0040007)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|negative regulation of autophagy (GO:0010507)|negative regulation of cell size (GO:0045792)|negative regulation of macroautophagy (GO:0016242)|negative regulation of NFAT protein import into nucleus (GO:0051534)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|phosphorylation (GO:0016310)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of gene expression (GO:0010628)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of lipid biosynthetic process (GO:0046889)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of carbohydrate utilization (GO:0043610)|regulation of fatty acid beta-oxidation (GO:0031998)|regulation of glycogen biosynthetic process (GO:0005979)|regulation of protein kinase activity (GO:0045859)|regulation of Rac GTPase activity (GO:0032314)|regulation of response to food (GO:0032095)|response to amino acid (GO:0043200)|response to nutrient (GO:0007584)|response to stress (GO:0006950)|ruffle organization (GO:0031529)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)|TOR signaling (GO:0031929)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|phosphatidylinositol 3-kinase complex (GO:0005942)|PML body (GO:0016605)|TORC1 complex (GO:0031931)|TORC2 complex (GO:0031932)	ATP binding (GO:0005524)|drug binding (GO:0008144)|kinase activity (GO:0016301)|phosphoprotein binding (GO:0051219)|protein serine/threonine kinase activity (GO:0004674)|ribosome binding (GO:0043022)|RNA polymerase III type 1 promoter DNA binding (GO:0001030)|RNA polymerase III type 2 promoter DNA binding (GO:0001031)|RNA polymerase III type 3 promoter DNA binding (GO:0001032)|TFIIIC-class transcription factor binding (GO:0001156)	p.E2388Q(1)		breast(5)|central_nervous_system(7)|endometrium(20)|kidney(34)|large_intestine(21)|lung(43)|ovary(9)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	149					Everolimus(DB01590)|Pimecrolimus(DB00337)|Sirolimus(DB00877)|Temsirolimus(DB06287)	CCACTCACCTCCATAGCATTG	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											158.0	130.0	140.0					1																	11174872		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34075	CCDS127.1	1p36	2014-09-17	2009-05-29	2009-05-29	ENSG00000198793	ENSG00000198793			3942	protein-coding gene	gene with protein product	"""FK506 binding protein 12-rapamycin associated protein 2"", ""rapamycin target protein"", ""FKBP12-rapamycin complex-associated protein 1"", ""FKBP-rapamycin associated protein"", ""rapamycin associated protein FRAP2"", ""dJ576K7.1 (FK506 binding protein 12-rapamycin associated protein 1)"", ""rapamycin and FKBP12 target 1"", ""mammalian target of rapamycin"""	601231	"""FK506 binding protein 12-rapamycin associated protein 1"""	FRAP, FRAP2, FRAP1		8008069, 8660990	Standard	NM_004958		Approved	RAFT1, RAPT1, FLJ44809	uc001asd.3	P42345	OTTHUMG00000002001	ENST00000361445.4:c.7162G>C	1.37:g.11174872C>G	ENSP00000354558:p.Glu2388Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4LE76|Q5TER1|Q6LE87|Q96QG3|Q9Y4I3	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_DUF3385_TOR,pfam_FKBP_rapamycin-assoc_FKBP12-bd,pfam_FATC,superfamily_ARM-type_fold,superfamily_Kinase-like_dom,superfamily_FKBP_rapamycin-assoc_FKBP12-bd,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E2388Q	ENST00000361445.4	37	c.7162	CCDS127.1	1	.	.	.	.	.	.	.	.	.	.	C	22.5	4.293184	0.80914	.	.	ENSG00000198793	ENST00000361445;ENST00000376838;ENST00000455339	D;D;D	0.81659	-1.52;-1.52;-1.52	5.71	5.71	0.89125	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.000000	0.85682	D	0.000000	D	0.91666	0.7366	M	0.88377	2.95	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.92655	0.6136	10	0.87932	D	0	-11.3863	18.8382	0.92171	0.0:1.0:0.0:0.0	.	2388	P42345	MTOR_HUMAN	Q	2388;593;44	ENSP00000354558:E2388Q;ENSP00000366034:E593Q;ENSP00000398745:E44Q	ENSP00000354558:E2388Q	E	-	1	0	MTOR	11097459	1.000000	0.71417	1.000000	0.80357	0.372000	0.29890	7.365000	0.79537	2.697000	0.92050	0.563000	0.77884	GAG	MTOR	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000198793		0.443	MTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTOR	HGNC	protein_coding	OTTHUMT00000005558.1	89	0.00	0	C	NM_004958		11174872	11174872	-1	no_errors	ENST00000361445	ensembl	human	known	69_37n	missense	97	12.61	14	SNP	1.000	G
MUC12	10071	genome.wustl.edu	37	7	100635483	100635483	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:100635483C>A	ENST00000379442.3	+	5	2068	c.2068C>A	c.(2068-2070)Cag>Aag	p.Q690K	MUC12_ENST00000536621.1_Missense_Mutation_p.Q547K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	690	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.Q547K(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGGCCTCAGTCAGGAATCTAC	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											238.0	263.0	255.0					7																	100635483		692	1591	2283	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.2068C>A	7.37:g.100635483C>A	ENSP00000368755:p.Gln690Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.Q690K	ENST00000379442.3	37	c.2068		7	.	.	.	.	.	.	.	.	.	.	C	2.049	-0.418202	0.04766	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.10763	2.84;2.84	0.695	-1.39	0.08997	.	.	.	.	.	T	0.03739	0.0106	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.45571	-0.9252	7	0.08179	T	0.78	.	6.1635	0.20378	0.0:0.604:0.396:0.0	.	.	.	.	K	690;547	ENSP00000368755:Q690K;ENSP00000441929:Q547K	ENSP00000368755:Q690K	Q	+	1	0	MUC12	100422203	0.000000	0.05858	0.004000	0.12327	0.042000	0.13812	-0.457000	0.06745	-0.376000	0.07943	0.162000	0.16502	CAG	MUC12	-	NULL	ENSG00000205277		0.557	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	446	0.00	0	C	XM_379904		100635483	100635483	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	199	16.39	39	SNP	0.019	A
MUC12	10071	genome.wustl.edu	37	7	100635483	100635483	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:100635483C>A	ENST00000379442.3	+	5	2068	c.2068C>A	c.(2068-2070)Cag>Aag	p.Q690K	MUC12_ENST00000536621.1_Missense_Mutation_p.Q547K			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	690	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)		p.Q547K(1)		breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AGGCCTCAGTCAGGAATCTAC	0.557																																						dbGAP											1	Substitution - Missense(1)	breast(1)											238.0	263.0	255.0					7																	100635483		692	1591	2283	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.2068C>A	7.37:g.100635483C>A	ENSP00000368755:p.Gln690Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.Q690K	ENST00000379442.3	37	c.2068		7	.	.	.	.	.	.	.	.	.	.	C	2.049	-0.418202	0.04766	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.10763	2.84;2.84	0.695	-1.39	0.08997	.	.	.	.	.	T	0.03739	0.0106	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.45571	-0.9252	7	0.08179	T	0.78	.	6.1635	0.20378	0.0:0.604:0.396:0.0	.	.	.	.	K	690;547	ENSP00000368755:Q690K;ENSP00000441929:Q547K	ENSP00000368755:Q690K	Q	+	1	0	MUC12	100422203	0.000000	0.05858	0.004000	0.12327	0.042000	0.13812	-0.457000	0.06745	-0.376000	0.07943	0.162000	0.16502	CAG	MUC12	-	NULL	ENSG00000205277		0.557	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	446	0.00	0	C	XM_379904		100635483	100635483	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	304	16.02	58	SNP	0.019	A
NCOR1	9611	genome.wustl.edu	37	17	16068438	16068438	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:16068438G>A	ENST00000268712.3	-	5	730	c.473C>T	c.(472-474)tCt>tTt	p.S158F	NCOR1_ENST00000395848.1_Missense_Mutation_p.S49F|NCOR1_ENST00000395851.1_Missense_Mutation_p.S158F	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	158	Interaction with ZBTB33 and HEXIM1.				CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CGAAATTGGAGAGGATGGAGC	0.393																																						dbGAP											0													113.0	107.0	109.0					17																	16068438		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.473C>T	17.37:g.16068438G>A	ENSP00000268712:p.Ser158Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S158F	ENST00000268712.3	37	c.473	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	G	15.01	2.706100	0.48412	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000458113;ENST00000395848;ENST00000411510;ENST00000436828	T;T;T	0.58506	0.5;1.01;0.33	5.04	5.04	0.67666	.	0.159576	0.64402	D	0.000018	T	0.74581	0.3735	M	0.65975	2.015	0.80722	D	1	D;P;D;P;D;D;D	0.76494	0.966;0.923;0.966;0.923;0.999;0.985;0.994	P;P;P;P;D;P;D	0.74674	0.781;0.714;0.668;0.714;0.984;0.703;0.931	T	0.77907	-0.2412	10	0.87932	D	0	-1.9965	17.4183	0.87507	0.0:0.0:1.0:0.0	.	158;158;158;158;49;158;158	E7EU93;E7EV02;Q3B773;E7EW50;E9PGV6;O75376;O75376-2	.;.;.;.;.;NCOR1_HUMAN;.	F	158;158;49;158;49;158;158	ENSP00000268712:S158F;ENSP00000379192:S158F;ENSP00000379189:S49F	ENSP00000268712:S158F	S	-	2	0	NCOR1	16009163	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.006000	0.93592	2.349000	0.79799	0.478000	0.44815	TCT	NCOR1	-	NULL	ENSG00000141027		0.393	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	208	0.00	0	G	NM_006311		16068438	16068438	-1	no_errors	ENST00000268712	ensembl	human	known	69_37n	missense	221	11.95	30	SNP	1.000	A
NEDD4L	23327	genome.wustl.edu	37	18	55916155	55916155	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr18:55916155G>C	ENST00000400345.3	+	4	512	c.229G>C	c.(229-231)Gaa>Caa	p.E77Q	NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000435432.2_5'UTR|NEDD4L_ENST00000382850.4_Missense_Mutation_p.E77Q|NEDD4L_ENST00000456173.2_5'UTR|NEDD4L_ENST00000456986.1_5'UTR|NEDD4L_ENST00000256832.7_5'UTR|NEDD4L_ENST00000586263.1_Missense_Mutation_p.E69Q|NEDD4L_ENST00000431212.2_5'UTR|NEDD4L_ENST00000256830.9_Missense_Mutation_p.E77Q|NEDD4L_ENST00000356462.6_Missense_Mutation_p.E77Q|NEDD4L_ENST00000357895.5_Missense_Mutation_p.E69Q	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	77	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)	p.E77Q(2)		breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						ATGGAATGAAGAATTTTATTT	0.313																																						dbGAP											2	Substitution - Missense(2)	breast(2)											52.0	47.0	49.0					18																	55916155		1762	3952	5714	-	-	-	SO:0001583	missense	0			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.229G>C	18.37:g.55916155G>C	ENSP00000383199:p.Glu77Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP,prints_C2_dom	p.E77Q	ENST00000400345.3	37	c.229	CCDS45872.1	18	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853326	0.71719	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000357895	T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45	5.26	5.26	0.73747	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.113216	0.64402	D	0.000016	T	0.74959	0.3785	L	0.33339	1.005	0.80722	D	1	D;D;D;D;D	0.63880	0.976;0.993;0.982;0.976;0.976	P;D;D;D;P	0.70016	0.891;0.967;0.923;0.929;0.756	T	0.75906	-0.3152	10	0.52906	T	0.07	.	19.2186	0.93788	0.0:0.0:1.0:0.0	.	69;69;77;77;77	Q96PU5-6;Q96PU5-7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;NED4L_HUMAN;.	Q	77;77;77;77;69	ENSP00000383199:E77Q;ENSP00000372301:E77Q;ENSP00000348847:E77Q;ENSP00000256830:E77Q;ENSP00000350569:E69Q	ENSP00000256830:E77Q	E	+	1	0	NEDD4L	54067135	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	8.766000	0.91728	2.622000	0.88805	0.462000	0.41574	GAA	NEDD4L	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	ENSG00000049759		0.313	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD4L	HGNC	protein_coding	OTTHUMT00000448749.1	135	0.00	0	G			55916155	55916155	+1	no_errors	ENST00000400345	ensembl	human	known	69_37n	missense	180	18.55	41	SNP	1.000	C
NEDD4L	23327	genome.wustl.edu	37	18	55916155	55916155	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr18:55916155G>C	ENST00000400345.3	+	4	512	c.229G>C	c.(229-231)Gaa>Caa	p.E77Q	NEDD4L_ENST00000589054.1_Intron|NEDD4L_ENST00000435432.2_5'UTR|NEDD4L_ENST00000382850.4_Missense_Mutation_p.E77Q|NEDD4L_ENST00000456173.2_5'UTR|NEDD4L_ENST00000456986.1_5'UTR|NEDD4L_ENST00000256832.7_5'UTR|NEDD4L_ENST00000586263.1_Missense_Mutation_p.E69Q|NEDD4L_ENST00000431212.2_5'UTR|NEDD4L_ENST00000256830.9_Missense_Mutation_p.E77Q|NEDD4L_ENST00000356462.6_Missense_Mutation_p.E77Q|NEDD4L_ENST00000357895.5_Missense_Mutation_p.E69Q	NM_001144967.2	NP_001138439.1	Q96PU5	NED4L_HUMAN	neural precursor cell expressed, developmentally down-regulated 4-like, E3 ubiquitin protein ligase	77	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cellular sodium ion homeostasis (GO:0006883)|excretion (GO:0007588)|gene expression (GO:0010467)|ion transmembrane transport (GO:0034220)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of protein localization to cell surface (GO:2000009)|negative regulation of sodium ion transmembrane transport (GO:1902306)|negative regulation of sodium ion transmembrane transporter activity (GO:2000650)|negative regulation of systemic arterial blood pressure (GO:0003085)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of cation channel activity (GO:2001259)|positive regulation of caveolin-mediated endocytosis (GO:2001288)|positive regulation of endocytosis (GO:0045807)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of sodium ion transport (GO:0010765)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked ubiquitination (GO:0070936)|protein monoubiquitination (GO:0006513)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane depolarization (GO:0003254)|regulation of membrane potential (GO:0042391)|regulation of membrane repolarization (GO:0060306)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|regulation of protein catabolic process (GO:0042176)|regulation of tight junction assembly (GO:2000810)|response to metal ion (GO:0010038)|response to salt stress (GO:0009651)|sodium ion transport (GO:0006814)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)|ventricular cardiac muscle cell action potential (GO:0086005)|viral life cycle (GO:0019058)|viral process (GO:0016032)|water homeostasis (GO:0030104)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ion channel binding (GO:0044325)|ligase activity (GO:0016874)|potassium channel inhibitor activity (GO:0019870)|potassium channel regulator activity (GO:0015459)|sodium channel inhibitor activity (GO:0019871)|sodium channel regulator activity (GO:0017080)|ubiquitin-protein transferase activity (GO:0004842)	p.E77Q(2)		breast(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(11)|ovary(1)|prostate(4)	37						ATGGAATGAAGAATTTTATTT	0.313																																						dbGAP											2	Substitution - Missense(2)	breast(2)											52.0	47.0	49.0					18																	55916155		1762	3952	5714	-	-	-	SO:0001583	missense	0			AF210730	CCDS45872.1, CCDS45873.1, CCDS45874.1, CCDS45875.1, CCDS45876.1, CCDS58632.1, CCDS59323.1	18q21.31	2014-08-12	2012-02-23		ENSG00000049759				7728	protein-coding gene	gene with protein product		606384	"""neural precursor cell expressed, developmentally down-regulated 4-like"""			10594025, 11244092, 18322022	Standard	NM_001144965		Approved	KIAA0439, RSP5, NEDD4-2	uc002lgy.3	Q96PU5	OTTHUMG00000179875	ENST00000400345.3:c.229G>C	18.37:g.55916155G>C	ENSP00000383199:p.Glu77Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O43165|Q3LSM7|Q7Z5F1|Q7Z5F2|Q7Z5N3|Q8N5A7|Q8WUU9|Q9BW58|Q9H2W4|Q9NT88	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP,prints_C2_dom	p.E77Q	ENST00000400345.3	37	c.229	CCDS45872.1	18	.	.	.	.	.	.	.	.	.	.	G	19.57	3.853326	0.71719	.	.	ENSG00000049759	ENST00000400345;ENST00000382850;ENST00000356462;ENST00000256830;ENST00000357895	T;T;T;T;T	0.70045	-0.45;-0.45;-0.45;-0.45;-0.45	5.26	5.26	0.73747	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.113216	0.64402	D	0.000016	T	0.74959	0.3785	L	0.33339	1.005	0.80722	D	1	D;D;D;D;D	0.63880	0.976;0.993;0.982;0.976;0.976	P;D;D;D;P	0.70016	0.891;0.967;0.923;0.929;0.756	T	0.75906	-0.3152	10	0.52906	T	0.07	.	19.2186	0.93788	0.0:0.0:1.0:0.0	.	69;69;77;77;77	Q96PU5-6;Q96PU5-7;Q96PU5-2;Q96PU5;Q96PU5-5	.;.;.;NED4L_HUMAN;.	Q	77;77;77;77;69	ENSP00000383199:E77Q;ENSP00000372301:E77Q;ENSP00000348847:E77Q;ENSP00000256830:E77Q;ENSP00000350569:E69Q	ENSP00000256830:E77Q	E	+	1	0	NEDD4L	54067135	1.000000	0.71417	1.000000	0.80357	0.836000	0.47400	8.766000	0.91728	2.622000	0.88805	0.462000	0.41574	GAA	NEDD4L	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	ENSG00000049759		0.313	NEDD4L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD4L	HGNC	protein_coding	OTTHUMT00000448749.1	135	0.00	0	G			55916155	55916155	+1	no_errors	ENST00000400345	ensembl	human	known	69_37n	missense	295	20.91	78	SNP	1.000	C
NEK5	341676	genome.wustl.edu	37	13	52663415	52663415	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr13:52663415G>A	ENST00000355568.4	-	14	1382	c.1243C>T	c.(1243-1245)Caa>Taa	p.Q415*		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	415					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Q415*(1)|p.Q472*(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		TTATATTGTTGAGCTTCAAAT	0.338																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											72.0	71.0	72.0					13																	52663415		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1243C>T	13.37:g.52663415G>A	ENSP00000347767:p.Gln415*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q415*	ENST00000355568.4	37	c.1243	CCDS31979.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.401600	0.97537	.	.	ENSG00000197168	ENST00000355568	.	.	.	5.61	5.61	0.85477	.	0.179319	0.38436	N	0.001699	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	16.3508	0.83204	0.0:0.0:1.0:0.0	.	.	.	.	X	415	.	ENSP00000347767:Q415X	Q	-	1	0	NEK5	51561416	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	4.986000	0.63851	2.652000	0.90054	0.505000	0.49811	CAA	NEK5	-	NULL	ENSG00000197168		0.338	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK5	HGNC	protein_coding	OTTHUMT00000045045.3	159	0.00	0	G	NM_199289		52663415	52663415	-1	no_errors	ENST00000355568	ensembl	human	known	69_37n	nonsense	185	15.91	35	SNP	1.000	A
NEK5	341676	genome.wustl.edu	37	13	52663415	52663415	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr13:52663415G>A	ENST00000355568.4	-	14	1382	c.1243C>T	c.(1243-1245)Caa>Taa	p.Q415*		NM_199289.1	NP_954983.1	Q6P3R8	NEK5_HUMAN	NIMA-related kinase 5	415					positive regulation of cysteine-type endopeptidase activity (GO:2001056)|positive regulation of striated muscle cell differentiation (GO:0051155)		ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.Q415*(1)|p.Q472*(1)		breast(5)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(8)|lung(11)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Breast(56;0.00173)|Lung NSC(96;0.0168)|Prostate(109;0.0412)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;3.7e-08)		TTATATTGTTGAGCTTCAAAT	0.338																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											72.0	71.0	72.0					13																	52663415		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC063885	CCDS31979.1	13q14.2	2012-11-15	2012-11-15		ENSG00000197168	ENSG00000197168			7748	protein-coding gene	gene with protein product			"""NIMA (never in mitosis gene a)-related kinase 5"""			9552363	Standard	XM_006719807		Approved		uc001vge.3	Q6P3R8	OTTHUMG00000016957	ENST00000355568.4:c.1243C>T	13.37:g.52663415G>A	ENSP00000347767:p.Gln415*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q415*	ENST00000355568.4	37	c.1243	CCDS31979.1	13	.	.	.	.	.	.	.	.	.	.	G	37	6.401600	0.97537	.	.	ENSG00000197168	ENST00000355568	.	.	.	5.61	5.61	0.85477	.	0.179319	0.38436	N	0.001699	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	16.3508	0.83204	0.0:0.0:1.0:0.0	.	.	.	.	X	415	.	ENSP00000347767:Q415X	Q	-	1	0	NEK5	51561416	1.000000	0.71417	0.998000	0.56505	0.878000	0.50629	4.986000	0.63851	2.652000	0.90054	0.505000	0.49811	CAA	NEK5	-	NULL	ENSG00000197168		0.338	NEK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK5	HGNC	protein_coding	OTTHUMT00000045045.3	159	0.00	0	G	NM_199289		52663415	52663415	-1	no_errors	ENST00000355568	ensembl	human	known	69_37n	nonsense	300	15.25	54	SNP	1.000	A
NFYC	4802	genome.wustl.edu	37	1	41228646	41228646	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:41228646G>A	ENST00000308733.5	+	6	654	c.648G>A	c.(646-648)caG>caA	p.Q216Q	NFYC_ENST00000372653.1_Intron|NFYC_ENST00000372652.1_Silent_p.Q216Q|NFYC_ENST00000440226.3_Silent_p.Q216Q|NFYC_ENST00000427410.2_Silent_p.Q178Q|NFYC_ENST00000447388.3_Silent_p.Q216Q|NFYC_ENST00000372654.1_Silent_p.Q216Q|NFYC_ENST00000372651.1_Silent_p.Q216Q|NFYC_ENST00000425457.2_Silent_p.Q216Q|NFYC_ENST00000456393.2_Silent_p.Q216Q			Q13952	NFYC_HUMAN	nuclear transcription factor Y, gamma	216				QS -> HN (in Ref. 4; BAA14051). {ECO:0000305}.	cellular lipid metabolic process (GO:0044255)|positive regulation of transcription, DNA-templated (GO:0045893)|protein folding (GO:0006457)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	CCAAT-binding factor complex (GO:0016602)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(1)|prostate(1)|skin(2)	15	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.72e-17)			AACAGGCCCAGAGTGGCACTG	0.552																																						dbGAP											0													88.0	73.0	78.0					1																	41228646		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U78774	CCDS455.1, CCDS44120.1, CCDS44121.1, CCDS44122.1, CCDS44123.1	1p32	2008-11-11			ENSG00000066136	ENSG00000066136			7806	protein-coding gene	gene with protein product		605344				8921405, 9249075	Standard	NM_014223		Approved	CBF-C, NF-YC	uc009vwd.3	Q13952	OTTHUMG00000007729	ENST00000308733.5:c.648G>A	1.37:g.41228646G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUS6|B4DW63|D3DPV9|F8VWM3|Q59GY4|Q5T6K8|Q5T6K9|Q5T6L1|Q5TZR6|Q92869|Q9HBX1|Q9NXB5|Q9UM67|Q9UML0|Q9UMT7	Missense_Mutation	SNP	NULL	p.E99K	ENST00000308733.5	37	c.295		1	.	.	.	.	.	.	.	.	.	.	G	2.459	-0.324488	0.05350	.	.	ENSG00000066136	ENST00000414185	.	.	.	5.56	4.64	0.57946	.	.	.	.	.	T	0.64159	0.2573	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61535	-0.7043	4	.	.	.	.	12.574	0.56354	0.083:0.0:0.917:0.0	.	.	.	.	K	99	.	.	E	+	1	0	NFYC	41001233	1.000000	0.71417	1.000000	0.80357	0.293000	0.27360	4.132000	0.57977	2.618000	0.88619	0.508000	0.49915	GAG	NFYC	-	NULL	ENSG00000066136		0.552	NFYC-007	KNOWN	basic	protein_coding	NFYC	HGNC	protein_coding	OTTHUMT00000020802.1	55	0.00	0	G	NM_014223		41228646	41228646	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000414185	ensembl	human	putative	69_37n	missense	26	10.34	3	SNP	1.000	A
NOP58	51602	genome.wustl.edu	37	2	203139857	203139857	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:203139857C>G	ENST00000264279.5	+	2	293	c.67C>G	c.(67-69)Caa>Gaa	p.Q23E	NOP58_ENST00000467734.1_Intron|SNORD70_ENST00000391007.1_RNA|SNORD70_ENST00000391232.1_RNA	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	23					cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.Q23E(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						GAAGAAACTTCAAGAGGTTGA	0.294																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	38.0	37.0					2																	203139857		2196	4284	6480	-	-	-	SO:0001583	missense	0				CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.67C>G	2.37:g.203139857C>G	ENSP00000264279:p.Gln23Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SA4|Q6PK08|Q9P036|Q9UFN3	Missense_Mutation	SNP	pfam_SnoRNA-bd_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.Q23E	ENST00000264279.5	37	c.67	CCDS2353.1	2	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897337	0.33535	.	.	ENSG00000055044	ENST00000264279	T	0.59502	0.26	5.06	5.06	0.68205	NOP5, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	N	0.05608	-0.01	0.80722	D	1	B;B	0.11235	0.0;0.004	B;B	0.17098	0.01;0.017	T	0.31530	-0.9940	10	0.02654	T	1	1.3688	18.2112	0.89871	0.0:1.0:0.0:0.0	.	23;23	B4DUY3;Q9Y2X3	.;NOP58_HUMAN	E	23	ENSP00000264279:Q23E	ENSP00000264279:Q23E	Q	+	1	0	NOP58	202848102	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.824000	0.75288	2.630000	0.89119	0.655000	0.94253	CAA	NOP58	-	pfam_NOP5_N	ENSG00000055044		0.294	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP58	HGNC	protein_coding	OTTHUMT00000256313.2	76	0.00	0	C	NM_015934		203139857	203139857	+1	no_errors	ENST00000264279	ensembl	human	known	69_37n	missense	165	18.72	38	SNP	1.000	G
NOP58	51602	genome.wustl.edu	37	2	203139857	203139857	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:203139857C>G	ENST00000264279.5	+	2	293	c.67C>G	c.(67-69)Caa>Gaa	p.Q23E	NOP58_ENST00000467734.1_Intron|SNORD70_ENST00000391007.1_RNA|SNORD70_ENST00000391232.1_RNA	NM_015934.3	NP_057018.1	Q9Y2X3	NOP58_HUMAN	NOP58 ribonucleoprotein	23					cell growth (GO:0016049)|rRNA processing (GO:0006364)|snRNP protein import into nucleus (GO:0006608)	box C/D snoRNP complex (GO:0031428)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|pre-snoRNP complex (GO:0070761)|small nucleolar ribonucleoprotein complex (GO:0005732)	poly(A) RNA binding (GO:0044822)|snoRNA binding (GO:0030515)	p.Q23E(1)		breast(2)|cervix(1)|endometrium(3)|large_intestine(4)|lung(4)|prostate(2)	16						GAAGAAACTTCAAGAGGTTGA	0.294																																						dbGAP											1	Substitution - Missense(1)	breast(1)											35.0	38.0	37.0					2																	203139857		2196	4284	6480	-	-	-	SO:0001583	missense	0				CCDS2353.1	2q33.1	2012-12-10	2012-12-10		ENSG00000055044	ENSG00000055044			29926	protein-coding gene	gene with protein product			"""NOP58 ribonucleoprotein homolog (yeast)"""			10606270, 10925205	Standard	NM_015934		Approved	NOP5, HSPC120	uc002uzb.3	Q9Y2X3	OTTHUMG00000132840	ENST00000264279.5:c.67C>G	2.37:g.203139857C>G	ENSP00000264279:p.Gln23Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SA4|Q6PK08|Q9P036|Q9UFN3	Missense_Mutation	SNP	pfam_SnoRNA-bd_dom,pfam_NOSIC,pfam_NOP5_N,smart_NOSIC	p.Q23E	ENST00000264279.5	37	c.67	CCDS2353.1	2	.	.	.	.	.	.	.	.	.	.	C	12.30	1.897337	0.33535	.	.	ENSG00000055044	ENST00000264279	T	0.59502	0.26	5.06	5.06	0.68205	NOP5, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	N	0.05608	-0.01	0.80722	D	1	B;B	0.11235	0.0;0.004	B;B	0.17098	0.01;0.017	T	0.31530	-0.9940	10	0.02654	T	1	1.3688	18.2112	0.89871	0.0:1.0:0.0:0.0	.	23;23	B4DUY3;Q9Y2X3	.;NOP58_HUMAN	E	23	ENSP00000264279:Q23E	ENSP00000264279:Q23E	Q	+	1	0	NOP58	202848102	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.824000	0.75288	2.630000	0.89119	0.655000	0.94253	CAA	NOP58	-	pfam_NOP5_N	ENSG00000055044		0.294	NOP58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP58	HGNC	protein_coding	OTTHUMT00000256313.2	76	0.00	0	C	NM_015934		203139857	203139857	+1	no_errors	ENST00000264279	ensembl	human	known	69_37n	missense	94	19.66	23	SNP	1.000	G
NUF2	83540	genome.wustl.edu	37	1	163318851	163318851	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:163318851G>A	ENST00000271452.3	+	13	1520	c.1241G>A	c.(1240-1242)aGg>aAg	p.R414K	NUF2_ENST00000524800.1_Missense_Mutation_p.R367K|NUF2_ENST00000367900.3_Missense_Mutation_p.R414K	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	414	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.R414K(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					GCTGCTGAAAGGGAGAAACTG	0.323																																						dbGAP											2	Substitution - Missense(2)	breast(2)											54.0	56.0	55.0					1																	163318851		2203	4299	6502	-	-	-	SO:0001583	missense	0			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1241G>A	1.37:g.163318851G>A	ENSP00000271452:p.Arg414Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	pfam_Kinetochore_Nuf2	p.R414K	ENST00000271452.3	37	c.1241	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	G	2.766	-0.256869	0.05829	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.27890	1.64;1.75;1.75	5.5	3.6	0.41247	.	0.309039	0.39544	N	0.001327	T	0.05547	0.0146	N	0.25647	0.755	0.26163	N	0.979979	B;B	0.15930	0.015;0.015	B;B	0.14023	0.01;0.01	T	0.27706	-1.0066	9	0.02654	T	1	-19.6464	7.5557	0.27822	0.249:0.0:0.751:0.0	.	367;414	E9PQC4;Q9BZD4	.;NUF2_HUMAN	K	367;414;414	ENSP00000436888:R367K;ENSP00000356875:R414K;ENSP00000271452:R414K	ENSP00000271452:R414K	R	+	2	0	NUF2	161585475	1.000000	0.71417	0.920000	0.36463	0.761000	0.43186	1.862000	0.39448	1.545000	0.49373	0.655000	0.94253	AGG	NUF2	-	NULL	ENSG00000143228		0.323	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	HGNC	protein_coding	OTTHUMT00000082812.1	94	0.00	0	G	NM_145697		163318851	163318851	+1	no_errors	ENST00000271452	ensembl	human	known	69_37n	missense	123	45.09	101	SNP	0.874	A
NUF2	83540	genome.wustl.edu	37	1	163318851	163318851	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:163318851G>A	ENST00000271452.3	+	13	1520	c.1241G>A	c.(1240-1242)aGg>aAg	p.R414K	NUF2_ENST00000524800.1_Missense_Mutation_p.R367K|NUF2_ENST00000367900.3_Missense_Mutation_p.R414K	NM_145697.2	NP_663735.2	Q9BZD4	NUF2_HUMAN	NUF2, NDC80 kinetochore complex component	414	Interaction with the C-terminus of NDC80 and the SPBC24-SPBC25 subcomplex.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)		p.R414K(2)		breast(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(15)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	35	all_hematologic(923;0.101)					GCTGCTGAAAGGGAGAAACTG	0.323																																						dbGAP											2	Substitution - Missense(2)	breast(2)											54.0	56.0	55.0					1																	163318851		2203	4299	6502	-	-	-	SO:0001583	missense	0			BG354574	CCDS1245.1	1q23.3	2013-07-03	2013-07-03	2006-11-07	ENSG00000143228	ENSG00000143228			14621	protein-coding gene	gene with protein product	"""cancer/testis antigen 106"""	611772	"""cell division cycle associated 1"", ""NUF2, NDC80 kinetochore complex component, homolog (S. cerevisiae)"""	CDCA1		11266451, 11685532	Standard	NM_031423		Approved	NUF2R, CT106	uc001gcr.1	Q9BZD4	OTTHUMG00000034275	ENST00000271452.3:c.1241G>A	1.37:g.163318851G>A	ENSP00000271452:p.Arg414Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WU69|Q96HJ4|Q96Q78	Missense_Mutation	SNP	pfam_Kinetochore_Nuf2	p.R414K	ENST00000271452.3	37	c.1241	CCDS1245.1	1	.	.	.	.	.	.	.	.	.	.	G	2.766	-0.256869	0.05829	.	.	ENSG00000143228	ENST00000524800;ENST00000367900;ENST00000271452	T;T;T	0.27890	1.64;1.75;1.75	5.5	3.6	0.41247	.	0.309039	0.39544	N	0.001327	T	0.05547	0.0146	N	0.25647	0.755	0.26163	N	0.979979	B;B	0.15930	0.015;0.015	B;B	0.14023	0.01;0.01	T	0.27706	-1.0066	9	0.02654	T	1	-19.6464	7.5557	0.27822	0.249:0.0:0.751:0.0	.	367;414	E9PQC4;Q9BZD4	.;NUF2_HUMAN	K	367;414;414	ENSP00000436888:R367K;ENSP00000356875:R414K;ENSP00000271452:R414K	ENSP00000271452:R414K	R	+	2	0	NUF2	161585475	1.000000	0.71417	0.920000	0.36463	0.761000	0.43186	1.862000	0.39448	1.545000	0.49373	0.655000	0.94253	AGG	NUF2	-	NULL	ENSG00000143228		0.323	NUF2-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	NUF2	HGNC	protein_coding	OTTHUMT00000082812.1	94	0.00	0	G	NM_145697		163318851	163318851	+1	no_errors	ENST00000271452	ensembl	human	known	69_37n	missense	66	49.62	65	SNP	0.874	A
OPALIN	93377	genome.wustl.edu	37	10	98108092	98108092	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:98108092C>T	ENST00000371172.3	-	5	608	c.203G>A	c.(202-204)aGa>aAa	p.R68K	OPALIN_ENST00000419479.1_Missense_Mutation_p.R58K|OPALIN_ENST00000393870.2_Missense_Mutation_p.R57K|OPALIN_ENST00000393871.1_Missense_Mutation_p.R45K|OPALIN_ENST00000536387.1_Missense_Mutation_p.R58K	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	68						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R58K(1)|p.R68K(1)		breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TTCACATGGTCTGTCACTTTC	0.313																																						dbGAP											2	Substitution - Missense(2)	breast(2)											71.0	71.0	71.0					10																	98108092		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.203G>A	10.37:g.98108092C>T	ENSP00000360214:p.Arg68Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NULL	p.R68K	ENST00000371172.3	37	c.203	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342412	0.41498	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.92	0.688	0.18027	.	0.449602	0.21142	N	0.079468	T	0.22859	0.0552	L	0.32530	0.975	0.18873	N	0.999986	P;B;P	0.36535	0.557;0.341;0.557	B;B;B	0.36845	0.234;0.116;0.234	T	0.13872	-1.0493	9	0.24483	T	0.36	-5.6699	7.5383	0.27723	0.3099:0.3888:0.3013:0.0	.	45;68;58	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	K	68;45;58;57;58	.	ENSP00000360214:R68K	R	-	2	0	OPALIN	98098082	0.913000	0.31002	0.761000	0.31378	0.930000	0.56654	0.036000	0.13819	0.038000	0.15604	0.558000	0.71614	AGA	OPALIN	-	NULL	ENSG00000197430		0.313	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	HGNC	protein_coding	OTTHUMT00000049606.1	95	0.00	0	C	NM_033207		98108092	98108092	-1	no_errors	ENST00000371172	ensembl	human	known	69_37n	missense	151	16.57	30	SNP	0.779	T
OPALIN	93377	genome.wustl.edu	37	10	98108092	98108092	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:98108092C>T	ENST00000371172.3	-	5	608	c.203G>A	c.(202-204)aGa>aAa	p.R68K	OPALIN_ENST00000419479.1_Missense_Mutation_p.R58K|OPALIN_ENST00000393870.2_Missense_Mutation_p.R57K|OPALIN_ENST00000393871.1_Missense_Mutation_p.R45K|OPALIN_ENST00000536387.1_Missense_Mutation_p.R58K	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	68						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.R58K(1)|p.R68K(1)		breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TTCACATGGTCTGTCACTTTC	0.313																																						dbGAP											2	Substitution - Missense(2)	breast(2)											71.0	71.0	71.0					10																	98108092		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.203G>A	10.37:g.98108092C>T	ENSP00000360214:p.Arg68Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NULL	p.R68K	ENST00000371172.3	37	c.203	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	C	13.79	2.342412	0.41498	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	4.92	0.688	0.18027	.	0.449602	0.21142	N	0.079468	T	0.22859	0.0552	L	0.32530	0.975	0.18873	N	0.999986	P;B;P	0.36535	0.557;0.341;0.557	B;B;B	0.36845	0.234;0.116;0.234	T	0.13872	-1.0493	9	0.24483	T	0.36	-5.6699	7.5383	0.27723	0.3099:0.3888:0.3013:0.0	.	45;68;58	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	K	68;45;58;57;58	.	ENSP00000360214:R68K	R	-	2	0	OPALIN	98098082	0.913000	0.31002	0.761000	0.31378	0.930000	0.56654	0.036000	0.13819	0.038000	0.15604	0.558000	0.71614	AGA	OPALIN	-	NULL	ENSG00000197430		0.313	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	HGNC	protein_coding	OTTHUMT00000049606.1	95	0.00	0	C	NM_033207		98108092	98108092	-1	no_errors	ENST00000371172	ensembl	human	known	69_37n	missense	235	19.24	56	SNP	0.779	T
OR1L4	254973	genome.wustl.edu	37	9	125487177	125487177	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:125487177G>A	ENST00000259466.1	+	1	909	c.909G>A	c.(907-909)aaG>aaA	p.K303K		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K303K(1)		breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						GGGGTTTGAAGAAATTAAGAC	0.398																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											46.0	46.0	46.0					9																	125487177		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.909G>A	9.37:g.125487177G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN0|Q96R81	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K303	ENST00000259466.1	37	c.909	CCDS35129.1	9																																																																																			OR1L4	-	NULL	ENSG00000136939		0.398	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L4	HGNC	protein_coding	OTTHUMT00000053951.1	68	0.00	0	G			125487177	125487177	+1	no_errors	ENST00000259466	ensembl	human	known	69_37n	silent	44	13.73	7	SNP	0.089	A
OR1L4	254973	genome.wustl.edu	37	9	125487177	125487177	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:125487177G>A	ENST00000259466.1	+	1	909	c.909G>A	c.(907-909)aaG>aaA	p.K303K		NM_001005235.1	NP_001005235.1	Q8NGR5	OR1L4_HUMAN	olfactory receptor, family 1, subfamily L, member 4	303						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.K303K(1)		breast(2)|large_intestine(3)|lung(13)|prostate(1)|skin(1)	20						GGGGTTTGAAGAAATTAAGAC	0.398																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											46.0	46.0	46.0					9																	125487177		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS35129.1	9q33.2	2013-09-20			ENSG00000136939	ENSG00000136939		"""GPCR / Class A : Olfactory receptors"""	8216	protein-coding gene	gene with protein product				OR1L5			Standard	NM_001005235		Approved	OR9-E	uc004bmu.1	Q8NGR5	OTTHUMG00000020620	ENST00000259466.1:c.909G>A	9.37:g.125487177G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFN0|Q96R81	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.K303	ENST00000259466.1	37	c.909	CCDS35129.1	9																																																																																			OR1L4	-	NULL	ENSG00000136939		0.398	OR1L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1L4	HGNC	protein_coding	OTTHUMT00000053951.1	68	0.00	0	G			125487177	125487177	+1	no_errors	ENST00000259466	ensembl	human	known	69_37n	silent	65	18.75	15	SNP	0.089	A
OR51D1	390038	genome.wustl.edu	37	11	4661785	4661785	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:4661785C>T	ENST00000357605.2	+	1	841	c.765C>T	c.(763-765)atC>atT	p.I255I	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I255I(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACACCTGCATCTCCCACCTCT	0.547																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											167.0	153.0	158.0					11																	4661785		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.765C>T	11.37:g.4661785C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIK4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I255	ENST00000357605.2	37	c.765	CCDS31357.1	11																																																																																			OR51D1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197428		0.547	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	HGNC	protein_coding	OTTHUMT00000385956.1	171	0.00	0	C	NM_001004751		4661785	4661785	+1	no_errors	ENST00000357605	ensembl	human	known	69_37n	silent	125	20.89	33	SNP	0.898	T
OR51D1	390038	genome.wustl.edu	37	11	4661785	4661785	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:4661785C>T	ENST00000357605.2	+	1	841	c.765C>T	c.(763-765)atC>atT	p.I255I	OR51E1_ENST00000396952.5_5'Flank	NM_001004751.2	NP_001004751.1	Q8NGF3	O51D1_HUMAN	olfactory receptor, family 51, subfamily D, member 1	255						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I255I(1)		autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|liver(2)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	27		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;2.74e-13)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|GBM - Glioblastoma multiforme(2;0.0841)|LUSC - Lung squamous cell carcinoma(625;0.19)		ACACCTGCATCTCCCACCTCT	0.547																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											167.0	153.0	158.0					11																	4661785		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065855	CCDS31357.1	11p15.4	2012-08-09			ENSG00000197428	ENSG00000197428		"""GPCR / Class A : Olfactory receptors"""	15193	protein-coding gene	gene with protein product							Standard	NM_001004751		Approved	OR51D1Q	uc010qyk.2	Q8NGF3	OTTHUMG00000165724	ENST00000357605.2:c.765C>T	11.37:g.4661785C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIK4	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I255	ENST00000357605.2	37	c.765	CCDS31357.1	11																																																																																			OR51D1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197428		0.547	OR51D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51D1	HGNC	protein_coding	OTTHUMT00000385956.1	171	0.00	0	C	NM_001004751		4661785	4661785	+1	no_errors	ENST00000357605	ensembl	human	known	69_37n	silent	193	20.90	51	SNP	0.898	T
OR7A17	26333	genome.wustl.edu	37	19	14992033	14992033	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:14992033G>A	ENST00000327462.2	-	1	231	c.135C>T	c.(133-135)atC>atT	p.I45I		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I45I(1)		breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					TGGCCAGGATGATGAGCAGAT	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											62.0	53.0	56.0					19																	14992033		2203	4295	6498	-	-	-	SO:0001819	synonymous_variant	0			X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.135C>T	19.37:g.14992033G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFQ6|Q96R98	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I45	ENST00000327462.2	37	c.135	CCDS12319.1	19																																																																																			OR7A17	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000185385		0.507	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A17	HGNC	protein_coding	OTTHUMT00000466523.1	72	0.00	0	G	NM_030901		14992033	14992033	-1	no_errors	ENST00000327462	ensembl	human	known	69_37n	silent	38	20.83	10	SNP	0.947	A
OR7A17	26333	genome.wustl.edu	37	19	14992033	14992033	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:14992033G>A	ENST00000327462.2	-	1	231	c.135C>T	c.(133-135)atC>atT	p.I45I		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	45						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.I45I(1)		breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					TGGCCAGGATGATGAGCAGAT	0.507																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											62.0	53.0	56.0					19																	14992033		2203	4295	6498	-	-	-	SO:0001819	synonymous_variant	0			X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.135C>T	19.37:g.14992033G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFQ6|Q96R98	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I45	ENST00000327462.2	37	c.135	CCDS12319.1	19																																																																																			OR7A17	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000185385		0.507	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A17	HGNC	protein_coding	OTTHUMT00000466523.1	72	0.00	0	G	NM_030901		14992033	14992033	-1	no_errors	ENST00000327462	ensembl	human	known	69_37n	silent	61	22.78	18	SNP	0.947	A
ORM2	5005	genome.wustl.edu	37	9	117092822	117092822	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:117092822G>C	ENST00000431067.2	+	2	259	c.223G>C	c.(223-225)Gag>Cag	p.E75Q	ORM2_ENST00000412657.1_3'UTR	NM_000608.2	NP_000599.1	P19652	A1AG2_HUMAN	orosomucoid 2	75					acute-phase response (GO:0006953)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.E75Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7		Myeloproliferative disorder(63;0.163)			Chlorpromazine(DB00477)|Oxycodone(DB00497)|Thalidomide(DB01041)	CAACAAGACAGAGGACACGAT	0.507																																					NSCLC(65;867 1308 1814 2391 12508)	dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	82.0	78.0					9																	117092822		2198	4299	6497	-	-	-	SO:0001583	missense	0				CCDS6804.1	9q32	2013-09-19			ENSG00000228278	ENSG00000228278		"""Lipocalins"""	8499	protein-coding gene	gene with protein product	"""alpha-1-acid glycoprotein, type 2"""	138610				4711474, 2970990	Standard	NM_000608		Approved	AGP-B, AGP-B', AGP2		P19652	OTTHUMG00000021014	ENST00000431067.2:c.223G>C	9.37:g.117092822G>C	ENSP00000394936:p.Glu75Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5L2|Q16571|Q5T538|Q6IB74	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_ApoM,superfamily_Calycin-like,pirsf_A1A_glycop,prints_A1A_glycop	p.E75Q	ENST00000431067.2	37	c.223	CCDS6804.1	9	.	.	.	.	.	.	.	.	.	.	-	15.81	2.944558	0.53079	.	.	ENSG00000228278	ENST00000431067	T	0.15372	2.43	3.11	0.0669	0.14363	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.061530	0.07272	N	0.869307	T	0.19406	0.0466	M	0.75447	2.3	0.09310	N	0.999998	B	0.24882	0.113	B	0.26517	0.07	T	0.37526	-0.9702	10	0.44086	T	0.13	-26.1683	3.1907	0.06616	0.2767:0.2272:0.4961:0.0	.	75	P19652	A1AG2_HUMAN	Q	75	ENSP00000394936:E75Q	ENSP00000394936:E75Q	E	+	1	0	ORM2	116132643	0.341000	0.24801	0.001000	0.08648	0.464000	0.32679	1.612000	0.36889	0.020000	0.15106	0.494000	0.49563	GAG	ORM2	-	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_ApoM,superfamily_Calycin-like,pirsf_A1A_glycop,prints_A1A_glycop	ENSG00000228278		0.507	ORM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORM2	HGNC	protein_coding	OTTHUMT00000055432.1	160	0.00	0	G	NM_000608		117092822	117092822	+1	no_errors	ENST00000431067	ensembl	human	known	69_37n	missense	138	23.76	43	SNP	0.001	C
ORM2	5005	genome.wustl.edu	37	9	117092822	117092822	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:117092822G>C	ENST00000431067.2	+	2	259	c.223G>C	c.(223-225)Gag>Cag	p.E75Q	ORM2_ENST00000412657.1_3'UTR	NM_000608.2	NP_000599.1	P19652	A1AG2_HUMAN	orosomucoid 2	75					acute-phase response (GO:0006953)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.E75Q(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7		Myeloproliferative disorder(63;0.163)			Chlorpromazine(DB00477)|Oxycodone(DB00497)|Thalidomide(DB01041)	CAACAAGACAGAGGACACGAT	0.507																																					NSCLC(65;867 1308 1814 2391 12508)	dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	82.0	78.0					9																	117092822		2198	4299	6497	-	-	-	SO:0001583	missense	0				CCDS6804.1	9q32	2013-09-19			ENSG00000228278	ENSG00000228278		"""Lipocalins"""	8499	protein-coding gene	gene with protein product	"""alpha-1-acid glycoprotein, type 2"""	138610				4711474, 2970990	Standard	NM_000608		Approved	AGP-B, AGP-B', AGP2		P19652	OTTHUMG00000021014	ENST00000431067.2:c.223G>C	9.37:g.117092822G>C	ENSP00000394936:p.Glu75Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5L2|Q16571|Q5T538|Q6IB74	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_ApoM,superfamily_Calycin-like,pirsf_A1A_glycop,prints_A1A_glycop	p.E75Q	ENST00000431067.2	37	c.223	CCDS6804.1	9	.	.	.	.	.	.	.	.	.	.	-	15.81	2.944558	0.53079	.	.	ENSG00000228278	ENST00000431067	T	0.15372	2.43	3.11	0.0669	0.14363	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	1.061530	0.07272	N	0.869307	T	0.19406	0.0466	M	0.75447	2.3	0.09310	N	0.999998	B	0.24882	0.113	B	0.26517	0.07	T	0.37526	-0.9702	10	0.44086	T	0.13	-26.1683	3.1907	0.06616	0.2767:0.2272:0.4961:0.0	.	75	P19652	A1AG2_HUMAN	Q	75	ENSP00000394936:E75Q	ENSP00000394936:E75Q	E	+	1	0	ORM2	116132643	0.341000	0.24801	0.001000	0.08648	0.464000	0.32679	1.612000	0.36889	0.020000	0.15106	0.494000	0.49563	GAG	ORM2	-	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_ApoM,superfamily_Calycin-like,pirsf_A1A_glycop,prints_A1A_glycop	ENSG00000228278		0.507	ORM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORM2	HGNC	protein_coding	OTTHUMT00000055432.1	160	0.00	0	G	NM_000608		117092822	117092822	+1	no_errors	ENST00000431067	ensembl	human	known	69_37n	missense	93	21.19	25	SNP	0.001	C
OXCT1	5019	genome.wustl.edu	37	5	41731843	41731843	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:41731843C>G	ENST00000196371.5	-	17	1711	c.1551G>C	c.(1549-1551)caG>caC	p.Q517H	OXCT1_ENST00000510634.1_Missense_Mutation_p.Q120H|OXCT1_ENST00000509987.1_Missense_Mutation_p.Q331H|OXCT1_ENST00000512084.1_Missense_Mutation_p.Q120H	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	517					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.Q517H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	AATTTGCGATCTGCTGCATTG	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	50.0	51.0					5																	41731843		2203	4299	6502	-	-	-	SO:0001583	missense	0			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1551G>C	5.37:g.41731843C>G	ENSP00000196371:p.Gln517His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V2|B7Z528	Missense_Mutation	SNP	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase,tigrfam_3-oxoacid_CoA-transf_B,tigrfam_3-oxoacid_CoA-transf_A	p.Q517H	ENST00000196371.5	37	c.1551	CCDS3937.1	5	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995990	0.54147	.	.	ENSG00000083720	ENST00000196371;ENST00000512084;ENST00000510634;ENST00000509987	D;D;D;D	0.90620	-2.13;-2.7;-2.7;-2.3	5.66	3.57	0.40892	.	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	M	0.91090	3.175	0.58432	D	0.999997	D	0.63880	0.993	P	0.51974	0.686	D	0.94842	0.8006	10	0.87932	D	0	-7.7385	12.4272	0.55553	0.0:0.835:0.0:0.165	.	517	P55809	SCOT1_HUMAN	H	517;120;120;331	ENSP00000196371:Q517H;ENSP00000421143:Q120H;ENSP00000423144:Q120H;ENSP00000425348:Q331H	ENSP00000196371:Q517H	Q	-	3	2	OXCT1	41767600	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.001000	0.29783	1.403000	0.46800	0.655000	0.94253	CAG	OXCT1	-	pirsf_3-oxoacid_CoA-transferase	ENSG00000083720		0.308	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXCT1	HGNC	protein_coding	OTTHUMT00000211594.2	91	0.00	0	C	NM_000436		41731843	41731843	-1	no_errors	ENST00000196371	ensembl	human	known	69_37n	missense	155	18.42	35	SNP	1.000	G
OXCT1	5019	genome.wustl.edu	37	5	41731843	41731843	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:41731843C>G	ENST00000196371.5	-	17	1711	c.1551G>C	c.(1549-1551)caG>caC	p.Q517H	OXCT1_ENST00000510634.1_Missense_Mutation_p.Q120H|OXCT1_ENST00000509987.1_Missense_Mutation_p.Q331H|OXCT1_ENST00000512084.1_Missense_Mutation_p.Q120H	NM_000436.3	NP_000427.1	P55809	SCOT1_HUMAN	3-oxoacid CoA transferase 1	517					adipose tissue development (GO:0060612)|brain development (GO:0007420)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular response to acid chemical (GO:0071229)|cellular response to glucose stimulus (GO:0071333)|heart development (GO:0007507)|ketone body catabolic process (GO:0046952)|ketone catabolic process (GO:0042182)|positive regulation of insulin secretion (GO:0032024)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to hormone (GO:0009725)|response to nutrient (GO:0007584)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	3-oxoacid CoA-transferase activity (GO:0008260)|protein homodimerization activity (GO:0042803)	p.Q517H(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(3)|prostate(1)|skin(2)	28					Succinic acid(DB00139)	AATTTGCGATCTGCTGCATTG	0.308																																						dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	50.0	51.0					5																	41731843		2203	4299	6502	-	-	-	SO:0001583	missense	0			U62961	CCDS3937.1	5p13	2008-02-05		2004-05-12	ENSG00000083720	ENSG00000083720			8527	protein-coding gene	gene with protein product		601424	"""3-oxoacid CoA transferase"""	OXCT		8751852	Standard	NM_000436		Approved	SCOT	uc003jmn.3	P55809	OTTHUMG00000094783	ENST00000196371.5:c.1551G>C	5.37:g.41731843C>G	ENSP00000196371:p.Gln517His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V2|B7Z528	Missense_Mutation	SNP	pfam_CoA_trans_fam_I,smart_CoA_trans_fam_I,pirsf_3-oxoacid_CoA-transferase,tigrfam_3-oxoacid_CoA-transf_B,tigrfam_3-oxoacid_CoA-transf_A	p.Q517H	ENST00000196371.5	37	c.1551	CCDS3937.1	5	.	.	.	.	.	.	.	.	.	.	C	15.99	2.995990	0.54147	.	.	ENSG00000083720	ENST00000196371;ENST00000512084;ENST00000510634;ENST00000509987	D;D;D;D	0.90620	-2.13;-2.7;-2.7;-2.3	5.66	3.57	0.40892	.	0.000000	0.85682	D	0.000000	D	0.94049	0.8093	M	0.91090	3.175	0.58432	D	0.999997	D	0.63880	0.993	P	0.51974	0.686	D	0.94842	0.8006	10	0.87932	D	0	-7.7385	12.4272	0.55553	0.0:0.835:0.0:0.165	.	517	P55809	SCOT1_HUMAN	H	517;120;120;331	ENSP00000196371:Q517H;ENSP00000421143:Q120H;ENSP00000423144:Q120H;ENSP00000425348:Q331H	ENSP00000196371:Q517H	Q	-	3	2	OXCT1	41767600	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	1.001000	0.29783	1.403000	0.46800	0.655000	0.94253	CAG	OXCT1	-	pirsf_3-oxoacid_CoA-transferase	ENSG00000083720		0.308	OXCT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXCT1	HGNC	protein_coding	OTTHUMT00000211594.2	91	0.00	0	C	NM_000436		41731843	41731843	-1	no_errors	ENST00000196371	ensembl	human	known	69_37n	missense	96	18.64	22	SNP	1.000	G
PACSIN3	29763	genome.wustl.edu	37	11	47201107	47201108	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:47201107_47201108CT>TG	ENST00000539589.1	-	7	975_976	c.633_634AG>CA	c.(631-636)gcAGag>gcCAag	p.E212K	ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|PACSIN3_ENST00000298838.6_Missense_Mutation_p.E212K|ARFGAP2_ENST00000319543.6_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	212	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CGATGCAGCTCTGCCAGCGTCT	0.574											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.633_634delinsTG	11.37:g.47201107_47201108delinsTG	ENSP00000440945:p.Glu212Lys	Somatic	945	WXS	Illumina GAIIx	Phase_IV	A6NH84|Q9H331|Q9NWV9	Missense_Mutation|Silent	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,prints_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.E212K|p.A211	ENST00000539589.1	37	c.634|c.633	CCDS31481.1	11																																																																																			PACSIN3	-	NULL	ENSG00000165912		0.574	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	48|47	0.00	0	C|T	NM_016223		47201107|47201108	47201107|47201108	-1	no_errors	ENST00000298838	ensembl	human	known	69_37n	missense|silent	12	33.33|29.41	6|5	SNP	1.000|0.505	T|G
PACSIN3	29763	genome.wustl.edu	37	11	47201107	47201108	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:47201107_47201108CT>TG	ENST00000539589.1	-	7	975_976	c.633_634AG>CA	c.(631-636)gcAGag>gcCAag	p.E212K	ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|PACSIN3_ENST00000298838.6_Missense_Mutation_p.E212K|ARFGAP2_ENST00000319543.6_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	212	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CGATGCAGCTCTGCCAGCGTCT	0.574											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.633_634delinsTG	11.37:g.47201107_47201108delinsTG	ENSP00000440945:p.Glu212Lys	Somatic	945	WXS	Illumina GAIIx	Phase_IV	A6NH84|Q9H331|Q9NWV9	Missense_Mutation|Silent	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,prints_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.E212K|p.A211	ENST00000539589.1	37	c.634|c.633	CCDS31481.1	11																																																																																			PACSIN3	-	NULL	ENSG00000165912		0.574	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	48|47	0.00	0	C|T	NM_016223		47201107|47201108	47201107|47201108	-1	no_errors	ENST00000298838	ensembl	human	known	69_37n	missense|silent	12|20	33.33|27.59	6|8	SNP	1.000|0.505	T|G
PACSIN3	29763	genome.wustl.edu	37	11	47201107	47201108	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:47201107_47201108CT>TG	ENST00000539589.1	-	7	975_976	c.633_634AG>CA	c.(631-636)gcAGag>gcCAag	p.E212K	ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|PACSIN3_ENST00000298838.6_Missense_Mutation_p.E212K|ARFGAP2_ENST00000319543.6_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	212	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CGATGCAGCTCTGCCAGCGTCT	0.574											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.633_634delinsTG	11.37:g.47201107_47201108delinsTG	ENSP00000440945:p.Glu212Lys	Somatic	945	WXS	Illumina GAIIx	Phase_IV	A6NH84|Q9H331|Q9NWV9	Missense_Mutation|Silent	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,prints_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.E212K|p.A211	ENST00000539589.1	37	c.634|c.633	CCDS31481.1	11																																																																																			PACSIN3	-	NULL	ENSG00000165912		0.574	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	48|47	0.00	0	C|T	NM_016223		47201107|47201108	47201107|47201108	-1	no_errors	ENST00000298838	ensembl	human	known	69_37n	missense|silent	21|12	30.00|29.41	9|5	SNP	1.000|0.505	T|G
PACSIN3	29763	genome.wustl.edu	37	11	47201107	47201108	+	Missense_Mutation	DNP	CT	CT	TG			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C|T	C|T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:47201107_47201108CT>TG	ENST00000539589.1	-	7	975_976	c.633_634AG>CA	c.(631-636)gcAGag>gcCAag	p.E212K	ARFGAP2_ENST00000419701.2_5'Flank|ARFGAP2_ENST00000524782.1_5'Flank|ARFGAP2_ENST00000426335.2_5'Flank|ARFGAP2_ENST00000395449.3_5'Flank|PACSIN3_ENST00000298838.6_Missense_Mutation_p.E212K|ARFGAP2_ENST00000319543.6_5'Flank	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	212	F-BAR domain. {ECO:0000250}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						CGATGCAGCTCTGCCAGCGTCT	0.574											OREG0020952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.633_634delinsTG	11.37:g.47201107_47201108delinsTG	ENSP00000440945:p.Glu212Lys	Somatic	945	WXS	Illumina GAIIx	Phase_IV	A6NH84|Q9H331|Q9NWV9	Missense_Mutation|Silent	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,prints_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.E212K|p.A211	ENST00000539589.1	37	c.634|c.633	CCDS31481.1	11																																																																																			PACSIN3	-	NULL	ENSG00000165912		0.574	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	48|47	0.00	0	C|T	NM_016223		47201107|47201108	47201107|47201108	-1	no_errors	ENST00000298838	ensembl	human	known	69_37n	missense|silent	21|20	30.00|27.59	9|8	SNP	1.000|0.505	T|G
PCDH19	57526	genome.wustl.edu	37	X	99662072	99662072	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:99662072G>C	ENST00000373034.4	-	1	3199	c.1524C>G	c.(1522-1524)atC>atG	p.I508M	PCDH19_ENST00000255531.7_Missense_Mutation_p.I508M|PCDH19_ENST00000420881.2_Missense_Mutation_p.I508M	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I9M(1)|p.I508M(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AGTTGGGATTGATGGAGACAT	0.597																																						dbGAP											2	Substitution - Missense(2)	breast(2)											98.0	98.0	98.0					X																	99662072		2162	4257	6419	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1524C>G	X.37:g.99662072G>C	ENSP00000362125:p.Ile508Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I508M	ENST00000373034.4	37	c.1524	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881200	0.33255	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.72615	-0.67;-0.67;-0.67	5.64	3.76	0.43208	Cadherin (4);Cadherin-like (1);	0.102167	0.64402	D	0.000003	T	0.81992	0.4940	M	0.82517	2.595	0.53688	D	0.999978	D;D;D	0.61697	0.99;0.973;0.979	D;P;P	0.65773	0.938;0.8;0.873	T	0.81295	-0.0997	10	0.72032	D	0.01	.	8.9411	0.35731	0.0824:0.0:0.7705:0.1471	.	508;508;508	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	M	508	ENSP00000400327:I508M;ENSP00000362125:I508M;ENSP00000255531:I508M	ENSP00000255531:I508M	I	-	3	3	PCDH19	99548728	1.000000	0.71417	0.998000	0.56505	0.824000	0.46624	1.722000	0.38042	0.455000	0.26910	0.513000	0.50165	ATC	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165194		0.597	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	90	0.00	0	G	NM_020766		99662072	99662072	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
PCDH19	57526	genome.wustl.edu	37	X	99662072	99662072	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:99662072G>C	ENST00000373034.4	-	1	3199	c.1524C>G	c.(1522-1524)atC>atG	p.I508M	PCDH19_ENST00000255531.7_Missense_Mutation_p.I508M|PCDH19_ENST00000420881.2_Missense_Mutation_p.I508M	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	508	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I9M(1)|p.I508M(1)		breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						AGTTGGGATTGATGGAGACAT	0.597																																						dbGAP											2	Substitution - Missense(2)	breast(2)											98.0	98.0	98.0					X																	99662072		2162	4257	6419	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.1524C>G	X.37:g.99662072G>C	ENSP00000362125:p.Ile508Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I508M	ENST00000373034.4	37	c.1524	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	12.25	1.881200	0.33255	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.72615	-0.67;-0.67;-0.67	5.64	3.76	0.43208	Cadherin (4);Cadherin-like (1);	0.102167	0.64402	D	0.000003	T	0.81992	0.4940	M	0.82517	2.595	0.53688	D	0.999978	D;D;D	0.61697	0.99;0.973;0.979	D;P;P	0.65773	0.938;0.8;0.873	T	0.81295	-0.0997	10	0.72032	D	0.01	.	8.9411	0.35731	0.0824:0.0:0.7705:0.1471	.	508;508;508	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	M	508	ENSP00000400327:I508M;ENSP00000362125:I508M;ENSP00000255531:I508M	ENSP00000255531:I508M	I	-	3	3	PCDH19	99548728	1.000000	0.71417	0.998000	0.56505	0.824000	0.46624	1.722000	0.38042	0.455000	0.26910	0.513000	0.50165	ATC	PCDH19	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165194		0.597	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	90	0.00	0	G	NM_020766		99662072	99662072	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	45	22.41	13	SNP	1.000	C
PEX11B	8799	genome.wustl.edu	37	1	145522859	145522859	+	Silent	SNP	C	C	T	rs184212399		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:145522859C>T	ENST00000369306.3	+	4	869	c.720C>T	c.(718-720)ctC>ctT	p.L240L	ITGA10_ENST00000539363.1_5'Flank|ITGA10_ENST00000369304.3_5'Flank|ITGA10_ENST00000538811.1_5'Flank|PEX11B_ENST00000537888.1_Silent_p.L226L	NM_003846.2	NP_003837.1	O96011	PX11B_HUMAN	peroxisomal biogenesis factor 11 beta	240	Interaction with PEX19 and peroxisome targeting.				peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|protein homooligomerization (GO:0051260)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)	p.L240L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTTGTGGCCTCGTGTCCTCCA	0.542																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											137.0	117.0	124.0					1																	145522859		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF093670	CCDS72870.1, CCDS72871.1	1q21	2008-08-26	2008-08-26		ENSG00000131779	ENSG00000131779			8853	protein-coding gene	gene with protein product		603867	"""peroxisomal biogenesis factor 11B"""			9792670	Standard	NM_003846		Approved		uc001eny.2	O96011	OTTHUMG00000013756	ENST00000369306.3:c.720C>T	1.37:g.145522859C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN85|B4DXH9|Q96ET2	Silent	SNP	pfam_PEX11	p.L240	ENST00000369306.3	37	c.720	CCDS917.1	1																																																																																			PEX11B	-	pfam_PEX11	ENSG00000131779		0.542	PEX11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11B	HGNC	protein_coding	OTTHUMT00000038549.1	74	0.00	0	C	NM_003846		145522859	145522859	+1	no_errors	ENST00000369306	ensembl	human	known	69_37n	silent	29	29.27	12	SNP	0.017	T
PEX11B	8799	genome.wustl.edu	37	1	145522859	145522859	+	Silent	SNP	C	C	T	rs184212399		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:145522859C>T	ENST00000369306.3	+	4	869	c.720C>T	c.(718-720)ctC>ctT	p.L240L	ITGA10_ENST00000539363.1_5'Flank|ITGA10_ENST00000369304.3_5'Flank|ITGA10_ENST00000538811.1_5'Flank|PEX11B_ENST00000537888.1_Silent_p.L226L	NM_003846.2	NP_003837.1	O96011	PX11B_HUMAN	peroxisomal biogenesis factor 11 beta	240	Interaction with PEX19 and peroxisome targeting.				peroxisome fission (GO:0016559)|peroxisome organization (GO:0007031)|protein homooligomerization (GO:0051260)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)	p.L240L(1)		breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					TTTGTGGCCTCGTGTCCTCCA	0.542																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											137.0	117.0	124.0					1																	145522859		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF093670	CCDS72870.1, CCDS72871.1	1q21	2008-08-26	2008-08-26		ENSG00000131779	ENSG00000131779			8853	protein-coding gene	gene with protein product		603867	"""peroxisomal biogenesis factor 11B"""			9792670	Standard	NM_003846		Approved		uc001eny.2	O96011	OTTHUMG00000013756	ENST00000369306.3:c.720C>T	1.37:g.145522859C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN85|B4DXH9|Q96ET2	Silent	SNP	pfam_PEX11	p.L240	ENST00000369306.3	37	c.720	CCDS917.1	1																																																																																			PEX11B	-	pfam_PEX11	ENSG00000131779		0.542	PEX11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11B	HGNC	protein_coding	OTTHUMT00000038549.1	74	0.00	0	C	NM_003846		145522859	145522859	+1	no_errors	ENST00000369306	ensembl	human	known	69_37n	silent	56	20.00	14	SNP	0.017	T
PHIP	55023	genome.wustl.edu	37	6	79672892	79672892	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:79672892C>T	ENST00000275034.4	-	30	3624	c.3457G>A	c.(3457-3459)Gat>Aat	p.D1153N	AL356776.1_ENST00000516160.2_RNA|PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1153					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.D1153N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CATTCTCCATCAAGAGGTTTA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											233.0	219.0	224.0					6																	79672892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3457G>A	6.37:g.79672892C>T	ENSP00000275034:p.Asp1153Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.D1153N	ENST00000275034.4	37	c.3457	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621385	0.66787	.	.	ENSG00000146247	ENST00000275034	T	0.18174	2.23	5.89	5.89	0.94794	Bromodomain (1);	0.000000	0.85682	D	0.000000	T	0.11665	0.0284	L	0.51422	1.61	0.58432	D	0.999992	P;P	0.48764	0.915;0.915	B;B	0.40165	0.321;0.321	T	0.03325	-1.1048	9	.	.	.	-22.4888	19.2409	0.93883	0.0:1.0:0.0:0.0	.	1153;1153	A7J992;Q8WWQ0	.;PHIP_HUMAN	N	1153	ENSP00000275034:D1153N	.	D	-	1	0	PHIP	79729611	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.747000	0.68689	2.788000	0.95919	0.557000	0.71058	GAT	PHIP	-	NULL	ENSG00000146247		0.408	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	160	0.00	0	C			79672892	79672892	-1	no_errors	ENST00000275034	ensembl	human	known	69_37n	missense	167	25.33	57	SNP	1.000	T
PHIP	55023	genome.wustl.edu	37	6	79672892	79672892	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:79672892C>T	ENST00000275034.4	-	30	3624	c.3457G>A	c.(3457-3459)Gat>Aat	p.D1153N	AL356776.1_ENST00000516160.2_RNA|PHIP_ENST00000479165.1_5'UTR	NM_017934.5	NP_060404	Q8WWQ0	PHIP_HUMAN	pleckstrin homology domain interacting protein	1153					cytoskeleton organization (GO:0007010)|insulin receptor signaling pathway (GO:0008286)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|positive regulation of insulin-like growth factor receptor signaling pathway (GO:0043568)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein import into nucleus (GO:0006606)|regulation of cell morphogenesis (GO:0022604)|regulation of growth (GO:0040008)|regulation of protein phosphorylation (GO:0001932)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	insulin receptor binding (GO:0005158)|lysine-acetylated histone binding (GO:0070577)	p.D1153N(1)		NS(1)|breast(1)|central_nervous_system(2)|endometrium(10)|kidney(4)|large_intestine(20)|lung(20)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	68		all_cancers(76;0.00125)|Acute lymphoblastic leukemia(125;1.1e-05)|all_hematologic(105;0.00117)|all_epithelial(107;0.219)		BRCA - Breast invasive adenocarcinoma(397;0.231)		CATTCTCCATCAAGAGGTTTA	0.408																																						dbGAP											1	Substitution - Missense(1)	breast(1)											233.0	219.0	224.0					6																	79672892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF310250	CCDS4987.1	6q14	2013-01-09			ENSG00000146247	ENSG00000146247		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	15673	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 14"""	612870		WDR11		11018022	Standard	NM_017934		Approved	ndrp, FLJ20705, DCAF14, BRWD2	uc003pir.3	Q8WWQ0	OTTHUMG00000015071	ENST00000275034.4:c.3457G>A	6.37:g.79672892C>T	ENSP00000275034:p.Asp1153Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7J992|B2RPK4|Q05CQ9|Q5VVH4|Q66I29|Q69YV1|Q8NBZ5|Q96H52|Q96ME2|Q9H261	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quinonprotein_ADH-like,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.D1153N	ENST00000275034.4	37	c.3457	CCDS4987.1	6	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621385	0.66787	.	.	ENSG00000146247	ENST00000275034	T	0.18174	2.23	5.89	5.89	0.94794	Bromodomain (1);	0.000000	0.85682	D	0.000000	T	0.11665	0.0284	L	0.51422	1.61	0.58432	D	0.999992	P;P	0.48764	0.915;0.915	B;B	0.40165	0.321;0.321	T	0.03325	-1.1048	9	.	.	.	-22.4888	19.2409	0.93883	0.0:1.0:0.0:0.0	.	1153;1153	A7J992;Q8WWQ0	.;PHIP_HUMAN	N	1153	ENSP00000275034:D1153N	.	D	-	1	0	PHIP	79729611	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.747000	0.68689	2.788000	0.95919	0.557000	0.71058	GAT	PHIP	-	NULL	ENSG00000146247		0.408	PHIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHIP	HGNC	protein_coding	OTTHUMT00000041297.2	160	0.00	0	C			79672892	79672892	-1	no_errors	ENST00000275034	ensembl	human	known	69_37n	missense	297	23.98	94	SNP	1.000	T
PHKA2	5256	genome.wustl.edu	37	X	18936866	18936866	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:18936866G>A	ENST00000379942.4	-	19	2735	c.2070C>T	c.(2068-2070)ttC>ttT	p.F690F		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	690					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.F690F(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GGATAGCACTGAAGACATGGC	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	100.0	106.0					X																	18936866		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2070C>T	X.37:g.18936866G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.F690	ENST00000379942.4	37	c.2070	CCDS14190.1	X																																																																																			PHKA2	-	pfam_Glyco_hydro_15	ENSG00000044446		0.433	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	89	0.00	0	G	NM_000292		18936866	18936866	-1	no_errors	ENST00000379942	ensembl	human	known	69_37n	silent	130	23.08	39	SNP	1.000	A
PHKA2	5256	genome.wustl.edu	37	X	18936866	18936866	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:18936866G>A	ENST00000379942.4	-	19	2735	c.2070C>T	c.(2068-2070)ttC>ttT	p.F690F		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	690					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.F690F(1)		NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GGATAGCACTGAAGACATGGC	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											118.0	100.0	106.0					X																	18936866		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.2070C>T	X.37:g.18936866G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.F690	ENST00000379942.4	37	c.2070	CCDS14190.1	X																																																																																			PHKA2	-	pfam_Glyco_hydro_15	ENSG00000044446		0.433	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	89	0.00	0	G	NM_000292		18936866	18936866	-1	no_errors	ENST00000379942	ensembl	human	known	69_37n	silent	80	23.81	25	SNP	1.000	A
PIEZO1	9780	genome.wustl.edu	37	16	88783032	88783032	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:88783032C>G	ENST00000301015.9	-	47	7107	c.6861G>C	c.(6859-6861)caG>caC	p.Q2287H	MIR4722_ENST00000578292.1_RNA|PIEZO1_ENST00000327397.7_Missense_Mutation_p.Q155H|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	2287					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						CCCGCTTCATCTGGGCACGGC	0.642																																						dbGAP											0													36.0	39.0	38.0					16																	88783032		692	1588	2280	-	-	-	SO:0001583	missense	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.6861G>C	16.37:g.88783032C>G	ENSP00000301015:p.Gln2287His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.Q155H	ENST00000301015.9	37	c.465	CCDS54058.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.54|11.54	1.669463|1.669463	0.29693|0.29693	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000451779|ENST00000301015;ENST00000327397	.|T;T	.|0.74106	.|-0.81;-0.81	4.67|4.67	2.68|2.68	0.31781|0.31781	.|.	.|0.064498	.|0.64402	.|D	.|0.000007	T|T	0.77824|0.77824	0.4188|0.4188	L|L	0.43152|0.43152	1.355|1.355	0.34545|0.34545	D|D	0.710667|0.710667	.|D;D;D	.|0.71674	.|0.99;0.998;0.998	.|P;D;D	.|0.71656	.|0.871;0.974;0.974	T|T	0.80665|0.80665	-0.1281|-0.1281	5|10	.|0.59425	.|D	.|0.04	-27.1475|-27.1475	8.2325|8.2325	0.31605|0.31605	0.1562:0.7589:0.0:0.0849|0.1562:0.7589:0.0:0.0849	.|.	.|2287;155;155	.|Q92508;E7EUT2;Q96HU3	.|PIEZ1_HUMAN;.;.	H|H	2233|2287;155	.|ENSP00000301015:Q2287H;ENSP00000333704:Q155H	.|ENSP00000301015:Q2287H	D|Q	-|-	1|3	0|2	FAM38A|FAM38A	87310533|87310533	1.000000|1.000000	0.71417|0.71417	0.733000|0.733000	0.30861|0.30861	0.054000|0.054000	0.15201|0.15201	1.728000|1.728000	0.38105|0.38105	0.382000|0.382000	0.24878|0.24878	-0.251000|-0.251000	0.11542|0.11542	GAT|CAG	PIEZO1	-	pfam_DUF3595	ENSG00000103335		0.642	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	40	0.00	0	C	NM_014745		88783032	88783032	-1	no_errors	ENST00000327397	ensembl	human	known	69_37n	missense	3	50.00	3	SNP	1.000	G
PIK3CD	5293	genome.wustl.edu	37	1	9781571	9781571	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:9781571C>T	ENST00000377346.4	+	15	2076	c.1881C>T	c.(1879-1881)tgC>tgT	p.C627C	PIK3CD_ENST00000536656.1_Silent_p.C651C|PIK3CD_ENST00000543390.1_Silent_p.C294C|PIK3CD_ENST00000361110.2_Silent_p.C651C	NM_005026.3	NP_005017.3	O00329	PK3CD_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit delta	627	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				adaptive immune response (GO:0002250)|B cell activation (GO:0042113)|B cell chemotaxis (GO:0035754)|B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|cytokine production (GO:0001816)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|mast cell chemotaxis (GO:0002551)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|natural killer cell activation (GO:0030101)|natural killer cell chemotaxis (GO:0035747)|natural killer cell differentiation (GO:0001779)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|neutrophil extravasation (GO:0072672)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein phosphorylation (GO:0006468)|respiratory burst involved in defense response (GO:0002679)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|T cell chemotaxis (GO:0010818)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	cytosol (GO:0005829)|mast cell granule (GO:0042629)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)			central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(12)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	31	all_lung(157;0.222)	all_lung(118;2.44e-05)|Lung NSC(185;4.08e-05)|Renal(390;0.000147)|Colorectal(325;0.00205)|Breast(348;0.00314)|Hepatocellular(190;0.00825)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0231)|Colorectal(212;7.52e-08)|COAD - Colon adenocarcinoma(227;1.78e-05)|Kidney(185;0.000322)|KIRC - Kidney renal clear cell carcinoma(229;0.00114)|BRCA - Breast invasive adenocarcinoma(304;0.0021)|STAD - Stomach adenocarcinoma(132;0.00395)|READ - Rectum adenocarcinoma(331;0.0419)	Caffeine(DB00201)	ACCTGGACTGCGAGCTGACCA	0.627											OREG0013082	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													60.0	60.0	60.0					1																	9781571		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS104.1	1p36.2	2014-09-17	2012-07-13		ENSG00000171608	ENSG00000171608	2.7.1.153		8977	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase, catalytic, delta polypeptide"", ""phosphoinositide-3-kinase C"""	602839	"""phosphoinositide-3-kinase, catalytic, delta polypeptide"""			9113989, 9455486	Standard	NM_005026		Approved	p110D	uc001aqb.4	O00329	OTTHUMG00000001450	ENST00000377346.4:c.1881C>T	1.37:g.9781571C>T		Somatic	659	WXS	Illumina GAIIx	Phase_IV	A6NCG0|G1FFP1|O15445|Q5SR49	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,pfam_PI3K_Ras-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.C651	ENST00000377346.4	37	c.1953	CCDS104.1	1																																																																																			PIK3CD	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000171608		0.627	PIK3CD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3CD	HGNC	protein_coding	OTTHUMT00000004235.1	73	0.00	0	C	NM_005026		9781571	9781571	+1	no_errors	ENST00000536656	ensembl	human	known	69_37n	silent	14	12.50	2	SNP	1.000	T
OOSP2	219990	genome.wustl.edu	37	11	59810970	59810970	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:59810970G>A	ENST00000278855.2	+	2	278	c.93G>A	c.(91-93)ttG>ttA	p.L31L	PLAC1L_ENST00000532905.1_De_novo_Start_InFrame	NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		31						extracellular region (GO:0005576)		p.L31L(1)		breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						TGGACTGGTTGATGGTCTCAG	0.398																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											125.0	123.0	124.0					11																	59810970		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000278855.2:c.93G>A	11.37:g.59810970G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJA4|Q8N9U6	Silent	SNP	NULL	p.L31	ENST00000278855.2	37	c.93	CCDS7979.1	11																																																																																			PLAC1L	-	NULL	ENSG00000149507		0.398	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1L	HGNC	protein_coding	OTTHUMT00000394411.1	184	0.00	0	G			59810970	59810970	+1	no_errors	ENST00000278855	ensembl	human	known	69_37n	silent	218	19.56	53	SNP	0.102	A
OOSP2	219990	genome.wustl.edu	37	11	59810970	59810970	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:59810970G>A	ENST00000278855.2	+	2	278	c.93G>A	c.(91-93)ttG>ttA	p.L31L	PLAC1L_ENST00000532905.1_De_novo_Start_InFrame	NM_173801.3	NP_776162.2	Q86WS3	OOSP2_HUMAN		31						extracellular region (GO:0005576)		p.L31L(1)		breast(1)|lung(9)|ovary(2)|prostate(2)|skin(1)	15						TGGACTGGTTGATGGTCTCAG	0.398																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											125.0	123.0	124.0					11																	59810970		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000278855.2:c.93G>A	11.37:g.59810970G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJA4|Q8N9U6	Silent	SNP	NULL	p.L31	ENST00000278855.2	37	c.93	CCDS7979.1	11																																																																																			PLAC1L	-	NULL	ENSG00000149507		0.398	PLAC1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLAC1L	HGNC	protein_coding	OTTHUMT00000394411.1	184	0.00	0	G			59810970	59810970	+1	no_errors	ENST00000278855	ensembl	human	known	69_37n	silent	342	20.28	87	SNP	0.102	A
POLH	5429	genome.wustl.edu	37	6	43550143	43550143	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:43550143G>C	ENST00000372236.4	+	2	382	c.87G>C	c.(85-87)ttG>ttC	p.L29F	POLH_ENST00000535400.1_Intron|POLH_ENST00000372226.1_Missense_Mutation_p.L29F	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.L29F(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			ATCCTCATTTGAGGAATAAAC	0.428								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																													dbGAP											1	Substitution - Missense(1)	breast(1)											238.0	220.0	226.0					6																	43550143		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.87G>C	6.37:g.43550143G>C	ENSP00000361310:p.Leu29Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,superfamily_DNA_pol_Y-fam_little_finger,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	p.L29F	ENST00000372236.4	37	c.87	CCDS4902.1	6	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609664	0.66558	.	.	ENSG00000170734	ENST00000372236;ENST00000372226	D;D	0.84070	-1.8;-1.8	5.7	1.95	0.26073	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.138776	0.49916	D	0.000125	D	0.86075	0.5846	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84749	0.0755	10	0.49607	T	0.09	-22.7296	9.2961	0.37815	0.2837:0.0:0.7163:0.0	.	29	Q9Y253	POLH_HUMAN	F	29	ENSP00000361310:L29F;ENSP00000361300:L29F	ENSP00000361300:L29F	L	+	3	2	POLH	43658121	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	2.679000	0.46909	0.141000	0.18875	-0.145000	0.13849	TTG	POLH	-	pfam_DNA_repair_prot_UmuC-like,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	ENSG00000170734		0.428	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLH	HGNC	protein_coding	OTTHUMT00000040666.1	189	0.00	0	G	NM_006502		43550143	43550143	+1	no_errors	ENST00000372236	ensembl	human	known	69_37n	missense	137	22.47	40	SNP	1.000	C
POLH	5429	genome.wustl.edu	37	6	43550143	43550143	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:43550143G>C	ENST00000372236.4	+	2	382	c.87G>C	c.(85-87)ttG>ttC	p.L29F	POLH_ENST00000535400.1_Intron|POLH_ENST00000372226.1_Missense_Mutation_p.L29F	NM_006502.2	NP_006493.1	O75417	DPOLQ_HUMAN	polymerase (DNA directed), eta	0					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)	p.L29F(1)		breast(4)|endometrium(5)|kidney(1)|large_intestine(6)|lung(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	21	all_cancers(18;1.89e-05)|Lung NSC(15;0.00161)|all_lung(25;0.004)		all cancers(41;0.000753)|Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|STAD - Stomach adenocarcinoma(11;0.0826)|OV - Ovarian serous cystadenocarcinoma(102;0.167)			ATCCTCATTTGAGGAATAAAC	0.428								DNA polymerases (catalytic subunits)	Xeroderma Pigmentosum																													dbGAP											1	Substitution - Missense(1)	breast(1)											238.0	220.0	226.0					6																	43550143		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV	AB024313	CCDS4902.1	6p21	2014-09-17			ENSG00000170734	ENSG00000170734			9181	protein-coding gene	gene with protein product		603968				10385124, 10398605	Standard	NM_006502		Approved	RAD30A, XP-V	uc003ovq.4	Q9Y253	OTTHUMG00000014743	ENST00000372236.4:c.87G>C	6.37:g.43550143G>C	ENSP00000361310:p.Leu29Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O95160|Q6VMB5	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,superfamily_DNA_pol_Y-fam_little_finger,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	p.L29F	ENST00000372236.4	37	c.87	CCDS4902.1	6	.	.	.	.	.	.	.	.	.	.	G	18.37	3.609664	0.66558	.	.	ENSG00000170734	ENST00000372236;ENST00000372226	D;D	0.84070	-1.8;-1.8	5.7	1.95	0.26073	DNA-repair protein, UmuC-like, N-terminal (1);DNA-repair protein, UmuC-like (1);	0.138776	0.49916	D	0.000125	D	0.86075	0.5846	M	0.81942	2.565	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.84749	0.0755	10	0.49607	T	0.09	-22.7296	9.2961	0.37815	0.2837:0.0:0.7163:0.0	.	29	Q9Y253	POLH_HUMAN	F	29	ENSP00000361310:L29F;ENSP00000361300:L29F	ENSP00000361300:L29F	L	+	3	2	POLH	43658121	1.000000	0.71417	0.998000	0.56505	0.875000	0.50365	2.679000	0.46909	0.141000	0.18875	-0.145000	0.13849	TTG	POLH	-	pfam_DNA_repair_prot_UmuC-like,pirsf_DNA_pol_eta,pfscan_DNA_repair_prot_UmuC-like_N	ENSG00000170734		0.428	POLH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLH	HGNC	protein_coding	OTTHUMT00000040666.1	189	0.00	0	G	NM_006502		43550143	43550143	+1	no_errors	ENST00000372236	ensembl	human	known	69_37n	missense	205	23.42	63	SNP	1.000	C
PPP1R14B	26472	genome.wustl.edu	37	11	64012756	64012756	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:64012756C>T	ENST00000309318.3	-	2	529	c.262G>A	c.(262-264)Gag>Aag	p.E88K	RP11-783K16.5_ENST00000538355.1_RNA|RP11-783K16.5_ENST00000544553.1_RNA|PPP1R14B_ENST00000542235.1_Missense_Mutation_p.E13K|PPP1R14B_ENST00000392210.2_5'UTR|RP11-783K16.13_ENST00000545800.1_lincRNA	NM_138689.2	NP_619634.1	Q96C90	PP14B_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 14B	88					regulation of phosphorylation (GO:0042325)	cytoplasm (GO:0005737)	protein phosphatase inhibitor activity (GO:0004864)			kidney(1)|lung(1)|pancreas(1)	3						GGGATCTCCTCTTCCTGGGGT	0.642																																						dbGAP											0													33.0	29.0	30.0					11																	64012756		2201	4297	6498	-	-	-	SO:0001583	missense	0			X91195	CCDS31596.1	11q13	2012-04-17		2001-07-06	ENSG00000173457	ENSG00000173457		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9057	protein-coding gene	gene with protein product		601140		PLCB3N		8838322, 10606530	Standard	NM_138689		Approved	SOM172, PNG, PHI-1	uc001nza.3	Q96C90	OTTHUMG00000167846	ENST00000309318.3:c.262G>A	11.37:g.64012756C>T	ENSP00000310117:p.Glu88Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504S7|Q7KZD7	Missense_Mutation	SNP	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	p.E88K	ENST00000309318.3	37	c.262	CCDS31596.1	11	.	.	.	.	.	.	.	.	.	.	c	17.32	3.359029	0.61403	.	.	ENSG00000173457	ENST00000309318;ENST00000542235	.	.	.	3.52	2.6	0.31112	.	0.130657	0.48767	D	0.000165	T	0.62183	0.2407	M	0.79926	2.475	0.48288	D	0.999628	P	0.52170	0.951	P	0.47118	0.538	T	0.66388	-0.5936	9	0.62326	D	0.03	-34.9002	9.8182	0.40865	0.0:0.8946:0.0:0.1054	.	88	Q96C90	PP14B_HUMAN	K	88;13	.	ENSP00000310117:E88K	E	-	1	0	PPP1R14B	63769332	1.000000	0.71417	0.999000	0.59377	0.974000	0.67602	6.385000	0.73182	0.831000	0.34780	0.450000	0.29827	GAG	PPP1R14B	-	pfam_PP1_inhibitor,superfamily_PP1_inhibitor	ENSG00000173457		0.642	PPP1R14B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R14B	HGNC	protein_coding	OTTHUMT00000396586.2	61	0.00	0	C	NM_138689		64012756	64012756	-1	no_errors	ENST00000309318	ensembl	human	known	69_37n	missense	18	10.00	2	SNP	1.000	T
PQBP1	10084	genome.wustl.edu	37	X	48759632	48759632	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:48759632G>A	ENST00000376563.1	+	5	615	c.415G>A	c.(415-417)Gac>Aac	p.D139N	PQBP1_ENST00000218224.4_Missense_Mutation_p.D139N|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000247140.4_Intron|PQBP1_ENST00000396763.1_Missense_Mutation_p.D139N|PQBP1_ENST00000376566.4_Intron|PQBP1_ENST00000447146.2_Missense_Mutation_p.D139N	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	139	3 X 2 AA tandem repeats of [DE]-R.|Intrinsically disordered.				alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)	p.D139N(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						CGACAAGTCTGACAGGGATCG	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	47.0	53.0					X																	48759632		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.415G>A	X.37:g.48759632G>A	ENSP00000365747:p.Asp139Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.D139N	ENST00000376563.1	37	c.415	CCDS14309.1	X	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008377	0.93346	.	.	ENSG00000102103	ENST00000376563;ENST00000447146;ENST00000218224;ENST00000396763;ENST00000443648	T;T;T;T;T	0.79141	-1.19;-1.19;-1.19;-1.19;-1.24	5.4	5.4	0.78164	.	0.186574	0.44688	D	0.000433	T	0.80742	0.4681	L	0.39898	1.24	0.80722	D	1	P;B;P;D;P	0.67145	0.873;0.23;0.734;0.996;0.941	P;B;B;D;P	0.63381	0.461;0.047;0.398;0.914;0.453	T	0.77699	-0.2490	10	0.27082	T	0.32	-22.5141	13.7387	0.62833	0.0:0.0:1.0:0.0	.	139;139;139;139;139	O60828-6;O60828-2;C9JQA1;O60828-3;O60828	.;.;.;.;PQBP1_HUMAN	N	139	ENSP00000365747:D139N;ENSP00000391759:D139N;ENSP00000218224:D139N;ENSP00000379985:D139N;ENSP00000414861:D139N	ENSP00000218224:D139N	D	+	1	0	PQBP1	48644576	1.000000	0.71417	0.874000	0.34290	0.913000	0.54294	4.848000	0.62874	2.401000	0.81631	0.600000	0.82982	GAC	PQBP1	-	NULL	ENSG00000102103		0.597	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	PQBP1	HGNC	protein_coding	OTTHUMT00000060777.1	132	0.00	0	G	NM_001032381.1		48759632	48759632	+1	no_errors	ENST00000218224	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.994	A
PQBP1	10084	genome.wustl.edu	37	X	48759632	48759632	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:48759632G>A	ENST00000376563.1	+	5	615	c.415G>A	c.(415-417)Gac>Aac	p.D139N	PQBP1_ENST00000218224.4_Missense_Mutation_p.D139N|PQBP1_ENST00000473764.1_3'UTR|PQBP1_ENST00000247140.4_Intron|PQBP1_ENST00000396763.1_Missense_Mutation_p.D139N|PQBP1_ENST00000376566.4_Intron|PQBP1_ENST00000447146.2_Missense_Mutation_p.D139N	NM_001032381.1|NM_001032382.1|NM_001032383.1|NM_001167989.1	NP_001027553.1|NP_001027554.1|NP_001027555.1|NP_001161461.1	O60828	PQBP1_HUMAN	polyglutamine binding protein 1	139	3 X 2 AA tandem repeats of [DE]-R.|Intrinsically disordered.				alternative mRNA splicing, via spliceosome (GO:0000380)|neuron projection development (GO:0031175)|regulation of dendrite morphogenesis (GO:0048814)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|neuronal ribonucleoprotein granule (GO:0071598)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ribonucleoprotein complex binding (GO:0043021)|transcription coactivator activity (GO:0003713)	p.D139N(1)		breast(1)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)	11						CGACAAGTCTGACAGGGATCG	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	47.0	53.0					X																	48759632		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ005893	CCDS14309.1, CCDS55412.1	Xp11.23	2014-01-31			ENSG00000102103	ENSG00000102103			9330	protein-coding gene	gene with protein product		300463	"""Sutherland-Haan X-linked mental retardation syndrome"", ""mental retardation, X-linked 55"", ""mental retardation, X-linked 2 (non-dysmorphic)"""	RENS1, MRXS8, SHS, MRX55, MRX2		9875212, 15024694, 14634649	Standard	NM_144495		Approved		uc004dlg.3	O60828	OTTHUMG00000024128	ENST00000376563.1:c.415G>A	X.37:g.48759632G>A	ENSP00000365747:p.Asp139Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VY25|Q4VY26|Q4VY27|Q4VY29|Q4VY30|Q4VY34|Q4VY35|Q4VY36|Q4VY37|Q4VY38|Q9GZP2|Q9GZU4|Q9GZZ4	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP	p.D139N	ENST00000376563.1	37	c.415	CCDS14309.1	X	.	.	.	.	.	.	.	.	.	.	G	29.5	5.008377	0.93346	.	.	ENSG00000102103	ENST00000376563;ENST00000447146;ENST00000218224;ENST00000396763;ENST00000443648	T;T;T;T;T	0.79141	-1.19;-1.19;-1.19;-1.19;-1.24	5.4	5.4	0.78164	.	0.186574	0.44688	D	0.000433	T	0.80742	0.4681	L	0.39898	1.24	0.80722	D	1	P;B;P;D;P	0.67145	0.873;0.23;0.734;0.996;0.941	P;B;B;D;P	0.63381	0.461;0.047;0.398;0.914;0.453	T	0.77699	-0.2490	10	0.27082	T	0.32	-22.5141	13.7387	0.62833	0.0:0.0:1.0:0.0	.	139;139;139;139;139	O60828-6;O60828-2;C9JQA1;O60828-3;O60828	.;.;.;.;PQBP1_HUMAN	N	139	ENSP00000365747:D139N;ENSP00000391759:D139N;ENSP00000218224:D139N;ENSP00000379985:D139N;ENSP00000414861:D139N	ENSP00000218224:D139N	D	+	1	0	PQBP1	48644576	1.000000	0.71417	0.874000	0.34290	0.913000	0.54294	4.848000	0.62874	2.401000	0.81631	0.600000	0.82982	GAC	PQBP1	-	NULL	ENSG00000102103		0.597	PQBP1-203	KNOWN	basic|appris_principal|CCDS	protein_coding	PQBP1	HGNC	protein_coding	OTTHUMT00000060777.1	132	0.00	0	G	NM_001032381.1		48759632	48759632	+1	no_errors	ENST00000218224	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.994	A
PRAMEF4	400735	genome.wustl.edu	37	1	12939611	12939611	+	Silent	SNP	C	C	T	rs536364380		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:12939611C>T	ENST00000235349.5	-	4	1261	c.1191G>A	c.(1189-1191)ctG>ctA	p.L397L		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	397					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGGTTCTCCAGGGTGGCCA	0.537													c|||	1	0.000199681	0.0	0.0	5008	,	,		19798	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													45.0	45.0	45.0					1																	12939611		1455	2579	4034	-	-	-	SO:0001819	synonymous_variant	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1191G>A	1.37:g.12939611C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Silent	SNP	NULL	p.L397	ENST00000235349.5	37	c.1191	CCDS30592.1	1																																																																																			PRAMEF4	-	NULL	ENSG00000243073		0.537	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	214	0.00	0	C	NM_001009611		12939611	12939611	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	silent	154	15.38	28	SNP	0.001	T
PRAMEF4	400735	genome.wustl.edu	37	1	12939611	12939611	+	Silent	SNP	C	C	T	rs536364380		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:12939611C>T	ENST00000235349.5	-	4	1261	c.1191G>A	c.(1189-1191)ctG>ctA	p.L397L		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	397					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCAGGTTCTCCAGGGTGGCCA	0.537													c|||	1	0.000199681	0.0	0.0	5008	,	,		19798	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													45.0	45.0	45.0					1																	12939611		1455	2579	4034	-	-	-	SO:0001819	synonymous_variant	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.1191G>A	1.37:g.12939611C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Silent	SNP	NULL	p.L397	ENST00000235349.5	37	c.1191	CCDS30592.1	1																																																																																			PRAMEF4	-	NULL	ENSG00000243073		0.537	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	214	0.00	0	C	NM_001009611		12939611	12939611	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	silent	93	14.68	16	SNP	0.001	T
PRAMEF4	400735	genome.wustl.edu	37	1	12943161	12943161	+	Missense_Mutation	SNP	G	G	T	rs201502377	byFrequency	TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:12943161G>T	ENST00000235349.5	-	2	125	c.55C>A	c.(55-57)Ctg>Atg	p.L19M		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	19					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L19M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCTTAGCAGGCTCCGCCCT	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	136.0	135.0					1																	12943161		2186	4284	6470	-	-	-	SO:0001583	missense	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.55C>A	1.37:g.12943161G>T	ENSP00000235349:p.Leu19Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Missense_Mutation	SNP	NULL	p.L19M	ENST00000235349.5	37	c.55	CCDS30592.1	1	.	.	.	.	.	.	.	.	.	.	g	11.60	1.686597	0.29962	.	.	ENSG00000243073	ENST00000235349	T	0.15372	2.43	1.48	1.48	0.22813	.	0.194416	0.34156	N	0.004206	T	0.45074	0.1324	M	0.94101	3.495	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.19745	-1.0296	10	0.87932	D	0	.	6.4564	0.21932	0.0:0.0:1.0:0.0	.	19	O60810	PRAM4_HUMAN	M	19	ENSP00000235349:L19M	ENSP00000235349:L19M	L	-	1	2	PRAMEF4	12865748	0.273000	0.24181	0.060000	0.19600	0.042000	0.13812	1.896000	0.39789	1.137000	0.42214	0.400000	0.26472	CTG	PRAMEF4	-	NULL	ENSG00000243073		0.562	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	130	0.00	0	G	NM_001009611		12943161	12943161	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	missense	14	53.33	16	SNP	0.074	T
PRAMEF4	400735	genome.wustl.edu	37	1	12943161	12943161	+	Missense_Mutation	SNP	G	G	T	rs201502377	byFrequency	TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:12943161G>T	ENST00000235349.5	-	2	125	c.55C>A	c.(55-57)Ctg>Atg	p.L19M		NM_001009611.2	NP_001009611.1	O60810	PRAM4_HUMAN	PRAME family member 4	19					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)			p.L19M(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(3)|skin(1)	24	Ovarian(185;0.249)	Lung NSC(185;3.67e-05)|all_lung(284;4.03e-05)|Renal(390;0.000147)|Breast(348;0.000278)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;4.88e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		TCCCTTAGCAGGCTCCGCCCT	0.562																																						dbGAP											1	Substitution - Missense(1)	breast(1)											132.0	136.0	135.0					1																	12943161		2186	4284	6470	-	-	-	SO:0001583	missense	0				CCDS30592.1	1p36.21	2013-01-17			ENSG00000243073	ENSG00000243073		"""-"""	31971	protein-coding gene	gene with protein product							Standard	NM_001009611		Approved	RP5-845O24.6	uc001aun.2	O60810	OTTHUMG00000001987	ENST00000235349.5:c.55C>A	1.37:g.12943161G>T	ENSP00000235349:p.Leu19Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5LJB5	Missense_Mutation	SNP	NULL	p.L19M	ENST00000235349.5	37	c.55	CCDS30592.1	1	.	.	.	.	.	.	.	.	.	.	g	11.60	1.686597	0.29962	.	.	ENSG00000243073	ENST00000235349	T	0.15372	2.43	1.48	1.48	0.22813	.	0.194416	0.34156	N	0.004206	T	0.45074	0.1324	M	0.94101	3.495	0.09310	N	1	D	0.89917	1.0	D	0.91635	0.999	T	0.19745	-1.0296	10	0.87932	D	0	.	6.4564	0.21932	0.0:0.0:1.0:0.0	.	19	O60810	PRAM4_HUMAN	M	19	ENSP00000235349:L19M	ENSP00000235349:L19M	L	-	1	2	PRAMEF4	12865748	0.273000	0.24181	0.060000	0.19600	0.042000	0.13812	1.896000	0.39789	1.137000	0.42214	0.400000	0.26472	CTG	PRAMEF4	-	NULL	ENSG00000243073		0.562	PRAMEF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF4	HGNC	protein_coding	OTTHUMT00000005518.1	130	0.00	0	G	NM_001009611		12943161	12943161	-1	no_errors	ENST00000235349	ensembl	human	known	69_37n	missense	26	49.02	25	SNP	0.074	T
PROK1	84432	genome.wustl.edu	37	1	110998922	110998922	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:110998922C>T	ENST00000271331.3	+	3	284	c.267C>T	c.(265-267)ttC>ttT	p.F89F	RP11-470L19.5_ENST00000481350.2_RNA	NM_032414.2	NP_115790.1	P58294	PROK1_HUMAN	prokineticin 1	89					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|regulation of angiogenesis (GO:0045765)	extracellular region (GO:0005576)		p.F89F(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTCCAGGTTCCCGGACGGCA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											109.0	99.0	102.0					1																	110998922		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF333024	CCDS825.1	1p21	2013-02-28			ENSG00000143125	ENSG00000143125		"""Endogenous ligands"""	18454	protein-coding gene	gene with protein product	"""black mamba toxin-related protein"", ""mambakine"""	606233				11259612	Standard	NM_032414		Approved	PK1, PRK1, EGVEGF	uc001dzs.3	P58294	OTTHUMG00000011569	ENST00000271331.3:c.267C>T	1.37:g.110998922C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWD4|Q8TC69	Silent	SNP	pfam_Prokineticin_domain	p.F89	ENST00000271331.3	37	c.267	CCDS825.1	1																																																																																			PROK1	-	pfam_Prokineticin_domain	ENSG00000143125		0.537	PROK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROK1	HGNC	protein_coding	OTTHUMT00000031969.1	58	0.00	0	C	NM_032414		110998922	110998922	+1	no_errors	ENST00000271331	ensembl	human	known	69_37n	silent	37	19.57	9	SNP	0.042	T
PROK1	84432	genome.wustl.edu	37	1	110998922	110998922	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:110998922C>T	ENST00000271331.3	+	3	284	c.267C>T	c.(265-267)ttC>ttT	p.F89F	RP11-470L19.5_ENST00000481350.2_RNA	NM_032414.2	NP_115790.1	P58294	PROK1_HUMAN	prokineticin 1	89					activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|regulation of angiogenesis (GO:0045765)	extracellular region (GO:0005576)		p.F89F(1)		breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)|stomach(1)	9		all_cancers(81;6.23e-06)|all_epithelial(167;2.12e-05)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0239)|all cancers(265;0.0699)|Epithelial(280;0.0753)|Colorectal(144;0.105)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCTCCAGGTTCCCGGACGGCA	0.537																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											109.0	99.0	102.0					1																	110998922		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF333024	CCDS825.1	1p21	2013-02-28			ENSG00000143125	ENSG00000143125		"""Endogenous ligands"""	18454	protein-coding gene	gene with protein product	"""black mamba toxin-related protein"", ""mambakine"""	606233				11259612	Standard	NM_032414		Approved	PK1, PRK1, EGVEGF	uc001dzs.3	P58294	OTTHUMG00000011569	ENST00000271331.3:c.267C>T	1.37:g.110998922C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWD4|Q8TC69	Silent	SNP	pfam_Prokineticin_domain	p.F89	ENST00000271331.3	37	c.267	CCDS825.1	1																																																																																			PROK1	-	pfam_Prokineticin_domain	ENSG00000143125		0.537	PROK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROK1	HGNC	protein_coding	OTTHUMT00000031969.1	58	0.00	0	C	NM_032414		110998922	110998922	+1	no_errors	ENST00000271331	ensembl	human	known	69_37n	silent	53	19.70	13	SNP	0.042	T
PROM1	8842	genome.wustl.edu	37	4	16010727	16010727	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:16010727G>C	ENST00000510224.1	-	12	1394	c.1146C>G	c.(1144-1146)atC>atG	p.I382M	RNU6-350P_ENST00000515949.1_RNA|PROM1_ENST00000539194.1_Missense_Mutation_p.I382M|PROM1_ENST00000540805.1_Missense_Mutation_p.I382M|PROM1_ENST00000505450.1_Missense_Mutation_p.I373M|PROM1_ENST00000508167.1_Missense_Mutation_p.I373M|PROM1_ENST00000447510.2_Missense_Mutation_p.I382M|PROM1_ENST00000543373.1_Missense_Mutation_p.I373M			O43490	PROM1_HUMAN	prominin 1	382					camera-type eye photoreceptor cell differentiation (GO:0060219)|glomerular parietal epithelial cell differentiation (GO:0072139)|glomerular visceral epithelial cell differentiation (GO:0072112)|photoreceptor cell maintenance (GO:0045494)|positive regulation of nephron tubule epithelial cell differentiation (GO:2000768)|retina layer formation (GO:0010842)|retina morphogenesis in camera-type eye (GO:0060042)	apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|photoreceptor outer segment membrane (GO:0042622)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|vesicle (GO:0031982)	actinin binding (GO:0042805)|cadherin binding (GO:0045296)	p.I381M(1)		breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(4)|liver(1)|lung(11)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(2)	35						AGACCCTTTTGATACCTGAAA	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											71.0	65.0	67.0					4																	16010727		1850	4088	5938	-	-	-	SO:0001583	missense	0			AF027208	CCDS47029.1, CCDS54746.1, CCDS54747.1, CCDS54748.1	4p15	2013-06-06	2001-11-28	2003-03-28	ENSG00000007062	ENSG00000007062		"""CD molecules"""	9454	protein-coding gene	gene with protein product		604365	"""prominin (mouse)-like 1"", ""macular dystrophy, retinal 2"", ""Stargardt disease 4 (autosomal dominant)"""	PROML1, MCDR2, STGD4		11467842	Standard	NM_006017		Approved	AC133, CD133, RP41, CORD12	uc003goo.2	O43490	OTTHUMG00000160180	ENST00000510224.1:c.1146C>G	4.37:g.16010727G>C	ENSP00000426809:p.Ile382Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6SV49|Q6SV50|Q6SV51|Q6SV52|Q6SV53|Q96EN6	Missense_Mutation	SNP	pfam_Prominin	p.I382M	ENST00000510224.1	37	c.1146	CCDS47029.1	4	.	.	.	.	.	.	.	.	.	.	G	8.543	0.873753	0.17322	.	.	ENSG00000007062	ENST00000447510;ENST00000540805;ENST00000539194;ENST00000505450;ENST00000508167;ENST00000510224;ENST00000543373	T;T;T;T;T;T;T	0.79940	-1.32;-1.32;-1.32;-1.32;-1.32;-1.32;-1.32	5.52	3.81	0.43845	.	0.669573	0.15220	N	0.273995	T	0.76807	0.4039	L	0.33485	1.01	0.26190	N	0.979597	P;P;P;P;D;B	0.59357	0.753;0.753;0.753;0.753;0.985;0.242	B;B;P;B;P;B	0.55303	0.406;0.406;0.511;0.406;0.773;0.326	T	0.64028	-0.6503	10	0.29301	T	0.29	-0.0146	5.2997	0.15772	0.1687:0.0:0.6692:0.162	.	373;382;373;382;373;382	O43490-5;O43490-6;O43490-4;O43490-7;O43490-2;O43490	.;.;.;.;.;PROM1_HUMAN	M	382;382;382;373;373;382;373	ENSP00000415481:I382M;ENSP00000438045:I382M;ENSP00000443620:I382M;ENSP00000426090:I373M;ENSP00000427346:I373M;ENSP00000426809:I382M;ENSP00000445526:I373M	ENSP00000415481:I382M	I	-	3	3	PROM1	15619825	1.000000	0.71417	0.606000	0.28943	0.057000	0.15508	2.371000	0.44248	0.705000	0.31890	0.655000	0.94253	ATC	PROM1	-	pfam_Prominin	ENSG00000007062		0.358	PROM1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PROM1	HGNC	protein_coding	OTTHUMT00000359595.2	113	0.00	0	G	NM_006017		16010727	16010727	-1	no_errors	ENST00000447510	ensembl	human	known	69_37n	missense	138	10.39	16	SNP	0.956	C
PRR21	643905	genome.wustl.edu	37	2	240982327	240982327	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:240982327G>C	ENST00000408934.1	-	1	72	c.73C>G	c.(73-75)Caa>Gaa	p.Q25E		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	25								p.Q25E(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						AAGAGCTGTTGAAGAAAAGTT	0.572																																						dbGAP											2	Substitution - Missense(2)	breast(2)											98.0	86.0	90.0					2																	240982327		2199	4299	6498	-	-	-	SO:0001583	missense	0			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.73C>G	2.37:g.240982327G>C	ENSP00000386166:p.Gln25Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q25E	ENST00000408934.1	37	c.73	CCDS33417.1	2	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.076379	0.00375	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.31247	1.5;1.5	0.656	0.656	0.17844	.	.	.	.	.	T	0.11024	0.0269	N	0.08118	0	0.09310	N	1	B	0.27823	0.19	B	0.19666	0.026	T	0.29822	-0.9999	9	0.02654	T	1	.	7.1959	0.25853	1.0E-4:0.0:0.9999:0.0	.	25	Q8WXC7	PRR21_HUMAN	E	25	ENSP00000386166:Q25E;ENSP00000418240:Q25E	ENSP00000386166:Q25E	Q	-	1	0	PRR21	240631000	0.053000	0.20554	0.001000	0.08648	0.001000	0.01503	0.710000	0.25748	0.654000	0.30846	0.494000	0.49563	CAA	PRR21	-	NULL	ENSG00000221961		0.572	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR21	HGNC	protein_coding		404	0.00	0	G	NM_001080835		240982327	240982327	-1	no_errors	ENST00000408934	ensembl	human	known	69_37n	missense	105	26.06	37	SNP	0.004	C
PRR21	643905	genome.wustl.edu	37	2	240982327	240982327	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:240982327G>C	ENST00000408934.1	-	1	72	c.73C>G	c.(73-75)Caa>Gaa	p.Q25E		NM_001080835.1	NP_001074304.1	Q8WXC7	PRR21_HUMAN	proline rich 21	25								p.Q25E(2)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(5)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)	29						AAGAGCTGTTGAAGAAAAGTT	0.572																																						dbGAP											2	Substitution - Missense(2)	breast(2)											98.0	86.0	90.0					2																	240982327		2199	4299	6498	-	-	-	SO:0001583	missense	0			AF453950	CCDS33417.1	2q37.3	2009-04-20			ENSG00000221961	ENSG00000221961			33866	protein-coding gene	gene with protein product							Standard	NM_001080835		Approved		uc010zod.2	Q8WXC7	OTTHUMG00000159174	ENST00000408934.1:c.73C>G	2.37:g.240982327G>C	ENSP00000386166:p.Gln25Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q25E	ENST00000408934.1	37	c.73	CCDS33417.1	2	.	.	.	.	.	.	.	.	.	.	g	0.006	-2.076379	0.00375	.	.	ENSG00000221961	ENST00000408934;ENST00000486799	T;T	0.31247	1.5;1.5	0.656	0.656	0.17844	.	.	.	.	.	T	0.11024	0.0269	N	0.08118	0	0.09310	N	1	B	0.27823	0.19	B	0.19666	0.026	T	0.29822	-0.9999	9	0.02654	T	1	.	7.1959	0.25853	1.0E-4:0.0:0.9999:0.0	.	25	Q8WXC7	PRR21_HUMAN	E	25	ENSP00000386166:Q25E;ENSP00000418240:Q25E	ENSP00000386166:Q25E	Q	-	1	0	PRR21	240631000	0.053000	0.20554	0.001000	0.08648	0.001000	0.01503	0.710000	0.25748	0.654000	0.30846	0.494000	0.49563	CAA	PRR21	-	NULL	ENSG00000221961		0.572	PRR21-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR21	HGNC	protein_coding		404	0.00	0	G	NM_001080835		240982327	240982327	-1	no_errors	ENST00000408934	ensembl	human	known	69_37n	missense	164	25.45	56	SNP	0.004	C
PSMB4	5692	genome.wustl.edu	37	1	151372187	151372187	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:151372187C>G	ENST00000290541.6	+	1	178	c.124C>G	c.(124-126)Cca>Gca	p.P42A		NM_002796.2	NP_002787.2	P28070	PSB4_HUMAN	proteasome (prosome, macropain) subunit, beta type, 4	42					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of inflammatory response to antigenic stimulus (GO:0002862)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	lipopolysaccharide binding (GO:0001530)|threonine-type endopeptidase activity (GO:0004298)			endometrium(1)|lung(9)|ovary(2)|prostate(1)|skin(1)	14	Lung SC(34;0.00471)|Ovarian(49;0.00871)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTACAGAGGTCCAATCACGCG	0.627																																						dbGAP											0													65.0	68.0	67.0					1																	151372187		2203	4300	6503	-	-	-	SO:0001583	missense	0			D26600	CCDS996.1	1q21	2008-02-05			ENSG00000159377	ENSG00000159377		"""Proteasome (prosome, macropain) subunits"""	9541	protein-coding gene	gene with protein product		602177				7918633	Standard	NM_002796		Approved	HN3, PROS26	uc001eyc.1	P28070	OTTHUMG00000012494	ENST00000290541.6:c.124C>G	1.37:g.151372187C>G	ENSP00000290541:p.Pro42Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9L3|P31148|Q5SZS5|Q6IBI4|Q969L6	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pirsf_Proteasome_endopept_cplx_B	p.P42A	ENST00000290541.6	37	c.124	CCDS996.1	1	.	.	.	.	.	.	.	.	.	.	C	11.90	1.777839	0.31502	.	.	ENSG00000159377	ENST00000290541	T	0.56275	0.47	5.21	4.29	0.51040	.	0.000000	0.85682	D	0.000000	T	0.17280	0.0415	N	0.08118	0	0.39952	D	0.97455	B;B	0.10296	0.003;0.002	B;B	0.11329	0.006;0.005	T	0.05305	-1.0893	10	0.48119	T	0.1	-12.3123	11.8303	0.52290	0.0:0.8234:0.1766:0.0	.	42;42	B4DFL3;P28070	.;PSB4_HUMAN	A	42	ENSP00000290541:P42A	ENSP00000290541:P42A	P	+	1	0	PSMB4	149638811	0.259000	0.24043	0.116000	0.21606	0.012000	0.07955	2.499000	0.45372	1.179000	0.42884	0.561000	0.74099	CCA	PSMB4	-	pirsf_Proteasome_endopept_cplx_B	ENSG00000159377		0.627	PSMB4-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	PSMB4	HGNC	protein_coding	OTTHUMT00000034885.1	58	0.00	0	C	NM_002796		151372187	151372187	+1	no_errors	ENST00000290541	ensembl	human	known	69_37n	missense	27	15.62	5	SNP	0.434	G
PSMC6	5706	genome.wustl.edu	37	14	53177881	53177881	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:53177881C>T	ENST00000606149.1	+	5	337	c.321C>T	c.(319-321)atC>atT	p.I107I	PSMC6_ENST00000445930.2_Silent_p.I121I	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	107					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)	p.I121I(1)|p.I107I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					CACTAACTATCATGAGGTGGG	0.333																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											100.0	95.0	97.0					14																	53177881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.321C>T	14.37:g.53177881C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.H107Y	ENST00000606149.1	37	c.319		14	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102975	0.20632	.	.	ENSG00000100519	ENST00000555339;ENST00000556813	.	.	.	4.99	3.05	0.35203	.	.	.	.	.	T	0.47507	0.1449	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38672	-0.9650	4	.	.	.	.	4.298	0.10911	0.3722:0.4808:0.0:0.1469	.	.	.	.	Y	68;107	.	.	H	+	1	0	PSMC6	52247631	0.573000	0.26676	1.000000	0.80357	0.997000	0.91878	-0.208000	0.09371	1.178000	0.42870	0.650000	0.86243	CAT	PSMC6	-	NULL	ENSG00000100519		0.333	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	173	0.00	0	C	NM_002806		53177881	53177881	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000556813	ensembl	human	novel	69_37n	missense	180	13.04	27	SNP	0.998	T
PSMC6	5706	genome.wustl.edu	37	14	53177881	53177881	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr14:53177881C>T	ENST00000606149.1	+	5	337	c.321C>T	c.(319-321)atC>atT	p.I107I	PSMC6_ENST00000445930.2_Silent_p.I121I	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	107					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)	p.I121I(1)|p.I107I(1)		breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					CACTAACTATCATGAGGTGGG	0.333																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											100.0	95.0	97.0					14																	53177881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.321C>T	14.37:g.53177881C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R975|P49719|Q6IBU3|Q92524	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_dyneun-rel_AAA,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.H107Y	ENST00000606149.1	37	c.319		14	.	.	.	.	.	.	.	.	.	.	C	9.500	1.102975	0.20632	.	.	ENSG00000100519	ENST00000555339;ENST00000556813	.	.	.	4.99	3.05	0.35203	.	.	.	.	.	T	0.47507	0.1449	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38672	-0.9650	4	.	.	.	.	4.298	0.10911	0.3722:0.4808:0.0:0.1469	.	.	.	.	Y	68;107	.	.	H	+	1	0	PSMC6	52247631	0.573000	0.26676	1.000000	0.80357	0.997000	0.91878	-0.208000	0.09371	1.178000	0.42870	0.650000	0.86243	CAT	PSMC6	-	NULL	ENSG00000100519		0.333	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	173	0.00	0	C	NM_002806		53177881	53177881	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000556813	ensembl	human	novel	69_37n	missense	305	11.34	39	SNP	0.998	T
PTEN	5728	genome.wustl.edu	37	10	89712018	89712018	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:89712018T>C	ENST00000371953.3	+	6	1991		c.e6+2		PTEN_ENST00000472832.1_Splice_Site	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(3)|p.Y27fs*1(2)|p.G165_*404del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAACTTGCAGTAAGTGCTTGA	0.343		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	48	Whole gene deletion(37)|Deletion - Frameshift(7)|Unknown(3)|Deletion - In frame(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)|kidney(1)	GRCh37	CS043793	PTEN	S							139.0	137.0	138.0					10																	89712018		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.634+2T>C	10.37:g.89712018T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Splice_Site	SNP	-	e6+2	ENST00000371953.3	37	c.634+2	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	T	20.2	3.944905	0.73672	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2416	0.82411	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTEN	89701998	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.611000	0.82962	2.241000	0.73720	0.477000	0.44152	.	PTEN	-	-	ENSG00000171862		0.343	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	79	0.00	0	T	NM_000314	Intron	89712018	89712018	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	splice_site	105	30.92	47	SNP	1.000	C
PTEN	5728	genome.wustl.edu	37	10	89712018	89712018	+	Splice_Site	SNP	T	T	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:89712018T>C	ENST00000371953.3	+	6	1991		c.e6+2		PTEN_ENST00000472832.1_Splice_Site	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog						activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(3)|p.Y27fs*1(2)|p.G165_*404del(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAACTTGCAGTAAGTGCTTGA	0.343		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	48	Whole gene deletion(37)|Deletion - Frameshift(7)|Unknown(3)|Deletion - In frame(1)	prostate(16)|central_nervous_system(10)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|breast(3)|ovary(3)|soft_tissue(1)|urinary_tract(1)|kidney(1)	GRCh37	CS043793	PTEN	S							139.0	137.0	138.0					10																	89712018		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.634+2T>C	10.37:g.89712018T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Splice_Site	SNP	-	e6+2	ENST00000371953.3	37	c.634+2	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	T	20.2	3.944905	0.73672	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.85	5.85	0.93711	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2416	0.82411	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	+	.	.	PTEN	89701998	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.611000	0.82962	2.241000	0.73720	0.477000	0.44152	.	PTEN	-	-	ENSG00000171862		0.343	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	79	0.00	0	T	NM_000314	Intron	89712018	89712018	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	splice_site	58	36.96	34	SNP	1.000	C
PTPRF	5792	genome.wustl.edu	37	1	44087660	44087660	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:44087660C>A	ENST00000359947.4	+	34	6050	c.5710C>A	c.(5710-5712)Cac>Aac	p.H1904N	PTPRF_ENST00000438120.1_Missense_Mutation_p.H1895N|PTPRF_ENST00000372413.3_Missense_Mutation_p.H1895N|PTPRF_ENST00000422171.2_Missense_Mutation_p.H1263N|PTPRF_ENST00000372414.3_Missense_Mutation_p.H1904N|PTPRF_ENST00000496447.1_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1904					cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H1894N(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAGCTTTGACCACTATGCAAC	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											180.0	139.0	153.0					1																	44087660		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.5710C>A	1.37:g.44087660C>A	ENSP00000353030:p.His1904Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.H1904N	ENST00000359947.4	37	c.5710	CCDS489.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.24|16.24	3.067931|3.067931	0.55539|0.55539	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000412568;ENST00000414879	T;T;T;T;T;T|.	0.55930|.	0.49;0.51;0.49;0.51;2.43;4.12|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.000000|.	0.36167|.	N|.	0.002755|.	T|T	0.58552|0.58552	0.2130|0.2130	L|L	0.28504|0.28504	0.86|0.86	0.80722|0.80722	D|D	1|1	B;B;B;D;D|.	0.71674|.	0.394;0.23;0.125;0.989;0.998|.	B;B;B;D;D|.	0.76071|.	0.321;0.119;0.253;0.979;0.987|.	T|T	0.52275|0.52275	-0.8597|-0.8597	10|5	0.36615|.	T|.	0.2|.	.|.	19.3582|19.3582	0.94424|0.94424	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1549;1263;1481;1895;1904|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	N|Q	1904;1895;1904;1895;1263;976|1287;1328	ENSP00000353030:H1904N;ENSP00000398822:H1895N;ENSP00000361491:H1904N;ENSP00000361490:H1895N;ENSP00000387885:H1263N;ENSP00000361484:H976N|.	ENSP00000353030:H1904N|.	H|P	+|+	1|2	0|0	PTPRF|PTPRF	43860247|43860247	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.999000|5.999000	0.70665|0.70665	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	CAC|CCA	PTPRF	-	NULL	ENSG00000142949		0.657	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	73	0.00	0	C			44087660	44087660	+1	no_errors	ENST00000359947	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	1.000	A
PTPRF	5792	genome.wustl.edu	37	1	44087660	44087660	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:44087660C>A	ENST00000359947.4	+	34	6050	c.5710C>A	c.(5710-5712)Cac>Aac	p.H1904N	PTPRF_ENST00000438120.1_Missense_Mutation_p.H1895N|PTPRF_ENST00000372413.3_Missense_Mutation_p.H1895N|PTPRF_ENST00000422171.2_Missense_Mutation_p.H1263N|PTPRF_ENST00000372414.3_Missense_Mutation_p.H1904N|PTPRF_ENST00000496447.1_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1904					cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.H1894N(1)		NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAGCTTTGACCACTATGCAAC	0.657																																						dbGAP											1	Substitution - Missense(1)	breast(1)											180.0	139.0	153.0					1																	44087660		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.5710C>A	1.37:g.44087660C>A	ENSP00000353030:p.His1904Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.H1904N	ENST00000359947.4	37	c.5710	CCDS489.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.24|16.24	3.067931|3.067931	0.55539|0.55539	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000422171;ENST00000372407|ENST00000412568;ENST00000414879	T;T;T;T;T;T|.	0.55930|.	0.49;0.51;0.49;0.51;2.43;4.12|.	5.07|5.07	5.07|5.07	0.68467|0.68467	.|.	0.000000|.	0.36167|.	N|.	0.002755|.	T|T	0.58552|0.58552	0.2130|0.2130	L|L	0.28504|0.28504	0.86|0.86	0.80722|0.80722	D|D	1|1	B;B;B;D;D|.	0.71674|.	0.394;0.23;0.125;0.989;0.998|.	B;B;B;D;D|.	0.76071|.	0.321;0.119;0.253;0.979;0.987|.	T|T	0.52275|0.52275	-0.8597|-0.8597	10|5	0.36615|.	T|.	0.2|.	.|.	19.3582|19.3582	0.94424|0.94424	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1549;1263;1481;1895;1904|.	Q59FI2;F2Z3B8;Q5W9G3;P10586-2;P10586|.	.;.;.;.;PTPRF_HUMAN|.	N|Q	1904;1895;1904;1895;1263;976|1287;1328	ENSP00000353030:H1904N;ENSP00000398822:H1895N;ENSP00000361491:H1904N;ENSP00000361490:H1895N;ENSP00000387885:H1263N;ENSP00000361484:H976N|.	ENSP00000353030:H1904N|.	H|P	+|+	1|2	0|0	PTPRF|PTPRF	43860247|43860247	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.999000|5.999000	0.70665|0.70665	2.735000|2.735000	0.93741|0.93741	0.655000|0.655000	0.94253|0.94253	CAC|CCA	PTPRF	-	NULL	ENSG00000142949		0.657	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	73	0.00	0	C			44087660	44087660	+1	no_errors	ENST00000359947	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	A
PTPRH	5794	genome.wustl.edu	37	19	55715306	55715306	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:55715306G>A	ENST00000376350.3	-	5	752	c.730C>T	c.(730-732)Cag>Tag	p.Q244*	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	244	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q244*(1)		breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CCAGTGCACTGAACGCAGTAG	0.567																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											185.0	152.0	163.0					19																	55715306		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.730C>T	19.37:g.55715306G>A	ENSP00000365528:p.Gln244*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.Q244*	ENST00000376350.3	37	c.730	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487031	0.84854	.	.	ENSG00000080031	ENST00000376350	.	.	.	3.75	0.0876	0.14451	.	0.371767	0.16143	N	0.227658	.	.	.	.	.	.	0.20196	N	0.999925	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	3.6812	0.08310	0.1262:0.0:0.43:0.4438	.	.	.	.	X	244	.	ENSP00000365528:Q244X	Q	-	1	0	PTPRH	60407118	0.001000	0.12720	0.315000	0.25238	0.175000	0.22909	0.269000	0.18589	0.243000	0.21327	0.511000	0.50034	CAG	PTPRH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080031		0.567	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	151	0.00	0	G			55715306	55715306	-1	no_errors	ENST00000376350	ensembl	human	known	69_37n	nonsense	103	19.53	25	SNP	0.177	A
PTPRH	5794	genome.wustl.edu	37	19	55715306	55715306	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:55715306G>A	ENST00000376350.3	-	5	752	c.730C>T	c.(730-732)Cag>Tag	p.Q244*	PTPRH_ENST00000263434.5_Intron|PTPRH_ENST00000588559.1_5'UTR	NM_002842.3	NP_002833.3	Q9HD43	PTPRH_HUMAN	protein tyrosine phosphatase, receptor type, H	244	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic process (GO:0006915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)	p.Q244*(1)		breast(2)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(8)|lung(27)|ovary(2)|prostate(5)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	67		Renal(1328;0.245)	BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.0479)		CCAGTGCACTGAACGCAGTAG	0.567																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											185.0	152.0	163.0					19																	55715306		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33110.1, CCDS54321.1	19q13.4	2013-02-11				ENSG00000080031		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9672	protein-coding gene	gene with protein product		602510				8294459	Standard	XM_006723312		Approved	SAP-1	uc002qjq.3	Q9HD43		ENST00000376350.3:c.730C>T	19.37:g.55715306G>A	ENSP00000365528:p.Gln244*	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCH2|Q15426|Q2NKN9|Q2NKP0	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.Q244*	ENST00000376350.3	37	c.730	CCDS33110.1	19	.	.	.	.	.	.	.	.	.	.	G	24.0	4.487031	0.84854	.	.	ENSG00000080031	ENST00000376350	.	.	.	3.75	0.0876	0.14451	.	0.371767	0.16143	N	0.227658	.	.	.	.	.	.	0.20196	N	0.999925	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	3.6812	0.08310	0.1262:0.0:0.43:0.4438	.	.	.	.	X	244	.	ENSP00000365528:Q244X	Q	-	1	0	PTPRH	60407118	0.001000	0.12720	0.315000	0.25238	0.175000	0.22909	0.269000	0.18589	0.243000	0.21327	0.511000	0.50034	CAG	PTPRH	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000080031		0.567	PTPRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRH	HGNC	protein_coding	OTTHUMT00000452649.1	151	0.00	0	G			55715306	55715306	-1	no_errors	ENST00000376350	ensembl	human	known	69_37n	nonsense	64	20.00	16	SNP	0.177	A
PUF60	22827	genome.wustl.edu	37	8	144900366	144900366	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:144900366G>A	ENST00000526683.1	-	7	1155	c.600C>T	c.(598-600)atC>atT	p.I200I	PUF60_ENST00000456095.2_Silent_p.I171I|SCRIB_ENST00000320476.3_5'Flank|PUF60_ENST00000527197.1_Silent_p.I154I|PUF60_ENST00000349157.6_Silent_p.I183I|PUF60_ENST00000524570.1_5'UTR|PUF60_ENST00000453551.2_Silent_p.I157I|SCRIB_ENST00000356994.2_5'Flank|PUF60_ENST00000313352.7_Silent_p.I140I	NM_001271098.1|NM_078480.2	NP_001258027.1|NP_510965.1	Q9UHX1	PUF60_HUMAN	poly-U binding splicing factor 60KDa	200	Inhibits homodimerization.|Inhibits transcriptional repression, interaction with ERCC3 and apoptosis induction.|RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(1)|kidney(3)|lung(7)|prostate(2)	14	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;6.82e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GCCTCACCTTGATGTTCCTGC	0.632																																						dbGAP											0													39.0	39.0	39.0					8																	144900366		2136	4237	6373	-	-	-	SO:0001819	synonymous_variant	0			AF114818	CCDS47933.1, CCDS47934.1, CCDS47935.1, CCDS59514.1, CCDS59515.1, CCDS59516.1	8q24.3	2013-02-12	2007-07-27		ENSG00000179950	ENSG00000179950		"""RNA binding motif (RRM) containing"""	17042	protein-coding gene	gene with protein product	"""siah binding protein 1"", ""FBP interacting repressor"", ""pyrimidine tract binding splicing factor"", ""Ro ribonucleoprotein binding protein 1"""	604819				10668799, 10882074, 17579712	Standard	NM_078480		Approved	FIR, SIAHBP1, RoBPI	uc003yzs.4	Q9UHX1	OTTHUMG00000165155	ENST00000526683.1:c.600C>T	8.37:g.144900366G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8K8|Q969E7|Q96D94|Q96H63|Q99628|Q9NZA0|Q9UJY7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S65L	ENST00000526683.1	37	c.194	CCDS47934.1	8	.	.	.	.	.	.	.	.	.	.	G	8.206	0.799158	0.16397	.	.	ENSG00000179950	ENST00000532884;ENST00000527744	.	.	.	5.03	1.76	0.24704	.	.	.	.	.	T	0.46034	0.1372	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.28235	-1.0050	4	.	.	.	.	3.8359	0.08894	0.3243:0.0:0.4132:0.2626	.	.	.	.	L	65;198	.	.	S	-	2	0	PUF60	144972354	0.994000	0.37717	1.000000	0.80357	0.909000	0.53808	0.264000	0.18497	0.532000	0.28657	0.655000	0.94253	TCA	PUF60	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000179950		0.632	PUF60-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PUF60	HGNC	protein_coding	OTTHUMT00000382222.1	38	0.00	0	G	NM_014281		144900366	144900366	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000532884	ensembl	human	putative	69_37n	missense	14	12.50	2	SNP	0.992	A
RASAL3	64926	genome.wustl.edu	37	19	15575074	15575074	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:15575074C>A	ENST00000343625.7	-	2	181	c.96G>T	c.(94-96)gaG>gaT	p.E32D		NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	32					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)	p.E32D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						CAGCCGCCTTCTCCCCACCGC	0.701																																						dbGAP											1	Substitution - Missense(1)	breast(1)											23.0	28.0	26.0					19																	15575074		1933	4144	6077	-	-	-	SO:0001583	missense	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.96G>T	19.37:g.15575074C>A	ENSP00000341905:p.Glu32Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2T9|Q9H735	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGAP,pfscan_RasGAP	p.E32D	ENST00000343625.7	37	c.96	CCDS46006.1	19	.	.	.	.	.	.	.	.	.	.	C	8.538	0.872579	0.17322	.	.	ENSG00000105122	ENST00000343625	T	0.22539	1.95	4.17	0.724	0.18236	.	0.000000	0.32503	U	0.006012	T	0.13372	0.0324	L	0.38531	1.155	0.27365	N	0.955847	B	0.14012	0.009	B	0.10450	0.005	T	0.15549	-1.0433	10	0.87932	D	0	.	4.0132	0.09632	0.0:0.5801:0.1985:0.2214	.	32	Q86YV0	RASL3_HUMAN	D	32	ENSP00000341905:E32D	ENSP00000341905:E32D	E	-	3	2	RASAL3	15436074	0.996000	0.38824	0.589000	0.28718	0.066000	0.16364	0.418000	0.21230	0.451000	0.26802	0.462000	0.41574	GAG	RASAL3	-	NULL	ENSG00000105122		0.701	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3	80	0.00	0	C	NM_022904		15575074	15575074	-1	no_errors	ENST00000343625	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	0.912	A
RASAL3	64926	genome.wustl.edu	37	19	15575074	15575074	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:15575074C>A	ENST00000343625.7	-	2	181	c.96G>T	c.(94-96)gaG>gaT	p.E32D		NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	32					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)	p.E32D(1)		breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						CAGCCGCCTTCTCCCCACCGC	0.701																																						dbGAP											1	Substitution - Missense(1)	breast(1)											23.0	28.0	26.0					19																	15575074		1933	4144	6077	-	-	-	SO:0001583	missense	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.96G>T	19.37:g.15575074C>A	ENSP00000341905:p.Glu32Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2T9|Q9H735	Missense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGAP,pfscan_RasGAP	p.E32D	ENST00000343625.7	37	c.96	CCDS46006.1	19	.	.	.	.	.	.	.	.	.	.	C	8.538	0.872579	0.17322	.	.	ENSG00000105122	ENST00000343625	T	0.22539	1.95	4.17	0.724	0.18236	.	0.000000	0.32503	U	0.006012	T	0.13372	0.0324	L	0.38531	1.155	0.27365	N	0.955847	B	0.14012	0.009	B	0.10450	0.005	T	0.15549	-1.0433	10	0.87932	D	0	.	4.0132	0.09632	0.0:0.5801:0.1985:0.2214	.	32	Q86YV0	RASL3_HUMAN	D	32	ENSP00000341905:E32D	ENSP00000341905:E32D	E	-	3	2	RASAL3	15436074	0.996000	0.38824	0.589000	0.28718	0.066000	0.16364	0.418000	0.21230	0.451000	0.26802	0.462000	0.41574	GAG	RASAL3	-	NULL	ENSG00000105122		0.701	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3	80	0.00	0	C	NM_022904		15575074	15575074	-1	no_errors	ENST00000343625	ensembl	human	known	69_37n	missense	23	30.30	10	SNP	0.912	A
RGS20	8601	genome.wustl.edu	37	8	54852243	54852243	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:54852243C>T	ENST00000297313.3	+	3	710	c.618C>T	c.(616-618)aaC>aaT	p.N206N	RGS20_ENST00000522225.1_Intron|RGS20_ENST00000344277.6_Silent_p.N91N|RGS20_ENST00000276500.4_Silent_p.N59N	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	206					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.N206N(1)		breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			GCGGGTCCAACGCAtgctgct	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											34.0	40.0	38.0					8																	54852243		2182	4250	6432	-	-	-	SO:0001819	synonymous_variant	0			AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.618C>T	8.37:g.54852243C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BG9	Silent	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,prints_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.N206	ENST00000297313.3	37	c.618	CCDS6155.1	8																																																																																			RGS20	-	NULL	ENSG00000147509		0.622	RGS20-001	KNOWN	basic|CCDS	protein_coding	RGS20	HGNC	protein_coding	OTTHUMT00000380058.1	128	0.00	0	C			54852243	54852243	+1	no_errors	ENST00000297313	ensembl	human	known	69_37n	silent	17	33.33	9	SNP	0.272	T
RGS20	8601	genome.wustl.edu	37	8	54852243	54852243	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:54852243C>T	ENST00000297313.3	+	3	710	c.618C>T	c.(616-618)aaC>aaT	p.N206N	RGS20_ENST00000522225.1_Intron|RGS20_ENST00000344277.6_Silent_p.N91N|RGS20_ENST00000276500.4_Silent_p.N59N	NM_170587.2	NP_733466.1	O76081	RGS20_HUMAN	regulator of G-protein signaling 20	206					positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.N206N(1)		breast(2)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(7;1.37e-06)|Epithelial(17;0.000126)|all cancers(17;0.0009)			GCGGGTCCAACGCAtgctgct	0.622																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											34.0	40.0	38.0					8																	54852243		2182	4250	6432	-	-	-	SO:0001819	synonymous_variant	0			AF074979	CCDS6155.1, CCDS6156.1, CCDS69482.1	8q11.23	2008-07-25	2007-08-14		ENSG00000147509	ENSG00000147509		"""Regulators of G-protein signaling"""	14600	protein-coding gene	gene with protein product		607193	"""regulator of G-protein signalling 20"""			9748279, 9748280	Standard	NM_003702		Approved	RGSZ1, ZGAP1	uc003xrp.3	O76081	OTTHUMG00000164750	ENST00000297313.3:c.618C>T	8.37:g.54852243C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96BG9	Silent	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,prints_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal	p.N206	ENST00000297313.3	37	c.618	CCDS6155.1	8																																																																																			RGS20	-	NULL	ENSG00000147509		0.622	RGS20-001	KNOWN	basic|CCDS	protein_coding	RGS20	HGNC	protein_coding	OTTHUMT00000380058.1	128	0.00	0	C			54852243	54852243	+1	no_errors	ENST00000297313	ensembl	human	known	69_37n	silent	33	26.09	12	SNP	0.272	T
RGS4	5999	genome.wustl.edu	37	1	163043290	163043290	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:163043290G>A	ENST00000367909.6	+	4	596	c.256G>A	c.(256-258)Gag>Aag	p.E86K	RGS4_ENST00000531057.1_Missense_Mutation_p.E86K|RGS4_ENST00000421743.2_Missense_Mutation_p.E183K|RGS4_ENST00000527809.1_Missense_Mutation_p.E68K|RGS4_ENST00000367908.4_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367906.3_Missense_Mutation_p.E68K	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	86	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.E183K(1)|p.E86K(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TGAATATAGTGAGGAGAATAT	0.403																																					Ovarian(76;1257 1738 3039 6086)	dbGAP											2	Substitution - Missense(2)	breast(2)											127.0	120.0	122.0					1																	163043290		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.256G>A	1.37:g.163043290G>A	ENSP00000356885:p.Glu86Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.E183K	ENST00000367909.6	37	c.547	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.408230	0.96051	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000527809;ENST00000367906;ENST00000528938	T;T;T;T;T;T	0.03065	4.3;4.3;4.06;4.3;4.3;4.3	4.79	4.79	0.61399	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.115944	0.56097	D	0.000023	T	0.21718	0.0523	H	0.96015	3.755	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.83275	0.961;0.996	T	0.25502	-1.0130	10	0.87932	D	0	.	15.377	0.74615	0.0:0.0:1.0:0.0	.	86;183	P49798;A7XA59	RGS4_HUMAN;.	K	183;86;86;68;68;68	ENSP00000397181:E183K;ENSP00000356885:E86K;ENSP00000436106:E86K;ENSP00000433261:E68K;ENSP00000356882:E68K;ENSP00000432194:E68K	ENSP00000356882:E68K	E	+	1	0	RGS4	161309914	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.229000	0.65316	2.469000	0.83416	0.650000	0.86243	GAG	RGS4	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000117152		0.403	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	111	0.00	0	G	NM_005613		163043290	163043290	+1	no_errors	ENST00000421743	ensembl	human	known	69_37n	missense	167	12.11	23	SNP	1.000	A
RGS4	5999	genome.wustl.edu	37	1	163043290	163043290	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:163043290G>A	ENST00000367909.6	+	4	596	c.256G>A	c.(256-258)Gag>Aag	p.E86K	RGS4_ENST00000531057.1_Missense_Mutation_p.E86K|RGS4_ENST00000421743.2_Missense_Mutation_p.E183K|RGS4_ENST00000527809.1_Missense_Mutation_p.E68K|RGS4_ENST00000367908.4_Intron|RGS4_ENST00000491263.1_3'UTR|RGS4_ENST00000367906.3_Missense_Mutation_p.E68K	NM_001113380.1|NM_005613.5	NP_001106851.1|NP_005604.1	P49798	RGS4_HUMAN	regulator of G-protein signaling 4	86	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				inactivation of MAPK activity (GO:0000188)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)	p.E183K(1)|p.E86K(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|upper_aerodigestive_tract(2)	21						TGAATATAGTGAGGAGAATAT	0.403																																					Ovarian(76;1257 1738 3039 6086)	dbGAP											2	Substitution - Missense(2)	breast(2)											127.0	120.0	122.0					1																	163043290		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051869	CCDS1243.1, CCDS44270.1, CCDS44271.1, CCDS44272.1	1q23.3	2008-05-14	2007-08-14		ENSG00000117152	ENSG00000117152		"""Regulators of G-protein signaling"""	10000	protein-coding gene	gene with protein product		602516	"""regulator of G-protein signalling 4"", ""schizophrenia disorder 9"""	SCZD9		8602223, 8756726	Standard	NM_001102445		Approved		uc001gcl.4	P49798	OTTHUMG00000034417	ENST00000367909.6:c.256G>A	1.37:g.163043290G>A	ENSP00000356885:p.Glu86Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7XA56|A7XA58|A7XA59|A7YVV7|B1APZ3	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.E183K	ENST00000367909.6	37	c.547	CCDS1243.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.408230	0.96051	.	.	ENSG00000117152	ENST00000421743;ENST00000367909;ENST00000531057;ENST00000527809;ENST00000367906;ENST00000528938	T;T;T;T;T;T	0.03065	4.3;4.3;4.06;4.3;4.3;4.3	4.79	4.79	0.61399	Regulator of G protein signalling (4);Regulator of G protein signalling superfamily (1);Regulator of G-protein signaling, domain 1 (1);	0.115944	0.56097	D	0.000023	T	0.21718	0.0523	H	0.96015	3.755	0.58432	D	0.999999	D;D	0.89917	0.999;1.0	D;D	0.83275	0.961;0.996	T	0.25502	-1.0130	10	0.87932	D	0	.	15.377	0.74615	0.0:0.0:1.0:0.0	.	86;183	P49798;A7XA59	RGS4_HUMAN;.	K	183;86;86;68;68;68	ENSP00000397181:E183K;ENSP00000356885:E86K;ENSP00000436106:E86K;ENSP00000433261:E68K;ENSP00000356882:E68K;ENSP00000432194:E68K	ENSP00000356882:E68K	E	+	1	0	RGS4	161309914	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.229000	0.65316	2.469000	0.83416	0.650000	0.86243	GAG	RGS4	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000117152		0.403	RGS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS4	HGNC	protein_coding	OTTHUMT00000083197.2	111	0.00	0	G	NM_005613		163043290	163043290	+1	no_errors	ENST00000421743	ensembl	human	known	69_37n	missense	262	12.67	38	SNP	1.000	A
RIPK1	8737	genome.wustl.edu	37	6	3085612	3085612	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:3085612G>T	ENST00000259808.4	+	6	1106	c.808G>T	c.(808-810)Gcg>Tcg	p.A270S	RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.A270S|RIPK1_ENST00000541791.1_Missense_Mutation_p.A224S			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.A270S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CTGCTGGGAAGCGAATCCGGA	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	89.0	91.0					6																	3085612		2203	4300	6503	-	-	-	SO:0001583	missense	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.808G>T	6.37:g.3085612G>T	ENSP00000259808:p.Ala270Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Death,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A270S	ENST00000259808.4	37	c.808	CCDS4482.1	6	.	.	.	.	.	.	.	.	.	.	G	4.002	-0.002398	0.07819	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409	T;T;T	0.62105	0.05;0.05;0.05	5.66	2.91	0.33838	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.976137	0.08504	N	0.935935	T	0.20210	0.0486	N	0.17278	0.47	0.09310	N	1	B;B	0.32573	0.228;0.376	B;B	0.33960	0.083;0.173	T	0.25882	-1.0119	10	0.09338	T	0.73	-0.2557	8.2879	0.31939	0.1932:0.1643:0.6425:0.0	.	224;270	Q13546-2;Q13546	.;RIPK1_HUMAN	S	270;224;270	ENSP00000259808:A270S;ENSP00000442294:A224S;ENSP00000369773:A270S	ENSP00000259808:A270S	A	+	1	0	RIPK1	3030611	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.285000	0.18883	0.417000	0.25871	-0.136000	0.14681	GCG	RIPK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000137275		0.453	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	67	0.00	0	G	NM_003804		3085612	3085612	+1	no_errors	ENST00000259808	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	0.000	T
RIPK1	8737	genome.wustl.edu	37	6	3085612	3085612	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:3085612G>T	ENST00000259808.4	+	6	1106	c.808G>T	c.(808-810)Gcg>Tcg	p.A270S	RIPK1_ENST00000479389.1_3'UTR|RIPK1_ENST00000380409.2_Missense_Mutation_p.A270S|RIPK1_ENST00000541791.1_Missense_Mutation_p.A224S			Q13546	RIPK1_HUMAN	receptor (TNFRSF)-interacting serine-threonine kinase 1	270	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of JUN kinase activity (GO:0007257)|amyloid fibril formation (GO:1990000)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein catabolic process (GO:0044257)|cellular response to growth factor stimulus (GO:0071363)|cellular response to tumor necrosis factor (GO:0071356)|extrinsic apoptotic signaling pathway (GO:0097191)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|necroptotic process (GO:0070266)|necroptotic signaling pathway (GO:0097527)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of necroptotic process (GO:0060545)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of programmed cell death (GO:0043068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I interferon production (GO:0032481)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|regulation of ATP:ADP antiporter activity (GO:0070926)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|response to tumor necrosis factor (GO:0034612)|ripoptosome assembly (GO:0097343)|ripoptosome assembly involved in necroptotic process (GO:1901026)|T cell apoptotic process (GO:0070231)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|receptor complex (GO:0043235)|ripoptosome (GO:0097342)	ATP binding (GO:0005524)|death domain binding (GO:0070513)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|protein complex binding (GO:0032403)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)	p.A270S(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				CTGCTGGGAAGCGAATCCGGA	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	89.0	91.0					6																	3085612		2203	4300	6503	-	-	-	SO:0001583	missense	0			U25994	CCDS4482.1	6p25.2	2008-02-05			ENSG00000137275	ENSG00000137275			10019	protein-coding gene	gene with protein product		603453				7538908, 8612133	Standard	XM_005249458		Approved	RIP	uc003mux.3	Q13546	OTTHUMG00000014134	ENST00000259808.4:c.808G>T	6.37:g.3085612G>T	ENSP00000259808:p.Ala270Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV89|B2RAG1|B4E3F9|Q13180|Q59H33	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Death,superfamily_Kinase-like_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Death,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A270S	ENST00000259808.4	37	c.808	CCDS4482.1	6	.	.	.	.	.	.	.	.	.	.	G	4.002	-0.002398	0.07819	.	.	ENSG00000137275	ENST00000259808;ENST00000541791;ENST00000380409	T;T;T	0.62105	0.05;0.05;0.05	5.66	2.91	0.33838	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.976137	0.08504	N	0.935935	T	0.20210	0.0486	N	0.17278	0.47	0.09310	N	1	B;B	0.32573	0.228;0.376	B;B	0.33960	0.083;0.173	T	0.25882	-1.0119	10	0.09338	T	0.73	-0.2557	8.2879	0.31939	0.1932:0.1643:0.6425:0.0	.	224;270	Q13546-2;Q13546	.;RIPK1_HUMAN	S	270;224;270	ENSP00000259808:A270S;ENSP00000442294:A224S;ENSP00000369773:A270S	ENSP00000259808:A270S	A	+	1	0	RIPK1	3030611	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	0.285000	0.18883	0.417000	0.25871	-0.136000	0.14681	GCG	RIPK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	ENSG00000137275		0.453	RIPK1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	RIPK1	HGNC	protein_coding	OTTHUMT00000039659.2	67	0.00	0	G	NM_003804		3085612	3085612	+1	no_errors	ENST00000259808	ensembl	human	known	69_37n	missense	48	28.36	19	SNP	0.000	T
RLF	6018	genome.wustl.edu	37	1	40705986	40705986	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:40705986G>A	ENST00000372771.4	+	8	5639	c.5612G>A	c.(5611-5613)tGt>tAt	p.C1871Y		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1871					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C1871Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTAACAGACTGTGGAGAGCTT	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	109.0	108.0					1																	40705986		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.5612G>A	1.37:g.40705986G>A	ENSP00000361857:p.Cys1871Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1871Y	ENST00000372771.4	37	c.5612	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930943	0.52866	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.19532	2.14	5.35	5.35	0.76521	.	0.046439	0.85682	D	0.000000	T	0.42810	0.1219	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.956	T	0.14980	-1.0453	10	0.87932	D	0	-11.3676	19.6142	0.95626	0.0:0.0:1.0:0.0	.	1564;1871	F5H2M5;Q13129	.;RLF_HUMAN	Y	1871;1564	ENSP00000361857:C1871Y	ENSP00000361857:C1871Y	C	+	2	0	RLF	40478573	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.137000	0.94496	2.941000	0.99782	0.655000	0.94253	TGT	RLF	-	NULL	ENSG00000117000		0.403	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	116	0.00	0	G	NM_012421		40705986	40705986	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	missense	157	22.28	45	SNP	1.000	A
RLF	6018	genome.wustl.edu	37	1	40705986	40705986	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:40705986G>A	ENST00000372771.4	+	8	5639	c.5612G>A	c.(5611-5613)tGt>tAt	p.C1871Y		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1871					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.C1871Y(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTAACAGACTGTGGAGAGCTT	0.403																																						dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	109.0	108.0					1																	40705986		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.5612G>A	1.37:g.40705986G>A	ENSP00000361857:p.Cys1871Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1871Y	ENST00000372771.4	37	c.5612	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	G	15.77	2.930943	0.52866	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.19532	2.14	5.35	5.35	0.76521	.	0.046439	0.85682	D	0.000000	T	0.42810	0.1219	L	0.46157	1.445	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.956	T	0.14980	-1.0453	10	0.87932	D	0	-11.3676	19.6142	0.95626	0.0:0.0:1.0:0.0	.	1564;1871	F5H2M5;Q13129	.;RLF_HUMAN	Y	1871;1564	ENSP00000361857:C1871Y	ENSP00000361857:C1871Y	C	+	2	0	RLF	40478573	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.137000	0.94496	2.941000	0.99782	0.655000	0.94253	TGT	RLF	-	NULL	ENSG00000117000		0.403	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	116	0.00	0	G	NM_012421		40705986	40705986	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	missense	98	20.33	25	SNP	1.000	A
RPTN	126638	genome.wustl.edu	37	1	152129019	152129019	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:152129019C>G	ENST00000316073.3	-	3	620	c.556G>C	c.(556-558)Gag>Cag	p.E186Q		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	186	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.E186Q(1)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TCTTGTCTCTCAGACTGATTG	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											442.0	378.0	397.0					1																	152129019		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.556G>C	1.37:g.152129019C>G	ENSP00000317895:p.Glu186Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E186Q	ENST00000316073.3	37	c.556	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619888	0.66787	.	.	ENSG00000215853	ENST00000316073	T	0.14893	2.47	5.17	4.22	0.49857	.	0.817187	0.09901	U	0.741073	T	0.12178	0.0296	L	0.61387	1.9	0.19575	N	0.999966	D	0.57257	0.979	P	0.52554	0.702	T	0.14531	-1.0469	10	0.16896	T	0.51	-0.0474	8.3676	0.32395	0.0:0.8819:0.0:0.118	.	186	Q6XPR3	RPTN_HUMAN	Q	186	ENSP00000317895:E186Q	ENSP00000317895:E186Q	E	-	1	0	RPTN	150395643	0.000000	0.05858	0.241000	0.24154	0.309000	0.27889	-0.035000	0.12205	1.086000	0.41228	0.542000	0.68232	GAG	RPTN	-	NULL	ENSG00000215853		0.468	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	313	0.00	0	C	XM_371312		152129019	152129019	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	257	16.56	51	SNP	0.714	G
RPTN	126638	genome.wustl.edu	37	1	152129019	152129019	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:152129019C>G	ENST00000316073.3	-	3	620	c.556G>C	c.(556-558)Gag>Cag	p.E186Q		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	186	Gln-rich.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)	p.E186Q(1)		breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						TCTTGTCTCTCAGACTGATTG	0.468																																						dbGAP											1	Substitution - Missense(1)	breast(1)											442.0	378.0	397.0					1																	152129019		1568	3582	5150	-	-	-	SO:0001583	missense	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.556G>C	1.37:g.152129019C>G	ENSP00000317895:p.Glu186Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBZ3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E186Q	ENST00000316073.3	37	c.556	CCDS41397.1	1	.	.	.	.	.	.	.	.	.	.	C	18.42	3.619888	0.66787	.	.	ENSG00000215853	ENST00000316073	T	0.14893	2.47	5.17	4.22	0.49857	.	0.817187	0.09901	U	0.741073	T	0.12178	0.0296	L	0.61387	1.9	0.19575	N	0.999966	D	0.57257	0.979	P	0.52554	0.702	T	0.14531	-1.0469	10	0.16896	T	0.51	-0.0474	8.3676	0.32395	0.0:0.8819:0.0:0.118	.	186	Q6XPR3	RPTN_HUMAN	Q	186	ENSP00000317895:E186Q	ENSP00000317895:E186Q	E	-	1	0	RPTN	150395643	0.000000	0.05858	0.241000	0.24154	0.309000	0.27889	-0.035000	0.12205	1.086000	0.41228	0.542000	0.68232	GAG	RPTN	-	NULL	ENSG00000215853		0.468	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	313	0.00	0	C	XM_371312		152129019	152129019	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	missense	392	19.01	92	SNP	0.714	G
RTP4	64108	genome.wustl.edu	37	3	187088789	187088789	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:187088789G>A	ENST00000259030.2	+	2	479	c.369G>A	c.(367-369)ctG>ctA	p.L123L		NM_022147.2	NP_071430.2	Q96DX8	RTP4_HUMAN	receptor (chemosensory) transporter protein 4	123					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.L123L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	all_cancers(143;4.66e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		AGCATATACTGAAGAAATACT	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	57.0	57.0					3																	187088789		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC013161	CCDS33910.1	3q27.3	2014-02-20	2006-11-21		ENSG00000136514	ENSG00000136514		"""Receptor transporter proteins"""	23992	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 4"""	609350	"""receptor transporter protein 4"""			16271481, 15550249, 16720576	Standard	NM_022147		Approved	IFRG28, Z3CXXC4	uc003frm.3	Q96DX8	OTTHUMG00000156459	ENST00000259030.2:c.369G>A	3.37:g.187088789G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4F3	Silent	SNP	NULL	p.L123	ENST00000259030.2	37	c.369	CCDS33910.1	3																																																																																			RTP4	-	NULL	ENSG00000136514		0.498	RTP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP4	HGNC	protein_coding	OTTHUMT00000344260.1	80	0.00	0	G	NM_022147		187088789	187088789	+1	no_errors	ENST00000259030	ensembl	human	known	69_37n	silent	27	30.77	12	SNP	0.012	A
RTP4	64108	genome.wustl.edu	37	3	187088789	187088789	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:187088789G>A	ENST00000259030.2	+	2	479	c.369G>A	c.(367-369)ctG>ctA	p.L123L		NM_022147.2	NP_071430.2	Q96DX8	RTP4_HUMAN	receptor (chemosensory) transporter protein 4	123					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|protein targeting to membrane (GO:0006612)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.L123L(1)		breast(1)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	11	all_cancers(143;4.66e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;5.56e-18)	GBM - Glioblastoma multiforme(93;0.0269)		AGCATATACTGAAGAAATACT	0.498																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											57.0	57.0	57.0					3																	187088789		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC013161	CCDS33910.1	3q27.3	2014-02-20	2006-11-21		ENSG00000136514	ENSG00000136514		"""Receptor transporter proteins"""	23992	protein-coding gene	gene with protein product	"""zinc finger, 3CxxC-type 4"""	609350	"""receptor transporter protein 4"""			16271481, 15550249, 16720576	Standard	NM_022147		Approved	IFRG28, Z3CXXC4	uc003frm.3	Q96DX8	OTTHUMG00000156459	ENST00000259030.2:c.369G>A	3.37:g.187088789G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4F3	Silent	SNP	NULL	p.L123	ENST00000259030.2	37	c.369	CCDS33910.1	3																																																																																			RTP4	-	NULL	ENSG00000136514		0.498	RTP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RTP4	HGNC	protein_coding	OTTHUMT00000344260.1	80	0.00	0	G	NM_022147		187088789	187088789	+1	no_errors	ENST00000259030	ensembl	human	known	69_37n	silent	47	31.88	22	SNP	0.012	A
RUNX1	861	genome.wustl.edu	37	21	36252856	36252857	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr21:36252856_36252857insT	ENST00000344691.4	-	2	2001_2002	c.424_425insA	c.(424-426)agafs	p.R142fs	RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.R169fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.R169fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.R142fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.R157fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.R142fs|RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.R145fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	142	Interaction with DNA.|Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R169fs*44(1)|p.R169fs*11(1)|p.R169fs*10(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						TAACGTACCTCTTCCACTTCGA	0.421			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	3	Insertion - Frameshift(3)	haematopoietic_and_lymphoid_tissue(2)|breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.425dupA	21.37:g.36252858_36252858dupT	ENSP00000340690:p.Arg142fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.R169fs	ENST00000344691.4	37	c.506_505	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.421	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	87	0.00	0	-			36252856	36252857	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	101	18.55	23	INS	1.000:0.998	T
RUNX1	861	genome.wustl.edu	37	21	36252856	36252857	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr21:36252856_36252857insT	ENST00000344691.4	-	2	2001_2002	c.424_425insA	c.(424-426)agafs	p.R142fs	RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.R169fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.R169fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.R142fs|RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.R157fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.R142fs|RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.R145fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	142	Interaction with DNA.|Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.R169fs*44(1)|p.R169fs*11(1)|p.R169fs*10(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						TAACGTACCTCTTCCACTTCGA	0.421			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	3	Insertion - Frameshift(3)	haematopoietic_and_lymphoid_tissue(2)|breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.425dupA	21.37:g.36252858_36252858dupT	ENSP00000340690:p.Arg142fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.R169fs	ENST00000344691.4	37	c.506_505	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.421	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	87	0.00	0	-			36252856	36252857	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	55	19.12	13	INS	1.000:0.998	T
SCARB1	949	genome.wustl.edu	37	12	125292447	125292447	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:125292447G>T	ENST00000415380.2	-	7	994	c.869C>A	c.(868-870)tCa>tAa	p.S290*	SCARB1_ENST00000261693.6_Nonsense_Mutation_p.S290*|SCARB1_ENST00000339570.5_Nonsense_Mutation_p.S290*|SCARB1_ENST00000540495.1_Nonsense_Mutation_p.S253*|SCARB1_ENST00000546215.1_Nonsense_Mutation_p.S290*|SCARB1_ENST00000544327.1_Nonsense_Mutation_p.S236*|SCARB1_ENST00000376788.1_Nonsense_Mutation_p.S190*|SCARB1_ENST00000535005.1_5'UTR|SCARB1_ENST00000541205.1_Nonsense_Mutation_p.S249*			Q8WTV0	SCRB1_HUMAN	scavenger receptor class B, member 1	290					adhesion of symbiont to host (GO:0044406)|androgen biosynthetic process (GO:0006702)|blood vessel endothelial cell migration (GO:0043534)|cell adhesion (GO:0007155)|cholesterol catabolic process (GO:0006707)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol import (GO:0070508)|detection of lipopolysaccharide (GO:0032497)|endothelial cell proliferation (GO:0001935)|high-density lipoprotein particle clearance (GO:0034384)|high-density lipoprotein particle remodeling (GO:0034375)|lipopolysaccharide transport (GO:0015920)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|lipoprotein metabolic process (GO:0042157)|low-density lipoprotein particle clearance (GO:0034383)|phospholipid transport (GO:0015914)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of triglyceride biosynthetic process (GO:0010867)|receptor-mediated endocytosis (GO:0006898)|recognition of apoptotic cell (GO:0043654)|regulation of phagocytosis (GO:0050764)|regulation of phosphatidylcholine catabolic process (GO:0010899)|reverse cholesterol transport (GO:0043691)|small molecule metabolic process (GO:0044281)|triglyceride homeostasis (GO:0070328)|viral process (GO:0016032)|wound healing (GO:0042060)	caveola (GO:0005901)|cell surface (GO:0009986)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)	1-phosphatidylinositol binding (GO:0005545)|apolipoprotein A-I binding (GO:0034186)|apolipoprotein binding (GO:0034185)|high-density lipoprotein particle binding (GO:0008035)|high-density lipoprotein particle receptor activity (GO:0070506)|lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|low-density lipoprotein particle binding (GO:0030169)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|prostate(1)	17	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000116)|Epithelial(86;0.000415)|all cancers(50;0.00395)	Phosphatidylserine(DB00144)	AAACACCCCTGACTCCTTGTA	0.607																																						dbGAP											0													105.0	90.0	95.0					12																	125292447		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			Z22555	CCDS9259.1, CCDS45008.1	12q24.32	2008-08-05	2002-09-06	2002-09-06	ENSG00000073060	ENSG00000073060			1664	protein-coding gene	gene with protein product		601040	"""CD36 antigen (collagen type I receptor, thrombospondin receptor)-like 1"""	CD36L1		7689561	Standard	NM_001082959		Approved	SRB1, CLA-1, CLA1, SR-BI	uc001ugm.4	Q8WTV0	OTTHUMG00000168544	ENST00000415380.2:c.869C>A	12.37:g.125292447G>T	ENSP00000414979:p.Ser290*	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W8N0|Q14016|Q52LZ5|Q6KFX4	Nonsense_Mutation	SNP	pfam_CD36,prints_CD36,prints_CD36_antigen	p.S290*	ENST00000415380.2	37	c.869		12	.	.	.	.	.	.	.	.	.	.	G	35	5.592489	0.96590	.	.	ENSG00000073060	ENST00000339570;ENST00000415380;ENST00000261693;ENST00000376788;ENST00000546215;ENST00000541205;ENST00000544327;ENST00000540495	.	.	.	5.33	2.38	0.29361	.	1.227250	0.05370	N	0.535210	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	-0.0671	14.0152	0.64519	0.0:0.0:0.4519:0.5481	.	.	.	.	X	290;290;290;190;290;249;236;253	.	ENSP00000261693:S290X	S	-	2	0	SCARB1	123858400	0.110000	0.22057	0.000000	0.03702	0.888000	0.51559	2.684000	0.46951	0.193000	0.20303	0.491000	0.48974	TCA	SCARB1	-	pfam_CD36	ENSG00000073060		0.607	SCARB1-006	KNOWN	basic	protein_coding	SCARB1	HGNC	protein_coding	OTTHUMT00000400165.1	45	0.00	0	G	NM_005505		125292447	125292447	-1	no_errors	ENST00000415380	ensembl	human	known	69_37n	nonsense	17	15.00	3	SNP	0.002	T
SCN11A	11280	genome.wustl.edu	37	3	38968358	38968358	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:38968358G>C	ENST00000302328.3	-	4	751	c.553C>G	c.(553-555)Ctg>Gtg	p.L185V	SCN11A_ENST00000456224.3_Missense_Mutation_p.L185V|SCN11A_ENST00000450244.1_Missense_Mutation_p.L185V|SCN11A_ENST00000444237.2_Missense_Mutation_p.L185V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	185					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L185V(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACTCATCCAGAATGAAACCT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	103.0	101.0					3																	38968358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.553C>G	3.37:g.38968358G>C	ENSP00000307599:p.Leu185Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.L185V	ENST00000302328.3	37	c.553	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	9.319	1.057608	0.19907	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.96885	-4.16;-4.16;-4.11;-4.01	5.64	4.74	0.60224	Ion transport (1);	0.418793	0.25285	N	0.031777	D	0.93226	0.7842	L	0.49350	1.555	0.23304	N	0.997944	B	0.24258	0.1	B	0.30029	0.11	D	0.83418	0.0031	10	0.19590	T	0.45	.	7.6825	0.28522	0.0874:0.1743:0.7383:0.0	.	185	Q9UI33	SCNBA_HUMAN	V	185	ENSP00000307599:L185V;ENSP00000400945:L185V;ENSP00000416757:L185V;ENSP00000408028:L185V	ENSP00000307599:L185V	L	-	1	2	SCN11A	38943362	0.204000	0.23447	0.944000	0.38274	0.967000	0.64934	0.072000	0.14617	1.340000	0.45581	0.563000	0.77884	CTG	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.353	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	111	0.00	0	G	NM_014139		38968358	38968358	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	123	20.13	31	SNP	0.575	C
SCN11A	11280	genome.wustl.edu	37	3	38968358	38968358	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:38968358G>C	ENST00000302328.3	-	4	751	c.553C>G	c.(553-555)Ctg>Gtg	p.L185V	SCN11A_ENST00000456224.3_Missense_Mutation_p.L185V|SCN11A_ENST00000450244.1_Missense_Mutation_p.L185V|SCN11A_ENST00000444237.2_Missense_Mutation_p.L185V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	185					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.L185V(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AACTCATCCAGAATGAAACCT	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	103.0	101.0					3																	38968358		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.553C>G	3.37:g.38968358G>C	ENSP00000307599:p.Leu185Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.L185V	ENST00000302328.3	37	c.553	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	9.319	1.057608	0.19907	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.96885	-4.16;-4.16;-4.11;-4.01	5.64	4.74	0.60224	Ion transport (1);	0.418793	0.25285	N	0.031777	D	0.93226	0.7842	L	0.49350	1.555	0.23304	N	0.997944	B	0.24258	0.1	B	0.30029	0.11	D	0.83418	0.0031	10	0.19590	T	0.45	.	7.6825	0.28522	0.0874:0.1743:0.7383:0.0	.	185	Q9UI33	SCNBA_HUMAN	V	185	ENSP00000307599:L185V;ENSP00000400945:L185V;ENSP00000416757:L185V;ENSP00000408028:L185V	ENSP00000307599:L185V	L	-	1	2	SCN11A	38943362	0.204000	0.23447	0.944000	0.38274	0.967000	0.64934	0.072000	0.14617	1.340000	0.45581	0.563000	0.77884	CTG	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.353	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	111	0.00	0	G	NM_014139		38968358	38968358	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	200	19.68	49	SNP	0.575	C
SCN4A	6329	genome.wustl.edu	37	17	62041972	62041972	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:62041972G>C	ENST00000435607.1	-	9	1384	c.1308C>G	c.(1306-1308)ttC>ttG	p.F436L	SCN4A_ENST00000578147.1_Missense_Mutation_p.F436L	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	436					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.F436L(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGATGAGGTAGAAAGAGCCCA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	79.0	79.0					17																	62041972		2015	4200	6215	-	-	-	SO:0001583	missense	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.1308C>G	17.37:g.62041972G>C	ENSP00000396320:p.Phe436Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.F436L	ENST00000435607.1	37	c.1308	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	g	21.1	4.093682	0.76870	.	.	ENSG00000007314	ENST00000435607	D	0.98649	-5.05	4.9	3.93	0.45458	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99345	0.9770	H	0.96111	3.77	0.47819	D	0.999523	D	0.89917	1.0	D	0.97110	1.0	D	0.98779	1.0731	10	0.87932	D	0	.	12.2699	0.54700	0.0816:0.0:0.9184:0.0	.	436	P35499	SCN4A_HUMAN	L	436	ENSP00000396320:F436L	ENSP00000396320:F436L	F	-	3	2	SCN4A	59395704	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.142000	0.50601	1.285000	0.44548	0.457000	0.33378	TTC	SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.567	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		148	0.00	0	G	NM_000334		62041972	62041972	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	C
SCN4A	6329	genome.wustl.edu	37	17	62041972	62041972	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:62041972G>C	ENST00000435607.1	-	9	1384	c.1308C>G	c.(1306-1308)ttC>ttG	p.F436L	SCN4A_ENST00000578147.1_Missense_Mutation_p.F436L	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	436					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.F436L(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TGATGAGGTAGAAAGAGCCCA	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											80.0	79.0	79.0					17																	62041972		2015	4200	6215	-	-	-	SO:0001583	missense	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.1308C>G	17.37:g.62041972G>C	ENSP00000396320:p.Phe436Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.F436L	ENST00000435607.1	37	c.1308	CCDS45761.1	17	.	.	.	.	.	.	.	.	.	.	g	21.1	4.093682	0.76870	.	.	ENSG00000007314	ENST00000435607	D	0.98649	-5.05	4.9	3.93	0.45458	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.99345	0.9770	H	0.96111	3.77	0.47819	D	0.999523	D	0.89917	1.0	D	0.97110	1.0	D	0.98779	1.0731	10	0.87932	D	0	.	12.2699	0.54700	0.0816:0.0:0.9184:0.0	.	436	P35499	SCN4A_HUMAN	L	436	ENSP00000396320:F436L	ENSP00000396320:F436L	F	-	3	2	SCN4A	59395704	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	3.142000	0.50601	1.285000	0.44548	0.457000	0.33378	TTC	SCN4A	-	pfam_Ion_trans_dom	ENSG00000007314		0.567	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		148	0.00	0	G	NM_000334		62041972	62041972	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	missense	64	25.58	22	SNP	1.000	C
SF3B1	23451	genome.wustl.edu	37	2	198267361	198267361	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:198267361T>C	ENST00000335508.6	-	14	2087	c.1996A>G	c.(1996-1998)Aag>Gag	p.K666E	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	666					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K666E(7)|p.K666Q(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGTACAATCTTAATACCAGTG	0.413			Mis		myelodysplastic syndrome																																	dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	8	Substitution - Missense(8)	haematopoietic_and_lymphoid_tissue(7)|breast(1)											116.0	116.0	116.0					2																	198267361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1996A>G	2.37:g.198267361T>C	ENSP00000335321:p.Lys666Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K666E	ENST00000335508.6	37	c.1996	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	29.3	4.991337	0.93106	.	.	ENSG00000115524	ENST00000335508	T	0.64803	-0.12	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85066	0.5612	H	0.95645	3.7	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.89677	0.3888	10	0.87932	D	0	.	15.938	0.79729	0.0:0.0:0.0:1.0	.	666	O75533	SF3B1_HUMAN	E	666	ENSP00000335321:K666E	ENSP00000335321:K666E	K	-	1	0	SF3B1	197975606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.877000	0.87225	2.167000	0.68274	0.459000	0.35465	AAG	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.413	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	104	0.00	0	T			198267361	198267361	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	106	28.86	43	SNP	1.000	C
SF3B1	23451	genome.wustl.edu	37	2	198267361	198267361	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:198267361T>C	ENST00000335508.6	-	14	2087	c.1996A>G	c.(1996-1998)Aag>Gag	p.K666E	SF3B1_ENST00000462613.1_5'Flank|SNORA4_ENST00000365564.1_RNA	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	666					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K666E(7)|p.K666Q(1)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			TGTACAATCTTAATACCAGTG	0.413			Mis		myelodysplastic syndrome																																	dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	8	Substitution - Missense(8)	haematopoietic_and_lymphoid_tissue(7)|breast(1)											116.0	116.0	116.0					2																	198267361		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.1996A>G	2.37:g.198267361T>C	ENSP00000335321:p.Lys666Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K666E	ENST00000335508.6	37	c.1996	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	29.3	4.991337	0.93106	.	.	ENSG00000115524	ENST00000335508	T	0.64803	-0.12	5.68	5.68	0.88126	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85066	0.5612	H	0.95645	3.7	0.80722	D	1	D	0.76494	0.999	D	0.74348	0.983	D	0.89677	0.3888	10	0.87932	D	0	.	15.938	0.79729	0.0:0.0:0.0:1.0	.	666	O75533	SF3B1_HUMAN	E	666	ENSP00000335321:K666E	ENSP00000335321:K666E	K	-	1	0	SF3B1	197975606	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.877000	0.87225	2.167000	0.68274	0.459000	0.35465	AAG	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.413	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	104	0.00	0	T			198267361	198267361	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	76	26.21	27	SNP	1.000	C
SHISA9	729993	genome.wustl.edu	37	16	13010601	13010601	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:13010601G>A	ENST00000424107.3	+	2	1065	c.620G>A	c.(619-621)aGa>aAa	p.R207K	SHISA9_ENST00000558583.1_Missense_Mutation_p.R248K			B4DS77	SHSA9_HUMAN	shisa family member 9	207					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)		p.R248K(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						CACATGGAGAGAGACCTAAAC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	101.0	110.0					16																	13010601		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.620G>A	16.37:g.13010601G>A	ENSP00000407958:p.Arg207Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J314|C9JCE9	Missense_Mutation	SNP	NULL	p.R248K	ENST00000424107.3	37	c.743	CCDS45417.2	16	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312120	0.81358	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	T	0.72787	0.3504	L	0.43923	1.385	0.80722	D	1	P	0.49185	0.92	D	0.66716	0.946	T	0.70561	-0.4838	8	0.41790	T	0.15	.	17.0389	0.86483	0.0:0.0:1.0:0.0	.	207	B4DS77	SHSA9_HUMAN	K	248	.	ENSP00000407958:R248K	R	+	2	0	SHISA9	12918102	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.308000	0.72820	2.629000	0.89072	0.655000	0.94253	AGA	SHISA9	-	NULL	ENSG00000237515		0.443	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	61	0.00	0	G	NM_001145204		13010601	13010601	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	A
SHISA9	729993	genome.wustl.edu	37	16	13010601	13010601	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:13010601G>A	ENST00000424107.3	+	2	1065	c.620G>A	c.(619-621)aGa>aAa	p.R207K	SHISA9_ENST00000558583.1_Missense_Mutation_p.R248K			B4DS77	SHSA9_HUMAN	shisa family member 9	207					regulation of short-term neuronal synaptic plasticity (GO:0048172)	cell junction (GO:0030054)|dendritic spine membrane (GO:0032591)|ionotropic glutamate receptor complex (GO:0008328)|synapse (GO:0045202)		p.R248K(1)		breast(1)|endometrium(2)|kidney(1)|lung(2)|prostate(1)|skin(2)	9						CACATGGAGAGAGACCTAAAC	0.443																																						dbGAP											1	Substitution - Missense(1)	breast(1)											131.0	101.0	110.0					16																	13010601		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45417.1, CCDS45418.1, CCDS45417.2, CCDS45418.2	16p13.12	2013-07-31	2013-07-31		ENSG00000237515	ENSG00000237515		"""Shisa homologs"""	37231	protein-coding gene	gene with protein product		613346	"""shisa homolog 9 (Xenopus laevis)"""				Standard	NM_001145205		Approved		uc010uyy.2	B4DS77	OTTHUMG00000154258	ENST00000424107.3:c.620G>A	16.37:g.13010601G>A	ENSP00000407958:p.Arg207Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J314|C9JCE9	Missense_Mutation	SNP	NULL	p.R248K	ENST00000424107.3	37	c.743	CCDS45417.2	16	.	.	.	.	.	.	.	.	.	.	G	22.6	4.312120	0.81358	.	.	ENSG00000237515	ENST00000424107	.	.	.	5.56	5.56	0.83823	.	.	.	.	.	T	0.72787	0.3504	L	0.43923	1.385	0.80722	D	1	P	0.49185	0.92	D	0.66716	0.946	T	0.70561	-0.4838	8	0.41790	T	0.15	.	17.0389	0.86483	0.0:0.0:1.0:0.0	.	207	B4DS77	SHSA9_HUMAN	K	248	.	ENSP00000407958:R248K	R	+	2	0	SHISA9	12918102	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.308000	0.72820	2.629000	0.89072	0.655000	0.94253	AGA	SHISA9	-	NULL	ENSG00000237515		0.443	SHISA9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SHISA9	HGNC	protein_coding	OTTHUMT00000334564.5	61	0.00	0	G	NM_001145204		13010601	13010601	+1	no_errors	ENST00000558583	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	1.000	A
SIK3	23387	genome.wustl.edu	37	11	116798097	116798097	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:116798097C>A	ENST00000292055.4	-	4	316		c.e4-1		SIK3_ENST00000375288.1_Splice_Site|SIK3_ENST00000375300.1_Splice_Site|SIK3_ENST00000542607.1_Splice_Site|SIK3_ENST00000446921.2_Splice_Site|SIK3_ENST00000434315.2_Splice_Site	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3						protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						ACCAGGTGGTCTGTGTTGAAG	0.453																																						dbGAP											1	Unknown(1)	breast(1)											133.0	117.0	123.0					11																	116798097		2201	4296	6497	-	-	-	SO:0001630	splice_region_variant	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.281-1G>T	11.37:g.116798097C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Splice_Site	SNP	-	e4-1	ENST00000292055.4	37	c.455-1	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585870	0.86748	.	.	ENSG00000160584	ENST00000445177;ENST00000375300;ENST00000292055;ENST00000542607;ENST00000446921;ENST00000413553	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3625	0.94446	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIK3	116303307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.567000	0.86603	0.655000	0.94253	.	SIK3	-	-	ENSG00000160584		0.453	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		153	0.00	0	C	NM_025164	Intron	116798097	116798097	-1	no_errors	ENST00000375300	ensembl	human	known	69_37n	splice_site	117	29.52	49	SNP	1.000	A
SIK3	23387	genome.wustl.edu	37	11	116798097	116798097	+	Splice_Site	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:116798097C>A	ENST00000292055.4	-	4	316		c.e4-1		SIK3_ENST00000375288.1_Splice_Site|SIK3_ENST00000375300.1_Splice_Site|SIK3_ENST00000542607.1_Splice_Site|SIK3_ENST00000446921.2_Splice_Site|SIK3_ENST00000434315.2_Splice_Site	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3						protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)	p.?(1)		breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						ACCAGGTGGTCTGTGTTGAAG	0.453																																						dbGAP											1	Unknown(1)	breast(1)											133.0	117.0	123.0					11																	116798097		2201	4296	6497	-	-	-	SO:0001630	splice_region_variant	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.281-1G>T	11.37:g.116798097C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Splice_Site	SNP	-	e4-1	ENST00000292055.4	37	c.455-1	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	C	24.9	4.585870	0.86748	.	.	ENSG00000160584	ENST00000445177;ENST00000375300;ENST00000292055;ENST00000542607;ENST00000446921;ENST00000413553	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3625	0.94446	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIK3	116303307	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.487000	0.81328	2.567000	0.86603	0.655000	0.94253	.	SIK3	-	-	ENSG00000160584		0.453	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		153	0.00	0	C	NM_025164	Intron	116798097	116798097	-1	no_errors	ENST00000375300	ensembl	human	known	69_37n	splice_site	73	29.13	30	SNP	1.000	A
SLAIN1	122060	genome.wustl.edu	37	13	78327410	78327410	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr13:78327410C>T	ENST00000466548.1	+	6	1291	c.1265C>T	c.(1264-1266)tCt>tTt	p.S422F	SLAIN1_ENST00000488699.1_Missense_Mutation_p.S280F|SLAIN1_ENST00000314070.5_Missense_Mutation_p.S45F|SLAIN1_ENST00000267219.8_Missense_Mutation_p.S203F|SLAIN1_ENST00000358679.3_Missense_Mutation_p.S159F|SLAIN1_ENST00000418532.1_Missense_Mutation_p.S203F|SLAIN1_ENST00000351546.3_Missense_Mutation_p.S159F	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	422								p.S203F(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		AACATTAGTTCTCCGGTCACC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	79.0	80.0					13																	78327410		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.1265C>T	13.37:g.78327410C>T	ENSP00000419730:p.Ser422Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Missense_Mutation	SNP	NULL	p.S422F	ENST00000466548.1	37	c.1265		13	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863332	0.91511	.	.	ENSG00000139737	ENST00000466548;ENST00000389459;ENST00000418532;ENST00000442759;ENST00000488699;ENST00000267219;ENST00000351546;ENST00000441784;ENST00000314070;ENST00000358679	.	.	.	5.55	5.55	0.83447	.	0.114913	0.64402	D	0.000009	T	0.80253	0.4589	M	0.74881	2.28	0.53688	D	0.999973	D;P;D;D	0.76494	0.999;0.937;0.999;0.997	D;P;D;D	0.80764	0.952;0.679;0.965;0.994	T	0.81885	-0.0727	9	0.87932	D	0	-12.6762	19.5053	0.95113	0.0:1.0:0.0:0.0	.	158;280;45;422	B7Z326;B7Z209;Q8ND10;Q8ND83	.;.;.;SLAI1_HUMAN	F	422;422;203;203;280;203;159;159;45;159	.	ENSP00000267219:S203F	S	+	2	0	SLAIN1	77225411	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.195000	0.65131	2.616000	0.88540	0.585000	0.79938	TCT	SLAIN1	-	NULL	ENSG00000139737		0.388	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	SLAIN1	HGNC	protein_coding	OTTHUMT00000355018.1	112	0.00	0	C	NM_144595		78327410	78327410	+1	no_errors	ENST00000466548	ensembl	human	known	69_37n	missense	109	19.85	27	SNP	0.997	T
SLAIN1	122060	genome.wustl.edu	37	13	78327410	78327410	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr13:78327410C>T	ENST00000466548.1	+	6	1291	c.1265C>T	c.(1264-1266)tCt>tTt	p.S422F	SLAIN1_ENST00000488699.1_Missense_Mutation_p.S280F|SLAIN1_ENST00000314070.5_Missense_Mutation_p.S45F|SLAIN1_ENST00000267219.8_Missense_Mutation_p.S203F|SLAIN1_ENST00000358679.3_Missense_Mutation_p.S159F|SLAIN1_ENST00000418532.1_Missense_Mutation_p.S203F|SLAIN1_ENST00000351546.3_Missense_Mutation_p.S159F	NM_001242868.1	NP_001229797.1	Q8ND83	SLAI1_HUMAN	SLAIN motif family, member 1	422								p.S203F(1)		breast(1)|endometrium(3)|large_intestine(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	14		Acute lymphoblastic leukemia(28;0.0279)|Breast(118;0.037)		GBM - Glioblastoma multiforme(99;0.0853)		AACATTAGTTCTCCGGTCACC	0.388																																						dbGAP											1	Substitution - Missense(1)	breast(1)											82.0	79.0	80.0					13																	78327410		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054608	CCDS9460.1, CCDS31995.1, CCDS31995.2, CCDS55901.1, CCDS73588.1, CCDS73589.1	13q22.3	2006-09-12	2006-09-12	2006-09-12	ENSG00000139737	ENSG00000139737			26387	protein-coding gene	gene with protein product		610491	"""chromosome 13 open reading frame 32"""	C13orf32		16546155	Standard	NM_001040153		Approved	FLJ30046	uc001vkk.3	Q8ND83	OTTHUMG00000017110	ENST00000466548.1:c.1265C>T	13.37:g.78327410C>T	ENSP00000419730:p.Ser422Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0Z9|B7Z209|Q5T6P4|Q5T6P7|Q8ND10|Q96NV0	Missense_Mutation	SNP	NULL	p.S422F	ENST00000466548.1	37	c.1265		13	.	.	.	.	.	.	.	.	.	.	C	27.8	4.863332	0.91511	.	.	ENSG00000139737	ENST00000466548;ENST00000389459;ENST00000418532;ENST00000442759;ENST00000488699;ENST00000267219;ENST00000351546;ENST00000441784;ENST00000314070;ENST00000358679	.	.	.	5.55	5.55	0.83447	.	0.114913	0.64402	D	0.000009	T	0.80253	0.4589	M	0.74881	2.28	0.53688	D	0.999973	D;P;D;D	0.76494	0.999;0.937;0.999;0.997	D;P;D;D	0.80764	0.952;0.679;0.965;0.994	T	0.81885	-0.0727	9	0.87932	D	0	-12.6762	19.5053	0.95113	0.0:1.0:0.0:0.0	.	158;280;45;422	B7Z326;B7Z209;Q8ND10;Q8ND83	.;.;.;SLAI1_HUMAN	F	422;422;203;203;280;203;159;159;45;159	.	ENSP00000267219:S203F	S	+	2	0	SLAIN1	77225411	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	5.195000	0.65131	2.616000	0.88540	0.585000	0.79938	TCT	SLAIN1	-	NULL	ENSG00000139737		0.388	SLAIN1-009	KNOWN	not_organism_supported|basic	protein_coding	SLAIN1	HGNC	protein_coding	OTTHUMT00000355018.1	112	0.00	0	C	NM_144595		78327410	78327410	+1	no_errors	ENST00000466548	ensembl	human	known	69_37n	missense	58	24.68	19	SNP	0.997	T
SLC13A3	64849	genome.wustl.edu	37	20	45188729	45188729	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:45188729C>T	ENST00000279027.4	-	13	1759	c.1741G>A	c.(1741-1743)Gat>Aat	p.D581N	SLC13A3_ENST00000290317.5_Missense_Mutation_p.D534N|SLC13A3_ENST00000495082.1_Missense_Mutation_p.D534N|SLC13A3_ENST00000435032.1_Missense_Mutation_p.D166N|SLC13A3_ENST00000413164.2_Missense_Mutation_p.D531N|SLC13A3_ENST00000472148.1_Missense_Mutation_p.D499N|SLC13A3_ENST00000396360.1_Missense_Mutation_p.D499N	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	581					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.D581N(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GAGTACATATCAGCCCAGTCC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	140.0	149.0					20																	45188729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1741G>A	20.37:g.45188729C>T	ENSP00000279027:p.Asp581Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.D581N	ENST00000279027.4	37	c.1741	CCDS13400.1	20	.	.	.	.	.	.	.	.	.	.	C	1.081	-0.666940	0.03428	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000435032;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082	T;T;T;T;T;T;T	0.28069	4.0;3.97;1.63;4.26;3.97;3.8;4.0	4.66	-5.39	0.02664	.	1.138560	0.06069	N	0.659746	T	0.05364	0.0142	N	0.00377	-1.585	0.09310	N	1	B;B;B;B;B;B	0.10296	0.0;0.003;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0;0.0	T	0.21075	-1.0256	10	0.02654	T	1	-0.9503	4.177	0.10356	0.1036:0.1387:0.2052:0.5525	.	531;166;499;534;483;581	B4DIR8;B4E181;Q8WWT9-3;F6WI18;B4DF27;Q8WWT9	.;.;.;.;.;S13A3_HUMAN	N	534;499;166;581;499;531;534	ENSP00000290317:D534N;ENSP00000379648:D499N;ENSP00000403394:D166N;ENSP00000279027:D581N;ENSP00000420177:D499N;ENSP00000415852:D531N;ENSP00000419621:D534N	ENSP00000279027:D581N	D	-	1	0	SLC13A3	44622136	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.753000	0.04792	-1.525000	0.01762	-0.895000	0.02911	GAT	SLC13A3	-	NULL	ENSG00000158296		0.567	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2	71	0.00	0	C			45188729	45188729	-1	no_errors	ENST00000279027	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.000	T
SLC13A3	64849	genome.wustl.edu	37	20	45188729	45188729	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:45188729C>T	ENST00000279027.4	-	13	1759	c.1741G>A	c.(1741-1743)Gat>Aat	p.D581N	SLC13A3_ENST00000290317.5_Missense_Mutation_p.D534N|SLC13A3_ENST00000495082.1_Missense_Mutation_p.D534N|SLC13A3_ENST00000435032.1_Missense_Mutation_p.D166N|SLC13A3_ENST00000413164.2_Missense_Mutation_p.D531N|SLC13A3_ENST00000472148.1_Missense_Mutation_p.D499N|SLC13A3_ENST00000396360.1_Missense_Mutation_p.D499N	NM_001193342.1|NM_022829.5	NP_001180271.1|NP_073740.2	Q8WWT9	S13A3_HUMAN	solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3	581					transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	high-affinity sodium:dicarboxylate symporter activity (GO:0015362)	p.D581N(1)		breast(2)|endometrium(2)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(115;0.0122)			Succinic acid(DB00139)	GAGTACATATCAGCCCAGTCC	0.567																																						dbGAP											1	Substitution - Missense(1)	breast(1)											167.0	140.0	149.0					20																	45188729		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154121	CCDS13400.1, CCDS42886.1, CCDS54469.1, CCDS54470.1	20q13.12	2013-05-22			ENSG00000158296	ENSG00000158296		"""Solute carriers"""	14430	protein-coding gene	gene with protein product		606411				10794676, 10992006	Standard	NM_001011554		Approved	NADC3, SDCT2	uc002xsf.2	Q8WWT9	OTTHUMG00000033042	ENST00000279027.4:c.1741G>A	20.37:g.45188729C>T	ENSP00000279027:p.Asp581Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIR8|E1P5U4|F6WI18|Q5JYC9|Q5JYD0|Q5JYD1|Q5TCQ2|Q8IVB1|Q8N8K4|Q96MM5|Q9BR25|Q9H1G1|Q9H3W4|Q9NQN5|Q9NS04	Missense_Mutation	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.D581N	ENST00000279027.4	37	c.1741	CCDS13400.1	20	.	.	.	.	.	.	.	.	.	.	C	1.081	-0.666940	0.03428	.	.	ENSG00000158296	ENST00000290317;ENST00000396360;ENST00000435032;ENST00000279027;ENST00000472148;ENST00000413164;ENST00000495082	T;T;T;T;T;T;T	0.28069	4.0;3.97;1.63;4.26;3.97;3.8;4.0	4.66	-5.39	0.02664	.	1.138560	0.06069	N	0.659746	T	0.05364	0.0142	N	0.00377	-1.585	0.09310	N	1	B;B;B;B;B;B	0.10296	0.0;0.003;0.0;0.0;0.0;0.0	B;B;B;B;B;B	0.04013	0.001;0.001;0.001;0.001;0.0;0.0	T	0.21075	-1.0256	10	0.02654	T	1	-0.9503	4.177	0.10356	0.1036:0.1387:0.2052:0.5525	.	531;166;499;534;483;581	B4DIR8;B4E181;Q8WWT9-3;F6WI18;B4DF27;Q8WWT9	.;.;.;.;.;S13A3_HUMAN	N	534;499;166;581;499;531;534	ENSP00000290317:D534N;ENSP00000379648:D499N;ENSP00000403394:D166N;ENSP00000279027:D581N;ENSP00000420177:D499N;ENSP00000415852:D531N;ENSP00000419621:D534N	ENSP00000279027:D581N	D	-	1	0	SLC13A3	44622136	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.753000	0.04792	-1.525000	0.01762	-0.895000	0.02911	GAT	SLC13A3	-	NULL	ENSG00000158296		0.567	SLC13A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A3	HGNC	protein_coding	OTTHUMT00000080329.2	71	0.00	0	C			45188729	45188729	-1	no_errors	ENST00000279027	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.000	T
SLC22A16	85413	genome.wustl.edu	37	6	110763662	110763662	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:110763662G>A	ENST00000368919.3	-	4	1034	c.968C>T	c.(967-969)tCa>tTa	p.S323L	SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000330550.4_Missense_Mutation_p.S289L|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000439654.1_Missense_Mutation_p.S323L	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	323					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.S323L(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	TAAAAGTTCTGACAGTTTACA	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	98.0	100.0					6																	110763662		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.968C>T	6.37:g.110763662G>A	ENSP00000357915:p.Ser323Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S323L	ENST00000368919.3	37	c.968	CCDS5084.1	6	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563103	0.45694	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378	T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	4.78	1.82	0.25136	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.853808	0.09618	N	0.778009	T	0.56156	0.1966	M	0.75264	2.295	0.58432	D	0.999999	P;P	0.35656	0.514;0.458	B;B	0.39217	0.294;0.194	T	0.56613	-0.7950	10	0.08837	T	0.75	.	9.4052	0.38457	0.0756:0.2737:0.6508:0.0	.	323;289	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	L	323;240;289;323;153;280	ENSP00000357915:S323L;ENSP00000395642:S240L;ENSP00000328583:S289L;ENSP00000408799:S323L;ENSP00000409306:S153L;ENSP00000416310:S280L	ENSP00000328583:S289L	S	-	2	0	SLC22A16	110870355	1.000000	0.71417	0.017000	0.16124	0.202000	0.24057	3.328000	0.52052	0.123000	0.18342	0.655000	0.94253	TCA	SLC22A16	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000004809		0.428	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A16	HGNC	protein_coding	OTTHUMT00000043428.1	121	0.00	0	G	NM_033125		110763662	110763662	-1	no_errors	ENST00000368919	ensembl	human	known	69_37n	missense	110	20.29	28	SNP	0.906	A
SLC22A16	85413	genome.wustl.edu	37	6	110763662	110763662	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:110763662G>A	ENST00000368919.3	-	4	1034	c.968C>T	c.(967-969)tCa>tTa	p.S323L	SLC22A16_ENST00000456137.2_3'UTR|SLC22A16_ENST00000330550.4_Missense_Mutation_p.S289L|RN7SL617P_ENST00000485298.2_RNA|SLC22A16_ENST00000439654.1_Missense_Mutation_p.S323L	NM_033125.3	NP_149116.2	Q86VW1	S22AG_HUMAN	solute carrier family 22 (organic cation/carnitine transporter), member 16	323					acid secretion (GO:0046717)|amine transport (GO:0015837)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|organic cation transport (GO:0015695)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amine transmembrane transporter activity (GO:0005275)|carnitine transmembrane transporter activity (GO:0015226)|organic cation transmembrane transporter activity (GO:0015101)	p.S323L(1)		breast(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	34		all_cancers(87;0.00221)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.0485)|Colorectal(196;0.101)		OV - Ovarian serous cystadenocarcinoma(136;0.0513)|Epithelial(106;0.0921)|all cancers(137;0.115)	Doxorubicin(DB00997)|L-Carnitine(DB00583)	TAAAAGTTCTGACAGTTTACA	0.428																																						dbGAP											1	Substitution - Missense(1)	breast(1)											104.0	98.0	100.0					6																	110763662		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5084.1	6q21	2013-05-22	2008-01-11		ENSG00000004809	ENSG00000004809		"""Solute carriers"""	20302	protein-coding gene	gene with protein product		608276	"""solute carrier family 22 (organic cation transporter), member 16"""			12372408, 12089149, 17473959	Standard	NM_033125		Approved	FLIPT2, CT2, OKB1, OAT6	uc003puf.3	Q86VW1	OTTHUMG00000016171	ENST00000368919.3:c.968C>T	6.37:g.110763662G>A	ENSP00000357915:p.Ser323Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14567|Q5JXM1|Q8IUG8|Q8IZD5|Q96M90|Q96RU0	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S323L	ENST00000368919.3	37	c.968	CCDS5084.1	6	.	.	.	.	.	.	.	.	.	.	G	14.53	2.563103	0.45694	.	.	ENSG00000004809	ENST00000368919;ENST00000451557;ENST00000330550;ENST00000439654;ENST00000434949;ENST00000437378	T;T;T;T;T;T	0.74315	-0.83;-0.83;-0.83;-0.83;-0.83;-0.83	4.78	1.82	0.25136	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.853808	0.09618	N	0.778009	T	0.56156	0.1966	M	0.75264	2.295	0.58432	D	0.999999	P;P	0.35656	0.514;0.458	B;B	0.39217	0.294;0.194	T	0.56613	-0.7950	10	0.08837	T	0.75	.	9.4052	0.38457	0.0756:0.2737:0.6508:0.0	.	323;289	Q86VW1;Q86VW1-2	S22AG_HUMAN;.	L	323;240;289;323;153;280	ENSP00000357915:S323L;ENSP00000395642:S240L;ENSP00000328583:S289L;ENSP00000408799:S323L;ENSP00000409306:S153L;ENSP00000416310:S280L	ENSP00000328583:S289L	S	-	2	0	SLC22A16	110870355	1.000000	0.71417	0.017000	0.16124	0.202000	0.24057	3.328000	0.52052	0.123000	0.18342	0.655000	0.94253	TCA	SLC22A16	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000004809		0.428	SLC22A16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A16	HGNC	protein_coding	OTTHUMT00000043428.1	121	0.00	0	G	NM_033125		110763662	110763662	-1	no_errors	ENST00000368919	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	0.906	A
SLC30A5	64924	genome.wustl.edu	37	5	68419174	68419174	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:68419174G>A	ENST00000396591.3	+	14	2530	c.1920G>A	c.(1918-1920)ctG>ctA	p.L640L	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	640					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.L640L(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTGTTCCACTGATTAAAGATG	0.373																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											97.0	95.0	96.0					5																	68419174		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1920G>A	5.37:g.68419174G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.L640	ENST00000396591.3	37	c.1920	CCDS3996.1	5																																																																																			SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.373	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	108	0.00	0	G			68419174	68419174	+1	no_errors	ENST00000396591	ensembl	human	known	69_37n	silent	142	18.86	33	SNP	1.000	A
SLC30A5	64924	genome.wustl.edu	37	5	68419174	68419174	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:68419174G>A	ENST00000396591.3	+	14	2530	c.1920G>A	c.(1918-1920)ctG>ctA	p.L640L	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	640					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)	p.L640L(1)		breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		TTGTTCCACTGATTAAAGATG	0.373																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											97.0	95.0	96.0					5																	68419174		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1920G>A	5.37:g.68419174G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Silent	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.L640	ENST00000396591.3	37	c.1920	CCDS3996.1	5																																																																																			SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.373	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	108	0.00	0	G			68419174	68419174	+1	no_errors	ENST00000396591	ensembl	human	known	69_37n	silent	216	18.49	49	SNP	1.000	A
SMARCC1	6599	genome.wustl.edu	37	3	47680259	47680259	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:47680259C>G	ENST00000254480.5	-	22	2451	c.2332G>C	c.(2332-2334)Gag>Cag	p.E778Q	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	778	Glu-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)	p.E778Q(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		ATTTTTTCCTCTTCAGCTCCT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	132.0	132.0					3																	47680259		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2332G>C	3.37:g.47680259C>G	ENSP00000254480:p.Glu778Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.E778Q	ENST00000254480.5	37	c.2332	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371253	0.42003	.	.	ENSG00000173473	ENST00000254480	T	0.63913	-0.07	5.16	5.16	0.70880	.	0.165679	0.52532	D	0.000063	T	0.61949	0.2388	M	0.65498	2.005	0.40667	D	0.982188	B	0.20671	0.047	B	0.18561	0.022	T	0.62310	-0.6881	10	0.51188	T	0.08	-24.9238	15.7325	0.77817	0.0:1.0:0.0:0.0	.	778	Q92922	SMRC1_HUMAN	Q	778	ENSP00000254480:E778Q	ENSP00000254480:E778Q	E	-	1	0	SMARCC1	47655263	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.142000	0.42177	2.564000	0.86499	0.655000	0.94253	GAG	SMARCC1	-	NULL	ENSG00000173473		0.393	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	169	0.00	0	C			47680259	47680259	-1	no_errors	ENST00000254480	ensembl	human	known	69_37n	missense	169	24.22	54	SNP	1.000	G
SMARCC1	6599	genome.wustl.edu	37	3	47680259	47680259	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:47680259C>G	ENST00000254480.5	-	22	2451	c.2332G>C	c.(2332-2334)Gag>Cag	p.E778Q	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	778	Glu-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)	p.E778Q(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		ATTTTTTCCTCTTCAGCTCCT	0.393																																						dbGAP											1	Substitution - Missense(1)	breast(1)											133.0	132.0	132.0					3																	47680259		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.2332G>C	3.37:g.47680259C>G	ENSP00000254480:p.Glu778Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.E778Q	ENST00000254480.5	37	c.2332	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	C	13.89	2.371253	0.42003	.	.	ENSG00000173473	ENST00000254480	T	0.63913	-0.07	5.16	5.16	0.70880	.	0.165679	0.52532	D	0.000063	T	0.61949	0.2388	M	0.65498	2.005	0.40667	D	0.982188	B	0.20671	0.047	B	0.18561	0.022	T	0.62310	-0.6881	10	0.51188	T	0.08	-24.9238	15.7325	0.77817	0.0:1.0:0.0:0.0	.	778	Q92922	SMRC1_HUMAN	Q	778	ENSP00000254480:E778Q	ENSP00000254480:E778Q	E	-	1	0	SMARCC1	47655263	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.142000	0.42177	2.564000	0.86499	0.655000	0.94253	GAG	SMARCC1	-	NULL	ENSG00000173473		0.393	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	169	0.00	0	C			47680259	47680259	-1	no_errors	ENST00000254480	ensembl	human	known	69_37n	missense	293	20.60	76	SNP	1.000	G
SMC5	23137	genome.wustl.edu	37	9	72913049	72913049	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:72913049G>C	ENST00000361138.5	+	9	1279	c.1221G>C	c.(1219-1221)ctG>ctC	p.L407L		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	407					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.L407L(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						CAAATGATCTGAGACGGATTC	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											115.0	106.0	109.0					9																	72913049		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1221G>C	9.37:g.72913049G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	pfam_RecF/RecN/SMC	p.L407	ENST00000361138.5	37	c.1221	CCDS6632.1	9																																																																																			SMC5	-	pfam_RecF/RecN/SMC	ENSG00000198887		0.393	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	117	0.00	0	G	NM_015110		72913049	72913049	+1	no_errors	ENST00000361138	ensembl	human	known	69_37n	silent	156	23.53	48	SNP	0.999	C
SMC5	23137	genome.wustl.edu	37	9	72913049	72913049	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr9:72913049G>C	ENST00000361138.5	+	9	1279	c.1221G>C	c.(1219-1221)ctG>ctC	p.L407L		NM_015110.3	NP_055925.2	Q8IY18	SMC5_HUMAN	structural maintenance of chromosomes 5	407					cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|mitotic nuclear division (GO:0007067)|positive regulation of maintenance of mitotic sister chromatid cohesion (GO:0034184)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|telomere maintenance via recombination (GO:0000722)	cell junction (GO:0030054)|chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)	p.L407L(1)		breast(1)|central_nervous_system(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(4)	35						CAAATGATCTGAGACGGATTC	0.393																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											115.0	106.0	109.0					9																	72913049		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB011166	CCDS6632.1	9q21.11	2008-02-05	2006-07-06	2006-07-06	ENSG00000198887	ENSG00000198887		"""Structural maintenance of chromosomes proteins"""	20465	protein-coding gene	gene with protein product		609386	"""SMC5 structural maintenance of chromosomes 5-like 1 (yeast)"""	SMC5L1		9628581	Standard	NM_015110		Approved	KIAA0594	uc004ahr.2	Q8IY18	OTTHUMG00000019992	ENST00000361138.5:c.1221G>C	9.37:g.72913049G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM81|O60335|Q05D92|Q5VZ60|Q96SB9	Silent	SNP	pfam_RecF/RecN/SMC	p.L407	ENST00000361138.5	37	c.1221	CCDS6632.1	9																																																																																			SMC5	-	pfam_RecF/RecN/SMC	ENSG00000198887		0.393	SMC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC5	HGNC	protein_coding	OTTHUMT00000052603.1	117	0.00	0	G	NM_015110		72913049	72913049	+1	no_errors	ENST00000361138	ensembl	human	known	69_37n	silent	81	25.00	27	SNP	0.999	C
SNCB	6620	genome.wustl.edu	37	5	176048277	176048277	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:176048277C>T	ENST00000310112.3	-	6	560	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	SNCB_ENST00000393693.2_Missense_Mutation_p.E104K|SNCB_ENST00000506696.1_Missense_Mutation_p.E104K|SNCB_ENST00000510387.1_Missense_Mutation_p.E104K	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	104					dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)	p.E104K(1)		breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTGGTTCTTCAGCAGCTTCC	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	56.0	57.0					5																	176048277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.310G>A	5.37:g.176048277C>T	ENSP00000308057:p.Glu104Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IAX7	Missense_Mutation	SNP	pfam_Synuclein,prints_Synuclein,prints_Synuclein_beta	p.E104K	ENST00000310112.3	37	c.310	CCDS4406.1	5	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302106	0.60195	.	.	ENSG00000074317	ENST00000310112;ENST00000393693;ENST00000510387;ENST00000506696	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.29	5.29	0.74685	.	0.276491	0.34291	N	0.004100	D	0.89420	0.6710	L	0.56769	1.78	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	D	0.88136	0.2841	10	0.38643	T	0.18	-22.1152	18.9259	0.92544	0.0:1.0:0.0:0.0	.	104	Q16143	SYUB_HUMAN	K	104	ENSP00000308057:E104K;ENSP00000377296:E104K;ENSP00000424073:E104K;ENSP00000422223:E104K	ENSP00000308057:E104K	E	-	1	0	SNCB	175980883	1.000000	0.71417	0.996000	0.52242	0.277000	0.26821	6.034000	0.70933	2.479000	0.83701	0.650000	0.86243	GAA	SNCB	-	pfam_Synuclein,prints_Synuclein_beta	ENSG00000074317		0.597	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCB	HGNC	protein_coding	OTTHUMT00000253152.2	87	0.00	0	C	NM_001001502		176048277	176048277	-1	no_errors	ENST00000310112	ensembl	human	known	69_37n	missense	41	21.15	11	SNP	1.000	T
SNCB	6620	genome.wustl.edu	37	5	176048277	176048277	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:176048277C>T	ENST00000310112.3	-	6	560	c.310G>A	c.(310-312)Gaa>Aaa	p.E104K	SNCB_ENST00000393693.2_Missense_Mutation_p.E104K|SNCB_ENST00000506696.1_Missense_Mutation_p.E104K|SNCB_ENST00000510387.1_Missense_Mutation_p.E104K	NM_001001502.1	NP_001001502.1	Q16143	SYUB_HUMAN	synuclein, beta	104					dopamine metabolic process (GO:0042417)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|inclusion body (GO:0016234)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)|phospholipase inhibitor activity (GO:0004859)	p.E104K(1)		breast(1)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	10	all_cancers(89;0.00222)|Renal(175;0.000269)|Lung NSC(126;0.00902)|all_lung(126;0.0142)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTGGTTCTTCAGCAGCTTCC	0.597																																						dbGAP											1	Substitution - Missense(1)	breast(1)											57.0	56.0	57.0					5																	176048277		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF053134	CCDS4406.1	5q35	2008-07-18			ENSG00000074317	ENSG00000074317			11140	protein-coding gene	gene with protein product		602569				7558013, 9806846	Standard	NM_003085		Approved		uc003meq.3	Q16143	OTTHUMG00000130661	ENST00000310112.3:c.310G>A	5.37:g.176048277C>T	ENSP00000308057:p.Glu104Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IAX7	Missense_Mutation	SNP	pfam_Synuclein,prints_Synuclein,prints_Synuclein_beta	p.E104K	ENST00000310112.3	37	c.310	CCDS4406.1	5	.	.	.	.	.	.	.	.	.	.	C	17.10	3.302106	0.60195	.	.	ENSG00000074317	ENST00000310112;ENST00000393693;ENST00000510387;ENST00000506696	D;D;D;D	0.83250	-1.7;-1.7;-1.7;-1.7	5.29	5.29	0.74685	.	0.276491	0.34291	N	0.004100	D	0.89420	0.6710	L	0.56769	1.78	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	D	0.88136	0.2841	10	0.38643	T	0.18	-22.1152	18.9259	0.92544	0.0:1.0:0.0:0.0	.	104	Q16143	SYUB_HUMAN	K	104	ENSP00000308057:E104K;ENSP00000377296:E104K;ENSP00000424073:E104K;ENSP00000422223:E104K	ENSP00000308057:E104K	E	-	1	0	SNCB	175980883	1.000000	0.71417	0.996000	0.52242	0.277000	0.26821	6.034000	0.70933	2.479000	0.83701	0.650000	0.86243	GAA	SNCB	-	pfam_Synuclein,prints_Synuclein_beta	ENSG00000074317		0.597	SNCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNCB	HGNC	protein_coding	OTTHUMT00000253152.2	87	0.00	0	C	NM_001001502		176048277	176048277	-1	no_errors	ENST00000310112	ensembl	human	known	69_37n	missense	59	28.92	24	SNP	1.000	T
SPEG	10290	genome.wustl.edu	37	2	220338317	220338317	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:220338317C>G	ENST00000312358.7	+	17	4371	c.4239C>G	c.(4237-4239)ttC>ttG	p.F1413L	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1413	Ig-like 7.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.F1413L(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCGTCACATTCAACCATGTGG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	155.0	152.0					2																	220338317		2042	4178	6220	-	-	-	SO:0001583	missense	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4239C>G	2.37:g.220338317C>G	ENSP00000311684:p.Phe1413Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.F1413L	ENST00000312358.7	37	c.4239	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	C	9.383	1.073451	0.20147	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.65732	-0.17	4.64	2.8	0.32819	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.43919	D	0.000507	T	0.28400	0.0702	N	0.02916	-0.46	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24764	-1.0151	10	0.02654	T	1	.	7.4213	0.27073	0.0:0.5872:0.3216:0.0911	.	1413	Q15772	SPEG_HUMAN	L	1413	ENSP00000311684:F1413L	ENSP00000265327:F1413L	F	+	3	2	SPEG	220046561	0.232000	0.23762	1.000000	0.80357	0.613000	0.37349	-0.629000	0.05508	0.547000	0.28938	0.462000	0.41574	TTC	SPEG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000072195		0.647	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	63	0.00	0	C	NM_005876		220338317	220338317	+1	no_errors	ENST00000312358	ensembl	human	novel	69_37n	missense	12	29.41	5	SNP	1.000	G
SPEG	10290	genome.wustl.edu	37	2	220338317	220338317	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:220338317C>G	ENST00000312358.7	+	17	4371	c.4239C>G	c.(4237-4239)ttC>ttG	p.F1413L	SPEG_ENST00000485813.1_3'UTR	NM_005876.4	NP_005867.3	Q15772	SPEG_HUMAN	SPEG complex locus	1413	Ig-like 7.				cardiac muscle cell development (GO:0055013)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of cell proliferation (GO:0008285)|respiratory system development (GO:0060541)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)	p.F1413L(1)		breast(2)|central_nervous_system(3)|endometrium(10)|kidney(2)|large_intestine(9)|lung(42)|ovary(5)|pancreas(1)|prostate(8)|skin(1)|stomach(9)|upper_aerodigestive_tract(4)|urinary_tract(4)	100		Renal(207;0.0183)		Epithelial(149;4.5e-10)|all cancers(144;7.93e-08)|Lung(261;0.00639)|LUSC - Lung squamous cell carcinoma(224;0.00829)|READ - Rectum adenocarcinoma(5;0.163)		CCGTCACATTCAACCATGTGG	0.647																																						dbGAP											1	Substitution - Missense(1)	breast(1)											147.0	155.0	152.0					2																	220338317		2042	4178	6220	-	-	-	SO:0001583	missense	0			BC006346	CCDS42824.1, CCDS54432.1	2q35	2013-01-11	2006-04-27	2006-04-27	ENSG00000072195	ENSG00000072195		"""Immunoglobulin superfamily / I-set domain containing"""	16901	protein-coding gene	gene with protein product		615950	"""aortic preferentially expressed gene 1"""	APEG1		8663449, 10973969	Standard	NM_005876		Approved	MGC12676, KIAA1297, SPEGalpha, SPEGbeta, BPEG	uc010fwg.3	Q15772	OTTHUMG00000058925	ENST00000312358.7:c.4239C>G	2.37:g.220338317C>G	ENSP00000311684:p.Phe1413Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G6|A8MRU0|Q27J74|Q695L1|Q6FGA6|Q6ZQW1|Q6ZTL8|Q9P2P9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.F1413L	ENST00000312358.7	37	c.4239	CCDS42824.1	2	.	.	.	.	.	.	.	.	.	.	C	9.383	1.073451	0.20147	.	.	ENSG00000072195	ENST00000312358;ENST00000265327	T	0.65732	-0.17	4.64	2.8	0.32819	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.43919	D	0.000507	T	0.28400	0.0702	N	0.02916	-0.46	0.80722	D	1	B	0.02656	0.0	B	0.06405	0.002	T	0.24764	-1.0151	10	0.02654	T	1	.	7.4213	0.27073	0.0:0.5872:0.3216:0.0911	.	1413	Q15772	SPEG_HUMAN	L	1413	ENSP00000311684:F1413L	ENSP00000265327:F1413L	F	+	3	2	SPEG	220046561	0.232000	0.23762	1.000000	0.80357	0.613000	0.37349	-0.629000	0.05508	0.547000	0.28938	0.462000	0.41574	TTC	SPEG	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000072195		0.647	SPEG-004	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEG	HGNC	protein_coding	OTTHUMT00000130252.2	63	0.00	0	C	NM_005876		220338317	220338317	+1	no_errors	ENST00000312358	ensembl	human	novel	69_37n	missense	20	28.57	8	SNP	1.000	G
SPEN	23013	genome.wustl.edu	37	1	16257914	16257914	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:16257914C>T	ENST00000375759.3	+	11	5383	c.5179C>T	c.(5179-5181)Cag>Tag	p.Q1727*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1727					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.Q1727*(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATCAGGTGACCAGCCGCCTTA	0.577																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											138.0	150.0	146.0					1																	16257914		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5179C>T	1.37:g.16257914C>T	ENSP00000364912:p.Gln1727*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.Q1727*	ENST00000375759.3	37	c.5179	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	46	12.483781	0.99671	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.16	3.25	0.37280	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	1.6316	11.7713	0.51960	0.1386:0.7283:0.1332:0.0	.	.	.	.	X	1727	.	ENSP00000364912:Q1727X	Q	+	1	0	SPEN	16130501	0.019000	0.18553	0.000000	0.03702	0.799000	0.45148	1.393000	0.34497	0.528000	0.28580	0.467000	0.42956	CAG	SPEN	-	NULL	ENSG00000065526		0.577	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	63	0.00	0	C	NM_015001		16257914	16257914	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	nonsense	12	29.41	5	SNP	0.015	T
SPEN	23013	genome.wustl.edu	37	1	16257914	16257914	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:16257914C>T	ENST00000375759.3	+	11	5383	c.5179C>T	c.(5179-5181)Cag>Tag	p.Q1727*		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1727					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.Q1727*(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		ATCAGGTGACCAGCCGCCTTA	0.577																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											138.0	150.0	146.0					1																	16257914		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.5179C>T	1.37:g.16257914C>T	ENSP00000364912:p.Gln1727*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Nonsense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.Q1727*	ENST00000375759.3	37	c.5179	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	C	46	12.483781	0.99671	.	.	ENSG00000065526	ENST00000375759	.	.	.	5.16	3.25	0.37280	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	1.6316	11.7713	0.51960	0.1386:0.7283:0.1332:0.0	.	.	.	.	X	1727	.	ENSP00000364912:Q1727X	Q	+	1	0	SPEN	16130501	0.019000	0.18553	0.000000	0.03702	0.799000	0.45148	1.393000	0.34497	0.528000	0.28580	0.467000	0.42956	CAG	SPEN	-	NULL	ENSG00000065526		0.577	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	63	0.00	0	C	NM_015001		16257914	16257914	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	nonsense	18	30.77	8	SNP	0.015	T
SREK1	140890	genome.wustl.edu	37	5	65474672	65474672	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:65474672C>T	ENST00000380918.3	+	13	2163	c.1503C>T	c.(1501-1503)ctC>ctT	p.L501L	SREK1_ENST00000284041.3_3'UTR|SREK1_ENST00000334121.6_Silent_p.L617L	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	501					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L501L(1)|p.L617L(1)		breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						AAGAAAACCTCTCTACCAAAA	0.398																																					GBM(10;31 347 27684 38976 41583)	dbGAP											2	Substitution - coding silent(2)	breast(2)											129.0	111.0	117.0					5																	65474672		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.1503C>T	5.37:g.65474672C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTW3|Q2M1J0|Q86X37	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L617	ENST00000380918.3	37	c.1851	CCDS3991.1	5																																																																																			SREK1	-	NULL	ENSG00000153914		0.398	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	103	0.00	0	C	NM_001077199		65474672	65474672	+1	no_errors	ENST00000334121	ensembl	human	known	69_37n	silent	126	23.17	38	SNP	0.858	T
SREK1	140890	genome.wustl.edu	37	5	65474672	65474672	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:65474672C>T	ENST00000380918.3	+	13	2163	c.1503C>T	c.(1501-1503)ctC>ctT	p.L501L	SREK1_ENST00000284041.3_3'UTR|SREK1_ENST00000334121.6_Silent_p.L617L	NM_139168.3	NP_631907.1	Q8WXA9	SREK1_HUMAN	splicing regulatory glutamine/lysine-rich protein 1	501					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.L501L(1)|p.L617L(1)		breast(1)|kidney(3)|large_intestine(2)|lung(1)|pancreas(1)|prostate(1)	9						AAGAAAACCTCTCTACCAAAA	0.398																																					GBM(10;31 347 27684 38976 41583)	dbGAP											2	Substitution - coding silent(2)	breast(2)											129.0	111.0	117.0					5																	65474672		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF459094	CCDS3991.1, CCDS43323.1, CCDS75253.1	5q11.2-q12.1	2013-02-12	2010-09-08	2010-09-08	ENSG00000153914	ENSG00000153914		"""RNA binding motif (RRM) containing"""	17882	protein-coding gene	gene with protein product	"""serine-arginine-rich splicing regulatory protein 508"""	609268	"""splicing factor, arginine/serine-rich 12"""	SFRS12		12043562	Standard	NM_001077199		Approved	DKFZp564B176, SRrp86, SRrp508	uc003jun.4	Q8WXA9	OTTHUMG00000097809	ENST00000380918.3:c.1503C>T	5.37:g.65474672C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FTW3|Q2M1J0|Q86X37	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L617	ENST00000380918.3	37	c.1851	CCDS3991.1	5																																																																																			SREK1	-	NULL	ENSG00000153914		0.398	SREK1-002	KNOWN	basic|CCDS	protein_coding	SREK1	HGNC	protein_coding	OTTHUMT00000381118.1	103	0.00	0	C	NM_001077199		65474672	65474672	+1	no_errors	ENST00000334121	ensembl	human	known	69_37n	silent	70	24.73	23	SNP	0.858	T
SRL	6345	genome.wustl.edu	37	16	4247856	4247856	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:4247856G>T	ENST00000399609.3	-	4	332	c.320C>A	c.(319-321)tCt>tAt	p.S107Y	SRL_ENST00000537996.1_Missense_Mutation_p.S65Y	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	566	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S107Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						TATCATGGTAGATTTACCAAC	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	98.0	100.0					16																	4247856		1896	4105	6001	-	-	-	SO:0001583	missense	0			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.320C>A	16.37:g.4247856G>T	ENSP00000382518:p.Ser107Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	p.S107Y	ENST00000399609.3	37	c.320	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.142088	0.94560	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.99239	-5.61;-5.61	5.32	5.32	0.75619	.	0.066967	0.64402	U	0.000008	D	0.99591	0.9852	H	0.96604	3.85	0.80722	D	1	D	0.59767	0.986	P	0.59487	0.858	D	0.97912	1.0309	10	0.87932	D	0	-14.1242	19.0082	0.92861	0.0:0.0:1.0:0.0	.	107	Q86TD4-2	.	Y	107;565;65	ENSP00000382518:S107Y;ENSP00000440350:S65Y	ENSP00000333285:S565Y	S	-	2	0	SRL	4187857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.487000	0.83934	0.591000	0.81541	TCT	SRL	-	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	ENSG00000185739		0.413	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	77	0.00	0	G	XM_064152		4247856	4247856	-1	no_errors	ENST00000399609	ensembl	human	known	69_37n	missense	127	22.56	37	SNP	1.000	T
SRL	6345	genome.wustl.edu	37	16	4247856	4247856	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:4247856G>T	ENST00000399609.3	-	4	332	c.320C>A	c.(319-321)tCt>tAt	p.S107Y	SRL_ENST00000537996.1_Missense_Mutation_p.S65Y	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	566	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)	p.S107Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						TATCATGGTAGATTTACCAAC	0.413																																						dbGAP											1	Substitution - Missense(1)	breast(1)											103.0	98.0	100.0					16																	4247856		1896	4105	6001	-	-	-	SO:0001583	missense	0			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.320C>A	16.37:g.4247856G>T	ENSP00000382518:p.Ser107Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	p.S107Y	ENST00000399609.3	37	c.320	CCDS42113.1	16	.	.	.	.	.	.	.	.	.	.	G	32	5.142088	0.94560	.	.	ENSG00000185739	ENST00000399609;ENST00000330063;ENST00000537996	D;D	0.99239	-5.61;-5.61	5.32	5.32	0.75619	.	0.066967	0.64402	U	0.000008	D	0.99591	0.9852	H	0.96604	3.85	0.80722	D	1	D	0.59767	0.986	P	0.59487	0.858	D	0.97912	1.0309	10	0.87932	D	0	-14.1242	19.0082	0.92861	0.0:0.0:1.0:0.0	.	107	Q86TD4-2	.	Y	107;565;65	ENSP00000382518:S107Y;ENSP00000440350:S65Y	ENSP00000333285:S565Y	S	-	2	0	SRL	4187857	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.487000	0.83934	0.591000	0.81541	TCT	SRL	-	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	ENSG00000185739		0.413	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	77	0.00	0	G	XM_064152		4247856	4247856	-1	no_errors	ENST00000399609	ensembl	human	known	69_37n	missense	70	27.08	26	SNP	1.000	T
SUSD4	55061	genome.wustl.edu	37	1	223402560	223402560	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:223402560G>C	ENST00000343846.3	-	5	1528	c.895C>G	c.(895-897)Caa>Gaa	p.Q299E	SUSD4_ENST00000366878.4_Missense_Mutation_p.Q299E|SUSD4_ENST00000484758.2_Missense_Mutation_p.Q230E|SUSD4_ENST00000494793.2_Missense_Mutation_p.Q299E|SUSD4_ENST00000454695.2_Missense_Mutation_p.Q139E|SUSD4_ENST00000478605.1_Intron			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	299	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.Q299E(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		CAGTAGACTTGATAAGAAGGA	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	128.0	124.0					1																	223402560		2090	4222	6312	-	-	-	SO:0001583	missense	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.895C>G	1.37:g.223402560G>C	ENSP00000344219:p.Gln299Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q299E	ENST00000343846.3	37	c.895	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.692929	0.48202	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695	T;T;T	0.65364	-0.15;-0.15;-0.15	5.73	5.73	0.89815	Complement control module (2);Sushi/SCR/CCP (2);	0.000000	0.45361	D	0.000364	T	0.61515	0.2353	L	0.32530	0.975	0.80722	D	1	P	0.52577	0.954	P	0.52554	0.702	T	0.53809	-0.8386	10	0.06891	T	0.86	-14.9657	19.9097	0.97022	0.0:0.0:1.0:0.0	.	299	Q5VX71	SUSD4_HUMAN	E	299;299;230;139	ENSP00000344219:Q299E;ENSP00000355843:Q299E;ENSP00000399288:Q139E	ENSP00000344219:Q299E	Q	-	1	0	SUSD4	221469183	1.000000	0.71417	0.925000	0.36789	0.981000	0.71138	6.760000	0.74939	2.720000	0.93068	0.655000	0.94253	CAA	SUSD4	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143502		0.512	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	66	0.00	0	G	NM_017982		223402560	223402560	-1	no_errors	ENST00000343846	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.997	C
SUSD4	55061	genome.wustl.edu	37	1	223402560	223402560	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:223402560G>C	ENST00000343846.3	-	5	1528	c.895C>G	c.(895-897)Caa>Gaa	p.Q299E	SUSD4_ENST00000366878.4_Missense_Mutation_p.Q299E|SUSD4_ENST00000484758.2_Missense_Mutation_p.Q230E|SUSD4_ENST00000494793.2_Missense_Mutation_p.Q299E|SUSD4_ENST00000454695.2_Missense_Mutation_p.Q139E|SUSD4_ENST00000478605.1_Intron			Q5VX71	SUSD4_HUMAN	sushi domain containing 4	299	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)		p.Q299E(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|skin(1)	17				GBM - Glioblastoma multiforme(131;0.0611)		CAGTAGACTTGATAAGAAGGA	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											118.0	128.0	124.0					1																	223402560		2090	4222	6312	-	-	-	SO:0001583	missense	0			AK096265	CCDS31034.1, CCDS41471.1	1q41	2008-05-14			ENSG00000143502	ENSG00000143502			25470	protein-coding gene	gene with protein product		615827				12477932	Standard	NM_017982		Approved	FLJ10052	uc001hny.4	Q5VX71	OTTHUMG00000037936	ENST00000343846.3:c.895C>G	1.37:g.223402560G>C	ENSP00000344219:p.Gln299Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTB9|Q6UX62|Q9BSR0|Q9NWG0	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.Q299E	ENST00000343846.3	37	c.895	CCDS41471.1	1	.	.	.	.	.	.	.	.	.	.	G	14.97	2.692929	0.48202	.	.	ENSG00000143502	ENST00000343846;ENST00000366878;ENST00000542750;ENST00000454695	T;T;T	0.65364	-0.15;-0.15;-0.15	5.73	5.73	0.89815	Complement control module (2);Sushi/SCR/CCP (2);	0.000000	0.45361	D	0.000364	T	0.61515	0.2353	L	0.32530	0.975	0.80722	D	1	P	0.52577	0.954	P	0.52554	0.702	T	0.53809	-0.8386	10	0.06891	T	0.86	-14.9657	19.9097	0.97022	0.0:0.0:1.0:0.0	.	299	Q5VX71	SUSD4_HUMAN	E	299;299;230;139	ENSP00000344219:Q299E;ENSP00000355843:Q299E;ENSP00000399288:Q139E	ENSP00000344219:Q299E	Q	-	1	0	SUSD4	221469183	1.000000	0.71417	0.925000	0.36789	0.981000	0.71138	6.760000	0.74939	2.720000	0.93068	0.655000	0.94253	CAA	SUSD4	-	superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143502		0.512	SUSD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD4	HGNC	protein_coding	OTTHUMT00000092592.2	66	0.00	0	G	NM_017982		223402560	223402560	-1	no_errors	ENST00000343846	ensembl	human	known	69_37n	missense	47	22.95	14	SNP	0.997	C
TAAR9	134860	genome.wustl.edu	37	6	132859522	132859522	+	RNA	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:132859522C>T	ENST00000434551.1	+	0	94					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.R32*(1)				Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		GCCAGGTCCTCGATCTATCCT	0.483																																					Colon(10;433 445 15992 45047 47213)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											119.0	116.0	117.0					6																	132859522		2036	4207	6243	-	-	-			0			AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859522C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.R32*	ENST00000434551.1	37	c.94		6																																																																																			TAAR9	-	NULL	ENSG00000237110		0.483	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	TAAR9	HGNC	polymorphic_pseudogene	OTTHUMT00000042254.2	117	0.00	0	C	NM_175057		132859522	132859522	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434551	ensembl	human	known	69_37n	nonsense	100	21.26	27	SNP	0.076	T
TAAR9	134860	genome.wustl.edu	37	6	132859522	132859522	+	RNA	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:132859522C>T	ENST00000434551.1	+	0	94					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.R32*(1)				Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		GCCAGGTCCTCGATCTATCCT	0.483																																					Colon(10;433 445 15992 45047 47213)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											119.0	116.0	117.0					6																	132859522		2036	4207	6243	-	-	-			0			AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859522C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.R32*	ENST00000434551.1	37	c.94		6																																																																																			TAAR9	-	NULL	ENSG00000237110		0.483	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	TAAR9	HGNC	polymorphic_pseudogene	OTTHUMT00000042254.2	117	0.00	0	C	NM_175057		132859522	132859522	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434551	ensembl	human	known	69_37n	nonsense	160	23.08	48	SNP	0.076	T
TAF1	6872	genome.wustl.edu	37	X	70607298	70607298	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:70607298G>A	ENST00000373790.4	+	15	2462	c.2411G>A	c.(2410-2412)cGa>cAa	p.R804Q	TAF1_ENST00000276072.3_Missense_Mutation_p.R825Q|TAF1_ENST00000423759.1_Missense_Mutation_p.R825Q|TAF1_ENST00000449580.1_Missense_Mutation_p.R804Q	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	804	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R804Q(1)|p.R825Q(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ACGCATATTCGAGACTTTCTA	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											83.0	74.0	77.0					X																	70607298		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2411G>A	X.37:g.70607298G>A	ENSP00000362895:p.Arg804Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R804Q	ENST00000373790.4	37	c.2411	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	29.8	5.039700	0.93630	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.14022	2.54;2.54;2.54;2.54	4.7	4.7	0.59300	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.103621	0.64402	D	0.000007	T	0.45518	0.1346	M	0.88105	2.93	0.80722	D	1	D;P	0.89917	1.0;0.772	D;P	0.85130	0.997;0.586	T	0.57934	-0.7725	10	0.87932	D	0	.	17.1936	0.86887	0.0:0.0:1.0:0.0	.	804;825	P21675;P21675-2	TAF1_HUMAN;.	Q	804;804;825;825	ENSP00000362895:R804Q;ENSP00000389000:R804Q;ENSP00000406549:R825Q;ENSP00000276072:R825Q	ENSP00000276072:R825Q	R	+	2	0	TAF1	70524023	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.467000	0.97671	2.070000	0.61991	0.458000	0.33432	CGA	TAF1	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000147133		0.488	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	182	0.00	0	G	NM_004606		70607298	70607298	+1	no_errors	ENST00000449580	ensembl	human	known	69_37n	missense	159	23.56	49	SNP	1.000	A
TAF1	6872	genome.wustl.edu	37	X	70607298	70607298	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:70607298G>A	ENST00000373790.4	+	15	2462	c.2411G>A	c.(2410-2412)cGa>cAa	p.R804Q	TAF1_ENST00000276072.3_Missense_Mutation_p.R825Q|TAF1_ENST00000423759.1_Missense_Mutation_p.R825Q|TAF1_ENST00000449580.1_Missense_Mutation_p.R804Q	NM_004606.3|NM_138923.2	NP_004597.2|NP_620278.1	P21675	TAF1_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 250kDa	804	Histone acetyltransferase (HAT).				cellular response to DNA damage stimulus (GO:0006974)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|protein autophosphorylation (GO:0046777)|regulation of transcription involved in G2/M transition of mitotic cell cycle (GO:0000117)|RNA polymerase II transcriptional preinitiation complex assembly (GO:0051123)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	ATP binding (GO:0005524)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)|sequence-specific DNA binding (GO:0043565)|TBP-class protein binding (GO:0017025)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)	p.R804Q(1)|p.R825Q(1)		breast(13)|central_nervous_system(6)|cervix(1)|endometrium(25)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(16)|lung(34)|ovary(9)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(3)	124	Renal(35;0.156)	all_lung(315;0.000321)				ACGCATATTCGAGACTTTCTA	0.488																																						dbGAP											2	Substitution - Missense(2)	breast(2)											83.0	74.0	77.0					X																	70607298		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14412.1, CCDS35325.1, CCDS69783.1	Xq13.1	2011-07-01	2002-08-29	2001-12-07	ENSG00000147133	ENSG00000147133		"""Chromatin-modifying enzymes / K-acetyltransferases"""	11535	protein-coding gene	gene with protein product		313650	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, A, 250kD"", ""dystonia 3 (with Parkinsonism)"""	TAF2A, BA2R, CCG1, CCGS, DYT3		3556424, 12928496, 17952504	Standard	XM_005262295		Approved	NSCL2, TAFII250, KAT4, DYT3/TAF1	uc004dzt.4	P21675	OTTHUMG00000022723	ENST00000373790.4:c.2411G>A	X.37:g.70607298G>A	ENSP00000362895:p.Arg804Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5CVC8|A5CVC9|A5CVD0|A5CVD1|B1Q2X3|Q59FZ3|Q6IUZ1|Q70Q86|Q70Q87|Q70T00|Q70T01|Q70T02|Q70T03	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.R804Q	ENST00000373790.4	37	c.2411	CCDS35325.1	X	.	.	.	.	.	.	.	.	.	.	.	29.8	5.039700	0.93630	.	.	ENSG00000147133	ENST00000373790;ENST00000449580;ENST00000423759;ENST00000276072	T;T;T;T	0.14022	2.54;2.54;2.54;2.54	4.7	4.7	0.59300	Transcription initiation factor TFIID subunit 1, domain of unknown function (1);	0.103621	0.64402	D	0.000007	T	0.45518	0.1346	M	0.88105	2.93	0.80722	D	1	D;P	0.89917	1.0;0.772	D;P	0.85130	0.997;0.586	T	0.57934	-0.7725	10	0.87932	D	0	.	17.1936	0.86887	0.0:0.0:1.0:0.0	.	804;825	P21675;P21675-2	TAF1_HUMAN;.	Q	804;804;825;825	ENSP00000362895:R804Q;ENSP00000389000:R804Q;ENSP00000406549:R825Q;ENSP00000276072:R825Q	ENSP00000276072:R825Q	R	+	2	0	TAF1	70524023	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.467000	0.97671	2.070000	0.61991	0.458000	0.33432	CGA	TAF1	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000147133		0.488	TAF1-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	TAF1	HGNC	protein_coding	OTTHUMT00000058995.2	182	0.00	0	G	NM_004606		70607298	70607298	+1	no_errors	ENST00000449580	ensembl	human	known	69_37n	missense	251	20.82	66	SNP	1.000	A
TANC1	85461	genome.wustl.edu	37	2	160035600	160035600	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:160035600C>T	ENST00000263635.6	+	14	2673	c.2436C>T	c.(2434-2436)ttC>ttT	p.F812F	TANC1_ENST00000454300.1_Silent_p.F706F	NM_001145909.1|NM_033394.2	NP_001139381.1|NP_203752.2	Q9C0D5	TANC1_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1	812					dendritic spine maintenance (GO:0097062)|myoblast fusion (GO:0007520)|visual learning (GO:0008542)	axon terminus (GO:0043679)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(4)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(9)|lung(25)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	77						CCCGCATGTTCTGCCACCCGT	0.587																																						dbGAP											0													77.0	82.0	80.0					2																	160035600		1968	4151	6119	-	-	-	SO:0001819	synonymous_variant	0			AB051515	CCDS42766.1	2q24.2	2013-01-11			ENSG00000115183	ENSG00000115183		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29364	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	611397				15673434	Standard	NM_033394		Approved	KIAA1728, ROLSB	uc002uag.3	Q9C0D5	OTTHUMG00000153945	ENST00000263635.6:c.2436C>T	2.37:g.160035600C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD88|Q49AI8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.F812	ENST00000263635.6	37	c.2436	CCDS42766.1	2																																																																																			TANC1	-	NULL	ENSG00000115183		0.587	TANC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TANC1	HGNC	protein_coding	OTTHUMT00000333135.1	31	0.00	0	C			160035600	160035600	+1	no_errors	ENST00000263635	ensembl	human	known	69_37n	silent	9	18.18	2	SNP	1.000	T
TAP1	6890	genome.wustl.edu	37	6	32816574	32816574	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:32816574G>T	ENST00000354258.4	-	7	1762	c.1601C>A	c.(1600-1602)tCc>tAc	p.S534Y	TAPSAR1_ENST00000453426.1_lincRNA|TAP1_ENST00000425148.2_Missense_Mutation_p.S273Y|PSMB9_ENST00000395330.1_Intron	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	534	Involved in peptide-binding site.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)	p.S534Y(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	TTTCTCTGAGGAGCCCACAGC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	110.0	110.0					6																	32816574		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.1601C>A	6.37:g.32816574G>T	ENSP00000346206:p.Ser534Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16149|Q96CP4	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_ABC_B2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Ag_transporter2	p.S534Y	ENST00000354258.4	37	c.1601	CCDS4758.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061752	0.76187	.	.	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.83250	-1.7;-1.7	5.02	4.16	0.48862	ABC transporter, transmembrane domain, type 1 (1);	3.243150	0.01065	N	0.004716	D	0.82651	0.5083	M	0.61387	1.9	0.45528	D	0.998485	P	0.41080	0.737	P	0.48454	0.578	T	0.71192	-0.4665	10	0.87932	D	0	-4.278	11.2507	0.49024	0.0886:0.0:0.9114:0.0	.	534	Q03518	TAP1_HUMAN	Y	534;273	ENSP00000346206:S534Y;ENSP00000401919:S273Y	ENSP00000346206:S534Y	S	-	2	0	TAP1	32924552	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.270000	0.65547	1.347000	0.45714	0.643000	0.83706	TCC	TAP1	-	superfamily_ABC_transptrTM_dom_typ1,tigrfam_Ag_transporter2	ENSG00000168394		0.517	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAP1	HGNC	protein_coding	OTTHUMT00000076087.2	219	0.00	0	G	NM_000593		32816574	32816574	-1	no_errors	ENST00000354258	ensembl	human	known	69_37n	missense	114	10.94	14	SNP	1.000	T
TAP1	6890	genome.wustl.edu	37	6	32816574	32816574	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr6:32816574G>T	ENST00000354258.4	-	7	1762	c.1601C>A	c.(1600-1602)tCc>tAc	p.S534Y	TAPSAR1_ENST00000453426.1_lincRNA|TAP1_ENST00000425148.2_Missense_Mutation_p.S273Y|PSMB9_ENST00000395330.1_Intron	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	534	Involved in peptide-binding site.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)	p.S534Y(1)		breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	TTTCTCTGAGGAGCCCACAGC	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											110.0	110.0	110.0					6																	32816574		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.1601C>A	6.37:g.32816574G>T	ENSP00000346206:p.Ser534Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16149|Q96CP4	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_ABC_B2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Ag_transporter2	p.S534Y	ENST00000354258.4	37	c.1601	CCDS4758.1	6	.	.	.	.	.	.	.	.	.	.	G	20.9	4.061752	0.76187	.	.	ENSG00000168394	ENST00000354258;ENST00000425148	D;D	0.83250	-1.7;-1.7	5.02	4.16	0.48862	ABC transporter, transmembrane domain, type 1 (1);	3.243150	0.01065	N	0.004716	D	0.82651	0.5083	M	0.61387	1.9	0.45528	D	0.998485	P	0.41080	0.737	P	0.48454	0.578	T	0.71192	-0.4665	10	0.87932	D	0	-4.278	11.2507	0.49024	0.0886:0.0:0.9114:0.0	.	534	Q03518	TAP1_HUMAN	Y	534;273	ENSP00000346206:S534Y;ENSP00000401919:S273Y	ENSP00000346206:S534Y	S	-	2	0	TAP1	32924552	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	5.270000	0.65547	1.347000	0.45714	0.643000	0.83706	TCC	TAP1	-	superfamily_ABC_transptrTM_dom_typ1,tigrfam_Ag_transporter2	ENSG00000168394		0.517	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAP1	HGNC	protein_coding	OTTHUMT00000076087.2	219	0.00	0	G	NM_000593		32816574	32816574	-1	no_errors	ENST00000354258	ensembl	human	known	69_37n	missense	176	11.56	23	SNP	1.000	T
TCEA1	6917	genome.wustl.edu	37	8	54897032	54897032	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:54897032C>G	ENST00000521604.2	-	7	972	c.569G>C	c.(568-570)aGa>aCa	p.R190T	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000396401.3_Missense_Mutation_p.R169T|TCEA1_ENST00000522635.1_Intron	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	190	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R190T(1)|p.R6T(1)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			ACTTCGTACTCTATTTTTGTA	0.308			T	PLAG1	salivary adenoma																																	dbGAP		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	2	Substitution - Missense(2)	breast(2)											69.0	57.0	61.0					8																	54897032		1799	4062	5861	-	-	-	SO:0001583	missense	0			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.569G>C	8.37:g.54897032C>G	ENSP00000428426:p.Arg190Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.R190T	ENST00000521604.2	37	c.569	CCDS47858.1	8	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691145	0.88735	.	.	ENSG00000187735	ENST00000396401;ENST00000521604	T;T	0.51817	0.69;0.69	5.15	5.15	0.70609	Transcription elongation factor S-IIM (1);Transcription elongation factor S-II, central domain (4);	0.046806	0.85682	D	0.000000	T	0.73102	0.3544	M	0.86028	2.79	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.74348	0.944;0.983	T	0.78074	-0.2346	10	0.87932	D	0	-15.1875	18.9917	0.92794	0.0:1.0:0.0:0.0	.	169;190	P23193-2;P23193	.;TCEA1_HUMAN	T	169;190	ENSP00000395483:R169T;ENSP00000428426:R190T	ENSP00000395483:R169T	R	-	2	0	TCEA1	55059585	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.572000	0.86782	0.491000	0.48974	AGA	TCEA1	-	pfam_TFIIS_cen_dom,superfamily_TFIIS_cen_dom,smart_TFS2M,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000187735		0.308	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA1	HGNC	protein_coding	OTTHUMT00000377975.2	155	0.00	0	C	NM_006756		54897032	54897032	-1	no_errors	ENST00000521604	ensembl	human	known	69_37n	missense	245	18.33	55	SNP	1.000	G
TCEA1	6917	genome.wustl.edu	37	8	54897032	54897032	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:54897032C>G	ENST00000521604.2	-	7	972	c.569G>C	c.(568-570)aGa>aCa	p.R190T	TCEA1_ENST00000521086.2_5'UTR|TCEA1_ENST00000396401.3_Missense_Mutation_p.R169T|TCEA1_ENST00000522635.1_Intron	NM_006756.2	NP_006747.1	P23193	TCEA1_HUMAN	transcription elongation factor A (SII), 1	190	TFIIS central. {ECO:0000255|PROSITE- ProRule:PRU00651}.				DNA repair (GO:0006281)|erythrocyte differentiation (GO:0030218)|gene expression (GO:0010467)|nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|regulation of DNA-templated transcription, elongation (GO:0032784)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.R190T(1)|p.R6T(1)		breast(1)|large_intestine(1)|lung(1)|skin(1)	4		Lung NSC(129;0.109)|all_epithelial(80;0.11)|all_lung(136;0.181)	OV - Ovarian serous cystadenocarcinoma(7;9.1e-07)|Epithelial(17;9.44e-05)|all cancers(17;0.000699)			ACTTCGTACTCTATTTTTGTA	0.308			T	PLAG1	salivary adenoma																																	dbGAP		Dom	yes		8	8q11.2	6917	"""transcription elongation factor A (SII), 1"""		E	2	Substitution - Missense(2)	breast(2)											69.0	57.0	61.0					8																	54897032		1799	4062	5861	-	-	-	SO:0001583	missense	0			X62585	CCDS47857.1, CCDS47858.1	8q11.2	2011-01-25			ENSG00000187735	ENSG00000187735		"""General transcription factors"""	11612	protein-coding gene	gene with protein product		601425		TCEA, GTF2S		8812434, 8112616	Standard	NM_006756		Approved	SII, TF2S, TFIIS	uc003xru.3	P23193	OTTHUMG00000164262	ENST00000521604.2:c.569G>C	8.37:g.54897032C>G	ENSP00000428426:p.Arg190Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF25|A8K339|Q15563|Q6FG87	Missense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_Znf_TFIIS,pfam_TFIIS_N,superfamily_TFIIS_cen_dom,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub,smart_TFS2M,smart_Znf_TFIIS,pirsf_TF_IIS-rel,pfscan_Znf_TFIIS,tigrfam_TFSII	p.R190T	ENST00000521604.2	37	c.569	CCDS47858.1	8	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691145	0.88735	.	.	ENSG00000187735	ENST00000396401;ENST00000521604	T;T	0.51817	0.69;0.69	5.15	5.15	0.70609	Transcription elongation factor S-IIM (1);Transcription elongation factor S-II, central domain (4);	0.046806	0.85682	D	0.000000	T	0.73102	0.3544	M	0.86028	2.79	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.74348	0.944;0.983	T	0.78074	-0.2346	10	0.87932	D	0	-15.1875	18.9917	0.92794	0.0:1.0:0.0:0.0	.	169;190	P23193-2;P23193	.;TCEA1_HUMAN	T	169;190	ENSP00000395483:R169T;ENSP00000428426:R190T	ENSP00000395483:R169T	R	-	2	0	TCEA1	55059585	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.776000	0.85560	2.572000	0.86782	0.491000	0.48974	AGA	TCEA1	-	pfam_TFIIS_cen_dom,superfamily_TFIIS_cen_dom,smart_TFS2M,pirsf_TF_IIS-rel,tigrfam_TFSII	ENSG00000187735		0.308	TCEA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEA1	HGNC	protein_coding	OTTHUMT00000377975.2	155	0.00	0	C	NM_006756		54897032	54897032	-1	no_errors	ENST00000521604	ensembl	human	known	69_37n	missense	385	19.12	91	SNP	1.000	G
TFDP2	7029	genome.wustl.edu	37	3	141671859	141671859	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:141671859C>G	ENST00000489671.1	-	12	1482		c.e12-1		TFDP2_ENST00000486111.1_Splice_Site|TFDP2_ENST00000317104.7_Splice_Site|TFDP2_ENST00000467072.1_Splice_Site|TFDP2_ENST00000499676.2_Splice_Site|TFDP2_ENST00000310282.6_Splice_Site|TFDP2_ENST00000397991.4_Splice_Site|TFDP2_ENST00000495310.1_Splice_Site|TFDP2_ENST00000479040.1_Splice_Site|TFDP2_ENST00000477292.1_Splice_Site			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)						gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.?(1)		kidney(1)|upper_aerodigestive_tract(2)	3						GTGGAGATATCTAAAGGAAAA	0.428																																						dbGAP											1	Unknown(1)	breast(1)											76.0	76.0	76.0					3																	141671859		1852	4089	5941	-	-	-	SO:0001630	splice_region_variant	0			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.1052-1G>C	3.37:g.141671859C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Splice_Site	SNP	-	e11-1	ENST00000489671.1	37	c.1052-1	CCDS54650.1	3	.	.	.	.	.	.	.	.	.	.	C	19.24	3.790323	0.70337	.	.	ENSG00000114126	ENST00000499676;ENST00000489671;ENST00000486111;ENST00000477292;ENST00000495310;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991;ENST00000474279	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8504	0.57855	0.0:0.9258:0.0:0.0742	.	.	.	.	.	-1	.	.	.	-	.	.	TFDP2	143154549	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	3.400000	0.52594	2.832000	0.97577	0.655000	0.94253	.	TFDP2	-	-	ENSG00000114126		0.428	TFDP2-001	KNOWN	basic|CCDS	protein_coding	TFDP2	HGNC	protein_coding	OTTHUMT00000353294.4	78	0.00	0	C	NM_006286	Intron	141671859	141671859	-1	no_errors	ENST00000489671	ensembl	human	known	69_37n	splice_site	101	22.31	29	SNP	1.000	G
TFDP2	7029	genome.wustl.edu	37	3	141671859	141671859	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:141671859C>G	ENST00000489671.1	-	12	1482		c.e12-1		TFDP2_ENST00000486111.1_Splice_Site|TFDP2_ENST00000317104.7_Splice_Site|TFDP2_ENST00000467072.1_Splice_Site|TFDP2_ENST00000499676.2_Splice_Site|TFDP2_ENST00000310282.6_Splice_Site|TFDP2_ENST00000397991.4_Splice_Site|TFDP2_ENST00000495310.1_Splice_Site|TFDP2_ENST00000479040.1_Splice_Site|TFDP2_ENST00000477292.1_Splice_Site			Q14188	TFDP2_HUMAN	transcription factor Dp-2 (E2F dimerization partner 2)						gene expression (GO:0010467)|heart development (GO:0007507)|mitotic cell cycle (GO:0000278)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transcription factor binding (GO:0008134)	p.?(1)		kidney(1)|upper_aerodigestive_tract(2)	3						GTGGAGATATCTAAAGGAAAA	0.428																																						dbGAP											1	Unknown(1)	breast(1)											76.0	76.0	76.0					3																	141671859		1852	4089	5941	-	-	-	SO:0001630	splice_region_variant	0			U18422	CCDS43159.1, CCDS54647.1, CCDS54648.1, CCDS54649.1, CCDS54650.1	3q23	2011-05-24			ENSG00000114126	ENSG00000114126			11751	protein-coding gene	gene with protein product		602160				7784053, 9027491	Standard	NM_001178138		Approved	Dp-2	uc003eun.4	Q14188	OTTHUMG00000164975	ENST00000489671.1:c.1052-1G>C	3.37:g.141671859C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8C8|B7Z8L5|D3DNG1|E9PFC3|F8WAI2|Q13331|Q14187|Q6R754|Q8WU88|Q9UG28	Splice_Site	SNP	-	e11-1	ENST00000489671.1	37	c.1052-1	CCDS54650.1	3	.	.	.	.	.	.	.	.	.	.	C	19.24	3.790323	0.70337	.	.	ENSG00000114126	ENST00000499676;ENST00000489671;ENST00000486111;ENST00000477292;ENST00000495310;ENST00000467072;ENST00000317104;ENST00000310282;ENST00000479040;ENST00000397991;ENST00000474279	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.8504	0.57855	0.0:0.9258:0.0:0.0742	.	.	.	.	.	-1	.	.	.	-	.	.	TFDP2	143154549	1.000000	0.71417	0.998000	0.56505	0.984000	0.73092	3.400000	0.52594	2.832000	0.97577	0.655000	0.94253	.	TFDP2	-	-	ENSG00000114126		0.428	TFDP2-001	KNOWN	basic|CCDS	protein_coding	TFDP2	HGNC	protein_coding	OTTHUMT00000353294.4	78	0.00	0	C	NM_006286	Intron	141671859	141671859	-1	no_errors	ENST00000489671	ensembl	human	known	69_37n	splice_site	64	21.95	18	SNP	1.000	G
THSD7A	221981	genome.wustl.edu	37	7	11676040	11676040	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:11676040C>T	ENST00000423059.4	-	2	990	c.739G>A	c.(739-741)Gag>Aag	p.E247K	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	247	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E247K(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCCTCGGCCTCGCATGGACTG	0.632										HNSCC(18;0.044)																												dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	50.0	50.0					7																	11676040		2068	4203	6271	-	-	-	SO:0001583	missense	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.739G>A	7.37:g.11676040C>T	ENSP00000406482:p.Glu247Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E247K	ENST00000423059.4	37	c.739	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	2.639	-0.284702	0.05605	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.58506	0.33	5.62	4.75	0.60458	.	0.150621	0.64402	D	0.000014	T	0.46151	0.1378	L	0.57536	1.79	0.40397	D	0.979615	P	0.35774	0.519	B	0.26517	0.07	T	0.42916	-0.9423	10	0.13470	T	0.59	.	11.4625	0.50219	0.0:0.8103:0.0:0.1897	.	247	Q9UPZ6	THS7A_HUMAN	K	247	ENSP00000406482:E247K	ENSP00000262042:E247K	E	-	1	0	THSD7A	11642565	0.000000	0.05858	0.041000	0.18516	0.005000	0.04900	0.020000	0.13466	1.520000	0.48965	-0.224000	0.12420	GAG	THSD7A	-	smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000005108		0.632	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	86	0.00	0	C	XM_928187.2		11676040	11676040	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	missense	159	16.75	32	SNP	0.606	T
THSD7A	221981	genome.wustl.edu	37	7	11676040	11676040	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:11676040C>T	ENST00000423059.4	-	2	990	c.739G>A	c.(739-741)Gag>Aag	p.E247K	THSD7A_ENST00000480061.1_5'Flank	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A	247	TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.E247K(1)		NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		TCCTCGGCCTCGCATGGACTG	0.632										HNSCC(18;0.044)																												dbGAP											1	Substitution - Missense(1)	breast(1)											52.0	50.0	50.0					7																	11676040		2068	4203	6271	-	-	-	SO:0001583	missense	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.739G>A	7.37:g.11676040C>T	ENSP00000406482:p.Glu247Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E247K	ENST00000423059.4	37	c.739	CCDS47543.1	7	.	.	.	.	.	.	.	.	.	.	C	2.639	-0.284702	0.05605	.	.	ENSG00000005108	ENST00000262042;ENST00000423059	T	0.58506	0.33	5.62	4.75	0.60458	.	0.150621	0.64402	D	0.000014	T	0.46151	0.1378	L	0.57536	1.79	0.40397	D	0.979615	P	0.35774	0.519	B	0.26517	0.07	T	0.42916	-0.9423	10	0.13470	T	0.59	.	11.4625	0.50219	0.0:0.8103:0.0:0.1897	.	247	Q9UPZ6	THS7A_HUMAN	K	247	ENSP00000406482:E247K	ENSP00000262042:E247K	E	-	1	0	THSD7A	11642565	0.000000	0.05858	0.041000	0.18516	0.005000	0.04900	0.020000	0.13466	1.520000	0.48965	-0.224000	0.12420	GAG	THSD7A	-	smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000005108		0.632	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THSD7A	HGNC	protein_coding	OTTHUMT00000325944.4	86	0.00	0	C	XM_928187.2		11676040	11676040	-1	no_errors	ENST00000423059	ensembl	human	known	69_37n	missense	97	18.49	22	SNP	0.606	T
TLL2	7093	genome.wustl.edu	37	10	98205902	98205902	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:98205902C>G	ENST00000357947.3	-	3	535	c.310G>C	c.(310-312)Gag>Cag	p.E104Q	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	104					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E104Q(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GGGCTGCTCTCAGATGCCTGC	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											207.0	176.0	186.0					10																	98205902		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.310G>C	10.37:g.98205902C>G	ENSP00000350630:p.Glu104Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.E104Q	ENST00000357947.3	37	c.310	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	C	8.000	0.755141	0.15846	.	.	ENSG00000095587	ENST00000357947	T	0.14391	2.51	4.98	4.98	0.66077	.	0.194510	0.23993	U	0.042546	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	1	B	0.23735	0.09	B	0.23419	0.046	T	0.29792	-1.0000	10	0.15066	T	0.55	.	14.1085	0.65107	0.0:1.0:0.0:0.0	.	104	Q9Y6L7	TLL2_HUMAN	Q	104	ENSP00000350630:E104Q	ENSP00000350630:E104Q	E	-	1	0	TLL2	98195892	0.179000	0.23135	0.195000	0.23364	0.501000	0.33797	3.761000	0.55242	2.476000	0.83614	0.555000	0.69702	GAG	TLL2	-	pirsf_BMP_1/tolloid-like	ENSG00000095587		0.527	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	217	0.00	0	C			98205902	98205902	-1	no_errors	ENST00000357947	ensembl	human	known	69_37n	missense	163	21.63	45	SNP	0.038	G
TLL2	7093	genome.wustl.edu	37	10	98205902	98205902	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:98205902C>G	ENST00000357947.3	-	3	535	c.310G>C	c.(310-312)Gag>Cag	p.E104Q	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	104					cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.E104Q(1)		NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		GGGCTGCTCTCAGATGCCTGC	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											207.0	176.0	186.0					10																	98205902		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.310G>C	10.37:g.98205902C>G	ENSP00000350630:p.Glu104Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.E104Q	ENST00000357947.3	37	c.310	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	C	8.000	0.755141	0.15846	.	.	ENSG00000095587	ENST00000357947	T	0.14391	2.51	4.98	4.98	0.66077	.	0.194510	0.23993	U	0.042546	T	0.08670	0.0215	N	0.14661	0.345	0.09310	N	1	B	0.23735	0.09	B	0.23419	0.046	T	0.29792	-1.0000	10	0.15066	T	0.55	.	14.1085	0.65107	0.0:1.0:0.0:0.0	.	104	Q9Y6L7	TLL2_HUMAN	Q	104	ENSP00000350630:E104Q	ENSP00000350630:E104Q	E	-	1	0	TLL2	98195892	0.179000	0.23135	0.195000	0.23364	0.501000	0.33797	3.761000	0.55242	2.476000	0.83614	0.555000	0.69702	GAG	TLL2	-	pirsf_BMP_1/tolloid-like	ENSG00000095587		0.527	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	217	0.00	0	C			98205902	98205902	-1	no_errors	ENST00000357947	ensembl	human	known	69_37n	missense	89	24.58	29	SNP	0.038	G
TMEM132D	121256	genome.wustl.edu	37	12	130015639	130015639	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:130015639G>A	ENST00000422113.2	-	3	1406	c.1080C>T	c.(1078-1080)atC>atT	p.I360I		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	360					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.I360I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCTGACAAACGATGACAGCTG	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	84.0	87.0					12																	130015639		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1080C>T	12.37:g.130015639G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.I360	ENST00000422113.2	37	c.1080	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.483	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	79	0.00	0	G	NM_133448		130015639	130015639	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	silent	47	11.32	6	SNP	0.030	A
TMEM132D	121256	genome.wustl.edu	37	12	130015639	130015639	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:130015639G>A	ENST00000422113.2	-	3	1406	c.1080C>T	c.(1078-1080)atC>atT	p.I360I		NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	360					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)		p.I360I(1)		NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TCTGACAAACGATGACAGCTG	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											93.0	84.0	87.0					12																	130015639		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1080C>T	12.37:g.130015639G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Silent	SNP	NULL	p.I360	ENST00000422113.2	37	c.1080	CCDS9266.1	12																																																																																			TMEM132D	-	NULL	ENSG00000151952		0.483	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	79	0.00	0	G	NM_133448		130015639	130015639	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	silent	60	25.00	20	SNP	0.030	A
TMEM155	132332	genome.wustl.edu	37	4	122682808	122682808	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:122682808G>A	ENST00000337677.5	-	5	655	c.97C>T	c.(97-99)Cta>Tta	p.L33L	TMEM155_ENST00000394396.1_Silent_p.L33L|TMEM155_ENST00000394394.1_Silent_p.L33L|AC079341.1_ENST00000424958.1_5'Flank	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	33						extracellular region (GO:0005576)		p.L33L(1)		breast(1)|lung(5)	6						TTATTCTGTAGAATCGCACCA	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											76.0	75.0	75.0					4																	122682808		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.97C>T	4.37:g.122682808G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNW9|Q96NI2	Silent	SNP	NULL	p.L33	ENST00000337677.5	37	c.97	CCDS3721.1	4																																																																																			TMEM155	-	NULL	ENSG00000164112		0.433	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM155	HGNC	protein_coding	OTTHUMT00000256637.2	109	0.00	0	G	NM_152399		122682808	122682808	-1	no_errors	ENST00000337677	ensembl	human	known	69_37n	silent	145	25.26	49	SNP	0.090	A
TMEM155	132332	genome.wustl.edu	37	4	122682808	122682808	+	Silent	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:122682808G>A	ENST00000337677.5	-	5	655	c.97C>T	c.(97-99)Cta>Tta	p.L33L	TMEM155_ENST00000394396.1_Silent_p.L33L|TMEM155_ENST00000394394.1_Silent_p.L33L|AC079341.1_ENST00000424958.1_5'Flank	NM_152399.2	NP_689612.2	Q4W5P6	TM155_HUMAN	transmembrane protein 155	33						extracellular region (GO:0005576)		p.L33L(1)		breast(1)|lung(5)	6						TTATTCTGTAGAATCGCACCA	0.433																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											76.0	75.0	75.0					4																	122682808		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055396	CCDS3721.1	4q27	2008-02-05			ENSG00000164112	ENSG00000164112			26418	protein-coding gene	gene with protein product							Standard	NM_152399		Approved	FLJ30834	uc003idx.1	Q4W5P6	OTTHUMG00000133035	ENST00000337677.5:c.97C>T	4.37:g.122682808G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNW9|Q96NI2	Silent	SNP	NULL	p.L33	ENST00000337677.5	37	c.97	CCDS3721.1	4																																																																																			TMEM155	-	NULL	ENSG00000164112		0.433	TMEM155-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM155	HGNC	protein_coding	OTTHUMT00000256637.2	109	0.00	0	G	NM_152399		122682808	122682808	-1	no_errors	ENST00000337677	ensembl	human	known	69_37n	silent	73	29.81	31	SNP	0.090	A
TNIP1	10318	genome.wustl.edu	37	5	150439923	150439923	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:150439923C>T	ENST00000389378.2	-	5	979	c.391G>A	c.(391-393)Gag>Aag	p.E131K	TNIP1_ENST00000524280.1_Missense_Mutation_p.E131K|TNIP1_ENST00000522226.1_Missense_Mutation_p.E131K|TNIP1_ENST00000315050.7_Missense_Mutation_p.E131K|TNIP1_ENST00000518977.1_Missense_Mutation_p.E131K|TNIP1_ENST00000523200.1_Missense_Mutation_p.E131K|TNIP1_ENST00000521591.1_Missense_Mutation_p.E131K|TNIP1_ENST00000523338.1_Missense_Mutation_p.E131K|TNIP1_ENST00000520931.1_Missense_Mutation_p.E78K	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	131	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.E131K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCTGCTCCTCAGGAGTGACC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	83.0	84.0					5																	150439923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.391G>A	5.37:g.150439923C>T	ENSP00000374029:p.Glu131Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E131K	ENST00000389378.2	37	c.391	CCDS34280.1	5	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062561	0.55432	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100;ENST00000520695;ENST00000521001	T;T;T;T;T;T;T;T;T;T;T;T	0.54866	2.43;2.46;2.46;2.46;2.46;2.46;2.46;2.48;2.48;2.23;0.55;0.56	5.24	5.24	0.73138	.	0.633271	0.17108	N	0.186722	T	0.51856	0.1699	M	0.64997	1.995	0.50813	D	0.999891	P;B;P;B;B;B;B	0.42692	0.51;0.383;0.787;0.383;0.196;0.348;0.348	B;B;B;B;B;B;B	0.37387	0.154;0.231;0.23;0.248;0.167;0.156;0.22	T	0.60801	-0.7191	10	0.87932	D	0	-17.6494	15.9161	0.79521	0.0:1.0:0.0:0.0	.	131;85;85;131;131;131;131	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	K	78;131;131;131;88;88;93;131;131;131;131;131;88;78;131;131	ENSP00000429891:E78K;ENSP00000374029:E131K;ENSP00000317891:E131K;ENSP00000428243:E131K;ENSP00000428187:E131K;ENSP00000430760:E131K;ENSP00000430971:E131K;ENSP00000429912:E131K;ENSP00000431105:E131K;ENSP00000428487:E78K;ENSP00000430279:E131K;ENSP00000428404:E131K	ENSP00000317891:E131K	E	-	1	0	TNIP1	150420116	0.942000	0.31987	0.989000	0.46669	0.282000	0.26991	3.761000	0.55242	2.595000	0.87683	0.655000	0.94253	GAG	TNIP1	-	NULL	ENSG00000145901		0.582	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1	80	0.00	0	C	NM_006058		150439923	150439923	-1	no_errors	ENST00000315050	ensembl	human	known	69_37n	missense	29	27.50	11	SNP	0.992	T
TNIP1	10318	genome.wustl.edu	37	5	150439923	150439923	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr5:150439923C>T	ENST00000389378.2	-	5	979	c.391G>A	c.(391-393)Gag>Aag	p.E131K	TNIP1_ENST00000524280.1_Missense_Mutation_p.E131K|TNIP1_ENST00000522226.1_Missense_Mutation_p.E131K|TNIP1_ENST00000315050.7_Missense_Mutation_p.E131K|TNIP1_ENST00000518977.1_Missense_Mutation_p.E131K|TNIP1_ENST00000523200.1_Missense_Mutation_p.E131K|TNIP1_ENST00000521591.1_Missense_Mutation_p.E131K|TNIP1_ENST00000523338.1_Missense_Mutation_p.E131K|TNIP1_ENST00000520931.1_Missense_Mutation_p.E78K	NM_001252385.1|NM_001252393.1|NM_001258454.1|NM_006058.4	NP_001239314.1|NP_001239322.1|NP_001245383.1|NP_006049.3	Q15025	TNIP1_HUMAN	TNFAIP3 interacting protein 1	131	Interacts with Nef.				defense response (GO:0006952)|glycoprotein biosynthetic process (GO:0009101)|inflammatory response (GO:0006954)|leukocyte cell-cell adhesion (GO:0007159)|modulation by symbiont of host I-kappaB kinase/NF-kappaB cascade (GO:0085032)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of viral genome replication (GO:0045071)|positive regulation of inflammatory response (GO:0050729)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|translation (GO:0006412)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	mitogen-activated protein kinase binding (GO:0051019)	p.E131K(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(5)|ovary(2)|prostate(2)|skin(3)	23		Medulloblastoma(196;0.0911)|all_hematologic(541;0.207)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTCTGCTCCTCAGGAGTGACC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	83.0	84.0					5																	150439923		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011895	CCDS34280.1, CCDS58982.1, CCDS58983.1, CCDS58984.1, CCDS58985.1, CCDS75359.1	5q32-q33.1	2008-07-18							16903	protein-coding gene	gene with protein product	"""virion-associated nuclear-shuttling protein"", ""Nef-associated factor 1 SNP"""	607714				9923610, 11090181	Standard	NM_001252385		Approved	NAF1, KIAA0113, ABIN-1, VAN	uc003ltj.3	Q15025		ENST00000389378.2:c.391G>A	5.37:g.150439923C>T	ENSP00000374029:p.Glu131Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4F1W8|A4F1W9|A4F1X2|A4F1X4|A4F1X5|A4F1X6|A4F1X7|A4F1X9|B7Z699|E7EPY1|E7ET96|O76008|Q05KP3|Q05KP4|Q6N077|Q96EL9|Q99833|Q9H1J3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E131K	ENST00000389378.2	37	c.391	CCDS34280.1	5	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062561	0.55432	.	.	ENSG00000145901	ENST00000520931;ENST00000389378;ENST00000315050;ENST00000523338;ENST00000544828;ENST00000417127;ENST00000539213;ENST00000522226;ENST00000521591;ENST00000518977;ENST00000524280;ENST00000523200;ENST00000545840;ENST00000522100;ENST00000520695;ENST00000521001	T;T;T;T;T;T;T;T;T;T;T;T	0.54866	2.43;2.46;2.46;2.46;2.46;2.46;2.46;2.48;2.48;2.23;0.55;0.56	5.24	5.24	0.73138	.	0.633271	0.17108	N	0.186722	T	0.51856	0.1699	M	0.64997	1.995	0.50813	D	0.999891	P;B;P;B;B;B;B	0.42692	0.51;0.383;0.787;0.383;0.196;0.348;0.348	B;B;B;B;B;B;B	0.37387	0.154;0.231;0.23;0.248;0.167;0.156;0.22	T	0.60801	-0.7191	10	0.87932	D	0	-17.6494	15.9161	0.79521	0.0:1.0:0.0:0.0	.	131;85;85;131;131;131;131	B7Z8K2;A4F1X9;A4F1X7;E7EPY1;E7ET96;A4F1W9;Q15025	.;.;.;.;.;.;TNIP1_HUMAN	K	78;131;131;131;88;88;93;131;131;131;131;131;88;78;131;131	ENSP00000429891:E78K;ENSP00000374029:E131K;ENSP00000317891:E131K;ENSP00000428243:E131K;ENSP00000428187:E131K;ENSP00000430760:E131K;ENSP00000430971:E131K;ENSP00000429912:E131K;ENSP00000431105:E131K;ENSP00000428487:E78K;ENSP00000430279:E131K;ENSP00000428404:E131K	ENSP00000317891:E131K	E	-	1	0	TNIP1	150420116	0.942000	0.31987	0.989000	0.46669	0.282000	0.26991	3.761000	0.55242	2.595000	0.87683	0.655000	0.94253	GAG	TNIP1	-	NULL	ENSG00000145901		0.582	TNIP1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP1	HGNC	protein_coding	OTTHUMT00000374914.1	80	0.00	0	C	NM_006058		150439923	150439923	-1	no_errors	ENST00000315050	ensembl	human	known	69_37n	missense	48	25.00	16	SNP	0.992	T
TRIM51	84767	genome.wustl.edu	37	11	55653691	55653691	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:55653691G>A	ENST00000449290.2	+	3	596	c.504G>A	c.(502-504)tgG>tgA	p.W168*	TRIM51_ENST00000244891.3_Nonsense_Mutation_p.W25*	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	168						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.W168*(1)|p.W9*(1)									CCAGATGCTGGAAGGTTAGTA	0.398																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											91.0	91.0	91.0					11																	55653691		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.504G>A	11.37:g.55653691G>A	ENSP00000395086:p.Trp168*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMG2	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.W168*	ENST00000449290.2	37	c.504		11	.	.	.	.	.	.	.	.	.	.	.	9.668	1.146031	0.21288	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	168;25	.	ENSP00000244891:W25X	W	+	3	0	SPRYD5	55410267	0.892000	0.30473	0.107000	0.21349	0.117000	0.20001	0.793000	0.26944	0.149000	0.19098	0.152000	0.16155	TGG	TRIM51	-	NULL	ENSG00000124900		0.398	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	TRIM51	HGNC	protein_coding	OTTHUMT00000391522.1	204	0.00	0	G	NM_032681		55653691	55653691	+1	no_errors	ENST00000449290	ensembl	human	known	69_37n	nonsense	166	14.87	29	SNP	0.117	A
TRIM51	84767	genome.wustl.edu	37	11	55653691	55653691	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:55653691G>A	ENST00000449290.2	+	3	596	c.504G>A	c.(502-504)tgG>tgA	p.W168*	TRIM51_ENST00000244891.3_Nonsense_Mutation_p.W25*	NM_032681.3	NP_116070.2	Q9BSJ1	TRI51_HUMAN	tripartite motif-containing 51	168						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.W168*(1)|p.W9*(1)									CCAGATGCTGGAAGGTTAGTA	0.398																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											91.0	91.0	91.0					11																	55653691		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			BC005014		11p11	2013-01-09	2012-05-18	2012-05-18	ENSG00000124900	ENSG00000124900		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19023	protein-coding gene	gene with protein product			"""SPRY domain containing 5"""	SPRYD5			Standard	NM_032681		Approved	TRIM51A	uc010rip.2	Q9BSJ1	OTTHUMG00000156437	ENST00000449290.2:c.504G>A	11.37:g.55653691G>A	ENSP00000395086:p.Trp168*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMG2	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.W168*	ENST00000449290.2	37	c.504		11	.	.	.	.	.	.	.	.	.	.	.	9.668	1.146031	0.21288	.	.	ENSG00000124900	ENST00000449290;ENST00000244891	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	168;25	.	ENSP00000244891:W25X	W	+	3	0	SPRYD5	55410267	0.892000	0.30473	0.107000	0.21349	0.117000	0.20001	0.793000	0.26944	0.149000	0.19098	0.152000	0.16155	TGG	TRIM51	-	NULL	ENSG00000124900		0.398	TRIM51-004	KNOWN	basic|appris_principal	protein_coding	TRIM51	HGNC	protein_coding	OTTHUMT00000391522.1	204	0.00	0	G	NM_032681		55653691	55653691	+1	no_errors	ENST00000449290	ensembl	human	known	69_37n	nonsense	89	16.04	17	SNP	0.117	A
TRIP12	9320	genome.wustl.edu	37	2	230678948	230678948	+	Splice_Site	DEL	C	C	-			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:230678948delC	ENST00000283943.5	-	11	1859		c.e11+1		TRIP12_ENST00000389045.3_Splice_Site|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Splice_Site	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACAACACTTACCGCCTGTAGA	0.403																																						dbGAP											1	Unknown(1)	breast(1)											144.0	139.0	141.0					2																	230678948		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1680+1G>-	2.37:g.230678948delC		Somatic		WXS	Illumina GAIIx	Phase_IV	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Splice_Site	DEL	-	e10+1	ENST00000283943.5	37	c.1680+1	CCDS33391.1	2																																																																																			TRIP12	-	-	ENSG00000153827		0.403	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	85	0.00	0	C	NM_004238	Intron	230678948	230678948	-1	no_errors	ENST00000283943	ensembl	human	known	69_37n	splice_site_del	103	22.56	30	DEL	1.000	-
TRIP12	9320	genome.wustl.edu	37	2	230678948	230678948	+	Splice_Site	DEL	C	C	-			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:230678948delC	ENST00000283943.5	-	11	1859		c.e11+1		TRIP12_ENST00000389045.3_Splice_Site|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389044.4_Splice_Site	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)	p.?(1)		breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		ACAACACTTACCGCCTGTAGA	0.403																																						dbGAP											1	Unknown(1)	breast(1)											144.0	139.0	141.0					2																	230678948		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.1680+1G>-	2.37:g.230678948delC		Somatic		WXS	Illumina GAIIx	Phase_IV	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Splice_Site	DEL	-	e10+1	ENST00000283943.5	37	c.1680+1	CCDS33391.1	2																																																																																			TRIP12	-	-	ENSG00000153827		0.403	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	85	0.00	0	C	NM_004238	Intron	230678948	230678948	-1	no_errors	ENST00000283943	ensembl	human	known	69_37n	splice_site_del	60	27.71	23	DEL	1.000	-
TRMT6	51605	genome.wustl.edu	37	20	5921753	5921753	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:5921753C>T	ENST00000203001.2	-	10	1378	c.1248G>A	c.(1246-1248)gaG>gaA	p.E416E	TRMT6_ENST00000473131.1_5'UTR|TRMT6_ENST00000453074.2_Silent_p.E246E	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	416					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.E416E(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						CCCCTCCCCTCTCCCGCAGTT	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											153.0	147.0	149.0					20																	5921753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.1248G>A	20.37:g.5921753C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Silent	SNP	pfam_EIF3_gamma,pirsf_tRNA_m1A_mtfrase	p.E416	ENST00000203001.2	37	c.1248	CCDS13093.1	20																																																																																			TRMT6	-	pirsf_tRNA_m1A_mtfrase	ENSG00000089195		0.483	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT6	HGNC	protein_coding	OTTHUMT00000077889.2	142	0.00	0	C			5921753	5921753	-1	no_errors	ENST00000203001	ensembl	human	known	69_37n	silent	124	22.01	35	SNP	0.997	T
TRMT6	51605	genome.wustl.edu	37	20	5921753	5921753	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:5921753C>T	ENST00000203001.2	-	10	1378	c.1248G>A	c.(1246-1248)gaG>gaA	p.E416E	TRMT6_ENST00000473131.1_5'UTR|TRMT6_ENST00000453074.2_Silent_p.E246E	NM_015939.3	NP_057023.2	Q9UJA5	TRM6_HUMAN	tRNA methyltransferase 6 homolog (S. cerevisiae)	416					regulation of translational initiation (GO:0006446)|tRNA processing (GO:0008033)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|translation initiation factor activity (GO:0003743)	p.E416E(1)		breast(2)|endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)	15						CCCCTCCCCTCTCCCGCAGTT	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											153.0	147.0	149.0					20																	5921753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000613	CCDS13093.1, CCDS63225.1	20p12.3	2009-01-12			ENSG00000089195	ENSG00000089195			20900	protein-coding gene	gene with protein product						16043508	Standard	NM_001281467		Approved	GCD10, MGC5029, Gcd10p, CGI-09	uc002wmh.1	Q9UJA5	OTTHUMG00000031816	ENST00000203001.2:c.1248G>A	20.37:g.5921753C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUV6|Q76P92|Q9BQV5|Q9ULR7|Q9Y2Z8	Silent	SNP	pfam_EIF3_gamma,pirsf_tRNA_m1A_mtfrase	p.E416	ENST00000203001.2	37	c.1248	CCDS13093.1	20																																																																																			TRMT6	-	pirsf_tRNA_m1A_mtfrase	ENSG00000089195		0.483	TRMT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT6	HGNC	protein_coding	OTTHUMT00000077889.2	142	0.00	0	C			5921753	5921753	-1	no_errors	ENST00000203001	ensembl	human	known	69_37n	silent	70	26.32	25	SNP	0.997	T
TRPM8	79054	genome.wustl.edu	37	2	234878931	234878931	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:234878931C>T	ENST00000324695.4	+	17	2256	c.2216C>T	c.(2215-2217)tCc>tTc	p.S739F	TRPM8_ENST00000433712.2_Intron	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	739					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.S739F(1)		breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GTGGTCTTCTCCTGGAATGTG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											458.0	394.0	415.0					2																	234878931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2216C>T	2.37:g.234878931C>T	ENSP00000323926:p.Ser739Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.S739F	ENST00000324695.4	37	c.2216	CCDS33407.1	2	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223524	0.39300	.	.	ENSG00000144481	ENST00000324695	T	0.60171	0.21	4.72	4.72	0.59763	.	0.097205	0.46145	D	0.000309	T	0.65647	0.2711	L	0.41236	1.265	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.58451	-0.7634	10	0.10636	T	0.68	-24.9985	16.6947	0.85332	0.0:1.0:0.0:0.0	.	739	Q7Z2W7	TRPM8_HUMAN	F	739	ENSP00000323926:S739F	ENSP00000323926:S739F	S	+	2	0	TRPM8	234543670	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.461000	0.45040	2.357000	0.79964	0.558000	0.71614	TCC	TRPM8	-	NULL	ENSG00000144481		0.547	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	HGNC	protein_coding	OTTHUMT00000131005.4	273	0.00	0	C	NM_024080		234878931	234878931	+1	no_errors	ENST00000324695	ensembl	human	known	69_37n	missense	144	22.58	42	SNP	1.000	T
TRPM8	79054	genome.wustl.edu	37	2	234878931	234878931	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:234878931C>T	ENST00000324695.4	+	17	2256	c.2216C>T	c.(2215-2217)tCc>tTc	p.S739F	TRPM8_ENST00000433712.2_Intron	NM_024080.4	NP_076985.4	Q7Z2W7	TRPM8_HUMAN	transient receptor potential cation channel, subfamily M, member 8	739					calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|protein homotetramerization (GO:0051289)|protein homotrimerization (GO:0070207)|response to cold (GO:0009409)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.S739F(1)		breast(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(2)|lung(27)|prostate(2)|skin(7)|stomach(2)	66		Breast(86;0.00205)|Renal(207;0.00694)|all_lung(227;0.0129)|Lung NSC(271;0.0408)|all_hematologic(139;0.0753)|Acute lymphoblastic leukemia(138;0.224)		Epithelial(121;1.19e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000139)|Lung(119;0.00758)|LUSC - Lung squamous cell carcinoma(224;0.0108)	Menthol(DB00825)	GTGGTCTTCTCCTGGAATGTG	0.547																																						dbGAP											1	Substitution - Missense(1)	breast(1)											458.0	394.0	415.0					2																	234878931		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005538	CCDS33407.1	2q37	2011-12-14			ENSG00000144481	ENSG00000144481		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17961	protein-coding gene	gene with protein product		606678				16382100	Standard	NM_024080		Approved		uc002vvh.3	Q7Z2W7	OTTHUMG00000059129	ENST00000324695.4:c.2216C>T	2.37:g.234878931C>T	ENSP00000323926:p.Ser739Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVG2|Q3YFM7|Q6QNH9|Q8TAC3|Q8TDX8|Q9BVK1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.S739F	ENST00000324695.4	37	c.2216	CCDS33407.1	2	.	.	.	.	.	.	.	.	.	.	C	13.39	2.223524	0.39300	.	.	ENSG00000144481	ENST00000324695	T	0.60171	0.21	4.72	4.72	0.59763	.	0.097205	0.46145	D	0.000309	T	0.65647	0.2711	L	0.41236	1.265	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.58451	-0.7634	10	0.10636	T	0.68	-24.9985	16.6947	0.85332	0.0:1.0:0.0:0.0	.	739	Q7Z2W7	TRPM8_HUMAN	F	739	ENSP00000323926:S739F	ENSP00000323926:S739F	S	+	2	0	TRPM8	234543670	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	2.461000	0.45040	2.357000	0.79964	0.558000	0.71614	TCC	TRPM8	-	NULL	ENSG00000144481		0.547	TRPM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM8	HGNC	protein_coding	OTTHUMT00000131005.4	273	0.00	0	C	NM_024080		234878931	234878931	+1	no_errors	ENST00000324695	ensembl	human	known	69_37n	missense	238	21.19	64	SNP	1.000	T
TSHZ2	128553	genome.wustl.edu	37	20	51872856	51872856	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:51872856G>A	ENST00000371497.5	+	2	3746	c.2859G>A	c.(2857-2859)atG>atA	p.M953I	TSHZ2_ENST00000603338.2_Missense_Mutation_p.M950I|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.M950I	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	953					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M953I(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GTTTCCAAATGAAGGACATGA	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	77.0	77.0					20																	51872856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2859G>A	20.37:g.51872856G>A	ENSP00000360552:p.Met953Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.M953I	ENST00000371497.5	37	c.2859	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106821	0.37145	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.12774	2.65;2.65	5.7	5.7	0.88788	Zinc finger, C2H2 (1);	0.039076	0.85682	D	0.000000	T	0.07369	0.0186	N	0.02011	-0.69	0.54753	D	0.999989	B	0.17268	0.021	B	0.15870	0.014	T	0.42241	-0.9463	10	0.34782	T	0.22	-4.5602	19.8272	0.96622	0.0:0.0:1.0:0.0	.	953	Q9NRE2	TSH2_HUMAN	I	953;950;479	ENSP00000360552:M953I;ENSP00000333114:M950I	ENSP00000333114:M950I	M	+	3	0	TSHZ2	51306263	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.392000	0.66272	2.685000	0.91497	0.643000	0.83706	ATG	TSHZ2	-	pfscan_Znf_C2H2	ENSG00000182463		0.517	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	91	0.00	0	G	NM_173485		51872856	51872856	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	missense	59	20.27	15	SNP	1.000	A
TSHZ2	128553	genome.wustl.edu	37	20	51872856	51872856	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:51872856G>A	ENST00000371497.5	+	2	3746	c.2859G>A	c.(2857-2859)atG>atA	p.M953I	TSHZ2_ENST00000603338.2_Missense_Mutation_p.M950I|RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000329613.6_Missense_Mutation_p.M950I	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	953					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.M953I(1)		NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			GTTTCCAAATGAAGGACATGA	0.517																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	77.0	77.0					20																	51872856		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.2859G>A	20.37:g.51872856G>A	ENSP00000360552:p.Met953Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.M953I	ENST00000371497.5	37	c.2859	CCDS33490.1	20	.	.	.	.	.	.	.	.	.	.	G	13.00	2.106821	0.37145	.	.	ENSG00000182463	ENST00000371497;ENST00000329613;ENST00000450262	T;T	0.12774	2.65;2.65	5.7	5.7	0.88788	Zinc finger, C2H2 (1);	0.039076	0.85682	D	0.000000	T	0.07369	0.0186	N	0.02011	-0.69	0.54753	D	0.999989	B	0.17268	0.021	B	0.15870	0.014	T	0.42241	-0.9463	10	0.34782	T	0.22	-4.5602	19.8272	0.96622	0.0:0.0:1.0:0.0	.	953	Q9NRE2	TSH2_HUMAN	I	953;950;479	ENSP00000360552:M953I;ENSP00000333114:M950I	ENSP00000333114:M950I	M	+	3	0	TSHZ2	51306263	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.392000	0.66272	2.685000	0.91497	0.643000	0.83706	ATG	TSHZ2	-	pfscan_Znf_C2H2	ENSG00000182463		0.517	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	91	0.00	0	G	NM_173485		51872856	51872856	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	missense	93	21.19	25	SNP	1.000	A
TSHZ3	57616	genome.wustl.edu	37	19	31768347	31768347	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:31768347G>C	ENST00000240587.4	-	2	2679	c.2352C>G	c.(2350-2352)gtC>gtG	p.V784V		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	784					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V601V(1)|p.V784V(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGTCGTTGTTGACGTGGTAGA	0.587																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											107.0	90.0	95.0					19																	31768347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2352C>G	19.37:g.31768347G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.V784	ENST00000240587.4	37	c.2352	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.587	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	88	0.00	0	G	NM_020856		31768347	31768347	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	silent	53	23.19	16	SNP	0.965	C
TSHZ3	57616	genome.wustl.edu	37	19	31768347	31768347	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:31768347G>C	ENST00000240587.4	-	2	2679	c.2352C>G	c.(2350-2352)gtC>gtG	p.V784V		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	784					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.V601V(1)|p.V784V(1)		breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					GGTCGTTGTTGACGTGGTAGA	0.587																																						dbGAP											2	Substitution - coding silent(2)	breast(2)											107.0	90.0	95.0					19																	31768347		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.2352C>G	19.37:g.31768347G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.V784	ENST00000240587.4	37	c.2352	CCDS12421.2	19																																																																																			TSHZ3	-	NULL	ENSG00000121297		0.587	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	88	0.00	0	G	NM_020856		31768347	31768347	-1	no_errors	ENST00000240587	ensembl	human	known	69_37n	silent	85	19.05	20	SNP	0.965	C
TTC26	79989	genome.wustl.edu	37	7	138865859	138865859	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:138865859G>C	ENST00000464848.1	+	16	1414	c.1334G>C	c.(1333-1335)aGa>aCa	p.R445T	TTC26_ENST00000495038.1_Missense_Mutation_p.R314T|TTC26_ENST00000343187.4_Missense_Mutation_p.R414T|TTC26_ENST00000478836.2_Missense_Mutation_p.R338T|TTC26_ENST00000430935.1_Missense_Mutation_p.R445T			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	445					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)		p.R445T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						AAGAAACCAAGACTAGCCTGG	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	86.0	85.0					7																	138865859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.1334G>C	7.37:g.138865859G>C	ENSP00000419279:p.Arg445Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.R445T	ENST00000464848.1	37	c.1334	CCDS5852.1	7	.	.	.	.	.	.	.	.	.	.	G	14.02	2.411566	0.42817	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000478836;ENST00000464848;ENST00000343187	T;T;T;T;T	0.62498	0.02;1.21;1.21;1.21;1.21	5.72	3.92	0.45320	Tetratricopeptide-like helical (1);	0.239928	0.42172	D	0.000752	T	0.58779	0.2146	M	0.67953	2.075	0.46203	D	0.998923	B;B;P;B	0.36282	0.129;0.403;0.546;0.18	B;B;B;B	0.35550	0.027;0.12;0.205;0.083	T	0.59156	-0.7507	10	0.46703	T	0.11	.	11.7345	0.51757	0.1454:0.0:0.8546:0.0	.	314;414;445;445	B7Z2T3;F8W724;C9J2N7;A0AVF1	.;.;.;TTC26_HUMAN	T	445;314;338;445;414	ENSP00000410655:R445T;ENSP00000418788:R314T;ENSP00000419178:R338T;ENSP00000419279:R445T;ENSP00000339135:R414T	ENSP00000339135:R414T	R	+	2	0	TTC26	138516399	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.121000	0.57904	0.888000	0.36160	0.650000	0.86243	AGA	TTC26	-	NULL	ENSG00000105948		0.363	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC26	HGNC	protein_coding	OTTHUMT00000348919.2	131	0.00	0	G	NM_024926		138865859	138865859	+1	no_errors	ENST00000464848	ensembl	human	known	69_37n	missense	100	23.66	31	SNP	1.000	C
TTC26	79989	genome.wustl.edu	37	7	138865859	138865859	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:138865859G>C	ENST00000464848.1	+	16	1414	c.1334G>C	c.(1333-1335)aGa>aCa	p.R445T	TTC26_ENST00000495038.1_Missense_Mutation_p.R314T|TTC26_ENST00000343187.4_Missense_Mutation_p.R414T|TTC26_ENST00000478836.2_Missense_Mutation_p.R338T|TTC26_ENST00000430935.1_Missense_Mutation_p.R445T			A0AVF1	TTC26_HUMAN	tetratricopeptide repeat domain 26	445					cilium assembly (GO:0042384)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|intraciliary transport particle B (GO:0030992)|primary cilium (GO:0072372)		p.R445T(1)		breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	24						AAGAAACCAAGACTAGCCTGG	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											83.0	86.0	85.0					7																	138865859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022633	CCDS5852.1, CCDS55172.1, CCDS55173.1, CCDS75665.1	7q34	2013-01-11			ENSG00000105948	ENSG00000105948		"""Intraflagellar transport homologs"", ""Tetratricopeptide (TTC) repeat domain containing"""	21882	protein-coding gene	gene with protein product							Standard	NM_001144920		Approved	FLJ12571, dyf-13, DYF13	uc003vus.2	A0AVF1	OTTHUMG00000157472	ENST00000464848.1:c.1334G>C	7.37:g.138865859G>C	ENSP00000419279:p.Arg445Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1S3|B7Z5M0|C9J2N7|F8W724|Q9H9S8|Q9NTC0	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR-contain_dom	p.R445T	ENST00000464848.1	37	c.1334	CCDS5852.1	7	.	.	.	.	.	.	.	.	.	.	G	14.02	2.411566	0.42817	.	.	ENSG00000105948	ENST00000430935;ENST00000495038;ENST00000478836;ENST00000464848;ENST00000343187	T;T;T;T;T	0.62498	0.02;1.21;1.21;1.21;1.21	5.72	3.92	0.45320	Tetratricopeptide-like helical (1);	0.239928	0.42172	D	0.000752	T	0.58779	0.2146	M	0.67953	2.075	0.46203	D	0.998923	B;B;P;B	0.36282	0.129;0.403;0.546;0.18	B;B;B;B	0.35550	0.027;0.12;0.205;0.083	T	0.59156	-0.7507	10	0.46703	T	0.11	.	11.7345	0.51757	0.1454:0.0:0.8546:0.0	.	314;414;445;445	B7Z2T3;F8W724;C9J2N7;A0AVF1	.;.;.;TTC26_HUMAN	T	445;314;338;445;414	ENSP00000410655:R445T;ENSP00000418788:R314T;ENSP00000419178:R338T;ENSP00000419279:R445T;ENSP00000339135:R414T	ENSP00000339135:R414T	R	+	2	0	TTC26	138516399	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.121000	0.57904	0.888000	0.36160	0.650000	0.86243	AGA	TTC26	-	NULL	ENSG00000105948		0.363	TTC26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC26	HGNC	protein_coding	OTTHUMT00000348919.2	131	0.00	0	G	NM_024926		138865859	138865859	+1	no_errors	ENST00000464848	ensembl	human	known	69_37n	missense	175	20.45	45	SNP	1.000	C
CFAP46	54777	genome.wustl.edu	37	10	134751139	134751139	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:134751139C>T	ENST00000368586.5	-	6	677	c.577G>A	c.(577-579)Gag>Aag	p.E193K	TTC40_ENST00000368585.3_Missense_Mutation_p.E193K|TTC40_ENST00000368582.2_Missense_Mutation_p.E193K	NM_001200049.2	NP_001186978.2												p.E193K(2)|p.E135K(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CTGGCAGCCTCCTCCTTTCTT	0.463																																						dbGAP											3	Substitution - Missense(3)	breast(3)											93.0	97.0	95.0					10																	134751139		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.577G>A	10.37:g.134751139C>T	ENSP00000357575:p.Glu193Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E193K	ENST00000368586.5	37	c.577	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	17.93	3.510280	0.64522	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	D;D;D	0.82711	-1.64;-1.64;-1.64	4.74	3.81	0.43845	.	0.627359	0.15465	N	0.260950	D	0.87192	0.6116	M	0.64997	1.995	0.25954	N	0.982711	P;D	0.61697	0.925;0.99	P;P	0.56398	0.54;0.797	T	0.80044	-0.1547	10	0.66056	D	0.02	.	13.873	0.63631	0.0:0.8452:0.1548:0.0	.	193;193	Q5SR76-2;Q5SR76-1	.;.	K	193	ENSP00000357575:E193K;ENSP00000357571:E193K;ENSP00000357574:E193K	ENSP00000357571:E193K	E	-	1	0	C10orf93	134601129	0.193000	0.23313	0.966000	0.40874	0.192000	0.23643	1.741000	0.38238	1.072000	0.40860	0.650000	0.86243	GAG	TTC40	-	NULL	ENSG00000171811		0.463	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	64	0.00	0	C			134751139	134751139	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	missense	42	25.00	14	SNP	0.998	T
CFAP46	54777	genome.wustl.edu	37	10	134751139	134751139	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:134751139C>T	ENST00000368586.5	-	6	677	c.577G>A	c.(577-579)Gag>Aag	p.E193K	TTC40_ENST00000368585.3_Missense_Mutation_p.E193K|TTC40_ENST00000368582.2_Missense_Mutation_p.E193K	NM_001200049.2	NP_001186978.2												p.E193K(2)|p.E135K(1)		breast(1)|endometrium(5)|lung(19)|urinary_tract(3)	28						CTGGCAGCCTCCTCCTTTCTT	0.463																																						dbGAP											3	Substitution - Missense(3)	breast(3)											93.0	97.0	95.0					10																	134751139		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000368586.5:c.577G>A	10.37:g.134751139C>T	ENSP00000357575:p.Glu193Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E193K	ENST00000368586.5	37	c.577	CCDS58101.1	10	.	.	.	.	.	.	.	.	.	.	C	17.93	3.510280	0.64522	.	.	ENSG00000171811	ENST00000368586;ENST00000368582;ENST00000368585	D;D;D	0.82711	-1.64;-1.64;-1.64	4.74	3.81	0.43845	.	0.627359	0.15465	N	0.260950	D	0.87192	0.6116	M	0.64997	1.995	0.25954	N	0.982711	P;D	0.61697	0.925;0.99	P;P	0.56398	0.54;0.797	T	0.80044	-0.1547	10	0.66056	D	0.02	.	13.873	0.63631	0.0:0.8452:0.1548:0.0	.	193;193	Q5SR76-2;Q5SR76-1	.;.	K	193	ENSP00000357575:E193K;ENSP00000357571:E193K;ENSP00000357574:E193K	ENSP00000357571:E193K	E	-	1	0	C10orf93	134601129	0.193000	0.23313	0.966000	0.40874	0.192000	0.23643	1.741000	0.38238	1.072000	0.40860	0.650000	0.86243	GAG	TTC40	-	NULL	ENSG00000171811		0.463	TTC40-001	PUTATIVE	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	TTC40	HGNC	protein_coding	OTTHUMT00000051095.3	64	0.00	0	C			134751139	134751139	-1	no_errors	ENST00000368582	ensembl	human	known	69_37n	missense	66	29.79	28	SNP	0.998	T
TTLL9	164395	genome.wustl.edu	37	20	30486275	30486275	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:30486275G>A	ENST00000375938.4	+	4	366		c.e4-1		TTLL9_ENST00000375921.2_Splice_Site|TTLL9_ENST00000375934.4_Splice_Site|TTLL9_ENST00000310998.4_Splice_Site|TTLL9_ENST00000375922.4_Splice_Site|RNU1-94P_ENST00000362627.1_RNA|TTLL9_ENST00000535842.1_Splice_Site			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9						cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.?(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TTGTCTTGCAGAGAGCAGAGA	0.498																																						dbGAP											2	Unknown(2)	breast(2)											100.0	99.0	99.0					20																	30486275		2033	4189	6222	-	-	-	SO:0001630	splice_region_variant	0			AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.114-1G>A	20.37:g.30486275G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Splice_Site	SNP	-	e3-1	ENST00000375938.4	37	c.114-1	CCDS42863.1	20	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928545	0.73327	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000375935;ENST00000375934	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1125	0.72368	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTLL9	29949936	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.004000	0.63966	2.647000	0.89833	0.650000	0.86243	.	TTLL9	-	-	ENSG00000131044		0.498	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL9	HGNC	protein_coding		63	0.00	0	G	NM_001008409	Intron	30486275	30486275	+1	no_errors	ENST00000375938	ensembl	human	known	69_37n	splice_site	23	17.86	5	SNP	1.000	A
TTLL9	164395	genome.wustl.edu	37	20	30486275	30486275	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr20:30486275G>A	ENST00000375938.4	+	4	366		c.e4-1		TTLL9_ENST00000375921.2_Splice_Site|TTLL9_ENST00000375934.4_Splice_Site|TTLL9_ENST00000310998.4_Splice_Site|TTLL9_ENST00000375922.4_Splice_Site|RNU1-94P_ENST00000362627.1_RNA|TTLL9_ENST00000535842.1_Splice_Site			Q3SXZ7	TTLL9_HUMAN	tubulin tyrosine ligase-like family, member 9						cellular protein modification process (GO:0006464)	cilium (GO:0005929)|cytoplasm (GO:0005737)|microtubule (GO:0005874)	ligase activity (GO:0016874)	p.?(2)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	26			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			TTGTCTTGCAGAGAGCAGAGA	0.498																																						dbGAP											2	Unknown(2)	breast(2)											100.0	99.0	99.0					20																	30486275		2033	4189	6222	-	-	-	SO:0001630	splice_region_variant	0			AL031658	CCDS42863.1	20q11	2013-02-14	2005-07-28	2005-07-28		ENSG00000131044		"""Tubulin tyrosine ligase-like family"""	16118	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 125"""	C20orf125		15890843	Standard	NM_001008409		Approved	dJ310O13.1	uc010gdx.1	Q3SXZ7		ENST00000375938.4:c.114-1G>A	20.37:g.30486275G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH06|A6NIS5|B3KSG8|Q3SXZ8|Q5JYS3|Q5JYS4	Splice_Site	SNP	-	e3-1	ENST00000375938.4	37	c.114-1	CCDS42863.1	20	.	.	.	.	.	.	.	.	.	.	G	19.99	3.928545	0.73327	.	.	ENSG00000131044	ENST00000375938;ENST00000535842;ENST00000375935;ENST00000375934	.	.	.	5.57	5.57	0.84162	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.1125	0.72368	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TTLL9	29949936	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	5.004000	0.63966	2.647000	0.89833	0.650000	0.86243	.	TTLL9	-	-	ENSG00000131044		0.498	TTLL9-205	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL9	HGNC	protein_coding		63	0.00	0	G	NM_001008409	Intron	30486275	30486275	+1	no_errors	ENST00000375938	ensembl	human	known	69_37n	splice_site	34	27.66	13	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179497091	179497091	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:179497091C>G	ENST00000591111.1	-	186	38831	c.38607G>C	c.(38605-38607)gaG>gaC	p.E12869D	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E5637D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E11942D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E5570D|TTN_ENST00000589042.1_Missense_Mutation_p.E14510D|TTN_ENST00000460472.2_Missense_Mutation_p.E5445D|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12869					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E11942D(2)|p.E5637D(1)|p.E5445D(1)|p.E5570D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTTCCTTCTCTTTGGCAG	0.398																																						dbGAP											5	Substitution - Missense(5)	breast(5)											75.0	68.0	70.0					2																	179497091		1870	4109	5979	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.38607G>C	2.37:g.179497091C>G	ENSP00000465570:p.Glu12869Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E11942D	ENST00000591111.1	37	c.35826		2	.	.	.	.	.	.	.	.	.	.	C	10.40	1.338415	0.24253	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	6.1	1.82	0.25136	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82930	0.5144	M	0.92169	3.28	0.39036	D	0.960046	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	D	0.84014	0.0350	9	0.87932	D	0	.	9.1579	0.37005	0.0:0.5722:0.0:0.4278	.	5445;5570;5637;12869	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	11942;5445;5637;5570;5445	ENSP00000343764:E11942D;ENSP00000434586:E5445D;ENSP00000340554:E5637D;ENSP00000352154:E5570D	ENSP00000340554:E5637D	E	-	3	2	TTN	179205336	0.993000	0.37304	1.000000	0.80357	0.992000	0.81027	0.276000	0.18716	0.458000	0.26988	0.650000	0.86243	GAG	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	158	0.00	0	C	NM_133378		179497091	179497091	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	146	23.96	46	SNP	0.996	G
TTN	7273	genome.wustl.edu	37	2	179497091	179497091	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:179497091C>G	ENST00000591111.1	-	186	38831	c.38607G>C	c.(38605-38607)gaG>gaC	p.E12869D	TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E5637D|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E11942D|TTN-AS1_ENST00000589907.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E5570D|TTN_ENST00000589042.1_Missense_Mutation_p.E14510D|TTN_ENST00000460472.2_Missense_Mutation_p.E5445D|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000589487.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12869					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)	p.E11942D(2)|p.E5637D(1)|p.E5445D(1)|p.E5570D(1)		NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CACTTTCCTTCTCTTTGGCAG	0.398																																						dbGAP											5	Substitution - Missense(5)	breast(5)											75.0	68.0	70.0					2																	179497091		1870	4109	5979	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.38607G>C	2.37:g.179497091C>G	ENSP00000465570:p.Glu12869Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E11942D	ENST00000591111.1	37	c.35826		2	.	.	.	.	.	.	.	.	.	.	C	10.40	1.338415	0.24253	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.70164	-0.46;-0.46;-0.46;-0.46	6.1	1.82	0.25136	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.82930	0.5144	M	0.92169	3.28	0.39036	D	0.960046	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.80764	0.994;0.994;0.994;0.994	D	0.84014	0.0350	9	0.87932	D	0	.	9.1579	0.37005	0.0:0.5722:0.0:0.4278	.	5445;5570;5637;12869	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	D	11942;5445;5637;5570;5445	ENSP00000343764:E11942D;ENSP00000434586:E5445D;ENSP00000340554:E5637D;ENSP00000352154:E5570D	ENSP00000340554:E5637D	E	-	3	2	TTN	179205336	0.993000	0.37304	1.000000	0.80357	0.992000	0.81027	0.276000	0.18716	0.458000	0.26988	0.650000	0.86243	GAG	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub	ENSG00000155657		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	158	0.00	0	C	NM_133378		179497091	179497091	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	227	21.18	61	SNP	0.996	G
TUBD1	51174	genome.wustl.edu	37	17	57968254	57968254	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:57968254C>G	ENST00000592426.1	-	1	110	c.110G>C	c.(109-111)aGa>aCa	p.R37T	TUBD1_ENST00000376094.4_Missense_Mutation_p.R37T|TUBD1_ENST00000394239.3_Missense_Mutation_p.R37T|TUBD1_ENST00000346141.6_Missense_Mutation_p.R37T|TUBD1_ENST00000325752.3_Missense_Mutation_p.R37T|TUBD1_ENST00000539018.1_Intron|RPS6KB1_ENST00000443572.2_5'Flank|RPS6KB1_ENST00000406116.3_5'Flank|TUBD1_ENST00000591611.1_5'UTR|TUBD1_ENST00000340993.6_Missense_Mutation_p.R37T|RPS6KB1_ENST00000225577.4_5'Flank|RPS6KB1_ENST00000393021.3_5'Flank			Q9UJT1	TBD_HUMAN	tubulin, delta 1	37					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R37T(1)		NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	CTCATTCTCTCTCATAGAGCA	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											193.0	179.0	184.0					17																	57968254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.110G>C	17.37:g.57968254C>G	ENSP00000468518:p.Arg37Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,prints_Delta_tubulin,prints_Tubulin,prints_Epsilon_tubulin	p.R37T	ENST00000592426.1	37	c.110	CCDS11620.1	17	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411986	0.42817	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000376094	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.74	1.27	0.21489	Tubulin/FtsZ, GTPase domain (3);	0.391485	0.26331	N	0.024984	T	0.52517	0.1739	L	0.36672	1.1	0.32219	N	0.575543	B;B;B;B;B	0.30973	0.014;0.302;0.175;0.004;0.004	B;B;B;B;B	0.30943	0.012;0.05;0.122;0.007;0.016	T	0.55964	-0.8057	10	0.51188	T	0.08	-10.46	9.2179	0.37360	0.0:0.4891:0.0:0.5109	.	37;37;37;37;37	E9PCA7;Q9UJT1-3;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;TBD_HUMAN	T	37	ENSP00000320797:R37T;ENSP00000342399:R37T;ENSP00000342561:R37T;ENSP00000377785:R37T;ENSP00000365262:R37T	ENSP00000320797:R37T	R	-	2	0	TUBD1	55323036	0.979000	0.34478	0.991000	0.47740	0.974000	0.67602	0.281000	0.18810	0.075000	0.16796	0.650000	0.86243	AGA	TUBD1	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase	ENSG00000108423		0.453	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBD1	HGNC	protein_coding	OTTHUMT00000448815.1	112	0.00	0	C	NM_016261		57968254	57968254	-1	no_errors	ENST00000325752	ensembl	human	known	69_37n	missense	150	15.73	28	SNP	0.988	G
TUBD1	51174	genome.wustl.edu	37	17	57968254	57968254	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr17:57968254C>G	ENST00000592426.1	-	1	110	c.110G>C	c.(109-111)aGa>aCa	p.R37T	TUBD1_ENST00000376094.4_Missense_Mutation_p.R37T|TUBD1_ENST00000394239.3_Missense_Mutation_p.R37T|TUBD1_ENST00000346141.6_Missense_Mutation_p.R37T|TUBD1_ENST00000325752.3_Missense_Mutation_p.R37T|TUBD1_ENST00000539018.1_Intron|RPS6KB1_ENST00000443572.2_5'Flank|RPS6KB1_ENST00000406116.3_5'Flank|TUBD1_ENST00000591611.1_5'UTR|TUBD1_ENST00000340993.6_Missense_Mutation_p.R37T|RPS6KB1_ENST00000225577.4_5'Flank|RPS6KB1_ENST00000393021.3_5'Flank			Q9UJT1	TBD_HUMAN	tubulin, delta 1	37					cell differentiation (GO:0030154)|microtubule-based process (GO:0007017)|multicellular organismal development (GO:0007275)|protein polymerization (GO:0051258)|spermatogenesis (GO:0007283)	centriole (GO:0005814)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.R37T(1)		NS(2)|breast(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(2)|skin(1)|stomach(2)	21	all_cancers(5;3.18e-13)|Breast(5;2.91e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;9.34e-13)|all cancers(12;1.91e-11)		Vinblastine(DB00570)	CTCATTCTCTCTCATAGAGCA	0.453																																						dbGAP											1	Substitution - Missense(1)	breast(1)											193.0	179.0	184.0					17																	57968254		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF201333	CCDS11620.1, CCDS54151.1, CCDS54152.1, CCDS54153.1, CCDS54154.1	17q23.1	2007-03-16						"""Tubulins"""	16811	protein-coding gene	gene with protein product		607344				10620804	Standard	NM_016261		Approved	FLJ12709, TUBD	uc002ixw.2	Q9UJT1		ENST00000592426.1:c.110G>C	17.37:g.57968254C>G	ENSP00000468518:p.Arg37Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPT8|B4DW01|D3DU02|E9PCA7|E9PCQ8|Q5KU36|Q9BWG9|Q9H7Z8	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,prints_Delta_tubulin,prints_Tubulin,prints_Epsilon_tubulin	p.R37T	ENST00000592426.1	37	c.110	CCDS11620.1	17	.	.	.	.	.	.	.	.	.	.	C	14.02	2.411986	0.42817	.	.	ENSG00000108423	ENST00000325752;ENST00000340993;ENST00000346141;ENST00000394239;ENST00000376094	T;T;T;T;T	0.67345	-0.26;-0.26;-0.26;-0.26;-0.26	5.74	1.27	0.21489	Tubulin/FtsZ, GTPase domain (3);	0.391485	0.26331	N	0.024984	T	0.52517	0.1739	L	0.36672	1.1	0.32219	N	0.575543	B;B;B;B;B	0.30973	0.014;0.302;0.175;0.004;0.004	B;B;B;B;B	0.30943	0.012;0.05;0.122;0.007;0.016	T	0.55964	-0.8057	10	0.51188	T	0.08	-10.46	9.2179	0.37360	0.0:0.4891:0.0:0.5109	.	37;37;37;37;37	E9PCA7;Q9UJT1-3;E9PCQ8;Q9UJT1-2;Q9UJT1	.;.;.;.;TBD_HUMAN	T	37	ENSP00000320797:R37T;ENSP00000342399:R37T;ENSP00000342561:R37T;ENSP00000377785:R37T;ENSP00000365262:R37T	ENSP00000320797:R37T	R	-	2	0	TUBD1	55323036	0.979000	0.34478	0.991000	0.47740	0.974000	0.67602	0.281000	0.18810	0.075000	0.16796	0.650000	0.86243	AGA	TUBD1	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase	ENSG00000108423		0.453	TUBD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBD1	HGNC	protein_coding	OTTHUMT00000448815.1	112	0.00	0	C	NM_016261		57968254	57968254	-1	no_errors	ENST00000325752	ensembl	human	known	69_37n	missense	99	15.38	18	SNP	0.988	G
UPP2	151531	genome.wustl.edu	37	2	158991285	158991285	+	Silent	SNP	C	C	G	rs144944982		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:158991285C>G	ENST00000005756.4	+	7	1031	c.837C>G	c.(835-837)ctC>ctG	p.L279L	UPP2_ENST00000460456.1_3'UTR|UPP2_ENST00000605860.1_Silent_p.L336L|UPP2_ENST00000409859.4_Silent_p.L336L|UPP2-IT1_ENST00000439185.1_RNA	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	279					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)	p.L279L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	TGACACTTCTCGACAGACTCG	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											161.0	136.0	144.0					2																	158991285		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.837C>G	2.37:g.158991285C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV87	Silent	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	p.L336	ENST00000005756.4	37	c.1008	CCDS2207.1	2																																																																																			UPP2	-	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	ENSG00000007001		0.483	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPP2	HGNC	protein_coding	OTTHUMT00000254929.2	89	0.00	0	C	NM_173355		158991285	158991285	+1	no_errors	ENST00000409859	ensembl	human	known	69_37n	silent	37	35.09	20	SNP	0.004	G
UPP2	151531	genome.wustl.edu	37	2	158991285	158991285	+	Silent	SNP	C	C	G	rs144944982		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:158991285C>G	ENST00000005756.4	+	7	1031	c.837C>G	c.(835-837)ctC>ctG	p.L279L	UPP2_ENST00000460456.1_3'UTR|UPP2_ENST00000605860.1_Silent_p.L336L|UPP2_ENST00000409859.4_Silent_p.L336L|UPP2-IT1_ENST00000439185.1_RNA	NM_173355.3	NP_775491.1	O95045	UPP2_HUMAN	uridine phosphorylase 2	279					nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)|type III intermediate filament (GO:0045098)	uridine phosphorylase activity (GO:0004850)	p.L279L(1)		breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	31					Fluorouracil(DB00544)	TGACACTTCTCGACAGACTCG	0.483																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											161.0	136.0	144.0					2																	158991285		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY225131	CCDS2207.1, CCDS46435.1	2q24.2	2008-02-05			ENSG00000007001	ENSG00000007001			23061	protein-coding gene	gene with protein product						12849978	Standard	NM_173355		Approved	UPASE2, UP2, UDRPASE2	uc002tzo.3	O95045	OTTHUMG00000131969	ENST00000005756.4:c.837C>G	2.37:g.158991285C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV87	Silent	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	p.L336	ENST00000005756.4	37	c.1008	CCDS2207.1	2																																																																																			UPP2	-	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	ENSG00000007001		0.483	UPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPP2	HGNC	protein_coding	OTTHUMT00000254929.2	89	0.00	0	C	NM_173355		158991285	158991285	+1	no_errors	ENST00000409859	ensembl	human	known	69_37n	silent	58	30.95	26	SNP	0.004	G
USH2A	7399	genome.wustl.edu	37	1	216061968	216061968	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:216061968G>C	ENST00000307340.3	-	41	8409	c.8023C>G	c.(8023-8025)Ctc>Gtc	p.L2675V	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.L2675V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2675	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L2675V(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCCTCGGGAGAGTCACCAGG	0.458										HNSCC(13;0.011)																												dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	89.0	88.0					1																	216061968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8023C>G	1.37:g.216061968G>C	ENSP00000305941:p.Leu2675Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L2675V	ENST00000307340.3	37	c.8023	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876130	0.51801	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53857	0.6;0.6	5.84	3.94	0.45596	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.38548	N	0.001645	T	0.34716	0.0907	L	0.31664	0.95	0.37893	D	0.930786	P	0.39424	0.673	B	0.38327	0.271	T	0.16897	-1.0387	10	0.16420	T	0.52	.	6.4538	0.21918	0.2059:0.1329:0.6611:0.0	.	2675	O75445	USH2A_HUMAN	V	2675	ENSP00000305941:L2675V;ENSP00000355910:L2675V	ENSP00000305941:L2675V	L	-	1	0	USH2A	214128591	0.845000	0.29573	0.752000	0.31206	0.703000	0.40648	1.025000	0.30090	0.778000	0.33520	0.655000	0.94253	CTC	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	142	0.00	0	G	NM_007123		216061968	216061968	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	117	19.86	29	SNP	0.991	C
USH2A	7399	genome.wustl.edu	37	1	216061968	216061968	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:216061968G>C	ENST00000307340.3	-	41	8409	c.8023C>G	c.(8023-8025)Ctc>Gtc	p.L2675V	RP5-1111A8.3_ENST00000414995.1_RNA|USH2A_ENST00000366943.2_Missense_Mutation_p.L2675V	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2675	Fibronectin type-III 13. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.L2675V(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTCCTCGGGAGAGTCACCAGG	0.458										HNSCC(13;0.011)																												dbGAP											1	Substitution - Missense(1)	breast(1)											85.0	89.0	88.0					1																	216061968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.8023C>G	1.37:g.216061968G>C	ENSP00000305941:p.Leu2675Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.L2675V	ENST00000307340.3	37	c.8023	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	15.58	2.876130	0.51801	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53857	0.6;0.6	5.84	3.94	0.45596	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.38548	N	0.001645	T	0.34716	0.0907	L	0.31664	0.95	0.37893	D	0.930786	P	0.39424	0.673	B	0.38327	0.271	T	0.16897	-1.0387	10	0.16420	T	0.52	.	6.4538	0.21918	0.2059:0.1329:0.6611:0.0	.	2675	O75445	USH2A_HUMAN	V	2675	ENSP00000305941:L2675V;ENSP00000355910:L2675V	ENSP00000305941:L2675V	L	-	1	0	USH2A	214128591	0.845000	0.29573	0.752000	0.31206	0.703000	0.40648	1.025000	0.30090	0.778000	0.33520	0.655000	0.94253	CTC	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.458	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	142	0.00	0	G	NM_007123		216061968	216061968	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	188	18.18	42	SNP	0.991	C
USP28	57646	genome.wustl.edu	37	11	113723334	113723334	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr11:113723334G>A	ENST00000003302.4	-	3	225	c.157C>T	c.(157-159)Cag>Tag	p.Q53*	USP28_ENST00000545540.1_Intron|USP28_ENST00000260188.5_Nonsense_Mutation_p.Q53*|USP28_ENST00000542033.1_5'UTR|USP28_ENST00000537706.1_Nonsense_Mutation_p.Q53*	NM_020886.2	NP_065937.1	Q96RU2	UBP28_HUMAN	ubiquitin specific peptidase 28	53					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|protein deubiquitination (GO:0016579)|response to ionizing radiation (GO:0010212)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(12)|lung(24)|ovary(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	59		all_cancers(61;3.74e-18)|all_epithelial(67;3.75e-11)|Melanoma(852;1.46e-05)|all_hematologic(158;4.65e-05)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|Prostate(24;0.0153)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|Epithelial(105;0.000122)|all cancers(92;0.00104)		CTGACTGCCTGAGTAATGTCA	0.403																																					Melanoma(4;162 555 7664)|GBM(79;500 2010 17506)|Esophageal Squamous(9;463 924 15765)	dbGAP											0													101.0	85.0	91.0					11																	113723334		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0			AB040948	CCDS31680.1, CCDS73394.1	11q23	2008-04-11	2005-08-08		ENSG00000048028	ENSG00000048028		"""Ubiquitin-specific peptidases"""	12625	protein-coding gene	gene with protein product		610748	"""ubiquitin specific protease 28"""			12838346, 11597335	Standard	XM_005271630		Approved	KIAA1515	uc001poh.3	Q96RU2	OTTHUMG00000168205	ENST00000003302.4:c.157C>T	11.37:g.113723334G>A	ENSP00000003302:p.Gln53*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJC0|B0YJC1|Q9P213	Nonsense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,pfscan_Peptidase_C19	p.Q53*	ENST00000003302.4	37	c.157	CCDS31680.1	11	.	.	.	.	.	.	.	.	.	.	G	16.74	3.206842	0.58343	.	.	ENSG00000048028	ENST00000003302;ENST00000260188;ENST00000537706;ENST00000540925	.	.	.	5.78	5.78	0.91487	.	0.393276	0.28247	N	0.016056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18276	T	0.48	-10.2388	15.5051	0.75731	0.0:0.0:1.0:0.0	.	.	.	.	X	53;53;53;50	.	ENSP00000003302:Q53X	Q	-	1	0	USP28	113228544	1.000000	0.71417	0.995000	0.50966	0.250000	0.25880	3.412000	0.52679	2.726000	0.93360	0.563000	0.77884	CAG	USP28	-	superfamily_UBA-like	ENSG00000048028		0.403	USP28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP28	HGNC	protein_coding	OTTHUMT00000398789.1	58	0.00	0	G			113723334	113723334	-1	no_errors	ENST00000003302	ensembl	human	known	69_37n	nonsense	25	32.43	12	SNP	1.000	A
UTP20	27340	genome.wustl.edu	37	12	101776918	101776918	+	Missense_Mutation	SNP	G	G	A	rs200357157		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:101776918G>A	ENST00000261637.4	+	59	7930	c.7756G>A	c.(7756-7758)Gaa>Aaa	p.E2586K		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2586					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.E2586K(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GGAAGAACAAGAAGCTTTAGA	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15580	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	72.0	70.0					12																	101776918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.7756G>A	12.37:g.101776918G>A	ENSP00000261637:p.Glu2586Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.E2586K	ENST00000261637.4	37	c.7756	CCDS9081.1	12	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.996	0.184899	0.09495	.	.	ENSG00000120800	ENST00000261637	T	0.05580	3.42	4.52	3.62	0.41486	.	0.628414	0.16775	N	0.200046	T	0.04092	0.0114	N	0.22421	0.69	0.09310	N	1	B	0.24258	0.1	B	0.15870	0.014	T	0.43845	-0.9366	10	0.12103	T	0.63	-0.2572	9.0423	0.36325	0.1045:0.0:0.8955:0.0	.	2586	O75691	UTP20_HUMAN	K	2586	ENSP00000261637:E2586K	ENSP00000261637:E2586K	E	+	1	0	UTP20	100301049	0.030000	0.19436	0.006000	0.13384	0.002000	0.02628	2.307000	0.43682	1.024000	0.39682	0.643000	0.83706	GAA	UTP20	-	NULL	ENSG00000120800		0.463	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	175	0.00	0	G	NM_014503		101776918	101776918	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	136	24.44	44	SNP	0.005	A
UTP20	27340	genome.wustl.edu	37	12	101776918	101776918	+	Missense_Mutation	SNP	G	G	A	rs200357157		TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:101776918G>A	ENST00000261637.4	+	59	7930	c.7756G>A	c.(7756-7758)Gaa>Aaa	p.E2586K		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	2586					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)	p.E2586K(1)		NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						GGAAGAACAAGAAGCTTTAGA	0.463													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15580	0.0		0.0	False		,,,				2504	0.0					dbGAP											1	Substitution - Missense(1)	breast(1)											65.0	72.0	70.0					12																	101776918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.7756G>A	12.37:g.101776918G>A	ENSP00000261637:p.Glu2586Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.E2586K	ENST00000261637.4	37	c.7756	CCDS9081.1	12	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	G	4.996	0.184899	0.09495	.	.	ENSG00000120800	ENST00000261637	T	0.05580	3.42	4.52	3.62	0.41486	.	0.628414	0.16775	N	0.200046	T	0.04092	0.0114	N	0.22421	0.69	0.09310	N	1	B	0.24258	0.1	B	0.15870	0.014	T	0.43845	-0.9366	10	0.12103	T	0.63	-0.2572	9.0423	0.36325	0.1045:0.0:0.8955:0.0	.	2586	O75691	UTP20_HUMAN	K	2586	ENSP00000261637:E2586K	ENSP00000261637:E2586K	E	+	1	0	UTP20	100301049	0.030000	0.19436	0.006000	0.13384	0.002000	0.02628	2.307000	0.43682	1.024000	0.39682	0.643000	0.83706	GAA	UTP20	-	NULL	ENSG00000120800		0.463	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	175	0.00	0	G	NM_014503		101776918	101776918	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	92	25.20	31	SNP	0.005	A
VAV3	10451	genome.wustl.edu	37	1	108303488	108303488	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:108303488C>G	ENST00000370056.4	-	10	1209	c.935G>C	c.(934-936)aGa>aCa	p.R312T	VAV3_ENST00000371846.4_Missense_Mutation_p.R247T|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.R312T	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	312	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.R312T(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		ATTATTTGCTCTTTTGGAACA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	65.0	68.0					1																	108303488		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.935G>C	1.37:g.108303488C>G	ENSP00000359073:p.Arg312Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain,prints_SM22_calponin	p.R312T	ENST00000370056.4	37	c.935	CCDS785.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.746136|4.746136	0.89663|0.89663	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000490388|ENST00000370056;ENST00000527011;ENST00000371846	.|T;T;T	.|0.63417	.|-0.04;-0.04;-0.04	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Dbl homology (DH) domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78104|0.78104	0.4231|0.4231	M|M	0.82132|0.82132	2.575|2.575	0.58432|0.58432	D|D	0.999999|0.999999	.|B;D;D;D	.|0.89917	.|0.361;1.0;0.995;0.995	.|P;D;D;D	.|0.70716	.|0.558;0.97;0.961;0.946	T|T	0.80070|0.80070	-0.1536|-0.1536	5|10	.|0.72032	.|D	.|0.01	.|.	19.7509|19.7509	0.96268|0.96268	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|312;312;247;312	.|B7ZLR1;E9PQ97;B4DHL6;Q9UKW4	.|.;.;.;VAV3_HUMAN	Q|T	307|312;312;247	.|ENSP00000359073:R312T;ENSP00000432540:R312T;ENSP00000360912:R247T	.|ENSP00000359073:R312T	E|R	-|-	1|2	0|0	VAV3|VAV3	108105011|108105011	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.441000|7.441000	0.80485|0.80485	2.664000|2.664000	0.90586|0.90586	0.650000|0.650000	0.86243|0.86243	GAG|AGA	VAV3	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000134215		0.353	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	96	0.00	0	C	NM_006113		108303488	108303488	-1	no_errors	ENST00000370056	ensembl	human	known	69_37n	missense	118	20.27	30	SNP	1.000	G
VAV3	10451	genome.wustl.edu	37	1	108303488	108303488	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:108303488C>G	ENST00000370056.4	-	10	1209	c.935G>C	c.(934-936)aGa>aCa	p.R312T	VAV3_ENST00000371846.4_Missense_Mutation_p.R247T|VAV3_ENST00000343258.4_5'UTR|VAV3_ENST00000527011.1_Missense_Mutation_p.R312T	NM_006113.4	NP_006104.4	Q9UKW4	VAV3_HUMAN	vav 3 guanine nucleotide exchange factor	312	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|lamellipodium assembly (GO:0030032)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|platelet activation (GO:0030168)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell adhesion (GO:0045785)|positive regulation of GTPase activity (GO:0043547)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of signal transduction (GO:0009967)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to drug (GO:0042493)|small GTPase mediated signal transduction (GO:0007264)|vesicle fusion (GO:0006906)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|SH3/SH2 adaptor activity (GO:0005070)	p.R312T(1)		NS(2)|breast(5)|endometrium(4)|kidney(2)|large_intestine(14)|lung(20)|ovary(6)|prostate(3)|stomach(1)|urinary_tract(1)	58		all_epithelial(167;5.38e-05)|all_lung(203;0.000314)|Lung NSC(277;0.000594)		Colorectal(144;0.0331)|Lung(183;0.128)|Epithelial(280;0.204)		ATTATTTGCTCTTTTGGAACA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											76.0	65.0	68.0					1																	108303488		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF118886	CCDS785.1, CCDS44181.1	1p13.3	2013-02-14	2007-07-25		ENSG00000134215	ENSG00000134215		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	12659	protein-coding gene	gene with protein product		605541	"""vav 3 oncogene"""				Standard	NM_001079874		Approved		uc001dvk.1	Q9UKW4	OTTHUMG00000010995	ENST00000370056.4:c.935G>C	1.37:g.108303488C>G	ENSP00000359073:p.Arg312Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMM0|B1APV5|B4E232|B7ZLR1|E9PQ97|O60498|O95230|Q9Y5X8	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_CAMSAP_CH,pfam_SH3_domain,pfam_SH2,pfam_CH-domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_CH-domain,superfamily_SH3_domain,smart_CH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,smart_SH2,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain,prints_SH2,prints_SH3_domain,prints_SM22_calponin	p.R312T	ENST00000370056.4	37	c.935	CCDS785.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	26.5|26.5	4.746136|4.746136	0.89663|0.89663	.|.	.|.	ENSG00000134215|ENSG00000134215	ENST00000490388|ENST00000370056;ENST00000527011;ENST00000371846	.|T;T;T	.|0.63417	.|-0.04;-0.04;-0.04	5.66|5.66	5.66|5.66	0.87406|0.87406	.|Dbl homology (DH) domain (5);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.78104|0.78104	0.4231|0.4231	M|M	0.82132|0.82132	2.575|2.575	0.58432|0.58432	D|D	0.999999|0.999999	.|B;D;D;D	.|0.89917	.|0.361;1.0;0.995;0.995	.|P;D;D;D	.|0.70716	.|0.558;0.97;0.961;0.946	T|T	0.80070|0.80070	-0.1536|-0.1536	5|10	.|0.72032	.|D	.|0.01	.|.	19.7509|19.7509	0.96268|0.96268	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|312;312;247;312	.|B7ZLR1;E9PQ97;B4DHL6;Q9UKW4	.|.;.;.;VAV3_HUMAN	Q|T	307|312;312;247	.|ENSP00000359073:R312T;ENSP00000432540:R312T;ENSP00000360912:R247T	.|ENSP00000359073:R312T	E|R	-|-	1|2	0|0	VAV3|VAV3	108105011|108105011	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	7.441000|7.441000	0.80485|0.80485	2.664000|2.664000	0.90586|0.90586	0.650000|0.650000	0.86243|0.86243	GAG|AGA	VAV3	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000134215		0.353	VAV3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAV3	HGNC	protein_coding	OTTHUMT00000030242.2	96	0.00	0	C	NM_006113		108303488	108303488	-1	no_errors	ENST00000370056	ensembl	human	known	69_37n	missense	73	17.98	16	SNP	1.000	G
WDFY3	23001	genome.wustl.edu	37	4	85638146	85638146	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:85638146C>G	ENST00000295888.4	-	49	8185	c.7778G>C	c.(7777-7779)aGa>aCa	p.R2593T	WDFY3_ENST00000322366.6_Missense_Mutation_p.R2576T	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2593	Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.R2593T(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTGGCTCCTCTAGGAATAAT	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											105.0	107.0	106.0					4																	85638146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7778G>C	4.37:g.85638146C>G	ENSP00000295888:p.Arg2593Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2593T	ENST00000295888.4	37	c.7778	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	1.724	-0.495984	0.04291	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.62941	-0.0;-0.01;0.01	5.21	4.36	0.52297	PH-BEACH domain (1);	0.054242	0.64402	D	0.000002	T	0.53351	0.1791	L	0.50333	1.59	0.50039	D	0.999846	B	0.28820	0.224	B	0.24701	0.055	T	0.48725	-0.9010	10	0.17369	T	0.5	.	13.7977	0.63182	0.0:0.9254:0.0:0.0746	.	2593	Q8IZQ1	WDFY3_HUMAN	T	2576;2593;196	ENSP00000318466:R2576T;ENSP00000295888:R2593T;ENSP00000424987:R196T	ENSP00000295888:R2593T	R	-	2	0	WDFY3	85857170	1.000000	0.71417	0.920000	0.36463	0.350000	0.29205	5.675000	0.68123	1.318000	0.45170	0.650000	0.86243	AGA	WDFY3	-	NULL	ENSG00000163625		0.418	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	82	0.00	0	C	NM_014991		85638146	85638146	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	missense	113	15.67	21	SNP	0.993	G
WDFY3	23001	genome.wustl.edu	37	4	85638146	85638146	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr4:85638146C>G	ENST00000295888.4	-	49	8185	c.7778G>C	c.(7777-7779)aGa>aCa	p.R2593T	WDFY3_ENST00000322366.6_Missense_Mutation_p.R2576T	NM_014991.4	NP_055806.2	Q8IZQ1	WDFY3_HUMAN	WD repeat and FYVE domain containing 3	2593	Interaction with SQSTM1.|Sufficient for translocalization to p62 bodies/ALIS.				aggrephagy (GO:0035973)|positive regulation of macroautophagy (GO:0016239)	autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|extrinsic component of membrane (GO:0019898)|inclusion body (GO:0016234)|nuclear envelope (GO:0005635)|PML body (GO:0016605)	1-phosphatidylinositol binding (GO:0005545)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|metal ion binding (GO:0046872)	p.R2593T(1)		breast(5)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(32)|lung(50)|ovary(3)|prostate(5)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	134		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000808)		CCTGGCTCCTCTAGGAATAAT	0.418																																						dbGAP											1	Substitution - Missense(1)	lung(1)											105.0	107.0	106.0					4																	85638146		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023210	CCDS3609.1	4q21.3	2013-01-09			ENSG00000163625	ENSG00000163625		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20751	protein-coding gene	gene with protein product						10231032	Standard	NM_014991		Approved	KIAA0993, ALFY, ZFYVE25	uc003hpd.3	Q8IZQ1	OTTHUMG00000130424	ENST00000295888.4:c.7778G>C	4.37:g.85638146C>G	ENSP00000295888:p.Arg2593Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5K5|Q6P0Q5|Q8N1T2|Q8NAV6|Q96BS7|Q96D33|Q96N85|Q9Y2J7	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_Znf_FYVE,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,superfamily_ConA-like_lec_gl,superfamily_Cyclin-like,superfamily_ARM-type_fold,smart_WD40_repeat,smart_Znf_FYVE,pfscan_BEACH_dom,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2593T	ENST00000295888.4	37	c.7778	CCDS3609.1	4	.	.	.	.	.	.	.	.	.	.	C	1.724	-0.495984	0.04291	.	.	ENSG00000163625	ENST00000322366;ENST00000295888;ENST00000514711	T;T;T	0.62941	-0.0;-0.01;0.01	5.21	4.36	0.52297	PH-BEACH domain (1);	0.054242	0.64402	D	0.000002	T	0.53351	0.1791	L	0.50333	1.59	0.50039	D	0.999846	B	0.28820	0.224	B	0.24701	0.055	T	0.48725	-0.9010	10	0.17369	T	0.5	.	13.7977	0.63182	0.0:0.9254:0.0:0.0746	.	2593	Q8IZQ1	WDFY3_HUMAN	T	2576;2593;196	ENSP00000318466:R2576T;ENSP00000295888:R2593T;ENSP00000424987:R196T	ENSP00000295888:R2593T	R	-	2	0	WDFY3	85857170	1.000000	0.71417	0.920000	0.36463	0.350000	0.29205	5.675000	0.68123	1.318000	0.45170	0.650000	0.86243	AGA	WDFY3	-	NULL	ENSG00000163625		0.418	WDFY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY3	HGNC	protein_coding	OTTHUMT00000252811.2	82	0.00	0	C	NM_014991		85638146	85638146	-1	no_errors	ENST00000295888	ensembl	human	known	69_37n	missense	193	17.87	42	SNP	0.993	G
WNK3	65267	genome.wustl.edu	37	X	54319370	54319370	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:54319370G>A	ENST00000375159.2	-	9	1987	c.1988C>T	c.(1987-1989)tCa>tTa	p.S663L	WNK3_ENST00000354646.2_Missense_Mutation_p.S663L|WNK3_ENST00000375169.3_Missense_Mutation_p.S663L			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	663					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S663L(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CTGGGGTTGTGAAACAACTGT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	85.0	89.0					X																	54319370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1988C>T	X.37:g.54319370G>A	ENSP00000364301:p.Ser663Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S663L	ENST00000375159.2	37	c.1988	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259903	0.23051	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.48201	0.82;0.82;0.82	5.23	3.47	0.39725	.	0.349704	0.20671	N	0.087826	T	0.29976	0.0750	N	0.19112	0.55	0.23186	N	0.998155	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.16630	-1.0396	10	0.40728	T	0.16	-0.2878	7.8409	0.29397	0.2001:0.0:0.7999:0.0	.	663;663	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	L	663	ENSP00000364312:S663L;ENSP00000346667:S663L;ENSP00000364301:S663L	ENSP00000346667:S663L	S	-	2	0	WNK3	54336095	1.000000	0.71417	0.989000	0.46669	0.569000	0.35902	3.255000	0.51484	0.518000	0.28383	-0.255000	0.11280	TCA	WNK3	-	NULL	ENSG00000196632		0.418	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	188	0.00	0	G	NM_020922		54319370	54319370	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	133	26.11	47	SNP	0.954	A
WNK3	65267	genome.wustl.edu	37	X	54319370	54319370	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chrX:54319370G>A	ENST00000375159.2	-	9	1987	c.1988C>T	c.(1987-1989)tCa>tTa	p.S663L	WNK3_ENST00000354646.2_Missense_Mutation_p.S663L|WNK3_ENST00000375169.3_Missense_Mutation_p.S663L			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	663					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.S663L(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						CTGGGGTTGTGAAACAACTGT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											96.0	85.0	89.0					X																	54319370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1988C>T	X.37:g.54319370G>A	ENSP00000364301:p.Ser663Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S663L	ENST00000375159.2	37	c.1988	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	G	10.11	1.259903	0.23051	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.48201	0.82;0.82;0.82	5.23	3.47	0.39725	.	0.349704	0.20671	N	0.087826	T	0.29976	0.0750	N	0.19112	0.55	0.23186	N	0.998155	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.16630	-1.0396	10	0.40728	T	0.16	-0.2878	7.8409	0.29397	0.2001:0.0:0.7999:0.0	.	663;663	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	L	663	ENSP00000364312:S663L;ENSP00000346667:S663L;ENSP00000364301:S663L	ENSP00000346667:S663L	S	-	2	0	WNK3	54336095	1.000000	0.71417	0.989000	0.46669	0.569000	0.35902	3.255000	0.51484	0.518000	0.28383	-0.255000	0.11280	TCA	WNK3	-	NULL	ENSG00000196632		0.418	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	188	0.00	0	G	NM_020922		54319370	54319370	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	missense	209	24.28	67	SNP	0.954	A
WWP2	11060	genome.wustl.edu	37	16	69973789	69973789	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:69973789G>C	ENST00000359154.2	+	24	2660	c.2559G>C	c.(2557-2559)ctG>ctC	p.L853L	WWP2_ENST00000568684.1_Silent_p.L414L|WWP2_ENST00000542271.1_Silent_p.L737L|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000448661.1_Silent_p.L853L|WWP2_ENST00000356003.2_Silent_p.L853L	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	853	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.L853L(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACGAACAGCTGAGAGAGAAGC	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											89.0	67.0	74.0					16																	69973789		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.2559G>C	16.37:g.69973789G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.L853	ENST00000359154.2	37	c.2559	CCDS10885.1	16																																																																																			WWP2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198373		0.587	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	41	0.00	0	G	NM_007014		69973789	69973789	+1	no_errors	ENST00000356003	ensembl	human	known	69_37n	silent	15	21.05	4	SNP	0.995	C
WWP2	11060	genome.wustl.edu	37	16	69973789	69973789	+	Silent	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:69973789G>C	ENST00000359154.2	+	24	2660	c.2559G>C	c.(2557-2559)ctG>ctC	p.L853L	WWP2_ENST00000568684.1_Silent_p.L414L|WWP2_ENST00000542271.1_Silent_p.L737L|WWP2_ENST00000544162.1_3'UTR|WWP2_ENST00000448661.1_Silent_p.L853L|WWP2_ENST00000356003.2_Silent_p.L853L	NM_001270454.1|NM_007014.4	NP_001257383.1|NP_008945.2	O00308	WWP2_HUMAN	WW domain containing E3 ubiquitin protein ligase 2	853	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				cellular protein modification process (GO:0006464)|negative regulation of gene expression (GO:0010629)|negative regulation of protein transport (GO:0051224)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transporter activity (GO:0032410)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of ion transmembrane transport (GO:0034765)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|RNA polymerase II transcription factor binding (GO:0001085)|transcription factor binding (GO:0008134)|ubiquitin-protein transferase activity (GO:0004842)	p.L853L(1)		breast(4)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						ACGAACAGCTGAGAGAGAAGC	0.587																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											89.0	67.0	74.0					16																	69973789		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			BC013645	CCDS10885.1, CCDS58475.1, CCDS58476.1, CCDS58477.1	16q22.1	2008-02-05			ENSG00000198373	ENSG00000198373			16804	protein-coding gene	gene with protein product		602308				9169421, 12167593	Standard	NM_007014		Approved	AIP2	uc002exv.2	O00308	OTTHUMG00000137573	ENST00000359154.2:c.2559G>C	16.37:g.69973789G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEP1|B2R706|B4DTL5|F5H213|H3BRF3|I3RSG8|Q6ZTQ5|Q96CZ2|Q9BWN6	Silent	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_WW_Rsp5_WWP	p.L853	ENST00000359154.2	37	c.2559	CCDS10885.1	16																																																																																			WWP2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000198373		0.587	WWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP2	HGNC	protein_coding	OTTHUMT00000268954.1	41	0.00	0	G	NM_007014		69973789	69973789	+1	no_errors	ENST00000356003	ensembl	human	known	69_37n	silent	23	14.81	4	SNP	0.995	C
XPO1	7514	genome.wustl.edu	37	2	61708356	61708356	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:61708356G>C	ENST00000401558.2	-	24	3760	c.3033C>G	c.(3031-3033)ttC>ttG	p.F1011L	RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA|RP11-355B11.2_ENST00000603028.1_RNA|XPO1_ENST00000406957.1_Missense_Mutation_p.F1011L|RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000404992.2_Missense_Mutation_p.F1011L|RP11-355B11.2_ENST00000605437.1_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	1011					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AATGTTCCTTGAAAGCAGGAA	0.313			Mis		CLL																																	dbGAP	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													55.0	56.0	56.0					2																	61708356		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.3033C>G	2.37:g.61708356G>C	ENSP00000384863:p.Phe1011Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F1011L	ENST00000401558.2	37	c.3033	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337955	0.60963	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.64260	-0.09;-0.09;-0.09	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70833	0.3269	M	0.91459	3.21	0.54753	D	0.999987	B;B	0.20368	0.025;0.044	B;B	0.26310	0.068;0.043	T	0.71494	-0.4576	10	0.54805	T	0.06	-12.2732	13.1355	0.59407	0.0733:0.0:0.9267:0.0	.	658;1011	B3KWD0;O14980	.;XPO1_HUMAN	L	1011	ENSP00000384863:F1011L;ENSP00000385942:F1011L;ENSP00000385559:F1011L	ENSP00000384863:F1011L	F	-	3	2	XPO1	61561860	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.490000	0.45294	2.768000	0.95171	0.655000	0.94253	TTC	XPO1	-	pfam_CRM1_C_dom,superfamily_ARM-type_fold	ENSG00000082898		0.313	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	66	0.00	0	G	NM_003400		61708356	61708356	-1	no_errors	ENST00000401558	ensembl	human	known	69_37n	missense	133	24.00	42	SNP	1.000	C
XPO1	7514	genome.wustl.edu	37	2	61708356	61708356	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:61708356G>C	ENST00000401558.2	-	24	3760	c.3033C>G	c.(3031-3033)ttC>ttG	p.F1011L	RP11-355B11.2_ENST00000578974.2_RNA|RP11-355B11.2_ENST00000603652.1_RNA|RP11-355B11.2_ENST00000603028.1_RNA|XPO1_ENST00000406957.1_Missense_Mutation_p.F1011L|RP11-355B11.2_ENST00000603199.1_RNA|XPO1_ENST00000404992.2_Missense_Mutation_p.F1011L|RP11-355B11.2_ENST00000605437.1_RNA	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1	1011					gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			AATGTTCCTTGAAAGCAGGAA	0.313			Mis		CLL																																	dbGAP	-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0													55.0	56.0	56.0					2																	61708356		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.3033C>G	2.37:g.61708356G>C	ENSP00000384863:p.Phe1011Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Missense_Mutation	SNP	pfam_CRM1_C_dom,pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F1011L	ENST00000401558.2	37	c.3033	CCDS33205.1	2	.	.	.	.	.	.	.	.	.	.	G	17.23	3.337955	0.60963	.	.	ENSG00000082898	ENST00000401558;ENST00000404992;ENST00000406957	T;T;T	0.64260	-0.09;-0.09;-0.09	5.55	5.55	0.83447	Armadillo-like helical (1);Armadillo-type fold (2);Exportin 1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.70833	0.3269	M	0.91459	3.21	0.54753	D	0.999987	B;B	0.20368	0.025;0.044	B;B	0.26310	0.068;0.043	T	0.71494	-0.4576	10	0.54805	T	0.06	-12.2732	13.1355	0.59407	0.0733:0.0:0.9267:0.0	.	658;1011	B3KWD0;O14980	.;XPO1_HUMAN	L	1011	ENSP00000384863:F1011L;ENSP00000385942:F1011L;ENSP00000385559:F1011L	ENSP00000384863:F1011L	F	-	3	2	XPO1	61561860	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.490000	0.45294	2.768000	0.95171	0.655000	0.94253	TTC	XPO1	-	pfam_CRM1_C_dom,superfamily_ARM-type_fold	ENSG00000082898		0.313	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	66	0.00	0	G	NM_003400		61708356	61708356	-1	no_errors	ENST00000401558	ensembl	human	known	69_37n	missense	78	25.00	26	SNP	1.000	C
XPOT	11260	genome.wustl.edu	37	12	64814203	64814203	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:64814203G>C	ENST00000332707.5	+	8	1274	c.745G>C	c.(745-747)Gaa>Caa	p.E249Q		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	249	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.E249Q(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		CTGTTTATTTGAAGTTGTAAA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	92.0	90.0					12																	64814203		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.745G>C	12.37:g.64814203G>C	ENSP00000327821:p.Glu249Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.E249Q	ENST00000332707.5	37	c.745	CCDS31852.1	12	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833310	0.91036	.	.	ENSG00000184575	ENST00000332707	T	0.68331	-0.32	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);	0.048168	0.85682	D	0.000000	T	0.78666	0.4319	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.77250	-0.2657	9	.	.	.	.	18.9398	0.92601	0.0:0.0:1.0:0.0	.	249	O43592	XPOT_HUMAN	Q	249	ENSP00000327821:E249Q	.	E	+	1	0	XPOT	63100470	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.655000	0.98512	2.649000	0.89929	0.655000	0.94253	GAA	XPOT	-	superfamily_ARM-type_fold	ENSG00000184575		0.353	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1	318	0.00	0	G	NM_007235		64814203	64814203	+1	no_errors	ENST00000332707	ensembl	human	known	69_37n	missense	221	16.92	45	SNP	1.000	C
XPOT	11260	genome.wustl.edu	37	12	64814203	64814203	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr12:64814203G>C	ENST00000332707.5	+	8	1274	c.745G>C	c.(745-747)Gaa>Caa	p.E249Q		NM_007235.4	NP_009166.2	O43592	XPOT_HUMAN	exportin, tRNA	249	Necessary for interaction with Ran, nuclear localization and nuclear import.				intracellular protein transport (GO:0006886)|tRNA export from nucleus (GO:0006409)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	tRNA binding (GO:0000049)	p.E249Q(1)		NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(7)|lung(12)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				GBM - Glioblastoma multiforme(28;0.0404)		CTGTTTATTTGAAGTTGTAAA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											86.0	92.0	90.0					12																	64814203		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF039022	CCDS31852.1	12q14.1	2012-10-17	2012-10-17		ENSG00000184575	ENSG00000184575		"""Exportins"""	12826	protein-coding gene	gene with protein product		603180	"""exportin, tRNA (nuclear export receptor for tRNAs)"""			9660920, 9512417	Standard	NM_007235		Approved	XPO3	uc001ssb.3	O43592	OTTHUMG00000168794	ENST00000332707.5:c.745G>C	12.37:g.64814203G>C	ENSP00000327821:p.Glu249Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH1|O43784|Q8WUG2|Q9BVS7	Missense_Mutation	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.E249Q	ENST00000332707.5	37	c.745	CCDS31852.1	12	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833310	0.91036	.	.	ENSG00000184575	ENST00000332707	T	0.68331	-0.32	4.89	4.89	0.63831	Armadillo-like helical (1);Armadillo-type fold (1);	0.048168	0.85682	D	0.000000	T	0.78666	0.4319	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.66716	0.946	T	0.77250	-0.2657	9	.	.	.	.	18.9398	0.92601	0.0:0.0:1.0:0.0	.	249	O43592	XPOT_HUMAN	Q	249	ENSP00000327821:E249Q	.	E	+	1	0	XPOT	63100470	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.655000	0.98512	2.649000	0.89929	0.655000	0.94253	GAA	XPOT	-	superfamily_ARM-type_fold	ENSG00000184575		0.353	XPOT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPOT	HGNC	protein_coding	OTTHUMT00000401122.1	318	0.00	0	G	NM_007235		64814203	64814203	+1	no_errors	ENST00000332707	ensembl	human	known	69_37n	missense	359	13.91	58	SNP	1.000	C
YEATS2	55689	genome.wustl.edu	37	3	183432996	183432996	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:183432996G>A	ENST00000305135.5	+	2	241	c.46G>A	c.(46-48)Gag>Aag	p.E16K		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	16					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.E16K(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCCTGATTACGAGGATGTATC	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	121.0	121.0					3																	183432996		1875	4104	5979	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.46G>A	3.37:g.183432996G>A	ENSP00000306983:p.Glu16Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.E16K	ENST00000305135.5	37	c.46	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.502312	0.96371	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.38560	1.13	5.65	5.65	0.86999	.	0.063755	0.64402	D	0.000008	T	0.54271	0.1848	L	0.61218	1.895	0.58432	D	0.999999	D	0.69078	0.997	P	0.50825	0.651	T	0.57900	-0.7731	10	0.72032	D	0.01	-24.4434	19.313	0.94199	0.0:0.0:1.0:0.0	.	16	Q9ULM3	YETS2_HUMAN	K	16	ENSP00000306983:E16K	ENSP00000306983:E16K	E	+	1	0	YEATS2	184915690	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.954000	0.87848	2.674000	0.91012	0.467000	0.42956	GAG	YEATS2	-	NULL	ENSG00000163872		0.358	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	155	0.00	0	G	NM_018023		183432996	183432996	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	137	22.60	40	SNP	1.000	A
YEATS2	55689	genome.wustl.edu	37	3	183432996	183432996	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr3:183432996G>A	ENST00000305135.5	+	2	241	c.46G>A	c.(46-48)Gag>Aag	p.E16K		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	16					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)	p.E16K(1)		NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CCCTGATTACGAGGATGTATC	0.358																																						dbGAP											1	Substitution - Missense(1)	breast(1)											120.0	121.0	121.0					3																	183432996		1875	4104	5979	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.46G>A	3.37:g.183432996G>A	ENSP00000306983:p.Glu16Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.E16K	ENST00000305135.5	37	c.46	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.502312	0.96371	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.38560	1.13	5.65	5.65	0.86999	.	0.063755	0.64402	D	0.000008	T	0.54271	0.1848	L	0.61218	1.895	0.58432	D	0.999999	D	0.69078	0.997	P	0.50825	0.651	T	0.57900	-0.7731	10	0.72032	D	0.01	-24.4434	19.313	0.94199	0.0:0.0:1.0:0.0	.	16	Q9ULM3	YETS2_HUMAN	K	16	ENSP00000306983:E16K	ENSP00000306983:E16K	E	+	1	0	YEATS2	184915690	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.954000	0.87848	2.674000	0.91012	0.467000	0.42956	GAG	YEATS2	-	NULL	ENSG00000163872		0.358	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	155	0.00	0	G	NM_018023		183432996	183432996	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	78	25.71	27	SNP	1.000	A
ZBTB10	65986	genome.wustl.edu	37	8	81412521	81412521	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:81412521C>G	ENST00000430430.1	+	3	2544	c.1765C>G	c.(1765-1767)Cca>Gca	p.P589A	ZBTB10_ENST00000455036.3_Missense_Mutation_p.P589A|ZBTB10_ENST00000379091.4_Missense_Mutation_p.P297A|ZBTB10_ENST00000426744.2_Missense_Mutation_p.P589A	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P589A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TTATAATATTCCACCTAATAA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											10.0	10.0	10.0					8																	81412521		1812	4065	5877	-	-	-	SO:0001583	missense	0			AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1765C>G	8.37:g.81412521C>G	ENSP00000387462:p.Pro589Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P589A	ENST00000430430.1	37	c.1765	CCDS47880.1	8	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851096	0.51270	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	L	0.32530	0.975	0.58432	D	0.999999	B;P;D;D	0.89917	0.278;0.807;1.0;0.979	B;B;D;P	0.85130	0.084;0.294;0.997;0.742	T	0.11891	-1.0569	10	0.16896	T	0.51	.	19.3983	0.94617	0.0:1.0:0.0:0.0	.	445;589;589;297	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	A	297;589;589;589;417	ENSP00000368384:P297A;ENSP00000387462:P589A;ENSP00000412036:P589A;ENSP00000416134:P589A	ENSP00000368384:P297A	P	+	1	0	ZBTB10	81575076	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.102000	0.64572	2.596000	0.87737	0.650000	0.86243	CCA	ZBTB10	-	NULL	ENSG00000205189		0.353	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZBTB10	HGNC	protein_coding	OTTHUMT00000338055.2	57	0.00	0	C	NM_023929		81412521	81412521	+1	no_errors	ENST00000426744	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	1.000	G
ZBTB10	65986	genome.wustl.edu	37	8	81412521	81412521	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:81412521C>G	ENST00000430430.1	+	3	2544	c.1765C>G	c.(1765-1767)Cca>Gca	p.P589A	ZBTB10_ENST00000455036.3_Missense_Mutation_p.P589A|ZBTB10_ENST00000379091.4_Missense_Mutation_p.P297A|ZBTB10_ENST00000426744.2_Missense_Mutation_p.P589A	NM_001277145.1	NP_001264074.1	Q96DT7	ZBT10_HUMAN	zinc finger and BTB domain containing 10	589					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.P589A(1)		breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|upper_aerodigestive_tract(4)	20	all_cancers(3;1.68e-09)|all_epithelial(4;5.13e-11)|Lung NSC(7;1.75e-07)|all_lung(9;7.38e-07)|Breast(3;2.96e-06)		BRCA - Breast invasive adenocarcinoma(6;0.000434)|Epithelial(68;0.00486)|all cancers(69;0.0296)			TTATAATATTCCACCTAATAA	0.353																																						dbGAP											1	Substitution - Missense(1)	breast(1)											10.0	10.0	10.0					8																	81412521		1812	4065	5877	-	-	-	SO:0001583	missense	0			AK022814	CCDS47880.1, CCDS64920.1	8q13-q21.1	2013-01-09			ENSG00000205189	ENSG00000205189		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	30953	protein-coding gene	gene with protein product						12477932	Standard	NM_001105539		Approved	RINZF, FLJ12752	uc003ybx.5	Q96DT7	OTTHUMG00000155016	ENST00000430430.1:c.1765C>G	8.37:g.81412521C>G	ENSP00000387462:p.Pro589Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVD0|Q86W96|Q8IXI9|Q96MH9	Missense_Mutation	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.P589A	ENST00000430430.1	37	c.1765	CCDS47880.1	8	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851096	0.51270	.	.	ENSG00000205189	ENST00000379091;ENST00000430430;ENST00000455036;ENST00000426744;ENST00000519370	T;T;T;T	0.32023	1.47;1.47;1.47;1.47	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.45094	0.1325	L	0.32530	0.975	0.58432	D	0.999999	B;P;D;D	0.89917	0.278;0.807;1.0;0.979	B;B;D;P	0.85130	0.084;0.294;0.997;0.742	T	0.11891	-1.0569	10	0.16896	T	0.51	.	19.3983	0.94617	0.0:1.0:0.0:0.0	.	445;589;589;297	A8E4L4;Q96DT7;Q96DT7-2;Q96DT7-4	.;ZBT10_HUMAN;.;.	A	297;589;589;589;417	ENSP00000368384:P297A;ENSP00000387462:P589A;ENSP00000412036:P589A;ENSP00000416134:P589A	ENSP00000368384:P297A	P	+	1	0	ZBTB10	81575076	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.102000	0.64572	2.596000	0.87737	0.650000	0.86243	CCA	ZBTB10	-	NULL	ENSG00000205189		0.353	ZBTB10-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZBTB10	HGNC	protein_coding	OTTHUMT00000338055.2	57	0.00	0	C	NM_023929		81412521	81412521	+1	no_errors	ENST00000426744	ensembl	human	known	69_37n	missense	49	23.44	15	SNP	1.000	G
ZFHX3	463	genome.wustl.edu	37	16	72830257	72830257	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:72830257C>T	ENST00000268489.5	-	9	6996	c.6324G>A	c.(6322-6324)caG>caA	p.Q2108Q	ZFHX3_ENST00000397992.5_Silent_p.Q1194Q	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2108					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q2108Q(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCGGCAAGGTCTGCAGCGGCA	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											54.0	49.0	51.0					16																	72830257		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6324G>A	16.37:g.72830257C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.Q2108	ENST00000268489.5	37	c.6324	CCDS10908.1	16																																																																																			ZFHX3	-	NULL	ENSG00000140836		0.642	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	36	0.00	0	C	NM_006885		72830257	72830257	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	1.000	T
ZFHX3	463	genome.wustl.edu	37	16	72830257	72830257	+	Silent	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr16:72830257C>T	ENST00000268489.5	-	9	6996	c.6324G>A	c.(6322-6324)caG>caA	p.Q2108Q	ZFHX3_ENST00000397992.5_Silent_p.Q1194Q	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	2108					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.Q2108Q(1)		NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				CCGGCAAGGTCTGCAGCGGCA	0.642																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											54.0	49.0	51.0					16																	72830257		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.6324G>A	16.37:g.72830257C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.Q2108	ENST00000268489.5	37	c.6324	CCDS10908.1	16																																																																																			ZFHX3	-	NULL	ENSG00000140836		0.642	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	36	0.00	0	C	NM_006885		72830257	72830257	-1	no_errors	ENST00000268489	ensembl	human	known	69_37n	silent	9	35.71	5	SNP	1.000	T
ZHX1	11244	genome.wustl.edu	37	8	124266322	124266322	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:124266322G>C	ENST00000522655.1	-	3	2405	c.1865C>G	c.(1864-1866)tCa>tGa	p.S622*	ZHX1_ENST00000522595.1_5'Flank|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000297857.2_Nonsense_Mutation_p.S622*|ZHX1_ENST00000395571.3_Nonsense_Mutation_p.S622*			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	622					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S622*(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TAAAGCTTTTGATTTCTTCTT	0.373																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											118.0	125.0	123.0					8																	124266322		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1865C>G	8.37:g.124266322G>C	ENSP00000428821:p.Ser622*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWD8	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S622*	ENST00000522655.1	37	c.1865	CCDS6342.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	10.607691|10.607691	0.99436|0.99436	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000520474|ENST00000297857;ENST00000395571;ENST00000522655	.|.	.|.	.|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.478424	.|0.24141	.|N	.|0.041172	T|.	0.60650|.	0.2285|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.60672|.	-0.7217|.	3|.	.|0.24483	.|T	.|0.36	-5.5744|-5.5744	14.7633|14.7633	0.69621|0.69621	0.0705:0.0:0.9295:0.0|0.0705:0.0:0.9295:0.0	.|.	.|.	.|.	.|.	E|X	307|622	.|.	.|ENSP00000297857:S622X	Q|S	-|-	1|2	0|0	ZHX1|ZHX1	124335503|124335503	0.911000|0.911000	0.30947|0.30947	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	4.115000|4.115000	0.57865|0.57865	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	CAA|TCA	ZHX1	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000165156		0.373	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	238	0.00	0	G			124266322	124266322	-1	no_errors	ENST00000297857	ensembl	human	known	69_37n	nonsense	288	17.24	60	SNP	0.638	C
ZHX1	11244	genome.wustl.edu	37	8	124266322	124266322	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr8:124266322G>C	ENST00000522655.1	-	3	2405	c.1865C>G	c.(1864-1866)tCa>tGa	p.S622*	ZHX1_ENST00000522595.1_5'Flank|ZHX1-C8ORF76_ENST00000357082.4_Intron|ZHX1_ENST00000297857.2_Nonsense_Mutation_p.S622*|ZHX1_ENST00000395571.3_Nonsense_Mutation_p.S622*			Q9UKY1	ZHX1_HUMAN	zinc fingers and homeoboxes 1	622					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S622*(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(37;1.25e-09)|Ovarian(258;0.0154)		STAD - Stomach adenocarcinoma(47;0.00527)			TAAAGCTTTTGATTTCTTCTT	0.373																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											118.0	125.0	123.0					8																	124266322		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF106862	CCDS6342.1	8q24.13	2012-03-09	2004-01-23		ENSG00000165156	ENSG00000165156		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	12871	protein-coding gene	gene with protein product		604764	"""zinc-fingers and homeoboxes 1"""			10441475	Standard	NM_001017926		Approved		uc003yqe.3	Q9UKY1	OTTHUMG00000165088	ENST00000522655.1:c.1865C>G	8.37:g.124266322G>C	ENSP00000428821:p.Ser622*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IWD8	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S622*	ENST00000522655.1	37	c.1865	CCDS6342.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	44|44	10.607691|10.607691	0.99436|0.99436	.|.	.|.	ENSG00000165156|ENSG00000165156	ENST00000520474|ENST00000297857;ENST00000395571;ENST00000522655	.|.	.|.	.|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.478424	.|0.24141	.|N	.|0.041172	T|.	0.60650|.	0.2285|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.60672|.	-0.7217|.	3|.	.|0.24483	.|T	.|0.36	-5.5744|-5.5744	14.7633|14.7633	0.69621|0.69621	0.0705:0.0:0.9295:0.0|0.0705:0.0:0.9295:0.0	.|.	.|.	.|.	.|.	E|X	307|622	.|.	.|ENSP00000297857:S622X	Q|S	-|-	1|2	0|0	ZHX1|ZHX1	124335503|124335503	0.911000|0.911000	0.30947|0.30947	0.998000|0.998000	0.56505|0.56505	0.981000|0.981000	0.71138|0.71138	4.115000|4.115000	0.57865|0.57865	2.868000|2.868000	0.98415|0.98415	0.555000|0.555000	0.69702|0.69702	CAA|TCA	ZHX1	-	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000165156		0.373	ZHX1-003	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZHX1	HGNC	protein_coding	OTTHUMT00000381759.1	238	0.00	0	G			124266322	124266322	-1	no_errors	ENST00000297857	ensembl	human	known	69_37n	nonsense	462	16.91	94	SNP	0.638	C
ZNF283	284349	genome.wustl.edu	37	19	44351927	44351927	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:44351927C>T	ENST00000324461.7	+	7	1471	c.1174C>T	c.(1174-1176)Cga>Tga	p.R392*	ZNF283_ENST00000588797.1_Nonsense_Mutation_p.R253*	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R392*(1)		endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TCAACTTACTCGACATCAGAT	0.373																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											98.0	114.0	109.0					19																	44351927		2175	4291	6466	-	-	-	SO:0001587	stop_gained	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1174C>T	19.37:g.44351927C>T	ENSP00000327314:p.Arg392*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R392*	ENST00000324461.7	37	c.1174	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.726937	0.96847	.	.	ENSG00000167637	ENST00000324461	.	.	.	2.99	-0.5	0.12012	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999971	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	2.0735	0.03618	0.2506:0.3456:0.0:0.4037	.	.	.	.	X	392	.	ENSP00000327314:R392X	R	+	1	2	ZNF283	49043767	0.000000	0.05858	0.937000	0.37676	0.966000	0.64601	-2.317000	0.01122	0.102000	0.17638	-0.521000	0.04368	CGA	ZNF283	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167637		0.373	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	166	0.00	0	C	NM_181845		44351927	44351927	+1	no_errors	ENST00000324461	ensembl	human	known	69_37n	nonsense	121	23.90	38	SNP	0.025	T
ZNF283	284349	genome.wustl.edu	37	19	44351927	44351927	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:44351927C>T	ENST00000324461.7	+	7	1471	c.1174C>T	c.(1174-1176)Cga>Tga	p.R392*	ZNF283_ENST00000588797.1_Nonsense_Mutation_p.R253*	NM_181845.1	NP_862828.1	Q8N7M2	ZN283_HUMAN	zinc finger protein 283	392					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R392*(1)		endometrium(1)|large_intestine(3)|lung(4)	8		Prostate(69;0.0352)				TCAACTTACTCGACATCAGAT	0.373																																						dbGAP											1	Substitution - Nonsense(1)	breast(1)											98.0	114.0	109.0					19																	44351927		2175	4291	6466	-	-	-	SO:0001587	stop_gained	0			AK098175	CCDS46097.1, CCDS74387.1	19q13.31	2013-01-08			ENSG00000167637	ENSG00000167637		"""Zinc fingers, C2H2-type"", ""-"""	13077	protein-coding gene	gene with protein product						12743021	Standard	NM_181845		Approved		uc002oxr.4	Q8N7M2		ENST00000324461.7:c.1174C>T	19.37:g.44351927C>T	ENSP00000327314:p.Arg392*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGZ5|B7WP04|Q6RFR9|Q86WM6	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R392*	ENST00000324461.7	37	c.1174	CCDS46097.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.726937	0.96847	.	.	ENSG00000167637	ENST00000324461	.	.	.	2.99	-0.5	0.12012	.	.	.	.	.	.	.	.	.	.	.	0.19300	N	0.999971	.	.	.	.	.	.	.	.	.	.	0.05620	T	0.96	.	2.0735	0.03618	0.2506:0.3456:0.0:0.4037	.	.	.	.	X	392	.	ENSP00000327314:R392X	R	+	1	2	ZNF283	49043767	0.000000	0.05858	0.937000	0.37676	0.966000	0.64601	-2.317000	0.01122	0.102000	0.17638	-0.521000	0.04368	CGA	ZNF283	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167637		0.373	ZNF283-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF283	HGNC	protein_coding	OTTHUMT00000459909.1	166	0.00	0	C	NM_181845		44351927	44351927	+1	no_errors	ENST00000324461	ensembl	human	known	69_37n	nonsense	208	22.96	62	SNP	0.025	T
ZNF28	7576	genome.wustl.edu	37	19	53303801	53303801	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:53303801G>A	ENST00000457749.2	-	4	1416	c.1297C>T	c.(1297-1299)Cac>Tac	p.H433Y	ZNF28_ENST00000360272.4_Missense_Mutation_p.H380Y|ZNF28_ENST00000438150.2_Missense_Mutation_p.H380Y|ZNF28_ENST00000414252.2_Missense_Mutation_p.H380Y	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H380Y(2)|p.H433Y(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TCTCCAGTGTGAATTATACTA	0.373																																						dbGAP											3	Substitution - Missense(3)	breast(3)											113.0	120.0	118.0					19																	53303801		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1297C>T	19.37:g.53303801G>A	ENSP00000397693:p.His433Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H433Y	ENST00000457749.2	37	c.1297	CCDS33093.2	19	.	.	.	.	.	.	.	.	.	.	-	15.06	2.720129	0.48728	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27	1.74	0.624	0.17659	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.80325	0.4602	M	0.87456	2.885	0.26053	N	0.98145	D	0.67145	0.996	D	0.75020	0.985	T	0.67565	-0.5638	9	0.87932	D	0	.	6.9561	0.24572	0.1616:0.0:0.8384:0.0	.	433	P17035	ZNF28_HUMAN	Y	380;433;380;380;380	ENSP00000412143:H380Y;ENSP00000397693:H433Y;ENSP00000353410:H380Y;ENSP00000444965:H380Y;ENSP00000375661:H380Y	ENSP00000353410:H380Y	H	-	1	0	ZNF28	57995613	1.000000	0.71417	0.003000	0.11579	0.128000	0.20619	4.471000	0.60182	0.072000	0.16694	0.186000	0.17326	CAC	ZNF28	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198538		0.373	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF28	HGNC	protein_coding	OTTHUMT00000336038.2	126	0.00	0	G	NM_006969		53303801	53303801	-1	no_errors	ENST00000457749	ensembl	human	known	69_37n	missense	136	15.00	24	SNP	0.982	A
ZNF28	7576	genome.wustl.edu	37	19	53303801	53303801	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:53303801G>A	ENST00000457749.2	-	4	1416	c.1297C>T	c.(1297-1299)Cac>Tac	p.H433Y	ZNF28_ENST00000360272.4_Missense_Mutation_p.H380Y|ZNF28_ENST00000438150.2_Missense_Mutation_p.H380Y|ZNF28_ENST00000414252.2_Missense_Mutation_p.H380Y	NM_006969.3	NP_008900.3	P17035	ZNF28_HUMAN	zinc finger protein 28	433					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H380Y(2)|p.H433Y(1)		breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(10)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(134;0.0386)|Lung(386;0.145)		TCTCCAGTGTGAATTATACTA	0.373																																						dbGAP											3	Substitution - Missense(3)	breast(3)											113.0	120.0	118.0					19																	53303801		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52355	CCDS33093.1, CCDS33093.2	19q13.41	2013-01-08	2006-05-10		ENSG00000198538	ENSG00000198538		"""Zinc fingers, C2H2-type"", ""-"""	13073	protein-coding gene	gene with protein product			"""zinc finger protein 28 (KOX 24)"""				Standard	NR_036599		Approved	KOX24, DKFZp781D0275	uc002qad.3	P17035	OTTHUMG00000154564	ENST00000457749.2:c.1297C>T	19.37:g.53303801G>A	ENSP00000397693:p.His433Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAK9|B4E3G0|B9EIK7|Q5H9V1|Q5HYM9|Q6ZML9|Q6ZN56	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H433Y	ENST00000457749.2	37	c.1297	CCDS33093.2	19	.	.	.	.	.	.	.	.	.	.	-	15.06	2.720129	0.48728	.	.	ENSG00000198538	ENST00000438150;ENST00000457749;ENST00000360272;ENST00000414252;ENST00000391783	T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27	1.74	0.624	0.17659	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.80325	0.4602	M	0.87456	2.885	0.26053	N	0.98145	D	0.67145	0.996	D	0.75020	0.985	T	0.67565	-0.5638	9	0.87932	D	0	.	6.9561	0.24572	0.1616:0.0:0.8384:0.0	.	433	P17035	ZNF28_HUMAN	Y	380;433;380;380;380	ENSP00000412143:H380Y;ENSP00000397693:H433Y;ENSP00000353410:H380Y;ENSP00000444965:H380Y;ENSP00000375661:H380Y	ENSP00000353410:H380Y	H	-	1	0	ZNF28	57995613	1.000000	0.71417	0.003000	0.11579	0.128000	0.20619	4.471000	0.60182	0.072000	0.16694	0.186000	0.17326	CAC	ZNF28	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198538		0.373	ZNF28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF28	HGNC	protein_coding	OTTHUMT00000336038.2	126	0.00	0	G	NM_006969		53303801	53303801	-1	no_errors	ENST00000457749	ensembl	human	known	69_37n	missense	221	17.23	46	SNP	0.982	A
ZNF638	27332	genome.wustl.edu	37	2	71576606	71576606	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:71576606G>C	ENST00000409544.1	+	2	1152	c.522G>C	c.(520-522)ttG>ttC	p.L174F	ZNF638_ENST00000264447.4_Missense_Mutation_p.L174F|ZNF638_ENST00000377802.2_Missense_Mutation_p.L174F|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000355812.3_Missense_Mutation_p.L174F	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	174					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L174F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						CATTAATTTTGAGGGATATAA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	60.0	60.0					2																	71576606		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.522G>C	2.37:g.71576606G>C	ENSP00000386433:p.Leu174Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.L174F	ENST00000409544.1	37	c.522	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240907	0.39598	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544;ENST00000437658	T;D;T;T;T;T;T	0.83837	-1.18;-1.77;-0.59;-1.2;0.25;0.25;-0.06	5.71	3.91	0.45181	.	0.079949	0.50627	N	0.000115	D	0.84593	0.5506	L	0.29908	0.895	0.38761	D	0.954327	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.994;0.997;0.994;0.994	D	0.85599	0.1251	10	0.87932	D	0	-4.2255	10.1889	0.43015	0.1611:0.0:0.8389:0.0	.	280;174;174;174;174	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	F	174;280;174;174;174;174;174	ENSP00000386669:L174F;ENSP00000438189:L280F;ENSP00000348066:L174F;ENSP00000367033:L174F;ENSP00000264447:L174F;ENSP00000386433:L174F;ENSP00000388164:L174F	ENSP00000264447:L174F	L	+	3	2	ZNF638	71430114	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	0.295000	0.19065	0.773000	0.33404	0.655000	0.94253	TTG	ZNF638	-	NULL	ENSG00000075292		0.363	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	93	0.00	0	G	NM_014497		71576606	71576606	+1	no_errors	ENST00000264447	ensembl	human	known	69_37n	missense	112	21.13	30	SNP	0.998	C
ZNF638	27332	genome.wustl.edu	37	2	71576606	71576606	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:71576606G>C	ENST00000409544.1	+	2	1152	c.522G>C	c.(520-522)ttG>ttC	p.L174F	ZNF638_ENST00000264447.4_Missense_Mutation_p.L174F|ZNF638_ENST00000377802.2_Missense_Mutation_p.L174F|ZNF638_ENST00000410075.1_3'UTR|ZNF638_ENST00000355812.3_Missense_Mutation_p.L174F	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638	174					regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)	p.L174F(1)		breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						CATTAATTTTGAGGGATATAA	0.363																																						dbGAP											1	Substitution - Missense(1)	breast(1)											60.0	60.0	60.0					2																	71576606		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.522G>C	2.37:g.71576606G>C	ENSP00000386433:p.Leu174Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	Missense_Mutation	SNP	pfam_RRM_dom,smart_Znf_U1,smart_Znf_C2H2-like,smart_RRM_dom,pfscan_Znf_C2H2_matrin,pfscan_RRM_dom	p.L174F	ENST00000409544.1	37	c.522	CCDS1917.1	2	.	.	.	.	.	.	.	.	.	.	G	13.45	2.240907	0.39598	.	.	ENSG00000075292	ENST00000410075;ENST00000544512;ENST00000355812;ENST00000377802;ENST00000264447;ENST00000409544;ENST00000437658	T;D;T;T;T;T;T	0.83837	-1.18;-1.77;-0.59;-1.2;0.25;0.25;-0.06	5.71	3.91	0.45181	.	0.079949	0.50627	N	0.000115	D	0.84593	0.5506	L	0.29908	0.895	0.38761	D	0.954327	D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;0.999	D;D;D;D;D	0.87578	0.998;0.994;0.997;0.994;0.994	D	0.85599	0.1251	10	0.87932	D	0	-4.2255	10.1889	0.43015	0.1611:0.0:0.8389:0.0	.	280;174;174;174;174	F5H330;Q14966-4;Q14966-3;Q14966;Q14966-2	.;.;.;ZN638_HUMAN;.	F	174;280;174;174;174;174;174	ENSP00000386669:L174F;ENSP00000438189:L280F;ENSP00000348066:L174F;ENSP00000367033:L174F;ENSP00000264447:L174F;ENSP00000386433:L174F;ENSP00000388164:L174F	ENSP00000264447:L174F	L	+	3	2	ZNF638	71430114	0.994000	0.37717	1.000000	0.80357	0.997000	0.91878	0.295000	0.19065	0.773000	0.33404	0.655000	0.94253	TTG	ZNF638	-	NULL	ENSG00000075292		0.363	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	93	0.00	0	G	NM_014497		71576606	71576606	+1	no_errors	ENST00000264447	ensembl	human	known	69_37n	missense	70	23.08	21	SNP	0.998	C
ZNF385B	151126	genome.wustl.edu	37	2	180634302	180634302	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:180634302G>A	ENST00000410066.1	-	3	784	c.181C>T	c.(181-183)Cga>Tga	p.R61*		NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	61	Required for induction of apoptosis.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)	p.R61*(1)		breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TGCTTCACTCGTTTGCGGTGG	0.582																																					Colon(155;204 2491 32774 51842)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											84.0	74.0	78.0					2																	180634302		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.181C>T	2.37:g.180634302G>A	ENSP00000386845:p.Arg61*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Nonsense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.R61*	ENST00000410066.1	37	c.181	CCDS33339.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.740696	0.96873	.	.	ENSG00000144331	ENST00000410066;ENST00000451732	.	.	.	6.06	4.08	0.47627	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.4063	13.7802	0.63079	0.0:0.0:0.6088:0.3912	.	.	.	.	X	61	.	ENSP00000386845:R61X	R	-	1	2	ZNF385B	180342547	0.996000	0.38824	0.933000	0.37362	0.972000	0.66771	2.430000	0.44766	1.551000	0.49450	0.655000	0.94253	CGA	ZNF385B	-	smart_Znf_U1	ENSG00000144331		0.582	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	HGNC	protein_coding	OTTHUMT00000335972.1	92	0.00	0	G	NM_152520		180634302	180634302	-1	no_errors	ENST00000410066	ensembl	human	known	69_37n	nonsense	15	31.82	7	SNP	0.985	A
ZNF385B	151126	genome.wustl.edu	37	2	180634302	180634302	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr2:180634302G>A	ENST00000410066.1	-	3	784	c.181C>T	c.(181-183)Cga>Tga	p.R61*		NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B	61	Required for induction of apoptosis.				intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)	p.R61*(1)		breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			TGCTTCACTCGTTTGCGGTGG	0.582																																					Colon(155;204 2491 32774 51842)	dbGAP											1	Substitution - Nonsense(1)	breast(1)											84.0	74.0	78.0					2																	180634302		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.181C>T	2.37:g.180634302G>A	ENSP00000386845:p.Arg61*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	Nonsense_Mutation	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.R61*	ENST00000410066.1	37	c.181	CCDS33339.1	2	.	.	.	.	.	.	.	.	.	.	G	36	5.740696	0.96873	.	.	ENSG00000144331	ENST00000410066;ENST00000451732	.	.	.	6.06	4.08	0.47627	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.4063	13.7802	0.63079	0.0:0.0:0.6088:0.3912	.	.	.	.	X	61	.	ENSP00000386845:R61X	R	-	1	2	ZNF385B	180342547	0.996000	0.38824	0.933000	0.37362	0.972000	0.66771	2.430000	0.44766	1.551000	0.49450	0.655000	0.94253	CGA	ZNF385B	-	smart_Znf_U1	ENSG00000144331		0.582	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	HGNC	protein_coding	OTTHUMT00000335972.1	92	0.00	0	G	NM_152520		180634302	180634302	-1	no_errors	ENST00000410066	ensembl	human	known	69_37n	nonsense	35	25.53	12	SNP	0.985	A
ZNF736	728927	genome.wustl.edu	37	7	63797334	63797334	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:63797334G>A	ENST00000423484.2	+	3	322	c.200G>A	c.(199-201)aGa>aAa	p.R67K	ZNF736_ENST00000355095.4_Missense_Mutation_p.R67K			B4DX44	ZN736_HUMAN	zinc finger protein 736	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R67K(1)		breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						AAAGTGAAGAGACAGGAGGCA	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	73.0	75.0					7																	63797334		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.200G>A	7.37:g.63797334G>A	ENSP00000400852:p.Arg67Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R67K	ENST00000423484.2	37	c.200	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	G	4.407	0.075289	0.08485	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.04454	3.62;3.62	0.235	-0.47	0.12131	Krueppel-associated box (1);	.	.	.	.	T	0.04543	0.0124	L	0.46567	1.45	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40421	-0.9564	8	0.48119	T	0.1	.	.	.	.	.	67	B4DX44	ZN736_HUMAN	K	67	ENSP00000347210:R67K;ENSP00000400852:R67K	ENSP00000347210:R67K	R	+	2	0	ZNF736	63434769	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.703000	0.05063	-0.671000	0.05274	-0.657000	0.03884	AGA	ZNF736	-	pfscan_Krueppel-associated_box	ENSG00000234444		0.433	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	109	0.00	0	G	NM_001170905		63797334	63797334	+1	no_errors	ENST00000355095	ensembl	human	known	69_37n	missense	129	23.21	39	SNP	0.003	A
ZNF736	728927	genome.wustl.edu	37	7	63797334	63797334	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr7:63797334G>A	ENST00000423484.2	+	3	322	c.200G>A	c.(199-201)aGa>aAa	p.R67K	ZNF736_ENST00000355095.4_Missense_Mutation_p.R67K			B4DX44	ZN736_HUMAN	zinc finger protein 736	67	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.R67K(1)		breast(1)|endometrium(6)|stomach(1)|urinary_tract(1)	9						AAAGTGAAGAGACAGGAGGCA	0.433																																						dbGAP											1	Substitution - Missense(1)	breast(1)											79.0	73.0	75.0					7																	63797334		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS55114.1	7q11.21	2013-01-08			ENSG00000234444	ENSG00000234444		"""Zinc fingers, C2H2-type"", ""-"""	32467	protein-coding gene	gene with protein product							Standard	XM_006716104		Approved		uc011kdo.2	B4DX44	OTTHUMG00000156537	ENST00000423484.2:c.200G>A	7.37:g.63797334G>A	ENSP00000400852:p.Arg67Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R67K	ENST00000423484.2	37	c.200	CCDS55114.1	7	.	.	.	.	.	.	.	.	.	.	G	4.407	0.075289	0.08485	.	.	ENSG00000234444	ENST00000355095;ENST00000423484	T;T	0.04454	3.62;3.62	0.235	-0.47	0.12131	Krueppel-associated box (1);	.	.	.	.	T	0.04543	0.0124	L	0.46567	1.45	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.40421	-0.9564	8	0.48119	T	0.1	.	.	.	.	.	67	B4DX44	ZN736_HUMAN	K	67	ENSP00000347210:R67K;ENSP00000400852:R67K	ENSP00000347210:R67K	R	+	2	0	ZNF736	63434769	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.703000	0.05063	-0.671000	0.05274	-0.657000	0.03884	AGA	ZNF736	-	pfscan_Krueppel-associated_box	ENSG00000234444		0.433	ZNF736-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF736	HGNC	protein_coding	OTTHUMT00000344559.2	109	0.00	0	G	NM_001170905		63797334	63797334	+1	no_errors	ENST00000355095	ensembl	human	known	69_37n	missense	82	23.36	25	SNP	0.003	A
ZNF83	55769	genome.wustl.edu	37	19	53116808	53116808	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:53116808C>T	ENST00000597597.1	-	2	3263	c.1010G>A	c.(1009-1011)aGa>aAa	p.R337K	ZNF83_ENST00000391789.4_Missense_Mutation_p.R309K|ZNF83_ENST00000301096.3_Missense_Mutation_p.R337K|ZNF83_ENST00000536937.1_Missense_Mutation_p.R337K|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000541777.2_Missense_Mutation_p.R337K|ZNF83_ENST00000545872.1_Missense_Mutation_p.R337K|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000544146.1_Missense_Mutation_p.R337K			P51522	ZNF83_HUMAN	zinc finger protein 83	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R337K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		AGTGTGGATTCTCCAGTGATT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											117.0	119.0	118.0					19																	53116808		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.1010G>A	19.37:g.53116808C>T	ENSP00000472619:p.Arg337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R337K	ENST00000597597.1	37	c.1010	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	N	9.996	1.232074	0.22626	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22	2.1	-0.348	0.12613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25791	0.0628	L	0.42581	1.335	0.09310	N	1	B;D	0.67145	0.003;0.996	B;D	0.81914	0.007;0.995	T	0.13045	-1.0524	9	0.40728	T	0.16	.	4.3169	0.10997	0.0:0.5535:0.1879:0.2586	.	309;337	P51522-2;P51522	.;ZNF83_HUMAN	K	337;337;337;309;337;337;309	ENSP00000445993:R337K;ENSP00000301096:R337K;ENSP00000445470:R337K;ENSP00000440713:R337K;ENSP00000439681:R337K;ENSP00000375666:R309K	ENSP00000301096:R337K	R	-	2	0	ZNF83	57808620	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.900000	0.04097	-0.130000	0.11599	-0.879000	0.02964	AGA	ZNF83	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167766		0.418	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	94	0.00	0	C	NM_018300		53116808	53116808	-1	no_errors	ENST00000301096	ensembl	human	known	69_37n	missense	155	17.55	33	SNP	0.035	T
ZNF83	55769	genome.wustl.edu	37	19	53116808	53116808	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr19:53116808C>T	ENST00000597597.1	-	2	3263	c.1010G>A	c.(1009-1011)aGa>aAa	p.R337K	ZNF83_ENST00000391789.4_Missense_Mutation_p.R309K|ZNF83_ENST00000301096.3_Missense_Mutation_p.R337K|ZNF83_ENST00000536937.1_Missense_Mutation_p.R337K|ZNF83_ENST00000600714.1_Intron|ZNF83_ENST00000541777.2_Missense_Mutation_p.R337K|ZNF83_ENST00000545872.1_Missense_Mutation_p.R337K|ZNF83_ENST00000601257.1_Intron|ZNF83_ENST00000594682.2_3'UTR|ZNF83_ENST00000544146.1_Missense_Mutation_p.R337K			P51522	ZNF83_HUMAN	zinc finger protein 83	337					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.R337K(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				OV - Ovarian serous cystadenocarcinoma(262;0.00841)|GBM - Glioblastoma multiforme(134;0.0244)		AGTGTGGATTCTCCAGTGATT	0.418																																						dbGAP											1	Substitution - Missense(1)	breast(1)											117.0	119.0	118.0					19																	53116808		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27877	CCDS12854.1	19q13.3	2013-01-08	2006-05-12			ENSG00000167766		"""Zinc fingers, C2H2-type"""	13158	protein-coding gene	gene with protein product		194558	"""zinc finger protein 83 (HPF1)"", ""zinc finger protein 816B"""	ZNF816B		8088807	Standard	NM_018300		Approved	FLJ11015, HPF1	uc010epy.3	P51522		ENST00000597597.1:c.1010G>A	19.37:g.53116808C>T	ENSP00000472619:p.Arg337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MT75|Q3ZCX0|Q6PI08	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R337K	ENST00000597597.1	37	c.1010	CCDS12854.1	19	.	.	.	.	.	.	.	.	.	.	N	9.996	1.232074	0.22626	.	.	ENSG00000167766	ENST00000536937;ENST00000301096;ENST00000544146;ENST00000434535;ENST00000545872;ENST00000541777;ENST00000391789	T;T;T;T;T;T	0.18338	2.22;2.22;2.22;2.22;2.22;2.22	2.1	-0.348	0.12613	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.25791	0.0628	L	0.42581	1.335	0.09310	N	1	B;D	0.67145	0.003;0.996	B;D	0.81914	0.007;0.995	T	0.13045	-1.0524	9	0.40728	T	0.16	.	4.3169	0.10997	0.0:0.5535:0.1879:0.2586	.	309;337	P51522-2;P51522	.;ZNF83_HUMAN	K	337;337;337;309;337;337;309	ENSP00000445993:R337K;ENSP00000301096:R337K;ENSP00000445470:R337K;ENSP00000440713:R337K;ENSP00000439681:R337K;ENSP00000375666:R309K	ENSP00000301096:R337K	R	-	2	0	ZNF83	57808620	0.000000	0.05858	0.001000	0.08648	0.003000	0.03518	-0.900000	0.04097	-0.130000	0.11599	-0.879000	0.02964	AGA	ZNF83	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167766		0.418	ZNF83-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF83	HGNC	protein_coding	OTTHUMT00000463700.1	94	0.00	0	C	NM_018300		53116808	53116808	-1	no_errors	ENST00000301096	ensembl	human	known	69_37n	missense	90	17.43	19	SNP	0.035	T
ZNHIT6	54680	genome.wustl.edu	37	1	86144457	86144457	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:86144457C>A	ENST00000370574.3	-	7	1229	c.1096G>T	c.(1096-1098)Gat>Tat	p.D366Y	ZNHIT6_ENST00000431532.2_Missense_Mutation_p.D327Y			Q9NWK9	BCD1_HUMAN	zinc finger, HIT-type containing 6	366					box C/D snoRNP assembly (GO:0000492)|ribosome biogenesis (GO:0042254)	extracellular vesicular exosome (GO:0070062)|pre-snoRNP complex (GO:0070761)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.D366Y(1)		autonomic_ganglia(1)|breast(2)|cervix(2)|large_intestine(10)|lung(1)|urinary_tract(1)	17						GTTTTATCATCTGGTACTCTT	0.254																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	98.0	98.0					1																	86144457		2200	4296	6496	-	-	-	SO:0001583	missense	0			AL442074	CCDS707.1, CCDS53338.1	1p22.3	2013-01-17	2010-09-15	2008-06-23	ENSG00000117174	ENSG00000117174		"""Zinc fingers, HIT-type"""	26089	protein-coding gene	gene with protein product	"""box C/D snoRNA essential 1 homolog (S. cerevisiae)"""		"""chromosome 1 open reading frame 181"", ""zinc finger, HIT type 6"""	C1orf181		12747765	Standard	NM_017953		Approved	FLJ20729, NY-BR-75, BCD1	uc001dlh.3	Q9NWK9	OTTHUMG00000010576	ENST00000370574.3:c.1096G>T	1.37:g.86144457C>A	ENSP00000359606:p.Asp366Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBA1|B4DP13|D3DT20|Q9H278|Q9H3X3|Q9NWN0	Missense_Mutation	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.D366Y	ENST00000370574.3	37	c.1096	CCDS707.1	1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933144	0.73442	.	.	ENSG00000117174	ENST00000431532;ENST00000370574	T;T	0.47528	0.87;0.84	5.46	5.46	0.80206	.	0.210083	0.47455	D	0.000226	T	0.59609	0.2206	M	0.61703	1.905	0.49798	D	0.999823	D;D	0.71674	0.998;0.995	D;P	0.64144	0.922;0.725	T	0.62234	-0.6897	10	0.87932	D	0	-19.3753	18.4407	0.90665	0.0:1.0:0.0:0.0	.	327;366	B4DP13;Q9NWK9	.;BCD1_HUMAN	Y	327;366	ENSP00000414344:D327Y;ENSP00000359606:D366Y	ENSP00000359606:D366Y	D	-	1	0	ZNHIT6	85917045	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.712000	0.61888	2.714000	0.92807	0.655000	0.94253	GAT	ZNHIT6	-	NULL	ENSG00000117174		0.254	ZNHIT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT6	HGNC	protein_coding	OTTHUMT00000029186.1	215	0.00	0	C	NM_017953		86144457	86144457	-1	no_errors	ENST00000370574	ensembl	human	known	69_37n	missense	276	18.34	62	SNP	1.000	A
ZNHIT6	54680	genome.wustl.edu	37	1	86144457	86144457	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr1:86144457C>A	ENST00000370574.3	-	7	1229	c.1096G>T	c.(1096-1098)Gat>Tat	p.D366Y	ZNHIT6_ENST00000431532.2_Missense_Mutation_p.D327Y			Q9NWK9	BCD1_HUMAN	zinc finger, HIT-type containing 6	366					box C/D snoRNP assembly (GO:0000492)|ribosome biogenesis (GO:0042254)	extracellular vesicular exosome (GO:0070062)|pre-snoRNP complex (GO:0070761)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)	p.D366Y(1)		autonomic_ganglia(1)|breast(2)|cervix(2)|large_intestine(10)|lung(1)|urinary_tract(1)	17						GTTTTATCATCTGGTACTCTT	0.254																																						dbGAP											1	Substitution - Missense(1)	breast(1)											98.0	98.0	98.0					1																	86144457		2200	4296	6496	-	-	-	SO:0001583	missense	0			AL442074	CCDS707.1, CCDS53338.1	1p22.3	2013-01-17	2010-09-15	2008-06-23	ENSG00000117174	ENSG00000117174		"""Zinc fingers, HIT-type"""	26089	protein-coding gene	gene with protein product	"""box C/D snoRNA essential 1 homolog (S. cerevisiae)"""		"""chromosome 1 open reading frame 181"", ""zinc finger, HIT type 6"""	C1orf181		12747765	Standard	NM_017953		Approved	FLJ20729, NY-BR-75, BCD1	uc001dlh.3	Q9NWK9	OTTHUMG00000010576	ENST00000370574.3:c.1096G>T	1.37:g.86144457C>A	ENSP00000359606:p.Asp366Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBA1|B4DP13|D3DT20|Q9H278|Q9H3X3|Q9NWN0	Missense_Mutation	SNP	pfam_Znf_HIT,pfscan_Znf_HIT	p.D366Y	ENST00000370574.3	37	c.1096	CCDS707.1	1	.	.	.	.	.	.	.	.	.	.	C	20.1	3.933144	0.73442	.	.	ENSG00000117174	ENST00000431532;ENST00000370574	T;T	0.47528	0.87;0.84	5.46	5.46	0.80206	.	0.210083	0.47455	D	0.000226	T	0.59609	0.2206	M	0.61703	1.905	0.49798	D	0.999823	D;D	0.71674	0.998;0.995	D;P	0.64144	0.922;0.725	T	0.62234	-0.6897	10	0.87932	D	0	-19.3753	18.4407	0.90665	0.0:1.0:0.0:0.0	.	327;366	B4DP13;Q9NWK9	.;BCD1_HUMAN	Y	327;366	ENSP00000414344:D327Y;ENSP00000359606:D366Y	ENSP00000359606:D366Y	D	-	1	0	ZNHIT6	85917045	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	4.712000	0.61888	2.714000	0.92807	0.655000	0.94253	GAT	ZNHIT6	-	NULL	ENSG00000117174		0.254	ZNHIT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNHIT6	HGNC	protein_coding	OTTHUMT00000029186.1	215	0.00	0	C	NM_017953		86144457	86144457	-1	no_errors	ENST00000370574	ensembl	human	known	69_37n	missense	423	18.02	93	SNP	1.000	A
ZSCAN2	54993	genome.wustl.edu	37	15	85147402	85147402	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr15:85147402G>A	ENST00000448803.2	+	2	536	c.244G>A	c.(244-246)Gag>Aag	p.E82K	ZSCAN2_ENST00000379358.3_Missense_Mutation_p.E82K|ZSCAN2_ENST00000485222.2_Missense_Mutation_p.E82K|ZSCAN2_ENST00000327179.6_Missense_Mutation_p.E82K|ZSCAN2_ENST00000334141.3_Missense_Mutation_p.E82K|ZSCAN2_ENST00000546148.1_Missense_Mutation_p.E82K|ZSCAN2_ENST00000538076.1_Missense_Mutation_p.E82K|ZSCAN2_ENST00000541040.1_Missense_Mutation_p.E82K|ZSCAN2_ENST00000358472.3_Intron	NM_181877.3	NP_870992.2	Q7Z7L9	ZSCA2_HUMAN	zinc finger and SCAN domain containing 2	82	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|liver(2)|lung(4)|ovary(1)|pancreas(1)	19				UCEC - Uterine corpus endometrioid carcinoma (272;0.168)|all cancers(203;5.43e-22)		CCGCCTCCGAGAGCTCTGCCG	0.637																																						dbGAP											0													29.0	29.0	29.0					15																	85147402		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC041620	CCDS10329.2, CCDS32315.1, CCDS32316.1	15q25.2	2013-01-08	2004-11-01	2004-11-02	ENSG00000176371	ENSG00000176371		"""-"", ""Zinc fingers, C2H2-type"""	20994	protein-coding gene	gene with protein product			"""zinc finger protein 29"""	ZFP29		1937051	Standard	NM_017894		Approved	FLJ20595, ZNF854	uc002bkr.3	Q7Z7L9	OTTHUMG00000074027	ENST00000448803.2:c.244G>A	15.37:g.85147402G>A	ENSP00000410198:p.Glu82Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG83|B2RMQ9|Q6ZQY9|Q9NWU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E82K	ENST00000448803.2	37	c.244	CCDS10329.2	15	.	.	.	.	.	.	.	.	.	.	G	31	5.065862	0.93898	.	.	ENSG00000176371	ENST00000540936;ENST00000448803;ENST00000546148;ENST00000334141;ENST00000379358;ENST00000327179;ENST00000541040;ENST00000538076;ENST00000485222;ENST00000379353	T;T;T;T;T;T;T;T;T	0.07216	3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21;3.21	5.63	5.63	0.86233	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.53938	D	0.000054	T	0.24122	0.0584	M	0.64676	1.99	0.41634	D	0.989036	D;D;D;D;D;D;D	0.89917	0.998;0.999;0.998;0.997;0.997;0.998;1.0	D;D;D;D;D;D;D	0.91635	0.994;0.996;0.994;0.992;0.992;0.994;0.999	T	0.02220	-1.1193	10	0.16420	T	0.52	-22.3023	15.1847	0.72989	0.0:0.0:1.0:0.0	.	82;82;82;82;82;82;82	F5H3F3;F5GY18;F5GZ04;A8K5A9;Q7Z7L9;Q7Z7L9-4;Q7Z7L9-3	.;.;.;.;ZSCA2_HUMAN;.;.	K	82;82;82;82;82;82;82;82;82;63	ENSP00000446041:E82K;ENSP00000410198:E82K;ENSP00000445451:E82K;ENSP00000333895:E82K;ENSP00000368663:E82K;ENSP00000325123:E82K;ENSP00000441342:E82K;ENSP00000439132:E82K;ENSP00000440004:E82K	ENSP00000325123:E82K	E	+	1	0	ZSCAN2	82948406	1.000000	0.71417	0.969000	0.41365	0.912000	0.54170	3.470000	0.53100	2.644000	0.89710	0.655000	0.94253	GAG	ZSCAN2	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000176371		0.637	ZSCAN2-007	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN2	HGNC	protein_coding	OTTHUMT00000396956.1	49	0.00	0	G	NM_017894		85147402	85147402	+1	no_errors	ENST00000448803	ensembl	human	known	69_37n	missense	7	22.22	2	SNP	0.982	A
ZWINT	11130	genome.wustl.edu	37	10	58120134	58120134	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0HP-01A-12D-A099-09	TCGA-BH-A0HP-10A-01D-A099-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ad52a8fb-7a76-4aa0-95fb-d6edab0fe2b2	8c059d33-23de-439a-914a-290527c5efbe	g.chr10:58120134C>T	ENST00000373944.3	-	2	90	c.52G>A	c.(52-54)Gag>Aag	p.E18K	ZWINT_ENST00000361148.6_Missense_Mutation_p.E18K|ZWINT_ENST00000318387.2_5'Flank|ZWINT_ENST00000460654.1_5'Flank|ZWINT_ENST00000395405.1_Missense_Mutation_p.E18K			O95229	ZWINT_HUMAN	ZW10 interacting kinetochore protein	18					establishment of localization in cell (GO:0051649)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid segregation (GO:0000070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|kinetochore (GO:0000776)|nucleus (GO:0005634)	protein N-terminus binding (GO:0047485)			NS(2)|breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)	20						CCTGCCACCTCAGCCAGGACC	0.512																																						dbGAP											0													51.0	46.0	47.0					10																	58120134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067656	CCDS7249.1, CCDS31205.1	10q21-q22	2013-05-01	2013-05-01		ENSG00000122952	ENSG00000122952			13195	protein-coding gene	gene with protein product		609177	"""ZW10 interactor"""				Standard	XM_005269463		Approved	KNTC2AP	uc001jka.1	O95229	OTTHUMG00000018261	ENST00000373944.3:c.52G>A	10.37:g.58120134C>T	ENSP00000363055:p.Glu18Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNV6|Q0D2I3|Q9BWD0	Missense_Mutation	SNP	NULL	p.E18K	ENST00000373944.3	37	c.52	CCDS7249.1	10	.	.	.	.	.	.	.	.	.	.	C	11.55	1.671925	0.29693	.	.	ENSG00000122952	ENST00000373944;ENST00000395405;ENST00000373940;ENST00000361148	T;T;T	0.30981	1.53;1.53;1.51	4.56	-2.86	0.05717	.	0.774367	0.11347	N	0.573396	T	0.10551	0.0258	N	0.11201	0.11	0.09310	N	1	B;B	0.11235	0.004;0.004	B;B	0.11329	0.006;0.006	T	0.31420	-0.9944	10	0.13853	T	0.58	-2.0048	1.0588	0.01596	0.1552:0.2874:0.1525:0.4049	.	18;18	A6NNV6;O95229	.;ZWINT_HUMAN	K	18	ENSP00000363055:E18K;ENSP00000378801:E18K;ENSP00000354921:E18K	ENSP00000354921:E18K	E	-	1	0	ZWINT	57790140	0.000000	0.05858	0.002000	0.10522	0.604000	0.37047	0.015000	0.13355	-0.293000	0.08986	0.557000	0.71058	GAG	ZWINT	-	NULL	ENSG00000122952		0.512	ZWINT-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZWINT	HGNC	protein_coding	OTTHUMT00000048132.1	62	0.00	0	C			58120134	58120134	-1	no_errors	ENST00000373944	ensembl	human	known	69_37n	missense	16	15.79	3	SNP	0.000	T
