#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ANO4	121601	genome.wustl.edu	37	12	101505394	101505394	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr12:101505394G>A	ENST00000392977.3	+	24	2566	c.2356G>A	c.(2356-2358)Gca>Aca	p.A786T	ANO4_ENST00000550015.1_Missense_Mutation_p.A306T|ANO4_ENST00000392979.3_Missense_Mutation_p.A751T|ANO4_ENST00000299222.9_Missense_Mutation_p.A306T			Q32M45	ANO4_HUMAN	anoctamin 4	786					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)	p.A751T(1)		NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						TATCACAAATGCATTTGTCAT	0.393										HNSCC(74;0.22)																												dbGAP											1	Substitution - Missense(1)	breast(1)											143.0	132.0	135.0					12																	101505394		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2356G>A	12.37:g.101505394G>A	ENSP00000376703:p.Ala786Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.A786T	ENST00000392977.3	37	c.2356		12	.	.	.	.	.	.	.	.	.	.	G	35	5.540647	0.96474	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.82167	0.4978	M	0.84326	2.69	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.97110	0.998;1.0;0.999	D	0.83554	0.0103	10	0.72032	D	0.01	.	20.0313	0.97540	0.0:0.0:1.0:0.0	.	306;786;751	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	T	751;306;786;306	ENSP00000376705:A751T;ENSP00000299222:A306T;ENSP00000376703:A786T;ENSP00000450192:A306T	ENSP00000299222:A306T	A	+	1	0	ANO4	100029525	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.746000	0.94184	0.655000	0.94253	GCA	ANO4	-	pfam_Anoctamin	ENSG00000151572		0.393	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	213	0.00	0	G	NM_178826		101505394	101505394	+1	no_errors	ENST00000392977	ensembl	human	known	69_37n	missense	148	15.43	27	SNP	1.000	A
APLNR	187	genome.wustl.edu	37	11	57003835	57003835	+	Missense_Mutation	SNP	G	G	A	rs532639542		TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr11:57003835G>A	ENST00000606794.1	-	1	840	c.644C>T	c.(643-645)aCc>aTc	p.T215I		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	215					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)	p.T215I(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CAGCATGATGGTGAAGGGCAC	0.622																																						dbGAP											1	Substitution - Missense(1)	breast(1)											146.0	121.0	130.0					11																	57003835		2201	4296	6497	-	-	-	SO:0001583	missense	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.644C>T	11.37:g.57003835G>A	ENSP00000475344:p.Thr215Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_APJ_rcpt,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_ATII_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.T215I	ENST00000606794.1	37	c.644	CCDS7950.1	11	.	.	.	.	.	.	.	.	.	.	G	8.582	0.882611	0.17467	.	.	ENSG00000134817	ENST00000257254;ENST00000326830;ENST00000444275	T	0.34072	1.38	5.25	0.785	0.18584	GPCR, rhodopsin-like superfamily (1);	0.690743	0.14213	N	0.333946	T	0.15912	0.0383	N	0.04994	-0.135	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.29274	-1.0017	10	0.17369	T	0.5	-6.2227	9.4202	0.38546	0.3797:0.0:0.6203:0.0	.	215	P35414	APJ_HUMAN	I	215;96;134	ENSP00000257254:T215I	ENSP00000257254:T215I	T	-	2	0	APLNR	56760411	0.000000	0.05858	0.318000	0.25279	0.974000	0.67602	0.299000	0.19138	-0.105000	0.12132	0.555000	0.69702	ACC	APLNR	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000134817		0.622	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	71	0.00	0	G	NM_005161		57003835	57003835	-1	no_errors	ENST00000257254	ensembl	human	known	69_37n	missense	30	16.67	6	SNP	0.106	A
CHAF1A	10036	genome.wustl.edu	37	19	4429539	4429539	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr19:4429539A>G	ENST00000301280.5	+	9	1810	c.1709A>G	c.(1708-1710)tAc>tGc	p.Y570C	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	570					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)	p.Y570C(1)		breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCCTGCCTACTGGGGTACC	0.632								Chromatin Structure																														dbGAP											1	Substitution - Missense(1)	breast(1)											87.0	79.0	81.0					19																	4429539		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1709A>G	19.37:g.4429539A>G	ENSP00000301280:p.Tyr570Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A,pfam_CAF-1_p150	p.Y570C	ENST00000301280.5	37	c.1709	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	A	17.27	3.346128	0.61073	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.54866	0.55	5.36	5.36	0.76844	.	.	.	.	.	T	0.80449	0.4625	H	0.95151	3.63	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86476	0.1788	9	0.87932	D	0	-36.952	14.5062	0.67755	1.0:0.0:0.0:0.0	.	570	Q13111	CAF1A_HUMAN	C	570	ENSP00000301280:Y570C	ENSP00000301280:Y570C	Y	+	2	0	CHAF1A	4380539	1.000000	0.71417	0.991000	0.47740	0.228000	0.25075	9.105000	0.94246	2.023000	0.59567	0.477000	0.44152	TAC	CHAF1A	-	pfam_CAF1A	ENSG00000167670		0.632	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	95	0.00	0	A	NM_005483		4429539	4429539	+1	no_errors	ENST00000301280	ensembl	human	known	69_37n	missense	83	13.40	13	SNP	1.000	G
CTCF	10664	genome.wustl.edu	37	16	67645923	67645923	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr16:67645923A>C	ENST00000264010.4	+	4	1295	c.851A>C	c.(850-852)cAc>cCc	p.H284P	CTCF_ENST00000401394.1_Intron|AC009095.4_ENST00000388909.4_RNA	NM_006565.3	NP_006556.1	P49711	CTCF_HUMAN	CCCTC-binding factor (zinc finger protein)	284					chromatin modification (GO:0016568)|chromosome segregation (GO:0007059)|DNA methylation (GO:0006306)|maintenance of DNA methylation (GO:0010216)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome positioning (GO:0016584)|positive regulation of gene expression (GO:0010628)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of gene expression, epigenetic (GO:0040029)|regulation of histone acetylation (GO:0035065)|regulation of histone methylation (GO:0031060)|regulation of molecular function, epigenetic (GO:0040030)	chromosome, centromeric region (GO:0000775)|condensed chromosome (GO:0000793)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin insulator sequence binding (GO:0043035)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.H284P(1)		breast(6)|central_nervous_system(2)|cervix(1)|endometrium(34)|haematopoietic_and_lymphoid_tissue(7)|kidney(3)|large_intestine(9)|liver(1)|lung(11)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	79		Acute lymphoblastic leukemia(13;3.76e-06)|all_hematologic(13;0.000303)|Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0166)|Epithelial(162;0.0577)		TTGGATCGTCACATGAAAAGC	0.463																																					Colon(175;1200 1966 6945 23069 27405)	dbGAP											1	Substitution - Missense(1)	breast(1)											152.0	123.0	133.0					16																	67645923		2198	4300	6498	-	-	-	SO:0001583	missense	0			U25435	CCDS10841.1, CCDS54029.1	16q21-q22.3	2013-01-08			ENSG00000102974	ENSG00000102974		"""Zinc fingers, C2H2-type"""	13723	protein-coding gene	gene with protein product	"""11 zinc finger transcriptional repressor"""	604167				8649389, 18550811	Standard	NM_006565		Approved		uc002etl.3	P49711	OTTHUMG00000137539	ENST00000264010.4:c.851A>C	16.37:g.67645923A>C	ENSP00000264010:p.His284Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC38|Q53XI7|Q59EL8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H284P	ENST00000264010.4	37	c.851	CCDS10841.1	16	.	.	.	.	.	.	.	.	.	.	A	20.8	4.047510	0.75846	.	.	ENSG00000102974	ENST00000264010	D	0.86865	-2.18	5.08	5.08	0.68730	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	D	0.000002	D	0.95446	0.8521	H	0.95884	3.735	0.80722	D	1	D	0.69078	0.997	D	0.81914	0.995	D	0.96498	0.9369	10	0.56958	D	0.05	.	15.0173	0.71597	1.0:0.0:0.0:0.0	.	284	P49711	CTCF_HUMAN	P	284	ENSP00000264010:H284P	ENSP00000264010:H284P	H	+	2	0	CTCF	66203424	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.139000	0.94554	2.133000	0.65898	0.533000	0.62120	CAC	CTCF	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000102974		0.463	CTCF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTCF	HGNC	protein_coding	OTTHUMT00000268870.2	80	0.00	0	A	NM_006565		67645923	67645923	+1	no_errors	ENST00000264010	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	1.000	C
ELF4	2000	genome.wustl.edu	37	X	129206310	129206310	+	Silent	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chrX:129206310G>A	ENST00000308167.5	-	5	802	c.423C>T	c.(421-423)ccC>ccT	p.P141P	ELF4_ENST00000335997.7_Silent_p.P141P	NM_001421.3	NP_001412.1			E74-like factor 4 (ets domain transcription factor)									p.P141P(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	22						TCAGGGCATCGGGCTCAGAGG	0.557			T	ERG	AML																																	dbGAP		Dom	yes		X	Xq26	2000	E74-like factor 4 (ets domain transcription factor)		L	1	Substitution - coding silent(1)	breast(1)											118.0	113.0	115.0					X																	129206310		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U32645	CCDS14617.1	Xq26	2014-09-17			ENSG00000102034	ENSG00000102034			3319	protein-coding gene	gene with protein product		300775				8895518	Standard	NM_001421		Approved	MEF, ELFR	uc004eve.4	Q99607	OTTHUMG00000022390	ENST00000308167.5:c.423C>T	X.37:g.129206310G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.P141	ENST00000308167.5	37	c.423	CCDS14617.1	X																																																																																			ELF4	-	NULL	ENSG00000102034		0.557	ELF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF4	HGNC	protein_coding	OTTHUMT00000058243.1	243	0.00	0	G	NM_001421		129206310	129206310	-1	no_errors	ENST00000308167	ensembl	human	known	69_37n	silent	136	16.05	26	SNP	0.000	A
MTX1	4580	genome.wustl.edu	37	1	155184057	155184057	+	IGR	SNP	G	G	A	rs114312440	byFrequency	TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr1:155184057G>A	ENST00000368376.3	+	0	1632				GBAP1_ENST00000486869.1_RNA|RP11-263K19.6_ENST00000455788.1_RNA	NM_002455.3	NP_002446.2	Q13505	MTX1_HUMAN	metaxin 1						cellular protein metabolic process (GO:0044267)|protein targeting to mitochondrion (GO:0006626)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)				breast(1)|endometrium(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)	7	all_epithelial(22;5.72e-28)|all_lung(78;2.07e-24)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			GTAAGCTCACGCTGGCCCTGT	0.572													G|||	1875	0.374401	0.1286	0.5259	5008	,	,		17617	0.6806		0.3012	False		,,,				2504	0.3589					dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0				CCDS1100.1, CCDS1101.1	1q21	2008-07-18			ENSG00000173171	ENSG00000173171			7504	protein-coding gene	gene with protein product		600605		MTX		7753840	Standard	XM_006711338		Approved	MTXN	uc001fjb.3	Q13505	OTTHUMG00000035708		1.37:g.155184057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AVR9|B1AVS0|B2R9P4|Q9BUU3	RNA	SNP	-	NULL	ENST00000368376.3	37	NULL	CCDS1100.1	1																																																																																			GBAP1	-	-	ENSG00000160766		0.572	MTX1-001	KNOWN	basic|CCDS	protein_coding	GBAP1	HGNC	protein_coding	OTTHUMT00000086844.1	30	0.00	0	G	NM_198883		155184057	155184057	-1	no_errors	ENST00000368374	ensembl	human	known	69_37n	rna	25	19.35	6	SNP	0.011	A
HNF1A	6927	genome.wustl.edu	37	12	121431482	121431482	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr12:121431482G>A	ENST00000257555.6	+	3	912	c.686G>A	c.(685-687)cGa>cAa	p.R229Q	HNF1A_ENST00000544413.1_Missense_Mutation_p.R229Q|HNF1A_ENST00000541395.1_Missense_Mutation_p.R229Q|HNF1A_ENST00000402929.1_Missense_Mutation_p.R229Q|HNF1A_ENST00000543427.1_Missense_Mutation_p.R112Q|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000400024.2_Missense_Mutation_p.R229Q			P20823	HNF1A_HUMAN	HNF1 homeobox A	229			R -> Q (in MODY3). {ECO:0000269|PubMed:9032114}.		glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.R229Q(2)		breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AAGGAGGAGCGAGAGACGCTA	0.602									Hepatic Adenoma, Familial Clustering of																													dbGAP											2	Substitution - Missense(2)	liver(1)|breast(1)	GRCh37	CM002864|CM971454	HNF1A	M							94.0	91.0	92.0					12																	121431482		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.686G>A	12.37:g.121431482G>A	ENSP00000257555:p.Arg229Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.R229Q	ENST00000257555.6	37	c.686	CCDS9209.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.185731	0.94885	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.97455	-4.39;-4.39;-4.39;-4.39	4.45	4.45	0.53987	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.53938	D	0.000044	D	0.97955	0.9327	M	0.76328	2.33	0.80722	D	1	D;D;D;D	0.76494	0.991;0.996;0.996;0.999	P;P;P;P	0.62885	0.701;0.849;0.802;0.908	D	0.98979	1.0804	10	0.87932	D	0	-6.8269	16.1263	0.81397	0.0:0.0:1.0:0.0	.	229;229;229;229	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	Q	229;229;229;229;229;112;229;229;229;229;229	ENSP00000257555:R229Q;ENSP00000439721:R112Q;ENSP00000443112:R229Q;ENSP00000438804:R229Q	ENSP00000257555:R229Q	R	+	2	0	HNF1A	119915865	1.000000	0.71417	1.000000	0.80357	0.894000	0.52154	9.276000	0.95745	2.045000	0.60652	0.517000	0.50305	CGA	HNF1A	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000135100		0.602	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	162	0.00	0	G	NM_000545		121431482	121431482	+1	no_errors	ENST00000257555	ensembl	human	known	69_37n	missense	99	13.16	15	SNP	1.000	A
KIFC3	3801	genome.wustl.edu	37	16	57794309	57794311	+	In_Frame_Del	DEL	TTC	TTC	-			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	TTC	TTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr16:57794309_57794311delTTC	ENST00000379655.4	-	17	2507_2509	c.2250_2252delGAA	c.(2248-2253)aagaac>aac	p.K750del	KIFC3_ENST00000421376.2_In_Frame_Del_p.K611del|KIFC3_ENST00000539578.1_In_Frame_Del_p.K692del|KIFC3_ENST00000540079.2_In_Frame_Del_p.K648del|KIFC3_ENST00000445690.2_In_Frame_Del_p.K750del|KIFC3_ENST00000541240.1_In_Frame_Del_p.K772del|KIFC3_ENST00000543930.1_In_Frame_Del_p.K608del|KIFC3_ENST00000562903.1_In_Frame_Del_p.K611del|KIFC3_ENST00000465878.2_In_Frame_Del_p.K611del	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	750	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.K750delK(1)		breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CTCGCTAGTGTTCTTCTCCACGG	0.65																																						dbGAP											1	Deletion - In frame(1)	breast(1)																																								-	-	-	SO:0001651	inframe_deletion	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.2250_2252delGAA	16.37:g.57794312_57794314delTTC	ENSP00000368976:p.Lys750del	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	In_Frame_Del	DEL	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.K750in_frame_del	ENST00000379655.4	37	c.2252_2250	CCDS10789.2	16																																																																																			KIFC3	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000140859		0.650	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2	50	0.00	0	TTC	NM_005550		57794309	57794311	-1	no_errors	ENST00000379655	ensembl	human	known	69_37n	in_frame_del	34	15.00	6	DEL	1.000:1.000:1.000	-
LARP6	55323	genome.wustl.edu	37	15	71125333	71125333	+	Silent	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr15:71125333G>A	ENST00000299213.8	-	3	604	c.534C>T	c.(532-534)aaC>aaT	p.N178N	RP11-138H8.7_ENST00000592096.1_lincRNA	NM_018357.2	NP_060827.2	Q9BRS8	LARP6_HUMAN	La ribonucleoprotein domain family, member 6	178					regulation of translation (GO:0006417)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.N178N(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(5)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	19						GGAGGTTCTCGTTGGGGAACA	0.552																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											69.0	69.0	69.0					15																	71125333		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0			BC009446	CCDS10236.1, CCDS32281.1	15q23	2012-11-19			ENSG00000166173	ENSG00000166173		"""La ribonucleoprotein domain containing"""	24012	protein-coding gene	gene with protein product		611300				12477932	Standard	NM_018357		Approved	acheron, FLJ11196	uc002ass.3	Q9BRS8	OTTHUMG00000172179	ENST00000299213.8:c.534C>T	15.37:g.71125333G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XKE4|Q8N3N2|Q9NUR0	Silent	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd,prints_Lupus_La	p.N178	ENST00000299213.8	37	c.534	CCDS32281.1	15																																																																																			LARP6	-	NULL	ENSG00000166173		0.552	LARP6-003	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP6	HGNC	protein_coding	OTTHUMT00000417197.2	50	0.00	0	G	NM_018357		71125333	71125333	-1	no_errors	ENST00000299213	ensembl	human	known	69_37n	silent	44	13.73	7	SNP	0.179	A
MAGEB4	4115	genome.wustl.edu	37	X	30261121	30261121	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chrX:30261121C>A	ENST00000378982.2	+	1	1065	c.869C>A	c.(868-870)gCc>gAc	p.A290D	MAGEB1_ENST00000378981.3_5'Flank|MAGEB1_ENST00000397550.1_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	290	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.							p.A290D(1)		breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						GAGTTTTTGGCCAAGGTGAAT	0.527																																						dbGAP											1	Substitution - Missense(1)	breast(1)											74.0	74.0	74.0					X																	30261121		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.869C>A	X.37:g.30261121C>A	ENSP00000368266:p.Ala290Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9G0|Q6FHH4|Q8IZ00	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.A290D	ENST00000378982.2	37	c.869	CCDS14221.1	X	.	.	.	.	.	.	.	.	.	.	C	16.70	3.195044	0.58017	.	.	ENSG00000120289	ENST00000378982	T	0.02709	4.19	3.16	1.29	0.21616	.	0.273246	0.27509	U	0.019058	T	0.17152	0.0412	H	0.95504	3.68	0.09310	N	1	D	0.76494	0.999	D	0.75484	0.986	T	0.06338	-1.0832	10	0.87932	D	0	.	5.1271	0.14890	0.2376:0.535:0.2275:0.0	.	290	O15481	MAGB4_HUMAN	D	290	ENSP00000368266:A290D	ENSP00000368266:A290D	A	+	2	0	MAGEB4	30171042	0.006000	0.16342	0.001000	0.08648	0.733000	0.41908	0.121000	0.15667	0.201000	0.20466	0.600000	0.82982	GCC	MAGEB4	-	pfscan_MAGE	ENSG00000120289		0.527	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	140	0.00	0	C	NM_002367		30261121	30261121	+1	no_errors	ENST00000378982	ensembl	human	known	69_37n	missense	103	12.71	15	SNP	0.001	A
MAP3K1	4214	genome.wustl.edu	37	5	56177500	56177500	+	Nonsense_Mutation	SNP	A	A	T			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr5:56177500A>T	ENST00000399503.3	+	14	2473	c.2473A>T	c.(2473-2475)Aga>Tga	p.R825*		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	825					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.R825*(1)|p.R662*(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		GAGTTCTGCAAGAATGGTTAC	0.443																																						dbGAP											2	Substitution - Nonsense(2)	breast(2)											111.0	102.0	105.0					5																	56177500		1882	4102	5984	-	-	-	SO:0001587	stop_gained	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2473A>T	5.37:g.56177500A>T	ENSP00000382423:p.Arg825*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.R825*	ENST00000399503.3	37	c.2473	CCDS43318.1	5	.	.	.	.	.	.	.	.	.	.	A	37	6.352295	0.97498	.	.	ENSG00000095015	ENST00000399503	.	.	.	5.56	3.04	0.35103	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.6892	0.56964	0.7406:0.2594:0.0:0.0	.	.	.	.	X	825	.	ENSP00000382423:R825X	R	+	1	2	MAP3K1	56213257	1.000000	0.71417	0.990000	0.47175	0.994000	0.84299	2.641000	0.46587	0.426000	0.26116	0.533000	0.62120	AGA	MAP3K1	-	NULL	ENSG00000095015		0.443	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	140	0.00	0	A	XM_042066		56177500	56177500	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	nonsense	101	26.28	36	SNP	0.995	T
MAP3K1	4214	genome.wustl.edu	37	5	56178253	56178253	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr5:56178253delC	ENST00000399503.3	+	14	3226	c.3226delC	c.(3226-3228)cccfs	p.P1076fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	1076					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)	p.S914fs*5(1)|p.S1077fs*5(1)		NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		ACAGGGAGATCCCTCAAAAAA	0.443																																						dbGAP											2	Deletion - Frameshift(2)	breast(2)											89.0	83.0	85.0					5																	56178253		1908	4128	6036	-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.3226delC	5.37:g.56178253delC	ENSP00000382423:p.Pro1076fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.S1077fs	ENST00000399503.3	37	c.3226	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.443	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	85	0.00	0	C	XM_042066		56178253	56178253	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	88	12.00	12	DEL	0.211	-
MMACHC	25974	genome.wustl.edu	37	1	45966053	45966053	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr1:45966053T>C	ENST00000401061.4	+	1	329	c.49T>C	c.(49-51)Tgt>Cgt	p.C17R	CCDC163P_ENST00000488405.2_5'Flank|CCDC163P_ENST00000502793.2_5'Flank|CCDC163P_ENST00000490551.3_5'Flank|CCDC163P_ENST00000432082.1_5'Flank	NM_015506.2	NP_056321.2	Q9Y4U1	MMAC_HUMAN	methylmalonic aciduria (cobalamin deficiency) cblC type, with homocystinuria	17					cobalamin biosynthetic process (GO:0009236)|cobalamin metabolic process (GO:0009235)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	cobalamin binding (GO:0031419)	p.C17R(1)		breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8	Acute lymphoblastic leukemia(166;0.155)				Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GGACACGCTATGTCCTTTTGG	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											215.0	211.0	212.0					1																	45966053		1994	4172	6166	-	-	-	SO:0001583	missense	0				CCDS41324.1	1p34.1	2011-05-12			ENSG00000132763	ENSG00000132763			24525	protein-coding gene	gene with protein product		609831				16311595	Standard	NM_015506		Approved	DKFZP564I122, cblC	uc009vxv.3	Q9Y4U1	OTTHUMG00000007742	ENST00000401061.4:c.49T>C	1.37:g.45966053T>C	ENSP00000383840:p.Cys17Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T157|Q9BRQ7	Missense_Mutation	SNP	NULL	p.C17R	ENST00000401061.4	37	c.49	CCDS41324.1	1	.	.	.	.	.	.	.	.	.	.	T	12.09	1.833284	0.32421	.	.	ENSG00000132763	ENST00000401061	D	0.95137	-3.62	5.78	4.6	0.57074	.	0.549745	0.20846	N	0.084620	D	0.87402	0.6168	L	0.47716	1.5	0.53005	D	0.999962	P	0.44816	0.844	B	0.31946	0.138	D	0.83799	0.0235	10	0.12766	T	0.61	-12.9482	6.7171	0.23310	0.0:0.0863:0.1665:0.7472	.	17	Q9Y4U1	MMAC_HUMAN	R	17	ENSP00000383840:C17R	ENSP00000383840:C17R	C	+	1	0	MMACHC	45738640	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	1.148000	0.31614	2.215000	0.71742	0.460000	0.39030	TGT	MMACHC	-	NULL	ENSG00000132763		0.512	MMACHC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMACHC	HGNC	protein_coding	OTTHUMT00000020864.2	146	0.00	0	T	NM_015506		45966053	45966053	+1	no_errors	ENST00000401061	ensembl	human	known	69_37n	missense	130	13.33	20	SNP	0.998	C
MUC17	140453	genome.wustl.edu	37	7	100677967	100677967	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr7:100677967C>G	ENST00000306151.4	+	3	3334	c.3270C>G	c.(3268-3270)agC>agG	p.S1090R		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	1090	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S1090R(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ACGGTACCAGCATGCCAACCT	0.502																																						dbGAP											1	Substitution - Missense(1)	breast(1)											482.0	388.0	420.0					7																	100677967		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.3270C>G	7.37:g.100677967C>G	ENSP00000302716:p.Ser1090Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S1090R	ENST00000306151.4	37	c.3270	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	2.342	-0.350956	0.05173	.	.	ENSG00000169876	ENST00000306151	T	0.02606	4.23	0.801	0.801	0.18679	.	.	.	.	.	T	0.01661	0.0053	N	0.14661	0.345	0.09310	N	1	B	0.31655	0.334	B	0.20384	0.029	T	0.49532	-0.8930	9	0.27082	T	0.32	.	7.4603	0.27291	0.0:1.0:0.0:0.0	.	1090	Q685J3	MUC17_HUMAN	R	1090	ENSP00000302716:S1090R	ENSP00000302716:S1090R	S	+	3	2	MUC17	100464687	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-2.572000	0.00912	0.727000	0.32360	0.196000	0.17591	AGC	MUC17	-	NULL	ENSG00000169876		0.502	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	307	0.00	0	C	NM_001040105		100677967	100677967	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	175	12.94	26	SNP	0.019	G
NKAPL	222698	genome.wustl.edu	37	6	28227597	28227597	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr6:28227597G>A	ENST00000343684.3	+	1	500	c.448G>A	c.(448-450)Gaa>Aaa	p.E150K	ZKSCAN4_ENST00000423974.2_5'Flank	NM_001007531.1	NP_001007532.1	Q5M9Q1	NKAPL_HUMAN	NFKB activating protein-like	150								p.E150K(1)		breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(8)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	31						AGATTCTGACGAACATACCCC	0.512																																						dbGAP											1	Substitution - Missense(1)	breast(1)											95.0	103.0	100.0					6																	28227597		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC038240	CCDS34353.1	6p21.33	2008-02-05	2007-08-16	2007-08-16	ENSG00000189134	ENSG00000189134			21584	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 194"""	C6orf194			Standard	NM_001007531		Approved	bA424I5.1	uc003nkt.4	Q5M9Q1	OTTHUMG00000014517	ENST00000343684.3:c.448G>A	6.37:g.28227597G>A	ENSP00000345716:p.Glu150Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIV1|Q9H4Q7	Missense_Mutation	SNP	pfam_DUF926	p.E150K	ENST00000343684.3	37	c.448	CCDS34353.1	6	.	.	.	.	.	.	.	.	.	.	G	15.08	2.725810	0.48833	.	.	ENSG00000189134	ENST00000343684	T	0.16324	2.35	4.77	4.77	0.60923	.	0.099404	0.64402	D	0.000002	T	0.24547	0.0595	M	0.81341	2.54	0.58432	D	0.999997	D	0.69078	0.997	P	0.53809	0.735	T	0.01294	-1.1393	10	0.40728	T	0.16	-13.9405	13.5138	0.61528	0.0:0.0:1.0:0.0	.	150	Q5M9Q1	NKAPL_HUMAN	K	150	ENSP00000345716:E150K	ENSP00000345716:E150K	E	+	1	0	NKAPL	28335576	1.000000	0.71417	0.856000	0.33681	0.206000	0.24218	7.193000	0.77780	2.656000	0.90262	0.655000	0.94253	GAA	NKAPL	-	NULL	ENSG00000189134		0.512	NKAPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAPL	HGNC	protein_coding	OTTHUMT00000040185.1	29	0.00	0	G			28227597	28227597	+1	no_errors	ENST00000343684	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	127	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	90	14.29	15	SNP	1.000	G
PPARGC1B	133522	genome.wustl.edu	37	5	149216402	149216402	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr5:149216402G>A	ENST00000309241.5	+	8	2416	c.2384G>A	c.(2383-2385)aGc>aAc	p.S795N	PPARGC1B_ENST00000403750.1_Missense_Mutation_p.S731N|PPARGC1B_ENST00000394320.3_Missense_Mutation_p.S795N|PPARGC1B_ENST00000360453.4_Missense_Mutation_p.S756N	NM_133263.3	NP_573570.3	Q86YN6	PRGC2_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 beta	795	Glu-rich.				actin filament organization (GO:0007015)|bone trabecula formation (GO:0060346)|cellular lipid metabolic process (GO:0044255)|cellular response to reactive oxygen species (GO:0034614)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of alkaline phosphatase activity (GO:0010694)|positive regulation of bone resorption (GO:0045780)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of phosphorylation (GO:0042327)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transcription from mitochondrial promoter (GO:0006390)|transcription from RNA polymerase II promoter (GO:0006366)	mediator complex (GO:0016592)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-2 domain binding (GO:0050682)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|receptor activator activity (GO:0030546)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)	p.S795N(1)		NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(1)|liver(2)|lung(15)|ovary(3)|prostate(2)|stomach(1)	30			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			TTTGAAGACAGCAGCAGCAGC	0.602																																						dbGAP											1	Substitution - Missense(1)	breast(1)											66.0	73.0	70.0					5																	149216402		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF468496	CCDS4298.1, CCDS54933.1, CCDS54934.1	5q33.1	2013-02-12	2006-10-17		ENSG00000155846	ENSG00000155846		"""RNA binding motif (RRM) containing"""	30022	protein-coding gene	gene with protein product		608886	"""peroxisome proliferative activated receptor, gamma, coactivator 1, beta"""			11793024, 11854298	Standard	NM_133263		Approved	PERC, PGC1B	uc003lrc.3	Q86YN6	OTTHUMG00000130055	ENST00000309241.5:c.2384G>A	5.37:g.149216402G>A	ENSP00000312649:p.Ser795Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUM8|A2RUN0|B3KVW0|Q86YN3|Q86YN4|Q86YN5|Q8N1N9|Q8TDE4|Q8TDE5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S795N	ENST00000309241.5	37	c.2384	CCDS4298.1	5	.	.	.	.	.	.	.	.	.	.	G	18.25	3.582486	0.65992	.	.	ENSG00000155846	ENST00000360453;ENST00000394320;ENST00000309241;ENST00000403750	T;T;T;T	0.09538	2.98;2.97;2.98;2.98	5.54	5.54	0.83059	.	0.055201	0.64402	D	0.000001	T	0.35422	0.0931	M	0.75615	2.305	0.41019	D	0.985062	D;D;D;D;D	0.89917	1.0;0.998;1.0;0.999;1.0	D;D;D;D;D	0.87578	0.998;0.994;0.998;0.995;0.998	T	0.05305	-1.0893	10	0.66056	D	0.02	-8.8453	17.6588	0.88185	0.0:0.0:1.0:0.0	.	774;774;756;795;795	Q86YN6-2;Q86YN6-4;Q86YN6-5;Q86YN6;Q86YN6-3	.;.;.;PRGC2_HUMAN;.	N	756;795;795;731	ENSP00000353638:S756N;ENSP00000377855:S795N;ENSP00000312649:S795N;ENSP00000384403:S731N	ENSP00000312649:S795N	S	+	2	0	PPARGC1B	149196595	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	3.902000	0.56310	2.598000	0.87819	0.462000	0.41574	AGC	PPARGC1B	-	NULL	ENSG00000155846		0.602	PPARGC1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPARGC1B	HGNC	protein_coding	OTTHUMT00000252334.1	19	0.00	0	G	NM_133263		149216402	149216402	+1	no_errors	ENST00000309241	ensembl	human	known	69_37n	missense	15	28.57	6	SNP	1.000	A
PTPN5	84867	genome.wustl.edu	37	11	18764029	18764029	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr11:18764029G>A	ENST00000358540.2	-	7	935	c.505C>T	c.(505-507)Ccc>Tcc	p.P169S	PTPN5_ENST00000396168.1_Missense_Mutation_p.P145S|PTPN5_ENST00000496201.2_5'UTR|PTPN5_ENST00000396171.4_Missense_Mutation_p.P169S|PTPN5_ENST00000396170.1_Missense_Mutation_p.P137S|RP11-1081L13.4_ENST00000527285.1_RNA|PTPN5_ENST00000477854.1_5'UTR|PTPN5_ENST00000396167.2_Missense_Mutation_p.P137S	NM_006906.1	NP_008837.1	P54829	PTN5_HUMAN	protein tyrosine phosphatase, non-receptor type 5 (striatum-enriched)	169					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	phosphotyrosine binding (GO:0001784)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(4)	27						GGCTCTGGGGGTGTCCTCAGG	0.632																																						dbGAP											0													42.0	45.0	44.0					11																	18764029		2199	4293	6492	-	-	-	SO:0001583	missense	0			BC064807	CCDS7845.1, CCDS41626.1, CCDS60746.1	11p15.1	2011-06-09			ENSG00000110786	ENSG00000110786		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9657	protein-coding gene	gene with protein product		176879				1714595	Standard	NM_001278236		Approved	STEP, PTPSTEP	uc001mpc.4	P54829	OTTHUMG00000134304	ENST00000358540.2:c.505C>T	11.37:g.18764029G>A	ENSP00000351342:p.Pro169Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXG7|B7Z386|B7ZAF5|D3DQY7|Q6P1Z2|Q8N2A1|Q8NDP8	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.P169S	ENST00000358540.2	37	c.505	CCDS7845.1	11	.	.	.	.	.	.	.	.	.	.	G	9.672	1.146959	0.21288	.	.	ENSG00000110786	ENST00000358540;ENST00000396170;ENST00000396171;ENST00000396167;ENST00000396168	T;T;T;T;T	0.03413	3.94;3.96;3.94;3.96;3.95	4.69	1.55	0.23275	.	0.509065	0.18361	N	0.143562	T	0.02012	0.0063	N	0.08118	0	0.20764	N	0.999852	B;B	0.10296	0.003;0.001	B;B	0.04013	0.001;0.001	T	0.45026	-0.9289	10	0.40728	T	0.16	.	6.8696	0.24113	0.1799:0.1499:0.6702:0.0	.	169;137	P54829;B3KXG7	PTN5_HUMAN;.	S	169;137;169;137;145	ENSP00000351342:P169S;ENSP00000379473:P137S;ENSP00000379474:P169S;ENSP00000379470:P137S;ENSP00000379471:P145S	ENSP00000351342:P169S	P	-	1	0	PTPN5	18720605	0.030000	0.19436	0.555000	0.28281	0.930000	0.56654	1.091000	0.30915	0.585000	0.29608	-0.304000	0.09214	CCC	PTPN5	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5	ENSG00000110786		0.632	PTPN5-001	KNOWN	basic|CCDS	protein_coding	PTPN5	HGNC	protein_coding	OTTHUMT00000259196.2	31	0.00	0	G	NM_001039970		18764029	18764029	-1	no_errors	ENST00000358540	ensembl	human	known	69_37n	missense	26	27.03	10	SNP	0.267	A
RPL10A	4736	genome.wustl.edu	37	6	35436736	35436736	+	Silent	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr6:35436736G>A	ENST00000322203.6	+	3	120	c.93G>A	c.(91-93)acG>acA	p.T31T	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	31					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)	p.T31T(1)		breast(1)|large_intestine(2)|ovary(1)	4						TCCTGGAGACGGTGGAGTTGC	0.647																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											40.0	40.0	40.0					6																	35436736		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.93G>A	6.37:g.35436736G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R801|P52859|P53025|Q5TZT6|Q8J013	Silent	SNP	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF,pirsf_Ribosomal_L1	p.T31	ENST00000322203.6	37	c.93	CCDS4806.1	6																																																																																			RPL10A	-	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF,pirsf_Ribosomal_L1	ENSG00000198755		0.647	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10A	HGNC	protein_coding	OTTHUMT00000040283.1	39	0.00	0	G	NM_007104		35436736	35436736	+1	no_errors	ENST00000322203	ensembl	human	known	69_37n	silent	25	13.79	4	SNP	0.961	A
SCN9A	6335	genome.wustl.edu	37	2	167159635	167159635	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr2:167159635A>G	ENST00000409435.1	-	6	865	c.866T>C	c.(865-867)aTa>aCa	p.I289T	AC010127.3_ENST00000447809.2_RNA|SCN9A_ENST00000303354.6_Missense_Mutation_p.I290T|SCN9A_ENST00000409672.1_Missense_Mutation_p.I289T|SCN9A_ENST00000375387.4_Missense_Mutation_p.I290T			Q15858	SCN9A_HUMAN	sodium channel, voltage-gated, type IX, alpha subunit	289					behavioral response to pain (GO:0048266)|inflammatory response (GO:0006954)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|post-embryonic development (GO:0009791)|response to toxic substance (GO:0009636)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	sodium ion binding (GO:0031402)|voltage-gated sodium channel activity (GO:0005248)	p.I289T(1)		NS(1)|breast(5)|central_nervous_system(6)|endometrium(6)|kidney(3)|large_intestine(27)|lung(38)|ovary(6)|prostate(8)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	108					Lacosamide(DB06218)|Lidocaine(DB00281)|Ranolazine(DB00243)|Rufinamide(DB06201)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GGTATTCATTATGCTTTCTAA	0.323																																						dbGAP											1	Substitution - Missense(1)	breast(1)											92.0	88.0	89.0					2																	167159635		2050	4261	6311	-	-	-	SO:0001583	missense	0			X82835	CCDS46441.1	2q24	2014-09-17	2007-01-23		ENSG00000169432	ENSG00000169432		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10597	protein-coding gene	gene with protein product		603415	"""sodium channel, voltage-gated, type IX, alpha polypeptide"""			7720699, 10198179, 16382098	Standard	NM_002977		Approved	Nav1.7, PN1, NE-NA, NENA, ETHA	uc010fpl.3	Q15858	OTTHUMG00000154044	ENST00000409435.1:c.866T>C	2.37:g.167159635A>G	ENSP00000386330:p.Ile289Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1BUH5|Q6B4R9|Q6B4S0|Q6B4S1|Q70HX1|Q70HX2|Q8WTU1|Q8WWN4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2	p.I290T	ENST00000409435.1	37	c.869	CCDS46441.1	2	.	.	.	.	.	.	.	.	.	.	A	6.781	0.512990	0.12944	.	.	ENSG00000169432	ENST00000409672;ENST00000375387;ENST00000303354;ENST00000409435;ENST00000454569;ENST00000452182	D;D;D;D;D;D	0.95980	-3.85;-3.86;-3.87;-3.87;-3.77;-3.79	6.07	4.92	0.64577	Ion transport (1);	4.377310	0.00622	N	0.000443	D	0.84745	0.5540	N	0.00661	-1.28	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.04013	0.001;0.001;0.001	T	0.76924	-0.2779	10	0.02654	T	1	.	10.3992	0.44220	0.9234:0.0:0.0766:0.0	.	289;289;290	E7EUN6;Q15858;E9PF08	.;SCN9A_HUMAN;.	T	289;290;290;289;154;154	ENSP00000386306:I289T;ENSP00000364536:I290T;ENSP00000304748:I290T;ENSP00000386330:I289T;ENSP00000413212:I154T;ENSP00000393141:I154T	ENSP00000304748:I290T	I	-	2	0	SCN9A	166867881	0.003000	0.15002	0.001000	0.08648	0.123000	0.20343	1.720000	0.38022	1.121000	0.41925	0.477000	0.44152	ATA	SCN9A	-	pfam_Ion_trans_dom	ENSG00000169432		0.323	SCN9A-004	KNOWN	basic|CCDS	protein_coding	SCN9A	HGNC	protein_coding	OTTHUMT00000333639.1	272	0.00	0	A	NM_002977		167159635	167159635	-1	no_errors	ENST00000303354	ensembl	human	known	69_37n	missense	215	14.34	36	SNP	0.002	G
SLC35G3	146861	genome.wustl.edu	37	17	33520540	33520540	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr17:33520540C>T	ENST00000297307.5	-	1	872	c.787G>A	c.(787-789)Gcc>Acc	p.A263T	RP11-799D4.2_ENST00000590144.1_RNA	NM_152462.2	NP_689675.1	Q8N808	S35G3_HUMAN	solute carrier family 35, member G3	263						integral component of membrane (GO:0016021)		p.A263T(1)									GAGACCAAGGCGAGGATCCCC	0.627																																						dbGAP											1	Substitution - Missense(1)	breast(1)											122.0	111.0	115.0					17																	33520540		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK097473	CCDS11293.1	17q21.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000164729	ENSG00000164729		"""Solute carriers"""	26848	protein-coding gene	gene with protein product			"""transmembrane protein 21A"", ""acyl-malonyl condensing enzyme 1"""	TMEM21A, AMAC1			Standard	NM_152462		Approved	FLJ40154	uc002hjd.2	Q8N808	OTTHUMG00000132929	ENST00000297307.5:c.787G>A	17.37:g.33520540C>T	ENSP00000297307:p.Ala263Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGE9	Missense_Mutation	SNP	pfam_DMT	p.A263T	ENST00000297307.5	37	c.787	CCDS11293.1	17	.	.	.	.	.	.	.	.	.	.	C	7.376	0.627836	0.14257	.	.	ENSG00000164729	ENST00000297307	T	0.67171	-0.25	.	.	.	.	0.000000	0.44285	D	0.000479	T	0.50599	0.1625	L	0.51422	1.61	0.31569	N	0.656615	B	0.18863	0.031	B	0.14578	0.011	T	0.38672	-0.9650	9	0.31617	T	0.26	-2.6207	2.6646	0.05037	0.0:0.5037:0.0:0.4962	.	263	Q8N808	S35G3_HUMAN	T	263	ENSP00000297307:A263T	ENSP00000297307:A263T	A	-	1	0	SLC35G3	30544653	0.996000	0.38824	0.256000	0.24389	0.257000	0.26127	0.721000	0.25911	0.064000	0.16427	0.064000	0.15345	GCC	SLC35G3	-	pfam_DMT	ENSG00000164729		0.627	SLC35G3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G3	HGNC	protein_coding	OTTHUMT00000256445.2	207	0.00	0	C	NM_152462		33520540	33520540	-1	no_errors	ENST00000297307	ensembl	human	known	69_37n	missense	122	12.23	17	SNP	1.000	T
SLITRK3	22865	genome.wustl.edu	37	3	164908518	164908518	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr3:164908518A>G	ENST00000475390.1	-	2	544	c.101T>C	c.(100-102)aTa>aCa	p.I34T	SLITRK3_ENST00000241274.3_Missense_Mutation_p.I34T			O94933	SLIK3_HUMAN	SLIT and NTRK-like family, member 3	34					axonogenesis (GO:0007409)	integral component of membrane (GO:0016021)		p.I34T(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(66)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(5)	119						TGAGTCCTCTATTAGGGGAAT	0.408										HNSCC(40;0.11)																												dbGAP											1	Substitution - Missense(1)	breast(1)											106.0	104.0	105.0					3																	164908518		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB020655	CCDS3197.1	3q26.1	2004-07-28			ENSG00000121871	ENSG00000121871			23501	protein-coding gene	gene with protein product		609679				10048485, 14557068	Standard	NM_014926		Approved	KIAA0848	uc003fek.3	O94933	OTTHUMG00000158072	ENST00000475390.1:c.101T>C	3.37:g.164908518A>G	ENSP00000420091:p.Ile34Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1RMY6	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.I34T	ENST00000475390.1	37	c.101	CCDS3197.1	3	.	.	.	.	.	.	.	.	.	.	A	0.705	-0.789276	0.02884	.	.	ENSG00000121871	ENST00000475390;ENST00000241274;ENST00000497724	T;T;T	0.69306	0.66;0.66;-0.39	6.01	6.01	0.97437	.	0.000000	0.42294	D	0.000732	T	0.52933	0.1765	L	0.27053	0.805	0.45502	D	0.998468	B	0.09022	0.002	B	0.04013	0.001	T	0.50591	-0.8810	10	0.10111	T	0.7	-15.3578	16.5237	0.84324	1.0:0.0:0.0:0.0	.	34	O94933	SLIK3_HUMAN	T	34	ENSP00000420091:I34T;ENSP00000241274:I34T;ENSP00000419611:I34T	ENSP00000241274:I34T	I	-	2	0	SLITRK3	166391212	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.175000	0.77632	2.306000	0.77630	0.533000	0.62120	ATA	SLITRK3	-	NULL	ENSG00000121871		0.408	SLITRK3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLITRK3	HGNC	protein_coding	OTTHUMT00000350126.1	202	0.00	0	A	NM_014926		164908518	164908518	-1	no_errors	ENST00000241274	ensembl	human	known	69_37n	missense	172	17.70	37	SNP	1.000	G
SSNA1	8636	genome.wustl.edu	37	9	140083619	140083619	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr9:140083619G>A	ENST00000322310.5	+	2	234	c.154G>A	c.(154-156)Gag>Aag	p.E52K	SSNA1_ENST00000459860.1_3'UTR|ANAPC2_ENST00000323927.2_5'Flank	NM_003731.2	NP_003722.2	O43805	SSNA1_HUMAN	Sjogren syndrome nuclear autoantigen 1	52					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport (GO:0042073)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytosol (GO:0005829)|nucleus (GO:0005634)		p.E52K(2)		breast(2)|kidney(1)|large_intestine(1)|lung(2)	6	all_cancers(76;0.0926)		STAD - Stomach adenocarcinoma(284;0.0698)	OV - Ovarian serous cystadenocarcinoma(145;6.43e-05)|Epithelial(140;0.00087)		GCAGCTGACAGAGAAGCTGGC	0.627																																						dbGAP											2	Substitution - Missense(2)	breast(1)|kidney(1)											41.0	33.0	36.0					9																	140083619		2201	4299	6500	-	-	-	SO:0001583	missense	0			Z96932	CCDS7034.1	9q34.3	2008-02-05	2007-10-04		ENSG00000176101	ENSG00000176101			11321	protein-coding gene	gene with protein product		610882	"""Sjogren's syndrome nuclear autoantigen 1"""			9430706	Standard	NM_003731		Approved	NA14, N14	uc004cls.2	O43805	OTTHUMG00000020982	ENST00000322310.5:c.154G>A	9.37:g.140083619G>A	ENSP00000313752:p.Glu52Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSG0|Q6FG70|Q9BVW8	Missense_Mutation	SNP	NULL	p.E52K	ENST00000322310.5	37	c.154	CCDS7034.1	9	.	.	.	.	.	.	.	.	.	.	G	19.17	3.775002	0.70107	.	.	ENSG00000176101	ENST00000322310	D	0.83755	-1.76	4.07	4.07	0.47477	.	0.124068	0.53938	D	0.000050	T	0.78541	0.4299	M	0.65677	2.01	0.58432	D	0.999991	B	0.34103	0.437	B	0.26770	0.073	T	0.77485	-0.2570	10	0.27785	T	0.31	-27.7985	14.1028	0.65068	0.0:0.0:1.0:0.0	.	52	O43805	SSNA1_HUMAN	K	52	ENSP00000313752:E52K	ENSP00000313752:E52K	E	+	1	0	SSNA1	139203440	1.000000	0.71417	0.904000	0.35570	0.888000	0.51559	7.282000	0.78630	1.972000	0.57404	0.561000	0.74099	GAG	SSNA1	-	NULL	ENSG00000176101		0.627	SSNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSNA1	HGNC	protein_coding	OTTHUMT00000055311.1	18	0.00	0	G	NM_003731		140083619	140083619	+1	no_errors	ENST00000322310	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.998	A
TRIP11	9321	genome.wustl.edu	37	14	92505990	92505990	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr14:92505990G>C	ENST00000267622.4	-	1	413	c.40C>G	c.(40-42)Cag>Gag	p.Q14E	TRIP11_ENST00000555105.1_5'UTR	NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	14					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)	p.Q14E(1)		breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		CCCAGAGACTGGCCCAATCCG	0.592			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)	dbGAP		Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	1	Substitution - Missense(1)	breast(1)											27.0	26.0	26.0					14																	92505990		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.40C>G	14.37:g.92505990G>C	ENSP00000267622:p.Gln14Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.Q14E	ENST00000267622.4	37	c.40	CCDS9899.1	14	.	.	.	.	.	.	.	.	.	.	G	23.8	4.456355	0.84317	.	.	ENSG00000100815	ENST00000267622	T	0.62639	0.01	5.57	5.57	0.84162	.	0.074891	0.56097	D	0.000033	T	0.52125	0.1715	L	0.29908	0.895	0.53688	D	0.999972	P	0.45902	0.868	B	0.38264	0.269	T	0.53500	-0.8430	10	0.36615	T	0.2	.	19.6367	0.95736	0.0:0.0:1.0:0.0	.	14	Q15643	TRIPB_HUMAN	E	14	ENSP00000267622:Q14E	ENSP00000267622:Q14E	Q	-	1	0	TRIP11	91575743	1.000000	0.71417	0.998000	0.56505	0.874000	0.50279	8.908000	0.92640	2.635000	0.89317	0.549000	0.68633	CAG	TRIP11	-	NULL	ENSG00000100815		0.592	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	55	0.00	0	G			92505990	92505990	-1	no_errors	ENST00000267622	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	C
ZP4	57829	genome.wustl.edu	37	1	238053448	238053448	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W5-01A-11D-A10G-09	TCGA-BH-A0W5-10A-01D-A117-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	aca1d737-c24c-49fd-86c0-ab2b29cd28de	0907d948-5ae6-478a-823a-e87b1b52ffbb	g.chr1:238053448C>A	ENST00000366570.4	-	2	362	c.204G>T	c.(202-204)caG>caT	p.Q68H	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	68					acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)	p.Q68H(1)		breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			CGGAGTCATTCTGCAGCTCGT	0.557																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											1	Substitution - Missense(1)	breast(1)											88.0	80.0	83.0					1																	238053448		2203	4300	6503	-	-	-	SO:0001583	missense	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.204G>T	1.37:g.238053448C>A	ENSP00000355529:p.Gln68His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAE1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.Q68H	ENST00000366570.4	37	c.204	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	C	5.501	0.277402	0.10403	.	.	ENSG00000116996	ENST00000366570	T	0.75477	-0.94	5.07	3.17	0.36434	.	0.367833	0.21761	N	0.069516	T	0.67249	0.2873	M	0.64260	1.97	0.09310	N	1	B	0.22276	0.067	B	0.19391	0.025	T	0.57323	-0.7831	10	0.36615	T	0.2	-1.9147	7.7723	0.29015	0.0:0.802:0.0:0.198	.	68	Q12836	ZP4_HUMAN	H	68	ENSP00000355529:Q68H	ENSP00000355529:Q68H	Q	-	3	2	ZP4	236120071	0.461000	0.25783	0.023000	0.16930	0.212000	0.24457	0.550000	0.23345	1.126000	0.42016	0.655000	0.94253	CAG	ZP4	-	NULL	ENSG00000116996		0.557	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	85	0.00	0	C			238053448	238053448	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	missense	84	15.84	16	SNP	0.046	A
