#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A4GNT	51146	genome.wustl.edu	37	3	137843658	137843658	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:137843658G>A	ENST00000236709.3	-	3	672	c.471C>T	c.(469-471)atC>atT	p.I157I		NM_016161.2	NP_057245.1	Q9UNA3	A4GCT_HUMAN	alpha-1,4-N-acetylglucosaminyltransferase	157					carbohydrate metabolic process (GO:0005975)|glycoprotein biosynthetic process (GO:0009101)|negative regulation of epithelial cell proliferation (GO:0050680)|protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	acetylglucosaminyltransferase activity (GO:0008375)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(7)	16						ATTTCCAGATGATGGCCAGGC	0.562																																						dbGAP											0													82.0	78.0	79.0					3																	137843658		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF141315	CCDS3097.1	3p14.3	2010-12-14			ENSG00000118017	ENSG00000118017			17968	protein-coding gene	gene with protein product						10430883	Standard	NM_016161		Approved	alpha4GnT	uc003ers.2	Q9UNA3	OTTHUMG00000159820	ENST00000236709.3:c.471C>T	3.37:g.137843658G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VDK1|Q0VDK2	Silent	SNP	pfam_A1-4-GlycosylTfrase_dom,pfam_GlycoTrfase_DXD_sugar-bd_CS	p.I157	ENST00000236709.3	37	c.471	CCDS3097.1	3																																																																																			A4GNT	-	pfam_GlycoTrfase_DXD_sugar-bd_CS	ENSG00000118017		0.562	A4GNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A4GNT	HGNC	protein_coding	OTTHUMT00000357557.1	35	0.00	0	G	NM_016161		137843658	137843658	-1	no_errors	ENST00000236709	ensembl	human	known	69_37n	silent	102	20.93	27	SNP	0.989	A
ABCA2	20	genome.wustl.edu	37	9	139910551	139910551	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:139910551C>T	ENST00000371605.3	-	21	3324	c.3177G>A	c.(3175-3177)atG>atA	p.M1059I	ABCA2_ENST00000492260.1_5'Flank|ABCA2_ENST00000341511.6_Missense_Mutation_p.M1060I|ABCA2_ENST00000265662.5_Missense_Mutation_p.M1060I			Q9BZC7	ABCA2_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 2	1059	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				ATP catabolic process (GO:0006200)|cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|regulation of intracellular cholesterol transport (GO:0032383)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)|response to steroid hormone (GO:0048545)|transmembrane transport (GO:0055085)|transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|nucleotide binding (GO:0000166)			central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|liver(1)|lung(25)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	41	all_cancers(76;0.16)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GGATCTCATCCATCTCCGTGC	0.612																																						dbGAP											0													95.0	101.0	99.0					9																	139910551		2141	4245	6386	-	-	-	SO:0001583	missense	0			U18235	CCDS43909.1	9q34	2012-03-14			ENSG00000107331	ENSG00000107331		"""ATP binding cassette transporters / subfamily A"""	32	protein-coding gene	gene with protein product		600047		ABC2		8088782	Standard	NM_212533		Approved		uc022bpy.1	Q9BZC7	OTTHUMG00000020958	ENST00000371605.3:c.3177G>A	9.37:g.139910551C>T	ENSP00000360666:p.Met1059Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NED5|Q5SPY5|Q5W9G5|Q76MW7|Q9HC28	Nonsense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.W410*	ENST00000371605.3	37	c.1229		9	.	.	.	.	.	.	.	.	.	.	c	16.41	3.115977	0.56505	.	.	ENSG00000107331	ENST00000265662;ENST00000371605;ENST00000355090;ENST00000341511	D;D;D	0.93307	-3.2;-3.2;-3.2	4.19	4.19	0.49359	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	U	0.000000	D	0.93294	0.7863	N	0.16708	0.43	0.58432	D	0.999998	D;P	0.65815	0.995;0.858	D;P	0.77004	0.989;0.717	D	0.94629	0.7820	10	0.59425	D	0.04	.	16.4978	0.84250	0.0:1.0:0.0:0.0	.	1059;1090	Q9BZC7;E7ETC3	ABCA2_HUMAN;.	I	1060;1059;1090;1060	ENSP00000265662:M1060I;ENSP00000360666:M1059I;ENSP00000344155:M1060I	ENSP00000265662:M1060I	M	-	3	0	ABCA2	139030372	1.000000	0.71417	1.000000	0.80357	0.696000	0.40369	5.888000	0.69758	1.876000	0.54355	0.306000	0.20318	ATG	ABCA2	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000107331		0.612	ABCA2-202	KNOWN	basic	protein_coding	ABCA2	HGNC	protein_coding		20	0.00	0	C	NM_001606		139910551	139910551	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000479446	ensembl	human	known	69_37n	nonsense	64	25.58	22	SNP	1.000	T
ABCC2	1244	genome.wustl.edu	37	10	101567200	101567200	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr10:101567200G>C	ENST00000370449.4	+	12	1703	c.1590G>C	c.(1588-1590)aaG>aaC	p.K530N		NM_000392.3	NP_000383	Q92887	MRP2_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 2	530	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular chloride ion homeostasis (GO:0030644)|drug transmembrane transport (GO:0006855)|prostaglandin transport (GO:0015732)|response to arsenic-containing substance (GO:0046685)|response to estrogen (GO:0043627)|response to heat (GO:0009408)|response to methotrexate (GO:0031427)|response to oxidative stress (GO:0006979)|thyroid hormone transport (GO:0070327)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intercellular canaliculus (GO:0046581)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			NS(1)|breast(5)|endometrium(9)|kidney(2)|large_intestine(20)|liver(1)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	67		Colorectal(252;0.234)		Epithelial(162;2.77e-10)|all cancers(201;2.47e-08)	Adenosine triphosphate(DB00171)|Aminohippurate(DB00345)|Arsenic trioxide(DB01169)|Atorvastatin(DB01076)|Canagliflozin(DB08907)|Carbamazepine(DB00564)|Carboplatin(DB00958)|Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Daunorubicin(DB00694)|Dexamethasone(DB01234)|Docetaxel(DB01248)|Doxorubicin(DB00997)|Eprosartan(DB00876)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Ezetimibe(DB00973)|Furosemide(DB00695)|Fusidic Acid(DB02703)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Ivermectin(DB00602)|Lamivudine(DB00709)|Leucovorin(DB00650)|Levetiracetam(DB01202)|Lomefloxacin(DB00978)|Lovastatin(DB00227)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Nifedipine(DB01115)|Norgestimate(DB00957)|Ofloxacin(DB01165)|Olmesartan(DB00275)|Oxaliplatin(DB00526)|Paclitaxel(DB01229)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pitavastatin(DB08860)|Pranlukast(DB01411)|Pravastatin(DB00175)|Probenecid(DB01032)|Quinidine(DB00908)|Reserpine(DB00206)|Rifampicin(DB01045)|Ritonavir(DB00503)|Saquinavir(DB01232)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Sulfasalazine(DB00795)|Sulfinpyrazone(DB01138)|Sunitinib(DB01268)|Tamoxifen(DB00675)|Telmisartan(DB00966)|Tenofovir(DB00300)|Tetrahydrofolic acid(DB00116)|Ursodeoxycholic acid(DB01586)|Vasopressin(DB00067)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)	ACCTCCGGAAGAAAGAGCTCA	0.433																																						dbGAP											0													157.0	155.0	156.0					10																	101567200		2203	4300	6503	-	-	-	SO:0001583	missense	0			U63970	CCDS7484.1	10q24	2012-03-14			ENSG00000023839	ENSG00000023839		"""ATP binding cassette transporters / subfamily C"""	53	protein-coding gene	gene with protein product		601107	"""canalicular multispecific organic anion transporter 1"""	CMOAT		8797578, 9284939	Standard	XM_006717630		Approved	DJS, MRP2, cMRP	uc001kqf.2	Q92887	OTTHUMG00000018895	ENST00000370449.4:c.1590G>C	10.37:g.101567200G>C	ENSP00000359478:p.Lys530Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMT8|Q14022|Q5T2B1|Q92500|Q92798|Q99663|Q9UMS2	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.K530N	ENST00000370449.4	37	c.1590	CCDS7484.1	10	.	.	.	.	.	.	.	.	.	.	G	6.800	0.516715	0.13005	.	.	ENSG00000023839	ENST00000370449	D	0.88975	-2.45	5.31	3.36	0.38483	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.270258	0.40728	N	0.001025	T	0.79137	0.4395	N	0.20807	0.61	0.80722	D	1	B	0.21381	0.055	B	0.28709	0.093	T	0.67518	-0.5650	10	0.22706	T	0.39	-13.2809	7.8024	0.29183	0.0774:0.0:0.5138:0.4087	.	530	Q92887	MRP2_HUMAN	N	530	ENSP00000359478:K530N	ENSP00000359478:K530N	K	+	3	2	ABCC2	101557190	0.809000	0.29036	1.000000	0.80357	0.180000	0.23129	0.347000	0.20014	0.655000	0.30866	0.561000	0.74099	AAG	ABCC2	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	ENSG00000023839		0.433	ABCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC2	HGNC	protein_coding	OTTHUMT00000049825.1	203	0.00	0	G	NM_000392		101567200	101567200	+1	no_errors	ENST00000370449	ensembl	human	known	69_37n	missense	178	23.93	56	SNP	0.998	C
ACSBG1	23205	genome.wustl.edu	37	15	78475050	78475050	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr15:78475050G>A	ENST00000258873.4	-	6	946	c.741C>T	c.(739-741)taC>taT	p.Y247Y	ACSBG1_ENST00000541759.1_Silent_p.Y5Y|ACSBG1_ENST00000560817.1_Silent_p.Y5Y	NM_001199377.1|NM_015162.4	NP_001186306.1|NP_055977.3	Q96GR2	ACBG1_HUMAN	acyl-CoA synthetase bubblegum family member 1	247					long-chain fatty acid metabolic process (GO:0001676)|myelination (GO:0042552)|ovarian follicle atresia (GO:0001552)|response to glucocorticoid (GO:0051384)|very long-chain fatty acid metabolic process (GO:0000038)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			endometrium(2)|kidney(2)|large_intestine(11)|liver(1)|lung(15)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	37						CCCATACCGTGTACACATTGG	0.537																																						dbGAP											0													134.0	126.0	129.0					15																	78475050		2196	4293	6489	-	-	-	SO:0001819	synonymous_variant	0			AB014531	CCDS10298.1	15q23-q24	2006-02-09			ENSG00000103740	ENSG00000103740		"""Acyl-CoA synthetase family"""	29567	protein-coding gene	gene with protein product	"""bubblegum"", ""very long-chain acyl-CoA synthetase"", ""lipidosin"""	614362				9734811, 10954726	Standard	NM_015162		Approved	BGM, FLJ30320, MGC14352, BG1, KIAA0631, hBG1, hsBG	uc002bdh.3	Q96GR2	OTTHUMG00000143734	ENST00000258873.4:c.741C>T	15.37:g.78475050G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB61|O75126|Q76N27|Q9HC26	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.Y247	ENST00000258873.4	37	c.741	CCDS10298.1	15																																																																																			ACSBG1	-	pfam_AMP-dep_Synth/Lig	ENSG00000103740		0.537	ACSBG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG1	HGNC	protein_coding	OTTHUMT00000289802.2	89	0.00	0	G	NM_015162		78475050	78475050	-1	no_errors	ENST00000258873	ensembl	human	known	69_37n	silent	159	22.82	47	SNP	1.000	A
ADAMTSL3	57188	genome.wustl.edu	37	15	84651757	84651757	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr15:84651757C>T	ENST00000286744.5	+	21	3601	c.3377C>T	c.(3376-3378)gCc>gTc	p.A1126V	ADAMTSL3_ENST00000567476.1_Missense_Mutation_p.A1126V	NM_207517.2	NP_997400.2	P82987	ATL3_HUMAN	ADAMTS-like 3	1126						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|breast(7)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(24)|lung(51)|ovary(7)|pancreas(2)|prostate(2)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	130			BRCA - Breast invasive adenocarcinoma(143;0.211)			CAGCTGGTGGCCGAATTAGCC	0.547																																						dbGAP											0													53.0	51.0	51.0					15																	84651757		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF237652	CCDS10326.1, CCDS73773.1	15q25.2	2013-01-29			ENSG00000156218	ENSG00000156218		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	14633	protein-coding gene	gene with protein product		609199				9628581, 10574462	Standard	NM_207517		Approved	KIAA1233, punctin-2	uc002bjz.4	P82987	OTTHUMG00000147363	ENST00000286744.5:c.3377C>T	15.37:g.84651757C>T	ENSP00000286744:p.Ala1126Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A566|A1A567|Q9ULI7	Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.A1126V	ENST00000286744.5	37	c.3377	CCDS10326.1	15	.	.	.	.	.	.	.	.	.	.	C	14.00	2.404595	0.42613	.	.	ENSG00000156218	ENST00000286744	T	0.64803	-0.12	5.43	4.52	0.55395	.	0.729912	0.11239	N	0.584767	T	0.69708	0.3141	M	0.64997	1.995	0.29265	N	0.871068	P;D	0.62365	0.778;0.991	P;P	0.56163	0.596;0.793	T	0.61407	-0.7069	10	0.38643	T	0.18	.	9.1204	0.36784	0.1456:0.7806:0.0:0.0738	.	1126;1126	P82987-2;P82987	.;ATL3_HUMAN	V	1126	ENSP00000286744:A1126V	ENSP00000286744:A1126V	A	+	2	0	ADAMTSL3	82442761	0.978000	0.34361	0.827000	0.32855	0.031000	0.12232	2.464000	0.45067	1.285000	0.44548	-0.262000	0.10625	GCC	ADAMTSL3	-	NULL	ENSG00000156218		0.547	ADAMTSL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTSL3	HGNC	protein_coding	OTTHUMT00000304007.2	26	0.00	0	C	NM_207517		84651757	84651757	+1	no_errors	ENST00000286744	ensembl	human	known	69_37n	missense	50	27.14	19	SNP	0.857	T
AHNAK	79026	genome.wustl.edu	37	11	62287266	62287266	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:62287266C>T	ENST00000378024.4	-	5	14897	c.14623G>A	c.(14623-14625)Gaa>Aaa	p.E4875K	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron|AHNAK_ENST00000525875.1_5'Flank	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	4875					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				AAAGTCCCTTCAACCTTAGGG	0.443																																						dbGAP											0													55.0	55.0	55.0					11																	62287266		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.14623G>A	11.37:g.62287266C>T	ENSP00000367263:p.Glu4875Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E4875K	ENST00000378024.4	37	c.14623	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	15.34	2.805298	0.50315	.	.	ENSG00000124942	ENST00000378024	T	0.01767	4.65	4.57	4.57	0.56435	.	0.080846	0.45126	D	0.000391	T	0.03178	0.0093	L	0.51853	1.615	0.35669	D	0.813133	P	0.48911	0.917	P	0.49561	0.615	T	0.57934	-0.7725	10	0.15952	T	0.53	-21.4331	9.7446	0.40440	0.0:0.9034:0.0:0.0966	.	4875	Q09666	AHNK_HUMAN	K	4875	ENSP00000367263:E4875K	ENSP00000367263:E4875K	E	-	1	0	AHNAK	62043842	0.963000	0.33076	0.662000	0.29724	0.531000	0.34715	2.250000	0.43178	2.110000	0.64415	0.472000	0.43445	GAA	AHNAK	-	NULL	ENSG00000124942		0.443	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	126	0.00	0	C	NM_024060		62287266	62287266	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	111	19.57	27	SNP	0.994	T
ALG10B	144245	genome.wustl.edu	37	12	38712174	38712174	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:38712174A>C	ENST00000308742.4	+	2	599	c.283A>C	c.(283-285)Atg>Ctg	p.M95L	ALG10B_ENST00000551464.1_Missense_Mutation_p.M95L	NM_001013620.3	NP_001013642.1	Q5I7T1	AG10B_HUMAN	ALG10B, alpha-1,2-glucosyltransferase	95					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transferase activity, transferring hexosyl groups (GO:0016758)			breast(2)|kidney(3)|large_intestine(7)|lung(8)|ovary(4)|skin(1)	25	Esophageal squamous(101;0.187)	Lung NSC(34;0.204)|all_lung(34;0.235)				CTCCATTGGGATGCTCAGATT	0.403																																						dbGAP											0													215.0	197.0	203.0					12																	38712174		2203	4297	6500	-	-	-	SO:0001583	missense	0			AY845858	CCDS31772.1	12q12	2013-03-04	2013-03-04		ENSG00000175548	ENSG00000175548	2.4.1.256		31088	protein-coding gene	gene with protein product	"""potassium channel regulator 1"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""		"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog B (yeast)"""				Standard	NM_001013620		Approved	KCR1	uc001rln.4	Q5I7T1	OTTHUMG00000169298	ENST00000308742.4:c.283A>C	12.37:g.38712174A>C	ENSP00000310120:p.Met95Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPF4	Missense_Mutation	SNP	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	p.M95L	ENST00000308742.4	37	c.283	CCDS31772.1	12	.	.	.	.	.	.	.	.	.	.	a	10.79	1.450193	0.26074	.	.	ENSG00000175548	ENST00000308742;ENST00000551464	T;T	0.39997	1.68;1.05	3.74	2.54	0.30619	.	0.034819	0.85682	D	0.000000	T	0.25044	0.0608	L	0.31752	0.955	0.47547	D	0.999451	B	0.06786	0.001	B	0.10450	0.005	T	0.05273	-1.0895	10	0.10377	T	0.69	.	7.8894	0.29669	0.8959:0.0:0.1041:0.0	.	95	Q5I7T1	AG10B_HUMAN	L	95	ENSP00000310120:M95L;ENSP00000448819:M95L	ENSP00000310120:M95L	M	+	1	0	ALG10B	36998441	1.000000	0.71417	0.965000	0.40720	0.994000	0.84299	4.490000	0.60319	0.733000	0.32492	0.533000	0.62120	ATG	ALG10B	-	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	ENSG00000175548		0.403	ALG10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10B	HGNC	protein_coding	OTTHUMT00000403349.1	430	0.00	0	A	NM_001013620		38712174	38712174	+1	no_errors	ENST00000308742	ensembl	human	known	69_37n	missense	449	26.47	162	SNP	0.999	C
ALG2	85365	genome.wustl.edu	37	9	101980615	101980615	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:101980615C>A	ENST00000476832.1	-	2	913	c.852G>T	c.(850-852)ttG>ttT	p.L284F	ALG2_ENST00000319033.6_Missense_Mutation_p.L191F	NM_033087.3	NP_149078.1	O75340	PDCD6_HUMAN	ALG2, alpha-1,3/1,6-mannosyltransferase	0					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|cellular response to heat (GO:0034605)|intracellular protein transport (GO:0006886)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of TOR signaling (GO:0032007)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|proteolysis (GO:0006508)|response to calcium ion (GO:0051592)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|calcium-dependent protein binding (GO:0048306)|protein dimerization activity (GO:0046983)			breast(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(11)|ovary(2)|prostate(2)	22		Acute lymphoblastic leukemia(62;0.0559)				CCATTTTCTTCAATTCCTGAT	0.483																																						dbGAP											0													120.0	106.0	111.0					9																	101980615		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027417	CCDS6739.1	9q31.1	2013-02-22	2013-02-22		ENSG00000119523	ENSG00000119523	2.4.1.132, 2.4.1.257	"""Glycosyltransferase group 1 domain containing"""	23159	protein-coding gene	gene with protein product		607905	"""asparagine-linked glycosylation 2 homolog (yeast, alpha-1,3-mannosyltransferase)"", ""asparagine-linked glycosylation 2, alpha-1,3-mannosyltransferase homolog (S. cerevisiae)"""			12684507	Standard	NR_024532		Approved	CDGIi, FLJ14511, hALPG2, NET38	uc004azf.3	Q9H553	OTTHUMG00000020355	ENST00000476832.1:c.852G>T	9.37:g.101980615C>A	ENSP00000417764:p.Leu284Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD16|E7ESR3|Q2YDC2|Q5TZS0	Missense_Mutation	SNP	pfam_Glyco_trans_1	p.L284F	ENST00000476832.1	37	c.852	CCDS6739.1	9	.	.	.	.	.	.	.	.	.	.	C	18.22	3.574652	0.65878	.	.	ENSG00000119523	ENST00000476832;ENST00000319033	D;D	0.84298	-1.83;-1.83	5.78	4.88	0.63580	Glycosyl transferase, family 1 (1);	0.000000	0.85682	D	0.000000	D	0.94735	0.8301	H	0.98682	4.3	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.94761	0.7936	10	0.72032	D	0.01	-9.6744	8.5336	0.33349	0.0:0.7363:0.1265:0.1372	.	191;284	Q9H553-2;Q9H553	.;ALG2_HUMAN	F	284;191	ENSP00000417764:L284F;ENSP00000326609:L191F	ENSP00000432675:L191F	L	-	3	2	ALG2	101020436	0.995000	0.38212	0.933000	0.37362	0.981000	0.71138	0.444000	0.21661	1.586000	0.49944	0.655000	0.94253	TTG	ALG2	-	pfam_Glyco_trans_1	ENSG00000119523		0.483	ALG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG2	HGNC	protein_coding	OTTHUMT00000215080.1	70	0.00	0	C	NM_033087		101980615	101980615	-1	no_errors	ENST00000476832	ensembl	human	known	69_37n	missense	118	16.31	23	SNP	1.000	A
ALG6	29929	genome.wustl.edu	37	1	63862213	63862213	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:63862213T>G	ENST00000371108.4	+	3	417	c.112T>G	c.(112-114)Tat>Gat	p.Y38D	ALG6_ENST00000263440.4_Missense_Mutation_p.Y38D	NM_013339.3	NP_037471.2	Q9Y672	ALG6_HUMAN	ALG6, alpha-1,3-glucosyltransferase	38					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucosyltransferase activity (GO:0046527)			endometrium(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13						GTTTGGTGATTATGAAGCTCA	0.313																																						dbGAP											0													155.0	141.0	145.0					1																	63862213		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063604	CCDS30735.1	1p31.3	2013-03-01	2013-03-01		ENSG00000088035	ENSG00000088035	2.4.1.267		23157	protein-coding gene	gene with protein product	"""dolichyl-P-Glc:Man(9)GlcNAc(2)-PP-dolichol alpha- 1->3-glucosyltransferase"""	604566	"""asparagine-linked glycosylation 6 homolog (yeast, alpha-1,3-glucosyltransferase)"", ""asparagine-linked glycosylation 6, alpha-1,3-glucosyltransferase homolog (S. cerevisiae)"""			10359825, 11875054	Standard	NM_013339		Approved		uc021oof.1	Q9Y672	OTTHUMG00000009140	ENST00000371108.4:c.112T>G	1.37:g.63862213T>G	ENSP00000360149:p.Tyr38Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMU2|Q5SXR9|Q9H3I0	Missense_Mutation	SNP	pfam_Glyco_trans_ALG6/ALG8	p.Y38D	ENST00000371108.4	37	c.112	CCDS30735.1	1	.	.	.	.	.	.	.	.	.	.	T	24.8	4.572710	0.86542	.	.	ENSG00000088035	ENST00000371108;ENST00000263440	D;D	0.86432	-2.12;-2.12	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.94215	0.8143	M	0.92026	3.265	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.95375	0.8468	10	0.87932	D	0	-21.3468	16.1038	0.81205	0.0:0.0:0.0:1.0	.	38	A2A2G4	.	D	38	ENSP00000360149:Y38D;ENSP00000263440:Y38D	ENSP00000263440:Y38D	Y	+	1	0	ALG6	63634801	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.461000	0.80834	2.277000	0.76020	0.528000	0.53228	TAT	ALG6	-	pfam_Glyco_trans_ALG6/ALG8	ENSG00000088035		0.313	ALG6-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	ALG6	HGNC	protein_coding	OTTHUMT00000025330.2	294	0.00	0	T	NM_013339		63862213	63862213	+1	no_errors	ENST00000263440	ensembl	human	known	69_37n	missense	312	20.15	79	SNP	1.000	G
AMOTL1	154810	genome.wustl.edu	37	11	94501722	94501722	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:94501722G>A	ENST00000433060.2	+	1	186	c.45G>A	c.(43-45)gtG>gtA	p.V15V	AMOTL1_ENST00000317837.9_Silent_p.V15V|AMOTL1_ENST00000317829.8_Silent_p.V15V	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	15					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				AGCCTGCGGTGAAAGGTAACC	0.682																																						dbGAP											0													33.0	40.0	38.0					11																	94501722		1953	4152	6105	-	-	-	SO:0001819	synonymous_variant	0			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.45G>A	11.37:g.94501722G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Silent	SNP	pfam_Angiomotin_C,prints_Angiomotin	p.V15	ENST00000433060.2	37	c.45	CCDS44712.1	11																																																																																			AMOTL1	-	NULL	ENSG00000166025		0.682	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMOTL1	HGNC	protein_coding	OTTHUMT00000396474.3	11	0.00	0	G	NM_130847		94501722	94501722	+1	no_errors	ENST00000433060	ensembl	human	known	69_37n	silent	58	15.94	11	SNP	1.000	A
ANKAR	150709	genome.wustl.edu	37	2	190611197	190611197	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:190611197C>G	ENST00000520309.1	+	23	4237	c.4149C>G	c.(4147-4149)ttC>ttG	p.F1383L	ANKAR_ENST00000431575.2_Missense_Mutation_p.F1312L|ANKAR_ENST00000313581.4_Missense_Mutation_p.F1383L|ANKAR_ENST00000281412.6_3'UTR|ANKAR_ENST00000438402.2_3'UTR	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1383						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			TGGGACTCTTCAAAGCAACAA	0.313																																						dbGAP											0													86.0	97.0	93.0					2																	190611197		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.4149C>G	2.37:g.190611197C>G	ENSP00000427882:p.Phe1383Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS6|Q4G0M2|Q6ZU02	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Armadillo,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Armadillo	p.F1383L	ENST00000520309.1	37	c.4149	CCDS33351.2	2	.	.	.	.	.	.	.	.	.	.	C	12.71	2.018309	0.35606	.	.	ENSG00000151687	ENST00000520309;ENST00000313581;ENST00000431575	T;T;T	0.30981	1.51;1.51;1.51	4.33	4.33	0.51752	.	0.709954	0.13291	N	0.398948	T	0.26593	0.0650	N	0.17082	0.46	0.80722	D	1	.	.	.	.	.	.	T	0.04767	-1.0928	8	0.22109	T	0.4	-9.6211	14.1831	0.65588	0.0:1.0:0.0:0.0	.	.	.	.	L	1383;1383;1312	ENSP00000427882:F1383L;ENSP00000313513:F1383L;ENSP00000393043:F1312L	ENSP00000313513:F1383L	F	+	3	2	ANKAR	190319442	0.999000	0.42202	0.997000	0.53966	0.981000	0.71138	1.620000	0.36976	2.407000	0.81776	0.591000	0.81541	TTC	ANKAR	-	NULL	ENSG00000151687		0.313	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	79	0.00	0	C	NM_144708		190611197	190611197	+1	no_errors	ENST00000313581	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	1.000	G
AP2A2	161	genome.wustl.edu	37	11	986843	986843	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:986843G>A	ENST00000448903.2	+	9	1162	c.1021G>A	c.(1021-1023)Gag>Aag	p.E341K	AP2A2_ENST00000534328.1_Intron|AP2A2_ENST00000332231.5_Missense_Mutation_p.E342K	NM_001242837.1|NM_012305.3	NP_001229766.1|NP_036437.1	O94973	AP2A2_HUMAN	adaptor-related protein complex 2, alpha 2 subunit	341					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|clathrin-coated endocytic vesicle membrane (GO:0030669)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)			breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|ovary(2)	21		all_cancers(49;9.46e-06)|Breast(177;0.00257)|all_epithelial(84;0.0027)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.75e-24)|BRCA - Breast invasive adenocarcinoma(625;5.73e-05)|Lung(200;0.0696)|LUSC - Lung squamous cell carcinoma(625;0.082)		GCAGCACCGCGAGACCAACCT	0.612																																						dbGAP											0													54.0	57.0	56.0					11																	986843		2134	4237	6371	-	-	-	SO:0001583	missense	0			AB020706	CCDS44512.1, CCDS73234.1	11p15.5	2008-07-18			ENSG00000183020	ENSG00000183020			562	protein-coding gene	gene with protein product	"""alpha-adaptin C; Huntingtin interacting protein J"", ""adaptin, alpha B"", ""clathrin-associated/assembly/adaptor protein, large, alpha 2"""	607242		CLAPA2, ADTAB		9700202, 2564002	Standard	NM_012305		Approved	DKFZP564D1864, HYPJ, KIAA0899, HIP9	uc001lst.2	O94973	OTTHUMG00000165627	ENST00000448903.2:c.1021G>A	11.37:g.986843G>A	ENSP00000413234:p.Glu341Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75403|Q53ET1|Q96SI8	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.E342K	ENST00000448903.2	37	c.1024	CCDS44512.1	11	.	.	.	.	.	.	.	.	.	.	G	32	5.115097	0.94339	.	.	ENSG00000183020	ENST00000448903;ENST00000332231;ENST00000448757;ENST00000329626	T;T	0.38560	1.13;1.13	3.29	3.29	0.37713	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72187	0.3429	M	0.93550	3.43	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.99;0.999	T	0.82362	-0.0495	10	0.87932	D	0	-5.9762	15.4493	0.75259	0.0:0.0:1.0:0.0	.	342;341	O94973-2;O94973	.;AP2A2_HUMAN	K	341;342;342;214	ENSP00000413234:E341K;ENSP00000327694:E342K	ENSP00000328024:E214K	E	+	1	0	AP2A2	976843	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	9.620000	0.98373	1.785000	0.52413	0.467000	0.42956	GAG	AP2A2	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu	ENSG00000183020		0.612	AP2A2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AP2A2	HGNC	protein_coding	OTTHUMT00000385431.2	16	0.00	0	G	NM_012305		986843	986843	+1	no_errors	ENST00000332231	ensembl	human	known	69_37n	missense	98	17.65	21	SNP	1.000	A
ARID1B	57492	genome.wustl.edu	37	6	157511206	157511206	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr6:157511206G>C	ENST00000350026.5	+	14	3686	c.3685G>C	c.(3685-3687)Gat>Cat	p.D1229H	ARID1B_ENST00000275248.4_Missense_Mutation_p.D1224H|ARID1B_ENST00000367148.1_Missense_Mutation_p.D1282H|ARID1B_ENST00000346085.5_Missense_Mutation_p.D1242H	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1229					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		CCCATTCTCAGATGTGAGTGA	0.498																																						dbGAP											0													182.0	175.0	177.0					6																	157511206		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.3685G>C	6.37:g.157511206G>C	ENSP00000055163:p.Asp1229His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.D1282H	ENST00000350026.5	37	c.3844	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	18.08	3.544994	0.65198	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02197	4.65;4.65;4.72;4.72;4.4	5.95	5.95	0.96441	.	0.051874	0.85682	D	0.000000	T	0.06508	0.0167	L	0.50333	1.59	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.972;0.988;0.988	T	0.46456	-0.9190	10	0.41790	T	0.15	.	20.3931	0.98965	0.0:0.0:1.0:0.0	.	1229;1242;1224	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	H	1242;1229;1282;1224;751	ENSP00000344546:D1242H;ENSP00000055163:D1229H;ENSP00000356116:D1282H;ENSP00000275248:D1224H;ENSP00000412835:D751H	ENSP00000275248:D1224H	D	+	1	0	ARID1B	157552898	1.000000	0.71417	0.993000	0.49108	0.774000	0.43823	9.476000	0.97823	2.824000	0.97209	0.655000	0.94253	GAT	ARID1B	-	NULL	ENSG00000049618		0.498	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	57	0.00	0	G	NM_020732		157511206	157511206	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	missense	122	16.44	24	SNP	1.000	C
ATG4A	115201	genome.wustl.edu	37	X	107381127	107381127	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:107381127C>G	ENST00000372232.3	+	8	800	c.641C>G	c.(640-642)tCt>tGt	p.S214C	ATG4A_ENST00000345734.3_Intron|ATG4A_ENST00000372254.3_Missense_Mutation_p.S190C|ATG4A_ENST00000545696.1_Intron	NM_052936.3	NP_443168.2	Q8WYN0	ATG4A_HUMAN	autophagy related 4A, cysteine peptidase	214					autophagy (GO:0006914)|protein transport (GO:0015031)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	cysteine-type peptidase activity (GO:0008234)			endometrium(3)|large_intestine(3)|lung(3)|pancreas(1)|prostate(1)	11						AAGGGCACCTCTGCCTACTGC	0.493																																						dbGAP											0													206.0	189.0	195.0					X																	107381127		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ320508	CCDS14538.1, CCDS14539.1	Xq22.1-q22.3	2014-02-12	2012-06-06	2005-09-11	ENSG00000101844	ENSG00000101844			16489	protein-coding gene	gene with protein product		300663	"""AUT-like 2, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog A (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog A (S. cerevisiae)"""	AUTL2, APG4A		12446702, 12473658	Standard	NM_052936		Approved		uc004enr.3	Q8WYN0	OTTHUMG00000022176	ENST00000372232.3:c.641C>G	X.37:g.107381127C>G	ENSP00000361306:p.Ser214Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCH2|B2RAZ7|D3DUY0|O95534|Q5JYY9|Q5JYZ0|Q86VE5|Q96KQ0|Q96KQ1	Missense_Mutation	SNP	pfam_Peptidase_C54	p.S214C	ENST00000372232.3	37	c.641	CCDS14538.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.44|15.44	2.835558|2.835558	0.50951|0.50951	.|.	.|.	ENSG00000101844|ENSG00000101844	ENST00000394892|ENST00000372232;ENST00000372254;ENST00000457035	.|T;T	.|0.47869	.|0.83;0.84	5.62|5.62	3.79|3.79	0.43588|0.43588	.|.	.|0.552337	.|0.18565	.|N	.|0.137496	T|T	0.45816|0.45816	0.1361|0.1361	L|L	0.38175|0.38175	1.15|1.15	0.22719|0.22719	N|N	0.998814|0.998814	.|P	.|0.49358	.|0.923	.|P	.|0.55667	.|0.781	T|T	0.23332|0.23332	-1.0191|-1.0191	5|10	.|0.19590	.|T	.|0.45	-1.2474|-1.2474	6.1818|6.1818	0.20476|0.20476	0.1375:0.6578:0.1302:0.0745|0.1375:0.6578:0.1302:0.0745	.|.	.|214	.|Q8WYN0	.|ATG4A_HUMAN	V|C	187|214;190;137	.|ENSP00000361306:S214C;ENSP00000361328:S190C	.|ENSP00000341833:S163C	L|S	+|+	1|2	2|0	ATG4A|ATG4A	107267783|107267783	0.710000|0.710000	0.27896|0.27896	0.194000|0.194000	0.23346|0.23346	0.695000|0.695000	0.40330|0.40330	1.172000|1.172000	0.31908|0.31908	0.489000|0.489000	0.27749|0.27749	0.600000|0.600000	0.82982|0.82982	CTG|TCT	ATG4A	-	pfam_Peptidase_C54	ENSG00000101844		0.493	ATG4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4A	HGNC	protein_coding	OTTHUMT00000057860.1	77	0.00	0	C	NM_052936		107381127	107381127	+1	no_errors	ENST00000372232	ensembl	human	known	69_37n	missense	119	21.71	33	SNP	0.309	G
ATP10D	57205	genome.wustl.edu	37	4	47559850	47559850	+	Missense_Mutation	SNP	G	G	T	rs146116655	byFrequency	TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr4:47559850G>T	ENST00000273859.3	+	12	2263	c.1994G>T	c.(1993-1995)cGa>cTa	p.R665L	AC092597.3_ENST00000508081.1_RNA	NM_020453.3	NP_065186.3	Q9P241	AT10D_HUMAN	ATPase, class V, type 10D	665					cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|endometrium(5)|kidney(5)|large_intestine(14)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	66						CTCTTTAGTCGAATGAAACCA	0.512																																						dbGAP											0													82.0	87.0	86.0					4																	47559850		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040920	CCDS3476.1	4p12	2010-04-20	2007-09-19		ENSG00000145246	ENSG00000145246		"""ATPases / P-type"""	13549	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10D"""			12532265	Standard	NM_020453		Approved	ATPVD, KIAA1487	uc003gxk.1	Q9P241	OTTHUMG00000160784	ENST00000273859.3:c.1994G>T	4.37:g.47559850G>T	ENSP00000273859:p.Arg665Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRC8|D6REN2|Q8NC70|Q96SR3	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.R665L	ENST00000273859.3	37	c.1994	CCDS3476.1	4	.	.	.	.	.	.	.	.	.	.	G	14.32	2.501363	0.44455	.	.	ENSG00000145246	ENST00000273859	T	0.38401	1.14	4.95	4.95	0.65309	HAD-like domain (1);	0.562071	0.16897	N	0.195061	T	0.38719	0.1051	M	0.67397	2.05	0.31218	N	0.697782	P	0.40398	0.716	B	0.40741	0.339	T	0.41734	-0.9492	10	0.24483	T	0.36	-13.5149	12.8111	0.57639	0.0815:0.0:0.9185:0.0	.	665	Q9P241	AT10D_HUMAN	L	665	ENSP00000273859:R665L	ENSP00000273859:R665L	R	+	2	0	ATP10D	47254607	0.542000	0.26426	0.038000	0.18304	0.008000	0.06430	3.642000	0.54367	2.580000	0.87095	0.561000	0.74099	CGA	ATP10D	-	superfamily_HAD-like_dom	ENSG00000145246		0.512	ATP10D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10D	HGNC	protein_coding	OTTHUMT00000216900.1	55	0.00	0	G	NM_020453		47559850	47559850	+1	no_errors	ENST00000273859	ensembl	human	known	69_37n	missense	111	15.27	20	SNP	0.045	T
BCAS3	54828	genome.wustl.edu	37	17	59118217	59118217	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:59118217G>A	ENST00000390652.5	+	20	2069	c.2038G>A	c.(2038-2040)Gat>Aat	p.D680N	RP11-264B14.1_ENST00000588604.1_RNA|BCAS3_ENST00000588462.1_Missense_Mutation_p.D680N|BCAS3_ENST00000589222.1_Missense_Mutation_p.D665N|BCAS3_ENST00000408905.3_Missense_Mutation_p.D665N|BCAS3_ENST00000588874.1_Missense_Mutation_p.D436N|BCAS3_ENST00000407086.3_Missense_Mutation_p.D665N|BCAS3_ENST00000585744.1_Missense_Mutation_p.D451N	NM_001099432.1	NP_001092902.1			breast carcinoma amplified sequence 3											NS(1)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(24)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44			BRCA - Breast invasive adenocarcinoma(1;3.11e-12)|Epithelial(12;8.2e-07)|all cancers(12;5.33e-06)			CCTCGCTGCAGATGCAGTACA	0.393																																						dbGAP											0													152.0	148.0	149.0					17																	59118217		1946	4146	6092	-	-	-	SO:0001583	missense	0			AF361219	CCDS11626.1, CCDS45749.1	17q23.2	2013-06-25			ENSG00000141376	ENSG00000141376		"""WD repeat domain containing"""	14347	protein-coding gene	gene with protein product		607470				12378525	Standard	NM_017679		Approved	FLJ20128	uc002iyv.4	Q9H6U6	OTTHUMG00000180064	ENST00000390652.5:c.2038G>A	17.37:g.59118217G>A	ENSP00000375067:p.Asp680Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_BCAS3,pfam_WD40_repeat	p.D680N	ENST00000390652.5	37	c.2038	CCDS45749.1	17	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797790	0.90538	.	.	ENSG00000141376	ENST00000390652;ENST00000407086;ENST00000405070;ENST00000408905	T;T;T	0.38240	1.15;1.26;1.17	5.39	5.39	0.77823	.	0.050481	0.85682	D	0.000000	T	0.52322	0.1727	L	0.46157	1.445	0.53005	D	0.999965	P;B;D;D;D	0.67145	0.93;0.096;0.994;0.995;0.996	P;B;D;D;D	0.76071	0.71;0.073;0.917;0.95;0.987	T	0.34304	-0.9834	10	0.13108	T	0.6	.	19.1505	0.93487	0.0:0.0:1.0:0.0	.	665;680;665;680;665	Q9H6U6-3;Q9H6U6-8;Q9H6U6-7;Q9H6U6;Q9H6U6-2	.;.;.;BCAS3_HUMAN;.	N	680;665;695;665	ENSP00000375067:D680N;ENSP00000385323:D665N;ENSP00000386173:D665N	ENSP00000375067:D680N	D	+	1	0	BCAS3	56472999	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.655000	0.83696	2.537000	0.85549	0.650000	0.86243	GAT	BCAS3	-	pfam_BCAS3	ENSG00000141376		0.393	BCAS3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAS3	HGNC	protein_coding	OTTHUMT00000449578.1	121	0.00	0	G	NM_017679		59118217	59118217	+1	no_errors	ENST00000390652	ensembl	human	known	69_37n	missense	187	20.76	49	SNP	1.000	A
BICD1	636	genome.wustl.edu	37	12	32491861	32491861	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:32491861C>T	ENST00000281474.5	+	8	2815	c.2712C>T	c.(2710-2712)ttC>ttT	p.F904F	BICD1_ENST00000548411.1_Intron	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	904					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			TGAGTGAATTCATCCAAGGGC	0.468																																						dbGAP											0													67.0	75.0	72.0					12																	32491861		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2712C>T	12.37:g.32491861C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2C3|F8W113|O43892|O43893	Silent	SNP	pfam_Bicaudal-D_microtubule-assoc,superfamily_SPOC-like	p.F904	ENST00000281474.5	37	c.2712	CCDS8726.1	12																																																																																			BICD1	-	NULL	ENSG00000151746		0.468	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICD1	HGNC	protein_coding	OTTHUMT00000403380.1	78	0.00	0	C	NM_001714		32491861	32491861	+1	no_errors	ENST00000281474	ensembl	human	known	69_37n	silent	61	21.79	17	SNP	1.000	T
BTBD10	84280	genome.wustl.edu	37	11	13443293	13443293	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:13443293C>T	ENST00000278174.5	-	3	439	c.194G>A	c.(193-195)cGa>cAa	p.R65Q	BTBD10_ENST00000528120.1_Missense_Mutation_p.R17Q|BTBD10_ENST00000530907.1_Missense_Mutation_p.R73Q|BTBD10_ENST00000532261.1_5'UTR	NM_032320.5	NP_115696.2	Q9BSF8	BTBDA_HUMAN	BTB (POZ) domain containing 10	65						nucleus (GO:0005634)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(7)|prostate(1)	20				Epithelial(150;0.0214)		ACTTGACCTTCGTCTATCTCT	0.453																																						dbGAP											0													131.0	108.0	116.0					11																	13443293		2200	4294	6494	-	-	-	SO:0001583	missense	0			AY221959	CCDS7811.1, CCDS73261.1	11p15.2	2013-01-24			ENSG00000148925	ENSG00000148925		"""BTB/POZ domain containing"""	21445	protein-coding gene	gene with protein product		615933				15556295	Standard	XM_005253164		Approved	GMRP1, GMRP-1, MGC13007	uc001mkz.3	Q9BSF8	OTTHUMG00000165787	ENST00000278174.5:c.194G>A	11.37:g.13443293C>T	ENSP00000278174:p.Arg65Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z228|Q86WG1	Missense_Mutation	SNP	superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.R65Q	ENST00000278174.5	37	c.194	CCDS7811.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.462754	0.96257	.	.	ENSG00000148925	ENST00000278174;ENST00000530907;ENST00000528120;ENST00000529708	T;T;T	0.34859	1.34;1.34;1.39	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	T	0.44993	0.1320	L	0.36672	1.1	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.978;0.992	P;P;B;P	0.58266	0.771;0.836;0.356;0.492	T	0.11941	-1.0567	10	0.21014	T	0.42	-53.0896	18.0084	0.89216	0.0:1.0:0.0:0.0	.	34;73;65;65	B7Z2J1;B7Z228;D3DQW7;Q9BSF8	.;.;.;BTBDA_HUMAN	Q	65;73;17;65	ENSP00000278174:R65Q;ENSP00000431186:R73Q;ENSP00000435257:R17Q	ENSP00000278174:R65Q	R	-	2	0	BTBD10	13399869	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.458000	0.80787	2.578000	0.87016	0.655000	0.94253	CGA	BTBD10	-	NULL	ENSG00000148925		0.453	BTBD10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD10	HGNC	protein_coding	OTTHUMT00000386200.1	102	0.00	0	C	NM_032320		13443293	13443293	-1	no_errors	ENST00000278174	ensembl	human	known	69_37n	missense	185	25.10	62	SNP	1.000	T
C2orf47	79568	genome.wustl.edu	37	2	200824060	200824060	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:200824060G>C	ENST00000392290.1	+	2	716	c.520G>C	c.(520-522)Gag>Cag	p.E174Q	C2orf47_ENST00000469156.1_3'UTR|C2orf47_ENST00000295079.2_Missense_Mutation_p.E174Q			Q8WWC4	CB047_HUMAN	chromosome 2 open reading frame 47	174						mitochondrion (GO:0005739)				cervix(1)|endometrium(2)|large_intestine(1)|lung(5)	9						TGTGGCCAAAGAGGTAAAGTA	0.323																																						dbGAP											0													129.0	133.0	132.0					2																	200824060		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC017959	CCDS2329.1	2q33.1	2011-03-08			ENSG00000162972	ENSG00000162972			26198	protein-coding gene	gene with protein product						12477932	Standard	NM_024520		Approved	DKFZp666A212, FLJ22555	uc002uvm.3	Q8WWC4	OTTHUMG00000132771	ENST00000392290.1:c.520G>C	2.37:g.200824060G>C	ENSP00000376111:p.Glu174Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q658V9|Q9H671	Missense_Mutation	SNP	NULL	p.E174Q	ENST00000392290.1	37	c.520	CCDS2329.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.8|26.8	4.770118|4.770118	0.90108|0.90108	.|.	.|.	ENSG00000162972|ENSG00000162972	ENST00000295079;ENST00000392290|ENST00000435773	T;T|.	0.52983|.	0.64;0.64|.	5.6|5.6	5.6|5.6	0.85130|0.85130	.|.	0.047223|.	0.85682|.	D|.	0.000000|.	T|T	0.68183|0.68183	0.2973|0.2973	L|L	0.39020|0.39020	1.185|1.185	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.74023|.	0.982|.	T|T	0.69034|0.69034	-0.5252|-0.5252	10|6	0.42905|0.59425	T|D	0.14|0.04	-20.1956|-20.1956	19.2174|19.2174	0.93783|0.93783	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	174|.	Q8WWC4|.	CB047_HUMAN|.	Q|N	174|166	ENSP00000295079:E174Q;ENSP00000376111:E174Q|.	ENSP00000295079:E174Q|ENSP00000396846:K166N	E|K	+|+	1|3	0|2	C2orf47|C2orf47	200532305|200532305	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	8.764000|8.764000	0.91719|0.91719	2.616000|2.616000	0.88540|0.88540	0.655000|0.655000	0.94253|0.94253	GAG|AAG	C2orf47	-	NULL	ENSG00000162972		0.323	C2orf47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf47	HGNC	protein_coding	OTTHUMT00000256146.1	405	0.00	0	G	NM_024520		200824060	200824060	+1	no_errors	ENST00000295079	ensembl	human	known	69_37n	missense	337	18.40	76	SNP	1.000	C
C3orf14	57415	genome.wustl.edu	37	3	62307654	62307654	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:62307654G>A	ENST00000494481.1	+	4	417	c.103G>A	c.(103-105)Gat>Aat	p.D35N	C3orf14_ENST00000486169.1_3'UTR|PTPRG-AS1_ENST00000490916.1_RNA|C3orf14_ENST00000542214.1_Missense_Mutation_p.D35N|C3orf14_ENST00000462069.1_Missense_Mutation_p.D35N|PTPRG-AS1_ENST00000495542.1_RNA|C3orf14_ENST00000232519.5_Missense_Mutation_p.D35N			Q9HBI5	CC014_HUMAN	chromosome 3 open reading frame 14	35										central_nervous_system(1)|large_intestine(1)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(55;0.00023)|KIRC - Kidney renal clear cell carcinoma(15;0.00877)|Kidney(15;0.0101)		TAAATTGGGTGATCAACACAC	0.303																																						dbGAP											0													64.0	69.0	67.0					3																	62307654		2202	4295	6497	-	-	-	SO:0001583	missense	0			AF236158	CCDS2896.1	3p14.2	2011-11-29			ENSG00000114405	ENSG00000114405			25024	protein-coding gene	gene with protein product						12477932	Standard	XM_005265338		Approved	HT021	uc003dlg.3	Q9HBI5	OTTHUMG00000158704	ENST00000494481.1:c.103G>A	3.37:g.62307654G>A	ENSP00000418086:p.Asp35Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9U0	Missense_Mutation	SNP	NULL	p.D35N	ENST00000494481.1	37	c.103	CCDS2896.1	3	.	.	.	.	.	.	.	.	.	.	G	2.881	-0.231871	0.05983	.	.	ENSG00000114405	ENST00000462069;ENST00000232519;ENST00000465142;ENST00000494481;ENST00000542214	.	.	.	6.17	0.723	0.18231	.	0.687575	0.14796	N	0.297922	T	0.37758	0.1015	L	0.48362	1.52	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.25398	-1.0133	9	0.30854	T	0.27	-18.6592	10.4994	0.44796	0.3123:0.0:0.6877:0.0	.	35	Q9HBI5	CC014_HUMAN	N	35	.	ENSP00000232519:D35N	D	+	1	0	C3orf14	62282694	0.698000	0.27777	0.000000	0.03702	0.314000	0.28054	1.511000	0.35801	0.058000	0.16222	-0.794000	0.03295	GAT	C3orf14	-	NULL	ENSG00000114405		0.303	C3orf14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf14	HGNC	protein_coding	OTTHUMT00000351807.1	139	0.00	0	G	NM_020685		62307654	62307654	+1	no_errors	ENST00000232519	ensembl	human	known	69_37n	missense	113	18.12	25	SNP	0.000	A
C3orf52	79669	genome.wustl.edu	37	3	111805372	111805372	+	Missense_Mutation	SNP	G	G	A	rs563113090		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:111805372G>A	ENST00000264848.5	+	1	177	c.118G>A	c.(118-120)Gag>Aag	p.E40K	C3orf52_ENST00000431717.2_Missense_Mutation_p.E40K|C3orf52_ENST00000430855.1_Missense_Mutation_p.E40K	NM_024616.2	NP_078892	Q5BVD1	TTMP_HUMAN	chromosome 3 open reading frame 52	40						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4						TTCTTTGGACGAGGAGGTCCC	0.652																																						dbGAP											0													62.0	65.0	64.0					3																	111805372		692	1591	2283	-	-	-	SO:0001583	missense	0			AY830714	CCDS46887.1, CCDS54620.1	3q13.2	2006-01-30			ENSG00000114529	ENSG00000114529			26255	protein-coding gene	gene with protein product	"""TPA induced trans-membrane protein"""	611956				15737651	Standard	NM_024616		Approved	FLJ23186, TTMP	uc011bhs.2	Q5BVD1	OTTHUMG00000159230	ENST00000264848.5:c.118G>A	3.37:g.111805372G>A	ENSP00000264848:p.Glu40Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNV2|B4E0Z2|Q96AJ4|Q9H5Q1	Missense_Mutation	SNP	NULL	p.E40K	ENST00000264848.5	37	c.118	CCDS46887.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.74|16.74	3.206988|3.206988	0.58343|0.58343	.|.	.|.	ENSG00000114529|ENSG00000114529	ENST00000430855;ENST00000431717;ENST00000264848|ENST00000484828	T;T;T|.	0.37058|.	1.29;1.22;1.79|.	3.72|3.72	1.83|1.83	0.25207|0.25207	.|.	0.867044|.	0.10179|.	N|.	0.706086|.	T|T	0.49660|0.49660	0.1570|0.1570	L|L	0.60455|0.60455	1.87|1.87	0.09310|0.09310	N|N	1|1	D;D;D|.	0.71674|.	0.975;0.998;0.975|.	B;P;P|.	0.54210|.	0.41;0.745;0.511|.	T|T	0.39333|0.39333	-0.9619|-0.9619	10|5	0.37606|.	T|.	0.19|.	-35.2581|-35.2581	10.0293|10.0293	0.42090|0.42090	0.0:0.3758:0.6242:0.0|0.0:0.3758:0.6242:0.0	.|.	40;40;40|.	Q5BVD1-2;Q5BVD1-3;Q5BVD1|.	.;.;TTMP_HUMAN|.	K|Q	40|30	ENSP00000390333:E40K;ENSP00000399392:E40K;ENSP00000264848:E40K|.	ENSP00000264848:E40K|.	E|R	+|+	1|2	0|0	C3orf52|C3orf52	113288062|113288062	0.689000|0.689000	0.27690|0.27690	0.020000|0.020000	0.16555|0.16555	0.009000|0.009000	0.06853|0.06853	0.790000|0.790000	0.26900|0.26900	0.503000|0.503000	0.28060|0.28060	0.407000|0.407000	0.27541|0.27541	GAG|CGA	C3orf52	-	NULL	ENSG00000114529		0.652	C3orf52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf52	HGNC	protein_coding	OTTHUMT00000353961.1	13	0.00	0	G	NM_024616		111805372	111805372	+1	no_errors	ENST00000431717	ensembl	human	known	69_37n	missense	57	19.72	14	SNP	0.023	A
CACNA1F	778	genome.wustl.edu	37	X	49075818	49075818	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:49075818C>T	ENST00000376265.2	-	21	2729	c.2668G>A	c.(2668-2670)Gct>Act	p.A890T	CACNA1F_ENST00000376251.1_Missense_Mutation_p.A825T|CACNA1F_ENST00000480889.1_5'Flank|CACNA1F_ENST00000323022.5_Missense_Mutation_p.A879T	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	890					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGGTCCTCAGCGGCCAGGGAC	0.597													c|||	1	0.000264901	0.0	0.0014	3775	,	,		14672	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													74.0	60.0	65.0					X																	49075818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.2668G>A	X.37:g.49075818C>T	ENSP00000365441:p.Ala890Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.A890T	ENST00000376265.2	37	c.2668	CCDS35253.1	X	.	.	.	.	.	.	.	.	.	.	.	21.6	4.172312	0.78452	.	.	ENSG00000102001	ENST00000376251;ENST00000323022;ENST00000376265	D;D;D	0.97505	-4.41;-4.41;-4.41	4.95	4.95	0.65309	.	0.347783	0.32459	N	0.006071	D	0.98466	0.9489	M	0.84773	2.715	0.58432	D	0.999997	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.97	D	0.99675	1.0997	10	0.87932	D	0	.	15.9731	0.80036	0.0:1.0:0.0:0.0	.	879;890	F5CIQ9;O60840	.;CAC1F_HUMAN	T	825;879;890	ENSP00000365427:A825T;ENSP00000321618:A879T;ENSP00000365441:A890T	ENSP00000321618:A879T	A	-	1	0	CACNA1F	48962762	1.000000	0.71417	0.946000	0.38457	0.331000	0.28603	5.901000	0.69861	2.286000	0.76751	0.500000	0.49745	GCT	CACNA1F	-	NULL	ENSG00000102001		0.597	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	35	0.00	0	C	NM_005183		49075818	49075818	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	missense	133	36.36	76	SNP	1.000	T
CD97	976	genome.wustl.edu	37	19	14513553	14513553	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:14513553C>T	ENST00000242786.5	+	12	1408	c.1328C>T	c.(1327-1329)tCt>tTt	p.S443F	CD97_ENST00000357355.3_Missense_Mutation_p.S394F|CTC-548K16.5_ENST00000590626.1_RNA|CD97_ENST00000358600.3_Missense_Mutation_p.S350F	NM_078481.3	NP_510966.1	P48960	CD97_HUMAN	CD97 molecule	443					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular component movement (GO:0006928)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30						AGACGCCTCTCTGCCGTCAAC	0.542																																						dbGAP											0													203.0	168.0	180.0					19																	14513553		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32929.1, CCDS32930.1, CCDS32931.1	19p13	2014-08-08	2006-03-28			ENSG00000123146		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	1711	protein-coding gene	gene with protein product	"""leukocyte antigen CD97"", ""seven-span transmembrane protein"", ""seven-transmembrane, heterodimeric receptor associated with inflammation"", ""seven transmembrane helix receptor"""	601211	"""CD97 antigen"""			7636245, 8786105	Standard	NM_078481		Approved	TM7LN1	uc002myl.3	P48960		ENST00000242786.5:c.1328C>T	19.37:g.14513553C>T	ENSP00000242786:p.Ser443Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Z4|B2RBJ9|O00718|O76101|Q8NG72|Q8TBQ7	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_CD97,prints_GPCR_2_secretin-like,prints_GPCR_2_EMR1_rcpt	p.S443F	ENST00000242786.5	37	c.1328	CCDS32929.1	19	.	.	.	.	.	.	.	.	.	.	C	17.14	3.313259	0.60414	.	.	ENSG00000123146	ENST00000242786;ENST00000357355;ENST00000358600;ENST00000393059	T;T;T	0.74209	-0.82;-0.73;-0.38	5.12	5.12	0.69794	.	.	.	.	.	D	0.86058	0.5842	M	0.82323	2.585	0.34060	D	0.657191	D;D;P	0.58620	0.983;0.983;0.618	D;D;P	0.66716	0.946;0.946;0.461	D	0.91334	0.5092	9	0.87932	D	0	.	14.0515	0.64739	0.0:1.0:0.0:0.0	.	350;394;443	P48960-2;P48960-3;P48960	.;.;CD97_HUMAN	F	443;394;350;393	ENSP00000242786:S443F;ENSP00000349918:S394F;ENSP00000351413:S350F	ENSP00000242786:S443F	S	+	2	0	CD97	14374553	0.637000	0.27216	0.078000	0.20375	0.006000	0.05464	3.656000	0.54467	2.368000	0.80403	0.455000	0.32223	TCT	CD97	-	prints_GPCR_2_CD97	ENSG00000123146		0.542	CD97-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CD97	HGNC	protein_coding	OTTHUMT00000459821.2	129	0.00	0	C	NM_078481		14513553	14513553	+1	no_errors	ENST00000242786	ensembl	human	known	69_37n	missense	362	23.14	109	SNP	0.525	T
CHD8	57680	genome.wustl.edu	37	14	21863271	21863271	+	Silent	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr14:21863271C>A	ENST00000557364.1	-	30	5453	c.5190G>T	c.(5188-5190)gtG>gtT	p.V1730V	SNORD9_ENST00000362566.1_RNA|CHD8_ENST00000555962.1_5'UTR|CHD8_ENST00000430710.3_Silent_p.V1451V|CHD8_ENST00000399982.2_Silent_p.V1730V|SNORD8_ENST00000363915.1_RNA			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1730					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		GCTGTTGGGTCACCTGGGCTG	0.488																																						dbGAP											0													27.0	27.0	27.0					14																	21863271		1910	4132	6042	-	-	-	SO:0001819	synonymous_variant	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.5190G>T	14.37:g.21863271C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V1730	ENST00000557364.1	37	c.5190	CCDS53885.1	14																																																																																			CHD8	-	NULL	ENSG00000100888		0.488	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	41	0.00	0	C	NM_020920		21863271	21863271	-1	no_errors	ENST00000399982	ensembl	human	known	69_37n	silent	93	13.08	14	SNP	0.998	A
CHRNB3	1142	genome.wustl.edu	37	8	42587035	42587035	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr8:42587035C>G	ENST00000289957.2	+	5	713	c.585C>G	c.(583-585)ttC>ttG	p.F195L		NM_000749.3	NP_000740.1	Q05901	ACHB3_HUMAN	cholinergic receptor, nicotinic, beta 3 (neuronal)	195					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine-activated cation-selective channel activity (GO:0004889)|channel activity (GO:0015267)|drug binding (GO:0008144)			endometrium(4)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(2)	25	all_lung(13;5.7e-12)|Lung NSC(13;1.6e-10)|Ovarian(28;0.00579)|Prostate(17;0.0119)|Lung SC(25;0.184)	all_lung(54;0.00026)|Lung NSC(58;0.000992)|Hepatocellular(245;0.0524)|Renal(179;0.0822)|Esophageal squamous(32;0.0954)	Lung(22;0.0199)|LUSC - Lung squamous cell carcinoma(45;0.0869)		Galantamine(DB00674)|Nicotine(DB00184)	GAAAAGACTTCTTCGATAACG	0.463																																						dbGAP											0													91.0	88.0	89.0					8																	42587035		2203	4300	6503	-	-	-	SO:0001583	missense	0			U62438	CCDS6134.1	8p11.21	2012-02-11	2012-02-07		ENSG00000147432	ENSG00000147432		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1963	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, beta 3 (neuronal)"""	118508	"""cholinergic receptor, nicotinic, beta polypeptide 3"""			1505988	Standard	NM_000749		Approved		uc003xpi.1	Q05901	OTTHUMG00000165262	ENST00000289957.2:c.585C>G	8.37:g.42587035C>G	ENSP00000289957:p.Phe195Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15827	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.F195L	ENST00000289957.2	37	c.585	CCDS6134.1	8	.	.	.	.	.	.	.	.	.	.	c	14.68	2.606686	0.46527	.	.	ENSG00000147432	ENST00000289957	D	0.82526	-1.62	5.49	2.68	0.31781	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.87795	0.6267	M	0.68728	2.09	0.52501	D	0.999951	D	0.71674	0.998	D	0.85130	0.997	D	0.85478	0.1177	10	0.72032	D	0.01	.	7.438	0.27166	0.0:0.5073:0.0:0.4927	.	195	Q05901	ACHB3_HUMAN	L	195	ENSP00000289957:F195L	ENSP00000289957:F195L	F	+	3	2	CHRNB3	42706192	0.935000	0.31712	0.996000	0.52242	0.569000	0.35902	0.102000	0.15272	0.276000	0.22118	-0.156000	0.13503	TTC	CHRNB3	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	ENSG00000147432		0.463	CHRNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNB3	HGNC	protein_coding	OTTHUMT00000383055.1	51	0.00	0	C			42587035	42587035	+1	no_errors	ENST00000289957	ensembl	human	known	69_37n	missense	90	11.65	12	SNP	1.000	G
COG8	84342	genome.wustl.edu	37	16	69370510	69370510	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:69370510G>A	ENST00000306875.4	-	2	597	c.483C>T	c.(481-483)ctC>ctT	p.L161L	RP11-343C2.7_ENST00000564737.1_3'UTR|NIP7_ENST00000254940.5_5'Flank|RP11-343C2.12_ENST00000562949.1_5'Flank|NIP7_ENST00000569637.2_5'Flank|RP11-343C2.9_ENST00000563634.1_Silent_p.L36L|COG8_ENST00000562081.1_Silent_p.L161L	NM_032382.4	NP_115758.3	Q96MW5	COG8_HUMAN	component of oligomeric golgi complex 8	161					protein transport (GO:0015031)	Golgi transport complex (GO:0017119)|membrane (GO:0016020)		p.L161L(1)		breast(3)|kidney(1)|large_intestine(2)|ovary(2)|skin(1)	9						AGGTGTCCATGAGCTGAGGAA	0.517																																						dbGAP											1	Substitution - coding silent(1)	breast(1)											108.0	98.0	102.0					16																	69370510		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AK025968	CCDS10876.1	16q22.1	2011-05-31			ENSG00000213380	ENSG00000213380		"""Components of oligomeric golgi complex"""	18623	protein-coding gene	gene with protein product		606979				11980916	Standard	NM_032382		Approved	FLJ22315, DOR1	uc002ewy.2	Q96MW5	OTTHUMG00000154277	ENST00000306875.4:c.483C>T	16.37:g.69370510G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAK2|Q8WVV6|Q9H6F8	Missense_Mutation	SNP	pfam_Dor1	p.H142Y	ENST00000306875.4	37	c.424	CCDS10876.1	16																																																																																			COG8	-	pfam_Dor1	ENSG00000213380		0.517	COG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG8	HGNC	protein_coding	OTTHUMT00000268948.2	123	0.00	0	G	NM_032382		69370510	69370510	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000562595	ensembl	human	putative	69_37n	missense	159	24.29	51	SNP	0.838	A
COL1A2	1278	genome.wustl.edu	37	7	94041910	94041910	+	Missense_Mutation	SNP	C	C	G	rs543815305		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:94041910C>G	ENST00000297268.6	+	25	1890	c.1419C>G	c.(1417-1419)atC>atG	p.I473M		NM_000089.3	NP_000080.2	P08123	CO1A2_HUMAN	collagen, type I, alpha 2	473					blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|odontogenesis (GO:0042476)|platelet activation (GO:0030168)|protein heterotrimerization (GO:0070208)|regulation of blood pressure (GO:0008217)|Rho protein signal transduction (GO:0007266)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|transforming growth factor beta receptor signaling pathway (GO:0007179)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|protein binding, bridging (GO:0030674)		COL1A2/PLAG1(3)	NS(2)|breast(2)|central_nervous_system(4)|cervix(1)|endometrium(6)|kidney(8)|large_intestine(21)|lung(51)|ovary(2)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	115	all_cancers(62;2.46e-09)|all_epithelial(64;2.7e-08)		STAD - Stomach adenocarcinoma(171;0.0031)		Collagenase(DB00048)	TCCCTGGCATCGACGGCAGGC	0.517										HNSCC(75;0.22)																												dbGAP											0													46.0	45.0	45.0					7																	94041910		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z74616	CCDS34682.1	7q21.3	2014-09-17	2002-02-13		ENSG00000164692	ENSG00000164692		"""Collagens"""	2198	protein-coding gene	gene with protein product	"""alpha 2(I)-collagen"", ""alpha-2 collagen type I"", ""type I procollagen"", ""collagen I, alpha-2 polypeptide"", ""collagen of skin, tendon and bone, alpha-2 chain"""	120160	"""osteogenesis imperfecta type IV"""	OI4		3857213, 2897363	Standard	NM_000089		Approved		uc003ung.1	P08123	OTTHUMG00000148675	ENST00000297268.6:c.1419C>G	7.37:g.94041910C>G	ENSP00000297268:p.Ile473Met	Somatic		WXS	Illumina GAIIx	Phase_IV	P02464|Q13897|Q13997|Q13998|Q14038|Q14057|Q15177|Q15947|Q16480|Q16511|Q7Z5S6|Q9UEB6|Q9UEF9|Q9UM83|Q9UMI1|Q9UML5|Q9UMM6|Q9UPH0	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_Fibrinogen_a/b/g_C,smart_Fib_collagen_C	p.I473M	ENST00000297268.6	37	c.1419	CCDS34682.1	7	.	.	.	.	.	.	.	.	.	.	C	7.873	0.728656	0.15507	.	.	ENSG00000164692	ENST00000297268;ENST00000545487	D	0.93426	-3.22	5.85	-10.1	0.00402	.	0.300998	0.37669	N	0.001988	D	0.88588	0.6477	L	0.44542	1.39	0.21762	N	0.999557	P	0.35527	0.507	P	0.46510	0.519	T	0.81254	-0.1016	10	0.62326	D	0.03	.	6.7148	0.23296	0.3298:0.3678:0.0:0.3024	.	473	P08123	CO1A2_HUMAN	M	473;474	ENSP00000297268:I473M	ENSP00000297268:I473M	I	+	3	3	COL1A2	93879846	0.417000	0.25432	0.053000	0.19242	0.238000	0.25445	-0.164000	0.09983	-1.919000	0.01071	-0.150000	0.13652	ATC	COL1A2	-	pfam_Collagen	ENSG00000164692		0.517	COL1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A2	HGNC	protein_coding	OTTHUMT00000309045.2	25	0.00	0	C	NM_000089		94041910	94041910	+1	no_errors	ENST00000297268	ensembl	human	known	69_37n	missense	44	38.03	27	SNP	0.004	G
CREBBP	1387	genome.wustl.edu	37	16	3778745	3778745	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:3778745G>C	ENST00000262367.5	-	31	7112	c.6303C>G	c.(6301-6303)atC>atG	p.I2101M	CREBBP_ENST00000382070.3_Missense_Mutation_p.I2063M	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	2101					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TGCGCTGTTTGATGAAAGCTG	0.612			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															dbGAP		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													108.0	119.0	116.0					16																	3778745		2197	4299	6496	-	-	-	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.6303C>G	16.37:g.3778745G>C	ENSP00000262367:p.Ile2101Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.I2101M	ENST00000262367.5	37	c.6303	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	g	3.217	-0.160390	0.06502	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070;ENST00000323508	D;D	0.88124	-2.34;-2.22	5.11	0.391	0.16282	Nuclear receptor coactivator, CREB-bp-like, interlocking (2);Nuclear receptor coactivator, interlocking (1);	0.000000	0.85682	D	0.000000	D	0.90556	0.7040	M	0.69523	2.12	0.53005	D	0.999964	D;D	0.69078	0.997;0.997	D;D	0.83275	0.996;0.996	D	0.87634	0.2518	10	0.66056	D	0.02	-21.4476	7.5064	0.27547	0.3042:0.0:0.5559:0.1399	.	2131;2101	Q4LE28;Q92793	.;CBP_HUMAN	M	2101;2131;2063;636	ENSP00000262367:I2101M;ENSP00000371502:I2063M	ENSP00000262367:I2101M	I	-	3	3	CREBBP	3718746	1.000000	0.71417	0.997000	0.53966	0.937000	0.57800	0.553000	0.23391	-0.035000	0.13691	-0.797000	0.03246	ATC	CREBBP	-	pfam_Nuc_rcpt_coact_CREBbp,superfamily_Nuc_rcpt_coact	ENSG00000005339		0.612	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	11	0.00	0	G	NM_004380		3778745	3778745	-1	no_errors	ENST00000262367	ensembl	human	known	69_37n	missense	62	17.33	13	SNP	0.986	C
CSNK2A1	1457	genome.wustl.edu	37	20	480564	480564	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:480564C>A	ENST00000217244.3	-	5	603	c.228G>T	c.(226-228)aaG>aaT	p.K76N	CSNK2A1_ENST00000400227.3_Missense_Mutation_p.K76N|CSNK2A1_ENST00000349736.5_Missense_Mutation_p.K76N|CSNK2A1_ENST00000400217.2_5'UTR	NM_177559.2	NP_808227.1	P68400	CSK21_HUMAN	casein kinase 2, alpha 1 polypeptide	76	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|chaperone-mediated protein folding (GO:0061077)|mitotic cell cycle (GO:0000278)|mitotic spindle checkpoint (GO:0071174)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of cell growth (GO:0030307)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	ATP binding (GO:0005524)|Hsp90 protein binding (GO:0051879)|protein N-terminus binding (GO:0047485)|protein phosphatase regulator activity (GO:0019888)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|central_nervous_system(2)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		Breast(17;0.231)	OV - Ovarian serous cystadenocarcinoma(29;0.0969)			GCTTAATTTTCTTCTTTTTTA	0.328																																						dbGAP											0													94.0	97.0	96.0					20																	480564		2202	4300	6502	-	-	-	SO:0001583	missense	0			M55265	CCDS13003.1, CCDS13004.1	20p13	2013-01-17			ENSG00000101266	ENSG00000101266			2457	protein-coding gene	gene with protein product		115440				2174700, 1766873	Standard	NM_177559		Approved		uc002wdx.1	P68400	OTTHUMG00000031636	ENST00000217244.3:c.228G>T	20.37:g.480564C>A	ENSP00000217244:p.Lys76Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYS6|D3DVV8|P19138|P20426|Q14013|Q5U065	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K76N	ENST00000217244.3	37	c.228	CCDS13003.1	20	.	.	.	.	.	.	.	.	.	.	C	19.61	3.860506	0.71834	.	.	ENSG00000101266	ENST00000400227;ENST00000349736;ENST00000217244;ENST00000381973	T;T;T	0.07327	3.2;3.2;3.2	5.2	5.2	0.72013	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.044299	0.85682	D	0.000000	T	0.24005	0.0581	M	0.67700	2.07	0.80722	D	1	D	0.71674	0.998	D	0.67382	0.951	T	0.00083	-1.2102	10	0.87932	D	0	-5.5501	11.3364	0.49507	0.0:0.9184:0.0:0.0815	.	76	P68400	CSK21_HUMAN	N	76	ENSP00000383086:K76N;ENSP00000339247:K76N;ENSP00000217244:K76N	ENSP00000217244:K76N	K	-	3	2	CSNK2A1	428564	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.576000	0.82467	2.717000	0.92951	0.655000	0.94253	AAG	CSNK2A1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101266		0.328	CSNK2A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CSNK2A1	HGNC	protein_coding	OTTHUMT00000077466.1	191	0.00	0	C	NM_001895		480564	480564	-1	no_errors	ENST00000217244	ensembl	human	known	69_37n	missense	145	17.61	31	SNP	1.000	A
CYFIP2	26999	genome.wustl.edu	37	5	156746911	156746911	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:156746911C>T	ENST00000521420.1	+	13	1511	c.1420C>T	c.(1420-1422)Cgg>Tgg	p.R474W	CYFIP2_ENST00000347377.6_Missense_Mutation_p.R500W|CYFIP2_ENST00000318218.6_Missense_Mutation_p.R500W|CYFIP2_ENST00000442283.2_5'UTR|CYFIP2_ENST00000541131.1_Missense_Mutation_p.R425W|CYFIP2_ENST00000377576.3_Missense_Mutation_p.R500W|CYFIP2_ENST00000522463.1_Missense_Mutation_p.R304W|CYFIP2_ENST00000435847.2_Missense_Mutation_p.R174W					cytoplasmic FMR1 interacting protein 2									p.R500W(1)		breast(1)|endometrium(12)|kidney(2)|lung(23)	38	Renal(175;0.00212)	Medulloblastoma(196;0.0306)|all_neural(177;0.0897)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCAGGCGGTACGGAAGAAGAA	0.562																																						dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											146.0	153.0	151.0					5																	156746911		2199	4300	6499	-	-	-	SO:0001583	missense	0			AF160973	CCDS75364.1	5q34	2008-07-18				ENSG00000055163			13760	protein-coding gene	gene with protein product	"""p53 inducible protein"""	606323				11438699	Standard	NM_001037333		Approved	PIR121	uc021ygm.1	Q96F07		ENST00000521420.1:c.1420C>T	5.37:g.156746911C>T	ENSP00000430904:p.Arg474Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub,prints_Cytoplasmic_FMR1-int	p.R500W	ENST00000521420.1	37	c.1498		5	.	.	.	.	.	.	.	.	.	.	C	18.54	3.646358	0.67358	.	.	ENSG00000055163	ENST00000318218;ENST00000522463;ENST00000521420;ENST00000347377;ENST00000377576;ENST00000541131;ENST00000435847	T;T;T;T;T;T;T	0.23950	1.88;1.88;1.88;1.88;1.88;1.88;1.88	5.97	2.9	0.33743	.	0.000000	0.85682	D	0.000000	T	0.32556	0.0833	N	0.19112	0.55	0.80722	D	1	D;D;D;D;D;D	0.69078	0.99;0.995;0.997;0.993;0.997;0.994	P;D;P;P;P;P	0.64321	0.834;0.924;0.85;0.724;0.812;0.826	T	0.20505	-1.0273	10	0.87932	D	0	-27.8639	14.3106	0.66413	0.5048:0.4952:0.0:0.0	.	364;304;474;500;500;500	A8MUM2;E7EW33;E7EVJ5;E7EVF4;Q96F07-2;Q96F07	.;.;.;.;.;CYFP2_HUMAN	W	500;304;474;500;500;425;174	ENSP00000325817:R500W;ENSP00000428009:R304W;ENSP00000430904:R474W;ENSP00000313567:R500W;ENSP00000366799:R500W;ENSP00000444645:R425W;ENSP00000403793:R174W	ENSP00000325817:R500W	R	+	1	2	CYFIP2	156679489	0.614000	0.27017	0.337000	0.25536	0.743000	0.42351	1.098000	0.31000	0.825000	0.34637	0.655000	0.94253	CGG	CYFIP2	-	pfam_Cytoplasmic_FMR1-int,pirsf_Cytoplasmic_FMR1-int_sub	ENSG00000055163		0.562	CYFIP2-001	NOVEL	basic	protein_coding	CYFIP2	HGNC	protein_coding	OTTHUMT00000373710.1	20	0.00	0	C	NM_001037332		156746911	156746911	+1	no_errors	ENST00000318218	ensembl	human	known	69_37n	missense	148	18.68	34	SNP	0.988	T
DCP1A	55802	genome.wustl.edu	37	3	53346358	53346358	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:53346358C>T	ENST00000607628.1	-	5	532	c.423G>A	c.(421-423)caG>caA	p.Q141Q	DCP1A_ENST00000294241.6_Silent_p.Q141Q|DCP1A_ENST00000480258.1_5'UTR|DCP1A_ENST00000606822.1_Silent_p.Q141Q	NM_018403.5	NP_060873.4	Q9NPI6	DCP1A_HUMAN	decapping mRNA 1A	141					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				BRCA - Breast invasive adenocarcinoma(193;0.000164)|KIRC - Kidney renal clear cell carcinoma(197;0.00525)|Kidney(197;0.00579)|OV - Ovarian serous cystadenocarcinoma(275;0.0647)		GGCTGGGACTCTGTTTGTCCC	0.542																																						dbGAP											0													54.0	58.0	57.0					3																	53346358		2008	4166	6174	-	-	-	SO:0001819	synonymous_variant	0			AJ275986	CCDS74946.1	3p21.1	2013-05-02	2013-05-02		ENSG00000162290	ENSG00000272886			18714	protein-coding gene	gene with protein product		607010	"""DCP1 decapping enzyme homolog A (S. cerevisiae)"""				Standard	XM_005278360		Approved	HSA275986, SMIF, SMAD4IP1	uc021wzi.1	Q9NPI6	OTTHUMG00000158193	ENST00000607628.1:c.423G>A	3.37:g.53346358C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHN9|U3KQM8	RNA	SNP	-	NULL	ENST00000607628.1	37	NULL		3																																																																																			DCP1A	-	-	ENSG00000162290		0.542	DCP1A-203	KNOWN	basic|appris_candidate_longest	protein_coding	DCP1A	HGNC	protein_coding		32	0.00	0	C	NM_018403		53346358	53346358	-1	no_errors	ENST00000294241	ensembl	human	known	69_37n	rna	179	10.05	20	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118454657	118454657	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:118454657G>C	ENST00000311085.8	+	8	971	c.891G>C	c.(889-891)aaG>aaC	p.K297N	DMXL1_ENST00000539542.1_Missense_Mutation_p.K297N	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	297										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		ATAACTTCAAGAGAAATGCTT	0.343																																						dbGAP											0													100.0	102.0	101.0					5																	118454657		2201	4300	6501	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.891G>C	5.37:g.118454657G>C	ENSP00000309690:p.Lys297Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K297N	ENST00000311085.8	37	c.891	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	13.21	2.168613	0.38315	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.24350	1.86;2.85;2.85	5.24	2.41	0.29592	WD40 repeat-like-containing domain (1);	0.135643	0.53938	D	0.000041	T	0.23289	0.0563	L	0.57536	1.79	0.49483	D	0.999799	P;B	0.35684	0.515;0.22	B;B	0.38225	0.268;0.102	T	0.03394	-1.1041	10	0.17832	T	0.49	-4.7571	8.3203	0.32126	0.3084:0.0:0.6916:0.0	.	297;297	F5H269;Q9Y485	.;DMXL1_HUMAN	N	297	ENSP00000427692:K297N;ENSP00000309690:K297N;ENSP00000439479:K297N	ENSP00000309690:K297N	K	+	3	2	DMXL1	118482556	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.033000	0.30191	0.186000	0.20125	0.655000	0.94253	AAG	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.343	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	226	0.00	0	G	NM_005509		118454657	118454657	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	299	12.32	42	SNP	1.000	C
DNAH1	25981	genome.wustl.edu	37	3	52400784	52400784	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:52400784G>A	ENST00000420323.2	+	36	5907	c.5646G>A	c.(5644-5646)ctG>ctA	p.L1882L		NM_015512.4	NP_056327	Q9P2D7	DYH1_HUMAN	dynein, axonemal, heavy chain 1	1882	AAA 2. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|response to mechanical stimulus (GO:0009612)	axonemal dynein complex (GO:0005858)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			cervix(2)|endometrium(18)|kidney(6)|large_intestine(3)|lung(31)|prostate(1)|urinary_tract(1)	62				BRCA - Breast invasive adenocarcinoma(193;2.02e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000207)|Kidney(197;0.0022)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		TGACGTCACTGAAAGGGCAGC	0.597																																						dbGAP											0													94.0	99.0	98.0					3																	52400784		2119	4216	6335	-	-	-	SO:0001819	synonymous_variant	0			U61738	CCDS46842.1	3p21-p14	2008-02-05	2006-09-04		ENSG00000114841	ENSG00000114841		"""Axonemal dyneins"""	2940	protein-coding gene	gene with protein product		603332	"""dynein, axonemal, heavy polypeptide 1"""			8812413, 9256245	Standard	NM_015512		Approved	XLHSRF-1, DNAHC1, HDHC7, HL-11, HL11	uc011bef.2	Q9P2D7	OTTHUMG00000158378	ENST00000420323.2:c.5646G>A	3.37:g.52400784G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R6|O00436|O15435|O95491|Q6ZU48|Q86YK7|Q8TEJ4|Q92863|Q9H8E6|Q9UFW6|Q9Y4Z7	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA	p.L1882	ENST00000420323.2	37	c.5646	CCDS46842.1	3																																																																																			DNAH1	-	pfam_ATPase_dyneun-rel_AAA	ENSG00000114841		0.597	DNAH1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH1	HGNC	protein_coding	OTTHUMT00000350816.1	23	0.00	0	G	NM_015512		52400784	52400784	+1	no_errors	ENST00000420323	ensembl	human	known	69_37n	silent	101	17.89	22	SNP	0.996	A
DNAH2	146754	genome.wustl.edu	37	17	7671380	7671380	+	Splice_Site	SNP	G	G	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:7671380G>T	ENST00000572933.1	+	23	5297		c.e23+1		DNAH2_ENST00000389173.2_Splice_Site			Q9P225	DYH2_HUMAN	dynein, axonemal, heavy chain 2						cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(3)|breast(11)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(16)|large_intestine(53)|liver(2)|lung(49)|ovary(7)|prostate(7)|skin(15)|upper_aerodigestive_tract(1)|urinary_tract(1)	189		all_cancers(10;4.66e-07)|Prostate(122;0.081)				AGAGTATAAGGTGGGGAGAAA	0.582																																						dbGAP											0													53.0	58.0	56.0					17																	7671380		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U83570, AK128517	CCDS32551.1	17p13.1	2007-10-05	2006-09-04			ENSG00000183914		"""Axonemal dyneins"""	2948	protein-coding gene	gene with protein product		603333	"""dynein, axonemal, heavy polypeptide 2"", ""dynein heavy chain domain 3"""	DNHD3		9256245	Standard	XM_005256470		Approved	KIAA1503, FLJ46675	uc002giu.1	Q9P225		ENST00000572933.1:c.3837+1G>T	17.37:g.7671380G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K992|B5MDX5|O15434|Q6PIH3|Q6ZR42	Splice_Site	SNP	-	e22+1	ENST00000572933.1	37	c.3837+1	CCDS32551.1	17	.	.	.	.	.	.	.	.	.	.	G	17.62	3.434144	0.62955	.	.	ENSG00000183914	ENST00000360606;ENST00000389173	.	.	.	4.27	3.27	0.37495	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.0767	0.53647	0.0:0.0:0.8259:0.1741	.	.	.	.	.	-1	.	.	.	+	.	.	DNAH2	7612105	1.000000	0.71417	0.847000	0.33407	0.863000	0.49368	7.228000	0.78079	0.748000	0.32831	0.491000	0.48974	.	DNAH2	-	-	ENSG00000183914		0.582	DNAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH2	HGNC	protein_coding	OTTHUMT00000440241.1	32	0.00	0	G	NM_020877	Intron	7671380	7671380	+1	no_errors	ENST00000389173	ensembl	human	known	69_37n	splice_site	60	18.92	14	SNP	1.000	T
DNAH17	8632	genome.wustl.edu	37	17	76455115	76455115	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:76455115C>T	ENST00000585328.1	-	61	9938	c.9814G>A	c.(9814-9816)Gag>Aag	p.E3272K	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.E3263K	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	3263	Stalk. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			GACAGCTTCTCTTGTGCCTCT	0.597																																						dbGAP											0													110.0	102.0	105.0					17																	76455115		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9814G>A	17.37:g.76455115C>T	ENSP00000465516:p.Glu3272Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.E3263K	ENST00000585328.1	37	c.9787		17	.	.	.	.	.	.	.	.	.	.	C	17.12	3.306955	0.60305	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.77489	-1.1	5.35	5.35	0.76521	.	0.677010	0.14205	N	0.334425	T	0.73552	0.3601	L	0.41027	1.25	0.37045	D	0.897321	B	0.14438	0.01	B	0.18263	0.021	T	0.69420	-0.5150	10	0.35671	T	0.21	.	18.6873	0.91570	0.0:1.0:0.0:0.0	.	3272	E7EUM8	.	K	3272;3263	ENSP00000374490:E3263K	ENSP00000300671:E3272K	E	-	1	0	DNAH17	73966710	1.000000	0.71417	0.960000	0.40013	0.662000	0.39071	3.639000	0.54339	2.491000	0.84063	0.655000	0.94253	GAG	DNAH17	-	superfamily_HR1_rho-bd	ENSG00000187775		0.597	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	40	0.00	0	C	NM_173628		76455115	76455115	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	140	23.50	43	SNP	1.000	T
DSN1	79980	genome.wustl.edu	37	20	35395197	35395197	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:35395197G>A	ENST00000426836.1	-	5	849	c.477C>T	c.(475-477)ttC>ttT	p.F159F	DSN1_ENST00000373734.4_Silent_p.F52F|DSN1_ENST00000373740.3_Silent_p.F87F|DSN1_ENST00000373750.4_Silent_p.F159F|DSN1_ENST00000373745.3_Silent_p.F159F|DSN1_ENST00000448110.2_Silent_p.F143F|DSN1_ENST00000473615.1_5'UTR	NM_001145316.1	NP_001138788.1	Q9H410	DSN1_HUMAN	DSN1, MIS12 kinetochore complex component	159					chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|MIS12/MIND type complex (GO:0000444)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	16		Myeloproliferative disorder(115;0.00874)				TTTCAAGACTGAAGCCCTTAG	0.413																																						dbGAP											0													128.0	128.0	128.0					20																	35395197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023408	CCDS13286.1, CCDS46596.1, CCDS46597.1	20q11.23	2013-07-03	2013-07-03	2006-11-07	ENSG00000149636	ENSG00000149636			16165	protein-coding gene	gene with protein product	"""kinetochore null 3 homolog (C. elegans)"""	609175	"""chromosome 20 open reading frame 172"", ""DSN1, MIND kinetochore complex component, homolog (S. cerevisiae)"""	C20orf172		16585270, 20819937	Standard	NM_001145315		Approved	dJ469A13.2, MIS13, KNL3, hKNL-3	uc002xfz.3	Q9H410	OTTHUMG00000032396	ENST00000426836.1:c.477C>T	20.37:g.35395197G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWT2|E1P5U9|Q5JW55|Q5JW56|Q9H8P4	Silent	SNP	pfam_Mtw1_DSN1	p.F159	ENST00000426836.1	37	c.477	CCDS13286.1	20																																																																																			DSN1	-	pfam_Mtw1_DSN1	ENSG00000149636		0.413	DSN1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DSN1	HGNC	protein_coding	OTTHUMT00000079043.2	119	0.00	0	G	NM_024918		35395197	35395197	-1	no_errors	ENST00000373745	ensembl	human	known	69_37n	silent	108	14.96	19	SNP	1.000	A
DYSF	8291	genome.wustl.edu	37	2	71913616	71913616	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:71913616C>T	ENST00000258104.3	+	55	6514	c.6237C>T	c.(6235-6237)ttC>ttT	p.F2079F	DYSF_ENST00000394120.2_Silent_p.F2080F|DYSF_ENST00000410020.3_Silent_p.F2118F|DYSF_ENST00000409651.1_Silent_p.F2111F|DYSF_ENST00000410041.1_Silent_p.F2097F|DYSF_ENST00000409582.3_Silent_p.F2117F|DYSF_ENST00000413539.2_Silent_p.F2110F|DYSF_ENST00000409366.1_Silent_p.F2101F|DYSF_ENST00000409744.1_Silent_p.F2087F|DYSF_ENST00000409762.1_Silent_p.F2096F|DYSF_ENST00000429174.2_Silent_p.F2100F|DYSF_ENST00000479049.2_3'UTR	NM_001130976.1|NM_003494.3	NP_001124448.1|NP_003485.1	O75923	DYSF_HUMAN	dysferlin	2079					plasma membrane repair (GO:0001778)|vesicle fusion (GO:0006906)	cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phospholipid binding (GO:0005543)			autonomic_ganglia(2)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|lung(57)|ovary(3)|pancreas(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	111						TGAAGCCCTTCAGCTGAGGAC	0.652																																						dbGAP											0													164.0	143.0	150.0					2																	71913616		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF075575	CCDS1918.1, CCDS46323.1, CCDS46324.1, CCDS46325.1, CCDS46326.1, CCDS46327.1, CCDS46328.1, CCDS46329.1, CCDS46330.1, CCDS46331.1, CCDS46332.1	2p13.3	2014-09-17	2013-09-12		ENSG00000135636	ENSG00000135636			3097	protein-coding gene	gene with protein product	"""fer-1-like family member 1"""	603009	"""limb girdle muscular dystrophy 2B (autosomal recessive)"""	LGMD2B		8320700	Standard	NM_003494		Approved	FER1L1	uc010fen.3	O75923	OTTHUMG00000129757	ENST00000258104.3:c.6237C>T	2.37:g.71913616C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FK00|B1PZ70|B1PZ71|B1PZ72|B1PZ73|B1PZ74|B1PZ75|B1PZ76|B1PZ77|B1PZ78|B1PZ79|B1PZ80|B1PZ81|B3KQB9|O75696|Q09EX5|Q0H395|Q53QY3|Q53TD2|Q8TEL8|Q9UEN7	Silent	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_MFS_dom_general_subst_transpt,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.F2110	ENST00000258104.3	37	c.6330	CCDS1918.1	2																																																																																			DYSF	-	NULL	ENSG00000135636		0.652	DYSF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DYSF	HGNC	protein_coding	OTTHUMT00000251970.3	34	0.00	0	C	NM_003494		71913616	71913616	+1	no_errors	ENST00000413539	ensembl	human	known	69_37n	silent	118	21.33	32	SNP	1.000	T
ESPL1	9700	genome.wustl.edu	37	12	53662952	53662952	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:53662952G>C	ENST00000257934.4	+	3	317	c.226G>C	c.(226-228)Gag>Cag	p.E76Q	ESPL1_ENST00000552462.1_Missense_Mutation_p.E76Q	NM_012291.4	NP_036423.4	Q14674	ESPL1_HUMAN	extra spindle pole bodies homolog 1 (S. cerevisiae)	76					apoptotic process (GO:0006915)|cytokinesis (GO:0000910)|establishment of mitotic spindle localization (GO:0040001)|homologous chromosome segregation (GO:0045143)|meiotic spindle organization (GO:0000212)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of sister chromatid cohesion (GO:0045875)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)	centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|cysteine-type peptidase activity (GO:0008234)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(10)|large_intestine(12)|lung(21)|ovary(2)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(8)	70						GAGCCTGCTGGAGCTGGCAGA	0.562																																					Colon(53;1069 1201 2587 5382)	dbGAP											0													94.0	91.0	92.0					12																	53662952		2203	4300	6503	-	-	-	SO:0001583	missense	0			D79987	CCDS8852.1	12q13.13	2014-08-04	2013-05-03		ENSG00000135476	ENSG00000135476	3.4.22.49		16856	protein-coding gene	gene with protein product	"""separin"", ""separase"", ""separin, cysteine protease"""	604143	"""extra spindle poles like 1 (S. cerevisiae)"""			8724849, 16258266	Standard	NM_012291		Approved	KIAA0165, ESP1, SEPA	uc001sck.2	Q14674	OTTHUMG00000169674	ENST00000257934.4:c.226G>C	12.37:g.53662952G>C	ENSP00000257934:p.Glu76Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C50	p.E76Q	ENST00000257934.4	37	c.226	CCDS8852.1	12	.	.	.	.	.	.	.	.	.	.	G	14.49	2.550526	0.45383	.	.	ENSG00000135476	ENST00000257934;ENST00000552462	T;T	0.12465	2.68;2.68	4.81	4.81	0.61882	.	0.478646	0.21731	N	0.069968	T	0.14356	0.0347	L	0.47716	1.5	0.24428	N	0.994589	B	0.14438	0.01	B	0.16722	0.016	T	0.07028	-1.0794	10	0.44086	T	0.13	.	12.9676	0.58494	0.0:0.1632:0.8368:0.0	.	76	Q14674	ESPL1_HUMAN	Q	76	ENSP00000257934:E76Q;ENSP00000449831:E76Q	ENSP00000257934:E76Q	E	+	1	0	ESPL1	51949219	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	1.642000	0.37207	2.657000	0.90304	0.655000	0.94253	GAG	ESPL1	-	NULL	ENSG00000135476		0.562	ESPL1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPL1	HGNC	protein_coding	OTTHUMT00000406899.2	48	0.00	0	G	NM_012291		53662952	53662952	+1	no_errors	ENST00000257934	ensembl	human	known	69_37n	missense	167	23.74	52	SNP	1.000	C
ERBB3	2065	genome.wustl.edu	37	12	56490901	56490901	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:56490901C>G	ENST00000267101.3	+	20	2787	c.2347C>G	c.(2347-2349)Ctg>Gtg	p.L783V	ERBB3_ENST00000415288.2_Missense_Mutation_p.L724V|ERBB3_ENST00000549832.1_5'Flank|ERBB3_ENST00000450146.2_Missense_Mutation_p.L140V|ERBB3_ENST00000553131.1_Missense_Mutation_p.L24V	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	783	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			AGGGTCATCTCTGCAGCTTGT	0.542																																						dbGAP											0													110.0	93.0	99.0					12																	56490901		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.2347C>G	12.37:g.56490901C>G	ENSP00000267101:p.Leu783Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L783V	ENST00000267101.3	37	c.2347	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	C	9.961	1.222817	0.22457	.	.	ENSG00000065361	ENST00000267101;ENST00000450146;ENST00000415288;ENST00000553131	T;T;T;T	0.64803	-0.12;-0.12;-0.12;-0.12	5.59	4.69	0.59074	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.51477	D	0.000085	T	0.65913	0.2737	L	0.41573	1.285	0.49389	D	0.999788	D	0.89917	1.0	D	0.75020	0.985	T	0.58853	-0.7563	10	0.02654	T	1	.	14.3775	0.66889	0.0:0.9233:0.0:0.0767	.	783	P21860	ERBB3_HUMAN	V	783;140;724;24	ENSP00000267101:L783V;ENSP00000399178:L140V;ENSP00000408340:L724V;ENSP00000449129:L24V	ENSP00000267101:L783V	L	+	1	2	ERBB3	54777168	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.828000	0.48120	2.793000	0.96121	0.561000	0.74099	CTG	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065361		0.542	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	74	0.00	0	C			56490901	56490901	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	166	18.23	37	SNP	1.000	G
ESYT1	23344	genome.wustl.edu	37	12	56531365	56531365	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:56531365C>T	ENST00000394048.5	+	18	2285	c.2021C>T	c.(2020-2022)tCa>tTa	p.S674L	ESYT1_ENST00000267113.4_Missense_Mutation_p.S684L|ESYT1_ENST00000541590.1_Missense_Mutation_p.S684L	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1	674	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						AAGGGCAAGTCAGACCCCTAT	0.532																																						dbGAP											0													143.0	147.0	146.0					12																	56531365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.2021C>T	12.37:g.56531365C>T	ENSP00000377612:p.Ser674Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_C2_dom,pfscan_C2_membr_targeting	p.S684L	ENST00000394048.5	37	c.2051	CCDS8904.1	12	.	.	.	.	.	.	.	.	.	.	C	27.3	4.817203	0.90790	.	.	ENSG00000139641	ENST00000394048;ENST00000402331;ENST00000267113;ENST00000541590	T;T;T	0.73258	-0.73;-0.73;-0.73	5.22	5.22	0.72569	C2 membrane targeting protein (1);C2 region (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.241414	0.41396	D	0.000884	D	0.88288	0.6396	M	0.93678	3.445	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90169	0.4234	10	0.51188	T	0.08	-10.0811	17.9354	0.89011	0.0:1.0:0.0:0.0	.	684;674	Q9BSJ8-2;Q9BSJ8	.;ESYT1_HUMAN	L	674;628;684;684	ENSP00000377612:S674L;ENSP00000267113:S684L;ENSP00000445952:S684L	ENSP00000267113:S684L	S	+	2	0	ESYT1	54817632	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.454000	0.60068	2.608000	0.88229	0.655000	0.94253	TCA	ESYT1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_C2_dom,pfscan_C2_membr_targeting	ENSG00000139641		0.532	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ESYT1	HGNC	protein_coding	OTTHUMT00000407906.1	90	0.00	0	C	NM_015292		56531365	56531365	+1	no_errors	ENST00000267113	ensembl	human	known	69_37n	missense	177	18.43	40	SNP	1.000	T
FAM160A1	729830	genome.wustl.edu	37	4	152583754	152583754	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr4:152583754G>A	ENST00000505231.1	+	12	3130	c.2971G>A	c.(2971-2973)Gag>Aag	p.E991K	FAM160A1_ENST00000435205.1_Missense_Mutation_p.E991K			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	991										endometrium(2)|kidney(1)	3						CAAGGTGGCTGAGGCACCCCC	0.612																																						dbGAP											0													38.0	46.0	43.0					4																	152583754		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.2971G>A	4.37:g.152583754G>A	ENSP00000421580:p.Glu991Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZUS2	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.E991K	ENST00000505231.1	37	c.2971	CCDS47146.1	4	.	.	.	.	.	.	.	.	.	.	G	0.022	-1.409609	0.01155	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.11604	2.76;2.76	5.35	3.58	0.41010	.	.	.	.	.	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.44726	-0.9309	9	0.06365	T	0.9	.	6.4246	0.21762	0.0745:0.1402:0.6566:0.1287	.	991	Q05DH4	F16A1_HUMAN	K	991	ENSP00000413196:E991K;ENSP00000421580:E991K	ENSP00000413196:E991K	E	+	1	0	FAM160A1	152803204	0.983000	0.35010	0.090000	0.20809	0.066000	0.16364	1.967000	0.40491	0.605000	0.29947	0.462000	0.41574	GAG	FAM160A1	-	NULL	ENSG00000164142		0.612	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	27	0.00	0	G	NM_001109977		152583754	152583754	+1	no_errors	ENST00000435205	ensembl	human	known	69_37n	missense	67	28.72	27	SNP	0.230	A
FAM208B	54906	genome.wustl.edu	37	10	5798685	5798685	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr10:5798685C>G	ENST00000328090.5	+	16	7341	c.6716C>G	c.(6715-6717)tCa>tGa	p.S2239*		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2239								p.S2239L(1)									GAAGATATATCATCACATTTG	0.383																																						dbGAP											1	Substitution - Missense(1)	lung(1)											120.0	105.0	109.0					10																	5798685		1886	4107	5993	-	-	-	SO:0001587	stop_gained	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.6716C>G	10.37:g.5798685C>G	ENSP00000328426:p.Ser2239*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Nonsense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.S2239*	ENST00000328090.5	37	c.6716	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	50	17.075941	0.99878	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	.	.	.	5.82	4.91	0.64330	.	1.131330	0.06576	N	0.749491	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	8.4631	0.32940	0.0:0.7626:0.0:0.2374	.	.	.	.	X	2239;1434	.	ENSP00000328426:S2239X	S	+	2	0	C10orf18	5838691	0.014000	0.17966	0.071000	0.20095	0.984000	0.73092	2.627000	0.46469	1.429000	0.47314	0.561000	0.74099	TCA	FAM208B	-	NULL	ENSG00000108021		0.383	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	134	0.00	0	C	NM_017782		5798685	5798685	+1	no_errors	ENST00000328090	ensembl	human	known	69_37n	nonsense	148	18.23	33	SNP	0.006	G
SPATA31D1	389763	genome.wustl.edu	37	9	84609355	84609355	+	Missense_Mutation	SNP	C	C	G	rs374785749		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:84609355C>G	ENST00000344803.2	+	4	4017	c.3970C>G	c.(3970-3972)Cat>Gat	p.H1324D		NM_001001670.2	NP_001001670.1	Q6ZQQ2	S31D1_HUMAN	SPATA31 subfamily D, member 1	1324					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											CCTCCCTGTTCATAACAAGAC	0.512																																						dbGAP											0													24.0	24.0	24.0					9																	84609355		1909	4110	6019	-	-	-	SO:0001583	missense	0				CCDS47986.1	9q21.32	2012-10-12	2012-10-12	2012-10-12	ENSG00000214929	ENSG00000214929			37283	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member D1"""	FAM75D1			Standard	NM_001001670		Approved	FLJ46321	uc004amn.3	Q6ZQQ2	OTTHUMG00000169122	ENST00000344803.2:c.3970C>G	9.37:g.84609355C>G	ENSP00000341988:p.His1324Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.H1324D	ENST00000344803.2	37	c.3970	CCDS47986.1	9	.	.	.	.	.	.	.	.	.	.	C	6.382	0.438553	0.12104	.	.	ENSG00000214929	ENST00000344803	T	0.04360	3.64	3.17	-3.83	0.04269	.	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	0.09310	N	1	B	0.19073	0.033	B	0.14578	0.011	T	0.44772	-0.9306	9	0.45353	T	0.12	1.1797	0.0441	0.00009	0.3217:0.2177:0.1777:0.2829	.	1324	Q6ZQQ2	F75D1_HUMAN	D	1324	ENSP00000341988:H1324D	ENSP00000341988:H1324D	H	+	1	0	FAM75D1	83799175	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.208000	0.09371	-0.834000	0.04239	-0.218000	0.12543	CAT	FAM75D1	-	NULL	ENSG00000214929		0.512	SPATA31D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM75D1	HGNC	protein_coding	OTTHUMT00000402325.1	32	0.00	0	C	NM_001001670		84609355	84609355	+1	no_errors	ENST00000344803	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.000	G
FIGNL1	63979	genome.wustl.edu	37	7	50513589	50513589	+	Missense_Mutation	SNP	G	G	T	rs192313152		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:50513589G>T	ENST00000419119.1	-	2	2950	c.1397C>A	c.(1396-1398)tCt>tAt	p.S466Y	FIGNL1_ENST00000433017.1_Missense_Mutation_p.S466Y|FIGNL1_ENST00000356889.4_Missense_Mutation_p.S466Y|FIGNL1_ENST00000395556.2_Missense_Mutation_p.S466Y			Q6PIW4	FIGL1_HUMAN	fidgetin-like 1	466					ATP metabolic process (GO:0046034)|cellular response to ionizing radiation (GO:0071479)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|regulation of cell cycle (GO:0051726)|regulation of double-strand break repair via homologous recombination (GO:0010569)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|hydrolase activity (GO:0016787)|magnesium ion binding (GO:0000287)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(3)|prostate(3)|upper_aerodigestive_tract(1)	29	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;3.73e-08)|all_hematologic(4;7.51e-06)				GGATGAAGCAGAGATGCTAAA	0.453																																						dbGAP											0													71.0	68.0	69.0					7																	50513589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023142	CCDS5510.1	7p12.2	2010-04-21			ENSG00000132436	ENSG00000132436		"""ATPases / AAA-type"""	13286	protein-coding gene	gene with protein product		615383					Standard	XM_005271783		Approved		uc003tpc.3	Q6PIW4	OTTHUMG00000022866	ENST00000419119.1:c.1397C>A	7.37:g.50513589G>T	ENSP00000410811:p.Ser466Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVM6|Q86V18|Q8ND59|Q9H8P1|Q9H917	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Vps4_C,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.S466Y	ENST00000419119.1	37	c.1397	CCDS5510.1	7	.	.	.	.	.	.	.	.	.	.	G	21.2	4.117857	0.77323	.	.	ENSG00000132436	ENST00000356889;ENST00000395556;ENST00000433017;ENST00000419119	D;D;D;D	0.95690	-3.78;-3.78;-3.78;-3.78	5.99	5.09	0.68999	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.093534	0.64402	D	0.000001	D	0.98118	0.9379	M	0.93763	3.455	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98342	1.0539	10	0.87932	D	0	-17.2025	12.9842	0.58581	0.0:0.3323:0.6677:0.0	.	466	Q6PIW4	FIGL1_HUMAN	Y	466	ENSP00000349356:S466Y;ENSP00000378924:S466Y;ENSP00000399997:S466Y;ENSP00000410811:S466Y	ENSP00000349356:S466Y	S	-	2	0	FIGNL1	50481083	1.000000	0.71417	0.996000	0.52242	0.996000	0.88848	5.623000	0.67757	2.840000	0.97914	0.655000	0.94253	TCT	FIGNL1	-	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	ENSG00000132436		0.453	FIGNL1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FIGNL1	HGNC	protein_coding	OTTHUMT00000342579.1	77	0.00	0	G	NM_001042762		50513589	50513589	-1	no_errors	ENST00000356889	ensembl	human	known	69_37n	missense	158	17.28	33	SNP	1.000	T
GABRA5	2558	genome.wustl.edu	37	15	27188366	27188366	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr15:27188366C>T	ENST00000335625.5	+	10	1770	c.882C>T	c.(880-882)gtC>gtT	p.V294V	GABRA5_ENST00000355395.5_Silent_p.V294V|GABRA5_ENST00000400081.3_Silent_p.V294V	NM_000810.3	NP_000801.1	P31644	GBRA5_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 5	294					associative learning (GO:0008306)|behavioral fear response (GO:0001662)|brain development (GO:0007420)|cochlea development (GO:0090102)|gamma-aminobutyric acid signaling pathway (GO:0007214)|inner ear receptor cell development (GO:0060119)|innervation (GO:0060384)|ion transmembrane transport (GO:0034220)|negative regulation of neuron apoptotic process (GO:0043524)|sensory perception of sound (GO:0007605)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|neuronal cell body membrane (GO:0032809)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(1)|upper_aerodigestive_tract(1)	49		all_lung(180;4.59e-13)|Breast(32;0.000563)|Colorectal(260;0.227)		all cancers(64;1.45e-08)|Epithelial(43;4.96e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0232)|Lung(196;0.182)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flunitrazepam(DB01544)|Flurazepam(DB00690)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zopiclone(DB01198)	CCGCAGGGGTCACCACGGTGC	0.597																																						dbGAP											0													12.0	13.0	13.0					15																	27188366		2052	4162	6214	-	-	-	SO:0001819	synonymous_variant	0				CCDS45194.1	15q12	2012-06-22			ENSG00000186297	ENSG00000186297		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4079	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 5"""	137142				1321750	Standard	NM_000810		Approved		uc021sgi.1	P31644	OTTHUMG00000171824	ENST00000335625.5:c.882C>T	15.37:g.27188366C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K338|Q14DC2|Q53XL6|Q9NYT3|Q9NYT4|Q9NYT5	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa5_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.V294	ENST00000335625.5	37	c.882	CCDS45194.1	15																																																																																			GABRA5	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel	ENSG00000186297		0.597	GABRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA5	HGNC	protein_coding	OTTHUMT00000415234.1	20	0.00	0	C			27188366	27188366	+1	no_errors	ENST00000335625	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	0.948	T
GATAD2B	57459	genome.wustl.edu	37	1	153785831	153785831	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:153785831C>G	ENST00000368655.4	-	8	1557	c.1314G>C	c.(1312-1314)aaG>aaC	p.K438N		NM_020699.2	NP_065750.1	Q8WXI9	P66B_HUMAN	GATA zinc finger domain containing 2B	438	CR2; histone tail-binding.				ATP-dependent chromatin remodeling (GO:0043044)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	38	all_lung(78;1.34e-32)|Lung NSC(65;1.04e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CACATAGAATCTTACCATTCT	0.478																																						dbGAP											0													170.0	147.0	155.0					1																	153785831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411836	CCDS1054.1	1q21.3	2013-01-25			ENSG00000143614	ENSG00000143614		"""GATA zinc finger domain containing"""	30778	protein-coding gene	gene with protein product	"""transcription repressor p66 beta component of the MeCP1 complex"""	614998				10574461, 11756549	Standard	NM_020699		Approved	P66beta	uc001fdb.4	Q8WXI9	OTTHUMG00000037162	ENST00000368655.4:c.1314G>C	1.37:g.153785831C>G	ENSP00000357644:p.Lys438Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUZ2|Q5VUR2|Q7LG68|Q9ULS0	Missense_Mutation	SNP	pfam_Znf_GATA,pfscan_Znf_GATA	p.K438N	ENST00000368655.4	37	c.1314	CCDS1054.1	1	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535826	0.45176	.	.	ENSG00000143614	ENST00000368655	D	0.99436	-5.9	5.19	4.26	0.50523	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (2);	0.252885	0.42548	D	0.000688	D	0.96018	0.8703	N	0.24115	0.695	0.47441	D	0.999428	P	0.37914	0.611	B	0.37015	0.239	D	0.97050	0.9763	10	0.19147	T	0.46	5.7523	14.0861	0.64957	0.1519:0.8481:0.0:0.0	.	438	Q8WXI9	P66B_HUMAN	N	438	ENSP00000357644:K438N	ENSP00000357644:K438N	K	-	3	2	GATAD2B	152052455	0.983000	0.35010	1.000000	0.80357	0.997000	0.91878	0.280000	0.18790	1.397000	0.46682	0.655000	0.94253	AAG	GATAD2B	-	pfam_Znf_GATA,pfscan_Znf_GATA	ENSG00000143614		0.478	GATAD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATAD2B	HGNC	protein_coding	OTTHUMT00000090305.1	183	0.00	0	C	NM_020699		153785831	153785831	-1	no_errors	ENST00000368655	ensembl	human	known	69_37n	missense	260	23.53	80	SNP	1.000	G
GOLPH3	64083	genome.wustl.edu	37	5	32126446	32126446	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:32126446G>C	ENST00000265070.6	-	4	1084	c.769C>G	c.(769-771)Ctg>Gtg	p.L257V	GOLPH3_ENST00000512668.1_5'Flank	NM_022130.3	NP_071413.1	Q9H4A6	GOLP3_HUMAN	golgi phosphoprotein 3 (coat-protein)	257					cell adhesion molecule production (GO:0060352)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|gene expression (GO:0010467)|glycoprotein biosynthetic process (GO:0009101)|Golgi organization (GO:0007030)|Golgi to plasma membrane protein transport (GO:0043001)|Golgi vesicle budding (GO:0048194)|lamellipodium assembly (GO:0030032)|leukocyte tethering or rolling (GO:0050901)|positive regulation of protein secretion (GO:0050714)|positive regulation of TOR signaling (GO:0032008)|protein retention in Golgi apparatus (GO:0045053)|protein secretion (GO:0009306)|regulation of mitochondrion organization (GO:0010821)	cytosol (GO:0005829)|endosome (GO:0005768)|Golgi cisterna (GO:0031985)|Golgi membrane (GO:0000139)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	enzyme binding (GO:0019899)|phosphatidylinositol-4-phosphate binding (GO:0070273)			kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	11						TGCTCGTCCAGAAGAGGAGCA	0.537																																						dbGAP											0													105.0	88.0	94.0					5																	32126446		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075156	CCDS3896.1	5p13.2	2008-07-18			ENSG00000113384	ENSG00000113384			15452	protein-coding gene	gene with protein product	"""golgi peripheral membrane protein 1, 34 kDa"", ""golgi protein"", ""coat-protein"", ""golgi-associated protein"""	612207				11042173, 16263763	Standard	NM_022130		Approved	GPP34, GOPP1, MIDAS	uc003jhp.1	Q9H4A6	OTTHUMG00000090679	ENST00000265070.6:c.769C>G	5.37:g.32126446G>C	ENSP00000265070:p.Leu257Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UIW5	Missense_Mutation	SNP	pfam_GPP34	p.L257V	ENST00000265070.6	37	c.769	CCDS3896.1	5	.	.	.	.	.	.	.	.	.	.	G	0.568	-0.842167	0.02671	.	.	ENSG00000113384	ENST00000265070;ENST00000542582	.	.	.	6.17	2.42	0.29668	.	0.140023	0.48767	D	0.000162	T	0.41213	0.1149	L	0.40543	1.245	0.42686	D	0.993562	B	0.12630	0.006	B	0.18263	0.021	T	0.16988	-1.0384	9	0.30854	T	0.27	.	3.715	0.08434	0.2084:0.1173:0.5541:0.1202	.	257	Q9H4A6	GOLP3_HUMAN	V	257;240	.	ENSP00000265070:L257V	L	-	1	2	GOLPH3	32162203	1.000000	0.71417	0.989000	0.46669	0.004000	0.04260	1.780000	0.38634	0.472000	0.27344	-0.182000	0.12963	CTG	GOLPH3	-	pfam_GPP34	ENSG00000113384		0.537	GOLPH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLPH3	HGNC	protein_coding	OTTHUMT00000207363.2	85	0.00	0	G	NM_022130		32126446	32126446	-1	no_errors	ENST00000265070	ensembl	human	known	69_37n	missense	149	17.22	31	SNP	0.984	C
GPR133	283383	genome.wustl.edu	37	12	131476808	131476808	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:131476808C>T	ENST00000261654.5	+	8	1396	c.837C>T	c.(835-837)atC>atT	p.I279I	GPR133_ENST00000535015.1_Silent_p.I311I|RP11-76C10.5_ENST00000542980.1_lincRNA	NM_198827.3	NP_942122.2	Q6QNK2	GP133_HUMAN	G protein-coupled receptor 133	279					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(2)|endometrium(6)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|pancreas(6)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	67	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.68e-06)|all cancers(50;2.71e-06)|Epithelial(86;6.75e-06)		ACCATCCCATCATAACCAACC	0.408																																						dbGAP											0													188.0	204.0	199.0					12																	131476808		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY278561	CCDS9272.1	12q24.33	2014-08-08			ENSG00000111452	ENSG00000111452		"""-"", ""GPCR / Class B : Orphans"""	19893	protein-coding gene	gene with protein product		613639					Standard	NM_198827		Approved	DKFZp434B1272, PGR25	uc001uit.4	Q6QNK2	OTTHUMG00000168339	ENST00000261654.5:c.837C>T	12.37:g.131476808C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2CKK9|B7ZLF7|Q2M1L3|Q6ZMQ1|Q7Z7M2|Q86SM4	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.I279	ENST00000261654.5	37	c.837	CCDS9272.1	12																																																																																			GPR133	-	NULL	ENSG00000111452		0.408	GPR133-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR133	HGNC	protein_coding	OTTHUMT00000399356.1	151	0.00	0	C	NM_198827		131476808	131476808	+1	no_errors	ENST00000261654	ensembl	human	known	69_37n	silent	140	19.54	34	SNP	0.990	T
GPR139	124274	genome.wustl.edu	37	16	20043114	20043114	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:20043114G>C	ENST00000570682.1	-	2	1305	c.1005C>G	c.(1003-1005)atC>atG	p.I335M		NM_001002911.2	NP_001002911.1	Q6DWJ6	GP139_HUMAN	G protein-coupled receptor 139	335					G-protein coupled receptor signaling pathway (GO:0007186)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)			autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	30						CCAGCATCTTGATGCAGTGTG	0.443																																						dbGAP											0													161.0	157.0	159.0					16																	20043114		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY255545	CCDS32398.1	16p13.11	2012-08-21						"""GPCR / Class A : Orphans"""	19995	protein-coding gene	gene with protein product						12679517	Standard	XM_005255114		Approved	PGR3	uc002dgu.1	Q6DWJ6		ENST00000570682.1:c.1005C>G	16.37:g.20043114G>C	ENSP00000458791:p.Ile335Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5R9|Q86SP2|Q8TDU8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I335M	ENST00000570682.1	37	c.1005	CCDS32398.1	16	.	.	.	.	.	.	.	.	.	.	G	13.85	2.361051	0.41801	.	.	ENSG00000180269	ENST00000326571	.	.	.	5.63	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.52058	0.1711	N	0.19112	0.55	0.43018	D	0.994562	D	0.57571	0.98	D	0.64321	0.924	T	0.49643	-0.8918	9	0.30078	T	0.28	-38.8408	10.1702	0.42904	0.1519:0.0:0.8481:0.0	.	335	Q6DWJ6	GP139_HUMAN	M	335	.	ENSP00000370779:I335M	I	-	3	3	GPR139	19950615	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.650000	0.54424	1.357000	0.45904	0.655000	0.94253	ATC	GPR139	-	NULL	ENSG00000180269		0.443	GPR139-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR139	HGNC	protein_coding	OTTHUMT00000438522.1	82	0.00	0	G	NM_001002911		20043114	20043114	-1	no_errors	ENST00000570682	ensembl	human	known	69_37n	missense	219	13.78	35	SNP	1.000	C
GPRASP1	9737	genome.wustl.edu	37	X	101912816	101912816	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:101912816C>T	ENST00000361600.5	+	5	4776	c.3975C>T	c.(3973-3975)ctC>ctT	p.L1325L	GPRASP1_ENST00000415986.1_Silent_p.L1325L|RP4-769N13.7_ENST00000602441.1_RNA|GPRASP1_ENST00000444152.1_Silent_p.L1325L|GPRASP1_ENST00000537097.1_Silent_p.L1325L	NM_014710.4	NP_055525.3	Q5JY77	GASP1_HUMAN	G protein-coupled receptor associated sorting protein 1	1325	OPRD1-binding.				endosome to lysosome transport (GO:0008333)|G-protein coupled receptor catabolic process (GO:1990172)	cytoplasm (GO:0005737)				NS(1)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(10)|lung(29)|ovary(2)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	60						TTATAGGCCTCTTTAACAGGG	0.328																																						dbGAP											0													68.0	67.0	67.0					X																	101912816		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AB007903	CCDS35352.1	Xq22.1	2014-03-21			ENSG00000198932	ENSG00000198932		"""Armadillo repeat containing"""	24834	protein-coding gene	gene with protein product		300417				9455477, 15086532, 16221301	Standard	NM_014710		Approved	GASP, GASP1	uc010nod.3	Q5JY77	OTTHUMG00000022061	ENST00000361600.5:c.3975C>T	X.37:g.101912816C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43168|Q96LA1	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.L1325	ENST00000361600.5	37	c.3975	CCDS35352.1	X																																																																																			GPRASP1	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000198932		0.328	GPRASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP1	HGNC	protein_coding	OTTHUMT00000057634.2	103	0.00	0	C	NM_014710		101912816	101912816	+1	no_errors	ENST00000361600	ensembl	human	known	69_37n	silent	92	16.36	18	SNP	0.000	T
GRIK1	2897	genome.wustl.edu	37	21	30909633	30909633	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr21:30909633G>C	ENST00000389125.3	-	16	2760	c.2636C>G	c.(2635-2637)tCa>tGa	p.S879*	GRIK1_ENST00000327783.4_Nonsense_Mutation_p.S923*|GRIK1_ENST00000535441.1_Nonsense_Mutation_p.S896*|GRIK1_ENST00000399913.1_Nonsense_Mutation_p.S894*|GRIK1_ENST00000399914.1_Nonsense_Mutation_p.S908*	NM_175611.2	NP_783300.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	0					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	CTTAGTTCTTGACTTTTTCTT	0.408																																						dbGAP											0													79.0	75.0	76.0					21																	30909633		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000389125.3:c.2636C>G	21.37:g.30909633G>C	ENSP00000373777:p.Ser879*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13001|Q86SU9	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S896*	ENST00000389125.3	37	c.2687	CCDS33530.1	21	.	.	.	.	.	.	.	.	.	.	G	37	6.199732	0.97371	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441	.	.	.	4.55	4.55	0.56014	.	0.958944	0.08631	N	0.917003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	18.2125	0.89874	0.0:0.0:1.0:0.0	.	.	.	.	X	923;879;894;908;896	.	ENSP00000327687:S923X	S	-	2	0	GRIK1	29831504	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.585000	0.74062	2.821000	0.97095	0.484000	0.47621	TCA	GRIK1	-	NULL	ENSG00000171189		0.408	GRIK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GRIK1	HGNC	protein_coding	OTTHUMT00000171978.1	183	0.00	0	G			30909633	30909633	-1	no_errors	ENST00000535441	ensembl	human	known	69_37n	nonsense	101	21.71	28	SNP	1.000	C
HDAC5	10014	genome.wustl.edu	37	17	42164964	42164964	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:42164964C>T	ENST00000393622.2	-	13	2031	c.1700G>A	c.(1699-1701)gGa>gAa	p.G567E	HDAC5_ENST00000586802.1_Missense_Mutation_p.G567E|HDAC5_ENST00000336057.5_Missense_Mutation_p.G567E|HDAC5_ENST00000225983.6_Missense_Mutation_p.G568E	NM_001015053.1|NM_005474.4	NP_001015053.1|NP_005465.2	Q9UQL6	HDAC5_HUMAN	histone deacetylase 5	567					B cell activation (GO:0042113)|B cell differentiation (GO:0030183)|cellular response to insulin stimulus (GO:0032869)|chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|chromatin silencing (GO:0006342)|heart development (GO:0007507)|histone deacetylation (GO:0016575)|inflammatory response (GO:0006954)|multicellular organismal response to stress (GO:0033555)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|osteoblast development (GO:0002076)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of gene expression, epigenetic (GO:0040029)|regulation of myotube differentiation (GO:0010830)|regulation of protein binding (GO:0043393)|regulation of skeletal muscle fiber development (GO:0048742)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|histone deacetylase complex (GO:0000118)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter binding (GO:0001047)|histone deacetylase activity (GO:0004407)|metal ion binding (GO:0046872)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein kinase C binding (GO:0005080)|repressing transcription factor binding (GO:0070491)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)|ovary(1)|prostate(2)|skin(1)	21		Breast(137;0.00637)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.118)		GGTCAGGGCTCCCTCCCCCAG	0.647																																						dbGAP											0													96.0	94.0	95.0					17																	42164964		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF249731	CCDS32663.1, CCDS45696.1	17q21	2008-07-18					3.5.1.98		14068	protein-coding gene	gene with protein product		605315				10220385, 9610721	Standard	XM_005256905		Approved	KIAA0600, NY-CO-9, FLJ90614	uc002iff.1	Q9UQL6		ENST00000393622.2:c.1700G>A	17.37:g.42164964C>T	ENSP00000377244:p.Gly567Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JFV9|O60340|O60528|Q96DY4	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Hist_deacetylase_Gln_rich_N,pirsf_Histone_deAcase_II_euk,prints_His_deacetylse	p.G568E	ENST00000393622.2	37	c.1703	CCDS45696.1	17	.	.	.	.	.	.	.	.	.	.	C	4.882	0.163900	0.09287	.	.	ENSG00000108840	ENST00000225983;ENST00000393622;ENST00000336057	T;T;T	0.06371	3.31;3.31;3.31	4.21	2.18	0.27775	.	0.452488	0.20978	N	0.082278	T	0.03871	0.0109	L	0.28556	0.865	0.28889	N	0.893977	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.0;0.001;0.0	T	0.44221	-0.9342	10	0.06365	T	0.9	-3.2849	7.4112	0.27019	0.1668:0.7422:0.0:0.0911	.	567;567;568;567	Q9UQL6-2;B4DGT4;Q9UQL6-3;Q9UQL6	.;.;.;HDAC5_HUMAN	E	568;567;567	ENSP00000225983:G568E;ENSP00000377244:G567E;ENSP00000337290:G567E	ENSP00000225983:G568E	G	-	2	0	HDAC5	39520490	0.000000	0.05858	0.195000	0.23364	0.086000	0.17979	0.654000	0.24918	0.414000	0.25790	-0.500000	0.04577	GGA	HDAC5	-	pirsf_Histone_deAcase_II_euk	ENSG00000108840		0.647	HDAC5-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC5	HGNC	protein_coding	OTTHUMT00000457686.1	38	0.00	0	C	NM_001015053		42164964	42164964	-1	no_errors	ENST00000225983	ensembl	human	known	69_37n	missense	76	35.59	42	SNP	0.630	T
HECW1	23072	genome.wustl.edu	37	7	43532742	43532742	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:43532742G>A	ENST00000395891.2	+	19	4005	c.3400G>A	c.(3400-3402)Gag>Aag	p.E1134K	HECW1_ENST00000453890.1_Missense_Mutation_p.E1100K	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1134					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						AATGCTGCAAGAGCGTCAGCC	0.483																																						dbGAP											0													83.0	80.0	81.0					7																	43532742		1966	4160	6126	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.3400G>A	7.37:g.43532742G>A	ENSP00000379228:p.Glu1134Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.E1134K	ENST00000395891.2	37	c.3400	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	36	5.625449	0.96671	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.85258	-1.96;-1.96	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	D	0.90783	0.7106	L	0.52573	1.65	0.80722	D	1	D;D	0.71674	0.998;0.995	D;D	0.77004	0.989;0.936	D	0.91049	0.4877	10	0.72032	D	0.01	.	19.406	0.94647	0.0:0.0:1.0:0.0	.	1100;1134	B4DH42;Q76N89	.;HECW1_HUMAN	K	1134;1100;1134	ENSP00000379228:E1134K;ENSP00000407774:E1100K	ENSP00000265522:E1134K	E	+	1	0	HECW1	43499267	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.400000	0.97290	2.679000	0.91253	0.655000	0.94253	GAG	HECW1	-	NULL	ENSG00000002746		0.483	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	95	0.00	0	G	NM_015052		43532742	43532742	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	230	19.86	57	SNP	1.000	A
HIST2H2AC	8338	genome.wustl.edu	37	1	149858776	149858776	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:149858776C>G	ENST00000331380.2	+	1	252	c.252C>G	c.(250-252)ctC>ctG	p.L84L	HIST2H2BE_ENST00000369155.2_5'Flank|BOLA1_ENST00000369153.2_5'Flank	NM_003517.2	NP_003508.1	Q16777	H2A2C_HUMAN	histone cluster 2, H2ac	84						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|breast(3)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|ovary(1)|skin(1)	20	Breast(34;0.0124)|all_hematologic(923;0.127)		STAD - Stomach adenocarcinoma(528;0.133)|LUSC - Lung squamous cell carcinoma(543;0.221)			CTCGTCACCTCCAGCTGGCCA	0.622																																						dbGAP											0													54.0	57.0	56.0					1																	149858776		2202	4287	6489	-	-	-	SO:0001819	synonymous_variant	0			AY131973	CCDS937.1	1q21.2	2011-01-27	2006-10-11	2003-02-21	ENSG00000184260	ENSG00000184260		"""Histones / Replication-dependent"""	4738	protein-coding gene	gene with protein product		602797	"""H2A histone family, member Q"", ""histone 2, H2ac"""	H2A, H2AFQ		1469070, 9439656, 12408966	Standard	NM_003517		Approved	H2A/q	uc001etd.3	Q16777	OTTHUMG00000035825	ENST00000331380.2:c.252C>G	1.37:g.149858776C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DRA7|Q8IUE5	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.L84	ENST00000331380.2	37	c.252	CCDS937.1	1																																																																																			HIST2H2AC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184260		0.622	HIST2H2AC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H2AC	HGNC	protein_coding	OTTHUMT00000087128.1	48	0.00	0	C	NM_003517		149858776	149858776	+1	no_errors	ENST00000331380	ensembl	human	known	69_37n	silent	184	17.41	39	SNP	1.000	G
HMGA2	8091	genome.wustl.edu	37	12	66308905	66308905	+	Intron	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:66308905C>T	ENST00000403681.2	+	4	1389				HMGA2_ENST00000541363.1_Intron|HMGA2_ENST00000536545.1_3'UTR|HMGA2_ENST00000354636.3_Missense_Mutation_p.H106Y|AC090673.2_ENST00000601398.1_Intron|HMGA2_ENST00000393577.3_Intron	NM_003483.4	NP_003474.1	P52926	HMGA2_HUMAN	high mobility group AT-hook 2						adrenal gland development (GO:0030325)|base-excision repair (GO:0006284)|cell proliferation in forebrain (GO:0021846)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|chromatin organization (GO:0006325)|chromosome breakage (GO:0031052)|chromosome condensation (GO:0030261)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA damage response, detection of DNA damage (GO:0042769)|endodermal cell differentiation (GO:0035987)|epithelial to mesenchymal transition (GO:0001837)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|heterochromatin assembly (GO:0031507)|histone H2A-S139 phosphorylation (GO:0035978)|male gonad development (GO:0008584)|mesenchymal cell differentiation (GO:0048762)|mesodermal cell differentiation (GO:0048333)|mesodermal-endodermal cell signaling (GO:0003131)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|multicellular organismal development (GO:0007275)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of apoptotic process (GO:0043066)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of DNA binding (GO:0043392)|negative regulation of double-strand break repair via nonhomologous end joining (GO:2001033)|negative regulation of intracellular steroid hormone receptor signaling pathway (GO:0033144)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|oncogene-induced cell senescence (GO:0090402)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of cellular response to X-ray (GO:2000685)|positive regulation of cellular senescence (GO:2000774)|positive regulation of gene expression (GO:0010628)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell cycle process (GO:0010564)|regulation of cellular response to drug (GO:2001038)|regulation of growth hormone secretion (GO:0060123)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|response to virus (GO:0009615)|senescence-associated heterochromatin focus assembly (GO:0035986)|signal transduction (GO:0007165)|somatic stem cell maintenance (GO:0035019)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)	nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|senescence-associated heterochromatin focus (GO:0035985)|SMAD protein complex (GO:0071141)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|AT DNA binding (GO:0003680)|C2H2 zinc finger domain binding (GO:0070742)|cAMP response element binding (GO:0035497)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|DNA-dependent protein kinase activity (GO:0004677)|MH1 domain binding (GO:0035501)|MH2 domain binding (GO:0035500)|nucleosomal DNA binding (GO:0031492)|regulatory region DNA binding (GO:0000975)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		HMGA2/RAD51B(11)|HMGA2/CCNB1IP1(2)|HMGA2/WIF1_ENST00000286574(14)|HMGA2/ALDH2_ENST00000261733(2)|HMGA2/EBF1(2)|HMGA2/LHFP(2)|HMGA2/NFIB_ENST00000397581(8)|HMGA2/LPP(161)|HMGA2/FHIT_ENST00000476844(4)|HMGA2/COX6C(2)	lung(2)	2	all_cancers(1;5.78e-46)		GBM - Glioblastoma multiforme(1;0.00179)|LUSC - Lung squamous cell carcinoma(43;0.156)	GBM - Glioblastoma multiforme(28;0.0386)		CAAAAGGAGTCACTGAATTGT	0.438			T	""" LHFP, RAD51L1, LPP, COX6C, CMKOR1, NFIB, ALDH2, CCNB1IP1, EBF1, WIF1, FHIT"""	"""lipoma, leiomyoma, pleiomorphic salivary gland adenoma"""																																	dbGAP		Dom	yes		12	12q15	8091	high mobility group AT-hook 2 (HMGIC)		M	0													134.0	123.0	126.0					12																	66308905		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U28754	CCDS31854.1, CCDS44936.1, CCDS73491.1, CCDS73492.1	12q15	2011-07-01	2002-07-25	2002-07-26	ENSG00000149948	ENSG00000149948		"""High-mobility group / Canonical"""	5009	protein-coding gene	gene with protein product		600698	"""high-mobility group (nonhistone chromosomal) protein isoform I-C"""	HMGIC		8824803, 9003504	Standard	XM_006719620		Approved	BABL, LIPO	uc001ssx.3	P52926	OTTHUMG00000168936	ENST00000403681.2:c.250-36258C>T	12.37:g.66308905C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EP85|E7EWA2|Q1M182|Q1M185|Q1M186|Q1M187|Q1M188	Missense_Mutation	SNP	pfam_AT_hook_DNA-bd_motif,smart_AT_hook_DNA-bd_motif,prints_HMGI/HMGY,prints_AT_hook-like	p.H106Y	ENST00000403681.2	37	c.316	CCDS44936.1	12	.	.	.	.	.	.	.	.	.	.	C	5.955	0.360183	0.11296	.	.	ENSG00000149948	ENST00000354636	.	.	.	3.43	2.52	0.30459	.	.	.	.	.	T	0.27169	0.0666	.	.	.	0.09310	N	0.999997	B	0.27882	0.192	B	0.28011	0.085	T	0.17899	-1.0354	6	.	.	.	.	8.7489	0.34602	0.0:0.7672:0.2328:0.0	.	106	Q1M182	.	Y	106	.	.	H	+	1	0	HMGA2	64595172	0.000000	0.05858	0.019000	0.16419	0.028000	0.11728	0.142000	0.16096	1.012000	0.39366	0.462000	0.41574	CAC	HMGA2	-	NULL	ENSG00000149948		0.438	HMGA2-001	KNOWN	basic|CCDS	protein_coding	HMGA2	HGNC	protein_coding	OTTHUMT00000401654.1	143	0.00	0	C	NM_003483		66308905	66308905	+1	no_errors	ENST00000354636	ensembl	human	known	69_37n	missense	133	23.56	41	SNP	0.021	T
HNF1A	6927	genome.wustl.edu	37	12	121426669	121426669	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:121426669G>T	ENST00000257555.6	+	2	586	c.360G>T	c.(358-360)aaG>aaT	p.K120N	HNF1A_ENST00000402929.1_Missense_Mutation_p.K120N|HNF1A_ENST00000400024.2_Missense_Mutation_p.K120N|HNF1A_ENST00000541395.1_Missense_Mutation_p.K120N|HNF1A_ENST00000543427.1_Missense_Mutation_p.K3N|HNF1A_ENST00000538626.1_Intron|HNF1A_ENST00000544413.1_Missense_Mutation_p.K120N			P20823	HNF1A_HUMAN	HNF1 homeobox A	120					glucose homeostasis (GO:0042593)|glucose import (GO:0046323)|insulin secretion (GO:0030073)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|renal glucose absorption (GO:0035623)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(8)|large_intestine(19)|liver(175)|lung(9)|ovary(2)|prostate(1)|urinary_tract(1)	221	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					AGATGGTCAAGTCCTACCTGC	0.627									Hepatic Adenoma, Familial Clustering of																													dbGAP											0													149.0	115.0	126.0					12																	121426669		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl. Maturity-Onset Diabetes of the Young type 3, MODY3	M57732	CCDS9209.1	12q24.31	2014-09-17	2007-08-24	2007-08-24	ENSG00000135100	ENSG00000135100		"""Homeoboxes / HNF class"""	11621	protein-coding gene	gene with protein product		142410	"""transcription factor 1, hepatic; LF-B1, hepatic nuclear factor (HNF1), albumin proximal factor"""	MODY3, TCF1		1535333, 7795649	Standard	NM_000545		Approved	HNF1, LFB1	uc001tzg.3	P20823	OTTHUMG00000151015	ENST00000257555.6:c.360G>T	12.37:g.121426669G>T	ENSP00000257555:p.Lys120Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z2R8|E0YMJ5|E0YMK0|E0YMK1|E2I9R4|E2I9R5|F5H5U3|Q2M3H2|Q99861	Missense_Mutation	SNP	pfam_HNF1b_C,pfam_HNF-1_N,pfam_HNF1a_C,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_HNF1_dimer_dom,smart_Homeodomain,pfscan_Homeodomain	p.K120N	ENST00000257555.6	37	c.360	CCDS9209.1	12	.	.	.	.	.	.	.	.	.	.	G	18.33	3.600503	0.66332	.	.	ENSG00000135100	ENST00000257555;ENST00000535125;ENST00000543536;ENST00000544680;ENST00000537424;ENST00000543027;ENST00000543427;ENST00000545458;ENST00000541395;ENST00000340577;ENST00000344370;ENST00000544413	D;D;D;D	0.99329	-5.75;-5.75;-5.75;-5.75	5.08	1.12	0.20585	Hepatocyte nuclear factor 1, N-terminal (1);Lambda repressor-like, DNA-binding (2);	0.000000	0.64402	D	0.000001	D	0.98927	0.9636	L	0.58669	1.825	0.58432	D	0.99999	D;D;D;D	0.89917	1.0;1.0;1.0;0.999	D;D;D;D	0.97110	1.0;0.997;1.0;0.995	D	0.98572	1.0646	10	0.87932	D	0	-33.3324	9.9434	0.41593	0.3668:0.0:0.6332:0.0	.	120;120;120;120	F5H0K0;P20823;E7EUQ4;E7EMR0	.;HNF1A_HUMAN;.;.	N	120;120;120;120;120;120;3;120;120;120;120;120	ENSP00000257555:K120N;ENSP00000439721:K3N;ENSP00000443112:K120N;ENSP00000438804:K120N	ENSP00000257555:K120N	K	+	3	2	HNF1A	119911052	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.255000	0.32909	0.175000	0.19841	0.530000	0.56133	AAG	HNF1A	-	pfam_HNF-1_N,superfamily_Lambda_DNA-bd_dom	ENSG00000135100		0.627	HNF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF1A	HGNC	protein_coding	OTTHUMT00000320957.5	34	0.00	0	G	NM_000545		121426669	121426669	+1	no_errors	ENST00000257555	ensembl	human	known	69_37n	missense	116	28.83	47	SNP	1.000	T
HPS3	84343	genome.wustl.edu	37	3	148858903	148858903	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:148858903C>G	ENST00000296051.2	+	3	952	c.812C>G	c.(811-813)tCt>tGt	p.S271C	HPS3_ENST00000460120.1_Missense_Mutation_p.S106C	NM_032383.3	NP_115759.2	Q969F9	HPS3_HUMAN	Hermansky-Pudlak syndrome 3	271					organelle organization (GO:0006996)|pigmentation (GO:0043473)	BLOC-2 complex (GO:0031084)				breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(12)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	34			LUSC - Lung squamous cell carcinoma(72;0.0473)|Lung(72;0.0607)			TCTGGATTATCTGTTACACTG	0.383									Hermansky-Pudlak syndrome																													dbGAP											0													81.0	87.0	85.0					3																	148858903		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	HPS, HPS1-8	AY033141	CCDS3140.1	3q24	2014-06-18			ENSG00000163755	ENSG00000163755			15597	protein-coding gene	gene with protein product		606118				11455388	Standard	NM_032383		Approved	SUTAL	uc003ewu.1	Q969F9	OTTHUMG00000159548	ENST00000296051.2:c.812C>G	3.37:g.148858903C>G	ENSP00000296051:p.Ser271Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G6|Q8WTV6|Q96AP1|Q96MR3|Q9H608	Missense_Mutation	SNP	pirsf_BLOC-2_complex_Hps3_subunit	p.S271C	ENST00000296051.2	37	c.812	CCDS3140.1	3	.	.	.	.	.	.	.	.	.	.	C	16.25	3.069080	0.55539	.	.	ENSG00000163755	ENST00000296051;ENST00000460120	T;T	0.63744	-0.06;-0.06	5.69	3.87	0.44632	.	0.552015	0.20602	N	0.089121	T	0.73590	0.3606	M	0.65975	2.015	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.69654	0.965;0.936	T	0.63915	-0.6529	10	0.54805	T	0.06	-5.208	9.786	0.40677	0.0:0.7867:0.1396:0.0737	.	106;271	G5E9V4;Q969F9	.;HPS3_HUMAN	C	271;106	ENSP00000296051:S271C;ENSP00000418230:S106C	ENSP00000296051:S271C	S	+	2	0	HPS3	150341593	0.007000	0.16637	0.039000	0.18376	0.948000	0.59901	1.195000	0.32186	0.738000	0.32606	0.563000	0.77884	TCT	HPS3	-	pirsf_BLOC-2_complex_Hps3_subunit	ENSG00000163755		0.383	HPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HPS3	HGNC	protein_coding	OTTHUMT00000356151.1	203	0.00	0	C	NM_032383		148858903	148858903	+1	no_errors	ENST00000296051	ensembl	human	known	69_37n	missense	145	27.14	54	SNP	0.108	G
HSF5	124535	genome.wustl.edu	37	17	56540556	56540556	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:56540556G>A	ENST00000323777.3	-	4	1238	c.1129C>T	c.(1129-1131)Cag>Tag	p.Q377*		NM_001080439.1	NP_001073908.1	Q4G112	HSF5_HUMAN	heat shock transcription factor family member 5	377					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(7)|ovary(3)|skin(1)	16	Medulloblastoma(34;0.127)|all_neural(34;0.237)					TCAACTATCTGAAAGACAGCC	0.443																																						dbGAP											0													99.0	94.0	96.0					17																	56540556		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC033020	CCDS32690.1	17q23.2	2006-04-25				ENSG00000176160			26862	protein-coding gene	gene with protein product							Standard	NM_001080439		Approved	FLJ40311	uc002iwi.1	Q4G112		ENST00000323777.3:c.1129C>T	17.37:g.56540556G>A	ENSP00000313243:p.Gln377*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08EH7|Q8N7V2	Nonsense_Mutation	SNP	pfam_HSF_DNA-bd,smart_HSF_DNA-bd	p.Q377*	ENST00000323777.3	37	c.1129	CCDS32690.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.754346	0.96890	.	.	ENSG00000176160	ENST00000412540;ENST00000323777	.	.	.	5.47	5.47	0.80525	.	0.334636	0.25987	N	0.027023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	16.0593	0.80830	0.0:0.0:1.0:0.0	.	.	.	.	X	277;377	.	ENSP00000313243:Q377X	Q	-	1	0	HSF5	53895555	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.434000	0.59935	2.563000	0.86464	0.650000	0.86243	CAG	HSF5	-	NULL	ENSG00000176160		0.443	HSF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSF5	HGNC	protein_coding	OTTHUMT00000444719.1	79	0.00	0	G	XM_064190		56540556	56540556	-1	no_errors	ENST00000323777	ensembl	human	known	69_37n	nonsense	96	19.33	23	SNP	1.000	A
HSPH1	10808	genome.wustl.edu	37	13	31719870	31719870	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr13:31719870C>G	ENST00000320027.5	-	11	1758	c.1414G>C	c.(1414-1416)Gat>Cat	p.D472H	HSPH1_ENST00000429785.2_Missense_Mutation_p.D291H|HSPH1_ENST00000380406.5_Missense_Mutation_p.D431H|HSPH1_ENST00000380405.4_Missense_Mutation_p.D472H|HSPH1_ENST00000445273.2_Missense_Mutation_p.D474H	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	472					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		TTTTCTCCATCTTTCTGTGCA	0.378																																						dbGAP											0													124.0	100.0	108.0					13																	31719870		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.1414G>C	13.37:g.31719870C>G	ENSP00000318687:p.Asp472His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.D474H	ENST00000320027.5	37	c.1420	CCDS9340.1	13	.	.	.	.	.	.	.	.	.	.	C	12.86	2.063171	0.36373	.	.	ENSG00000120694	ENST00000320027;ENST00000380405;ENST00000380406;ENST00000445273;ENST00000429785;ENST00000438061	T;T;T;T;T	0.01043	5.41;5.41;5.41;5.41;5.41	5.35	5.35	0.76521	.	0.056027	0.64402	D	0.000001	T	0.04182	0.0116	L	0.42632	1.34	0.50313	D	0.999862	D;D;D;D;D	0.76494	0.998;0.993;0.998;0.999;0.998	D;D;D;D;D	0.73708	0.981;0.919;0.973;0.972;0.973	T	0.48445	-0.9035	10	0.72032	D	0.01	-29.8839	13.7031	0.62622	0.0:0.926:0.0:0.074	.	291;431;474;472;472	B4DY72;Q92598-3;B4DYH1;Q92598-2;Q92598	.;.;.;.;HS105_HUMAN	H	472;472;431;474;291;523	ENSP00000318687:D472H;ENSP00000369768:D472H;ENSP00000369769:D431H;ENSP00000396090:D474H;ENSP00000388778:D291H	ENSP00000318687:D472H	D	-	1	0	HSPH1	30617870	1.000000	0.71417	1.000000	0.80357	0.004000	0.04260	2.085000	0.41634	2.648000	0.89879	0.655000	0.94253	GAT	HSPH1	-	pfam_Hsp_70_fam	ENSG00000120694		0.378	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1	121	0.00	0	C			31719870	31719870	-1	no_errors	ENST00000445273	ensembl	human	known	69_37n	missense	146	25.00	49	SNP	0.998	G
HYDIN	54768	genome.wustl.edu	37	16	70852401	70852401	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:70852401G>A	ENST00000393567.2	-	84	14652	c.14502C>T	c.(14500-14502)atC>atT	p.I4834I		NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	4834					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TGGTTTTGATGATGCCTGAAG	0.522																																						dbGAP											0													23.0	21.0	21.0					16																	70852401		1844	4045	5889	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.14502C>T	16.37:g.70852401G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.I4833	ENST00000393567.2	37	c.14499	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.522	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	48	0.00	0	G			70852401	70852401	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	76	26.92	28	SNP	0.674	A
ICMT	23463	genome.wustl.edu	37	1	6292039	6292039	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:6292039G>C	ENST00000343813.5	-	4	623	c.595C>G	c.(595-597)Ctg>Gtg	p.L199V		NM_012405.3	NP_036537.1	O60725	ICMT_HUMAN	isoprenylcysteine carboxyl methyltransferase	199					C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|multicellular organism growth (GO:0035264)|positive regulation of cell proliferation (GO:0008284)|protein targeting to membrane (GO:0006612)|regulation of Ras protein signal transduction (GO:0046578)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cAMP response element binding protein binding (GO:0008140)|protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|protein C-terminal S-isoprenylcysteine carboxyl O-methyltransferase activity (GO:0004671)			NS(1)|endometrium(2)	3	Ovarian(185;0.0634)	all_cancers(23;5.85e-39)|all_epithelial(116;2.4e-22)|all_lung(118;2.65e-08)|Lung NSC(185;6.45e-07)|all_neural(13;3.18e-06)|all_hematologic(16;8.99e-06)|Acute lymphoblastic leukemia(12;0.000365)|Breast(487;0.000688)|Renal(390;0.0007)|Colorectal(325;0.00104)|Glioma(11;0.00203)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)|Medulloblastoma(700;0.211)		Epithelial(90;5.52e-38)|GBM - Glioblastoma multiforme(13;6.51e-32)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;7.08e-08)|COAD - Colon adenocarcinoma(227;8.35e-06)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.182)		CTGGTCACCAGAGTATGTGTA	0.453																																						dbGAP											0													140.0	123.0	129.0					1																	6292039		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF064084	CCDS61.1	1p36	2010-04-29			ENSG00000116237	ENSG00000116237	2.1.1.100		5350	protein-coding gene	gene with protein product	"""protein-S-isoprenylcysteine O-methyltransferase"""	605851				9614111, 10441503	Standard	XM_005263437		Approved	PCCMT, HSTE14, PPMT	uc001amk.3	O60725	OTTHUMG00000001254	ENST00000343813.5:c.595C>G	1.37:g.6292039G>C	ENSP00000343552:p.Leu199Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHT0	Missense_Mutation	SNP	pfam_ICMT_MeTrfase	p.L199V	ENST00000343813.5	37	c.595	CCDS61.1	1	.	.	.	.	.	.	.	.	.	.	G	20.7	4.033794	0.75504	.	.	ENSG00000116237	ENST00000343813;ENST00000535068	.	.	.	6.07	4.2	0.49525	.	0.000000	0.85682	D	0.000000	T	0.81541	0.4844	H	0.94462	3.54	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.83078	-0.0139	9	0.72032	D	0.01	.	6.3805	0.21531	0.3068:0.0:0.6932:0.0	.	199	O60725	ICMT_HUMAN	V	199;103	.	ENSP00000343552:L199V	L	-	1	2	ICMT	6214626	1.000000	0.71417	0.985000	0.45067	0.985000	0.73830	3.807000	0.55591	1.577000	0.49804	0.655000	0.94253	CTG	ICMT	-	pfam_ICMT_MeTrfase	ENSG00000116237		0.453	ICMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICMT	HGNC	protein_coding	OTTHUMT00000003681.1	95	0.00	0	G	NM_012405		6292039	6292039	-1	no_errors	ENST00000343813	ensembl	human	known	69_37n	missense	186	18.78	43	SNP	0.997	C
IGKV5-2	28907	genome.wustl.edu	37	2	89196826	89196826	+	RNA	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:89196826C>G	ENST00000390244.2	+	0	79									immunoglobulin kappa variable 5-2																		GTCCCAGGTTCACCTCCTCAG	0.463																																						dbGAP											0													51.0	54.0	53.0					2																	89196826		1978	4111	6089	-	-	-			0			X02485		2p11.2	2012-02-10			ENSG00000211599	ENSG00000211599		"""Immunoglobulins / IGK locus"""	5835	other	immunoglobulin gene							Standard	NG_000834		Approved	IGKV52, B2			OTTHUMG00000151535		2.37:g.89196826C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_V-set_subgr,pfscan_Ig-like	p.H6D	ENST00000390244.2	37	c.16		2																																																																																			IGKV5-2	-	NULL	ENSG00000211599		0.463	IGKV5-2-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGKV5-2	HGNC	IG_V_gene	OTTHUMT00000323040.2	88	0.00	0	C	NG_000834		89196826	89196826	+1	no_stop_codon	ENST00000390244	ensembl	human	known	69_37n	missense	151	19.68	37	SNP	0.688	G
IL10RB	3588	genome.wustl.edu	37	21	34668591	34668591	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr21:34668591G>C	ENST00000290200.2	+	7	1015	c.907G>C	c.(907-909)Gag>Cag	p.E303Q		NM_000628.4	NP_000619.3	Q08334	I10R2_HUMAN	interleukin 10 receptor, beta	303				Missing (in Ref. 2; AAA86872). {ECO:0000305}.	cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|immune response (GO:0006955)|inflammatory response (GO:0006954)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|interleukin-28 receptor complex (GO:0032002)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	14						AGAAGACTCTGAGAGCGGCAA	0.527																																					Melanoma(67;315 1275 21667 21943 44564)	dbGAP											0													129.0	119.0	122.0					21																	34668591		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08988	CCDS13623.1	21q22.11	2014-09-17			ENSG00000243646	ENSG00000243646		"""Interleukins and interleukin receptors"", ""CD molecules"""	5965	protein-coding gene	gene with protein product		123889		CRFB4, D21S58, D21S66		8314576, 9312047	Standard	NM_000628		Approved	CRF2-4, CDW210B, IL-10R2		Q08334	OTTHUMG00000065128	ENST00000290200.2:c.907G>C	21.37:g.34668591G>C	ENSP00000290200:p.Glu303Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUU4	Missense_Mutation	SNP	pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3	p.E303Q	ENST00000290200.2	37	c.907	CCDS13623.1	21	.	.	.	.	.	.	.	.	.	.	G	10.99	1.507520	0.27036	.	.	ENSG00000243646	ENST00000290200;ENST00000539894	T	0.41400	1.0	4.04	2.1	0.27182	.	3.918870	0.00772	N	0.001215	T	0.44138	0.1279	M	0.74881	2.28	0.09310	N	1	B;B	0.26975	0.165;0.165	B;B	0.26202	0.067;0.067	T	0.13469	-1.0508	10	0.19590	T	0.45	-4.5779	5.8047	0.18434	0.11:0.1958:0.6942:0.0	.	305;303	Q6ZVU9;Q08334	.;I10R2_HUMAN	Q	303	ENSP00000290200:E303Q	ENSP00000290200:E303Q	E	+	1	0	IL10RB	33590461	0.000000	0.05858	0.001000	0.08648	0.440000	0.31957	0.455000	0.21843	0.437000	0.26423	0.485000	0.47835	GAG	IL10RB	-	NULL	ENSG00000243646		0.527	IL10RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL10RB	HGNC	protein_coding	OTTHUMT00000139831.3	102	0.00	0	G			34668591	34668591	+1	no_errors	ENST00000290200	ensembl	human	known	69_37n	missense	188	10.48	22	SNP	0.001	C
ITGAV	3685	genome.wustl.edu	37	2	187487072	187487072	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:187487072G>C	ENST00000261023.3	+	3	597	c.323G>C	c.(322-324)aGa>aCa	p.R108T	ITGAV_ENST00000433736.2_Missense_Mutation_p.R62T|ITGAV_ENST00000374907.3_Missense_Mutation_p.R108T	NM_002210.3	NP_002201	P06756	ITAV_HUMAN	integrin, alpha V	108					angiogenesis (GO:0001525)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apolipoprotein A-I-mediated signaling pathway (GO:0038027)|apoptotic cell clearance (GO:0043277)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|endodermal cell differentiation (GO:0035987)|entry of symbiont into host cell by promotion of host phagocytosis (GO:0052066)|ERK1 and ERK2 cascade (GO:0070371)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|negative chemotaxis (GO:0050919)|negative regulation of entry of bacterium into host cell (GO:2000536)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of lipid storage (GO:0010888)|negative regulation of lipid transport (GO:0032369)|negative regulation of lipoprotein metabolic process (GO:0050748)|negative regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045715)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast proliferation (GO:0033690)|regulation of apoptotic cell clearance (GO:2000425)|regulation of phagocytosis (GO:0050764)|substrate adhesion-dependent cell spreading (GO:0034446)|viral entry into host cell (GO:0046718)	alphav-beta3 integrin-IGF-1-IGF1R complex (GO:0035867)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin alphav-beta3 complex (GO:0034683)|integrin alphav-beta5 complex (GO:0034684)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|lamellipodium membrane (GO:0031258)|membrane (GO:0016020)|microvillus membrane (GO:0031528)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	extracellular matrix binding (GO:0050840)|extracellular matrix protein binding (GO:1990430)|fibronectin binding (GO:0001968)|metal ion binding (GO:0046872)|protease binding (GO:0002020)|transforming growth factor beta binding (GO:0050431)|virus receptor activity (GO:0001618)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	47			OV - Ovarian serous cystadenocarcinoma(117;0.0185)|Epithelial(96;0.072)|all cancers(119;0.189)	STAD - Stomach adenocarcinoma(3;0.106)|COAD - Colon adenocarcinoma(31;0.108)	Antithymocyte globulin(DB00098)	TTAGGCAATAGAGATTATGCC	0.348																																					Melanoma(58;108 1995 6081)	dbGAP											0													107.0	106.0	107.0					2																	187487072		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2292.1, CCDS46470.1, CCDS46471.1	2q31-q32	2012-04-20	2012-04-20		ENSG00000138448	ENSG00000138448		"""CD molecules"", ""Integrins"""	6150	protein-coding gene	gene with protein product		193210	"""antigen identified by monoclonal antibody L230"", ""vitronectin receptor"", ""integrin, alpha V (vitronectin receptor, alpha polypeptide, antigen CD51)"""	VNRA, MSK8, VTNR		2454952	Standard	NM_001144999		Approved	CD51	uc002upq.4	P06756	OTTHUMG00000132635	ENST00000261023.3:c.323G>C	2.37:g.187487072G>C	ENSP00000261023:p.Arg108Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV67|B0LPF4|B7Z883|B7ZLX0|D3DPG8|E7EWZ6|Q53SK4|Q59EB7|Q6LD15	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.R108T	ENST00000261023.3	37	c.323	CCDS2292.1	2	.	.	.	.	.	.	.	.	.	.	G	16.93	3.257904	0.59321	.	.	ENSG00000138448	ENST00000544640;ENST00000261023;ENST00000374907;ENST00000433736	D;D;D	0.87650	-2.28;-2.28;-2.28	5.41	5.41	0.78517	.	0.322398	0.33753	N	0.004581	D	0.90407	0.6997	L	0.53671	1.685	0.54753	D	0.999983	B;P;B	0.47191	0.321;0.891;0.376	B;P;B	0.54759	0.136;0.76;0.179	D	0.91255	0.5032	10	0.87932	D	0	.	17.9789	0.89134	0.0:0.0:1.0:0.0	.	62;108;108	E7EWZ6;P06756-2;P06756	.;.;ITAV_HUMAN	T	108;108;108;62	ENSP00000261023:R108T;ENSP00000364042:R108T;ENSP00000404291:R62T	ENSP00000261023:R108T	R	+	2	0	ITGAV	187195317	1.000000	0.71417	0.998000	0.56505	0.943000	0.58893	6.690000	0.74567	2.548000	0.85928	0.655000	0.94253	AGA	ITGAV	-	NULL	ENSG00000138448		0.348	ITGAV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGAV	HGNC	protein_coding	OTTHUMT00000255882.2	179	0.00	0	G	NM_002210		187487072	187487072	+1	no_errors	ENST00000261023	ensembl	human	known	69_37n	missense	167	17.73	36	SNP	1.000	C
JUP	3728	genome.wustl.edu	37	17	39919445	39919445	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:39919445C>G	ENST00000393931.3	-	8	1405	c.1287G>C	c.(1285-1287)gtG>gtC	p.V429V	JUP_ENST00000540235.1_Intron|JUP_ENST00000310706.5_Silent_p.V429V|JUP_ENST00000393930.1_Silent_p.V429V	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	429					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		TGTTCTGTGTCACCAGCGTCT	0.582																																					Colon(16;42 520 6044 17852 28530)	dbGAP											0													178.0	135.0	150.0					17																	39919445		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1287G>C	17.37:g.39919445C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,prints_Beta-catenin,pfscan_Armadillo	p.V429	ENST00000393931.3	37	c.1287	CCDS11407.1	17																																																																																			JUP	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	ENSG00000173801		0.582	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257406.1	56	0.00	0	C			39919445	39919445	-1	no_errors	ENST00000310706	ensembl	human	known	69_37n	silent	208	21.21	56	SNP	1.000	G
KCNA5	3741	genome.wustl.edu	37	12	5155077	5155077	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:5155077C>T	ENST00000252321.3	+	1	1993	c.1764C>T	c.(1762-1764)gtC>gtT	p.V588V		NM_002234.3	NP_002225.2	P22460	KCNA5_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 5	588					atrial cardiac muscle cell action potential (GO:0086014)|membrane hyperpolarization (GO:0060081)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|negative regulation of potassium ion transport (GO:0043267)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of myoblast proliferation (GO:2000288)|potassium ion export (GO:0071435)|potassium ion homeostasis (GO:0055075)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of membrane potential (GO:0042391)|regulation of potassium ion transport (GO:0043266)|regulation of vasoconstriction (GO:0019229)|response to hypoxia (GO:0001666)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|intracellular canaliculus (GO:0046691)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|delayed rectifier potassium channel activity (GO:0005251)|outward rectifier potassium channel activity (GO:0015271)|potassium channel inhibitor activity (GO:0019870)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(21)|ovary(5)|prostate(2)|upper_aerodigestive_tract(2)	52					Dalfampridine(DB06637)	AGTGTAACGTCAAGGCCAAGA	0.592																																						dbGAP											0													39.0	40.0	40.0					12																	5155077		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M83254	CCDS8536.1	12p13	2012-07-05				ENSG00000130037		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6224	protein-coding gene	gene with protein product		176267				16382104	Standard	NM_002234		Approved	Kv1.5, HK2, HPCN1	uc001qni.4	P22460		ENST00000252321.3:c.1764C>T	12.37:g.5155077C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKT8|Q4VAJ1|Q4VAJ2|Q9UDA4	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,pfam_PKD1_2_channel,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.5,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.V588	ENST00000252321.3	37	c.1764	CCDS8536.1	12																																																																																			KCNA5	-	prints_K_chnl_volt-dep_Kv1.5	ENSG00000130037		0.592	KCNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA5	HGNC	protein_coding	OTTHUMT00000398925.2	12	0.00	0	C	NM_002234		5155077	5155077	+1	no_errors	ENST00000252321	ensembl	human	known	69_37n	silent	14	58.82	20	SNP	1.000	T
KIAA1033	23325	genome.wustl.edu	37	12	105557985	105557985	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:105557985G>A	ENST00000332180.5	+	31	3341	c.3254G>A	c.(3253-3255)aGa>aAa	p.R1085K	KIAA1033_ENST00000547171.1_3'UTR	NM_015275.1	NP_056090.1			KIAA1033											breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(15)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	41						AAGGAGATAAGAGCAGTTGCT	0.423																																						dbGAP											0													121.0	113.0	116.0					12																	105557985		1883	4116	5999	-	-	-	SO:0001583	missense	0			AB028956	CCDS41826.1, CCDS73514.1	12q24.11	2014-05-09				ENSG00000136051			29174	protein-coding gene	gene with protein product		615748				20376207, 20498093, 21498477	Standard	XM_005268742		Approved	SWIP	uc001tld.3	Q2M389		ENST00000332180.5:c.3254G>A	12.37:g.105557985G>A	ENSP00000328062:p.Arg1085Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R1085K	ENST00000332180.5	37	c.3254	CCDS41826.1	12	.	.	.	.	.	.	.	.	.	.	G	14.41	2.526534	0.44969	.	.	ENSG00000136051	ENST00000332180	T	0.75260	-0.92	5.93	5.93	0.95920	.	0.128536	0.64402	D	0.000001	T	0.59404	0.2191	N	0.16368	0.405	0.42105	D	0.991354	B;B	0.19706	0.038;0.038	B;B	0.18871	0.023;0.023	T	0.58115	-0.7693	10	0.02654	T	1	.	20.3539	0.98825	0.0:0.0:1.0:0.0	.	1086;1085	B7ZKT9;Q2M389	.;WASH7_HUMAN	K	1085	ENSP00000328062:R1085K	ENSP00000328062:R1085K	R	+	2	0	KIAA1033	104082115	1.000000	0.71417	0.990000	0.47175	0.977000	0.68977	4.362000	0.59467	2.826000	0.97356	0.655000	0.94253	AGA	KIAA1033	-	NULL	ENSG00000136051		0.423	KIAA1033-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1033	HGNC	protein_coding	OTTHUMT00000406138.4	152	0.00	0	G	NM_015275		105557985	105557985	+1	no_errors	ENST00000332180	ensembl	human	known	69_37n	missense	208	15.45	38	SNP	0.998	A
KIAA1731	85459	genome.wustl.edu	37	11	93431181	93431181	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:93431181G>C	ENST00000325212.6	+	15	3265	c.3103G>C	c.(3103-3105)Gac>Cac	p.D1035H	KIAA1731_ENST00000531700.1_Intron|KIAA1731_ENST00000411936.1_Missense_Mutation_p.D1035H|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	1035						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				ATGCCAATCTGACATCCCCAT	0.408																																						dbGAP											0													100.0	77.0	84.0					11																	93431181		692	1591	2283	-	-	-	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.3103G>C	11.37:g.93431181G>C	ENSP00000316681:p.Asp1035His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.D1035H	ENST00000325212.6	37	c.3103	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	G	8.638	0.895248	0.17613	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.21932	1.98;1.98	4.88	3.97	0.46021	.	0.387176	0.22241	N	0.062693	T	0.14614	0.0353	N	0.08118	0	0.33004	D	0.526616	P	0.43094	0.799	P	0.48141	0.568	T	0.04065	-1.0980	10	0.52906	T	0.07	-0.0464	8.4112	0.32644	0.103:0.0:0.897:0.0	.	1035	Q9C0D2	K1731_HUMAN	H	1035	ENSP00000316681:D1035H;ENSP00000406505:D1035H	ENSP00000316681:D1035H	D	+	1	0	KIAA1731	93070829	0.664000	0.27457	0.847000	0.33407	0.045000	0.14185	1.100000	0.31025	2.689000	0.91719	0.655000	0.94253	GAC	KIAA1731	-	NULL	ENSG00000166004		0.408	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	78	0.00	0	G	NM_033395		93431181	93431181	+1	no_errors	ENST00000411936	ensembl	human	known	69_37n	missense	112	14.50	19	SNP	0.224	C
KIFAP3	22920	genome.wustl.edu	37	1	170008430	170008430	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:170008430C>G	ENST00000361580.2	-	4	547		c.e4-1		KIFAP3_ENST00000538366.1_Splice_Site|KIFAP3_ENST00000490550.1_Splice_Site|KIFAP3_ENST00000367767.1_Splice_Site|KIFAP3_ENST00000367765.1_Splice_Site	NM_014970.3	NP_055785.2	Q92845	KIFA3_HUMAN	kinesin-associated protein 3						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|membrane organization (GO:0061024)|microtubule-based movement (GO:0007018)|microtubule-based process (GO:0007017)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|plus-end-directed vesicle transport along microtubule (GO:0072383)|positive regulation of calcium-dependent cell-cell adhesion (GO:0046587)|protein complex assembly (GO:0006461)|protein localization (GO:0008104)|signal transduction (GO:0007165)	centrosome (GO:0005813)|condensed nuclear chromosome (GO:0000794)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|microtubule cytoskeleton (GO:0015630)	kinesin binding (GO:0019894)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|prostate(2)|skin(3)|urinary_tract(2)	35	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					TCTTTTTTCTCTGTAAAAAGA	0.338																																						dbGAP											0													62.0	58.0	60.0					1																	170008430		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			U59919	CCDS1288.1, CCDS55659.1, CCDS55660.1, CCDS55661.1	1q24.2	2012-09-20			ENSG00000075945	ENSG00000075945			17060	protein-coding gene	gene with protein product	"""Smg GDS"""	601836				8900189	Standard	NM_014970		Approved	SMAP, KAP3, FLA3, KAP-1	uc001ggv.3	Q92845	OTTHUMG00000035947	ENST00000361580.2:c.320-1G>C	1.37:g.170008430C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKU4|B1AKU5|B2RDL1|B7Z8A3|F5H591|Q8NHU7|Q9H416	Splice_Site	SNP	-	e4-1	ENST00000361580.2	37	c.320-1	CCDS1288.1	1	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584117	0.65992	.	.	ENSG00000075945	ENST00000361580;ENST00000367765;ENST00000367767;ENST00000538366	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6476	0.91416	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	KIFAP3	168275054	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	3.890000	0.56220	2.821000	0.97095	0.650000	0.86243	.	KIFAP3	-	-	ENSG00000075945		0.338	KIFAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFAP3	HGNC	protein_coding	OTTHUMT00000087568.1	247	0.00	0	C	NM_014970	Intron	170008430	170008430	-1	no_errors	ENST00000361580	ensembl	human	known	69_37n	splice_site	161	18.50	37	SNP	1.000	G
KRIT1	889	genome.wustl.edu	37	7	91855841	91855841	+	Splice_Site	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:91855841C>G	ENST00000340022.2	-	11	2163	c.1145G>C	c.(1144-1146)aGa>aCa	p.R382T	KRIT1_ENST00000394505.2_Splice_Site_p.R382T|KRIT1_ENST00000412043.2_Splice_Site_p.R382T|KRIT1_ENST00000394507.1_Splice_Site_p.R382T|KRIT1_ENST00000394503.2_Splice_Site_p.R334T	NM_004912.3|NM_194455.1	NP_004903.2|NP_919437.1	O00522	KRIT1_HUMAN	KRIT1, ankyrin repeat containing	382					angiogenesis (GO:0001525)|cell redox homeostasis (GO:0045454)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|positive regulation of protein binding (GO:0032092)|regulation of catalytic activity (GO:0050790)|regulation of establishment of cell polarity (GO:2000114)|small GTPase mediated signal transduction (GO:0007264)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|microtubule (GO:0005874)|plasma membrane (GO:0005886)	microtubule binding (GO:0008017)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)|small GTPase regulator activity (GO:0005083)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(2)|stomach(1)	22	all_cancers(62;1.04e-09)|all_epithelial(64;5.75e-09)|Breast(17;0.00206)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			ATAACTTACTCTATCCGTTTC	0.333																																						dbGAP											0													87.0	89.0	88.0					7																	91855841		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ294850	CCDS5624.1, CCDS34679.1	7q21.2	2014-09-17	2005-03-15	2005-03-17	ENSG00000001631	ENSG00000001631		"""Ankyrin repeat domain containing"""	1573	protein-coding gene	gene with protein product		604214	"""cerebral cavernous malformations 1"""	CCM1		7604043, 11342228	Standard	NM_194455		Approved	CAM	uc003ulu.1	O00522	OTTHUMG00000131187	ENST00000340022.2:c.1146+1G>C	7.37:g.91855841C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNU0|O43894|Q506L6|Q6U276|Q75N19|Q9H180|Q9H264|Q9HAX5	Missense_Mutation	SNP	pfam_FERM_central,superfamily_Ankyrin_rpt-contain_dom,superfamily_FERM_central,smart_Ankyrin_rpt,smart_Band_41_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_FERM_domain	p.R382T	ENST00000340022.2	37	c.1145	CCDS5624.1	7	.	.	.	.	.	.	.	.	.	.	C	18.52	3.641463	0.67244	.	.	ENSG00000001631	ENST00000394507;ENST00000340022;ENST00000412043;ENST00000394505;ENST00000394503;ENST00000415227;ENST00000445516	T;T;T;T;T;D	0.81908	-0.24;-0.24;-0.24;-0.24;1.44;-1.55	5.66	5.66	0.87406	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.88548	0.6466	L	0.51422	1.61	0.80722	D	1	D;D;D	0.89917	0.994;1.0;0.987	D;D;D	0.87578	0.985;0.998;0.942	D	0.84009	0.0347	10	0.16896	T	0.51	-8.0696	19.7529	0.96275	0.0:1.0:0.0:0.0	.	382;334;382	A4D1F7;A6NNU0;O00522	.;.;KRIT1_HUMAN	T	382;382;382;382;334;382;144	ENSP00000378015:R382T;ENSP00000344668:R382T;ENSP00000410909:R382T;ENSP00000378013:R382T;ENSP00000378011:R334T;ENSP00000404084:R144T	ENSP00000344668:R382T	R	-	2	0	KRIT1	91693777	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	7.601000	0.82783	2.668000	0.90789	0.460000	0.39030	AGA	KRIT1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000001631		0.333	KRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRIT1	HGNC	protein_coding	OTTHUMT00000253910.1	186	0.00	0	C		Missense_Mutation	91855841	91855841	-1	no_errors	ENST00000340022	ensembl	human	known	69_37n	missense	170	22.02	48	SNP	1.000	G
KRT72	140807	genome.wustl.edu	37	12	52992731	52992731	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:52992731C>T	ENST00000537672.2	-	2	602	c.592G>A	c.(592-594)Gat>Aat	p.D198N	KRT72_ENST00000398066.3_Missense_Mutation_p.D10N|KRT72_ENST00000354310.4_Missense_Mutation_p.D198N|RP11-641A6.2_ENST00000551089.1_RNA|KRT72_ENST00000293745.2_Missense_Mutation_p.D198N	NM_001146225.1	NP_001139697.1	Q14CN4	K2C72_HUMAN	keratin 72	198	Coil 1B.|Rod.					extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)	36				BRCA - Breast invasive adenocarcinoma(357;0.195)		AGCTCCGAATCCAGCCTCACC	0.532																																						dbGAP											0													201.0	181.0	188.0					12																	52992731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY033495	CCDS8833.1, CCDS53795.1	12q13.13	2013-06-25			ENSG00000170486	ENSG00000170486		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28932	protein-coding gene	gene with protein product		608246				12648212, 11703281, 16831889	Standard	NM_080747		Approved	K6IRS2, KRT6IRS2, KRT6, K6irs	uc001saq.2	Q14CN4	OTTHUMG00000169744	ENST00000537672.2:c.592G>A	12.37:g.52992731C>T	ENSP00000441160:p.Asp198Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DEI8|H9KV51|Q8NA87|Q8WWY9|Q8WWZ0	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.D198N	ENST00000537672.2	37	c.592	CCDS8833.1	12	.	.	.	.	.	.	.	.	.	.	C	24.0	4.483632	0.84854	.	.	ENSG00000170486	ENST00000537672;ENST00000293745;ENST00000354310;ENST00000398066	D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48	5.25	5.25	0.73442	Filament (1);	0.000000	0.53938	D	0.000053	D	0.93203	0.7835	L	0.60957	1.885	0.39820	D	0.972822	D;D	0.63046	0.992;0.992	D;D	0.65573	0.936;0.936	D	0.93493	0.6837	10	0.62326	D	0.03	.	19.7291	0.96175	0.0:1.0:0.0:0.0	.	198;198	B4DEI8;Q14CN4	.;K2C72_HUMAN	N	198;198;198;10	ENSP00000441160:D198N;ENSP00000293745:D198N;ENSP00000346269:D198N;ENSP00000446151:D10N	ENSP00000293745:D198N	D	-	1	0	KRT72	51278998	1.000000	0.71417	1.000000	0.80357	0.703000	0.40648	1.643000	0.37217	2.838000	0.97847	0.561000	0.74099	GAT	KRT72	-	pfam_F	ENSG00000170486		0.532	KRT72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT72	HGNC	protein_coding	OTTHUMT00000405693.1	194	0.00	0	C	NM_080747		52992731	52992731	-1	no_errors	ENST00000293745	ensembl	human	known	69_37n	missense	343	28.93	140	SNP	1.000	T
KRTAP1-5	83895	genome.wustl.edu	37	17	39183074	39183074	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:39183074C>T	ENST00000361883.5	-	1	380	c.334G>A	c.(334-336)Gtg>Atg	p.V112M		NM_031957.1	NP_114163.1	Q9BYS1	KRA15_HUMAN	keratin associated protein 1-5	112	15 X 5 AA repeats of C-C-[QEPVRC]- [TPIVLE]-[SRHVP].					keratin filament (GO:0045095)				central_nervous_system(1)|endometrium(2)|kidney(1)|lung(9)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	17		Breast(137;0.00043)	STAD - Stomach adenocarcinoma(17;0.000371)			CGGGTGCTCACAGCTCCACTG	0.647																																						dbGAP											0													22.0	29.0	26.0					17																	39183074		2126	4246	6372	-	-	-	SO:0001583	missense	0			AJ406928	CCDS42321.1	17q21.2	2013-06-25			ENSG00000221852	ENSG00000221852		"""Keratin associated proteins"""	16777	protein-coding gene	gene with protein product		608822				11279113	Standard	NM_031957		Approved	KAP1.5	uc002hvu.3	Q9BYS1	OTTHUMG00000133587	ENST00000361883.5:c.334G>A	17.37:g.39183074C>T	ENSP00000355302:p.Val112Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJW6|A6NLZ6|B6ZDR1|Q52LP6	Missense_Mutation	SNP	pfam_Keratin-assoc	p.V112M	ENST00000361883.5	37	c.334	CCDS42321.1	17	.	.	.	.	.	.	.	.	.	.	C	11.17	1.558755	0.27827	.	.	ENSG00000221852	ENST00000361883;ENST00000543389	T	0.37411	1.2	5.37	-9.66	0.00534	.	.	.	.	.	T	0.34424	0.0897	M	0.89785	3.06	0.09310	N	1	B	0.25850	0.136	B	0.24541	0.054	T	0.42378	-0.9455	9	0.49607	T	0.09	.	2.7225	0.05205	0.1029:0.175:0.3045:0.4176	.	112	Q9BYS1	KRA15_HUMAN	M	112;102	ENSP00000355302:V112M	ENSP00000355302:V112M	V	-	1	0	KRTAP1-5	36436600	0.000000	0.05858	0.000000	0.03702	0.036000	0.12997	-3.207000	0.00558	-1.587000	0.01630	-0.502000	0.04539	GTG	KRTAP1-5	-	pfam_Keratin-assoc	ENSG00000221852		0.647	KRTAP1-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP1-5	HGNC	protein_coding	OTTHUMT00000257691.1	11	0.00	0	C			39183074	39183074	-1	no_errors	ENST00000361883	ensembl	human	known	69_37n	missense	68	13.92	11	SNP	0.000	T
KRTAP4-8	728224	genome.wustl.edu	37	17	39254054	39254054	+	Missense_Mutation	SNP	A	A	T	rs76270529		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:39254054A>T	ENST00000333822.4	-	1	339	c.283T>A	c.(283-285)Tgc>Agc	p.C95S		NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8	95	25 X 5 AA repeats of C-C-[IKRQVHEC]- [SPRT]-[STCVQPR].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)		p.C95S(4)		endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						ctggagatgcagcagcTAGGG	0.677																																						dbGAP											4	Substitution - Missense(4)	endometrium(3)|kidney(1)											7.0	11.0	10.0					17																	39254054		685	1582	2267	-	-	-	SO:0001583	missense	0			AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.283T>A	17.37:g.39254054A>T	ENSP00000328444:p.Cys95Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSH3	Missense_Mutation	SNP	pfam_Keratin-assoc	p.C95S	ENST00000333822.4	37	c.283	CCDS45674.1	17	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755714	0.49362	.	.	ENSG00000204880	ENST00000333822;ENST00000332991	T	0.02280	4.36	3.11	2.01	0.26516	.	0.000000	0.52532	U	0.000067	T	0.04497	0.0123	M	0.83223	2.63	0.25182	N	0.99019	B	0.21606	0.058	B	0.27887	0.084	T	0.21793	-1.0235	10	0.54805	T	0.06	.	6.3859	0.21559	0.8715:0.0:0.1285:0.0	.	95	Q9BYQ9	KRA48_HUMAN	S	95;80	ENSP00000328444:C95S	ENSP00000414561:C80S	C	-	1	0	KRTAP4-8	36507580	0.999000	0.42202	0.393000	0.26258	0.649000	0.38597	3.122000	0.50446	0.404000	0.25506	0.374000	0.22700	TGC	KRTAP4-8	-	NULL	ENSG00000204880		0.677	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	KRTAP4-8	HGNC	protein_coding	OTTHUMT00000257684.1	24	0.00	0	A	NM_031960		39254054	39254054	-1	no_errors	ENST00000333822	ensembl	human	known	69_37n	missense	107	14.96	19	SNP	0.992	T
LARS2	23395	genome.wustl.edu	37	3	45561759	45561759	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:45561759C>T	ENST00000415258.1	+	18	2404	c.2263C>T	c.(2263-2265)Cag>Tag	p.Q755*	LARS2_ENST00000265537.3_Nonsense_Mutation_p.Q755*|LARS2_ENST00000467936.1_3'UTR|LARS2_ENST00000414984.1_Nonsense_Mutation_p.Q712*			Q15031	SYLM_HUMAN	leucyl-tRNA synthetase 2, mitochondrial	755					gene expression (GO:0010467)|leucyl-tRNA aminoacylation (GO:0006429)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|leucine-tRNA ligase activity (GO:0004823)			endometrium(1)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	18				BRCA - Breast invasive adenocarcinoma(193;0.0122)|KIRC - Kidney renal clear cell carcinoma(197;0.0313)|Kidney(197;0.0372)	L-Leucine(DB00149)	TGCAATTTCTCAGCTGATGGG	0.468																																						dbGAP											0													100.0	91.0	94.0					3																	45561759		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ312685	CCDS2728.1	3p21.3	2012-10-26			ENSG00000011376	ENSG00000011376	6.1.1.4	"""Aminoacyl tRNA synthetases / Class I"""	17095	protein-coding gene	gene with protein product	"""leucine tRNA ligase 2, mitochondrial"""	604544				20194621, 15123417	Standard	NM_015340		Approved	KIAA0028, LEURS, MGC26121	uc003cop.1	Q15031	OTTHUMG00000133177	ENST00000415258.1:c.2263C>T	3.37:g.45561759C>T	ENSP00000408576:p.Gln755*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_Methionyl/Leucyl_tRNA_Synth,pfam_V/L/I-tRNA-synth_anticodon-bd,superfamily_tRNAsynth_1a_anticodon-bd,superfamily_Val/Leu/Ile-tRNA-synth_edit,prints_Leu-tRNA-synth_Ia_bac/mito,tigrfam_Leu-tRNA-synth_Ia_bac/mito	p.Q755*	ENST00000415258.1	37	c.2263	CCDS2728.1	3	.	.	.	.	.	.	.	.	.	.	C	38	6.723508	0.97788	.	.	ENSG00000011376	ENST00000265537;ENST00000415258;ENST00000414984	.	.	.	5.91	5.04	0.67666	.	0.341161	0.33075	N	0.005304	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	-8.5039	15.0564	0.71917	0.0:0.9324:0.0:0.0676	.	.	.	.	X	755;755;712	.	ENSP00000265537:Q755X	Q	+	1	0	LARS2	45536763	1.000000	0.71417	0.595000	0.28798	0.201000	0.24016	5.502000	0.66956	1.505000	0.48720	0.655000	0.94253	CAG	LARS2	-	pfam_V/L/I-tRNA-synth_anticodon-bd,superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Leu-tRNA-synth_Ia_bac/mito	ENSG00000011376		0.468	LARS2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LARS2	HGNC	protein_coding	OTTHUMT00000345001.1	89	0.00	0	C	NM_015340		45561759	45561759	+1	no_errors	ENST00000265537	ensembl	human	known	69_37n	nonsense	161	15.18	29	SNP	0.982	T
LGR5	8549	genome.wustl.edu	37	12	71976250	71976250	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:71976250G>C	ENST00000266674.5	+	17	1878	c.1567G>C	c.(1567-1569)Gaa>Caa	p.E523Q	LGR5_ENST00000536515.1_Missense_Mutation_p.E451Q|RP11-186F10.2_ENST00000546601.1_RNA|LGR5_ENST00000540815.2_Missense_Mutation_p.E499Q			O75473	LGR5_HUMAN	leucine-rich repeat containing G protein-coupled receptor 5	523					G-protein coupled receptor signaling pathway (GO:0007186)|inner ear development (GO:0048839)|positive regulation of canonical Wnt signaling pathway (GO:0090263)	integral component of plasma membrane (GO:0005887)|trans-Golgi network membrane (GO:0032588)	G-protein coupled receptor activity (GO:0004930)|transmembrane signaling receptor activity (GO:0004888)		NUP107/LGR5(2)	endometrium(2)|kidney(3)|large_intestine(2)|lung(24)|ovary(1)|pancreas(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(3)	48						ACGTGACCTTGAAGATTTCCT	0.468																																						dbGAP											0													161.0	133.0	143.0					12																	71976250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF062006	CCDS9000.1, CCDS61194.1, CCDS61195.1	12q22-q23	2012-08-21	2011-01-25	2004-11-12				"""GPCR / Class A : Orphans"""	4504	protein-coding gene	gene with protein product		606667	"""G protein-coupled receptor 49"", ""leucine-rich repeat-containing G protein-coupled receptor 5"""	GPR67, GPR49		9642114	Standard	NM_003667		Approved	HG38, FEX	uc001swl.4	O75473	OTTHUMG00000169543	ENST00000266674.5:c.1567G>C	12.37:g.71976250G>C	ENSP00000266674:p.Glu523Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D8MCT0|Q4VAM0|Q4VAM2|Q9UP75	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_7TM_GPCR_Rhodpsn,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,pfscan_GPCR_Rhodpsn_supfam,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn	p.E523Q	ENST00000266674.5	37	c.1567	CCDS9000.1	12	.	.	.	.	.	.	.	.	.	.	G	25.5	4.642716	0.87859	.	.	ENSG00000139292	ENST00000266674;ENST00000451585;ENST00000536515;ENST00000540815	T;T;T	0.21361	2.01;2.01;2.01	5.36	5.36	0.76844	.	0.000000	0.64402	D	0.000003	T	0.44582	0.1300	M	0.79475	2.455	0.53005	D	0.999965	P;P	0.52692	0.942;0.955	P;P	0.55871	0.786;0.616	T	0.30475	-0.9977	10	0.44086	T	0.13	.	19.4686	0.94952	0.0:0.0:1.0:0.0	.	499;523	O75473-2;O75473	.;LGR5_HUMAN	Q	523;523;451;499	ENSP00000266674:E523Q;ENSP00000443033:E451Q;ENSP00000441035:E499Q	ENSP00000266674:E523Q	E	+	1	0	LGR5	70262517	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.805000	0.91925	2.668000	0.90789	0.650000	0.86243	GAA	LGR5	-	NULL	ENSG00000139292		0.468	LGR5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGR5	HGNC	protein_coding	OTTHUMT00000404744.1	106	0.00	0	G	NM_003667		71976250	71976250	+1	no_errors	ENST00000266674	ensembl	human	known	69_37n	missense	188	21.67	52	SNP	1.000	C
LMTK3	114783	genome.wustl.edu	37	19	49001389	49001389	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:49001389C>G	ENST00000600059.1	-	11	3164	c.2937G>C	c.(2935-2937)ctG>ctC	p.L979L	LMTK3_ENST00000270238.3_Silent_p.L1008L			Q96Q04	LMTK3_HUMAN	lemur tyrosine kinase 3	979	Pro-rich.				negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(9)|prostate(1)	16		all_lung(116;0.000147)|Lung NSC(112;0.000251)|all_epithelial(76;0.000326)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000114)|all cancers(93;0.000141)|Epithelial(262;0.00854)|GBM - Glioblastoma multiforme(486;0.0231)		CTGGGGACCTCAGCTCCCCAT	0.627																																						dbGAP											0													104.0	110.0	108.0					19																	49001389		1904	4119	6023	-	-	-	SO:0001819	synonymous_variant	0			AB067470	CCDS46136.1	19q13.33	2014-06-12				ENSG00000142235			19295	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 101"""						Standard	NM_001080434		Approved	KIAA1883, LMR3, TYKLM3, PPP1R101	uc002pjk.3	Q96Q04		ENST00000600059.1:c.2937G>C	19.37:g.49001389C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0U1	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L1008	ENST00000600059.1	37	c.3024		19																																																																																			LMTK3	-	smart_Ser/Thr_dual-sp_kinase_dom	ENSG00000142235		0.627	LMTK3-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	LMTK3	HGNC	protein_coding	OTTHUMT00000466137.1	101	0.98	1	C	NM_052895		49001389	49001389	-1	no_errors	ENST00000270238	ensembl	human	known	69_37n	silent	215	17.31	45	SNP	0.155	G
LONRF1	91694	genome.wustl.edu	37	8	12586696	12586696	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr8:12586696C>T	ENST00000398246.3	-	9	1903	c.1834G>A	c.(1834-1836)Gat>Aat	p.D612N	LONRF1_ENST00000533751.1_Missense_Mutation_p.D255N|MIR3926-2_ENST00000578598.1_RNA|LONRF1_ENST00000525024.1_Missense_Mutation_p.D38N	NM_152271.3	NP_689484.3	Q17RB8	LONF1_HUMAN	LON peptidase N-terminal domain and ring finger 1	612	Lon.						ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19				READ - Rectum adenocarcinoma(644;0.236)		TTTTGTGTATCACTGACACAC	0.368																																						dbGAP											0													83.0	78.0	79.0					8																	12586696		1888	4127	6015	-	-	-	SO:0001583	missense	0			AK074329	CCDS5987.2	8p23.1	2013-01-09			ENSG00000154359	ENSG00000154359		"""RING-type (C3HC4) zinc fingers"""	26302	protein-coding gene	gene with protein product						18253036	Standard	XM_005273685		Approved	FLJ23749, RNF191	uc003wwd.1	Q17RB8	OTTHUMG00000165475	ENST00000398246.3:c.1834G>A	8.37:g.12586696C>T	ENSP00000381298:p.Asp612Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DM29|B4DU84|Q8TEA0|Q9BSV1	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.D612N	ENST00000398246.3	37	c.1834	CCDS5987.2	8	.	.	.	.	.	.	.	.	.	.	C	19.72	3.879756	0.72294	.	.	ENSG00000154359	ENST00000398246;ENST00000525024;ENST00000533751;ENST00000524526	T;T;T;T	0.43688	0.94;0.94;0.94;0.94	5.04	5.04	0.67666	Peptidase S16, lon N-terminal (1);PUA-like domain (1);	0.000000	0.85682	D	0.000000	T	0.52484	0.1737	L	0.49455	1.56	0.80722	D	1	P;P	0.38048	0.562;0.616	P;P	0.49953	0.493;0.627	T	0.34551	-0.9824	10	0.25106	T	0.35	-20.2511	19.2731	0.94018	0.0:1.0:0.0:0.0	.	601;612	Q17RB8-2;Q17RB8	.;LONF1_HUMAN	N	612;38;255;215	ENSP00000381298:D612N;ENSP00000436770:D38N;ENSP00000432130:D255N;ENSP00000433327:D215N	ENSP00000381298:D612N	D	-	1	0	LONRF1	12631067	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.649000	0.61433	2.733000	0.93635	0.557000	0.71058	GAT	LONRF1	-	pfam_Pept_S16_N,superfamily_PUA-like_domain,smart_Pept_S16_N	ENSG00000154359		0.368	LONRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF1	HGNC	protein_coding	OTTHUMT00000251693.2	57	0.00	0	C	NM_152271		12586696	12586696	-1	no_errors	ENST00000398246	ensembl	human	known	69_37n	missense	135	10.00	15	SNP	1.000	T
LRRC41	10489	genome.wustl.edu	37	1	46763262	46763262	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:46763262C>G	ENST00000343304.6	-	3	615	c.330G>C	c.(328-330)ctG>ctC	p.L110L	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	110					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TTGTCTTCATCAGTTCATCCC	0.463																																						dbGAP											0													114.0	107.0	110.0					1																	46763262		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.330G>C	1.37:g.46763262C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L110	ENST00000343304.6	37	c.330	CCDS533.1	1																																																																																			LRRC41	-	NULL	ENSG00000132128		0.463	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	93	0.00	0	C	NM_006369		46763262	46763262	-1	no_errors	ENST00000343304	ensembl	human	known	69_37n	silent	155	24.39	50	SNP	1.000	G
LRRTM1	347730	genome.wustl.edu	37	2	80530006	80530006	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:80530006C>G	ENST00000295057.3	-	2	1595	c.939G>C	c.(937-939)ggG>ggC	p.G313G	CTNNA2_ENST00000402739.4_Intron|CTNNA2_ENST00000496558.1_Intron|CTNNA2_ENST00000466387.1_Intron|LRRTM1_ENST00000409148.1_Silent_p.G313G|CTNNA2_ENST00000540488.1_Intron|CTNNA2_ENST00000541047.1_Intron|CTNNA2_ENST00000361291.4_Intron	NM_178839.4	NP_849161.2	Q86UE6	LRRT1_HUMAN	leucine rich repeat transmembrane neuronal 1	313					exploration behavior (GO:0035640)|locomotory behavior (GO:0007626)|long-term synaptic potentiation (GO:0060291)|negative regulation of receptor internalization (GO:0002091)|protein localization to synapse (GO:0035418)|synapse organization (GO:0050808)	axon (GO:0030424)|cell junction (GO:0030054)|endoplasmic reticulum (GO:0005783)|excitatory synapse (GO:0060076)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				NS(1)|breast(1)|endometrium(5)|large_intestine(7)|liver(1)|lung(33)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(2)	63						CCCACAGGTTCCCGGCCAGGG	0.632										HNSCC(69;0.2)																												dbGAP											0													44.0	43.0	43.0					2																	80530006		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY358310	CCDS1966.1	2p12	2004-06-22			ENSG00000162951	ENSG00000162951			19408	protein-coding gene	gene with protein product		610867				12676565	Standard	XR_244930		Approved	FLJ32082	uc002sok.1	Q86UE6	OTTHUMG00000130021	ENST00000295057.3:c.939G>C	2.37:g.80530006C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K397|D6W5K1|Q96DN1	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.G313	ENST00000295057.3	37	c.939	CCDS1966.1	2																																																																																			LRRTM1	-	NULL	ENSG00000162951		0.632	LRRTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRTM1	HGNC	protein_coding	OTTHUMT00000313614.1	8	0.00	0	C	NM_178839		80530006	80530006	-1	no_errors	ENST00000295057	ensembl	human	known	69_37n	silent	30	18.92	7	SNP	0.997	G
MAP2K4	6416	genome.wustl.edu	37	17	12032510	12032510	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:12032510C>T	ENST00000353533.5	+	9	1009	c.946C>T	c.(946-948)Caa>Taa	p.Q316*	MAP2K4_ENST00000415385.3_Nonsense_Mutation_p.Q327*	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	316	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TGTATTTGATCAACTAACACA	0.423			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																	dbGAP		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	11	Whole gene deletion(10)|Unknown(1)	ovary(4)|breast(4)|biliary_tract(1)|lung(1)|pancreas(1)											89.0	81.0	83.0					17																	12032510		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.946C>T	17.37:g.12032510C>T	ENSP00000262445:p.Gln316*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q327*	ENST00000353533.5	37	c.979	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.586620	0.96578	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.8069	0.88604	0.0:1.0:0.0:0.0	.	.	.	.	X	316;327;293;188	.	ENSP00000262445:Q316X	Q	+	1	0	MAP2K4	11973235	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.597000	0.82733	2.805000	0.96524	0.655000	0.94253	CAA	MAP2K4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065559		0.423	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	115	0.00	0	C			12032510	12032510	+1	no_errors	ENST00000415385	ensembl	human	known	69_37n	nonsense	91	32.09	43	SNP	1.000	T
MAPKBP1	23005	genome.wustl.edu	37	15	42104774	42104774	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr15:42104774G>A	ENST00000456763.2	+	7	755	c.559G>A	c.(559-561)Gag>Aag	p.E187K	MAPKBP1_ENST00000514566.1_Missense_Mutation_p.E187K|MAPKBP1_ENST00000457542.2_Missense_Mutation_p.E187K|MAPKBP1_ENST00000221214.6_Missense_Mutation_p.E187K|MAPKBP1_ENST00000260357.7_Missense_Mutation_p.E75K	NM_001128608.1	NP_001122080.1	O60336	MABP1_HUMAN	mitogen-activated protein kinase binding protein 1	187										breast(6)|central_nervous_system(5)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(11)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	56		all_cancers(109;7.71e-14)|all_epithelial(112;5.15e-12)|Lung NSC(122;3.74e-08)|all_lung(180;1.81e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.95e-17)|GBM - Glioblastoma multiforme(94;5.71e-07)|Lung(196;0.0436)|BRCA - Breast invasive adenocarcinoma(123;0.203)|LUSC - Lung squamous cell carcinoma(244;0.225)		GTCCTTCTCTGAGGATTGCAG	0.507																																						dbGAP											0													120.0	107.0	111.0					15																	42104774		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011168	CCDS32201.1, CCDS45239.1, CCDS58359.1	15q15.1	2013-01-10	2008-01-30		ENSG00000137802	ENSG00000137802		"""WD repeat domain containing"""	29536	protein-coding gene	gene with protein product			"""mitogen activated protein kinase binding protein 1"""			9628581, 10471813	Standard	NM_014994		Approved	KIAA0596	uc001zok.4	O60336	OTTHUMG00000160227	ENST00000456763.2:c.559G>A	15.37:g.42104774G>A	ENSP00000393099:p.Glu187Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM93|A8K8P9|Q14CB5|Q14CD8|Q49AJ8|Q5W9G9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E187K	ENST00000456763.2	37	c.559	CCDS45239.1	15	.	.	.	.	.	.	.	.	.	.	g	21.0	4.087284	0.76642	.	.	ENSG00000137802	ENST00000457542;ENST00000221214;ENST00000260357;ENST00000456763;ENST00000514566	T;T;T;T;T	0.56611	5.07;0.45;0.59;5.07;5.07	5.95	5.95	0.96441	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.248736	0.46145	D	0.000307	T	0.67154	0.2863	M	0.77820	2.39	0.45648	D	0.998575	D;P;B;B	0.60575	0.988;0.716;0.343;0.294	P;B;B;B	0.53861	0.736;0.228;0.297;0.197	T	0.61603	-0.7029	10	0.16420	T	0.52	-4.0785	20.3789	0.98926	0.0:0.0:1.0:0.0	.	75;187;187;187	F8WC21;O60336-2;O60336;O60336-6	.;.;MABP1_HUMAN;.	K	187;187;75;187;187	ENSP00000397570:E187K;ENSP00000221214:E187K;ENSP00000260357:E75K;ENSP00000393099:E187K;ENSP00000426154:E187K	ENSP00000221214:E187K	E	+	1	0	MAPKBP1	39892066	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	5.459000	0.66685	2.826000	0.97356	0.563000	0.77884	GAG	MAPKBP1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000137802		0.507	MAPKBP1-002	KNOWN	basic|CCDS	protein_coding	MAPKBP1	HGNC	protein_coding	OTTHUMT00000359745.1	23	0.00	0	G	NM_014994		42104774	42104774	+1	no_errors	ENST00000456763	ensembl	human	known	69_37n	missense	106	19.70	26	SNP	1.000	A
MORC1	27136	genome.wustl.edu	37	3	108818304	108818304	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:108818304C>G	ENST00000483760.1	-	6	367	c.324G>C	c.(322-324)atG>atC	p.M108I	MORC1-AS1_ENST00000480826.1_RNA|MORC1_ENST00000232603.5_Missense_Mutation_p.M108I					MORC family CW-type zinc finger 1											breast(7)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(47)|ovary(3)|prostate(6)|skin(12)|upper_aerodigestive_tract(3)	105						TTCCAATTCTCATGGACCCAC	0.358																																						dbGAP											0													88.0	88.0	88.0					3																	108818304		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF084946	CCDS2955.1	3q13	2011-10-26	2005-06-15	2005-06-15	ENSG00000114487	ENSG00000114487			7198	protein-coding gene	gene with protein product	"""cancer/testis antigen 33"""	603205	"""microrchidia (mouse) homolog"", ""microrchidia homolog (mouse)"""	MORC		10369865	Standard	NM_014429		Approved	ZCW6, CT33	uc003dxl.3	Q86VD1	OTTHUMG00000159209	ENST00000483760.1:c.324G>C	3.37:g.108818304C>G	ENSP00000417282:p.Met108Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,superfamily_ATPase-like_ATP-bd,pfscan_Znf_CW	p.M108I	ENST00000483760.1	37	c.324		3	.	.	.	.	.	.	.	.	.	.	C	16.81	3.224724	0.58668	.	.	ENSG00000114487	ENST00000232603;ENST00000483760	D;D	0.94650	-3.48;-3.48	4.91	4.91	0.64330	ATPase-like, ATP-binding domain (3);	0.000000	0.64402	D	0.000012	D	0.96009	0.8700	L	0.52126	1.63	0.47621	D	0.999477	P;D	0.62365	0.64;0.991	B;D	0.74348	0.228;0.983	D	0.96060	0.9038	10	0.66056	D	0.02	-23.5066	15.9856	0.80151	0.0:1.0:0.0:0.0	.	108;108	E7ERX1;Q86VD1	.;MORC1_HUMAN	I	108	ENSP00000232603:M108I;ENSP00000417282:M108I	ENSP00000232603:M108I	M	-	3	0	MORC1	110300994	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	6.641000	0.74324	2.712000	0.92718	0.650000	0.86243	ATG	MORC1	-	superfamily_ATPase-like_ATP-bd	ENSG00000114487		0.358	MORC1-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	MORC1	HGNC	protein_coding	OTTHUMT00000353844.1	288	0.00	0	C			108818304	108818304	-1	no_errors	ENST00000232603	ensembl	human	known	69_37n	missense	192	18.99	45	SNP	1.000	G
MED12L	116931	genome.wustl.edu	37	3	151107914	151107914	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:151107914C>T	ENST00000474524.1	+	36	5532	c.5494C>T	c.(5494-5496)Ctt>Ttt	p.L1832F	MED12L_ENST00000273432.4_Missense_Mutation_p.L1692F	NM_053002.4	NP_443728.3	Q86YW9	MD12L_HUMAN	mediator complex subunit 12-like	1832						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			NS(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(27)|lung(50)|ovary(6)|prostate(3)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(1)	128			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			GAACCAATCTCTTACTCCAGG	0.488																																						dbGAP											0													126.0	139.0	134.0					3																	151107914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046855, AF388364	CCDS33876.1	3q25.1	2007-07-30	2007-07-30		ENSG00000144893	ENSG00000144893			16050	protein-coding gene	gene with protein product		611318	"""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)-like"""			11524702	Standard	XM_006713487		Approved	KIAA1635, TNRC11L, TRALPUSH, TRALP	uc003eyp.3	Q86YW9	OTTHUMG00000159844	ENST00000474524.1:c.5494C>T	3.37:g.151107914C>T	ENSP00000417235:p.Leu1832Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PC7|Q96PC8|Q9H9M5|Q9HCD7|Q9UI69	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12,pfam_Mediator_Med12_catenin-bd	p.L1832F	ENST00000474524.1	37	c.5494	CCDS33876.1	3	.	.	.	.	.	.	.	.	.	.	C	16.48	3.134852	0.56828	.	.	ENSG00000144893	ENST00000474524;ENST00000273432	T;T	0.62941	0.2;-0.01	5.75	4.87	0.63330	Mediator complex, subunit Med12, catenin-binding (1);	0.076790	0.53938	D	0.000054	T	0.69269	0.3092	M	0.70275	2.135	0.32527	N	0.535476	P;P	0.52061	0.95;0.78	P;P	0.49887	0.625;0.564	T	0.79806	-0.1648	10	0.72032	D	0.01	-8.0984	14.1346	0.65279	0.0:0.7146:0.2854:0.0	.	1692;1832	F8WAE6;Q86YW9	.;MD12L_HUMAN	F	1832;1692	ENSP00000417235:L1832F;ENSP00000273432:L1692F	ENSP00000273432:L1692F	L	+	1	0	MED12L	152590604	0.985000	0.35326	0.372000	0.25991	0.960000	0.62799	2.207000	0.42788	1.410000	0.46936	0.655000	0.94253	CTT	MED12L	-	pfam_Mediator_Med12_catenin-bd	ENSG00000144893		0.488	MED12L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED12L	HGNC	protein_coding	OTTHUMT00000357707.2	62	0.00	0	C	NM_053002		151107914	151107914	+1	no_errors	ENST00000474524	ensembl	human	known	69_37n	missense	98	17.65	21	SNP	0.597	T
MUC17	140453	genome.wustl.edu	37	7	100675920	100675920	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:100675920C>G	ENST00000306151.4	+	3	1287	c.1223C>G	c.(1222-1224)tCt>tGt	p.S408C		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	408	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTGGCCAGTTCTGAGGCTAGC	0.473																																						dbGAP											0													190.0	200.0	196.0					7																	100675920		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.1223C>G	7.37:g.100675920C>G	ENSP00000302716:p.Ser408Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S408C	ENST00000306151.4	37	c.1223	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	2.095	-0.407485	0.04832	.	.	ENSG00000169876	ENST00000306151	T	0.02682	4.2	1.22	1.22	0.21188	.	.	.	.	.	T	0.01870	0.0059	N	0.14661	0.345	0.09310	N	1	P	0.50156	0.932	B	0.37943	0.261	T	0.51996	-0.8634	9	0.59425	D	0.04	.	8.4626	0.32936	0.0:1.0:0.0:0.0	.	408	Q685J3	MUC17_HUMAN	C	408	ENSP00000302716:S408C	ENSP00000302716:S408C	S	+	2	0	MUC17	100462640	.	.	0.001000	0.08648	0.001000	0.01503	.	.	1.009000	0.39289	0.391000	0.25812	TCT	MUC17	-	NULL	ENSG00000169876		0.473	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	256	0.39	1	C	NM_001040105		100675920	100675920	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	missense	392	14.97	69	SNP	0.002	G
NBEAL2	23218	genome.wustl.edu	37	3	47047285	47047285	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:47047285C>A	ENST00000450053.3	+	42	6928	c.6749C>A	c.(6748-6750)cCc>cAc	p.P2250H	NBEAL2_ENST00000383740.2_Missense_Mutation_p.P529H|NBEAL2_ENST00000292309.5_Missense_Mutation_p.P2066H	NM_015175.2	NP_055990.1	Q6ZNJ1	NBEL2_HUMAN	neurobeachin-like 2	2250	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.				blood coagulation (GO:0007596)|megakaryocyte development (GO:0035855)|platelet alpha granule organization (GO:0070889)|platelet formation (GO:0030220)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)				NS(1)|breast(1)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(9)|lung(9)|ovary(4)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	51		Acute lymphoblastic leukemia(5;0.0534)		BRCA - Breast invasive adenocarcinoma(193;0.0012)|KIRC - Kidney renal clear cell carcinoma(197;0.00575)|Kidney(197;0.00656)		GTGGTGCTACCCCCGTGGGCC	0.617																																						dbGAP											0													57.0	60.0	59.0					3																	47047285		2045	4187	6232	-	-	-	SO:0001583	missense	0			AB011112	CCDS46817.1	3p21.31	2014-09-17			ENSG00000160796	ENSG00000160796		"""WD repeat domain containing"""	31928	protein-coding gene	gene with protein product		614169					Standard	NM_015175		Approved	KIAA0540	uc003cqp.3	Q6ZNJ1	OTTHUMG00000156497	ENST00000450053.3:c.6749C>A	3.37:g.47047285C>A	ENSP00000415034:p.Pro2250His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60288|Q6P994|Q6UX91|Q8NAC9	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.P2250H	ENST00000450053.3	37	c.6749	CCDS46817.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.993124|3.993124	0.74703|0.74703	.|.	.|.	ENSG00000160796|ENSG00000160796	ENST00000292309;ENST00000383740;ENST00000450053;ENST00000445550;ENST00000423436|ENST00000416683	D;D;D;D|D	0.95001|0.93953	-3.33;-3.33;-3.33;-3.58|-3.32	4.98|4.98	4.98|4.98	0.66077|0.66077	BEACH domain (4);|.	0.123608|0.123608	0.56097|0.56097	D|D	0.000028|0.000028	D|D	0.98381|0.98381	0.9462|0.9462	H|H	0.99425|0.99425	4.56|4.56	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.97110|.	0.999;1.0|.	D|D	0.99572|0.99572	1.0971|1.0971	10|8	0.87932|0.87932	D|D	0|0	.|.	17.0537|17.0537	0.86527|0.86527	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2066;2250|.	Q6ZNJ1-2;Q6ZNJ1|.	.;NBEL2_HUMAN|.	H|T	2066;529;2250;193;77|1538	ENSP00000292309:P2066H;ENSP00000373246:P529H;ENSP00000415034:P2250H;ENSP00000415063:P77H|ENSP00000410405:P1538T	ENSP00000292309:P2066H|ENSP00000410405:P1538T	P|P	+|+	2|1	0|0	NBEAL2|NBEAL2	47022289|47022289	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.540000|0.540000	0.34992|0.34992	7.584000|7.584000	0.82572|0.82572	2.599000|2.599000	0.87857|0.87857	0.650000|0.650000	0.86243|0.86243	CCC|CCC	NBEAL2	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000160796		0.617	NBEAL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL2	HGNC	protein_coding	OTTHUMT00000344363.3	11	0.00	0	C	XM_291064		47047285	47047285	+1	no_errors	ENST00000450053	ensembl	human	known	69_37n	missense	48	25.76	17	SNP	1.000	A
NBR1	4077	genome.wustl.edu	37	17	41341611	41341611	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:41341611G>A	ENST00000422280.1	+	8	946	c.487G>A	c.(487-489)Gaa>Aaa	p.E163K	NBR1_ENST00000590996.1_Missense_Mutation_p.E163K|NBR1_ENST00000542611.1_Missense_Mutation_p.E142K|NBR1_ENST00000389312.4_Missense_Mutation_p.E163K|NBR1_ENST00000341165.6_Missense_Mutation_p.E163K|NBR1_ENST00000589872.1_Missense_Mutation_p.E163K	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	163					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		CTAGTTCAGAGAACAAGTGGT	0.398																																						dbGAP											0													63.0	62.0	62.0					17																	41341611		1843	4089	5932	-	-	-	SO:0001583	missense	0			X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.487G>A	17.37:g.41341611G>A	ENSP00000411250:p.Glu163Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Missense_Mutation	SNP	pfam_OPR_PB1,pfam_Znf_ZZ,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.E163K	ENST00000422280.1	37	c.487	CCDS45694.1	17	.	.	.	.	.	.	.	.	.	.	G	35	5.450043	0.96205	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	T;T;T;T	0.48836	1.34;0.8;1.34;1.32	5.87	5.87	0.94306	.	0.050784	0.85682	D	0.000000	T	0.70579	0.3240	M	0.71581	2.175	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.983;0.996	T	0.71237	-0.4652	10	0.72032	D	0.01	-9.8065	20.206	0.98277	0.0:0.0:1.0:0.0	.	142;163;163	B7Z5R6;Q14596-2;Q14596	.;.;NBR1_HUMAN	K	163;142;163;163;163	ENSP00000411250:E163K;ENSP00000437545:E142K;ENSP00000343479:E163K;ENSP00000373963:E163K	ENSP00000343479:E163K	E	+	1	0	NBR1	38595137	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.238000	0.89809	2.785000	0.95823	0.655000	0.94253	GAA	NBR1	-	NULL	ENSG00000188554		0.398	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBR1	HGNC	protein_coding	OTTHUMT00000453461.1	33	0.00	0	G	NM_005899		41341611	41341611	+1	no_errors	ENST00000341165	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	A
NDST1	3340	genome.wustl.edu	37	5	149921221	149921221	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:149921221G>A	ENST00000261797.6	+	9	2341	c.1839G>A	c.(1837-1839)caG>caA	p.Q613Q	snoU13_ENST00000459561.1_RNA|NDST1_ENST00000523767.1_Silent_p.Q613Q	NM_001543.4	NP_001534.1	P52848	NDST1_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 1	613	Heparan sulfate N-sulfotransferase 1.				carbohydrate metabolic process (GO:0005975)|embryonic neurocranium morphogenesis (GO:0048702)|embryonic viscerocranium morphogenesis (GO:0048703)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|inflammatory response (GO:0006954)|MAPK cascade (GO:0000165)|midbrain development (GO:0030901)|polysaccharide biosynthetic process (GO:0000271)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(1)|large_intestine(6)|lung(10)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	34		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TCGGCCCCCAGAAAACAGGCA	0.572																																						dbGAP											0													65.0	54.0	58.0					5																	149921221		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U18918	CCDS34277.1, CCDS75358.1	5q33.1	2008-02-05				ENSG00000070614		"""Sulfotransferases, membrane-bound"""	7680	protein-coding gene	gene with protein product		600853		HSST		7601448, 9230113	Standard	NM_001543		Approved	NST1	uc003lsk.4	P52848		ENST00000261797.6:c.1839G>A	5.37:g.149921221G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96E57	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.Q613	ENST00000261797.6	37	c.1839	CCDS34277.1	5																																																																																			NDST1	-	pfam_Sulfotransferase_dom	ENSG00000070614		0.572	NDST1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST1	HGNC	protein_coding	OTTHUMT00000374314.2	42	0.00	0	G	NM_001543		149921221	149921221	+1	no_errors	ENST00000261797	ensembl	human	known	69_37n	silent	91	20.87	24	SNP	1.000	A
NEB	4703	genome.wustl.edu	37	2	152350316	152350316	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:152350316C>T	ENST00000172853.10	-	142	19224	c.19077G>A	c.(19075-19077)gtG>gtA	p.V6359V	NEB_ENST00000509223.2_Intron|RIF1_ENST00000457745.1_Intron|NEB_ENST00000604864.1_Silent_p.V8215V|NEB_ENST00000427231.2_Silent_p.V8215V|NEB_ENST00000409198.1_Silent_p.V6359V|NEB_ENST00000603639.1_Silent_p.V8215V|NEB_ENST00000397336.2_Silent_p.V190V|NEB_ENST00000397345.3_Silent_p.V8215V|NEB_ENST00000498015.2_Intron			P20929	NEBU_HUMAN	nebulin	6359					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GATTGCGTTTCACTCTTTCCA	0.398																																						dbGAP											0													71.0	64.0	66.0					2																	152350316		1820	4083	5903	-	-	-	SO:0001819	synonymous_variant	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.19077G>A	2.37:g.152350316C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	p.E361K	ENST00000172853.10	37	c.1081		2	.	.	.	.	.	.	.	.	.	.	C	2.361	-0.346577	0.05208	.	.	ENSG00000183091	ENST00000421461	.	.	.	5.93	5.06	0.68205	.	.	.	.	.	T	0.71143	0.3305	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70487	-0.4858	4	.	.	.	.	15.1149	0.72394	0.0:0.2804:0.7195:0.0	.	.	.	.	K	361	.	.	E	-	1	0	NEB	152058562	1.000000	0.71417	1.000000	0.80357	0.565000	0.35776	3.026000	0.49689	1.501000	0.48654	-0.165000	0.13383	GAA	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif	ENSG00000183091		0.398	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		387	0.00	0	C	NM_004543		152350316	152350316	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000421461	ensembl	human	novel	69_37n	missense	226	17.52	48	SNP	1.000	T
NFS1	9054	genome.wustl.edu	37	20	34262522	34262522	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:34262522G>A	ENST00000374092.4	-	9	1036	c.966C>T	c.(964-966)atC>atT	p.I322I	NFS1_ENST00000397425.1_Silent_p.I262I|NFS1_ENST00000374085.1_Silent_p.I262I|NFS1_ENST00000541387.1_Silent_p.I271I|NFS1_ENST00000498084.1_5'Flank|NFS1_ENST00000540053.1_Silent_p.I120I|RP1-309K20.6_ENST00000541176.2_5'Flank	NM_021100.4	NP_066923.3	Q9Y697	NFS1_HUMAN	NFS1 cysteine desulfurase	322					cysteine metabolic process (GO:0006534)|iron incorporation into metallo-sulfur cluster (GO:0018283)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|molybdopterin cofactor biosynthetic process (GO:0032324)|protein complex assembly (GO:0006461)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine desulfurase activity (GO:0031071)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	18	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.0886)		L-Alanine(DB00160)|L-Cysteine(DB00151)	ACAACTTTGAGATTCGCTTGT	0.463																																						dbGAP											0													86.0	86.0	86.0					20																	34262522		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF097025	CCDS13262.1, CCDS56185.1	20q11.22	2013-08-06	2013-08-06		ENSG00000244005	ENSG00000244005	2.8.1.7		15910	protein-coding gene	gene with protein product		603485	"""nitrogen fixation 1 (S. cerevisiae, homolog)"", ""NFS1 nitrogen fixation 1 homolog (S. cerevisiae)"""			9885568, 16847322	Standard	NM_021100		Approved	NifS, IscS	uc002xdw.2	Q9Y697	OTTHUMG00000032361	ENST00000374092.4:c.966C>T	20.37:g.34262522G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMA5|B4DXK9|E1P5R8|F5GYK5|Q6P0L8|Q9NTZ5|Q9Y481	Silent	SNP	pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,pfam_DegT/StrS_aminotransferase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cysteine_dSase_NifS,tigrfam_Cys_deSase	p.I322	ENST00000374092.4	37	c.966	CCDS13262.1	20																																																																																			NFS1	-	pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,pirsf_Cysteine_dSase_NifS,tigrfam_Cys_deSase	ENSG00000244005		0.463	NFS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFS1	HGNC	protein_coding	OTTHUMT00000078936.4	115	0.86	1	G	NM_021100		34262522	34262522	-1	no_errors	ENST00000374092	ensembl	human	known	69_37n	silent	242	19.60	59	SNP	0.974	A
NHSL2	340527	genome.wustl.edu	37	X	71360031	71360031	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:71360031C>T	ENST00000373677.1	+	2	2797	c.1535C>T	c.(1534-1536)gCc>gTc	p.A512V	NHSL2_ENST00000510661.1_Missense_Mutation_p.A647V|NHSL2_ENST00000540800.1_Missense_Mutation_p.A878V|NHSL2_ENST00000535692.1_Missense_Mutation_p.A512V			Q5HYW2	NHSL2_HUMAN	NHS-like 2	512										NS(1)|breast(3)|endometrium(4)|kidney(2)|large_intestine(10)|lung(7)|stomach(1)	28	Renal(35;0.156)					CCTCCGGTGGCCCGGAGGCCT	0.547																																						dbGAP											0													55.0	47.0	49.0					X																	71360031		2203	4300	6503	-	-	-	SO:0001583	missense	0					Xq13.1	2009-02-18			ENSG00000204131	ENSG00000204131			33737	protein-coding gene	gene with protein product							Standard	NM_001013627		Approved		uc011mqa.2	Q5HYW2	OTTHUMG00000021807	ENST00000373677.1:c.1535C>T	X.37:g.71360031C>T	ENSP00000362781:p.Ala512Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN94	Missense_Mutation	SNP	NULL	p.A878V	ENST00000373677.1	37	c.2633		X	.	.	.	.	.	.	.	.	.	.	C	17.48	3.400301	0.62177	.	.	ENSG00000204131	ENST00000540800;ENST00000373677;ENST00000510661;ENST00000535692	T;T;T;T	0.48201	1.43;0.84;0.82;0.84	5.65	4.65	0.58169	.	0.328806	0.28093	N	0.016631	T	0.42404	0.1201	L	0.51422	1.61	0.36717	D	0.880969	B;B;B	0.14438	0.01;0.01;0.01	B;B;B	0.21917	0.037;0.021;0.021	T	0.47711	-0.9096	10	0.72032	D	0.01	-7.185	9.1913	0.37200	0.0:0.8673:0.0:0.1327	.	878;647;512	F5H593;D6RBM4;Q5HYW2	.;.;NHSL2_HUMAN	V	878;512;647;512	ENSP00000444617:A878V;ENSP00000362781:A512V;ENSP00000424079:A647V;ENSP00000444914:A512V	ENSP00000362781:A512V	A	+	2	0	NHSL2	71276756	1.000000	0.71417	0.991000	0.47740	0.850000	0.48378	4.309000	0.59135	1.104000	0.41587	0.600000	0.82982	GCC	NHSL2	-	NULL	ENSG00000204131		0.547	NHSL2-001	KNOWN	basic	protein_coding	NHSL2	HGNC	protein_coding	OTTHUMT00000057170.1	53	0.00	0	C	NM_001013627		71360031	71360031	+1	no_errors	ENST00000540800	ensembl	human	known	69_37n	missense	83	21.70	23	SNP	1.000	T
NLK	51701	genome.wustl.edu	37	17	26495572	26495572	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:26495572G>A	ENST00000407008.3	+	6	1654	c.936G>A	c.(934-936)ctG>ctA	p.L312L		NM_016231.4	NP_057315.3	Q9UBE8	NLK_HUMAN	nemo-like kinase	312	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with DAPK3.				intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|negative regulation of Wnt signaling pathway (GO:0030178)|peptidyl-threonine phosphorylation (GO:0018107)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|serine phosphorylation of STAT3 protein (GO:0033136)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase activity (GO:0004707)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|SH2 domain binding (GO:0042169)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(1)	14	all_lung(13;0.000343)|Lung NSC(42;0.00184)			UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		CAGAAATCCTGATGGGCAGCC	0.433																																						dbGAP											0													166.0	166.0	166.0					17																	26495572		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF197898	CCDS11224.2	17q11.2	2005-12-22	2005-12-22		ENSG00000087095	ENSG00000087095			29858	protein-coding gene	gene with protein product		609476	"""nemo like kinase"""			9448268, 10863097	Standard	NM_016231		Approved		uc010crj.3	Q9UBE8	OTTHUMG00000132451	ENST00000407008.3:c.936G>A	17.37:g.26495572G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCX1|Q2PNI9|Q6P2A3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L312	ENST00000407008.3	37	c.936	CCDS11224.2	17																																																																																			NLK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000087095		0.433	NLK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLK	HGNC	protein_coding	OTTHUMT00000255607.3	157	0.00	0	G	NM_016231		26495572	26495572	+1	no_errors	ENST00000407008	ensembl	human	known	69_37n	silent	223	18.01	49	SNP	1.000	A
NRK	203447	genome.wustl.edu	37	X	105156652	105156652	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:105156652G>T	ENST00000243300.9	+	14	2557	c.2254G>T	c.(2254-2256)Gaa>Taa	p.E752*	NRK_ENST00000428173.2_Nonsense_Mutation_p.E753*	NM_198465.2	NP_940867.2	Q7Z2Y5	NRK_HUMAN	Nik related kinase	752					activation of JNKK activity (GO:0007256)|negative regulation of cell proliferation (GO:0008285)|parturition (GO:0007567)|regulation of spongiotrophoblast cell proliferation (GO:0060721)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(8)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(14)|lung(36)|ovary(3)|prostate(1)|skin(2)	76						CAAAGAAGATGAATCATCAGA	0.313										HNSCC(51;0.14)																												dbGAP											0													33.0	28.0	29.0					X																	105156652		1827	4064	5891	-	-	-	SO:0001587	stop_gained	0			BX538345	CCDS65305.1	Xq22.3	2008-02-05			ENSG00000123572	ENSG00000123572			25391	protein-coding gene	gene with protein product		300791					Standard	NM_198465		Approved	DKFZp686A17109	uc004emd.3	Q7Z2Y5	OTTHUMG00000022143	ENST00000243300.9:c.2254G>T	X.37:g.105156652G>T	ENSP00000434830:p.Glu752*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32ND6|Q5H9K2|Q6ZMP2	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Citron,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.E753*	ENST00000243300.9	37	c.2257		X	.	.	.	.	.	.	.	.	.	.	G	41	9.017899	0.99037	.	.	ENSG00000123572	ENST00000243300;ENST00000428173	.	.	.	3.69	3.69	0.42338	.	0.168062	0.28187	N	0.016274	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	.	9.9531	0.41651	0.0:0.0:1.0:0.0	.	.	.	.	X	752;753	.	ENSP00000434830:E752X	E	+	1	0	NRK	105043308	1.000000	0.71417	0.997000	0.53966	0.893000	0.52053	3.817000	0.55668	2.098000	0.63641	0.600000	0.82982	GAA	NRK	-	NULL	ENSG00000123572		0.313	NRK-001	KNOWN	non_canonical_conserved|basic|appris_candidate	protein_coding	NRK	HGNC	protein_coding	OTTHUMT00000106480.6	83	0.00	0	G	NM_198465		105156652	105156652	+1	no_errors	ENST00000428173	ensembl	human	known	69_37n	nonsense	80	18.37	18	SNP	0.998	T
NSMCE1	197370	genome.wustl.edu	37	16	27238139	27238139	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:27238139G>A	ENST00000361439.4	-	6	601	c.502C>T	c.(502-504)Ctg>Ttg	p.L168L	NSMCE1_ENST00000565384.1_5'UTR	NM_145080.3	NP_659547.2	Q8WV22	NSE1_HUMAN	non-SMC element 1 homolog (S. cerevisiae)	168					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|intracellular signal transduction (GO:0035556)|positive regulation of response to DNA damage stimulus (GO:2001022)|protein ubiquitination (GO:0016567)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|Smc5-Smc6 complex (GO:0030915)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(3)	7						CGGCCGTGCAGGGTGAACTCC	0.607																																						dbGAP											0													105.0	112.0	110.0					16																	27238139		2085	4205	6290	-	-	-	SO:0001819	synonymous_variant	0			AF161451	CCDS10628.2	16p12.1	2010-03-23	2006-07-05		ENSG00000169189	ENSG00000169189			29897	protein-coding gene	gene with protein product						11927594	Standard	XM_005255163		Approved	NSE1	uc002doi.1	Q8WV22	OTTHUMG00000131674	ENST00000361439.4:c.502C>T	16.37:g.27238139G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWF6|Q9P045|Q9P049	Silent	SNP	pfam_SMC_Nse1,pfam_Znf_RING-like,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Znf_RING	p.L168	ENST00000361439.4	37	c.502	CCDS10628.2	16																																																																																			NSMCE1	-	pfam_SMC_Nse1	ENSG00000169189		0.607	NSMCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSMCE1	HGNC	protein_coding	OTTHUMT00000254577.3	18	0.00	0	G	NM_145080		27238139	27238139	-1	no_errors	ENST00000361439	ensembl	human	known	69_37n	silent	80	25.23	27	SNP	0.982	A
ECD	11319	genome.wustl.edu	37	10	74890577	74890577	+	IGR	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr10:74890577C>T	ENST00000372979.4	-	0	3069				NUDT13_ENST00000544879.1_Silent_p.F199F|NUDT13_ENST00000537969.1_Silent_p.F128F|NUDT13_ENST00000357321.4_Silent_p.F325F|NUDT13_ENST00000372997.3_3'UTR|NUDT13_ENST00000349051.5_Silent_p.F236F|NUDT13_ENST00000488223.1_3'UTR	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)						cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					CTTTCCCATTCTGGCTGCCCC	0.517																																						dbGAP											0													71.0	67.0	69.0					10																	74890577		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905			10.37:g.74890577C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JX46|E9PAW8	Silent	SNP	pfam_NUDIX_hydrolase_dom,pfam_NADH_PPase-like_N,pfam_Znr_NADH_PPase,superfamily_NUDIX_hydrolase_dom-like	p.F325	ENST00000372979.4	37	c.975	CCDS7321.1	10																																																																																			NUDT13	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000166321		0.517	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT13	HGNC	protein_coding	OTTHUMT00000048606.1	61	0.00	0	C	NM_007265		74890577	74890577	+1	no_errors	ENST00000357321	ensembl	human	known	69_37n	silent	92	23.97	29	SNP	0.999	T
NXPE1	120400	genome.wustl.edu	37	11	114401498	114401498	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:114401498C>G	ENST00000424269.1	-	2	231	c.232G>C	c.(232-234)Gag>Cag	p.E78Q	NXPE1_ENST00000251921.2_5'UTR|NXPE1_ENST00000536312.1_Missense_Mutation_p.E78Q|NXPE1_ENST00000536271.1_5'Flank			Q8N323	NXPE1_HUMAN	neurexophilin and PC-esterase domain family, member 1	78						extracellular region (GO:0005576)											TCTAGTTTCTCTATGATTTCC	0.463																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC029049	CCDS8372.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000095110	ENSG00000095110			28527	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member A"""	FAM55A		12477932	Standard	NM_152315		Approved	MGC34290	uc001ppa.3	Q8N323	OTTHUMG00000168284	ENST00000424269.1:c.232G>C	11.37:g.114401498C>G	ENSP00000411690:p.Glu78Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ13	Missense_Mutation	SNP	superfamily_Ig_E-set	p.E78Q	ENST00000424269.1	37	c.232		11	.	.	.	.	.	.	.	.	.	.	C	12.09	1.834375	0.32421	.	.	ENSG00000095110	ENST00000424269;ENST00000536312;ENST00000539878	T;T;T	0.50548	2.65;0.78;0.74	4.39	1.65	0.23941	.	.	.	.	.	T	0.53642	0.1809	.	.	.	0.09310	N	1	D	0.54207	0.965	P	0.58391	0.838	T	0.38222	-0.9671	8	0.48119	T	0.1	.	4.5799	0.12253	0.0:0.5718:0.1772:0.251	.	78	F5H6W7	.	Q	78	ENSP00000411690:E78Q;ENSP00000442984:E78Q;ENSP00000439779:E78Q	ENSP00000411690:E78Q	E	-	1	0	FAM55A	113906708	0.008000	0.16893	0.006000	0.13384	0.415000	0.31203	0.122000	0.15687	0.350000	0.24002	0.563000	0.77884	GAG	NXPE1	-	NULL	ENSG00000095110		0.463	NXPE1-201	KNOWN	basic	protein_coding	NXPE1	HGNC	protein_coding		397	0.00	0	C	NM_152315		114401498	114401498	-1	no_errors	ENST00000424269	ensembl	human	known	69_37n	missense	589	20.83	155	SNP	0.005	G
OR1A2	26189	genome.wustl.edu	37	17	3101617	3101617	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:3101617G>C	ENST00000381951.1	+	1	805	c.805G>C	c.(805-807)Gat>Cat	p.D269H		NM_012352.1	NP_036484.1	Q9Y585	OR1A2_HUMAN	olfactory receptor, family 1, subfamily A, member 2	269					positive regulation of cytokinesis (GO:0032467)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|large_intestine(2)|lung(5)|skin(4)|stomach(2)	18						CAGCCCCAAAGATGCAGTGAT	0.453																																						dbGAP											0													124.0	120.0	121.0					17																	3101617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155225	CCDS11021.1	17p13.3	2012-08-09			ENSG00000172150	ENSG00000172150		"""GPCR / Class A : Olfactory receptors"""	8180	protein-coding gene	gene with protein product						10673334	Standard	NM_012352		Approved	OR17-6	uc002fvd.1	Q9Y585	OTTHUMG00000090638	ENST00000381951.1:c.805G>C	17.37:g.3101617G>C	ENSP00000371377:p.Asp269His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KPH3|Q6IFM0|Q6NTD8|Q96R86	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D269H	ENST00000381951.1	37	c.805	CCDS11021.1	17	.	.	.	.	.	.	.	.	.	.	G	7.525	0.657382	0.14580	.	.	ENSG00000172150	ENST00000381951	T	0.00253	8.43	4.0	2.99	0.34606	GPCR, rhodopsin-like superfamily (1);	0.265751	0.26971	N	0.021574	T	0.00412	0.0013	M	0.91300	3.195	0.09310	N	0.99999	P	0.35844	0.524	B	0.42112	0.376	T	0.03887	-1.0995	10	0.87932	D	0	.	12.2412	0.54544	0.0:0.1809:0.8191:0.0	.	269	Q9Y585	OR1A2_HUMAN	H	269	ENSP00000371377:D269H	ENSP00000371377:D269H	D	+	1	0	OR1A2	3048367	0.000000	0.05858	0.098000	0.21074	0.152000	0.21847	-0.541000	0.06099	0.983000	0.38602	0.543000	0.68304	GAT	OR1A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172150		0.453	OR1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A2	HGNC	protein_coding	OTTHUMT00000207293.1	136	0.00	0	G	NM_012352		3101617	3101617	+1	no_errors	ENST00000381951	ensembl	human	known	69_37n	missense	89	31.54	41	SNP	0.343	C
OR2L8	391190	genome.wustl.edu	37	1	248112192	248112192	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:248112192C>A	ENST00000357191.3	+	1	33	c.33C>A	c.(31-33)ttC>ttA	p.F11L	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	11						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			CAACTGATTTCATCTTATTGG	0.378																																						dbGAP											0													153.0	142.0	146.0					1																	248112192		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.33C>A	1.37:g.248112192C>A	ENSP00000349719:p.Phe11Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF03	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F11L	ENST00000357191.3	37	c.33	CCDS31101.1	1	.	.	.	.	.	.	.	.	.	.	C	16.37	3.103893	0.56291	.	.	ENSG00000196936	ENST00000357191	T	0.00537	6.72	1.48	0.475	0.16774	.	.	.	.	.	T	0.01189	0.0039	M	0.77103	2.36	0.24908	N	0.992067	P	0.47106	0.89	P	0.51945	0.685	T	0.44483	-0.9325	9	0.72032	D	0.01	.	6.9272	0.24422	0.0:0.8163:0.0:0.1837	.	11	Q8NGY9	OR2L8_HUMAN	L	11	ENSP00000349719:F11L	ENSP00000349719:F11L	F	+	3	2	OR2L8	246178815	0.083000	0.21467	0.223000	0.23860	0.477000	0.33069	0.286000	0.18902	0.803000	0.34113	0.298000	0.19748	TTC	OR2L8	-	NULL	ENSG00000196936		0.378	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	334	0.00	0	C			248112192	248112192	+1	no_errors	ENST00000357191	ensembl	human	known	69_37n	missense	279	25.33	95	SNP	0.630	A
OR4K15	81127	genome.wustl.edu	37	14	20443846	20443846	+	Missense_Mutation	SNP	C	C	A	rs375009594		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr14:20443846C>A	ENST00000305051.5	+	1	244	c.169C>A	c.(169-171)Cta>Ata	p.L57I		NM_001005486.1	NP_001005486.1	Q8NH41	OR4KF_HUMAN	olfactory receptor, family 4, subfamily K, member 15	57						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(6)|lung(23)|ovary(1)|prostate(2)|skin(1)|stomach(1)	39	all_cancers(95;0.00108)		Epithelial(56;9.96e-07)|all cancers(55;3.58e-06)	GBM - Glioblastoma multiforme(265;0.00327)		TACATTTTCACTACTTTATCT	0.438																																						dbGAP											0													139.0	152.0	148.0					14																	20443846		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS32026.1	14q11.2	2013-09-23			ENSG00000169488	ENSG00000169488		"""GPCR / Class A : Olfactory receptors"""	15353	protein-coding gene	gene with protein product							Standard	NM_001005486		Approved	OR4K15Q	uc010tkx.2	Q8NH41	OTTHUMG00000170635	ENST00000305051.5:c.169C>A	14.37:g.20443846C>A	ENSP00000304077:p.Leu57Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIL3|Q6IEZ4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L57I	ENST00000305051.5	37	c.169	CCDS32026.1	14	.	.	.	.	.	.	.	.	.	.	.	4.289	0.052866	0.08291	.	.	ENSG00000169488	ENST00000305051	T	0.00433	7.43	3.55	-1.36	0.09085	.	0.193645	0.24597	N	0.037161	T	0.00271	0.0008	L	0.43701	1.375	0.09310	N	1	B	0.15141	0.012	B	0.13407	0.009	T	0.40308	-0.9570	10	0.28530	T	0.3	.	8.4106	0.32640	0.0:0.4294:0.4718:0.0987	.	57	Q8NH41	OR4KF_HUMAN	I	57	ENSP00000304077:L57I	ENSP00000304077:L57I	L	+	1	2	OR4K15	19513686	0.000000	0.05858	0.000000	0.03702	0.847000	0.48162	-3.873000	0.00345	-0.179000	0.10654	0.467000	0.42956	CTA	OR4K15	-	prints_7TM_GPCR_Rhodpsn	ENSG00000169488		0.438	OR4K15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K15	HGNC	protein_coding	OTTHUMT00000409883.1	271	0.00	0	C			20443846	20443846	+1	no_errors	ENST00000305051	ensembl	human	known	69_37n	missense	396	20.80	104	SNP	0.000	A
OR52K1	390036	genome.wustl.edu	37	11	4510827	4510827	+	Missense_Mutation	SNP	C	C	G	rs148398771		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:4510827C>G	ENST00000307632.3	+	1	719	c.697C>G	c.(697-699)Cag>Gag	p.Q233E		NM_001005171.2	NP_001005171.2	Q8NGK4	O52K1_HUMAN	olfactory receptor, family 52, subfamily K, member 1	233						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(18)|skin(2)|stomach(1)	32		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.76e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0836)|LUSC - Lung squamous cell carcinoma(625;0.192)		GCTTGCCTCTCAGGAGGCCCG	0.502																																						dbGAP											0													333.0	281.0	299.0					11																	4510827		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065790	CCDS31352.1	11p15.4	2012-08-09			ENSG00000196778	ENSG00000196778		"""GPCR / Class A : Olfactory receptors"""	15222	protein-coding gene	gene with protein product							Standard	NM_001005171		Approved		uc001lza.2	Q8NGK4	OTTHUMG00000165705	ENST00000307632.3:c.697C>G	11.37:g.4510827C>G	ENSP00000302422:p.Gln233Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH54|Q6IFK5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.Q233E	ENST00000307632.3	37	c.697	CCDS31352.1	11	.	.	.	.	.	.	.	.	.	.	C	6.528	0.465610	0.12402	.	.	ENSG00000196778	ENST00000307632	T	0.00032	8.88	4.5	3.52	0.40303	GPCR, rhodopsin-like superfamily (1);	0.545074	0.15653	N	0.251307	T	0.00144	0.0004	L	0.33624	1.015	0.09310	N	1	B	0.25772	0.134	B	0.34038	0.174	T	0.25152	-1.0140	10	0.29301	T	0.29	.	7.3119	0.26479	0.1708:0.7359:0.0:0.0932	.	233	Q8NGK4	O52K1_HUMAN	E	233	ENSP00000302422:Q233E	ENSP00000302422:Q233E	Q	+	1	0	OR52K1	4467403	0.000000	0.05858	1.000000	0.80357	0.682000	0.39822	-0.349000	0.07731	2.487000	0.83934	0.411000	0.27672	CAG	OR52K1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196778		0.502	OR52K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K1	HGNC	protein_coding	OTTHUMT00000385846.1	305	0.00	0	C	NM_001005171		4510827	4510827	+1	no_errors	ENST00000307632	ensembl	human	known	69_37n	missense	604	22.31	174	SNP	0.037	G
OR5D14	219436	genome.wustl.edu	37	11	55563592	55563592	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:55563592C>G	ENST00000335605.1	+	1	561	c.561C>G	c.(559-561)atC>atG	p.I187M		NM_001004735.1	NP_001004735.1	Q8NGL3	OR5DE_HUMAN	olfactory receptor, family 5, subfamily D, member 14	187						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(30)|ovary(2)|prostate(1)|skin(2)|stomach(3)|urinary_tract(1)	48		all_epithelial(135;0.196)				CTGCTCTCATCTCTGTGTCTG	0.458																																						dbGAP											0													220.0	215.0	217.0					11																	55563592		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB065779	CCDS31508.1	11q11	2012-08-09			ENSG00000186113	ENSG00000186113		"""GPCR / Class A : Olfactory receptors"""	15281	protein-coding gene	gene with protein product							Standard	NM_001004735		Approved		uc010rim.2	Q8NGL3	OTTHUMG00000166809	ENST00000335605.1:c.561C>G	11.37:g.55563592C>G	ENSP00000334456:p.Ile187Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF69|Q6IFD4|Q96RB5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I187M	ENST00000335605.1	37	c.561	CCDS31508.1	11	.	.	.	.	.	.	.	.	.	.	c	4.080	0.012837	0.07912	.	.	ENSG00000186113	ENST00000335605	T	0.00164	8.64	5.08	-4.39	0.03611	GPCR, rhodopsin-like superfamily (1);	0.000000	0.45867	D	0.000323	T	0.00109	0.0003	L	0.35793	1.09	0.09310	N	1	P	0.37158	0.585	B	0.38921	0.285	T	0.46857	-0.9161	10	0.41790	T	0.15	-25.6716	1.8194	0.03107	0.2184:0.3453:0.0973:0.339	.	187	Q8NGL3	OR5DE_HUMAN	M	187	ENSP00000334456:I187M	ENSP00000334456:I187M	I	+	3	3	OR5D14	55320168	0.000000	0.05858	0.011000	0.14972	0.000000	0.00434	-5.474000	0.00119	-1.253000	0.02488	-0.829000	0.03081	ATC	OR5D14	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000186113		0.458	OR5D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5D14	HGNC	protein_coding	OTTHUMT00000391513.1	165	0.00	0	C	NM_001004735		55563592	55563592	+1	no_errors	ENST00000335605	ensembl	human	known	69_37n	missense	248	16.50	49	SNP	0.000	G
OR7A17	26333	genome.wustl.edu	37	19	14991294	14991294	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:14991294G>C	ENST00000327462.2	-	1	970	c.874C>G	c.(874-876)Ctg>Gtg	p.L292V		NM_030901.1	NP_112163.1	O14581	OR7AH_HUMAN	olfactory receptor, family 7, subfamily A, member 17	292						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|large_intestine(2)|lung(6)|prostate(1)|skin(1)	12	Ovarian(108;0.203)					TTATTCCTCAGACTGTAGATA	0.438																																						dbGAP											0													74.0	73.0	73.0					19																	14991294		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64993	CCDS12319.1	19p13.12	2012-08-09				ENSG00000185385		"""GPCR / Class A : Olfactory receptors"""	8363	protein-coding gene	gene with protein product						1370859	Standard	NM_030901		Approved	HTPCRX19	uc010xob.2	O14581		ENST00000327462.2:c.874C>G	19.37:g.14991294G>C	ENSP00000328144:p.Leu292Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFQ6|Q96R98	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L292V	ENST00000327462.2	37	c.874	CCDS12319.1	19	.	.	.	.	.	.	.	.	.	.	g	12.13	1.846080	0.32606	.	.	ENSG00000185385	ENST00000327462	T	0.46451	0.87	3.37	3.37	0.38596	.	0.285709	0.18851	U	0.129420	T	0.75503	0.3858	H	0.97874	4.095	0.23994	N	0.996233	D	0.76494	0.999	D	0.78314	0.991	T	0.70809	-0.4771	10	0.87932	D	0	.	12.7438	0.57268	0.0:0.0:1.0:0.0	.	292	O14581	OR7AH_HUMAN	V	292	ENSP00000328144:L292V	ENSP00000328144:L292V	L	-	1	2	OR7A17	14852294	0.402000	0.25311	0.951000	0.38953	0.239000	0.25481	0.677000	0.25262	1.922000	0.55676	0.454000	0.30748	CTG	OR7A17	-	prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000185385		0.438	OR7A17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7A17	HGNC	protein_coding	OTTHUMT00000466523.1	150	0.00	0	G	NM_030901		14991294	14991294	-1	no_errors	ENST00000327462	ensembl	human	known	69_37n	missense	197	17.23	41	SNP	0.881	C
OTOGL	283310	genome.wustl.edu	37	12	80650138	80650138	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:80650138C>T	ENST00000547103.1	+	16	1588	c.1582C>T	c.(1582-1584)Cag>Tag	p.Q528*	OTOGL_ENST00000458043.2_Nonsense_Mutation_p.Q528*			Q3ZCN5	OTOGL_HUMAN	otogelin-like	528	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						GGTCTGCCTTCAGTCTATAAC	0.438																																						dbGAP											0													88.0	79.0	82.0					12																	80650138		1864	4106	5970	-	-	-	SO:0001587	stop_gained	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1582C>T	12.37:g.80650138C>T	ENSP00000447211:p.Gln528*	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Nonsense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.Q528*	ENST00000547103.1	37	c.1582		12	.	.	.	.	.	.	.	.	.	.	C	39	7.355965	0.98231	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	.	15.9791	0.80094	0.0:0.8652:0.1348:0.0	.	.	.	.	X	528	.	ENSP00000400895:Q528X	Q	+	1	0	OTOGL	79174269	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	5.142000	0.64820	2.687000	0.91594	0.655000	0.94253	CAG	OTOGL	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000165899		0.438	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	183	0.00	0	C	NM_173591		80650138	80650138	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	nonsense	316	17.28	66	SNP	1.000	T
OTOGL	283310	genome.wustl.edu	37	12	80650216	80650216	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:80650216C>A	ENST00000547103.1	+	16	1666	c.1660C>A	c.(1660-1662)Cct>Act	p.P554T	OTOGL_ENST00000458043.2_Missense_Mutation_p.P554T			Q3ZCN5	OTOGL_HUMAN	otogelin-like	554	VWFD 2. {ECO:0000255|PROSITE- ProRule:PRU00580}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TCTCACTAGTCCTAACCAAGG	0.398																																						dbGAP											0													72.0	66.0	68.0					12																	80650216		1899	4108	6007	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.1660C>A	12.37:g.80650216C>A	ENSP00000447211:p.Pro554Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.P554T	ENST00000547103.1	37	c.1660		12	.	.	.	.	.	.	.	.	.	.	C	9.250	1.040522	0.19669	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.57752	0.38;0.38	5.66	5.66	0.87406	.	.	.	.	.	T	0.43722	0.1260	L	0.35414	1.06	0.28579	N	0.910242	.	.	.	.	.	.	T	0.33929	-0.9849	7	0.14252	T	0.57	.	9.9586	0.41682	0.0:0.8489:0.0:0.1511	.	.	.	.	T	554	ENSP00000447211:P554T;ENSP00000400895:P554T	ENSP00000400895:P554T	P	+	1	0	OTOGL	79174347	0.993000	0.37304	1.000000	0.80357	0.984000	0.73092	2.343000	0.44001	2.682000	0.91365	0.650000	0.86243	CCT	OTOGL	-	pfam_VWF_type-D,smart_VWF_type-D	ENSG00000165899		0.398	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	147	0.00	0	C	NM_173591		80650216	80650216	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	259	16.18	50	SNP	1.000	A
PAXIP1	22976	genome.wustl.edu	37	7	154754071	154754071	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:154754071G>A	ENST00000404141.1	-	10	2241	c.2087C>T	c.(2086-2088)cCa>cTa	p.P696L	PAXIP1_ENST00000397192.1_Missense_Mutation_p.P696L|PAXIP1_ENST00000473219.1_5'UTR			Q6ZW49	PAXI1_HUMAN	PAX interacting (with transcription-activation domain) protein 1	696	Interaction with TP53BP1.				adipose tissue development (GO:0060612)|chorion development (GO:0060717)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|endothelial cell migration (GO:0043542)|histone H3-K4 methylation (GO:0051568)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K36 methylation (GO:0000416)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of isotype switching (GO:0045830)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription initiation from RNA polymerase II promoter (GO:0060261)|response to ionizing radiation (GO:0010212)|transcription, DNA-templated (GO:0006351)|vasculogenesis (GO:0001570)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(1)	33	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.0296)	UCEC - Uterine corpus endometrioid carcinoma (81;0.178)		GAAGGCCACTGGGAAGTGAAG	0.463																																						dbGAP											0													157.0	162.0	161.0					7																	154754071		1941	4123	6064	-	-	-	SO:0001583	missense	0			U80735	CCDS47753.1	7q36	2007-07-06	2005-04-05	2005-04-05	ENSG00000157212	ENSG00000157212			8624	protein-coding gene	gene with protein product		608254	"""PAX transcription activation domain interacting protein 1 like"""	PAXIP1L		9225980	Standard	XM_005249539		Approved	CAGF29, CAGF28, TNRC2, PTIP	uc022aqf.1	Q6ZW49	OTTHUMG00000151322	ENST00000404141.1:c.2087C>T	7.37:g.154754071G>A	ENSP00000384048:p.Pro696Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15404|Q6N099|Q6ZWH9|Q7Z315|Q86UN0|Q8N4P9|Q96HP2	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.P696L	ENST00000404141.1	37	c.2087	CCDS47753.1	7	.	.	.	.	.	.	.	.	.	.	G	18.14	3.556714	0.65425	.	.	ENSG00000157212	ENST00000404141;ENST00000397192;ENST00000357094;ENST00000323199	T;T	0.54675	0.56;0.56	4.91	4.91	0.64330	BRCT (1);	0.000000	0.56097	U	0.000036	T	0.73567	0.3603	M	0.74647	2.275	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.993;0.999;0.997	T	0.77493	-0.2567	10	0.87932	D	0	-26.8568	18.4584	0.90729	0.0:0.0:1.0:0.0	.	649;662;696	B4DEQ6;Q6ZW49-1;Q6ZW49	.;.;PAXI1_HUMAN	L	696;696;520;649	ENSP00000384048:P696L;ENSP00000380376:P696L	ENSP00000319149:P649L	P	-	2	0	PAXIP1	154385004	1.000000	0.71417	0.409000	0.26459	0.623000	0.37688	9.049000	0.93837	2.426000	0.82243	0.467000	0.42956	CCA	PAXIP1	-	superfamily_BRCT_dom	ENSG00000157212		0.463	PAXIP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PAXIP1	HGNC	protein_coding	OTTHUMT00000322223.1	223	0.00	0	G	NM_007349		154754071	154754071	-1	no_errors	ENST00000397192	ensembl	human	known	69_37n	missense	586	16.38	115	SNP	1.000	A
PCDHA12	56137	genome.wustl.edu	37	5	140256808	140256808	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:140256808C>T	ENST00000398631.2	+	1	1751	c.1751C>T	c.(1750-1752)tCg>tTg	p.S584L	PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018903.2|NM_031864.2	NP_061726.1|NP_114070.1	Q9UN75	PCDAC_HUMAN	protocadherin alpha 12	584	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(4)|breast(2)|cervix(1)|endometrium(19)|kidney(8)|large_intestine(8)|liver(2)|lung(25)|prostate(1)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(1)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GTACCGCGGTCGGTGGGTGCG	0.682																																					Pancreas(113;759 1672 13322 24104 50104)	dbGAP											0													218.0	207.0	210.0					5																	140256808		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF152477	CCDS47285.1, CCDS75327.1	5q31	2010-11-26			ENSG00000251664	ENSG00000251664		"""Cadherins / Protocadherins : Clustered"""	8666	other	complex locus constituent	"""KIAA0345-like 2"""	606318				10380929	Standard	NM_018903		Approved	PCDH-ALPHA12	uc003lic.2	Q9UN75	OTTHUMG00000163366	ENST00000398631.2:c.1751C>T	5.37:g.140256808C>T	ENSP00000381628:p.Ser584Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75278|Q2M1N8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S584L	ENST00000398631.2	37	c.1751	CCDS47285.1	5	.	.	.	.	.	.	.	.	.	.	C	6.425	0.446456	0.12223	.	.	ENSG00000251664	ENST00000398631	T	0.39997	1.05	4.71	2.79	0.32731	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.41926	0.1180	M	0.80616	2.505	0.09310	N	1	B;P	0.34800	0.284;0.469	B;B	0.29176	0.099;0.082	T	0.37596	-0.9699	9	0.54805	T	0.06	.	8.7035	0.34340	0.0:0.7611:0.1521:0.0868	.	584;584	Q9UN75-2;Q9UN75	.;PCDAC_HUMAN	L	584	ENSP00000381628:S584L	ENSP00000381628:S584L	S	+	2	0	PCDHA12	140236992	0.000000	0.05858	0.001000	0.08648	0.012000	0.07955	-0.545000	0.06069	0.969000	0.38237	-0.291000	0.09656	TCG	PCDHA12	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000251664		0.682	PCDHA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA12	HGNC	protein_coding	OTTHUMT00000372882.2	57	0.00	0	C	NM_018903		140256808	140256808	+1	no_errors	ENST00000398631	ensembl	human	known	69_37n	missense	228	20.28	58	SNP	0.006	T
PCDHAC2	56134	genome.wustl.edu	37	5	140347416	140347416	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:140347416C>T	ENST00000289269.5	+	1	1597	c.1065C>T	c.(1063-1065)atC>atT	p.I355I	PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHAC1_ENST00000253807.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA2_ENST00000526136.1_Intron	NM_018899.5|NM_031883.2	NP_061722.1|NP_114089.1	Q9Y5I4	PCDC2_HUMAN	protocadherin alpha subfamily C, 2	355	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(10)|liver(2)|lung(9)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	45			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGTGGACATCGTGGACGTGA	0.577																																					Melanoma(190;638 2083 3390 11909 52360)	dbGAP											0													78.0	66.0	70.0					5																	140347416		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152474	CCDS4242.1	5q31	2010-11-26			ENSG00000243232	ENSG00000243232		"""Cadherins / Protocadherins : Clustered"""	8677	other	complex locus constituent		606321				10380929	Standard	NM_031883		Approved	PCDH-ALPHA-C2		Q9Y5I4	OTTHUMG00000129607	ENST00000289269.5:c.1065C>T	5.37:g.140347416C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3V1|Q9Y5F4	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I355	ENST00000289269.5	37	c.1065	CCDS4242.1	5																																																																																			PCDHAC2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	ENSG00000243232		0.577	PCDHAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHAC2	HGNC	protein_coding	OTTHUMT00000251802.2	11	0.00	0	C	NM_018899		140347416	140347416	+1	no_errors	ENST00000289269	ensembl	human	known	69_37n	silent	71	17.44	15	SNP	0.024	T
PCDHGB2	56103	genome.wustl.edu	37	5	140739809	140739809	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:140739809C>G	ENST00000522605.1	+	1	107	c.107C>G	c.(106-108)tCa>tGa	p.S36*	PCDHGA3_ENST00000253812.6_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	36	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATCCGCTATTCAATTCCAGAG	0.622											OREG0016857	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													36.0	40.0	38.0					5																	140739809		1877	4110	5987	-	-	-	SO:0001587	stop_gained	0			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.107C>G	5.37:g.140739809C>G	ENSP00000429018:p.Ser36*	Somatic	1658	WXS	Illumina GAIIx	Phase_IV	Q3MIJ3|Q9UN65	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S36*	ENST00000522605.1	37	c.107	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	19.87	3.907163	0.72868	.	.	ENSG00000253910	ENST00000522605	.	.	.	5.3	5.3	0.74995	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.9125	0.92491	0.0:1.0:0.0:0.0	.	.	.	.	X	36	.	ENSP00000429018:S36X	S	+	2	0	PCDHGB2	140719993	0.011000	0.17503	0.997000	0.53966	0.297000	0.27493	2.596000	0.46205	2.626000	0.88956	0.563000	0.77884	TCA	PCDHGB2	-	pfam_Cadherin_N,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000253910		0.622	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	39	0.00	0	C	NM_018923		140739809	140739809	+1	no_errors	ENST00000522605	ensembl	human	known	69_37n	nonsense	142	17.34	30	SNP	1.000	G
PCNX	22990	genome.wustl.edu	37	14	71492886	71492886	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr14:71492886G>C	ENST00000304743.2	+	14	3682	c.3236G>C	c.(3235-3237)tGc>tCc	p.C1079S	PCNX_ENST00000439984.3_Missense_Mutation_p.C968S|PCNX_ENST00000238570.5_Missense_Mutation_p.C1079S	NM_014982.2	NP_055797.2	Q96RV3	PCX1_HUMAN	pecanex homolog (Drosophila)	1079						integral component of membrane (GO:0016021)				NS(2)|biliary_tract(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(14)|liver(2)|lung(40)|ovary(1)|prostate(7)|skin(2)|urinary_tract(1)	87			KIRC - Kidney renal clear cell carcinoma(12;0.206)	all cancers(60;0.00835)|BRCA - Breast invasive adenocarcinoma(234;0.00951)|OV - Ovarian serous cystadenocarcinoma(108;0.0417)		TGCATATGTTGCGGTCTTATT	0.343																																						dbGAP											0													154.0	141.0	146.0					14																	71492886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF233450, AB018348	CCDS9806.1	14q24.2	2014-07-03							19740	protein-coding gene	gene with protein product			"""pecanex-like 1 (Drosophila)"""	PCNXL1		9244429, 15777640	Standard	NM_014982		Approved	KIAA0995, KIAA0805, pecanex	uc001xmo.2	Q96RV3		ENST00000304743.2:c.3236G>C	14.37:g.71492886G>C	ENSP00000304192:p.Cys1079Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR6|O94897|Q96AI7|Q9Y2J9	Missense_Mutation	SNP	pfam_Pecanex	p.C1079S	ENST00000304743.2	37	c.3236	CCDS9806.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.90|18.90	3.721923|3.721923	0.68959|0.68959	.|.	.|.	ENSG00000100731|ENSG00000100731	ENST00000554691|ENST00000304743;ENST00000238570;ENST00000439984	.|D;D;D	.|0.82619	.|-1.63;-1.63;-1.63	5.64|5.64	5.64|5.64	0.86602|0.86602	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.89649|0.89649	0.6776|0.6776	L|L	0.53561|0.53561	1.675|1.675	0.80722|0.80722	D|D	1|1	.|D;D	.|0.89917	.|1.0;0.993	.|D;D	.|0.87578	.|0.998;0.977	D|D	0.88563|0.88563	0.3124|0.3124	5|10	.|0.45353	.|T	.|0.12	.|.	19.6932|19.6932	0.96010|0.96010	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|968;1079	.|B2RTR6;Q96RV3	.|.;PCX1_HUMAN	P|S	138|1079;1079;968	.|ENSP00000304192:C1079S;ENSP00000238570:C1079S;ENSP00000396617:C968S	.|ENSP00000238570:C1079S	A|C	+|+	1|2	0|0	PCNX|PCNX	70562639|70562639	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.979000|0.979000	0.70002|0.70002	9.813000|9.813000	0.99286|0.99286	2.664000|2.664000	0.90586|0.90586	0.655000|0.655000	0.94253|0.94253	GCG|TGC	PCNX	-	NULL	ENSG00000100731		0.343	PCNX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNX	HGNC	protein_coding	OTTHUMT00000412479.1	246	0.40	1	G	NM_014982		71492886	71492886	+1	no_errors	ENST00000304743	ensembl	human	known	69_37n	missense	325	14.92	57	SNP	1.000	C
PCSK2	5126	genome.wustl.edu	37	20	17389950	17389950	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:17389950C>T	ENST00000262545.2	+	6	901	c.586C>T	c.(586-588)Cct>Tct	p.P196S	PCSK2_ENST00000536609.1_Missense_Mutation_p.P161S|PCSK2_ENST00000377899.1_Missense_Mutation_p.P177S	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	196	Peptidase S8.				cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CGACCCCTATCCTTACCCTCG	0.463																																						dbGAP											0													190.0	164.0	173.0					20																	17389950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.586C>T	20.37:g.17389950C>T	ENSP00000262545:p.Pro196Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.P196S	ENST00000262545.2	37	c.586	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.262192	0.95368	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.48836	0.8;0.8;0.8	5.91	5.91	0.95273	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.046469	0.85682	D	0.000000	T	0.73265	0.3565	M	0.88842	2.985	0.80722	D	1	P;D	0.71674	0.956;0.998	P;D	0.71414	0.9;0.973	T	0.77900	-0.2415	10	0.87932	D	0	-19.0796	15.7986	0.78433	0.0:1.0:0.0:0.0	.	161;196	B4DFQ3;P16519	.;NEC2_HUMAN	S	177;196;161	ENSP00000367131:P177S;ENSP00000262545:P196S;ENSP00000437458:P161S	ENSP00000262545:P196S	P	+	1	0	PCSK2	17337950	1.000000	0.71417	0.995000	0.50966	0.950000	0.60333	7.410000	0.80065	2.793000	0.96121	0.655000	0.94253	CCT	PCSK2	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000125851		0.463	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	HGNC	protein_coding	OTTHUMT00000078120.2	147	0.00	0	C	NM_002594		17389950	17389950	+1	no_errors	ENST00000262545	ensembl	human	known	69_37n	missense	252	25.44	86	SNP	1.000	T
PCSK5	5125	genome.wustl.edu	37	9	78638713	78638713	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:78638713G>C	ENST00000545128.1	+	4	1009	c.471G>C	c.(469-471)aaG>aaC	p.K157N	PCSK5_ENST00000376752.4_Missense_Mutation_p.K157N|PCSK5_ENST00000376767.3_Missense_Mutation_p.K157N	NM_001190482.1	NP_001177411.1	Q92824	PCSK5_HUMAN	proprotein convertase subtilisin/kexin type 5	157					anterior/posterior pattern specification (GO:0009952)|cell-cell signaling (GO:0007267)|cytokine biosynthetic process (GO:0042089)|embryo implantation (GO:0007566)|embryonic digestive tract development (GO:0048566)|embryonic skeletal system development (GO:0048706)|heart development (GO:0007507)|kidney development (GO:0001822)|limb morphogenesis (GO:0035108)|nerve growth factor processing (GO:0032455)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptide biosynthetic process (GO:0043043)|peptide hormone processing (GO:0016486)|protein processing (GO:0016485)|renin secretion into blood stream (GO:0002001)|respiratory tube development (GO:0030323)|signal peptide processing (GO:0006465)|viral life cycle (GO:0019058)	extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|secretory granule (GO:0030141)	peptidase activity (GO:0008233)|peptide binding (GO:0042277)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(7)|liver(2)|lung(25)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55						GAGCCTGGAAGAGAGGCTACA	0.458																																						dbGAP											0													159.0	141.0	147.0					9																	78638713		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6652.1, CCDS55320.1	9q21.13	2013-09-24			ENSG00000099139	ENSG00000099139			8747	protein-coding gene	gene with protein product		600488				7782070	Standard	NM_001190482		Approved	PC5, PC6, SPC6	uc004akc.2	Q92824	OTTHUMG00000020039	ENST00000545128.1:c.471G>C	9.37:g.78638713G>C	ENSP00000446280:p.Lys157Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H2G7|Q13527|Q96EP4	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Growth_fac_rcpt,superfamily_Prot_inh_propept,smart_Furin_repeat,smart_EGF-like,prints_Peptidase_S8_subtilisin-rel	p.K157N	ENST00000545128.1	37	c.471	CCDS55320.1	9	.	.	.	.	.	.	.	.	.	.	G	13.98	2.399193	0.42512	.	.	ENSG00000099139	ENST00000545128;ENST00000376767;ENST00000396108;ENST00000376752	T;T;T	0.46819	0.86;0.86;0.86	5.74	4.84	0.62591	.	.	.	.	.	T	0.47673	0.1458	L	0.57536	1.79	0.46927	D	0.999256	B;B	0.28439	0.185;0.212	B;B	0.34652	0.187;0.058	T	0.51172	-0.8739	9	0.72032	D	0.01	.	10.923	0.47176	0.1428:0.0:0.8572:0.0	.	157;157	Q92824-2;B1AMG5	.;.	N	157	ENSP00000446280:K157N;ENSP00000365958:K157N;ENSP00000365943:K157N	ENSP00000365943:K157N	K	+	3	2	PCSK5	77828533	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.275000	0.65575	1.561000	0.49584	0.561000	0.74099	AAG	PCSK5	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53	ENSG00000099139		0.458	PCSK5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK5	HGNC	protein_coding		100	0.00	0	G			78638713	78638713	+1	no_errors	ENST00000545128	ensembl	human	known	69_37n	missense	187	17.26	39	SNP	1.000	C
PDE12	201626	genome.wustl.edu	37	3	57543084	57543084	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:57543084G>A	ENST00000311180.8	+	1	1081	c.978G>A	c.(976-978)ctG>ctA	p.L326L	PDE12_ENST00000487257.1_Silent_p.L326L	NM_177966.5	NP_808881.3	Q6L8Q7	PDE12_HUMAN	phosphodiesterase 12	326					mRNA processing (GO:0006397)	mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|liver(4)|lung(3)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	20				KIRC - Kidney renal clear cell carcinoma(284;0.011)|Kidney(284;0.0127)		CCTACGCCCTGGAGCTCGACT	0.557																																					Colon(125;308 1634 19198 50622 50717)	dbGAP											0													73.0	68.0	70.0					3																	57543084		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074423	CCDS33772.1	3p14.3	2013-10-11			ENSG00000174840	ENSG00000174840			25386	protein-coding gene	gene with protein product	"""2'-phosphodiesterase"""					15231837	Standard	NM_177966		Approved	DKFZp667B1218, 2'-PDE	uc003diw.4	Q6L8Q7	OTTHUMG00000158599	ENST00000311180.8:c.978G>A	3.37:g.57543084G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU8|Q8IYU3|Q8NDU2|Q8TE78	Silent	SNP	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	p.L326	ENST00000311180.8	37	c.978	CCDS33772.1	3																																																																																			PDE12	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase	ENSG00000174840		0.557	PDE12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE12	HGNC	protein_coding	OTTHUMT00000351440.2	18	0.00	0	G	NM_177966		57543084	57543084	+1	no_errors	ENST00000311180	ensembl	human	known	69_37n	silent	73	22.34	21	SNP	1.000	A
PDE6C	5146	genome.wustl.edu	37	10	95380536	95380536	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr10:95380536G>A	ENST00000371447.3	+	2	766	c.628G>A	c.(628-630)Gaa>Aaa	p.E210K		NM_006204.3	NP_006195.3	P51160	PDE6C_HUMAN	phosphodiesterase 6C, cGMP-specific, cone, alpha prime	210	GAF 1.				phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|visual perception (GO:0007601)	plasma membrane (GO:0005886)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(12)|ovary(2)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.123)			Caffeine(DB00201)	CAAACAGGATGAAGAGGTAAT	0.423																																						dbGAP											0													169.0	165.0	167.0					10																	95380536		2203	4300	6503	-	-	-	SO:0001583	missense	0			U31973	CCDS7429.1	10q24	2013-01-23			ENSG00000095464	ENSG00000095464	3.1.4.17	"""Phosphodiesterases"""	8787	protein-coding gene	gene with protein product		600827					Standard	NM_006204		Approved	PDEA2, ACHM5, COD4	uc001kiu.4	P51160	OTTHUMG00000018775	ENST00000371447.3:c.628G>A	10.37:g.95380536G>A	ENSP00000360502:p.Glu210Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCR6|Q5VY29	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.E210K	ENST00000371447.3	37	c.628	CCDS7429.1	10	.	.	.	.	.	.	.	.	.	.	G	28.9	4.957261	0.92726	.	.	ENSG00000095464	ENST00000371447	T	0.68624	-0.34	5.23	5.23	0.72850	GAF (2);	0.047005	0.85682	D	0.000000	D	0.83031	0.5166	M	0.88181	2.935	0.58432	D	0.999995	D	0.61697	0.99	P	0.58820	0.846	D	0.85704	0.1315	10	0.59425	D	0.04	.	18.9873	0.92777	0.0:0.0:1.0:0.0	.	210	P51160	PDE6C_HUMAN	K	210	ENSP00000360502:E210K	ENSP00000360502:E210K	E	+	1	0	PDE6C	95370526	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.544000	0.73878	2.719000	0.93026	0.655000	0.94253	GAA	PDE6C	-	pfam_GAF,smart_GAF	ENSG00000095464		0.423	PDE6C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE6C	HGNC	protein_coding	OTTHUMT00000049437.1	172	0.00	0	G	NM_006204		95380536	95380536	+1	no_errors	ENST00000371447	ensembl	human	known	69_37n	missense	220	22.46	64	SNP	1.000	A
PDHA1	5160	genome.wustl.edu	37	X	19373844	19373844	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:19373844G>A	ENST00000422285.2	+	8	905	c.800G>A	c.(799-801)aGg>aAg	p.R267K	PDHA1_ENST00000540249.1_Missense_Mutation_p.R236K|PDHA1_ENST00000379804.1_5'UTR|PDHA1_ENST00000379806.5_Missense_Mutation_p.R305K|PDHA1_ENST00000545074.1_Missense_Mutation_p.R274K			P08559	ODPA_HUMAN	pyruvate dehydrogenase (lipoamide) alpha 1	267					acetyl-CoA biosynthetic process from pyruvate (GO:0006086)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pyruvate dehydrogenase complex (GO:0045254)	pyruvate dehydrogenase (acetyl-transferring) activity (GO:0004739)|pyruvate dehydrogenase activity (GO:0004738)			endometrium(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)	18	Hepatocellular(33;0.183)					GAGGCAACAAGGTTTGCTGCT	0.493																																						dbGAP											0													131.0	111.0	118.0					X																	19373844		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14192.1, CCDS55380.1, CCDS55381.1, CCDS55382.1	Xp22.1	2008-02-05			ENSG00000131828	ENSG00000131828	1.2.4.1		8806	protein-coding gene	gene with protein product		300502		PDHA			Standard	NM_001173454		Approved		uc004czh.4	P08559	OTTHUMG00000021224	ENST00000422285.2:c.800G>A	X.37:g.19373844G>A	ENSP00000394382:p.Arg267Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YVE9|B2R5P7|B7Z3T7|B7Z3X5|Q53H41|Q5JPT8|Q9NP12|Q9UBJ8|Q9UBU0|Q9UNG4|Q9UNG5	Missense_Mutation	SNP	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	p.R305K	ENST00000422285.2	37	c.914	CCDS14192.1	X	.	.	.	.	.	.	.	.	.	.	G	8.392	0.840048	0.16891	.	.	ENSG00000131828	ENST00000379806;ENST00000545074;ENST00000540249;ENST00000422285	D;D;D;D	0.94092	-3.35;-3.35;-3.35;-3.35	5.64	-6.18	0.02085	Dehydrogenase, E1 component (1);	0.331834	0.38837	N	0.001557	T	0.80226	0.4584	N	0.04018	-0.295	0.26661	N	0.971916	B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0	B;B;B;B;B	0.06405	0.002;0.001;0.002;0.001;0.002	T	0.60281	-0.7294	10	0.02654	T	1	-11.9596	20.3015	0.98615	0.9049:0.0:0.0951:0.0	.	236;274;267;305;267	B7Z3X5;B7Z3T7;B2R5P7;A5YVE9;P08559	.;.;.;.;ODPA_HUMAN	K	305;274;236;267	ENSP00000369134:R305K;ENSP00000438550:R274K;ENSP00000440761:R236K;ENSP00000394382:R267K	ENSP00000369134:R305K	R	+	2	0	PDHA1	19283765	0.919000	0.31177	0.377000	0.26055	0.969000	0.65631	0.151000	0.16283	-1.454000	0.01926	0.594000	0.82650	AGG	PDHA1	-	pfam_DH_E1,tigrfam_Pyrv_DH_E1_asu_subgrp-y	ENSG00000131828		0.493	PDHA1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PDHA1	HGNC	protein_coding	OTTHUMT00000055977.1	109	0.00	0	G			19373844	19373844	+1	no_errors	ENST00000379806	ensembl	human	known	69_37n	missense	280	14.37	47	SNP	0.890	A
PDXDC1	23042	genome.wustl.edu	37	16	15127253	15127253	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:15127253G>A	ENST00000396410.4	+	19	1906	c.1809G>A	c.(1807-1809)tcG>tcA	p.S603S	PDXDC1_ENST00000447912.2_Silent_p.S512S|PDXDC1_ENST00000569715.1_Silent_p.S576S|PDXDC1_ENST00000535621.2_Intron|PDXDC1_ENST00000450288.2_Silent_p.S575S|PDXDC1_ENST00000563679.1_Silent_p.S621S|PDXDC1_ENST00000325823.7_Silent_p.S588S	NM_015027.2	NP_055842.2	Q6P996	PDXD1_HUMAN	pyridoxal-dependent decarboxylase domain containing 1	603					carboxylic acid metabolic process (GO:0019752)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(10)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						AGGAGAACTCGAGGGTCCGTA	0.572																																						dbGAP											0													113.0	105.0	108.0					16																	15127253		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AK025504, BX647809	CCDS32393.1, CCDS66954.1, CCDS66957.1, CCDS73830.1, CCDS73831.1	16p13.11	2008-02-05							28995	protein-coding gene	gene with protein product		614244					Standard	XM_005255173		Approved	KIAA0251	uc002dda.4	Q6P996	OTTHUMG00000166304	ENST00000396410.4:c.1809G>A	16.37:g.15127253G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR55|B4DSL3|E7EMH5|E7EPL4|H3BNZ1|O00236|Q4F6X7|Q6PID7|Q86YF1|Q8N4Q9|Q8TBS5	Silent	SNP	pfam_PyrdxlP-dep_de-COase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.S603	ENST00000396410.4	37	c.1809	CCDS32393.1	16																																																																																			PDXDC1	-	NULL	ENSG00000179889		0.572	PDXDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDXDC1	HGNC	protein_coding	OTTHUMT00000389065.2	18	0.00	0	G	NM_015027		15127253	15127253	+1	no_errors	ENST00000396410	ensembl	human	known	69_37n	silent	72	25.77	25	SNP	0.944	A
PIK3CA	5290	genome.wustl.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	lung(4)|large_intestine(2)|breast(2)											89.0	78.0	82.0					3																	178938934		1917	4118	6035	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E726K	ENST00000263967.3	37	c.2176	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA	PIK3CA	-	superfamily_Kinase-like_dom	ENSG00000121879		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	112	0.00	0	G			178938934	178938934	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	154	21.43	42	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	86	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	139	25.67	48	SNP	1.000	G
PILRA	29992	genome.wustl.edu	37	7	99987590	99987590	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:99987590C>G	ENST00000198536.2	+	3	746	c.534C>G	c.(532-534)ctC>ctG	p.L178L	PILRA_ENST00000394000.2_Intron|PILRA_ENST00000453419.1_Intron|PILRA_ENST00000350573.2_Intron	NM_013439.2	NP_038467.2	Q9UKJ1	PILRA_HUMAN	paired immunoglobin-like type 2 receptor alpha	178					signal transduction (GO:0007165)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|pancreas(1)|skin(1)|urinary_tract(1)	15	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CAACCGGCCTCAGGGTCACAC	0.577																																						dbGAP											0													143.0	114.0	124.0					7																	99987590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161080	CCDS5691.1, CCDS5692.1, CCDS47660.1	7q22.1	2013-01-11			ENSG00000085514	ENSG00000085514		"""Immunoglobulin superfamily / V-set domain containing"""	20396	protein-coding gene	gene with protein product		605341				10660620	Standard	NM_178272		Approved	FDF03	uc003uuo.1	Q9UKJ1	OTTHUMG00000155248	ENST00000198536.2:c.534C>G	7.37:g.99987590C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHI1	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.L178	ENST00000198536.2	37	c.534	CCDS5691.1	7																																																																																			PILRA	-	NULL	ENSG00000085514		0.577	PILRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PILRA	HGNC	protein_coding	OTTHUMT00000339016.1	76	0.00	0	C	NM_013439		99987590	99987590	+1	no_errors	ENST00000198536	ensembl	human	known	69_37n	silent	336	13.40	52	SNP	0.001	G
PISD	23761	genome.wustl.edu	37	22	32019790	32019790	+	Intron	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr22:32019790C>T	ENST00000439502.2	-	4	545				PISD_ENST00000266095.5_Silent_p.L33L|PISD_ENST00000336566.4_Intron|PISD_ENST00000478893.1_5'UTR|PISD_ENST00000382151.2_Silent_p.L33L|PISD_ENST00000397500.1_Silent_p.L33L			Q9UG56	PISD_HUMAN	phosphatidylserine decarboxylase						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatidylserine decarboxylase activity (GO:0004609)			central_nervous_system(3)|endometrium(2)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)	12					Phosphatidylserine(DB00144)	ACATGCAGCTCAGCTGCCCCA	0.677																																						dbGAP											0													73.0	58.0	63.0					22																	32019790		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS13899.1	22q12.2	2011-01-25			ENSG00000241878	ENSG00000241878	4.1.1.65		8999	protein-coding gene	gene with protein product		612770				10591208	Standard	NM_014338		Approved	dJ858B16.2, PSDC	uc003alk.2	Q9UG56	OTTHUMG00000030252	ENST00000439502.2:c.322-1919G>A	22.37:g.32019790C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKM7|O43207|O95535|Q6IC28|Q96GQ2|Q9UGA9	Silent	SNP	pfam_PS_Dcarbxylase,tigrfam_PS_decarb	p.L33	ENST00000439502.2	37	c.99		22																																																																																			PISD	-	NULL	ENSG00000241878		0.677	PISD-001	KNOWN	basic	protein_coding	PISD	HGNC	protein_coding	OTTHUMT00000075106.4	15	0.00	0	C			32019790	32019790	-1	no_errors	ENST00000266095	ensembl	human	known	69_37n	silent	60	31.03	27	SNP	1.000	T
PNPLA7	375775	genome.wustl.edu	37	9	140437118	140437118	+	Silent	SNP	C	C	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:140437118C>A	ENST00000277531.4	-	6	753	c.567G>T	c.(565-567)cgG>cgT	p.R189R	PNPLA7_ENST00000406427.1_Silent_p.R214R	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7	189					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		AGACCTCCAGCCGCCCGTCCT	0.632																																						dbGAP											0													35.0	36.0	35.0					9																	140437118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.567G>T	9.37:g.140437118C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	Silent	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.R214	ENST00000277531.4	37	c.642	CCDS7045.1	9																																																																																			PNPLA7	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	ENSG00000130653		0.632	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	HGNC	protein_coding	OTTHUMT00000254787.1	8	0.00	0	C	NM_152286		140437118	140437118	-1	no_errors	ENST00000406427	ensembl	human	known	69_37n	silent	53	25.35	18	SNP	0.998	A
PPP4R1	9989	genome.wustl.edu	37	18	9588772	9588772	+	Silent	SNP	T	T	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr18:9588772T>C	ENST00000400556.3	-	5	448	c.375A>G	c.(373-375)ccA>ccG	p.P125P	PPP4R1_ENST00000580583.1_5'UTR|RP11-881L2.1_ENST00000584109.1_RNA|PPP4R1_ENST00000400555.3_Silent_p.P108P	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	125					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)			large_intestine(1)|skin(2)	3						AAAAAGCATATGGTATTGAAG	0.373																																					Melanoma(188;1232 2082 5061 11948 35994)	dbGAP											0													114.0	107.0	109.0					18																	9588772		1872	4104	5976	-	-	-	SO:0001819	synonymous_variant	0			AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.375A>G	18.37:g.9588772T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q99774|Q9UNQ7	Missense_Mutation	SNP	NULL	p.I90V	ENST00000400556.3	37	c.268	CCDS42412.1	18																																																																																			PPP4R1	-	NULL	ENSG00000154845		0.373	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP4R1	HGNC	protein_coding	OTTHUMT00000268571.1	179	0.00	0	T	NM_005134		9588772	9588772	-1	no_errors	ENST00000578875	ensembl	human	known	69_37n	missense	219	25.76	76	SNP	1.000	C
PTBP1	5725	genome.wustl.edu	37	19	810756	810756	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:810756T>G	ENST00000349038.4	+	14	1599	c.1526T>G	c.(1525-1527)aTt>aGt	p.I509S	PTBP1_ENST00000394601.4_Missense_Mutation_p.I528S|PTBP1_ENST00000356948.6_Missense_Mutation_p.I535S|PTBP1_ENST00000350092.4_Missense_Mutation_p.I175S|MIR3187_ENST00000583431.1_RNA	NM_031991.3	NP_114368.1	P26599	PTBP1_HUMAN	polypyrimidine tract binding protein 1	509	RRM 4. {ECO:0000255|PROSITE- ProRule:PRU00176}.				alternative mRNA splicing, via spliceosome (GO:0000380)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|negative regulation of muscle cell differentiation (GO:0051148)|negative regulation of RNA splicing (GO:0033119)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly-pyrimidine tract binding (GO:0008187)|pre-mRNA binding (GO:0036002)|RNA binding (GO:0003723)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)	19		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;0.000172)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAGGCCCTCATTGACCTGCAC	0.682																																						dbGAP											0													72.0	74.0	74.0					19																	810756		2203	4300	6503	-	-	-	SO:0001583	missense	0			X60648	CCDS32859.1, CCDS42456.1, CCDS45892.1	19p13.3	2013-07-16	2002-01-25	2002-01-25	ENSG00000011304	ENSG00000011304		"""RNA binding motif (RRM) containing"""	9583	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein I"""	600693	"""polypyrimidine tract binding protein (heterogeneous nuclear ribonucleoprotein I)"""	PTB		1906036, 11024286	Standard	NM_002819		Approved	HNRPI, HNRNP-I, PTB2, PTB3, PTB-1, PTB4, pPTB	uc002lpp.2	P26599		ENST00000349038.4:c.1526T>G	19.37:g.810756T>G	ENSP00000014112:p.Ile509Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUQ0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.I535S	ENST00000349038.4	37	c.1604	CCDS32859.1	19	.	.	.	.	.	.	.	.	.	.	T	23.2	4.387513	0.82902	.	.	ENSG00000011304	ENST00000356948;ENST00000394601;ENST00000349038;ENST00000350092	T;T;T;T	0.07216	3.21;3.21;3.21;3.21	5.38	5.38	0.77491	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.171217	0.49916	D	0.000129	T	0.33265	0.0857	M	0.85373	2.75	0.80722	D	1	D;D;D;D	0.89917	0.988;1.0;0.999;0.999	D;D;D;D	0.87578	0.97;0.998;0.997;0.996	T	0.18178	-1.0345	10	0.87932	D	0	-27.7986	14.5619	0.68144	0.0:0.0:0.0:1.0	.	175;509;528;535	A6NLN1;P26599;P26599-2;Q9BUQ0	.;PTBP1_HUMAN;.;.	S	535;528;509;175	ENSP00000349428:I535S;ENSP00000408096:I528S;ENSP00000014112:I509S;ENSP00000342332:I175S	ENSP00000014112:I509S	I	+	2	0	PTBP1	761756	1.000000	0.71417	0.969000	0.41365	0.976000	0.68499	6.052000	0.71080	2.027000	0.59764	0.533000	0.62120	ATT	PTBP1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	ENSG00000011304		0.682	PTBP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PTBP1	HGNC	protein_coding	OTTHUMT00000457605.1	23	0.00	0	T			810756	810756	+1	no_errors	ENST00000356948	ensembl	human	known	69_37n	missense	71	20.88	19	SNP	0.999	G
PSG6	5675	genome.wustl.edu	37	19	43420539	43420539	+	Silent	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:43420539G>C	ENST00000292125.2	-	2	209	c.165C>G	c.(163-165)gtC>gtG	p.V55V	PSG6_ENST00000402603.4_Silent_p.V55V|PSG6_ENST00000601833.1_5'UTR|PSG6_ENST00000187910.2_Silent_p.V55V	NM_002782.4	NP_002773.1	Q00889	PSG6_HUMAN	pregnancy specific beta-1-glycoprotein 6	55	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(19)|ovary(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	44		Prostate(69;0.00899)				GCAAATTGTGGACAAGTAGAA	0.438																																						dbGAP											0													200.0	199.0	199.0					19																	43420539		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0				CCDS12613.1, CCDS33038.1	19q13.2	2013-01-29			ENSG00000170848	ENSG00000170848		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9523	protein-coding gene	gene with protein product		176395				1690992	Standard	NM_002782		Approved			Q00889	OTTHUMG00000151127	ENST00000292125.2:c.165C>G	19.37:g.43420539G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O75244|Q15224|Q15235|Q549K1	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V55	ENST00000292125.2	37	c.165	CCDS12613.1	19																																																																																			PSG6	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000170848		0.438	PSG6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG6	HGNC	protein_coding	OTTHUMT00000321436.1	485	0.00	0	G	NM_002782		43420539	43420539	-1	no_errors	ENST00000292125	ensembl	human	known	69_37n	silent	537	18.70	124	SNP	0.009	C
QRSL1	55278	genome.wustl.edu	37	6	107096913	107096913	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr6:107096913G>C	ENST00000369046.4	+	5	498	c.394G>C	c.(394-396)Gat>Cat	p.D132H	QRSL1_ENST00000369044.1_Missense_Mutation_p.D132H	NM_018292.4	NP_060762.3			glutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1											endometrium(2)|kidney(1)|large_intestine(4)|lung(4)	11	Breast(9;0.0107)|all_epithelial(6;0.14)	all_cancers(87;0.00768)|Acute lymphoblastic leukemia(125;2.27e-07)|all_hematologic(75;1.38e-05)|all_epithelial(87;0.248)	Epithelial(6;0.000334)|all cancers(7;0.00157)|BRCA - Breast invasive adenocarcinoma(8;0.00721)|OV - Ovarian serous cystadenocarcinoma(5;0.0152)	BRCA - Breast invasive adenocarcinoma(108;0.118)|all cancers(137;0.167)|Epithelial(106;0.176)		TGGGAGCACAGATGGTGTATT	0.373																																					NSCLC(192;2127 2142 11668 26277 49545)	dbGAP											0													69.0	70.0	70.0					6																	107096913		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001851	CCDS5057.1	6q21	2014-08-04			ENSG00000130348	ENSG00000130348			21020	protein-coding gene	gene with protein product	"""glutamyl-tRNA(Gln) amidotransferase, subunit A"""					11230166, 19805282	Standard	NM_018292		Approved	GatA, FLJ10989, FLJ12189, DKFZP564C1278, FLJ13447	uc003prm.3	Q9H0R6	OTTHUMG00000015301	ENST00000369046.4:c.394G>C	6.37:g.107096913G>C	ENSP00000358042:p.Asp132His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Amidase,superfamily_Amidase_dom,tigrfam_GatA	p.D132H	ENST00000369046.4	37	c.394	CCDS5057.1	6	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469171	0.84533	.	.	ENSG00000130348	ENST00000369046;ENST00000369044	T;T	0.63255	1.56;-0.03	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	T	0.66684	0.2814	L	0.28400	0.85	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.78314	0.985;0.991	T	0.69221	-0.5202	10	0.66056	D	0.02	-26.1228	19.982	0.97329	0.0:0.0:1.0:0.0	.	132;132	Q9H0R6;Q9H0R6-2	GATA_HUMAN;.	H	132	ENSP00000358042:D132H;ENSP00000358040:D132H	ENSP00000358040:D132H	D	+	1	0	QRSL1	107203606	1.000000	0.71417	1.000000	0.80357	0.866000	0.49608	9.420000	0.97426	2.798000	0.96311	0.650000	0.86243	GAT	QRSL1	-	pfam_Amidase,superfamily_Amidase_dom,tigrfam_GatA	ENSG00000130348		0.373	QRSL1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	QRSL1	HGNC	protein_coding	OTTHUMT00000041667.1	141	0.70	1	G	NM_018292		107096913	107096913	+1	no_errors	ENST00000369046	ensembl	human	known	69_37n	missense	72	33.33	36	SNP	1.000	C
RALGAPA2	57186	genome.wustl.edu	37	20	20484088	20484088	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:20484088C>G	ENST00000202677.7	-	35	5122	c.5115G>C	c.(5113-5115)caG>caC	p.Q1705H		NM_020343.3	NP_065076.2	Q2PPJ7	RGPA2_HUMAN	Ral GTPase activating protein, alpha subunit 2 (catalytic)	1705	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	54						AAGGGGCCGTCTGCCCGGTGC	0.512																																						dbGAP											0													59.0	61.0	60.0					20																	20484088		1987	4177	6164	-	-	-	SO:0001583	missense	0			AL078634, DQ310704	CCDS46584.1	20p11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000188559	ENSG00000188559			16207	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 74"""	C20orf74		16490346, 19520869	Standard	NM_020343		Approved	dJ1049G11.4, AS250, KIAA1272, RapGAPalpha2	uc002wrz.3	Q2PPJ7	OTTHUMG00000032010	ENST00000202677.7:c.5115G>C	20.37:g.20484088C>G	ENSP00000202677:p.Gln1705His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXU6|Q5JUA3|Q5JUA4|Q5T9K3|Q96CX9|Q9BQT7|Q9H9D9|Q9ULE8	Missense_Mutation	SNP	pfam_Rap_GAP,superfamily_ARM-type_fold,pfscan_Rap_GAP	p.Q1705H	ENST00000202677.7	37	c.5115	CCDS46584.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.20|15.20	2.763052|2.763052	0.49574|0.49574	.|.	.|.	ENSG00000188559|ENSG00000188559	ENST00000417022;ENST00000202677|ENST00000430436;ENST00000427175	D;D|.	0.94046|.	-3.34;-3.34|.	5.75|5.75	3.62|3.62	0.41486|0.41486	Rap/ran-GAP (2);|.	0.068245|.	0.64402|.	D|.	0.000005|.	T|T	0.55321|0.55321	0.1913|0.1913	L|L	0.60845|0.60845	1.875|1.875	0.32689|0.32689	N|N	0.514437|0.514437	D;D;P|.	0.65815|.	0.959;0.995;0.946|.	D;P;P|.	0.63033|.	0.91;0.861;0.852|.	T|T	0.63726|0.63726	-0.6572|-0.6572	10|5	0.45353|.	T|.	0.12|.	.|.	8.8703|8.8703	0.35311|0.35311	0.0:0.709:0.0:0.291|0.0:0.709:0.0:0.291	.|.	1543;1705;1705|.	A8MSM5;Q2PPJ7-2;Q2PPJ7|.	.;.;RGPA2_HUMAN|.	H|T	135;1705|1522;116	ENSP00000408332:Q135H;ENSP00000202677:Q1705H|.	ENSP00000202677:Q1705H|.	Q|R	-|-	3|2	2|0	RALGAPA2|RALGAPA2	20432088|20432088	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.531000|0.531000	0.34715|0.34715	0.565000|0.565000	0.23578|0.23578	1.429000|1.429000	0.47314|0.47314	0.655000|0.655000	0.94253|0.94253	CAG|AGA	RALGAPA2	-	pfam_Rap_GAP,pfscan_Rap_GAP	ENSG00000188559		0.512	RALGAPA2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGAPA2	HGNC	protein_coding	OTTHUMT00000471941.1	37	0.00	0	C	NM_020343		20484088	20484088	-1	no_errors	ENST00000202677	ensembl	human	known	69_37n	missense	121	17.12	25	SNP	0.998	G
RBM6	10180	genome.wustl.edu	37	3	50091809	50091809	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:50091809C>G	ENST00000266022.4	+	8	1933	c.1674C>G	c.(1672-1674)ttC>ttG	p.F558L	RBM6_ENST00000442092.1_Missense_Mutation_p.F36L|RBM6_ENST00000443081.1_Missense_Mutation_p.F426L|RBM6_ENST00000539992.1_5'UTR|RBM6_ENST00000441115.1_3'UTR|RBM6_ENST00000422955.1_Missense_Mutation_p.F36L	NM_005777.2	NP_005768.1	P78332	RBM6_HUMAN	RNA binding motif protein 6	558					RNA processing (GO:0006396)	nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(3)|prostate(1)|skin(4)|urinary_tract(1)	33				BRCA - Breast invasive adenocarcinoma(193;6.81e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0084)|Kidney(197;0.00977)		CCTGTTCATTCTGCAAGAACC	0.373																																						dbGAP											0													186.0	194.0	192.0					3																	50091809		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF069517	CCDS2809.1, CCDS54586.1	3p21.3	2013-01-28			ENSG00000004534	ENSG00000004534		"""RNA binding motif (RRM) containing"", ""G patch domain containing"""	9903	protein-coding gene	gene with protein product		606886				10352938	Standard	NM_001167582		Approved	DEF-3, 3G2, NY-LU-12, g16, DEF3	uc003cyc.3	P78332	OTTHUMG00000156736	ENST00000266022.4:c.1674C>G	3.37:g.50091809C>G	ENSP00000266022:p.Phe558Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60549|O75524|Q86SS3	Missense_Mutation	SNP	pfam_G_patch_dom,smart_RRM_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_RRM_dom	p.F558L	ENST00000266022.4	37	c.1674	CCDS2809.1	3	.	.	.	.	.	.	.	.	.	.	C	12.31	1.900691	0.33535	.	.	ENSG00000004534	ENST00000442092;ENST00000266022;ENST00000443081;ENST00000422955;ENST00000446471	T;T;T;T;T	0.80909	0.95;1.59;1.6;0.95;-1.43	5.42	3.28	0.37604	.	0.793770	0.12032	N	0.505874	T	0.64000	0.2559	N	0.14661	0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.54057	-0.8350	9	.	.	.	0.4017	9.7227	0.40313	0.0:0.7615:0.0:0.2385	.	426;558	E9PGM9;P78332	.;RBM6_HUMAN	L	36;558;426;36;36	ENSP00000393530:F36L;ENSP00000266022:F558L;ENSP00000396466:F426L;ENSP00000392939:F36L;ENSP00000394336:F36L	.	F	+	3	2	RBM6	50066813	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	0.764000	0.26532	1.282000	0.44496	0.650000	0.86243	TTC	RBM6	-	NULL	ENSG00000004534		0.373	RBM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM6	HGNC	protein_coding	OTTHUMT00000345528.4	226	0.00	0	C	NM_005777		50091809	50091809	+1	no_errors	ENST00000266022	ensembl	human	known	69_37n	missense	299	20.48	77	SNP	0.997	G
RC3H2	54542	genome.wustl.edu	37	9	125642124	125642124	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:125642124C>T	ENST00000373670.1	-	7	1722	c.1122G>A	c.(1120-1122)ctG>ctA	p.L374L	SNORD90_ENST00000391145.1_RNA|RC3H2_ENST00000335387.5_Silent_p.L374L|RC3H2_ENST00000373665.2_Silent_p.L374L|RC3H2_ENST00000423239.2_Silent_p.L374L|RC3H2_ENST00000357244.2_Silent_p.L374L			Q9HBD1	RC3H2_HUMAN	ring finger and CCCH-type domains 2	374					B cell homeostasis (GO:0001782)|limb development (GO:0060173)|lung alveolus development (GO:0048286)|lymph node development (GO:0048535)|multicellular organism growth (GO:0035264)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|post-embryonic development (GO:0009791)|posttranscriptional regulation of gene expression (GO:0010608)|protein polyubiquitination (GO:0000209)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|T cell proliferation (GO:0042098)|T follicular helper cell differentiation (GO:0061470)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(6)|large_intestine(4)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	33						TTGCATTTTCCAGCTGCTCCC	0.438																																						dbGAP											0													65.0	64.0	65.0					9																	125642124		1864	4106	5970	-	-	-	SO:0001819	synonymous_variant	0			AK000308	CCDS43874.1, CCDS48014.1	9q34	2013-01-18	2010-09-15	2007-02-06	ENSG00000056586	ENSG00000056586		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, CCCH-type domain containing"""	21461	protein-coding gene	gene with protein product		615231	"""membrane associated DNA binding protein"", ""ring finger and CCCH-type zinc finger domains 2"""	MNAB		10938276	Standard	NM_001100588		Approved	FLJ20301, FLJ20713, RNF164	uc010mwc.1	Q9HBD1	OTTHUMG00000020632	ENST00000373670.1:c.1122G>A	9.37:g.125642124C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXB1|Q5JPD7|Q86ST6|Q8N3D6|Q96F27|Q9H5J2|Q9HBD2|Q9NWN9|Q9NXE1	Silent	SNP	pfam_Znf_CCCH,smart_Znf_RING,smart_Znf_CCCH,pfscan_Znf_RING	p.L374	ENST00000373670.1	37	c.1122	CCDS43874.1	9																																																																																			RC3H2	-	NULL	ENSG00000056586		0.438	RC3H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RC3H2	HGNC	protein_coding	OTTHUMT00000053966.1	108	0.00	0	C	NM_018835		125642124	125642124	-1	no_errors	ENST00000357244	ensembl	human	known	69_37n	silent	155	17.99	34	SNP	0.993	T
RFX8	731220	genome.wustl.edu	37	2	102083311	102083311	+	Silent	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:102083311G>C	ENST00000376826.2	-	2	125	c.126C>G	c.(124-126)ctC>ctG	p.L42L	RFX8_ENST00000428343.1_5'UTR			Q6ZV50	RFX8_HUMAN	RFX family member 8, lacking RFX DNA binding domain	42					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|stomach(1)	3						TCTCATACATGAGACAGCGAG	0.488																																						dbGAP											0													114.0	91.0	98.0					2																	102083311		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK124976	CCDS46376.1	2q11.2	2012-11-15	2012-11-15		ENSG00000196460	ENSG00000196460			37253	protein-coding gene	gene with protein product			"""regulatory factor X, 8"", ""RFX gene family member 8, lacking RFX DNA binding domain"""				Standard	NM_001145664		Approved	FLJ42986	uc010yvx.1	Q6ZV50	OTTHUMG00000130693	ENST00000376826.2:c.126C>G	2.37:g.102083311G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ32	Silent	SNP	pfam_DNA-bd_RFX	p.L42	ENST00000376826.2	37	c.126		2																																																																																			RFX8	-	pfam_DNA-bd_RFX	ENSG00000196460		0.488	RFX8-201	KNOWN	basic|appris_principal	protein_coding	RFX8	HGNC	protein_coding		103	0.00	0	G	NM_001145664		102083311	102083311	-1	no_errors	ENST00000376826	ensembl	human	known	69_37n	silent	228	16.79	46	SNP	1.000	C
RFTN2	130132	genome.wustl.edu	37	2	198495903	198495903	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:198495903C>G	ENST00000295049.4	-	5	1296	c.760G>C	c.(760-762)Gat>Cat	p.D254H		NM_144629.2	NP_653230.2	Q52LD8	RFTN2_HUMAN	raftlin family member 2	254					dsRNA transport (GO:0033227)|response to exogenous dsRNA (GO:0043330)	plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(13)|urinary_tract(3)	30						GTTGAATCATCATCAAAAGCA	0.373																																						dbGAP											0													75.0	67.0	70.0					2																	198495903		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK055136	CCDS2323.1	2q33.1	2008-02-05	2006-09-28	2006-09-28	ENSG00000162944	ENSG00000162944			26402	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 11"""	C2orf11			Standard	NM_144629		Approved	FLJ30574, Raftlin-2	uc002uuo.4	Q52LD8	OTTHUMG00000132746	ENST00000295049.4:c.760G>C	2.37:g.198495903C>G	ENSP00000295049:p.Asp254His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DH4|Q2TA69|Q53QE0|Q53SE1|Q96NM3	Missense_Mutation	SNP	NULL	p.D254H	ENST00000295049.4	37	c.760	CCDS2323.1	2	.	.	.	.	.	.	.	.	.	.	C	22.4	4.287047	0.80803	.	.	ENSG00000162944	ENST00000295049	T	0.33438	1.41	5.42	5.42	0.78866	.	0.165132	0.56097	D	0.000037	T	0.44307	0.1287	L	0.38531	1.155	0.42510	D	0.992967	D	0.64830	0.994	P	0.60473	0.875	T	0.31223	-0.9951	10	0.59425	D	0.04	-19.4908	17.7803	0.88522	0.0:1.0:0.0:0.0	.	254	Q52LD8	RFTN2_HUMAN	H	254	ENSP00000295049:D254H	ENSP00000295049:D254H	D	-	1	0	RFTN2	198204148	1.000000	0.71417	0.997000	0.53966	0.964000	0.63967	5.604000	0.67626	2.691000	0.91804	0.655000	0.94253	GAT	RFTN2	-	NULL	ENSG00000162944		0.373	RFTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFTN2	HGNC	protein_coding	OTTHUMT00000256106.2	75	0.00	0	C	NM_144629		198495903	198495903	-1	no_errors	ENST00000295049	ensembl	human	known	69_37n	missense	94	22.31	27	SNP	1.000	G
RLN2	6019	genome.wustl.edu	37	9	5300346	5300346	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:5300346C>T	ENST00000381627.3	-	2	698	c.310G>A	c.(310-312)Gag>Aag	p.E104K	RLN2_ENST00000308420.3_3'UTR	NM_134441.2	NP_604390.1	P04090	REL2_HUMAN	relaxin 2	104					female pregnancy (GO:0007565)	extracellular region (GO:0005576)				endometrium(2)|kidney(1)|large_intestine(2)|lung(6)	11	all_hematologic(13;0.137)	Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0201)|Lung(218;0.0987)		GGCTGCATCTCAGACAGGGTT	0.368																																						dbGAP											0													117.0	118.0	118.0					9																	5300346		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6460.1	9p24.1	2013-02-26	2004-11-15		ENSG00000107014	ENSG00000107014		"""Endogenous ligands"""	10027	protein-coding gene	gene with protein product	"""relaxin H2"", ""prorelaxin H2"", ""relaxin, ovarian, of pregnancy"""	179740	"""relaxin 2 (H2)"""			6548703, 6548702	Standard	NM_134441		Approved	H2, RLXH2, bA12D24.1.1, bA12D24.1.2	uc003zja.2	P04090	OTTHUMG00000019496	ENST00000381627.3:c.310G>A	9.37:g.5300346C>T	ENSP00000371040:p.Glu104Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVM0|Q99936|Q9UCX3|Q9UQJ2	Missense_Mutation	SNP	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Relaxin,prints_Insulin_family	p.E104K	ENST00000381627.3	37	c.310	CCDS6460.1	9	.	.	.	.	.	.	.	.	.	.	C	11.62	1.692568	0.30052	.	.	ENSG00000107014	ENST00000381627	T	0.41758	0.99	3.01	1.02	0.19986	Insulin-like (3);	2.114630	0.02137	N	0.056857	T	0.44414	0.1292	M	0.71036	2.16	0.09310	N	0.999998	P	0.41498	0.752	B	0.42625	0.393	T	0.15925	-1.0420	10	0.27082	T	0.32	.	3.3619	0.07189	0.2544:0.6045:0.0:0.1411	.	104	P04090	REL2_HUMAN	K	104	ENSP00000371040:E104K	ENSP00000371040:E104K	E	-	1	0	RLN2	5290346	0.000000	0.05858	0.011000	0.14972	0.011000	0.07611	0.098000	0.15189	0.280000	0.22209	0.650000	0.86243	GAG	RLN2	-	pfam_Insulin-like,superfamily_Insulin-like,smart_Insulin-like,prints_Relaxin	ENSG00000107014		0.368	RLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLN2	HGNC	protein_coding	OTTHUMT00000051619.1	221	0.00	0	C	NM_134441		5300346	5300346	-1	no_errors	ENST00000381627	ensembl	human	known	69_37n	missense	249	18.09	55	SNP	0.012	T
RNU11	26824	genome.wustl.edu	37	1	28975130	28975130	+	lincRNA	SNP	G	G	T	rs375949461		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:28975130G>T	ENST00000427804.1	+	0	1376				RNU11_ENST00000387069.1_lincRNA																							CTTCTGTCGTGAGTGGCACAC	0.458																																						dbGAP											0													149.0	136.0	140.0					1																	28975130		692	1591	2283	-	-	-			0																															1.37:g.28975130G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000427804.1	37	NULL		1																																																																																			RNU11	-	-	ENSG00000209804		0.458	RP11-442N24__B.1-002	KNOWN	basic	lincRNA	RNU11	HGNC	lincRNA	OTTHUMT00000010342.1	114	0.86	1	G			28975130	28975130	+1	no_errors	ENST00000387069	ensembl	human	known	69_37n	rna	186	19.83	46	SNP	1.000	T
RP1	6101	genome.wustl.edu	37	8	55538461	55538461	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr8:55538461G>T	ENST00000220676.1	+	4	2167	c.2019G>T	c.(2017-2019)aaG>aaT	p.K673N		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	673	Poly-Lys.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			GCAAAAAGAAGAAAAAATCTC	0.328																																					Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													33.0	35.0	34.0					8																	55538461		2202	4290	6492	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.2019G>T	8.37:g.55538461G>T	ENSP00000220676:p.Lys673Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.K673N	ENST00000220676.1	37	c.2019	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	G	9.096	1.002835	0.19121	.	.	ENSG00000104237	ENST00000220676	T	0.27890	1.64	5.93	3.21	0.36854	.	0.225098	0.30850	N	0.008755	T	0.46658	0.1404	M	0.61703	1.905	0.28747	N	0.901629	D	0.89917	1.0	D	0.69307	0.963	T	0.38067	-0.9678	10	0.87932	D	0	.	8.0188	0.30398	0.3403:0.0:0.6597:0.0	.	673	P56715	RP1_HUMAN	N	673	ENSP00000220676:K673N	ENSP00000220676:K673N	K	+	3	2	RP1	55701014	0.002000	0.14202	0.998000	0.56505	0.197000	0.23852	-0.100000	0.10990	0.868000	0.35678	-0.218000	0.12543	AAG	RP1	-	NULL	ENSG00000104237		0.328	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	35	0.00	0	G	NM_006269		55538461	55538461	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.935	T
RPTN	126638	genome.wustl.edu	37	1	152130351	152130351	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:152130351C>G	ENST00000316073.3	-	2	79	c.15G>C	c.(13-15)ctG>ctC	p.L5L		NM_001122965.1	NP_001116437.1	Q6XPR3	RPTN_HUMAN	repetin	5	S-100-like. {ECO:0000250}.					cornified envelope (GO:0001533)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|endometrium(14)|kidney(2)|large_intestine(1)|lung(32)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	59						GTATGCTATTCAGGAGTTGAG	0.443																																						dbGAP											0													154.0	126.0	134.0					1																	152130351		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			AK096436	CCDS41397.1	1q21.3	2013-01-10			ENSG00000215853	ENSG00000215853		"""EF-hand domain containing"""	26809	protein-coding gene	gene with protein product		613259				15854042	Standard	NM_001122965		Approved	FLJ39117	uc001ezs.1	Q6XPR3	OTTHUMG00000154095	ENST00000316073.3:c.15G>C	1.37:g.152130351C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBZ3	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.L5	ENST00000316073.3	37	c.15	CCDS41397.1	1																																																																																			RPTN	-	pfam_S100_Ca-bd_sub	ENSG00000215853		0.443	RPTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPTN	HGNC	protein_coding	OTTHUMT00000333867.1	206	0.00	0	C	XM_371312		152130351	152130351	-1	no_errors	ENST00000316073	ensembl	human	known	69_37n	silent	328	29.61	138	SNP	0.938	G
RYR3	6263	genome.wustl.edu	37	15	33952547	33952547	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr15:33952547G>A	ENST00000389232.4	+	34	4615	c.4545G>A	c.(4543-4545)gtG>gtA	p.V1515V	RYR3_ENST00000415757.3_Silent_p.V1515V	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1515	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CCGAGCGTGTGAGCGAGCGCC	0.657																																						dbGAP											0													23.0	26.0	25.0					15																	33952547		2165	4277	6442	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.4545G>A	15.37:g.33952547G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.V1515	ENST00000389232.4	37	c.4545	CCDS45210.1	15																																																																																			RYR3	-	NULL	ENSG00000198838		0.657	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	23	0.00	0	G			33952547	33952547	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	62	27.91	24	SNP	1.000	A
SASS6	163786	genome.wustl.edu	37	1	100598368	100598368	+	Start_Codon_SNP	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:100598368C>G	ENST00000287482.5	-	1	143	c.3G>C	c.(1-3)atG>atC	p.M1I	TRMT13_ENST00000370139.1_5'Flank|SASS6_ENST00000462159.1_5'UTR|TRMT13_ENST00000370143.1_5'Flank|TRMT13_ENST00000370141.2_5'Flank|SASS6_ENST00000535161.1_5'UTR	NM_194292.1	NP_919268.1	Q6UVJ0	SAS6_HUMAN	spindle assembly 6 homolog (C. elegans)	1					centriole replication (GO:0007099)|centrosome duplication (GO:0051298)	centriole (GO:0005814)|centrosome (GO:0005813)|deuterosome (GO:0098536)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	19		all_epithelial(167;4.58e-06)|all_lung(203;0.00125)|Lung NSC(277;0.00131)		Epithelial(280;0.085)|all cancers(265;0.139)|COAD - Colon adenocarcinoma(174;0.15)|Lung(183;0.197)		GCACTTGGCTCATGTTGGCTC	0.587																																						dbGAP											0													129.0	125.0	127.0					1																	100598368		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AL834265	CCDS764.1	1p21.3	2008-02-05			ENSG00000156876	ENSG00000156876			25403	protein-coding gene	gene with protein product		609321				15665853, 14654843	Standard	NM_194292		Approved	DKFZp761A078, SAS-6, FLJ22097, SAS6	uc001dsu.3	Q6UVJ0	OTTHUMG00000010754	ENST00000287482.5:c.3G>C	1.37:g.100598368C>G	ENSP00000287482:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT55|Q8N3K0	Missense_Mutation	SNP	NULL	p.M1I	ENST00000287482.5	37	c.3	CCDS764.1	1	.	.	.	.	.	.	.	.	.	.	C	24.4	4.522673	0.85600	.	.	ENSG00000156876	ENST00000287482	T	0.55234	0.53	4.65	4.65	0.58169	.	0.199326	0.48767	D	0.000166	T	0.67230	0.2871	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.72312	-0.4331	9	0.87932	D	0	-16.0815	15.0798	0.72106	0.0:1.0:0.0:0.0	.	1	Q6UVJ0	SAS6_HUMAN	I	1	ENSP00000287482:M1I	ENSP00000287482:M1I	M	-	3	0	SASS6	100370956	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	2.943000	0.49026	2.406000	0.81754	0.650000	0.86243	ATG	SASS6	-	NULL	ENSG00000156876		0.587	SASS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASS6	HGNC	protein_coding	OTTHUMT00000029656.2	50	0.00	0	C	NM_194292	Missense_Mutation	100598368	100598368	-1	no_errors	ENST00000287482	ensembl	human	known	69_37n	missense	128	16.88	26	SNP	1.000	G
SERPINA12	145264	genome.wustl.edu	37	14	94964318	94964318	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr14:94964318G>A	ENST00000341228.2	-	3	1212	c.417C>T	c.(415-417)ttC>ttT	p.F139F	SERPINA12_ENST00000556881.1_Silent_p.F139F	NM_173850.2	NP_776249.1	Q8IW75	SPA12_HUMAN	serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12	139					negative regulation of endopeptidase activity (GO:0010951)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)	p.F139L(1)		breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(7)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33				COAD - Colon adenocarcinoma(157;0.235)		TCTGGTCAATGAACAGCGTGT	0.468																																						dbGAP											1	Substitution - Missense(1)	lung(1)											137.0	133.0	135.0					14																	94964318		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY177692	CCDS9926.1	14q32.13	2014-02-21	2005-08-18		ENSG00000165953	ENSG00000165953		"""Serine (or cysteine) peptidase inhibitors"""	18359	protein-coding gene	gene with protein product			"""serine (or cysteine) proteinase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 12"""			24172014	Standard	NM_173850		Approved	OL-64, Vaspin	uc001ydj.3	Q8IW75	OTTHUMG00000171349	ENST00000341228.2:c.417C>T	14.37:g.94964318G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	p.F139	ENST00000341228.2	37	c.417	CCDS9926.1	14																																																																																			SERPINA12	-	pfam_Sepin_dom,superfamily_Sepin_dom,smart_Sepin_dom	ENSG00000165953		0.468	SERPINA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINA12	HGNC	protein_coding	OTTHUMT00000413097.1	128	0.00	0	G	NM_173850		94964318	94964318	-1	no_errors	ENST00000341228	ensembl	human	known	69_37n	silent	343	17.15	71	SNP	0.430	A
SETD5	55209	genome.wustl.edu	37	3	9517426	9517426	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:9517426C>G	ENST00000406341.1	+	22	4170	c.3980C>G	c.(3979-3981)tCt>tGt	p.S1327C	SETD5_ENST00000402198.1_Missense_Mutation_p.S1327C|SETD5_ENST00000302463.6_Missense_Mutation_p.S1229C|SETD5_ENST00000402466.1_Missense_Mutation_p.S1229C|SETD5_ENST00000407969.1_Missense_Mutation_p.S1346C			Q9C0A6	SETD5_HUMAN	SET domain containing 5	1327	Ser-rich.									NS(2)|breast(3)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(3)|prostate(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(99;0.227)			OV - Ovarian serous cystadenocarcinoma(96;0.112)		CAGCCACATTCTGGAAACAGC	0.577																																						dbGAP											0													34.0	35.0	35.0					3																	9517426		1977	4176	6153	-	-	-	SO:0001583	missense	0			BC020956	CCDS46741.1, CCDS74892.1	3p25.3	2011-12-13			ENSG00000168137	ENSG00000168137			25566	protein-coding gene	gene with protein product		615743				11214970	Standard	XM_005265299		Approved	FLJ10707	uc003brt.3	Q9C0A6	OTTHUMG00000150491	ENST00000406341.1:c.3980C>G	3.37:g.9517426C>G	ENSP00000383939:p.Ser1327Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AI17|Q8WUB6|Q9H3X4|Q9H6V7|Q9H7S3|Q9NVI9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.S1327C	ENST00000406341.1	37	c.3980	CCDS46741.1	3	.	.	.	.	.	.	.	.	.	.	C	10.05	1.245038	0.22796	.	.	ENSG00000168137	ENST00000402198;ENST00000402466;ENST00000406341;ENST00000407969;ENST00000302463	D;D;D;D;D	0.92965	-2.82;-3.14;-2.82;-2.81;-3.14	5.23	4.3	0.51218	.	0.175760	0.39834	N	0.001260	D	0.82305	0.5008	N	0.08118	0	0.29392	N	0.862565	B;B;B	0.17667	0.023;0.012;0.003	B;B;B	0.16722	0.016;0.011;0.002	T	0.76342	-0.2994	10	0.51188	T	0.08	-11.8057	10.7133	0.45997	0.144:0.7163:0.1397:0.0	.	996;1229;1327	B3KXG4;Q9C0A6-3;Q9C0A6	.;.;SETD5_HUMAN	C	1327;1229;1327;1346;1229	ENSP00000385852:S1327C;ENSP00000384429:S1229C;ENSP00000383939:S1327C;ENSP00000384114:S1346C;ENSP00000302028:S1229C	ENSP00000302028:S1229C	S	+	2	0	SETD5	9492426	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.122000	0.50446	2.586000	0.87340	0.591000	0.81541	TCT	SETD5	-	NULL	ENSG00000168137		0.577	SETD5-001	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	SETD5	HGNC	protein_coding	OTTHUMT00000318425.1	53	0.00	0	C	XM_371614		9517426	9517426	+1	no_errors	ENST00000402198	ensembl	human	known	69_37n	missense	84	20.75	22	SNP	1.000	G
SFMBT2	57713	genome.wustl.edu	37	10	7217979	7217979	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr10:7217979A>G	ENST00000361972.4	-	17	2047	c.1957T>C	c.(1957-1959)Tgc>Cgc	p.C653R	SFMBT2_ENST00000397167.1_Missense_Mutation_p.C653R	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	653					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TGAATGGAGCAGTTCTCTGGG	0.413																																						dbGAP											0													187.0	186.0	186.0					10																	7217979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1957T>C	10.37:g.7217979A>G	ENSP00000355109:p.Cys653Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.C653R	ENST00000361972.4	37	c.1957	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	A	21.3	4.123190	0.77436	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.26810	1.71;1.71	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.51449	0.1675	M	0.72894	2.215	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.52975	-0.8503	10	0.62326	D	0.03	.	16.2025	0.82095	1.0:0.0:0.0:0.0	.	653	Q5VUG0	SMBT2_HUMAN	R	653	ENSP00000355109:C653R;ENSP00000380353:C653R	ENSP00000355109:C653R	C	-	1	0	SFMBT2	7257985	1.000000	0.71417	1.000000	0.80357	0.819000	0.46315	8.809000	0.91944	2.231000	0.72958	0.459000	0.35465	TGC	SFMBT2	-	NULL	ENSG00000198879		0.413	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	204	0.00	0	A	NM_001029880		7217979	7217979	-1	no_errors	ENST00000361972	ensembl	human	known	69_37n	missense	216	28.71	87	SNP	1.000	G
SH3PXD2B	285590	genome.wustl.edu	37	5	171766111	171766111	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:171766111G>A	ENST00000311601.5	-	13	2168	c.1998C>T	c.(1996-1998)ctC>ctT	p.L666L	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	666					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GCTTACTCCTGAGGTTGCAGA	0.587																																						dbGAP											0													99.0	94.0	96.0					5																	171766111		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1998C>T	5.37:g.171766111G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B6F0V2|Q9P2Q1	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.L666	ENST00000311601.5	37	c.1998	CCDS34291.1	5																																																																																			SH3PXD2B	-	NULL	ENSG00000174705		0.587	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	68	0.00	0	G	NM_017963		171766111	171766111	-1	no_errors	ENST00000311601	ensembl	human	known	69_37n	silent	226	16.54	45	SNP	0.994	A
SHISA7	729956	genome.wustl.edu	37	19	55949000	55949000	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:55949000C>T	ENST00000376325.4	-	3	947	c.948G>A	c.(946-948)ctG>ctA	p.L316L		NM_001145176.1	NP_001138648.1	A6NL88	SHSA7_HUMAN	shisa family member 7	316						integral component of membrane (GO:0016021)				skin(1)	1						AGTAGCGGTTCAGCTCGGATT	0.662																																						dbGAP											0													36.0	43.0	41.0					19																	55949000		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS46193.1	19q13.42	2013-07-31	2013-07-31					"""Shisa homologs"""	35409	protein-coding gene	gene with protein product			"""shisa homolog 7 (Xenopus laevis)"""				Standard	NM_001145176		Approved		uc002qkz.3	A6NL88		ENST00000376325.4:c.948G>A	19.37:g.55949000C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L316	ENST00000376325.4	37	c.948	CCDS46193.1	19																																																																																			SHISA7	-	NULL	ENSG00000187902		0.662	SHISA7-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA7	HGNC	protein_coding	OTTHUMT00000334533.2	31	0.00	0	C	NM_001145176		55949000	55949000	-1	no_errors	ENST00000376325	ensembl	human	known	69_37n	silent	82	11.83	11	SNP	1.000	T
SIDT1	54847	genome.wustl.edu	37	3	113325917	113325917	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:113325917C>T	ENST00000264852.4	+	15	2160	c.1434C>T	c.(1432-1434)atC>atT	p.I478I	SIDT1_ENST00000393830.3_Silent_p.I478I|SIDT1_ENST00000463226.1_Intron	NM_017699.2	NP_060169.2	Q9NXL6	SIDT1_HUMAN	SID1 transmembrane family, member 1	478					dsRNA transport (GO:0033227)	integral component of membrane (GO:0016021)	RNA transmembrane transporter activity (GO:0051033)			breast(1)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|liver(2)|lung(15)|ovary(3)|pancreas(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	50						ACCAGGACATCTGTTACTACA	0.493																																						dbGAP											0													153.0	123.0	133.0					3																	113325917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK000181	CCDS2974.1	3q13.31	2009-11-26			ENSG00000072858	ENSG00000072858			25967	protein-coding gene	gene with protein product		606816					Standard	NM_017699		Approved	FLJ20174, SID-1	uc003eak.3	Q9NXL6	OTTHUMG00000159299	ENST00000264852.4:c.1434C>T	3.37:g.113325917C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RR4	Silent	SNP	NULL	p.I478	ENST00000264852.4	37	c.1434	CCDS2974.1	3																																																																																			SIDT1	-	NULL	ENSG00000072858		0.493	SIDT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIDT1	HGNC	protein_coding	OTTHUMT00000317564.1	85	0.00	0	C	NM_017699		113325917	113325917	+1	no_errors	ENST00000393830	ensembl	human	known	69_37n	silent	137	17.47	29	SNP	1.000	T
SLC30A5	64924	genome.wustl.edu	37	5	68414426	68414426	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:68414426C>T	ENST00000396591.3	+	12	2150	c.1540C>T	c.(1540-1542)Cct>Tct	p.P514S	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	514					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		ATTGATTGATCCTCCAGAATT	0.313																																						dbGAP											0													144.0	149.0	147.0					5																	68414426		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1540C>T	5.37:g.68414426C>T	ENSP00000379836:p.Pro514Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.P514S	ENST00000396591.3	37	c.1540	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	C	32	5.122792	0.94429	.	.	ENSG00000145740	ENST00000396591;ENST00000438236	T	0.69175	-0.38	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	D	0.88793	0.6533	H	0.96604	3.85	0.80722	D	1	D;P;D	0.76494	0.996;0.918;0.999	D;P;D	0.83275	0.996;0.882;0.996	D	0.91427	0.5163	10	0.72032	D	0.01	.	19.4112	0.94673	0.0:1.0:0.0:0.0	.	343;343;514	Q9H9X0;Q8TAD4-2;Q8TAD4	.;.;ZNT5_HUMAN	S	514;127	ENSP00000379836:P514S	ENSP00000379836:P514S	P	+	1	0	SLC30A5	68450182	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.758000	0.85224	2.880000	0.98712	0.650000	0.86243	CCT	SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.313	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	385	0.00	0	C			68414426	68414426	+1	no_errors	ENST00000396591	ensembl	human	known	69_37n	missense	359	14.73	62	SNP	1.000	T
SLC27A6	28965	genome.wustl.edu	37	5	128326091	128326091	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:128326091G>A	ENST00000262462.4	+	4	1913	c.903G>A	c.(901-903)aaG>aaA	p.K301K	SLC27A6_ENST00000506176.1_Silent_p.K301K|SLC27A6_ENST00000395266.1_Silent_p.K301K			Q9Y2P4	S27A6_HUMAN	solute carrier family 27 (fatty acid transporter), member 6	301					long-chain fatty acid metabolic process (GO:0001676)|long-chain fatty acid transport (GO:0015909)|transmembrane transport (GO:0055085)|very long-chain fatty acid metabolic process (GO:0000038)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	long-chain fatty acid-CoA ligase activity (GO:0004467)|nucleotide binding (GO:0000166)|very long-chain fatty acid-CoA ligase activity (GO:0031957)			NS(2)|endometrium(1)|kidney(3)|large_intestine(11)|liver(1)|lung(20)|prostate(1)|skin(4)|stomach(1)	44		all_cancers(142;0.0483)|Prostate(80;0.055)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.171)|OV - Ovarian serous cystadenocarcinoma(64;0.186)		GTGACTGCAAGAAGTATGATG	0.358																																						dbGAP											0													131.0	126.0	128.0					5																	128326091		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF064254	CCDS4145.1	5q23.3	2013-05-22			ENSG00000113396	ENSG00000113396		"""Acyl-CoA synthetase family"", ""Solute carriers"""	11000	protein-coding gene	gene with protein product	"""fatty-acid-Coenzyme A ligase, very long-chain 2"""	604196				12556534, 10479480	Standard	XM_005271967		Approved	FATP6, VLCS-H1, FACVL2, ACSVL2	uc003kuy.3	Q9Y2P4	OTTHUMG00000128991	ENST00000262462.4:c.903G>A	5.37:g.128326091G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IAM5|Q7Z6E6|Q86YF6	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.K301	ENST00000262462.4	37	c.903	CCDS4145.1	5																																																																																			SLC27A6	-	pfam_AMP-dep_Synth/Lig	ENSG00000113396		0.358	SLC27A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A6	HGNC	protein_coding	OTTHUMT00000250980.1	357	0.00	0	G	NM_014031		128326091	128326091	+1	no_errors	ENST00000262462	ensembl	human	known	69_37n	silent	476	13.92	77	SNP	0.845	A
SLCO1B3	28234	genome.wustl.edu	37	12	21054322	21054322	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:21054322G>C	ENST00000381545.3	+	15	2005	c.1786G>C	c.(1786-1788)Gat>Cat	p.D596H	SLCO1B3_ENST00000261196.2_Missense_Mutation_p.D596H|SLCO1B7_ENST00000554957.1_Intron|LST3_ENST00000381541.3_Intron|LST3_ENST00000540229.1_Missense_Mutation_p.D596H|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.D596H	NM_019844.3	NP_062818.1	Q9NPD5	SO1B3_HUMAN	solute carrier organic anion transporter family, member 1B3	596					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|organic anion transport (GO:0015711)|small molecule metabolic process (GO:0044281)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	organic anion transmembrane transporter activity (GO:0008514)	p.D596N(1)		breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(23)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(2)	63	Esophageal squamous(101;0.149)				Atorvastatin(DB01076)|Cabazitaxel(DB06772)|Caspofungin(DB00520)|Conjugated Estrogens(DB00286)|Dabrafenib(DB08912)|Digoxin(DB00390)|Docetaxel(DB01248)|Estradiol(DB00783)|Fexofenadine(DB00950)|Fluvastatin(DB01095)|Gadoxetate(DB08884)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)|Methotrexate(DB00563)|Mycophenolate mofetil(DB00688)|Olmesartan(DB00275)|Ouabain(DB01092)|Paclitaxel(DB01229)|Pioglitazone(DB01132)|Pitavastatin(DB08860)|Pravastatin(DB00175)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Rosuvastatin(DB01098)|Valsartan(DB00177)	GGCTCTGATTGATAAAACATG	0.378																																						dbGAP											1	Substitution - Missense(1)	lung(1)											183.0	177.0	179.0					12																	21054322		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8684.1	12p12	2013-05-22	2003-11-25	2003-11-26		ENSG00000111700		"""Solute carriers"""	10961	protein-coding gene	gene with protein product		605495	"""solute carrier family 21 (organic anion transporter), member 8"""	SLC21A8			Standard	NM_019844		Approved	OATP8, OATP1B3	uc001rel.4	Q9NPD5	OTTHUMG00000169011	ENST00000381545.3:c.1786G>C	12.37:g.21054322G>C	ENSP00000370956:p.Asp596His	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMT8|Q5JAR4	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.D596H	ENST00000381545.3	37	c.1786	CCDS8684.1	12	.	.	.	.	.	.	.	.	.	.	.	18.30	3.593024	0.66219	.	.	ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000111700;ENSG00000257046	ENST00000261196;ENST00000381545;ENST00000553473;ENST00000544370;ENST00000540229	T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78	4.53	4.53	0.55603	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.90143	0.6920	H	0.95816	3.725	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93337	0.6706	10	0.87932	D	0	.	16.3829	0.83481	0.0:0.0:1.0:0.0	.	596;596;596	Q5JAR4;B3KP78;Q9NPD5	.;.;SO1B3_HUMAN	H	596;596;596;420;596	ENSP00000261196:D596H;ENSP00000370956:D596H;ENSP00000451758:D596H;ENSP00000443225:D420H;ENSP00000441269:D596H	ENSP00000441269:D596H	D	+	1	0	SLCO1B3;RP11-545J16.1	20945589	1.000000	0.71417	0.991000	0.47740	0.756000	0.42949	7.840000	0.86819	2.213000	0.71641	0.313000	0.20887	GAT	SLCO1B3	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000111700		0.378	SLCO1B3-001	KNOWN	upstream_ATG|basic|appris_candidate|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000401936.1	446	0.22	1	G	NM_019844		21054322	21054322	+1	no_errors	ENST00000553473	ensembl	human	known	69_37n	missense	349	18.84	81	SNP	1.000	C
SON	6651	genome.wustl.edu	37	21	34932323	34932323	+	Intron	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr21:34932323C>G	ENST00000356577.4	+	6	7132				SON_ENST00000381692.2_Intron|SON_ENST00000290239.6_Intron|SON_ENST00000300278.4_Missense_Mutation_p.I2266M	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein						cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						ACAGTGTTATCACATCCCTAC	0.458																																						dbGAP											0													124.0	108.0	113.0					21																	34932323		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.6657+242C>G	21.37:g.34932323C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.I2266M	ENST00000356577.4	37	c.6798	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	C	11.67	1.706780	0.30232	.	.	ENSG00000159140	ENST00000300278	T	0.11385	2.78	5.58	5.58	0.84498	.	.	.	.	.	T	0.20007	0.0481	.	.	.	0.80722	D	1	P	0.41131	0.739	P	0.48400	0.576	T	0.00132	-1.2012	8	0.48119	T	0.1	.	15.0702	0.72030	0.0:1.0:0.0:0.0	.	2266	P18583-3	.	M	2266	ENSP00000300278:I2266M	ENSP00000300278:I2266M	I	+	3	3	SON	33854193	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.549000	0.53681	2.629000	0.89072	0.563000	0.77884	ATC	SON	-	NULL	ENSG00000159140		0.458	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	98	0.00	0	C	NM_138927		34932323	34932323	+1	no_errors	ENST00000300278	ensembl	human	known	69_37n	missense	177	17.97	39	SNP	1.000	G
SPATA6	54558	genome.wustl.edu	37	1	48865165	48865165	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:48865165G>A	ENST00000371847.3	-	7	802	c.638C>T	c.(637-639)tCa>tTa	p.S213L	SPATA6_ENST00000396199.3_Missense_Mutation_p.S141L|SPATA6_ENST00000371843.3_Missense_Mutation_p.S213L|SPATA6_ENST00000463938.1_5'UTR	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	213					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						GTGTGATTTTGAAGAAATTGT	0.413																																						dbGAP											0													262.0	267.0	265.0					1																	48865165		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.638C>T	1.37:g.48865165G>A	ENSP00000360913:p.Ser213Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3N7|Q8WUE6	Missense_Mutation	SNP	NULL	p.S213L	ENST00000371847.3	37	c.638	CCDS551.1	1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.803755	0.90623	.	.	ENSG00000132122	ENST00000371847;ENST00000371843;ENST00000396199;ENST00000371841	T;T;T;T	0.69435	2.52;2.5;2.51;-0.4	5.39	5.39	0.77823	.	0.257735	0.34580	N	0.003852	T	0.77405	0.4125	L	0.45137	1.4	0.53688	D	0.999972	D;P;D;D	0.76494	0.957;0.734;0.999;0.999	P;B;D;D	0.80764	0.832;0.391;0.994;0.994	T	0.79364	-0.1834	10	0.87932	D	0	.	18.1317	0.89604	0.0:0.0:1.0:0.0	.	141;141;213;213	B4DX17;A8MU33;Q9NWH7-2;Q9NWH7	.;.;.;SPAT6_HUMAN	L	213;213;141;54	ENSP00000360913:S213L;ENSP00000360909:S213L;ENSP00000379502:S141L;ENSP00000360907:S54L	ENSP00000360907:S54L	S	-	2	0	SPATA6	48637752	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.965000	0.87945	2.509000	0.84616	0.555000	0.69702	TCA	SPATA6	-	NULL	ENSG00000132122		0.413	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA6	HGNC	protein_coding	OTTHUMT00000021347.1	387	0.00	0	G	NM_019073		48865165	48865165	-1	no_errors	ENST00000371847	ensembl	human	known	69_37n	missense	314	19.80	78	SNP	1.000	A
SPO11	23626	genome.wustl.edu	37	20	55909851	55909851	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:55909851G>A	ENST00000371263.3	+	6	665	c.556G>A	c.(556-558)Gag>Aag	p.E186K	SPO11_ENST00000345868.4_Missense_Mutation_p.E148K|SPO11_ENST00000371260.4_Missense_Mutation_p.E148K	NM_012444.2	NP_036576.1	Q9Y5K1	SPO11_HUMAN	SPO11 meiotic protein covalently bound to DSB	186					DNA catabolic process, endonucleolytic (GO:0000737)|female gamete generation (GO:0007292)|male meiosis I (GO:0007141)|ovarian follicle development (GO:0001541)|protein localization to chromosome (GO:0034502)|reciprocal meiotic recombination (GO:0007131)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	chromosome, telomeric region (GO:0000781)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|hydrolase activity (GO:0016787)			autonomic_ganglia(1)|breast(3)|large_intestine(4)|lung(8)|skin(2)	18	Lung NSC(12;0.0066)|all_lung(29;0.0188)|Melanoma(10;0.242)		BRCA - Breast invasive adenocarcinoma(4;1.73e-14)|Epithelial(14;9.02e-10)|all cancers(14;9.31e-09)			AAGATACATCGAGGAAGATGG	0.358								Editing and processing nucleases																														dbGAP											0													107.0	103.0	104.0					20																	55909851		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169385	CCDS13456.1, CCDS13457.1	20q13.31	2013-06-05	2013-06-05		ENSG00000054796	ENSG00000054796			11250	protein-coding gene	gene with protein product	"""cancer/testis antigen 35"", ""spermatogenesis associated 43"""	605114	"""SPO11, meiotic protein covalently bound to DSB (S. cerevisiae)-like"", ""SPO11 meiotic protein covalently bound to DSB-like (S. cerevisiae)"", ""SPO11 meiotic protein covalently bound to DSB homolog (S. cerevisiae)"""			10534401	Standard	NM_012444		Approved	CT35, SPATA43, TOPVIA	uc002xye.3	Q9Y5K1	OTTHUMG00000032817	ENST00000371263.3:c.556G>A	20.37:g.55909851G>A	ENSP00000360310:p.Glu186Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TCI1|Q8N4V0|Q9NQM7|Q9NQM8	Missense_Mutation	SNP	pfam_Meiosis_Spo11,pfam_Spo11/TopoVI_A_N,superfamily_Spo11/TopoVI_A,prints_Meiotic_Spo11,prints_Spo11/TopoVI_A,prints_TopoVI_A	p.E186K	ENST00000371263.3	37	c.556	CCDS13456.1	20	.	.	.	.	.	.	.	.	.	.	G	18.93	3.728429	0.69074	.	.	ENSG00000054796	ENST00000371263;ENST00000345868;ENST00000371260;ENST00000418127	T;T;T;T	0.30448	1.53;1.53;1.53;1.53	5.21	5.21	0.72293	.	0.049256	0.85682	D	0.000000	T	0.52041	0.1710	M	0.77313	2.365	0.58432	D	0.999999	D;D	0.76494	0.999;0.998	P;P	0.59889	0.865;0.844	T	0.47586	-0.9106	10	0.15066	T	0.55	-25.6766	19.1051	0.93291	0.0:0.0:1.0:0.0	.	148;186	Q9Y5K1-2;Q9Y5K1	.;SPO11_HUMAN	K	186;148;148;164	ENSP00000360310:E186K;ENSP00000316034:E148K;ENSP00000360307:E148K;ENSP00000413185:E164K	ENSP00000316034:E148K	E	+	1	0	SPO11	55343258	1.000000	0.71417	0.879000	0.34478	0.049000	0.14656	8.792000	0.91856	2.568000	0.86640	0.563000	0.77884	GAG	SPO11	-	superfamily_Spo11/TopoVI_A	ENSG00000054796		0.358	SPO11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPO11	HGNC	protein_coding	OTTHUMT00000079836.2	200	0.00	0	G	NM_012444		55909851	55909851	+1	no_errors	ENST00000371263	ensembl	human	known	69_37n	missense	341	14.11	56	SNP	1.000	A
SVEP1	79987	genome.wustl.edu	37	9	113169407	113169407	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr9:113169407C>G	ENST00000401783.2	-	38	8809	c.8473G>C	c.(8473-8475)Gag>Cag	p.E2825Q	SVEP1_ENST00000297826.5_Missense_Mutation_p.E751Q|SVEP1_ENST00000374469.1_Missense_Mutation_p.E2802Q	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	2825	Sushi 23. {ECO:0000255|PROSITE- ProRule:PRU00302}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						CAAATGGGCTCATCCTCATCC	0.498																																						dbGAP											0													128.0	127.0	127.0					9																	113169407		2043	4198	6241	-	-	-	SO:0001583	missense	0			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.8473G>C	9.37:g.113169407C>G	ENSP00000384917:p.Glu2825Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EGF-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.E2825Q	ENST00000401783.2	37	c.8473	CCDS48004.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.07|10.07	1.249817|1.249817	0.22880|0.22880	.|.	.|.	ENSG00000165124|ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000297826|ENST00000374463	T;T;T|.	0.64260|.	-0.09;-0.09;-0.09|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Complement control module (2);Sushi/SCR/CCP (3);|.	0.108202|.	0.64402|.	D|.	0.000006|.	T|T	0.65923|0.65923	0.2738|0.2738	L|L	0.33668|0.33668	1.02|1.02	0.80722|0.80722	D|D	1|1	D|.	0.69078|.	0.997|.	D|.	0.64595|.	0.927|.	T|T	0.61068|0.61068	-0.7137|-0.7137	10|6	0.13853|0.34782	T|T	0.58|0.22	.|.	19.9348|19.9348	0.97133|0.97133	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2825|.	Q4LDE5|.	SVEP1_HUMAN|.	Q|I	2825;2802;751|496	ENSP00000384917:E2825Q;ENSP00000363593:E2802Q;ENSP00000297826:E751Q|.	ENSP00000297826:E751Q|ENSP00000363587:M496I	E|M	-|-	1|3	0|0	SVEP1|SVEP1	112209228|112209228	1.000000|1.000000	0.71417|0.71417	0.955000|0.955000	0.39395|0.39395	0.070000|0.070000	0.16714|0.16714	4.241000|4.241000	0.58707|0.58707	2.789000|2.789000	0.95967|0.95967	0.591000|0.591000	0.81541|0.81541	GAG|ATG	SVEP1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000165124		0.498	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		43	0.00	0	C			113169407	113169407	-1	no_errors	ENST00000401783	ensembl	human	known	69_37n	missense	119	15.60	22	SNP	0.994	G
TAAR9	134860	genome.wustl.edu	37	6	132859636	132859636	+	RNA	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr6:132859636C>G	ENST00000434551.1	+	0	208					NM_175057.3	NP_778227.3	Q96RI9	TAAR9_HUMAN	trace amine associated receptor 9 (gene/pseudogene)						G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)					Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.0042)|GBM - Glioblastoma multiforme(226;0.00816)		TACAAACTTTCTGATTGCGTC	0.522																																					Colon(10;433 445 15992 45047 47213)	dbGAP											0													164.0	160.0	161.0					6																	132859636		2165	4281	6446	-	-	-			0			AF380189	CCDS75520.1	6q23.2	2013-10-02	2010-03-12	2005-02-24	ENSG00000237110	ENSG00000237110		"""GPCR / Class A : Trace amine associated receptors"""	20977	protein-coding gene	gene with protein product		608282	"""trace amine receptor 3"", ""trace amine associated receptor 9"""	TRAR3		15718104	Standard	NM_175057		Approved	TA3, TAR3	uc011eci.2	Q96RI9	OTTHUMG00000015578		6.37:g.132859636C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L70V	ENST00000434551.1	37	c.208		6																																																																																			TAAR9	-	NULL	ENSG00000237110		0.522	TAAR9-001	KNOWN	mRNA_end_NF|cds_end_NF|basic	polymorphic_pseudogene	TAAR9	HGNC	polymorphic_pseudogene	OTTHUMT00000042254.2	221	0.00	0	C	NM_175057		132859636	132859636	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000434551	ensembl	human	known	69_37n	missense	433	19.78	107	SNP	1.000	G
TBX22	50945	genome.wustl.edu	37	X	79277998	79277998	+	Intron	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:79277998C>G	ENST00000373294.5	+	1	203				TBX22_ENST00000373296.3_Intron|TBX22_ENST00000442340.1_Intron|TBX22_ENST00000476373.1_3'UTR|TBX22_ENST00000373291.1_5'Flank	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22						multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TTCCGCATCTCTCCGCCTGGC	0.627																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.175+55C>G	X.37:g.79277998C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZ06|Q96LC0|Q9HBF1	RNA	SNP	-	NULL	ENST00000373294.5	37	NULL	CCDS14445.1	X																																																																																			TBX22	-	-	ENSG00000122145		0.627	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	20	0.00	0	C	NM_016954		79277998	79277998	+1	no_errors	ENST00000476373	ensembl	human	known	69_37n	rna	47	24.19	15	SNP	0.000	G
TCF4	6925	genome.wustl.edu	37	18	52896088	52896088	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr18:52896088C>G	ENST00000356073.4	-	18	2468	c.1857G>C	c.(1855-1857)caG>caC	p.Q619H	TCF4_ENST00000564228.1_Missense_Mutation_p.Q548H|TCF4_ENST00000537578.1_Missense_Mutation_p.Q599H|TCF4_ENST00000564403.2_Missense_Mutation_p.Q629H|TCF4_ENST00000568740.1_Missense_Mutation_p.Q594H|TCF4_ENST00000568673.1_Missense_Mutation_p.Q599H|TCF4_ENST00000457482.3_Missense_Mutation_p.Q463H|TCF4_ENST00000566286.1_Missense_Mutation_p.Q616H|TCF4_ENST00000566279.1_Missense_Mutation_p.Q563H|TCF4_ENST00000537856.3_Missense_Mutation_p.Q489H|TCF4_ENST00000564999.1_Missense_Mutation_p.Q619H|TCF4_ENST00000570287.2_Missense_Mutation_p.Q459H|TCF4_ENST00000565018.2_Missense_Mutation_p.Q623H|TCF4_ENST00000540999.1_Missense_Mutation_p.Q595H|TCF4_ENST00000561992.1_Missense_Mutation_p.Q489H|TCF4_ENST00000398339.1_Missense_Mutation_p.Q725H|TCF4_ENST00000561831.3_Missense_Mutation_p.Q459H|TCF4_ENST00000543082.1_Missense_Mutation_p.Q577H|TCF4_ENST00000567880.1_Missense_Mutation_p.Q559H|TCF4_ENST00000544241.2_Missense_Mutation_p.Q552H|TCF4_ENST00000570177.2_Missense_Mutation_p.Q489H|TCF4_ENST00000354452.3_Missense_Mutation_p.Q623H	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	619	Class A specific domain.				DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CTCGGACTTGCTGCTCCAGAC	0.627																																						dbGAP											0													54.0	46.0	49.0					18																	52896088		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1857G>C	18.37:g.52896088C>G	ENSP00000348374:p.Gln619His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.Q725H	ENST00000356073.4	37	c.2175	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	16.62	3.174686	0.57692	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	D;D;D;D;D;D;D;D;D	0.97665	-4.48;-4.48;-4.48;-4.48;-4.48;-4.48;-4.48;-4.48;-4.48	5.65	5.65	0.86999	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	D	0.98093	0.9371	M	0.78049	2.395	0.58432	D	0.999999	P;B;P;B;D;B;P;D;P	0.60575	0.752;0.311;0.746;0.374;0.98;0.37;0.752;0.988;0.485	B;B;P;B;D;B;B;D;B	0.72338	0.321;0.29;0.561;0.273;0.948;0.152;0.274;0.977;0.213	D	0.98336	1.0536	10	0.87932	D	0	-9.8823	12.5866	0.56421	0.0:0.9203:0.0:0.0797	.	599;623;459;725;619;577;552;463;616	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	H	623;463;619;577;595;599;552;489;725	ENSP00000346440:Q623H;ENSP00000409447:Q463H;ENSP00000348374:Q619H;ENSP00000439656:Q577H;ENSP00000445202:Q595H;ENSP00000440731:Q599H;ENSP00000441562:Q552H;ENSP00000439827:Q489H;ENSP00000381382:Q725H	ENSP00000346440:Q623H	Q	-	3	2	TCF4	51047086	0.999000	0.42202	1.000000	0.80357	0.970000	0.65996	1.648000	0.37271	2.681000	0.91329	0.563000	0.77884	CAG	TCF4	-	superfamily_HLH_DNA-bd,smart_HLH_DNA-bd	ENSG00000196628		0.627	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	17	0.00	0	C	NM_003199		52896088	52896088	-1	no_errors	ENST00000398339	ensembl	human	known	69_37n	missense	53	20.59	14	SNP	1.000	G
TEFM	79736	genome.wustl.edu	37	17	29226322	29226322	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:29226322G>A	ENST00000581216.1	-	4	1569	c.948C>T	c.(946-948)ttC>ttT	p.F316F	TEFM_ENST00000580840.1_3'UTR|TEFM_ENST00000579183.1_5'Flank	NM_024683.3	NP_078959.3	Q96QE5	TEFM_HUMAN	transcription elongation factor, mitochondrial	316					DNA metabolic process (GO:0006259)|oxidative phosphorylation (GO:0006119)|regulation of transcription, DNA-templated (GO:0006355)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|ribonucleoprotein complex (GO:0030529)	DNA polymerase processivity factor activity (GO:0030337)|poly(A) RNA binding (GO:0044822)										CTGATGGGAAGAACACCCGAG	0.393																																						dbGAP											0													122.0	120.0	121.0					17																	29226322		1853	4084	5937	-	-	-	SO:0001819	synonymous_variant	0				CCDS42291.1	17q11.2	2011-12-12	2011-12-12	2011-12-12	ENSG00000172171	ENSG00000172171			26223	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 42"""	C17orf42		11468690, 10843809, 21278163	Standard	NM_024683		Approved	FLJ22729	uc002hfu.2	Q96QE5		ENST00000581216.1:c.948C>T	17.37:g.29226322G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P655|Q6GPG5|Q6PJ19|Q96H04|Q9H5Z9	Silent	SNP	superfamily_RNaseH-like_dom	p.F316	ENST00000581216.1	37	c.948	CCDS42291.1	17																																																																																			TEFM	-	superfamily_RNaseH-like_dom	ENSG00000172171		0.393	TEFM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEFM	HGNC	protein_coding	OTTHUMT00000444498.1	102	0.00	0	G	NM_024683		29226322	29226322	-1	no_errors	ENST00000581216	ensembl	human	known	69_37n	silent	98	22.83	29	SNP	0.957	A
TFPT	29844	genome.wustl.edu	37	19	54610364	54610364	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:54610364G>C	ENST00000391759.1	-	6	1160	c.755C>G	c.(754-756)tCt>tGt	p.S252C	NDUFA3_ENST00000391764.3_Intron|TFPT_ENST00000391757.1_3'UTR|NDUFA3_ENST00000485876.1_3'UTR|TFPT_ENST00000391758.1_Missense_Mutation_p.S243C	NM_013342.3	NP_037474.1	P0C1Z6	TFPT_HUMAN	TCF3 (E2A) fusion partner (in childhood Leukemia)	252					apoptotic signaling pathway (GO:0097190)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|positive regulation of apoptotic process (GO:0043065)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|Ino80 complex (GO:0031011)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			large_intestine(2)|lung(2)	4	all_cancers(19;0.004)|all_epithelial(19;0.00195)|all_lung(19;0.0193)|Lung NSC(19;0.0358)|Breast(117;0.137)|Ovarian(34;0.19)					GCGTCAGTCAGAGGCTGGGCT	0.582			T	TCF3	pre-B ALL																																	dbGAP		Dom	yes		19	19q13	29844	TCF3 (E2A) fusion partner (in childhood Leukemia)		L	0													95.0	100.0	98.0					19																	54610364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF052052	CCDS12878.1	19q13	2011-07-06			ENSG00000105619	ENSG00000105619		"""INO80 complex subunits"""	13630	protein-coding gene	gene with protein product	"""amida, partner of the E2A"", ""INO80 complex subunit F"""	609519				10644725, 16230350	Standard	NM_013342		Approved	FB1, amida, INO80F	uc010yej.1	P0C1Z6	OTTHUMG00000065906	ENST00000391759.1:c.755C>G	19.37:g.54610364G>C	ENSP00000375639:p.Ser252Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S252C	ENST00000391759.1	37	c.755	CCDS12878.1	19	.	.	.	.	.	.	.	.	.	.	G	10.46	1.356294	0.24598	.	.	ENSG00000105619	ENST00000391759;ENST00000391758	.	.	.	4.79	2.61	0.31194	.	0.086444	0.49305	D	0.000156	T	0.29817	0.0745	N	0.08118	0	0.80722	D	1	B	0.30542	0.284	B	0.33960	0.173	T	0.07829	-1.0752	9	0.56958	D	0.05	7.0E-4	5.5533	0.17103	0.7299:0.1735:0.0966:0.0	.	252	P0C1Z6	TFPT_HUMAN	C	252;243	.	ENSP00000375638:S243C	S	-	2	0	TFPT	59302176	1.000000	0.71417	0.963000	0.40424	0.281000	0.26958	2.993000	0.49425	0.271000	0.22005	-0.302000	0.09304	TCT	TFPT	-	NULL	ENSG00000105619		0.582	TFPT-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TFPT	HGNC	protein_coding	OTTHUMT00000141215.4	55	0.00	0	G	NM_013342		54610364	54610364	-1	no_errors	ENST00000391759	ensembl	human	known	69_37n	missense	108	24.48	35	SNP	1.000	C
TLR2	7097	genome.wustl.edu	37	4	154626261	154626261	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr4:154626261C>T	ENST00000260010.6	+	1	3610	c.2202C>T	c.(2200-2202)ctC>ctT	p.L734L		NM_003264.3	NP_003255.2	O60603	TLR2_HUMAN	toll-like receptor 2	734	TIR. {ECO:0000255|PROSITE- ProRule:PRU00204}.				apoptotic process (GO:0006915)|cell surface pattern recognition receptor signaling pathway (GO:0002752)|cellular response to bacterial lipopeptide (GO:0071221)|cellular response to diacyl bacterial lipopeptide (GO:0071726)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to peptidoglycan (GO:0071224)|cellular response to triacyl bacterial lipopeptide (GO:0071727)|central nervous system myelin formation (GO:0032289)|chloramphenicol transport (GO:0042892)|defense response to Gram-positive bacterium (GO:0050830)|detection of diacyl bacterial lipopeptide (GO:0042496)|detection of triacyl bacterial lipopeptide (GO:0042495)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|induction by symbiont of defense-related host nitric oxide production (GO:0052063)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|leukotriene metabolic process (GO:0006691)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of cell proliferation (GO:0008285)|negative regulation of growth of symbiont in host (GO:0044130)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of interleukin-17 production (GO:0032700)|nitric oxide metabolic process (GO:0046209)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-18 production (GO:0032741)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of leukocyte migration (GO:0002687)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of toll-like receptor signaling pathway (GO:0034123)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of Wnt signaling pathway (GO:0030177)|response to fatty acid (GO:0070542)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to molecule of fungal origin (GO:0002238)|response to progesterone (GO:0032570)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)	cell body (GO:0044297)|cell projection (GO:0042995)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)|Toll-like receptor 2-Toll-like receptor 6 protein complex (GO:0035355)	diacyl lipopeptide binding (GO:0042498)|lipopolysaccharide receptor activity (GO:0001875)|lipoteichoic acid binding (GO:0070891)|peptidoglycan binding (GO:0042834)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|signaling pattern recognition receptor activity (GO:0008329)|transmembrane signaling receptor activity (GO:0004888)|triacyl lipopeptide binding (GO:0042497)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	29	all_hematologic(180;0.093)	Renal(120;0.117)			OspA lipoprotein(DB00045)	CTGCCATTCTCATTCTTCTGG	0.468																																						dbGAP											0													136.0	128.0	131.0					4																	154626261		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U88878	CCDS3784.1	4q32	2008-02-05				ENSG00000137462		"""CD molecules"""	11848	protein-coding gene	gene with protein product		603028				9435236	Standard	XM_005263193		Approved	TIL4, CD282	uc003inq.3	O60603		ENST00000260010.6:c.2202C>T	4.37:g.154626261C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3Y612|D1CS45|D1CS48|D1CS49|O15454|Q8NI00	Silent	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom	p.L734	ENST00000260010.6	37	c.2202	CCDS3784.1	4																																																																																			TLR2	-	pirsf_Toll-like_receptor,pfam_TIR_dom,superfamily_TIR_dom,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom	ENSG00000137462		0.468	TLR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR2	HGNC	protein_coding	OTTHUMT00000365205.1	134	0.00	0	C			154626261	154626261	+1	no_errors	ENST00000260010	ensembl	human	known	69_37n	silent	151	20.11	38	SNP	0.000	T
TM9SF3	56889	genome.wustl.edu	37	10	98303890	98303890	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr10:98303890G>A	ENST00000371142.4	-	9	1344	c.1128C>T	c.(1126-1128)ttC>ttT	p.F376F	TM9SF3_ENST00000490192.1_5'UTR	NM_020123.3	NP_064508.3	Q9HD45	TM9S3_HUMAN	transmembrane 9 superfamily member 3	376						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)	15		Colorectal(252;0.158)		Epithelial(162;1.84e-09)|all cancers(201;2.84e-08)		TGAAATTGATGAAGAAGGCAG	0.378																																						dbGAP											0													104.0	92.0	96.0					10																	98303890		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF160213, AF269150	CCDS7450.1	10q24.2	2006-04-12			ENSG00000077147	ENSG00000077147			21529	protein-coding gene	gene with protein product						11530251, 11595169	Standard	NM_020123		Approved	SMBP	uc001kmm.4	Q9HD45	OTTHUMG00000018834	ENST00000371142.4:c.1128C>T	10.37:g.98303890G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TB57|Q6UWE7|Q9NWL8|Q9P0G9|Q9UHW8	Silent	SNP	pfam_EMP70	p.F376	ENST00000371142.4	37	c.1128	CCDS7450.1	10																																																																																			TM9SF3	-	pfam_EMP70	ENSG00000077147		0.378	TM9SF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM9SF3	HGNC	protein_coding	OTTHUMT00000049610.2	101	0.00	0	G	NM_020123		98303890	98303890	-1	no_errors	ENST00000371142	ensembl	human	known	69_37n	silent	123	19.08	29	SNP	1.000	A
TMC6	11322	genome.wustl.edu	37	17	76116778	76116778	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:76116778G>A	ENST00000590602.1	-	13	1830	c.1671C>T	c.(1669-1671)ttC>ttT	p.F557F	TMC6_ENST00000592076.1_Intron|TMC6_ENST00000306591.7_Intron|TMC6_ENST00000322933.4_Intron|TMC6_ENST00000591436.1_Intron|TMC6_ENST00000322914.3_Silent_p.F557F|TMC6_ENST00000589553.1_3'UTR|TMC6_ENST00000392467.3_Silent_p.F557F			Q7Z403	TMC6_HUMAN	transmembrane channel-like 6	557					ion transport (GO:0006811)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	14			BRCA - Breast invasive adenocarcinoma(99;0.00269)|Lung(188;0.0973)			ACATGAGGACGAAGTCCATCA	0.632																																						dbGAP											0													166.0	158.0	161.0					17																	76116778		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY057379	CCDS32748.1	17q25.3	2014-09-17	2005-11-10	2005-11-10	ENSG00000141524	ENSG00000141524			18021	protein-coding gene	gene with protein product		605828	"""epidermodysplasia verruciformis 1"""	EVER1		12426567	Standard	NM_007267		Approved	LAK-4P, EVIN1	uc002juk.2	Q7Z403	OTTHUMG00000177466	ENST00000590602.1:c.1671C>T	17.37:g.76116778G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O43284|Q45VJ2|Q8IU98|Q8IUI7|Q8IWU8|Q8TEQ7|Q9HAG5	Silent	SNP	pfam_TMC	p.F557	ENST00000590602.1	37	c.1671	CCDS32748.1	17																																																																																			TMC6	-	pfam_TMC	ENSG00000141524		0.632	TMC6-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TMC6	HGNC	protein_coding	OTTHUMT00000437146.1	48	0.00	0	G			76116778	76116778	-1	no_errors	ENST00000322914	ensembl	human	known	69_37n	silent	157	26.64	57	SNP	0.856	A
TMEM27	57393	genome.wustl.edu	37	X	15646168	15646168	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:15646168C>T	ENST00000380342.3	-	6	850	c.595G>A	c.(595-597)Gat>Aat	p.D199N		NM_020665.4	NP_065716.1	Q9HBJ8	TMM27_HUMAN	transmembrane protein 27	199					positive regulation of amino acid transport (GO:0051957)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of SNARE complex assembly (GO:0035543)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metallopeptidase activity (GO:0008237)|peptidyl-dipeptidase activity (GO:0008241)			endometrium(3)|lung(4)|ovary(1)	8	Hepatocellular(33;0.183)					TCCAGGGGATCAGAGGGGATG	0.438																																						dbGAP											0													155.0	123.0	134.0					X																	15646168		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF229179	CCDS14170.1	Xp22	2012-04-13			ENSG00000147003	ENSG00000147003			29437	protein-coding gene	gene with protein product	"""collectrin"""	300631				11278314	Standard	NM_020665		Approved	NX17	uc004cxc.2	Q9HBJ8	OTTHUMG00000021181	ENST00000380342.3:c.595G>A	X.37:g.15646168C>T	ENSP00000369699:p.Asp199Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9M1|Q6UW07	Missense_Mutation	SNP	NULL	p.D199N	ENST00000380342.3	37	c.595	CCDS14170.1	X	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162813	0.57368	.	.	ENSG00000147003	ENST00000380342	T	0.48201	0.82	5.87	5.87	0.94306	.	0.246149	0.46442	D	0.000284	T	0.59542	0.2201	M	0.64997	1.995	0.30932	N	0.726777	D	0.57257	0.979	P	0.56563	0.801	T	0.63377	-0.6651	10	0.36615	T	0.2	-6.4332	14.3588	0.66754	0.0:1.0:0.0:0.0	.	199	Q9HBJ8	TMM27_HUMAN	N	199	ENSP00000369699:D199N	ENSP00000369699:D199N	D	-	1	0	TMEM27	15556089	0.992000	0.36948	0.300000	0.25030	0.174000	0.22865	3.915000	0.56409	2.466000	0.83321	0.594000	0.82650	GAT	TMEM27	-	NULL	ENSG00000147003		0.438	TMEM27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM27	HGNC	protein_coding	OTTHUMT00000055879.1	254	0.00	0	C	NM_020665		15646168	15646168	-1	no_errors	ENST00000380342	ensembl	human	known	69_37n	missense	361	22.20	103	SNP	0.581	T
TNFRSF21	27242	genome.wustl.edu	37	6	47254254	47254254	+	Silent	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr6:47254254G>A	ENST00000296861.2	-	2	567	c.174C>T	c.(172-174)gaC>gaT	p.D58D		NM_014452.3	NP_055267.1	O75509	TNR21_HUMAN	tumor necrosis factor receptor superfamily, member 21	58					adaptive immune response (GO:0002250)|apoptotic process (GO:0006915)|B cell apoptotic process (GO:0001783)|cellular lipid metabolic process (GO:0044255)|cellular response to tumor necrosis factor (GO:0071356)|humoral immune response (GO:0006959)|myelination (GO:0042552)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of interleukin-10 secretion (GO:2001180)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of myelination (GO:0031642)|negative regulation of T cell proliferation (GO:0042130)|neuron apoptotic process (GO:0051402)|oligodendrocyte apoptotic process (GO:0097252)|regulation of oligodendrocyte differentiation (GO:0048713)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|lung(7)|pancreas(1)|skin(2)	21			Lung(136;0.189)			CGGTGGCACGGTCAACATGGC	0.552																																						dbGAP											0													83.0	80.0	81.0					6																	47254254		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF068868	CCDS4921.1	6p21.1	2011-08-11			ENSG00000146072	ENSG00000146072		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	13469	protein-coding gene	gene with protein product	"""death receptor 6"""	605732				9714541	Standard	NM_014452		Approved	DR6, CD358	uc003oyv.3	O75509	OTTHUMG00000014796	ENST00000296861.2:c.174C>T	6.37:g.47254254G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDI9|Q0D2P5|Q96D86	Silent	SNP	pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,prints_TNFR_21,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg	p.D58	ENST00000296861.2	37	c.174	CCDS4921.1	6																																																																																			TNFRSF21	-	smart_TNFR/NGFR_Cys_rich_reg	ENSG00000146072		0.552	TNFRSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF21	HGNC	protein_coding	OTTHUMT00000040814.1	27	0.00	0	G	NM_014452		47254254	47254254	-1	no_errors	ENST00000296861	ensembl	human	known	69_37n	silent	137	23.46	42	SNP	1.000	A
TRANK1	9881	genome.wustl.edu	37	3	36873648	36873648	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:36873648G>C	ENST00000429976.2	-	21	7541	c.7294C>G	c.(7294-7296)Cta>Gta	p.L2432V	TRANK1_ENST00000428977.2_Missense_Mutation_p.L1882V|TRANK1_ENST00000301807.6_Missense_Mutation_p.L1882V	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2432							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						GGGAGGCATAGAATGACATTC	0.522																																						dbGAP											0													109.0	115.0	113.0					3																	36873648		1938	4145	6083	-	-	-	SO:0001583	missense	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.7294C>G	3.37:g.36873648G>C	ENSP00000416168:p.Leu2432Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.L2432V	ENST00000429976.2	37	c.7294	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	G	9.506	1.104451	0.20632	.	.	ENSG00000168016	ENST00000428977;ENST00000429976;ENST00000301807	T;T;T	0.40225	1.04;1.45;1.04	5.27	3.47	0.39725	.	0.000000	0.43919	D	0.000511	T	0.24928	0.0605	L	0.36672	1.1	0.09310	N	0.999997	B	0.34200	0.441	B	0.24848	0.056	T	0.15723	-1.0427	10	0.41790	T	0.15	.	3.9946	0.09553	0.1417:0.1273:0.5996:0.1314	.	2432	O15050	TRNK1_HUMAN	V	1882;2432;1882	ENSP00000416826:L1882V;ENSP00000416168:L2432V;ENSP00000301807:L1882V	ENSP00000301807:L1882V	L	-	1	2	TRANK1	36848652	0.980000	0.34600	0.804000	0.32291	0.980000	0.70556	1.353000	0.34045	0.723000	0.32274	0.561000	0.74099	CTA	TRANK1	-	NULL	ENSG00000168016		0.522	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		57	0.00	0	G	NM_014831		36873648	36873648	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	missense	115	19.58	28	SNP	0.137	C
TRHDE	29953	genome.wustl.edu	37	12	73012710	73012710	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr12:73012710C>G	ENST00000261180.4	+	13	2322	c.2226C>G	c.(2224-2226)atC>atG	p.I742M	TRHDE_ENST00000549138.1_3'UTR	NM_013381.2	NP_037513.1	Q9UKU6	TRHDE_HUMAN	thyrotropin-releasing hormone degrading enzyme	742					cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(8)|kidney(3)|large_intestine(13)|lung(38)|ovary(2)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	79						TGGAGATTATCAGATACCTGT	0.398																																						dbGAP											0													58.0	63.0	62.0					12																	73012710		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF126372	CCDS9004.1	12q15-q21	2012-07-25		2005-08-09		ENSG00000072657	3.4.19.6		30748	protein-coding gene	gene with protein product	"""pyroglutamyl-peptidase II"", ""pyroglutamyl aminopeptidase II"", ""TRH-specific aminopeptidase"""	606950				10491199, 12975309	Standard	NM_013381		Approved	PGPEP2, TRH-DE, PAP-II	uc001sxa.3	Q9UKU6		ENST00000261180.4:c.2226C>G	12.37:g.73012710C>G	ENSP00000261180:p.Ile742Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL19|Q6UWJ4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.I742M	ENST00000261180.4	37	c.2226	CCDS9004.1	12	.	.	.	.	.	.	.	.	.	.	C	11.87	1.768458	0.31320	.	.	ENSG00000072657	ENST00000261180	T	0.05996	3.36	5.77	3.92	0.45320	.	0.158341	0.56097	N	0.000036	T	0.06554	0.0168	L	0.39085	1.19	0.53688	D	0.999978	B	0.26002	0.139	B	0.18871	0.023	T	0.22173	-1.0224	10	0.54805	T	0.06	.	12.8756	0.57988	0.117:0.6359:0.2471:0.0	.	742	Q9UKU6	TRHDE_HUMAN	M	742	ENSP00000261180:I742M	ENSP00000261180:I742M	I	+	3	3	TRHDE	71298977	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.987000	0.40687	0.858000	0.35431	-0.211000	0.12701	ATC	TRHDE	-	NULL	ENSG00000072657		0.398	TRHDE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRHDE	HGNC	protein_coding	OTTHUMT00000405380.1	46	0.00	0	C	NM_013381		73012710	73012710	+1	no_errors	ENST00000261180	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	1.000	G
TRIB3	57761	genome.wustl.edu	37	20	368750	368750	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr20:368750G>C	ENST00000217233.3	+	2	649	c.96G>C	c.(94-96)caG>caC	p.Q32H	TRIB3_ENST00000422053.2_Missense_Mutation_p.Q59H|TRIB3_ENST00000485293.1_3'UTR	NM_021158.3	NP_066981.2	Q96RU7	TRIB3_HUMAN	tribbles pseudokinase 3	32	Interaction with DDIT3/CHOP.				cellular lipid metabolic process (GO:0044255)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of protein binding (GO:0032092)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein phosphorylation (GO:0006468)|regulation of glucose transport (GO:0010827)|regulation of MAP kinase activity (GO:0043405)|response to endoplasmic reticulum stress (GO:0034976)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein kinase inhibitor activity (GO:0004860)|transcription corepressor activity (GO:0003714)|transferase activity, transferring phosphorus-containing groups (GO:0016772)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase regulator activity (GO:0055106)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(3)|lung(9)|ovary(2)|skin(1)	21		all_epithelial(17;0.165)|Lung NSC(37;0.191)|Breast(17;0.231)		Colorectal(46;0.101)|COAD - Colon adenocarcinoma(99;0.112)		GTCCCGTCCAGAAACGAGCTC	0.627																																					Melanoma(101;421 2374 19538)	dbGAP											0													84.0	82.0	82.0					20																	368750		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF250311	CCDS12997.1	20p13-p12.2	2013-10-03	2013-10-03	2004-05-04	ENSG00000101255	ENSG00000101255			16228	protein-coding gene	gene with protein product		607898	"""chromosome 20 open reading frame 97"", ""tribbles homolog 3 (Drosophila)"""	C20orf97		12791994, 16715410	Standard	XM_005260773		Approved	dJ1103G7.3, TRB3	uc002wdm.3	Q96RU7	OTTHUMG00000031627	ENST00000217233.3:c.96G>C	20.37:g.368750G>C	ENSP00000217233:p.Gln32His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GU4|Q53ZW7|Q6I9Y9|Q8TAI6|Q9H5M8|Q9NUD2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.Q59H	ENST00000217233.3	37	c.177	CCDS12997.1	20	.	.	.	.	.	.	.	.	.	.	G	8.718	0.913720	0.17907	.	.	ENSG00000101255	ENST00000217233;ENST00000449710;ENST00000422053	T;T;T	0.61980	0.81;0.06;0.76	4.49	2.42	0.29668	.	1.548580	0.04736	N	0.422021	T	0.50240	0.1604	N	0.22421	0.69	0.09310	N	0.999995	B;B	0.26809	0.16;0.16	B;B	0.28916	0.096;0.096	T	0.42515	-0.9447	10	0.42905	T	0.14	-0.0573	7.2276	0.26024	0.2357:0.0:0.7643:0.0	.	59;32	B4DMM9;Q96RU7	.;TRIB3_HUMAN	H	32;32;59	ENSP00000217233:Q32H;ENSP00000391873:Q32H;ENSP00000415416:Q59H	ENSP00000217233:Q32H	Q	+	3	2	TRIB3	316750	0.226000	0.23696	0.486000	0.27416	0.417000	0.31264	0.311000	0.19380	0.428000	0.26173	0.561000	0.74099	CAG	TRIB3	-	NULL	ENSG00000101255		0.627	TRIB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIB3	HGNC	protein_coding	OTTHUMT00000077441.2	18	0.00	0	G	NM_021158		368750	368750	+1	no_errors	ENST00000422053	ensembl	human	known	69_37n	missense	92	17.12	19	SNP	0.367	C
TRIM41	90933	genome.wustl.edu	37	5	180651352	180651352	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:180651352A>G	ENST00000315073.5	+	1	1063	c.353A>G	c.(352-354)gAc>gGc	p.D118G	TRIM41_ENST00000351937.5_Missense_Mutation_p.D118G|MIR4638_ENST00000581158.1_RNA|CTC-338M12.7_ENST00000499096.2_RNA	NM_033549.4	NP_291027.3	Q8WV44	TRI41_HUMAN	tripartite motif containing 41	118	Glu-rich.				protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(3)|prostate(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	26	all_cancers(89;9.17e-06)|all_epithelial(37;1.19e-06)|Renal(175;0.000159)|Lung NSC(126;0.00354)|all_lung(126;0.00609)|Breast(19;0.0684)	all_cancers(40;0.000209)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)|all_lung(500;0.0221)|all_hematologic(541;0.0433)|Lung NSC(249;0.132)|Ovarian(839;0.238)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TCCAGCTGGGACAACATGGAC	0.592																																						dbGAP											0													188.0	179.0	182.0					5																	180651352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258579	CCDS4465.1, CCDS4466.1	5q35.3	2013-01-09	2011-01-25		ENSG00000146063	ENSG00000146063		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19013	protein-coding gene	gene with protein product	"""RING-finger protein that interacts with C kinase"""	610530	"""tripartite motif-containing 41"""			16022281	Standard	NM_033549		Approved	MGC1127, RINCK	uc003mne.2	Q8WV44	OTTHUMG00000130965	ENST00000315073.5:c.353A>G	5.37:g.180651352A>G	ENSP00000320869:p.Asp118Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNJ6|D3DWR9|Q5BKT0|Q7L484|Q96Q10|Q9BSL8	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,pfam_DUF3631,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.D118G	ENST00000315073.5	37	c.353	CCDS4466.1	5	.	.	.	.	.	.	.	.	.	.	A	14.14	2.445772	0.43429	.	.	ENSG00000146063	ENST00000351937;ENST00000315073	T;T	0.57273	0.47;0.41	4.96	4.96	0.65561	Zinc finger, RING-type (1);	0.000000	0.45606	D	0.000347	T	0.37812	0.1017	L	0.32530	0.975	0.32933	D	0.517402	B;B;B	0.15141	0.001;0.006;0.012	B;B;B	0.15870	0.001;0.006;0.014	T	0.44019	-0.9355	10	0.30854	T	0.27	.	7.2691	0.26246	0.9033:0.0:0.0966:0.0	.	118;118;118	Q8WV44;Q8WV44-2;Q8WV44-4	TRI41_HUMAN;.;.	G	118	ENSP00000336749:D118G;ENSP00000320869:D118G	ENSP00000320869:D118G	D	+	2	0	TRIM41	180583958	0.961000	0.32948	1.000000	0.80357	0.191000	0.23601	0.201000	0.17276	2.080000	0.62538	0.402000	0.26972	GAC	TRIM41	-	smart_Znf_RING	ENSG00000146063		0.592	TRIM41-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM41	HGNC	protein_coding	OTTHUMT00000253574.3	88	0.00	0	A	NM_201627		180651352	180651352	+1	no_errors	ENST00000315073	ensembl	human	known	69_37n	missense	376	26.27	134	SNP	1.000	G
TRPC6	7225	genome.wustl.edu	37	11	101324393	101324393	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr11:101324393C>T	ENST00000344327.3	-	12	3056	c.2632G>A	c.(2632-2634)Gaa>Aaa	p.E878K	TRPC6_ENST00000532133.1_Missense_Mutation_p.E800K|TRPC6_ENST00000360497.4_Missense_Mutation_p.E823K|TRPC6_ENST00000348423.4_Missense_Mutation_p.E762K	NM_004621.5	NP_004612.2	Q9Y210	TRPC6_HUMAN	transient receptor potential cation channel, subfamily C, member 6	878					aging (GO:0007568)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|ion transmembrane transport (GO:0034220)|platelet activation (GO:0030168)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of ion transmembrane transporter activity (GO:0032414)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(14)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	55		Acute lymphoblastic leukemia(157;0.000918)|all_hematologic(158;0.0162)		BRCA - Breast invasive adenocarcinoma(274;0.0442)		TCGTTCACTTCATCACTCTCC	0.463																																					Colon(166;1315 1927 11094 12848 34731)	dbGAP											0													206.0	173.0	185.0					11																	101324393		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ006276	CCDS8311.1	11q22.1	2014-02-04				ENSG00000137672		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	12338	protein-coding gene	gene with protein product		603652	"""focal segmental glomerulosclerosis 2"""	FSGS2		9925922, 16382100, 15879175	Standard	NM_004621		Approved	TRP6	uc001pgk.4	Q9Y210		ENST00000344327.3:c.2632G>A	11.37:g.101324393C>T	ENSP00000340913:p.Glu878Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M59|Q9HCW3|Q9NQA8|Q9NQA9	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC6_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.E878K	ENST00000344327.3	37	c.2632	CCDS8311.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.425712	0.96131	.	.	ENSG00000137672	ENST00000344327;ENST00000532133;ENST00000348423;ENST00000360497	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	5.89	5.89	0.94794	.	0.044292	0.85682	D	0.000000	D	0.88901	0.6563	M	0.65975	2.015	0.58432	D	0.999998	D;D;P	0.62365	0.965;0.991;0.941	P;P;P	0.61658	0.758;0.892;0.577	D	0.84150	0.0422	10	0.15066	T	0.55	-11.0825	20.3212	0.98679	0.0:1.0:0.0:0.0	.	823;762;878	Q9Y210-3;Q9Y210-2;Q9Y210	.;.;TRPC6_HUMAN	K	878;800;762;823	ENSP00000340913:E878K;ENSP00000435574:E800K;ENSP00000343672:E762K;ENSP00000353687:E823K	ENSP00000340913:E878K	E	-	1	0	TRPC6	100829603	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.793000	0.69060	2.810000	0.96702	0.650000	0.86243	GAA	TRPC6	-	superfamily_ARM-type_fold,tigrfam_TRP_channel	ENSG00000137672		0.463	TRPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC6	HGNC	protein_coding	OTTHUMT00000394770.1	331	0.00	0	C	NM_004621		101324393	101324393	-1	no_errors	ENST00000344327	ensembl	human	known	69_37n	missense	414	23.76	129	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98602971	98602971	+	Splice_Site	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:98602971G>A	ENST00000359863.4	+	68	10920	c.10711G>A	c.(10711-10713)Gtg>Atg	p.V3571M	TRRAP_ENST00000355540.3_Splice_Site_p.V3542M|TRRAP_ENST00000446306.3_Splice_Site_p.V3560M	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3571	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			GTTTTTCACAGGTAGGGTTGA	0.577																																						dbGAP											0													63.0	58.0	60.0					7																	98602971		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.10711+1G>A	7.37:g.98602971G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.V3571M	ENST00000359863.4	37	c.10711	CCDS59066.1	7	.	.	.	.	.	.	.	.	.	.	G	26.4	4.730877	0.89390	.	.	ENSG00000196367	ENST00000359863;ENST00000355540;ENST00000446306	T;T	0.81415	-1.49;-1.49	5.65	5.65	0.86999	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	D	0.91516	0.7321	M	0.86502	2.82	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	D	0.92242	0.5801	10	0.72032	D	0.01	.	19.7313	0.96182	0.0:0.0:1.0:0.0	.	3542;3299;3571	Q9Y4A5-2;Q59FH1;Q9Y4A5	.;.;TRRAP_HUMAN	M	3571;3542;3559	ENSP00000352925:V3571M;ENSP00000347733:V3542M	ENSP00000347733:V3542M	V	+	1	0	TRRAP	98440907	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	9.814000	0.99346	2.672000	0.90937	0.655000	0.94253	GTG	TRRAP	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000196367		0.577	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	16	0.00	0	G	NM_003496	Missense_Mutation	98602971	98602971	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	missense	40	31.03	18	SNP	1.000	A
TRPV6	55503	genome.wustl.edu	37	7	142571218	142571218	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr7:142571218C>T	ENST00000359396.3	-	13	2016	c.1771G>A	c.(1771-1773)Gag>Aag	p.E591K	RP11-114L10.2_ENST00000438839.1_RNA	NM_018646.3	NP_061116	Q9H1D0	TRPV6_HUMAN	transient receptor potential cation channel, subfamily V, member 6	591					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|regulation of calcium ion-dependent exocytosis (GO:0017158)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)			breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(15)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	42	Melanoma(164;0.059)					CTCCACAGCTCATCCCGCTCA	0.597																																						dbGAP											0													99.0	98.0	99.0					7																	142571218		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ277909	CCDS5874.1	7q34	2013-01-10	2002-01-29	2002-02-01	ENSG00000165125	ENSG00000165125		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	14006	protein-coding gene	gene with protein product		606680	"""epithelial calcium channel 2"""	ECAC2		11097838, 11549322, 16382100, 16717058	Standard	NM_018646		Approved	CaT1	uc003wbx.2	Q9H1D0	OTTHUMG00000157158	ENST00000359396.3:c.1771G>A	7.37:g.142571218C>T	ENSP00000352358:p.Glu591Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2I8|Q8TDL3|Q8WXR8|Q96LC5|Q9H1D1|Q9H296	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV5/TRPV6_channel,prints_TRPV6_channel,prints_Ankyrin_rpt,tigrfam_TRP_channel	p.E591K	ENST00000359396.3	37	c.1771	CCDS5874.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.356586	0.95854	.	.	ENSG00000165125	ENST00000359396;ENST00000311470	D	0.91521	-2.86	5.57	5.57	0.84162	.	0.000000	0.85682	D	0.000000	D	0.94463	0.8218	M	0.83953	2.67	0.80722	D	1	D	0.58620	0.983	P	0.60949	0.881	D	0.92299	0.5848	10	0.12103	T	0.63	-35.2634	18.5442	0.91040	0.0:1.0:0.0:0.0	.	591	Q9H1D0	TRPV6_HUMAN	K	591;423	ENSP00000352358:E591K	ENSP00000310825:E423K	E	-	1	0	TRPV6	142281340	1.000000	0.71417	1.000000	0.80357	0.909000	0.53808	7.741000	0.84997	2.613000	0.88420	0.655000	0.94253	GAG	TRPV6	-	tigrfam_TRP_channel	ENSG00000165125		0.597	TRPV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV6	HGNC	protein_coding	OTTHUMT00000347662.1	20	0.00	0	C	NM_014274		142571218	142571218	-1	no_errors	ENST00000359396	ensembl	human	known	69_37n	missense	74	28.57	30	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179569097	179569097	+	Silent	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:179569097C>G	ENST00000591111.1	-	104	29273	c.29049G>C	c.(29047-29049)ctG>ctC	p.L9683L	TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342992.6_Silent_p.L8756L|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000589042.1_Silent_p.L10000L|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13761	Ig-like 78.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GGCCTTCTTTCAGAGTCACAT	0.428																																						dbGAP											0													185.0	177.0	180.0					2																	179569097		1973	4171	6144	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.29049G>C	2.37:g.179569097C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L8756	ENST00000591111.1	37	c.26268		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like	ENSG00000155657		0.428	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	146	0.00	0	C	NM_133378		179569097	179569097	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	238	17.93	52	SNP	0.998	G
UBA1	7317	genome.wustl.edu	37	X	47058918	47058918	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:47058918G>A	ENST00000335972.6	+	5	568	c.385G>A	c.(385-387)Gag>Aag	p.E129K	UBA1_ENST00000377351.4_Missense_Mutation_p.E129K	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	129	2 approximate repeats.				cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAACCGGGCCGAGGTATCACA	0.562																																						dbGAP											0													108.0	98.0	101.0					X																	47058918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.385G>A	X.37:g.47058918G>A	ENSP00000338413:p.Glu129Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRR8|Q96E13	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.E129K	ENST00000335972.6	37	c.385	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359963	0.82353	.	.	ENSG00000130985	ENST00000377351;ENST00000412206;ENST00000427561;ENST00000442035;ENST00000457753;ENST00000335972;ENST00000451702	T;T;T;T;T;T;T	0.51574	0.7;0.7;0.7;0.7;0.7;0.7;0.7	4.68	3.81	0.43845	UBA/THIF-type NAD/FAD binding fold (1);Molybdenum cofactor biosynthesis, MoeB (1);NAD(P)-binding domain (1);	0.051018	0.85682	D	0.000000	T	0.57051	0.2027	M	0.73372	2.23	0.80722	D	1	D	0.56521	0.976	P	0.52514	0.701	T	0.59300	-0.7480	10	0.40728	T	0.16	-28.061	13.2635	0.60120	0.0:0.1566:0.8434:0.0	.	129	P22314	UBA1_HUMAN	K	129;129;143;143;180;129;180	ENSP00000366568:E129K;ENSP00000415033:E129K;ENSP00000397816:E143K;ENSP00000389583:E143K;ENSP00000404796:E180K;ENSP00000338413:E129K;ENSP00000401101:E180K	ENSP00000338413:E129K	E	+	1	0	UBA1	46943862	1.000000	0.71417	0.995000	0.50966	0.979000	0.70002	6.503000	0.73699	1.109000	0.41680	-0.176000	0.13171	GAG	UBA1	-	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.562	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	48	0.00	0	G	NM_003334		47058918	47058918	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	missense	144	17.71	31	SNP	0.999	A
UBE2O	63893	genome.wustl.edu	37	17	74392693	74392693	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr17:74392693C>T	ENST00000319380.7	-	14	2389	c.2325G>A	c.(2323-2325)gtG>gtA	p.V775V	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	775					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						CTTCACTGATCACCACTCCCT	0.672																																						dbGAP											0													53.0	62.0	59.0					17																	74392693		2201	4300	6501	-	-	-	SO:0001819	synonymous_variant	0			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.2325G>A	17.37:g.74392693C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Silent	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.V775	ENST00000319380.7	37	c.2325	CCDS32742.1	17																																																																																			UBE2O	-	NULL	ENSG00000175931		0.672	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	18	0.00	0	C	NM_022066		74392693	74392693	-1	no_errors	ENST00000319380	ensembl	human	known	69_37n	silent	38	26.92	14	SNP	0.998	T
VPRBP	9730	genome.wustl.edu	37	3	51456160	51456160	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:51456160G>C	ENST00000335891.5	-	8	2069	c.2060C>G	c.(2059-2061)tCa>tGa	p.S687*				Q9Y4B6	VPRBP_HUMAN	Vpr (HIV-1) binding protein	1136					B cell differentiation (GO:0030183)|cell competition in a multicellular organism (GO:0035212)|histone H2A-T120 phosphorylation (GO:1990245)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|histone kinase activity (H2A-T120 specific) (GO:1990244)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(193;0.000272)|Kidney(197;0.000729)|KIRC - Kidney renal clear cell carcinoma(197;0.000875)		TGTGATGGCTGAGTTGTGACA	0.502																																						dbGAP											0													139.0	141.0	140.0					3																	51456160		2029	4190	6219	-	-	-	SO:0001587	stop_gained	0			AB018343	CCDS74943.1, CCDS74944.1	3p21.2	2011-06-17			ENSG00000145041	ENSG00000145041		"""DDB1 and CUL4 associated factors"""	30911	protein-coding gene	gene with protein product	"""DDB1 and CUL4 associated factor 1"""					8195203, 11223251	Standard	NM_014703		Approved	KIAA0800, MGC102804, DCAF1	uc003dbe.2	Q9Y4B6	OTTHUMG00000156895	ENST00000335891.5:c.2060C>G	3.37:g.51456160G>C	ENSP00000338857:p.Ser687*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD74|Q8TBD9|Q9HCA1|Q9UG37	Nonsense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.S687*	ENST00000335891.5	37	c.2060		3	.	.	.	.	.	.	.	.	.	.	G	39	7.482684	0.98312	.	.	ENSG00000145041	ENST00000423656;ENST00000335891	.	.	.	5.99	5.99	0.97316	.	0.058639	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-5.5484	20.4777	0.99188	0.0:0.0:1.0:0.0	.	.	.	.	X	707;687	.	ENSP00000338857:S687X	S	-	2	0	VPRBP	51431200	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.199000	0.95003	2.840000	0.97914	0.655000	0.94253	TCA	VPRBP	-	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold	ENSG00000145041		0.502	VPRBP-201	KNOWN	basic|appris_principal	protein_coding	VPRBP	HGNC	protein_coding		83	0.00	0	G	NM_014703		51456160	51456160	-1	no_errors	ENST00000335891	ensembl	human	known	69_37n	nonsense	168	19.23	40	SNP	1.000	C
USP13	8975	genome.wustl.edu	37	3	179474867	179474867	+	Splice_Site	SNP	G	G	T	rs144162544		TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr3:179474867G>T	ENST00000263966.3	+	16	2419		c.e16+1		USP13_ENST00000496897.1_Splice_Site|USP13_ENST00000482333.1_3'UTR	NM_003940.2	NP_003931.2	Q92995	UBP13_HUMAN	ubiquitin specific peptidase 13 (isopeptidase T-3)						autophagy (GO:0006914)|cell proliferation (GO:0008283)|melanocyte differentiation (GO:0030318)|protein K63-linked deubiquitination (GO:0070536)|protein stabilization (GO:0050821)|regulation of autophagy (GO:0010506)|regulation of transcription, DNA-templated (GO:0006355)|ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type endopeptidase activity (GO:0004197)|omega peptidase activity (GO:0008242)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(20)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	46	all_cancers(143;7.79e-15)|Ovarian(172;0.0338)|Breast(254;0.148)		OV - Ovarian serous cystadenocarcinoma(80;1e-25)|GBM - Glioblastoma multiforme(14;0.0169)			TTGATAGACCGTATGTATCTT	0.358																																						dbGAP											0													261.0	255.0	257.0					3																	179474867		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U75362	CCDS3235.1	3q26.2-q26.3	2008-04-11	2005-08-08		ENSG00000058056	ENSG00000058056		"""Ubiquitin-specific peptidases"""	12611	protein-coding gene	gene with protein product		603591	"""ubiquitin specific protease 13 (isopeptidase T-3)"""			12838346	Standard	NM_003940		Approved	IsoT-3	uc003fkh.3	Q92995	OTTHUMG00000157783	ENST00000263966.3:c.1948+1G>T	3.37:g.179474867G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2S3|B4DYF3|D3DNS2|Q96B25	Splice_Site	SNP	-	e16+1	ENST00000263966.3	37	c.1948+1	CCDS3235.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.101759	0.76983	.	.	ENSG00000058056	ENST00000263966;ENST00000496897	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4218	0.83760	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	USP13	180957561	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.914000	0.69964	2.664000	0.90586	0.561000	0.74099	.	USP13	-	-	ENSG00000058056		0.358	USP13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP13	HGNC	protein_coding	OTTHUMT00000349617.1	421	0.00	0	G		Intron	179474867	179474867	+1	no_errors	ENST00000263966	ensembl	human	known	69_37n	splice_site	422	22.00	119	SNP	1.000	T
VPS13B	157680	genome.wustl.edu	37	8	100732756	100732756	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr8:100732756C>T	ENST00000358544.2	+	38	7027	c.6916C>T	c.(6916-6918)Cta>Tta	p.L2306L	VPS13B_ENST00000357162.2_Silent_p.L2281L|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2306					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			ACGGACAGGTCTATTTCAGTA	0.388																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													66.0	63.0	64.0					8																	100732756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.6916C>T	8.37:g.100732756C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	pfam_Autophagy-rel_C	p.L2306	ENST00000358544.2	37	c.6916	CCDS6280.1	8																																																																																			VPS13B	-	NULL	ENSG00000132549		0.388	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	78	0.00	0	C	NM_184042		100732756	100732756	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	silent	118	11.28	15	SNP	0.162	T
VPS13D	55187	genome.wustl.edu	37	1	12374365	12374365	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr1:12374365C>G	ENST00000358136.3	+	30	7259	c.7129C>G	c.(7129-7131)Cag>Gag	p.Q2377E	VPS13D_ENST00000356315.4_Missense_Mutation_p.Q2377E	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AGGGTCCATTCAGATTGAACT	0.502																																						dbGAP											0													141.0	114.0	123.0					1																	12374365		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.7129C>G	1.37:g.12374365C>G	ENSP00000350854:p.Gln2377Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.Q2377E	ENST00000358136.3	37	c.7129	CCDS30588.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.82|18.82	3.704431|3.704431	0.68615|0.68615	.|.	.|.	ENSG00000048707|ENSG00000048707	ENST00000011700|ENST00000356315;ENST00000358136	.|T;T	.|0.44482	.|0.92;0.92	5.32|5.32	5.32|5.32	0.75619|0.75619	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.66587|0.66587	0.2804|0.2804	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.982;0.999;0.998	.|D;D;D	.|0.83275	.|0.952;0.996;0.996	T|T	0.64672|0.64672	-0.6352|-0.6352	5|10	.|0.33141	.|T	.|0.24	.|.	18.9875|18.9875	0.92777|0.92777	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|284;2377;2377	.|B1AJZ2;Q5THJ4-2;Q5THJ4	.|.;.;VP13D_HUMAN	L|E	1199|2377	.|ENSP00000348666:Q2377E;ENSP00000350854:Q2377E	.|ENSP00000348666:Q2377E	F|Q	+|+	3|1	2|0	VPS13D|VPS13D	12296952|12296952	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.445000|0.445000	0.32107|0.32107	7.294000|7.294000	0.78760|0.78760	2.479000|2.479000	0.83701|0.83701	0.561000|0.561000	0.74099|0.74099	TTC|CAG	VPS13D	-	NULL	ENSG00000048707		0.502	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	164	0.00	0	C	NM_015378		12374365	12374365	+1	no_errors	ENST00000358136	ensembl	human	known	69_37n	missense	273	17.77	59	SNP	1.000	G
WAS	7454	genome.wustl.edu	37	X	48547760	48547760	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chrX:48547760G>C	ENST00000376701.4	+	11	1465	c.1390G>C	c.(1390-1392)Gag>Cag	p.E464Q		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	464					actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				TCAGAGCTCAGAGGGACTGGT	0.652			"""Mis, N, F, S"""			lymphoma																																dbGAP		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	0													25.0	25.0	25.0					X																	48547760		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1390G>C	X.37:g.48547760G>C	ENSP00000365891:p.Glu464Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BU11|Q9UNJ9	Missense_Mutation	SNP	pfam_EVH1,pfam_PAK_box_Rho-bd,pfam_WH2_dom,superfamily_WASP_C,smart_EVH1,smart_PAK_box_Rho-bd,smart_WH2_dom,pfscan_PAK_box_Rho-bd,pfscan_EVH1,pfscan_WH2_dom	p.E464Q	ENST00000376701.4	37	c.1390	CCDS14303.1	X	.	.	.	.	.	.	.	.	.	.	G	15.71	2.913431	0.52439	.	.	ENSG00000015285	ENST00000376701	D	0.95853	-3.83	4.47	4.47	0.54385	Wiscott-Aldrich syndrome, C-terminal (1);	0.129059	0.49916	D	0.000129	D	0.94637	0.8271	M	0.79805	2.47	0.46011	D	0.998819	B	0.31318	0.319	B	0.28305	0.088	D	0.94720	0.7900	10	0.87932	D	0	-11.8291	14.0072	0.64470	0.0:0.0:1.0:0.0	.	464	P42768	WASP_HUMAN	Q	464	ENSP00000365891:E464Q	ENSP00000365891:E464Q	E	+	1	0	WAS	48432704	1.000000	0.71417	0.708000	0.30435	0.968000	0.65278	6.334000	0.72944	1.966000	0.57179	0.452000	0.29995	GAG	WAS	-	superfamily_WASP_C	ENSG00000015285		0.652	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	WAS	HGNC	protein_coding	OTTHUMT00000083379.1	11	0.00	0	G	NM_000377		48547760	48547760	+1	no_errors	ENST00000376701	ensembl	human	known	69_37n	missense	52	31.58	24	SNP	0.993	C
XPO6	23214	genome.wustl.edu	37	16	28109862	28109862	+	Silent	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:28109862G>C	ENST00000304658.5	-	24	3875	c.3375C>G	c.(3373-3375)ctC>ctG	p.L1125L	XPO6_ENST00000565698.1_Silent_p.L1111L	NM_015171.3	NP_055986.1	Q96QU8	XPO6_HUMAN	exportin 6	1125					protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	25						AGCAGGCCTAGAGCTTCACAG	0.607																																						dbGAP											0													82.0	98.0	93.0					16																	28109862		2173	4269	6442	-	-	-	SO:0001819	synonymous_variant	0			AY026388	CCDS42135.1, CCDS59266.1	16p11.2	2011-04-13	2003-03-11	2003-03-14		ENSG00000169180		"""Exportins"""	19733	protein-coding gene	gene with protein product		608411	"""RAN binding protein 20"""	RANBP20		14592989	Standard	NM_001270940		Approved	KIAA0370, FLJ22519	uc002dpa.2	Q96QU8		ENST00000304658.5:c.3375C>G	16.37:g.28109862G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3W4|D3DWF9|Q2YDX3|Q53G88|Q68G50|Q76N88|Q96CP8|Q9BT21	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.L1125	ENST00000304658.5	37	c.3375	CCDS42135.1	16																																																																																			XPO6	-	NULL	ENSG00000169180		0.607	XPO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO6	HGNC	protein_coding	OTTHUMT00000433732.1	22	0.00	0	G	XM_055195		28109862	28109862	-1	no_errors	ENST00000304658	ensembl	human	known	69_37n	silent	163	15.98	31	SNP	0.998	C
XRCC4	7518	genome.wustl.edu	37	5	82500653	82500653	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr5:82500653G>C	ENST00000511817.1	+	6	738	c.658G>C	c.(658-660)Gaa>Caa	p.E220Q	XRCC4_ENST00000396027.4_Missense_Mutation_p.E220Q|XRCC4_ENST00000282268.3_Missense_Mutation_p.E220Q|XRCC4_ENST00000338635.6_Missense_Mutation_p.E220Q|XRCC4_ENST00000509268.1_3'UTR			Q13426	XRCC4_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 4	220					cellular response to lithium ion (GO:0071285)|central nervous system development (GO:0007417)|DNA ligation involved in DNA repair (GO:0051103)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|immunoglobulin V(D)J recombination (GO:0033152)|in utero embryonic development (GO:0001701)|isotype switching (GO:0045190)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of ligase activity (GO:0051351)|positive regulation of neurogenesis (GO:0050769)|pro-B cell differentiation (GO:0002328)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytosol (GO:0005829)|DNA ligase IV complex (GO:0032807)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein C-terminus binding (GO:0008022)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(2)|skin(3)	17		Lung NSC(167;0.00132)|all_lung(232;0.00154)|Ovarian(174;0.034)		OV - Ovarian serous cystadenocarcinoma(54;1.44e-38)|Epithelial(54;3.72e-33)|all cancers(79;9.22e-28)		AATCTGTTCTGAAATGACTGC	0.413								Non-homologous end-joining																														dbGAP											0													108.0	110.0	109.0					5																	82500653		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB017445	CCDS4058.1, CCDS4059.1	5q14.2	2008-02-05			ENSG00000152422	ENSG00000152422			12831	protein-coding gene	gene with protein product	"""X-ray repair, complementing defective, repair in Chinese hamster"", ""DNA repair protein XRCC4"""	194363				1697445, 7665175	Standard	NM_022406		Approved		uc003kib.3	Q13426	OTTHUMG00000131319	ENST00000511817.1:c.658G>C	5.37:g.82500653G>C	ENSP00000421491:p.Glu220Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3X4|Q9BS72|Q9UP94	Missense_Mutation	SNP	pfam_DNA_ds_break_repair_XRCC4,superfamily_XRCC4_N	p.E220Q	ENST00000511817.1	37	c.658	CCDS4059.1	5	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455908	0.26161	.	.	ENSG00000152422	ENST00000282268;ENST00000338635;ENST00000396027;ENST00000511817	T;T;T;T	0.13657	2.57;2.57;2.57;2.57	5.52	-0.0183	0.13965	.	0.588753	0.18086	N	0.152137	T	0.08313	0.0207	L	0.35414	1.06	0.09310	N	1	B;B;B	0.24618	0.023;0.059;0.107	B;B;B	0.22152	0.016;0.038;0.034	T	0.34976	-0.9807	10	0.22706	T	0.39	-12.6536	6.2586	0.20887	0.292:0.4422:0.2659:0.0	.	220;220;220	Q13426-2;Q13426;Q13426-3	.;XRCC4_HUMAN;.	Q	220	ENSP00000282268:E220Q;ENSP00000342011:E220Q;ENSP00000379344:E220Q;ENSP00000421491:E220Q	ENSP00000282268:E220Q	E	+	1	0	XRCC4	82536409	0.473000	0.25878	0.001000	0.08648	0.278000	0.26855	1.140000	0.31516	0.052000	0.16007	-0.150000	0.13652	GAA	XRCC4	-	pfam_DNA_ds_break_repair_XRCC4	ENSG00000152422		0.413	XRCC4-003	NOVEL	alternative_5_UTR|basic|CCDS	protein_coding	XRCC4	HGNC	protein_coding	OTTHUMT00000369624.1	223	0.00	0	G	NM_022550		82500653	82500653	+1	no_errors	ENST00000338635	ensembl	human	known	69_37n	missense	245	16.89	50	SNP	0.002	C
ZFP36L2	678	genome.wustl.edu	37	2	43452567	43452567	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr2:43452567C>G	ENST00000282388.3	-	2	669	c.376G>C	c.(376-378)Gag>Cag	p.E126Q	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	126					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				TCGCCGTTCTCGCTAAACGAG	0.662																																						dbGAP											0													26.0	31.0	30.0					2																	43452567		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.376G>C	2.37:g.43452567C>G	ENSP00000282388:p.Glu126Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.E126Q	ENST00000282388.3	37	c.376	CCDS1811.1	2	.	.	.	.	.	.	.	.	.	.	C	16.50	3.140625	0.56936	.	.	ENSG00000152518	ENST00000282388	T	0.50277	0.75	4.8	3.92	0.45320	Tis11B-like protein, N-terminal (1);	0.287586	0.32624	N	0.005841	T	0.60117	0.2244	L	0.61218	1.895	0.80722	D	1	D	0.58970	0.984	P	0.59595	0.86	T	0.63148	-0.6702	10	0.72032	D	0.01	-5.8409	11.9576	0.52991	0.0:0.9139:0.0:0.0861	.	126	P47974	TISD_HUMAN	Q	126	ENSP00000282388:E126Q	ENSP00000282388:E126Q	E	-	1	0	ZFP36L2	43306071	1.000000	0.71417	1.000000	0.80357	0.269000	0.26545	5.553000	0.67287	1.014000	0.39417	-0.258000	0.10820	GAG	ZFP36L2	-	pfam_Tis11B_N	ENSG00000152518		0.662	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L2	HGNC	protein_coding	OTTHUMT00000250513.2	13	0.00	0	C	NM_006887		43452567	43452567	-1	no_errors	ENST00000282388	ensembl	human	known	69_37n	missense	62	19.48	15	SNP	1.000	G
ZNF174	7727	genome.wustl.edu	37	16	3452196	3452196	+	Silent	SNP	C	C	T			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr16:3452196C>T	ENST00000268655.4	+	1	777	c.192C>T	c.(190-192)ctC>ctT	p.L64L	ZSCAN32_ENST00000422427.2_5'Flank|ZNF174_ENST00000571936.1_Silent_p.L64L|ZSCAN32_ENST00000573830.1_5'Flank|ZSCAN32_ENST00000439568.2_5'Flank|ZNF174_ENST00000344823.5_Silent_p.L64L|ZNF174_ENST00000572544.1_Silent_p.L64L|ZSCAN32_ENST00000304926.3_5'Flank|ZNF174_ENST00000575752.1_Silent_p.L64L|ZSCAN32_ENST00000396852.4_5'Flank	NM_003450.2	NP_003441.1	Q15697	ZN174_HUMAN	zinc finger protein 174	64	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase II promoter (GO:0006366)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|urinary_tract(2)	12						AAGAGGCTCTCTCCCAGCTCC	0.572																																						dbGAP											0													83.0	93.0	90.0					16																	3452196		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U31248	CCDS10504.1, CCDS32380.1	16p13	2013-01-09			ENSG00000103343	ENSG00000103343		"""-"", ""Zinc fingers, C2H2-type"""	12963	protein-coding gene	gene with protein product		603900					Standard	NM_003450		Approved	ZSCAN8	uc002cvc.3	Q15697	OTTHUMG00000129358	ENST00000268655.4:c.192C>T	16.37:g.3452196C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53Y68|Q9BQ34	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.L64	ENST00000268655.4	37	c.192	CCDS10504.1	16																																																																																			ZNF174	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000103343		0.572	ZNF174-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF174	HGNC	protein_coding	OTTHUMT00000251510.1	39	0.00	0	C	NM_003450		3452196	3452196	+1	no_errors	ENST00000268655	ensembl	human	known	69_37n	silent	84	18.45	19	SNP	0.029	T
ZNF570	148268	genome.wustl.edu	37	19	37975503	37975503	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A0W7-01A-11D-A10Y-09	TCGA-BH-A0W7-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7d20774c-6aac-4eb0-a876-1be14e0f3004	38761409-51cc-4347-a0fe-3c259e3a1219	g.chr19:37975503G>A	ENST00000330173.1	+	5	1508	c.979G>A	c.(979-981)Gag>Aag	p.E327K	ZNF570_ENST00000388801.3_Missense_Mutation_p.E124K|ZNF570_ENST00000586475.1_Missense_Mutation_p.E383K	NM_144694.1	NP_653295.1	Q96NI8	ZN570_HUMAN	zinc finger protein 570	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(3)|large_intestine(6)|lung(12)|ovary(1)|prostate(1)|skin(1)	27			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCACACGGGAGAGAAACCCTA	0.438																																						dbGAP											0													92.0	88.0	89.0					19																	37975503		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055353	CCDS12504.1, CCDS74355.1	19q13.12	2013-09-20			ENSG00000171827	ENSG00000171827		"""Zinc fingers, C2H2-type"", ""-"""	26416	protein-coding gene	gene with protein product							Standard	XM_005258567		Approved	FLJ30791	uc002ogk.1	Q96NI8	OTTHUMG00000048176	ENST00000330173.1:c.979G>A	19.37:g.37975503G>A	ENSP00000331540:p.Glu327Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L472|B4DMP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E327K	ENST00000330173.1	37	c.979	CCDS12504.1	19	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051119	0.75960	.	.	ENSG00000171827	ENST00000330173;ENST00000388801	T;T	0.24350	1.86;1.86	4.18	4.18	0.49190	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.43110	D	0.000608	T	0.42154	0.1190	L	0.45228	1.405	0.34492	D	0.705094	P;D	0.76494	0.837;0.999	P;D	0.71184	0.524;0.972	T	0.54695	-0.8255	10	0.52906	T	0.07	.	15.7734	0.78190	0.0:0.0:1.0:0.0	.	124;327	B4DMP1;Q96NI8	.;ZN570_HUMAN	K	327;124	ENSP00000331540:E327K;ENSP00000373453:E124K	ENSP00000331540:E327K	E	+	1	0	ZNF570	42667343	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	4.355000	0.59424	2.317000	0.78254	0.563000	0.77884	GAG	ZNF570	-	pfscan_Znf_C2H2	ENSG00000171827		0.438	ZNF570-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF570	HGNC	protein_coding	OTTHUMT00000109600.1	98	0.00	0	G	NM_144694		37975503	37975503	+1	no_errors	ENST00000330173	ensembl	human	known	69_37n	missense	129	17.31	27	SNP	1.000	A
