#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCD2	225	genome.wustl.edu	37	12	39947821	39947821	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr12:39947821G>A	ENST00000308666.3	-	10	2251	c.2116C>T	c.(2116-2118)Cag>Tag	p.Q706*		NM_005164.3	NP_005155.1	Q9UBJ2	ABCD2_HUMAN	ATP-binding cassette, sub-family D (ALD), member 2	706					fatty acid beta-oxidation (GO:0006635)|positive regulation of fatty acid beta-oxidation (GO:0032000)|transmembrane transport (GO:0055085)|very long-chain fatty acid catabolic process (GO:0042760)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(24)|ovary(2)|pancreas(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	52						CCAGCTAGCTGAGATTCTAGC	0.373																																						dbGAP											0													98.0	94.0	95.0					12																	39947821		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U28150	CCDS8734.1	12q12	2012-05-16			ENSG00000173208	ENSG00000173208		"""ATP binding cassette transporters / subfamily D"""	66	protein-coding gene	gene with protein product		601081		ALDL1		8577752	Standard	NM_005164		Approved	ALDR, ALDRP	uc001rmb.2	Q9UBJ2	OTTHUMG00000169337	ENST00000308666.3:c.2116C>T	12.37:g.39947821G>A	ENSP00000310688:p.Gln706*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAM3|Q13210|Q2M3H9	Nonsense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.Q706*	ENST00000308666.3	37	c.2116	CCDS8734.1	12	.	.	.	.	.	.	.	.	.	.	G	39	7.853815	0.98525	.	.	ENSG00000173208	ENST00000308666	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-14.1208	18.857	0.92257	0.0:0.0:1.0:0.0	.	.	.	.	X	706	.	.	Q	-	1	0	ABCD2	38234088	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.731000	0.98807	2.528000	0.85240	0.655000	0.94253	CAG	ABCD2	-	NULL	ENSG00000173208		0.373	ABCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD2	HGNC	protein_coding	OTTHUMT00000403591.1	393	0.00	0	G	NM_005164		39947821	39947821	-1	no_errors	ENST00000308666	ensembl	human	known	69_37n	nonsense	277	25.54	95	SNP	1.000	A
AGBL1	123624	genome.wustl.edu	37	15	87531306	87531306	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr15:87531306C>T	ENST00000441037.2	+	23	3267	c.3172C>T	c.(3172-3174)Ctg>Ttg	p.L1058L	RP11-133L19.1_ENST00000558587.1_RNA|AGBL1_ENST00000389298.3_Silent_p.L789L|AGBL1_ENST00000421325.2_Silent_p.L1058L	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	1058			Missing (in FECD8; enriched in the nucleus, decreased TCF4-binding). {ECO:0000269|PubMed:24094747}.		C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						gaaccttcttctgcatgtctc	0.413																																						dbGAP											0													237.0	223.0	228.0					15																	87531306		1875	4092	5967	-	-	-	SO:0001819	synonymous_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.3172C>T	15.37:g.87531306C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.L1058	ENST00000441037.2	37	c.3172	CCDS58398.1	15																																																																																			AGBL1	-	NULL	ENSG00000166748		0.413	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	536	0.19	1	C	NM_152336		87531306	87531306	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	silent	444	21.14	119	SNP	0.000	T
ANO5	203859	genome.wustl.edu	37	11	22271833	22271833	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr11:22271833A>T	ENST00000324559.8	+	10	1246	c.929A>T	c.(928-930)tAc>tTc	p.Y310F		NM_001142649.1|NM_213599.2	NP_001136121.1|NP_998764.1	Q75V66	ANO5_HUMAN	anoctamin 5	310					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	intracellular calcium activated chloride channel activity (GO:0005229)			breast(2)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(12)|lung(36)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						CTTGGATTTTACACAGAAATG	0.323																																						dbGAP											0													136.0	121.0	126.0					11																	22271833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833271	CCDS31444.1	11p15.1	2014-09-17	2008-08-28	2008-08-28	ENSG00000171714	ENSG00000171714		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	27337	protein-coding gene	gene with protein product		608662	"""transmembrane protein 16E"", ""limb girdle muscular dystrophy 2L (autosomal recessive)"""	TMEM16E, LGMD2L		15067359, 20096397, 24692353	Standard	NM_213599		Approved	GDD1	uc001mqi.2	Q75V66	OTTHUMG00000166051	ENST00000324559.8:c.929A>T	11.37:g.22271833A>T	ENSP00000315371:p.Tyr310Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Anoctamin	p.Y310F	ENST00000324559.8	37	c.929	CCDS31444.1	11	.	.	.	.	.	.	.	.	.	.	A	20.3	3.972544	0.74246	.	.	ENSG00000171714	ENST00000324559	T	0.72167	-0.63	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.79375	0.4435	M	0.82323	2.585	0.80722	D	1	B	0.28350	0.208	B	0.40636	0.335	T	0.80223	-0.1471	10	0.62326	D	0.03	.	15.1157	0.72401	1.0:0.0:0.0:0.0	.	310	Q75V66	ANO5_HUMAN	F	310	ENSP00000315371:Y310F	ENSP00000315371:Y310F	Y	+	2	0	ANO5	22228409	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.892000	0.92491	2.044000	0.60594	0.455000	0.32223	TAC	ANO5	-	pfam_Anoctamin	ENSG00000171714		0.323	ANO5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANO5	HGNC	protein_coding	OTTHUMT00000387615.1	586	0.00	0	A	NM_213599		22271833	22271833	+1	no_errors	ENST00000324559	ensembl	human	known	69_37n	missense	485	24.88	161	SNP	1.000	T
APLF	200558	genome.wustl.edu	37	2	68804999	68804999	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:68804999G>A	ENST00000303795.4	+	10	1552	c.1381G>A	c.(1381-1383)Gag>Aag	p.E461K	APLF_ENST00000471727.1_3'UTR	NM_173545.2	NP_775816.1	Q8IW19	APLF_HUMAN	aprataxin and PNKP like factor	461					cellular response to DNA damage stimulus (GO:0006974)|DNA catabolic process, endonucleolytic (GO:0000737)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of DNA ligation (GO:0051106)|regulation of isotype switching (GO:0045191)|single strand break repair (GO:0000012)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	3'-5' exonuclease activity (GO:0008408)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|endodeoxyribonuclease activity (GO:0004520)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|liver(2)|lung(9)|ovary(3)|prostate(1)|skin(1)	25						GCAACCCAATGAGTATGACCT	0.408																																						dbGAP											0													182.0	177.0	179.0					2																	68804999		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030711	CCDS1888.1	2p14	2014-02-20	2008-10-01	2008-10-01	ENSG00000169621	ENSG00000169621			28724	protein-coding gene	gene with protein product	"""XRCC1-interacting protein 1"", ""zinc finger, CX5CX6HX5H motif containing 1"""	611035	"""chromosome 2 open reading frame 13"""	C2orf13		18474613, 18077224, 17353262	Standard	NM_173545		Approved	MGC47799, Xip1, ZCCHH1	uc002sep.3	Q8IW19	OTTHUMG00000129566	ENST00000303795.4:c.1381G>A	2.37:g.68804999G>A	ENSP00000307004:p.Glu461Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K476|Q53P47|Q53PB9|Q53QU0	Missense_Mutation	SNP	pfam_Znf_C2H2_APLF-like,superfamily_SMAD_FHA_domain	p.E461K	ENST00000303795.4	37	c.1381	CCDS1888.1	2	.	.	.	.	.	.	.	.	.	.	G	27.3	4.820148	0.90873	.	.	ENSG00000169621	ENST00000303795	T	0.26067	1.76	5.59	5.59	0.84812	.	0.171732	0.49916	D	0.000128	T	0.48750	0.1517	M	0.67953	2.075	0.27401	N	0.954846	D	0.76494	0.999	D	0.66084	0.941	T	0.39542	-0.9609	10	0.33940	T	0.23	.	18.3684	0.90399	0.0:0.0:1.0:0.0	.	461	Q8IW19	APLF_HUMAN	K	461	ENSP00000307004:E461K	ENSP00000307004:E461K	E	+	1	0	APLF	68658503	1.000000	0.71417	0.034000	0.17996	0.238000	0.25445	3.801000	0.55545	2.634000	0.89283	0.650000	0.86243	GAG	APLF	-	NULL	ENSG00000169621		0.408	APLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APLF	HGNC	protein_coding	OTTHUMT00000251759.1	387	0.00	0	G	NM_173545		68804999	68804999	+1	no_errors	ENST00000303795	ensembl	human	known	69_37n	missense	331	26.87	122	SNP	0.519	A
ASXL3	80816	genome.wustl.edu	37	18	31320321	31320321	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr18:31320321G>A	ENST00000269197.5	+	11	2953	c.2953G>A	c.(2953-2955)Gat>Aat	p.D985N		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	985					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						GATAGAAGATGATCAGTCAAC	0.428																																						dbGAP											0													42.0	41.0	41.0					18																	31320321		1862	4106	5968	-	-	-	SO:0001583	missense	0			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2953G>A	18.37:g.31320321G>A	ENSP00000269197:p.Asp985Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD	p.D985N	ENST00000269197.5	37	c.2953	CCDS45847.1	18	.	.	.	.	.	.	.	.	.	.	G	16.44	3.122775	0.56613	.	.	ENSG00000141431	ENST00000269197	T	0.61392	0.11	5.93	5.93	0.95920	.	0.743893	0.12011	N	0.507908	T	0.61578	0.2358	N	0.20766	0.605	0.41057	D	0.985347	D	0.71674	0.998	P	0.59761	0.863	T	0.54330	-0.8310	10	0.15499	T	0.54	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	985	Q9C0F0	ASXL3_HUMAN	N	985	ENSP00000269197:D985N	ENSP00000269197:D985N	D	+	1	0	ASXL3	29574319	1.000000	0.71417	0.937000	0.37676	0.410000	0.31052	5.123000	0.64703	2.805000	0.96524	0.655000	0.94253	GAT	ASXL3	-	NULL	ENSG00000141431		0.428	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	103	0.00	0	G			31320321	31320321	+1	no_errors	ENST00000269197	ensembl	human	known	69_37n	missense	93	23.77	29	SNP	1.000	A
ATRNL1	26033	genome.wustl.edu	37	10	117075136	117075136	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr10:117075136C>T	ENST00000355044.3	+	18	3053	c.2927C>T	c.(2926-2928)tCt>tTt	p.S976F	ATRNL1_ENST00000423111.2_Missense_Mutation_p.S73F|ATRNL1_ENST00000303745.7_5'UTR	NM_207303.2	NP_997186.1	Q5VV63	ATRN1_HUMAN	attractin-like 1	976	PSI 5.				G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(11)|liver(2)|lung(44)|ovary(6)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95		all_lung(145;0.0686)|Breast(234;0.0969)|Lung NSC(174;0.17)|Colorectal(252;0.234)		Epithelial(162;0.00031)|all cancers(201;0.000753)|LUSC - Lung squamous cell carcinoma(1;0.0515)|Lung(30;0.0827)		ATTGAAGGTTCTTCACGGGGA	0.453																																						dbGAP											0													156.0	138.0	144.0					10																	117075136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011106	CCDS7592.1, CCDS73204.1	10q26	2004-03-04			ENSG00000107518	ENSG00000107518			29063	protein-coding gene	gene with protein product		612869				9628581	Standard	NM_001276282		Approved	KIAA0534, FLJ45344, ALP	uc001lcg.3	Q5VV63	OTTHUMG00000019096	ENST00000355044.3:c.2927C>T	10.37:g.117075136C>T	ENSP00000347152:p.Ser976Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O60283|Q5JSE8|Q5T5Y9|Q6T256|Q6ZSN4|Q86WX2	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_Plexin_repeat,pfam_CUB,pfam_EGF_extracell,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EGF-like,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.S976F	ENST00000355044.3	37	c.2927	CCDS7592.1	10	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554378	0.86231	.	.	ENSG00000107518	ENST00000355044;ENST00000423111	T;T	0.19394	2.15;2.15	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	T	0.52597	0.1744	M	0.84948	2.725	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.87578	0.998;0.998	T	0.53570	-0.8420	10	0.37606	T	0.19	-20.9633	19.0432	0.93010	0.0:1.0:0.0:0.0	.	73;976	B4DH41;Q5VV63	.;ATRN1_HUMAN	F	976;73	ENSP00000347152:S976F;ENSP00000409624:S73F	ENSP00000347152:S976F	S	+	2	0	ATRNL1	117065126	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	7.711000	0.84669	2.510000	0.84645	0.455000	0.32223	TCT	ATRNL1	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000107518		0.453	ATRNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATRNL1	HGNC	protein_coding	OTTHUMT00000050507.3	212	0.00	0	C	XM_049349		117075136	117075136	+1	no_errors	ENST00000355044	ensembl	human	known	69_37n	missense	154	22.22	44	SNP	1.000	T
BEND3	57673	genome.wustl.edu	37	6	107391941	107391941	+	Missense_Mutation	SNP	C	C	A	rs142662918	byFrequency	TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr6:107391941C>A	ENST00000369042.1	-	4	644	c.454G>T	c.(454-456)Gtg>Ttg	p.V152L	BEND3_ENST00000429433.2_Missense_Mutation_p.V152L			Q5T5X7	BEND3_HUMAN	BEN domain containing 3	152										central_nervous_system(1)|cervix(2)|endometrium(3)|large_intestine(7)|lung(10)|ovary(4)|prostate(3)	30						AGCTCGTACACGTTTAGCAGG	0.582																																						dbGAP											0													128.0	123.0	124.0					6																	107391941		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046773	CCDS34507.1	6q21	2012-11-22	2008-10-03	2008-10-03	ENSG00000178409	ENSG00000178409		"""BEN domain containing"""	23040	protein-coding gene	gene with protein product			"""KIAA1553"""	KIAA1553			Standard	NM_001080450		Approved		uc003prs.2	Q5T5X7	OTTHUMG00000015308	ENST00000369042.1:c.454G>T	6.37:g.107391941C>A	ENSP00000358038:p.Val152Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRH2|Q9HCL9	Missense_Mutation	SNP	pfam_BEN_domain	p.V152L	ENST00000369042.1	37	c.454	CCDS34507.1	6	.	.	.	.	.	.	.	.	.	.	T	0.184	-1.059786	0.01950	.	.	ENSG00000178409	ENST00000369042;ENST00000429433	.	.	.	4.88	-0.588	0.11687	.	0.828604	0.10973	N	0.613676	T	0.03390	0.0098	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39881	-0.9592	9	0.13108	T	0.6	-3.1766	0.5191	0.00609	0.1837:0.2269:0.1882:0.4012	.	152	Q5T5X7	BEND3_HUMAN	L	152	.	ENSP00000358038:V152L	V	-	1	0	BEND3	107498634	0.001000	0.12720	0.002000	0.10522	0.032000	0.12392	0.243000	0.18106	-0.951000	0.03654	-3.115000	0.00062	GTG	BEND3	-	NULL	ENSG00000178409		0.582	BEND3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BEND3	HGNC	protein_coding	OTTHUMT00000041686.1	232	0.00	0	C	NM_020913		107391941	107391941	-1	no_errors	ENST00000369042	ensembl	human	known	69_37n	missense	168	26.64	61	SNP	0.000	A
BPTF	2186	genome.wustl.edu	37	17	65909295	65909295	+	Silent	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr17:65909295C>A	ENST00000321892.4	+	13	5734	c.5673C>A	c.(5671-5673)atC>atA	p.I1891I	BPTF_ENST00000424123.3_Silent_p.I1752I|BPTF_ENST00000306378.6_Silent_p.I1765I|BPTF_ENST00000335221.5_Silent_p.I1891I			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1891					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			CCTTTGGCATCACTTGGAGGT	0.358																																						dbGAP											0													100.0	110.0	106.0					17																	65909295		2111	4261	6372	-	-	-	SO:0001819	synonymous_variant	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5673C>A	17.37:g.65909295C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Silent	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.I1891	ENST00000321892.4	37	c.5673		17																																																																																			BPTF	-	NULL	ENSG00000171634		0.358	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		71	0.00	0	C	NM_182641, NM_004459		65909295	65909295	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	silent	46	35.21	25	SNP	1.000	A
COA6	388753	genome.wustl.edu	37	1	234519488	234519488	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr1:234519488G>A	ENST00000366613.1	+	3	338	c.302G>A	c.(301-303)aGa>aAa	p.R101K	COA6_ENST00000366612.1_Missense_Mutation_p.R55K|COA6_ENST00000366615.4_Missense_Mutation_p.R131K	NM_001012985.2	NP_001013003.1	Q5JTJ3	COA6_HUMAN	cytochrome c oxidase assembly factor 6 homolog (S. cerevisiae)	101						mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|poly(A) RNA binding (GO:0044822)										TTTGATAAAAGAAGAGACTAC	0.294																																						dbGAP											0													32.0	36.0	34.0					1																	234519488		2193	4291	6484	-	-	-	SO:0001583	missense	0				CCDS31059.1, CCDS55690.1	1q42.2	2012-10-15	2012-10-15	2012-10-15	ENSG00000168275	ENSG00000168275		"""Mitochondrial respiratory chain complex assembly factors"""	18025	protein-coding gene	gene with protein product		614772	"""chromosome 1 open reading frame 31"""	C1orf31		22984289	Standard	NM_001012985		Approved		uc001hwc.3	Q5JTJ3	OTTHUMG00000037945	ENST00000366613.1:c.302G>A	1.37:g.234519488G>A	ENSP00000355572:p.Arg101Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTJ2|Q5JTJ4|Q8TA88	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B	p.R131K	ENST00000366613.1	37	c.392	CCDS31059.1	1	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754343	0.49362	.	.	ENSG00000168275	ENST00000366615;ENST00000424237;ENST00000366613;ENST00000366612	D;D;D	0.81996	-1.56;-1.56;-1.56	5.63	5.63	0.86233	.	0.000000	0.85682	D	0.000000	D	0.83834	0.5340	N	0.20986	0.625	0.48185	D	0.999603	D	0.89917	1.0	D	0.87578	0.998	T	0.75961	-0.3133	10	0.02654	T	1	.	19.6405	0.95755	0.0:0.0:1.0:0.0	.	101	Q5JTJ3	CA031_HUMAN	K	131;132;101;55	ENSP00000355574:R131K;ENSP00000355572:R101K;ENSP00000355571:R55K	ENSP00000355571:R55K	R	+	2	0	C1orf31	232586111	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.244000	0.72391	2.810000	0.96702	0.655000	0.94253	AGA	C1orf31	-	pfam_Cyt_c_oxidase_su6B,superfamily_Cyt_c_oxidase_su6B	ENSG00000168275		0.294	COA6-002	NOVEL	basic|CCDS	protein_coding	C1orf31	HGNC	protein_coding	OTTHUMT00000092613.1	121	0.00	0	G	NM_001012985		234519488	234519488	+1	no_errors	ENST00000366615	ensembl	human	known	69_37n	missense	102	24.44	33	SNP	1.000	A
C3orf30	152405	genome.wustl.edu	37	3	118865111	118865111	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr3:118865111C>T	ENST00000295622.1	+	1	115	c.75C>T	c.(73-75)ggC>ggT	p.G25G	IGSF11_ENST00000425327.2_5'Flank|IGSF11_ENST00000441144.2_5'Flank|IGSF11_ENST00000354673.2_5'Flank|RP11-484M3.5_ENST00000490594.1_5'Flank	NM_152539.2	NP_689752.2	Q96M34	CC030_HUMAN	chromosome 3 open reading frame 30	25										NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(20)|ovary(2)|prostate(1)|urinary_tract(1)	34				GBM - Glioblastoma multiforme(114;0.222)		CAAGTGCTGGCCACACTAAGG	0.562																																						dbGAP											0													63.0	46.0	52.0					3																	118865111		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK057421	CCDS2984.1	3q13.32	2011-08-09			ENSG00000163424	ENSG00000163424			26553	protein-coding gene	gene with protein product							Standard	NM_152539		Approved	FLJ32859	uc003ecb.1	Q96M34	OTTHUMG00000159349	ENST00000295622.1:c.75C>T	3.37:g.118865111C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B7	Silent	SNP	superfamily_cAMP_dep_PK_reg_su_I/II_a/b	p.G25	ENST00000295622.1	37	c.75	CCDS2984.1	3																																																																																			C3orf30	-	NULL	ENSG00000163424		0.562	C3orf30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf30	HGNC	protein_coding	OTTHUMT00000354838.1	54	0.00	0	C	NM_152539		118865111	118865111	+1	no_errors	ENST00000295622	ensembl	human	known	69_37n	silent	40	24.53	13	SNP	0.000	T
C9orf91	203197	genome.wustl.edu	37	9	117396146	117396146	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr9:117396146G>C	ENST00000288502.4	+	6	1010	c.573G>C	c.(571-573)caG>caC	p.Q191H	C9orf91_ENST00000374049.4_Missense_Mutation_p.Q192H			Q5VZI3	CI091_HUMAN	chromosome 9 open reading frame 91	191						integral component of membrane (GO:0016021)				endometrium(2)|large_intestine(3)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	13						AAGGATGCCAGAGTGTGATTC	0.567																																						dbGAP											0													128.0	100.0	109.0					9																	117396146		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX649023	CCDS6808.1	9q33.1	2008-02-05			ENSG00000157693	ENSG00000157693			24513	protein-coding gene	gene with protein product						14702039	Standard	NM_153045		Approved	DKFZp547P234, FLJ38045	uc004bjd.4	Q5VZI3	OTTHUMG00000020541	ENST00000288502.4:c.573G>C	9.37:g.117396146G>C	ENSP00000288502:p.Gln191His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJA3|Q3KNS4|Q5VZI2|Q6P5Z7|Q8N1P3|Q8ND43	Missense_Mutation	SNP	NULL	p.Q192H	ENST00000288502.4	37	c.576	CCDS6808.1	9	.	.	.	.	.	.	.	.	.	.	G	16.81	3.224525	0.58668	.	.	ENSG00000157693	ENST00000374049;ENST00000288502	.	.	.	5.72	4.83	0.62350	.	0.255114	0.40064	N	0.001198	T	0.55065	0.1897	L	0.40543	1.245	0.32133	N	0.586529	D;D	0.69078	0.997;0.997	D;D	0.81914	0.995;0.995	T	0.58962	-0.7543	9	0.22109	T	0.4	-10.0772	10.5474	0.45068	0.0884:0.0:0.9116:0.0	.	170;191	Q5VZI3-2;Q5VZI3	.;CI091_HUMAN	H	192;191	.	ENSP00000288502:Q191H	Q	+	3	2	C9orf91	116435967	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.740000	0.47418	1.436000	0.47453	0.555000	0.69702	CAG	C9orf91	-	NULL	ENSG00000157693		0.567	C9orf91-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	C9orf91	HGNC	protein_coding	OTTHUMT00000053780.1	80	0.00	0	G	NM_153045		117396146	117396146	+1	no_errors	ENST00000374049	ensembl	human	known	69_37n	missense	86	18.87	20	SNP	1.000	C
CDC25C	995	genome.wustl.edu	37	5	137621494	137621494	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:137621494G>T	ENST00000323760.6	-	14	1587	c.1309C>A	c.(1309-1311)Cat>Aat	p.H437N	CDC25C_ENST00000513970.1_Missense_Mutation_p.H437N|CDC25C_ENST00000415130.2_Missense_Mutation_p.H364N|CDC25C_ENST00000357274.3_Missense_Mutation_p.H394N|CDC25C_ENST00000348983.3_Missense_Mutation_p.H364N|CDC25C_ENST00000356505.3_Missense_Mutation_p.H407N|CDC25C_ENST00000514555.1_Missense_Mutation_p.H407N	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	437					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)			endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			TGGTCCTGATGATGCATAGGG	0.512																																						dbGAP											0													109.0	97.0	101.0					5																	137621494		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.1309C>A	5.37:g.137621494G>T	ENSP00000321656:p.His437Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Nonsense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.S238*	ENST00000323760.6	37	c.713	CCDS4202.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.6|20.6	4.017187|4.017187	0.75161|0.75161	.|.	.|.	ENSG00000158402|ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555|ENST00000514017	T;T;T;T;T;T;T|.	0.29917|.	1.55;1.55;1.55;1.55;1.55;1.55;1.55|.	5.32|5.32	4.45|4.45	0.53987|0.53987	Rhodanese-like (2);|.	0.346611|.	0.27420|.	N|.	0.019449|.	T|.	0.73536|.	0.3599|.	M|M	0.78456|0.78456	2.415|2.415	0.46011|0.46011	D|D	0.998811|0.998811	D;D;D;P|.	0.56746|.	0.969;0.969;0.977;0.948|.	P;D;P;P|.	0.63033|.	0.825;0.91;0.875;0.814|.	T|.	0.75091|.	-0.3440|.	10|.	0.87932|.	D|.	0|.	-18.2869|-18.2869	12.8042|12.8042	0.57603|0.57603	0.0794:0.0:0.9206:0.0|0.0794:0.0:0.9206:0.0	.|.	454;407;364;437|.	G3V1P6;P30307-2;P30307-4;P30307|.	.;.;.;MPIP3_HUMAN|.	N|X	437;407;394;364;364;437;454;407|238	ENSP00000321656:H437N;ENSP00000348898:H407N;ENSP00000349821:H394N;ENSP00000345205:H364N;ENSP00000392631:H364N;ENSP00000424795:H437N;ENSP00000425470:H407N|.	ENSP00000321656:H437N|.	H|S	-|-	1|2	0|0	CDC25C|CDC25C	137649393|137649393	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	5.539000|5.539000	0.67199|0.67199	1.482000|1.482000	0.48325|0.48325	0.655000|0.655000	0.94253|0.94253	CAT|TCA	CDC25C	-	superfamily_Rhodanese-like_dom,prints_MPI_Phosphatase	ENSG00000158402		0.512	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25C	HGNC	protein_coding	OTTHUMT00000251280.1	152	0.65	1	G			137621494	137621494	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000514017	ensembl	human	novel	69_37n	nonsense	133	20.83	35	SNP	1.000	T
COG3	83548	genome.wustl.edu	37	13	46050340	46050340	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr13:46050340C>T	ENST00000349995.5	+	2	291	c.179C>T	c.(178-180)cCa>cTa	p.P60L		NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	60					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		TTCAAGCTTCCAATTGAAGAC	0.383																																					Ovarian(150;1048 1859 18083 21577 42700)	dbGAP											0													76.0	74.0	75.0					13																	46050340		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.179C>T	13.37:g.46050340C>T	ENSP00000258654:p.Pro60Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	pfam_COG_su3,superfamily_Cullin_repeat-like_dom	p.P60L	ENST00000349995.5	37	c.179	CCDS9398.1	13	.	.	.	.	.	.	.	.	.	.	C	17.72	3.458880	0.63401	.	.	ENSG00000136152	ENST00000349995	T	0.42131	0.98	5.44	5.44	0.79542	.	0.000000	0.85682	D	0.000000	T	0.62865	0.2463	M	0.63843	1.955	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.997;0.999;0.992	T	0.57429	-0.7813	10	0.33940	T	0.23	-10.9765	18.6011	0.91248	0.0:1.0:0.0:0.0	.	60;60;60	Q96JB2;B4DH72;Q96JB2-2	COG3_HUMAN;.;.	L	60	ENSP00000258654:P60L	ENSP00000258654:P60L	P	+	2	0	COG3	44948341	1.000000	0.71417	0.907000	0.35723	0.709000	0.40893	7.252000	0.78309	2.702000	0.92279	0.655000	0.94253	CCA	COG3	-	NULL	ENSG00000136152		0.383	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG3	HGNC	protein_coding	OTTHUMT00000044777.2	158	0.00	0	C			46050340	46050340	+1	no_errors	ENST00000349995	ensembl	human	known	69_37n	missense	100	24.24	32	SNP	1.000	T
DNMT3A	1788	genome.wustl.edu	37	2	25471111	25471111	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:25471111T>G	ENST00000264709.3	-	7	987	c.650A>C	c.(649-651)aAa>aCa	p.K217T	DNMT3A_ENST00000402667.1_5'UTR|DNMT3A_ENST00000380746.4_Missense_Mutation_p.K28T|DNMT3A_ENST00000321117.5_Missense_Mutation_p.K217T	NM_175629.2	NP_783328.1	Q9Y6K1	DNM3A_HUMAN	DNA (cytosine-5-)-methyltransferase 3 alpha	217	Interaction with DNMT1 and DNMT3B.				C-5 methylation of cytosine (GO:0090116)|cellular response to amino acid stimulus (GO:0071230)|DNA methylation (GO:0006306)|DNA methylation involved in embryo development (GO:0043045)|DNA methylation involved in gamete generation (GO:0043046)|DNA methylation on cytosine within a CG sequence (GO:0010424)|hypermethylation of CpG island (GO:0044027)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of gene expression by genetic imprinting (GO:0006349)|S-adenosylhomocysteine metabolic process (GO:0046498)|S-adenosylmethioninamine metabolic process (GO:0046499)|spermatogenesis (GO:0007283)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|euchromatin (GO:0000791)|nuclear heterochromatin (GO:0005720)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA (cytosine-5-)-methyltransferase activity (GO:0003886)|DNA (cytosine-5-)-methyltransferase activity, acting on CpG substrates (GO:0051718)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|unmethylated CpG binding (GO:0045322)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(964)|kidney(3)|large_intestine(10)|lung(29)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)	1021	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GACCTTGGCTTTCTTCTCAGC	0.537			"""Mis, F, N, S"""		AML																																	dbGAP		Rec	yes		2	2p23	1788	DNA (cytosine-5-)-methyltransferase 3 alpha		L	0													51.0	56.0	54.0					2																	25471111		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS1718.2, CCDS33157.1, CCDS46232.1	2p23	2014-09-17			ENSG00000119772	ENSG00000119772			2978	protein-coding gene	gene with protein product		602769				9662389, 10433969	Standard	NM_175630		Approved		uc002rgc.4	Q9Y6K1	OTTHUMG00000094777	ENST00000264709.3:c.650A>C	2.37:g.25471111T>G	ENSP00000264709:p.Lys217Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PEB8|Q86TE8|Q86XF5|Q8IZV0|Q8WXU9	Missense_Mutation	SNP	pfam_PWWP,pfam_C5_MeTfrase,superfamily_Znf_FYVE_PHD,smart_PWWP,pfscan_PWWP	p.K217T	ENST00000264709.3	37	c.650	CCDS33157.1	2	.	.	.	.	.	.	.	.	.	.	T	16.69	3.193419	0.58017	.	.	ENSG00000119772	ENST00000380746;ENST00000321117;ENST00000264709	D;D;D	0.94723	-3.35;-3.5;-3.5	5.78	5.78	0.91487	.	0.058217	0.64402	D	0.000005	D	0.90034	0.6888	L	0.32530	0.975	0.80722	D	1	B;B	0.33694	0.421;0.281	B;B	0.26864	0.074;0.027	D	0.89356	0.3664	10	0.49607	T	0.09	-5.9321	14.9166	0.70801	0.0:0.0:0.0:1.0	.	217;28	Q9Y6K1;E9PEB8	DNM3A_HUMAN;.	T	28;217;217	ENSP00000370122:K28T;ENSP00000324375:K217T;ENSP00000264709:K217T	ENSP00000264709:K217T	K	-	2	0	DNMT3A	25324615	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.673000	0.46858	2.206000	0.71126	0.460000	0.39030	AAA	DNMT3A	-	NULL	ENSG00000119772		0.537	DNMT3A-001	KNOWN	basic|CCDS	protein_coding	DNMT3A	HGNC	protein_coding	OTTHUMT00000211587.1	167	0.00	0	T	NM_022552		25471111	25471111	-1	no_errors	ENST00000264709	ensembl	human	known	69_37n	missense	145	19.89	36	SNP	1.000	G
DTX4	23220	genome.wustl.edu	37	11	58949648	58949648	+	Silent	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr11:58949648G>A	ENST00000227451.3	+	2	752	c.648G>A	c.(646-648)gtG>gtA	p.V216V	DTX4_ENST00000532982.1_Silent_p.V110V	NM_015177.1	NP_055992.1	Q9Y2E6	DTX4_HUMAN	deltex 4, E3 ubiquitin ligase	216					innate immune response (GO:0045087)|Notch signaling pathway (GO:0007219)|positive regulation of type I interferon production (GO:0032481)|protein ubiquitination (GO:0016567)|regulation of type I interferon production (GO:0032479)	cytosol (GO:0005829)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	20		all_epithelial(135;0.125)				AGCTGCCAGTGACCCGCAAGA	0.642																																						dbGAP											0													21.0	27.0	25.0					11																	58949648		2011	4174	6185	-	-	-	SO:0001819	synonymous_variant	0			AB023154	CCDS44612.1	11q12.2	2014-01-28	2014-01-28		ENSG00000110042	ENSG00000110042		"""RING-type (C3HC4) zinc fingers"""	29151	protein-coding gene	gene with protein product			"""deltex 4 homolog (Drosophila)"", ""deltex homolog 4 (Drosophila)"""			10231032, 22388039	Standard	NM_015177		Approved	KIAA0937, RNF155	uc001nns.2	Q9Y2E6	OTTHUMG00000167336	ENST00000227451.3:c.648G>A	11.37:g.58949648G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VF38	Silent	SNP	pfam_WWE-dom,pfam_Znf_C3HC4_RING-type,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.V216	ENST00000227451.3	37	c.648	CCDS44612.1	11																																																																																			DTX4	-	NULL	ENSG00000110042		0.642	DTX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DTX4	HGNC	protein_coding	OTTHUMT00000394228.1	8	0.00	0	G	XM_166213		58949648	58949648	+1	no_errors	ENST00000227451	ensembl	human	known	69_37n	silent	11	26.67	4	SNP	0.000	A
EEF1B2	1933	genome.wustl.edu	37	2	207027604	207027604	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:207027604C>G	ENST00000392222.2	+	6	1050	c.675C>G	c.(673-675)atC>atG	p.I225M	EEF1B2_ENST00000392221.1_Missense_Mutation_p.I225M|EEF1B2_ENST00000236957.5_Missense_Mutation_p.I225M|SNORA41_ENST00000384675.1_RNA|SNORD51_ENST00000384320.2_RNA	NM_001959.3	NP_001950.1	P24534	EF1B_HUMAN	eukaryotic translation elongation factor 1 beta 2	225					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational elongation (GO:0006414)	cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)	translation elongation factor activity (GO:0003746)			breast(1)|endometrium(5)|kidney(3)|large_intestine(1)|lung(6)	16						TCAACAAGATCTAAAATCCAT	0.388																																						dbGAP											0													35.0	36.0	35.0					2																	207027604		2193	4295	6488	-	-	-	SO:0001583	missense	0			X60489	CCDS2367.1	2q33.3	2011-04-28			ENSG00000114942	ENSG00000114942			3208	protein-coding gene	gene with protein product		600655				8250921	Standard	NM_001959		Approved		uc002vbf.1	P24534	OTTHUMG00000132891	ENST00000392222.2:c.675C>G	2.37:g.207027604C>G	ENSP00000376056:p.Ile225Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K795|Q6IBH9	Missense_Mutation	SNP	pfam_Transl_elong_fac_EF1B_bsu/dsu,pfam_EF-1_beta_acid_region_euk,superfamily_Transl_elong_fac_EF1B_bsu/dsu,superfamily_Glutathione-S-Trfase_C-like,smart_Transl_elong_fac_EF1B_bsu/dsu	p.I225M	ENST00000392222.2	37	c.675	CCDS2367.1	2	.	.	.	.	.	.	.	.	.	.	C	13.29	2.194279	0.38806	.	.	ENSG00000114942	ENST00000236957;ENST00000392221;ENST00000392222	.	.	.	4.88	3.02	0.34903	Translation elongation factor EF1B/ribosomal protein S6 (1);Translation elongation factor EF1B, beta/delta chains, conserved site (1);Translation elongation factor EF1B, beta/delta subunit, guanine nucleotide exchange (3);	0.000000	0.85682	D	0.000000	T	0.74450	0.3718	M	0.90977	3.165	0.51482	D	0.999927	P	0.41978	0.767	P	0.51945	0.685	T	0.72802	-0.4183	9	0.62326	D	0.03	.	5.3855	0.16216	0.1571:0.6323:0.0:0.2106	.	225	P24534	EF1B_HUMAN	M	225	.	ENSP00000236957:I225M	I	+	3	3	EEF1B2	206735849	0.999000	0.42202	0.950000	0.38849	0.657000	0.38888	0.720000	0.25896	0.441000	0.26529	0.655000	0.94253	ATC	EEF1B2	-	pfam_Transl_elong_fac_EF1B_bsu/dsu,superfamily_Transl_elong_fac_EF1B_bsu/dsu,smart_Transl_elong_fac_EF1B_bsu/dsu	ENSG00000114942		0.388	EEF1B2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	EEF1B2	HGNC	protein_coding	OTTHUMT00000336436.1	107	0.00	0	C	NM_001037663		207027604	207027604	+1	no_errors	ENST00000236957	ensembl	human	known	69_37n	missense	96	31.91	45	SNP	1.000	G
EIF1AX	1964	genome.wustl.edu	37	X	20148714	20148714	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chrX:20148714C>A	ENST00000379607.5	-	6	552	c.349G>T	c.(349-351)Gaa>Taa	p.E117*	EIF1AX_ENST00000379593.1_Nonsense_Mutation_p.E89*	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	117					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						GTATCAGTTTCATTGATTTTA	0.328																																						dbGAP											0													149.0	122.0	131.0					X																	20148714		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.349G>T	X.37:g.20148714C>A	ENSP00000368927:p.Glu117*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Nonsense_Mutation	SNP	pfam_RNA-binding_domain_S1_IF1,superfamily_NA-bd_OB-fold-like,smart_TIF_eIF-1A,pfscan_RNA-binding_domain_S1_IF1,tigrfam_TIF_eIF-1A	p.E117*	ENST00000379607.5	37	c.349	CCDS14196.1	X	.	.	.	.	.	.	.	.	.	.	C	37	6.262216	0.97421	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	.	.	.	4.82	3.96	0.45880	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-18.1906	12.3435	0.55107	0.0:0.9158:0.0:0.0842	.	.	.	.	X	117;89	.	ENSP00000368912:E89X	E	-	1	0	EIF1AX	20058635	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.087000	0.76893	0.822000	0.34565	0.594000	0.82650	GAA	EIF1AX	-	superfamily_NA-bd_OB-fold-like	ENSG00000173674		0.328	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1AX	HGNC	protein_coding	OTTHUMT00000058913.1	565	0.00	0	C			20148714	20148714	-1	no_errors	ENST00000379607	ensembl	human	known	69_37n	nonsense	518	21.52	142	SNP	1.000	A
ELMOD2	255520	genome.wustl.edu	37	4	141446688	141446688	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr4:141446688G>A	ENST00000323570.3	+	2	238	c.106G>A	c.(106-108)Gat>Aat	p.D36N	ELMOD2_ENST00000511887.2_Missense_Mutation_p.D36N	NM_153702.3	NP_714913.1	Q8IZ81	ELMD2_HUMAN	ELMO/CED-12 domain containing 2	36					defense response to virus (GO:0051607)|phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)|regulation of defense response to virus (GO:0050688)	cytoskeleton (GO:0005856)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	7	all_hematologic(180;0.162)					GCGAATATTTGATACCTATGT	0.363																																						dbGAP											0													119.0	117.0	118.0					4																	141446688		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648349	CCDS3752.1	4q31.1	2006-10-24	2006-01-20		ENSG00000179387	ENSG00000179387			28111	protein-coding gene	gene with protein product		610196	"""ELMO domain containing 2"""			16773575	Standard	NM_153702		Approved	MGC10084	uc003iik.3	Q8IZ81	OTTHUMG00000133417	ENST00000323570.3:c.106G>A	4.37:g.141446688G>A	ENSP00000326342:p.Asp36Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R712|D3DNZ0	Missense_Mutation	SNP	pfam_Engulfment_cell_motility_ELMO	p.D36N	ENST00000323570.3	37	c.106	CCDS3752.1	4	.	.	.	.	.	.	.	.	.	.	G	8.371	0.835263	0.16820	.	.	ENSG00000179387	ENST00000323570;ENST00000502397	.	.	.	5.0	5.0	0.66597	.	0.160245	0.53938	D	0.000045	T	0.30039	0.0752	L	0.44542	1.39	0.30599	N	0.760735	P	0.38922	0.651	B	0.30401	0.115	T	0.33879	-0.9851	9	0.06099	T	0.92	-1.7789	17.1017	0.86652	0.0:0.0:1.0:0.0	.	36	Q8IZ81	ELMD2_HUMAN	N	36	.	ENSP00000326342:D36N	D	+	1	0	ELMOD2	141666138	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.983000	0.63832	2.313000	0.78055	0.561000	0.74099	GAT	ELMOD2	-	NULL	ENSG00000179387		0.363	ELMOD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMOD2	HGNC	protein_coding	OTTHUMT00000257277.2	495	0.00	0	G	NM_153702		141446688	141446688	+1	no_errors	ENST00000323570	ensembl	human	known	69_37n	missense	229	37.43	137	SNP	1.000	A
ENPP2	5168	genome.wustl.edu	37	8	120608116	120608116	+	Intron	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr8:120608116G>A	ENST00000075322.6	-	12	1031				ENPP2_ENST00000427067.2_Intron|ENPP2_ENST00000522826.1_Intron|ENPP2_ENST00000259486.6_Missense_Mutation_p.H367Y|ENPP2_ENST00000522167.1_5'Flank	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2						cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCAGCATAATGATCCATCCTA	0.458																																					Melanoma(20;305 879 2501 4818 31020)	dbGAP											0													152.0	151.0	151.0					8																	120608116		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.973-2016C>T	8.37:g.120608116G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.H367Y	ENST00000075322.6	37	c.1099	CCDS34936.1	8	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417754	0.25552	.	.	ENSG00000136960	ENST00000259486	T	0.73152	-0.72	5.97	5.97	0.96955	.	0.413847	0.18174	N	0.149378	T	0.69351	0.3101	.	.	.	0.80722	D	1	B	0.19445	0.036	B	0.25140	0.058	T	0.64816	-0.6318	9	0.72032	D	0.01	.	18.6044	0.91261	0.0:0.0:1.0:0.0	.	367	Q13822-2	.	Y	367	ENSP00000259486:H367Y	ENSP00000259486:H367Y	H	-	1	0	ENPP2	120677297	1.000000	0.71417	1.000000	0.80357	0.566000	0.35808	6.060000	0.71141	2.828000	0.97474	0.655000	0.94253	CAT	ENPP2	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000136960		0.458	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENPP2	HGNC	protein_coding	OTTHUMT00000381390.1	330	0.00	0	G			120608116	120608116	-1	no_errors	ENST00000259486	ensembl	human	known	69_37n	missense	237	20.47	61	SNP	1.000	A
GRIP2	80852	genome.wustl.edu	37	3	14551332	14551332	+	RNA	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr3:14551332C>T	ENST00000273083.3	-	0	2138							Q9C0E4	GRIP2_HUMAN	glutamate receptor interacting protein 2						synaptic transmission (GO:0007268)	cytosol (GO:0005829)|plasma membrane (GO:0005886)				endometrium(5)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(5)|skin(1)	25						GTTCACCTCTCAGCCAGGCCA	0.602																																						dbGAP											0													24.0	30.0	28.0					3																	14551332		1783	3594	5377	-	-	-			0			AB051506		3p24-p23	2012-02-08			ENSG00000144596	ENSG00000144596			23841	protein-coding gene	gene with protein product							Standard	NM_001080423		Approved	KIAA1719	uc021wtn.1	Q9C0E4	OTTHUMG00000155544		3.37:g.14551332C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEH9|Q9H7H3	RNA	SNP	-	NULL	ENST00000273083.3	37	NULL		3																																																																																			GRIP2	-	-	ENSG00000144596		0.602	GRIP2-001	KNOWN	basic	processed_transcript	GRIP2	HGNC	processed_transcript	OTTHUMT00000340582.2	52	0.00	0	C	NM_001080423		14551332	14551332	-1	no_errors	ENST00000273083	ensembl	human	known	69_37n	rna	124	13.89	20	SNP	1.000	T
HLF	3131	genome.wustl.edu	37	17	53342935	53342935	+	Silent	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr17:53342935G>A	ENST00000226067.5	+	1	563	c.90G>A	c.(88-90)ctG>ctA	p.L30L	HLF_ENST00000573945.1_5'Flank|HLF_ENST00000430986.2_5'Flank|HLF_ENST00000575345.1_5'Flank	NM_002126.4	NP_002117.1	Q16534	HLF_HUMAN	hepatic leukemia factor	30					multicellular organismal development (GO:0007275)|rhythmic process (GO:0048511)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|ovary(2)	3						AGAACCCGCTGAAGCTCCCCC	0.701			T	TCF3	ALL																																	dbGAP		Dom	yes		17	17q22	3131	hepatic leukemia factor		L	0													35.0	36.0	36.0					17																	53342935		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11585.1	17q22	2011-05-19			ENSG00000108924	ENSG00000108924			4977	protein-coding gene	gene with protein product		142385				1386162	Standard	XM_005257269		Approved	MGC33822	uc002iug.1	Q16534		ENST00000226067.5:c.90G>A	17.37:g.53342935G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1X8|Q6FHS9	Silent	SNP	pfam_bZIP_2,smart_bZIP,pfscan_bZIP	p.L30	ENST00000226067.5	37	c.90	CCDS11585.1	17																																																																																			HLF	-	NULL	ENSG00000108924		0.701	HLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLF	HGNC	protein_coding	OTTHUMT00000439185.1	73	0.00	0	G	NM_002126		53342935	53342935	+1	no_errors	ENST00000226067	ensembl	human	known	69_37n	silent	43	27.12	16	SNP	1.000	A
IL17RC	84818	genome.wustl.edu	37	3	9959575	9959575	+	Intron	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr3:9959575G>A	ENST00000295981.3	+	3	558				IL17RC_ENST00000455057.1_Intron|IL17RC_ENST00000413608.1_Intron|RNU6-882P_ENST00000391025.1_RNA|IL17RC_ENST00000383812.4_Intron|IL17RC_ENST00000498214.1_3'UTR|IL17RC_ENST00000403601.3_Intron|IL17RC_ENST00000416074.2_Intron	NM_153461.3	NP_703191	Q8NAC3	I17RC_HUMAN	interleukin 17 receptor C						cytokine-mediated signaling pathway (GO:0019221)|positive regulation of cytokine production involved in inflammatory response (GO:1900017)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	interleukin-17 receptor activity (GO:0030368)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						GCTTGGAACAGCTTCAGCTCC	0.627																																						dbGAP											0													53.0	53.0	53.0					3																	9959575		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC006411	CCDS2590.1, CCDS2591.2, CCDS46746.1, CCDS56240.1, CCDS56241.1, CCDS74898.1	3p25.3	2008-02-05			ENSG00000163702	ENSG00000163702		"""Interleukins and interleukin receptors"""	18358	protein-coding gene	gene with protein product		610925				11706037	Standard	NM_153460		Approved	IL17-RL	uc003bua.3	Q8NAC3	OTTHUMG00000128648	ENST00000295981.3:c.341-32G>A	3.37:g.9959575G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PHG1|E9PHJ6|Q6UVY3|Q6UWD4|Q8NFS1|Q9BR97	Missense_Mutation	SNP	NULL	p.S52N	ENST00000295981.3	37	c.155	CCDS2590.1	3																																																																																			IL17RC	-	NULL	ENSG00000163702		0.627	IL17RC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL17RC	HGNC	protein_coding	OTTHUMT00000250526.2	45	0.00	0	G	NM_032732		9959575	9959575	+1	no_errors	ENST00000451165	ensembl	human	known	69_37n	missense	44	31.34	21	SNP	0.002	A
KLHL41	10324	genome.wustl.edu	37	2	170366577	170366577	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:170366577G>C	ENST00000284669.1	+	1	366	c.289G>C	c.(289-291)Gat>Cat	p.D97H	RP11-724O16.1_ENST00000513963.1_Intron|BBS5_ENST00000554017.1_Intron	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	97	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											TGCCAGTATTGATCTCAATGA	0.398																																						dbGAP											0													134.0	134.0	134.0					2																	170366577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.289G>C	2.37:g.170366577G>C	ENSP00000284669:p.Asp97His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R42	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D97H	ENST00000284669.1	37	c.289	CCDS2234.1	2	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575500	0.65878	.	.	ENSG00000239474	ENST00000284669	T	0.68765	-0.35	5.17	5.17	0.71159	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.76147	0.3947	L	0.41236	1.265	0.80722	D	1	D	0.71674	0.998	D	0.72982	0.979	T	0.76323	-0.3001	10	0.46703	T	0.11	.	18.6673	0.91495	0.0:0.0:1.0:0.0	.	97	O60662	KBTBA_HUMAN	H	97	ENSP00000284669:D97H	ENSP00000284669:D97H	D	+	1	0	KBTBD10	170074823	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	9.431000	0.97494	2.411000	0.81874	0.585000	0.79938	GAT	KBTBD10	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000239474		0.398	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD10	HGNC	protein_coding	OTTHUMT00000255263.1	213	0.00	0	G	NM_006063		170366577	170366577	+1	no_errors	ENST00000284669	ensembl	human	known	69_37n	missense	205	22.64	60	SNP	1.000	C
KCNN2	3781	genome.wustl.edu	37	5	113831863	113831863	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:113831863C>T	ENST00000512097.3	+	9	2742	c.1724C>T	c.(1723-1725)tCa>tTa	p.S575L	KCNN2_ENST00000503706.1_Missense_Mutation_p.S227L|RP11-492A10.1_ENST00000514115.1_RNA|KCNN2_ENST00000264773.3_Missense_Mutation_p.S575L			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	575					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	CCACCAACTTCATCAGAGAGT	0.468																																						dbGAP											0													68.0	69.0	68.0					5																	113831863		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.1724C>T	5.37:g.113831863C>T	ENSP00000427120:p.Ser575Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.S575L	ENST00000512097.3	37	c.1724	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051865	0.75960	.	.	ENSG00000080709	ENST00000264773;ENST00000503706	D;D	0.98822	-5.16;-3.59	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	D	0.98893	0.9625	M	0.71581	2.175	0.80722	D	1	D	0.54601	0.967	D	0.63597	0.916	D	0.99744	1.1016	10	0.52906	T	0.07	.	18.5438	0.91039	0.0:1.0:0.0:0.0	.	575	Q9H2S1	KCNN2_HUMAN	L	575;227	ENSP00000264773:S575L;ENSP00000421439:S227L	ENSP00000264773:S575L	S	+	2	0	KCNN2	113859762	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.388000	0.79795	2.481000	0.83766	0.643000	0.83706	TCA	KCNN2	-	NULL	ENSG00000080709		0.468	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	69	0.00	0	C	NM_021614		113831863	113831863	+1	no_errors	ENST00000264773	ensembl	human	known	69_37n	missense	50	32.43	24	SNP	1.000	T
LIMS2	55679	genome.wustl.edu	37	2	128399741	128399741	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:128399741C>A	ENST00000355119.4	-	6	708	c.543G>T	c.(541-543)aaG>aaT	p.K181N	LIMS2_ENST00000409808.2_Missense_Mutation_p.K176N|LIMS2_ENST00000494613.1_5'Flank|LIMS2_ENST00000545738.2_Missense_Mutation_p.K203N|LIMS2_ENST00000409754.1_Missense_Mutation_p.K29N|LIMS2_ENST00000324938.5_Missense_Mutation_p.K205N|LIMS2_ENST00000410038.1_Missense_Mutation_p.K29N|LIMS2_ENST00000409455.1_Missense_Mutation_p.K176N|LIMS2_ENST00000409254.1_Missense_Mutation_p.K29N|LIMS2_ENST00000409286.1_Missense_Mutation_p.K29N|LIMS2_ENST00000410011.1_Missense_Mutation_p.K176N	NM_001161403.1	NP_001154875.1	Q7Z4I7	LIMS2_HUMAN	LIM and senescent cell antigen-like domains 2	181	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of apoptotic process (GO:0043066)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of neural precursor cell proliferation (GO:2000178)|positive regulation of integrin-mediated signaling pathway (GO:2001046)|single organismal cell-cell adhesion (GO:0016337)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0681)		AGAGCTCACCCTTCAGCTCGC	0.692																																						dbGAP											0													24.0	26.0	26.0					2																	128399741		2198	4294	6492	-	-	-	SO:0001583	missense	0			AF520987	CCDS2147.1, CCDS54394.1, CCDS54395.1, CCDS54396.1, CCDS58725.1	2q21.1	2008-02-05			ENSG00000072163	ENSG00000072163			16084	protein-coding gene	gene with protein product		607908					Standard	NM_017980		Approved		uc002tox.3	Q7Z4I7	OTTHUMG00000131529	ENST00000355119.4:c.543G>T	2.37:g.128399741C>A	ENSP00000347240:p.Lys181Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLH0|B4DMV1|F5H6E6|Q7Z4I2|Q7Z4I6|Q7Z4I8|Q8NFE7|Q9HA13	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH,pfscan_Znf_LIM	p.K205N	ENST00000355119.4	37	c.615	CCDS54395.1	2	.	.	.	.	.	.	.	.	.	.	c	15.32	2.799591	0.50208	.	.	ENSG00000072163	ENST00000545738;ENST00000355119;ENST00000409286;ENST00000409754;ENST00000324938;ENST00000409455;ENST00000410109;ENST00000409808;ENST00000410011;ENST00000342067;ENST00000537572;ENST00000410038;ENST00000544917;ENST00000409254	D;D;D;D;D;D;D;D;D;D	0.86865	-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18;-2.18	5.26	3.17	0.36434	Zinc finger, LIM-type (4);	0.000000	0.85682	D	0.000000	D	0.88254	0.6387	L	0.41906	1.305	0.48511	D	0.99966	B;D;D	0.76494	0.371;0.991;0.999	B;D;D	0.80764	0.059;0.991;0.994	D	0.85721	0.1325	10	0.37606	T	0.19	.	8.4952	0.33123	0.0:0.7042:0.0:0.2958	.	203;181;205	F5H6E6;Q7Z4I7;Q7Z4I7-2	.;LIMS2_HUMAN;.	N	203;181;29;29;205;176;176;176;176;89;29;29;203;29	ENSP00000443794:K203N;ENSP00000347240:K181N;ENSP00000386252:K29N;ENSP00000386345:K29N;ENSP00000326888:K205N;ENSP00000386383:K176N;ENSP00000386637:K176N;ENSP00000387002:K176N;ENSP00000386570:K29N;ENSP00000386907:K29N	ENSP00000326888:K205N	K	-	3	2	LIMS2	128116211	1.000000	0.71417	1.000000	0.80357	0.761000	0.43186	1.328000	0.33758	1.194000	0.43101	0.650000	0.86243	AAG	LIMS2	-	pfam_Znf_LIM,smart_Znf_LIM,pirsf_PINCH	ENSG00000072163		0.692	LIMS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LIMS2	HGNC	protein_coding	OTTHUMT00000331133.2	16	0.00	0	C	NM_017980		128399741	128399741	-1	no_errors	ENST00000324938	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	A
LINC00621	100996930	genome.wustl.edu	37	13	23490129	23490129	+	lincRNA	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr13:23490129C>G	ENST00000577004.1	-	0	379				RP11-124N19.3_ENST00000575845.1_lincRNA					long intergenic non-protein coding RNA 621																		AACCCAGCTTCTCGGACATCG	0.582																																						dbGAP											0																																										-	-	-			0			AK091626		13q12.12	2012-10-12			ENSG00000262619	ENSG00000262619		"""Long non-coding RNAs"""	44227	non-coding RNA	RNA, long non-coding							Standard			Approved				OTTHUMG00000177835		13.37:g.23490129C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000577004.1	37	NULL		13																																																																																			LINC00621	-	-	ENSG00000262619		0.582	LINC00621-001	KNOWN	basic	lincRNA	LINC00621	HGNC	lincRNA	OTTHUMT00000439167.1	84	0.00	0	C			23490129	23490129	-1	no_errors	ENST00000577004	ensembl	human	known	69_37n	rna	67	28.72	27	SNP	0.998	G
LRRIQ4	344657	genome.wustl.edu	37	3	169539890	169539890	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr3:169539890G>A	ENST00000340806.6	+	1	181	c.181G>A	c.(181-183)Gaa>Aaa	p.E61K		NM_001080460.1	NP_001073929.1	A6NIV6	LRIQ4_HUMAN	leucine-rich repeats and IQ motif containing 4	61										breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|lung(14)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	30						TAACCAGATTGAAGAAATTCC	0.458																																						dbGAP											0													97.0	98.0	98.0					3																	169539890		1904	4125	6029	-	-	-	SO:0001583	missense	0				CCDS46951.1	3q26.2	2008-08-08	2008-06-12	2008-06-12	ENSG00000188306	ENSG00000188306			34298	protein-coding gene	gene with protein product	"""leucine rich repeat containing 64"""						Standard	NM_001080460		Approved	LRRC64	uc003fgb.3	A6NIV6	OTTHUMG00000164420	ENST00000340806.6:c.181G>A	3.37:g.169539890G>A	ENSP00000342188:p.Glu61Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,pfscan_IQ_motif_EF-hand-BS	p.E61K	ENST00000340806.6	37	c.181	CCDS46951.1	3	.	.	.	.	.	.	.	.	.	.	G	10.72	1.431136	0.25726	.	.	ENSG00000188306	ENST00000340806	T	0.55588	0.51	5.69	4.81	0.61882	.	0.645274	0.15121	N	0.279367	T	0.39279	0.1072	N	0.20881	0.62	0.09310	N	1	B	0.21225	0.053	B	0.20577	0.03	T	0.13495	-1.0507	10	0.11485	T	0.65	.	15.8699	0.79108	0.0:0.0:0.8637:0.1363	.	61	A6NIV6	LRIQ4_HUMAN	K	61	ENSP00000342188:E61K	ENSP00000342188:E61K	E	+	1	0	LRRIQ4	171022584	0.796000	0.28864	0.009000	0.14445	0.085000	0.17905	1.173000	0.31920	1.383000	0.46405	0.561000	0.74099	GAA	LRRIQ4	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000188306		0.458	LRRIQ4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRIQ4	HGNC	protein_coding	OTTHUMT00000378698.1	140	0.00	0	G	NM_001080460		169539890	169539890	+1	no_errors	ENST00000340806	ensembl	human	known	69_37n	missense	140	19.54	34	SNP	0.072	A
MAPK9	5601	genome.wustl.edu	37	5	179676088	179676088	+	Silent	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:179676088G>A	ENST00000452135.2	-	6	799	c.501C>T	c.(499-501)atC>atT	p.I167I	MAPK9_ENST00000524170.1_5'UTR|MAPK9_ENST00000539014.1_Silent_p.I167I|MAPK9_ENST00000343111.6_Silent_p.I167I|MAPK9_ENST00000347470.4_Silent_p.I167I|MAPK9_ENST00000397072.3_3'UTR|MAPK9_ENST00000393360.3_Silent_p.I167I|MAPK9_ENST00000425491.2_Silent_p.I167I|MAPK9_ENST00000455781.1_Silent_p.I167I			P45984	MK09_HUMAN	mitogen-activated protein kinase 9	167	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular response to growth factor stimulus (GO:0071363)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to UV (GO:0034644)|central nervous system development (GO:0007417)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neuron projection development (GO:0031175)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell morphogenesis involved in differentiation (GO:0010770)|positive regulation of chemokine production (GO:0032722)|positive regulation of gene expression (GO:0010628)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of prostaglandin secretion (GO:0032308)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of transcription, DNA-templated (GO:0045893)|protein targeting to mitochondrion (GO:0006626)|regulation of JNK cascade (GO:0046328)|regulation of protein ubiquitination (GO:0031396)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|release of cytochrome c from mitochondria (GO:0001836)|response to amine (GO:0014075)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|JUN kinase activity (GO:0004705)|transcription factor binding (GO:0008134)			central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(89;6.54e-05)|all_epithelial(37;1.22e-05)|Renal(175;0.000269)|Lung NSC(126;0.00199)|all_lung(126;0.00351)|Breast(19;0.137)	all_cancers(40;0.0236)|Medulloblastoma(196;0.0133)|all_neural(177;0.0199)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CAAAGTCAAGGATCTTCAGGG	0.473																																						dbGAP											0													112.0	112.0	112.0					5																	179676088		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U09759	CCDS4453.1, CCDS4454.1, CCDS43409.1, CCDS43410.1, CCDS47356.1	5q35	2011-06-09			ENSG00000050748	ENSG00000050748	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6886	protein-coding gene	gene with protein product	"""Jun kinase"""	602896		PRKM9		8001819	Standard	NM_002752		Approved	JNK2, p54a, SAPK	uc003mls.4	P45984	OTTHUMG00000130934	ENST00000452135.2:c.501C>T	5.37:g.179676088G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0S3|B5BU66|B5M0B4|D3DWQ8|D3DWQ9|Q15708|Q15710|Q15711|Q8N5C5	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_JNK	p.I167	ENST00000452135.2	37	c.501	CCDS4453.1	5																																																																																			MAPK9	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000050748		0.473	MAPK9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAPK9	HGNC	protein_coding	OTTHUMT00000253530.3	213	0.00	0	G			179676088	179676088	-1	no_errors	ENST00000452135	ensembl	human	known	69_37n	silent	201	19.28	48	SNP	1.000	A
MARS2	92935	genome.wustl.edu	37	2	198570604	198570604	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:198570604C>T	ENST00000282276.6	+	1	518	c.475C>T	c.(475-477)Ctg>Ttg	p.L159L	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	159					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	GTCCCGCGGTCTGCTCTACAA	0.637																																						dbGAP											0													49.0	54.0	52.0					2																	198570604		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.475C>T	2.37:g.198570604C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Silent	SNP	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,pfam_Cys-tRNA/MSH_ligase,superfamily_tRNAsynth_1a_anticodon-bd,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.L159	ENST00000282276.6	37	c.475	CCDS33358.1	2																																																																																			MARS2	-	pfam_Methionyl/Leucyl_tRNA_Synth,tigrfam_Met-tRNA_synth	ENSG00000247626		0.637	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS2	HGNC	protein_coding	OTTHUMT00000335477.1	38	0.00	0	C	NM_138395		198570604	198570604	+1	no_errors	ENST00000282276	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	1.000	T
MIA2	117153	genome.wustl.edu	37	14	39717240	39717240	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr14:39717240C>G	ENST00000280082.3	+	4	1661	c.1462C>G	c.(1462-1464)Caa>Gaa	p.Q488E	MIA2_ENST00000556784.1_Missense_Mutation_p.Q487E|RP11-407N17.3_ENST00000553728.1_Missense_Mutation_p.Q488E	NM_054024.3	NP_473365.3	Q96PC5	MIA2_HUMAN	melanoma inhibitory activity 2	488					cholesterol homeostasis (GO:0042632)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum exit site (GO:0070971)|extracellular region (GO:0005576)				NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(6)|lung(13)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)	31	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0216)		GATACTGGATCAAAATAATGT	0.303																																						dbGAP											0													49.0	57.0	54.0					14																	39717240		2200	4284	6484	-	-	-	SO:0001583	missense	0			BC035981	CCDS9672.1	14q13.2	2007-05-01			ENSG00000150526	ENSG00000150526			18432	protein-coding gene	gene with protein product		608001				12586826	Standard	NM_054024		Approved	FLJ22404	uc001wux.3	Q96PC5	OTTHUMG00000028831	ENST00000280082.3:c.1462C>G	14.37:g.39717240C>G	ENSP00000280082:p.Gln488Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4H0|Q9H6C1	Missense_Mutation	SNP	pfam_SH3_2,superfamily_SH3_domain	p.Q487E	ENST00000280082.3	37	c.1459	CCDS9672.1	14	.	.	.	.	.	.	.	.	.	.	C	3.523	-0.097276	0.07010	.	.	ENSG00000150526;ENSG00000150526;ENSG00000258941	ENST00000280082;ENST00000556784;ENST00000553728	T;T;T	0.46819	0.86;0.88;3.17	5.49	-3.07	0.05363	.	0.549745	0.15207	N	0.274700	T	0.18215	0.0437	N	0.01505	-0.83	0.23916	N	0.996474	B;B	0.06786	0.001;0.001	B;B	0.08055	0.001;0.003	T	0.22034	-1.0228	9	.	.	.	0.6511	15.6302	0.76904	0.193:0.1341:0.6729:0.0	.	488;488	Q96PC5;Q96PC5-2	MIA2_HUMAN;.	E	488;487;488	ENSP00000280082:Q488E;ENSP00000451934:Q487E;ENSP00000452252:Q488E	.	Q	+	1	0	MIA2;RP11-407N17.3	38786991	1.000000	0.71417	0.108000	0.21378	0.696000	0.40369	0.704000	0.25661	-0.516000	0.06470	-0.181000	0.13052	CAA	MIA2	-	NULL	ENSG00000150526		0.303	MIA2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MIA2	HGNC	protein_coding	OTTHUMT00000276768.3	89	0.00	0	C	NM_054024		39717240	39717240	+1	no_errors	ENST00000556784	ensembl	human	known	69_37n	missense	49	24.62	16	SNP	0.677	G
NELL2	4753	genome.wustl.edu	37	12	44914000	44914000	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr12:44914000C>G	ENST00000429094.2	-	19	2692	c.2188G>C	c.(2188-2190)Gat>Cat	p.D730H	NELL2_ENST00000437801.2_Missense_Mutation_p.D780H|NELL2_ENST00000549027.1_Missense_Mutation_p.D729H|NELL2_ENST00000452445.2_Missense_Mutation_p.D730H|NELL2_ENST00000333837.4_Missense_Mutation_p.D753H|NELL2_ENST00000395487.2_Missense_Mutation_p.D729H|NELL2_ENST00000551601.1_Missense_Mutation_p.D682H	NM_001145108.1	NP_001138580.1	Q99435	NELL2_HUMAN	NEL-like 2 (chicken)	730	VWFC 3. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(16)|lung(30)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	65	Lung SC(27;0.192)	Lung NSC(34;0.144)		GBM - Glioblastoma multiforme(48;0.092)		GGCCAACAATCAACTTCCCCT	0.547																																						dbGAP											0													50.0	42.0	45.0					12																	44914000		2203	4300	6503	-	-	-	SO:0001583	missense	0			D83018	CCDS8746.1, CCDS44863.1, CCDS44864.1, CCDS53781.1	12q12	2012-01-30	2001-11-28		ENSG00000184613	ENSG00000184613			7751	protein-coding gene	gene with protein product		602320	"""nel (chicken)-like 2"""			19249368	Standard	NM_006159		Approved	NRP2	uc010skz.1	Q99435	OTTHUMG00000169464	ENST00000429094.2:c.2188G>C	12.37:g.44914000C>G	ENSP00000390680:p.Asp730His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2U7|B7Z5Q4|B7Z9J5|B7Z9U3|Q96JS2	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_VWF_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_VWC_out,smart_VWF_C,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_VWF_C	p.D780H	ENST00000429094.2	37	c.2338	CCDS8746.1	12	.	.	.	.	.	.	.	.	.	.	C	25.1	4.607575	0.87157	.	.	ENSG00000184613	ENST00000395487;ENST00000429094;ENST00000551601;ENST00000452445;ENST00000549027;ENST00000333837;ENST00000437801	T;T;T;T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62;-0.62;-0.62;-0.62	5.07	5.07	0.68467	von Willebrand factor, type C (4);	0.000000	0.85682	D	0.000000	D	0.82917	0.5141	M	0.62154	1.92	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;0.999;0.999;1.0;0.999	D	0.84778	0.0771	10	0.72032	D	0.01	-17.5562	18.4463	0.90685	0.0:1.0:0.0:0.0	.	753;780;682;730;729	B7Z2U7;B7Z9U3;F8VVB6;Q99435;Q96JS2	.;.;.;NELL2_HUMAN;.	H	729;730;682;730;729;753;780	ENSP00000378866:D729H;ENSP00000390680:D730H;ENSP00000449332:D682H;ENSP00000394612:D730H;ENSP00000447927:D729H;ENSP00000327988:D753H;ENSP00000416341:D780H	ENSP00000327988:D753H	D	-	1	0	NELL2	43200267	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	7.814000	0.86154	2.325000	0.78763	0.650000	0.86243	GAT	NELL2	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000184613		0.547	NELL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NELL2	HGNC	protein_coding	OTTHUMT00000404180.1	83	0.00	0	C	NM_006159		44914000	44914000	-1	no_errors	ENST00000437801	ensembl	human	known	69_37n	missense	55	28.57	22	SNP	1.000	G
KMT2D	8085	genome.wustl.edu	37	12	49431434	49431434	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr12:49431434C>G	ENST00000301067.7	-	34	9704	c.9705G>C	c.(9703-9705)aaG>aaC	p.K3235N	KMT2D_ENST00000549743.1_5'Flank	NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	3235					chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										AGCTCTCCATCTTGTCTAGCT	0.562																																						dbGAP											0													34.0	34.0	34.0					12																	49431434		2087	4235	6322	-	-	-	SO:0001583	missense	0			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.9705G>C	12.37:g.49431434C>G	ENSP00000301067:p.Lys3235Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O14687	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.K3235N	ENST00000301067.7	37	c.9705	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	C	7.966	0.747946	0.15710	.	.	ENSG00000167548	ENST00000301067	D	0.84223	-1.82	5.61	2.79	0.32731	.	0.000000	0.38663	N	0.001611	D	0.85500	0.5711	L	0.27053	0.805	0.42796	D	0.993911	D	0.89917	1.0	D	0.85130	0.997	D	0.84433	0.0578	10	0.87932	D	0	.	8.9584	0.35832	0.0:0.7062:0.0:0.2938	.	3235	O14686	MLL2_HUMAN	N	3235	ENSP00000301067:K3235N	ENSP00000301067:K3235N	K	-	3	2	MLL2	47717701	0.497000	0.26067	1.000000	0.80357	0.998000	0.95712	-0.206000	0.09398	0.412000	0.25729	0.655000	0.94253	AAG	MLL2	-	NULL	ENSG00000167548		0.562	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	102	0.00	0	C			49431434	49431434	-1	no_errors	ENST00000301067	ensembl	human	known	69_37n	missense	89	24.58	29	SNP	1.000	G
NEXN	91624	genome.wustl.edu	37	1	78381798	78381798	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr1:78381798G>A	ENST00000334785.7	+	2	191	c.7G>A	c.(7-9)Gat>Aat	p.D3N	NEXN_ENST00000330010.8_Missense_Mutation_p.D3N|NEXN_ENST00000457030.1_Missense_Mutation_p.D3N|NEXN_ENST00000294624.8_Missense_Mutation_p.D3N	NM_144573.3	NP_653174.3			nexilin (F actin binding protein)									p.D3N(1)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	30				Colorectal(170;0.114)		AAACATGAATGATATTTCCCA	0.299																																						dbGAP											1	Substitution - Missense(1)	skin(1)											34.0	31.0	32.0					1																	78381798		1807	4058	5865	-	-	-	SO:0001583	missense	0			AK057954	CCDS41351.1, CCDS53335.1	1p31.1	2014-09-17			ENSG00000162614	ENSG00000162614		"""Immunoglobulin superfamily / I-set domain containing"""	29557	protein-coding gene	gene with protein product		613121				12053183, 8227983	Standard	NM_144573		Approved	nexilin, NELIN	uc001dic.4	Q0ZGT2	OTTHUMG00000040533	ENST00000334785.7:c.7G>A	1.37:g.78381798G>A	ENSP00000333938:p.Asp3Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.D3N	ENST00000334785.7	37	c.7	CCDS41351.1	1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.628063	0.87560	.	.	ENSG00000162614	ENST00000401035;ENST00000457030;ENST00000330010;ENST00000294624;ENST00000334785;ENST00000440324	T;T;T;T;T;T	0.73152	-0.36;-0.3;-0.18;-0.72;-0.32;-0.54	4.59	4.59	0.56863	.	0.000000	0.48767	D	0.000171	T	0.77671	0.4165	L	0.53249	1.67	0.39775	D	0.972229	D;D;D	0.67145	0.993;0.996;0.993	D;P;D	0.74674	0.984;0.864;0.977	T	0.81064	-0.1102	10	0.87932	D	0	-25.1935	17.7463	0.88422	0.0:0.0:1.0:0.0	.	3;3;3	D3DQ79;Q0ZGT2;B4DPZ7	.;NEXN_HUMAN;.	N	3	ENSP00000383814:D3N;ENSP00000388048:D3N;ENSP00000327363:D3N;ENSP00000294624:D3N;ENSP00000333938:D3N;ENSP00000411902:D3N	ENSP00000294624:D3N	D	+	1	0	NEXN	78154386	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	6.300000	0.72776	2.273000	0.75805	0.591000	0.81541	GAT	NEXN	-	NULL	ENSG00000162614		0.299	NEXN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEXN	HGNC	protein_coding	OTTHUMT00000097549.1	148	0.00	0	G	NM_144573		78381798	78381798	+1	no_errors	ENST00000334785	ensembl	human	known	69_37n	missense	91	14.95	16	SNP	1.000	A
NHLRC1	378884	genome.wustl.edu	37	6	18121699	18121699	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr6:18121699A>G	ENST00000340650.3	-	1	1152	c.1139T>C	c.(1138-1140)cTg>cCg	p.L380P		NM_198586.2	NP_940988.2	Q6VVB1	NHLC1_HUMAN	NHL repeat containing E3 ubiquitin protein ligase 1	380					autophagy (GO:0006914)|carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|positive regulation of protein ubiquitination (GO:0031398)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein polyubiquitination (GO:0000209)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(2)	11	Ovarian(93;0.016)|Breast(50;0.0245)	all_hematologic(90;0.165)	all cancers(50;0.0451)|Epithelial(50;0.0493)			TGCTGTGTCCAGCACAAGAAG	0.488																																						dbGAP											0			GRCh37	CM071896	NHLRC1	M							56.0	59.0	58.0					6																	18121699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY324849	CCDS4542.1	6p22.3	2014-01-28	2013-12-12		ENSG00000187566	ENSG00000187566			21576	protein-coding gene	gene with protein product	"""epilepsy, progressive myoclonus type 2B"""	608072	"""NHL repeat containing 1"""			12958597	Standard	NM_198586		Approved	bA204B7.2, EPM2B, malin	uc003ncl.1	Q6VVB1	OTTHUMG00000014315	ENST00000340650.3:c.1139T>C	6.37:g.18121699A>G	ENSP00000345464:p.Leu380Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYB1|Q5VUK7|Q6IMH1	Missense_Mutation	SNP	smart_Znf_RING,pfscan_NHL_repeat_subgr,pfscan_Znf_RING	p.L380P	ENST00000340650.3	37	c.1139	CCDS4542.1	6	.	.	.	.	.	.	.	.	.	.	A	20.5	4.006928	0.74932	.	.	ENSG00000187566	ENST00000340650	D	0.90444	-2.67	5.76	5.76	0.90799	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.64402	D	0.000003	D	0.93989	0.8075	M	0.73598	2.24	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.93664	0.6984	10	0.44086	T	0.13	-14.5019	16.0916	0.81094	1.0:0.0:0.0:0.0	.	380	Q6VVB1	NHLC1_HUMAN	P	380	ENSP00000345464:L380P	ENSP00000345464:L380P	L	-	2	0	NHLRC1	18229678	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	8.449000	0.90337	2.186000	0.69663	0.533000	0.62120	CTG	NHLRC1	-	pfscan_NHL_repeat_subgr	ENSG00000187566		0.488	NHLRC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC1	HGNC	protein_coding	OTTHUMT00000039958.1	103	0.00	0	A			18121699	18121699	-1	no_errors	ENST00000340650	ensembl	human	known	69_37n	missense	58	31.76	27	SNP	1.000	G
NNT	23530	genome.wustl.edu	37	5	43644857	43644857	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:43644857G>C	ENST00000264663.5	+	9	1464	c.1243G>C	c.(1243-1245)Gac>Cac	p.D415H	NNT_ENST00000512996.2_Missense_Mutation_p.D284H|NNT_ENST00000344920.4_Missense_Mutation_p.D415H	NM_012343.3	NP_036475.3	Q13423	NNTM_HUMAN	nicotinamide nucleotide transhydrogenase	415					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)|proton transport (GO:0015992)|reactive oxygen species metabolic process (GO:0072593)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain (GO:0005746)|mitochondrion (GO:0005739)	NAD binding (GO:0051287)|NAD(P)+ transhydrogenase (AB-specific) activity (GO:0008750)|NAD(P)+ transhydrogenase (B-specific) activity (GO:0003957)|NAD(P)+ transhydrogenase activity (GO:0008746)|NADP binding (GO:0050661)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(7)|large_intestine(6)|liver(2)|lung(20)|ovary(3)|prostate(2)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	Lung NSC(6;2.58e-06)					AGATGACTTTGACTTTGGTAC	0.378																																						dbGAP											0													87.0	86.0	87.0					5																	43644857		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40490	CCDS3949.1	5p12	2008-02-05			ENSG00000112992	ENSG00000112992	1.6.1.1		7863	protein-coding gene	gene with protein product		607878				9271681, 9524818	Standard	NM_182977		Approved		uc003jof.3	Q13423	OTTHUMG00000096961	ENST00000264663.5:c.1243G>C	5.37:g.43644857G>C	ENSP00000264663:p.Asp415His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16796|Q2TB60|Q8N3V4	Missense_Mutation	SNP	pfam_NADH_DH_b,pfam_AlaDH/PNT_NAD(H)-bd,pfam_AlaDH/PNT_N,tigrfam_NADP_transhyd_a	p.D415H	ENST00000264663.5	37	c.1243	CCDS3949.1	5	.	.	.	.	.	.	.	.	.	.	G	26.9	4.782764	0.90282	.	.	ENSG00000112992	ENST00000264663;ENST00000344920;ENST00000512996	D;D;D	0.95724	-3.79;-3.79;-3.67	5.79	5.79	0.91817	.	0.127306	0.64402	D	0.000001	D	0.95395	0.8505	M	0.68317	2.08	0.58432	D	0.999999	P	0.51147	0.942	P	0.44359	0.447	D	0.95535	0.8607	10	0.66056	D	0.02	-16.5226	20.0176	0.97485	0.0:0.0:1.0:0.0	.	415	Q13423	NNTM_HUMAN	H	415;415;284	ENSP00000264663:D415H;ENSP00000343873:D415H;ENSP00000426343:D284H	ENSP00000264663:D415H	D	+	1	0	NNT	43680614	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.399000	0.97285	2.735000	0.93741	0.655000	0.94253	GAC	NNT	-	tigrfam_NADP_transhyd_a	ENSG00000112992		0.378	NNT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNT	HGNC	protein_coding	OTTHUMT00000214026.1	279	0.00	0	G	NM_182977		43644857	43644857	+1	no_errors	ENST00000264663	ensembl	human	known	69_37n	missense	257	22.12	73	SNP	1.000	C
NOXO1	124056	genome.wustl.edu	37	16	2029831	2029831	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr16:2029831C>T	ENST00000397280.4	-	6	678	c.675G>A	c.(673-675)ccG>ccA	p.P225P	NOXO1_ENST00000354249.4_Silent_p.P219P|NOXO1_ENST00000356120.4_Silent_p.P220P|TBL3_ENST00000568546.1_3'UTR|AC005606.1_ENST00000598236.1_5'Flank|NOXO1_ENST00000566005.1_Silent_p.P224P			Q8NFA2	NOXO1_HUMAN	NADPH oxidase organizer 1	225	SH3 1. {ECO:0000255|PROSITE- ProRule:PRU00192}.				extracellular matrix disassembly (GO:0022617)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of respiratory burst (GO:0060263)|superoxide metabolic process (GO:0006801)	NADPH oxidase complex (GO:0043020)	enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|phospholipid binding (GO:0005543)|superoxide-generating NADPH oxidase activator activity (GO:0016176)			lung(2)	2					Ecabet(DB05265)	GGCCTTGGCCCGGGGCCGCCT	0.697																																					Pancreas(104;2811 2841 4129)|Esophageal Squamous(25;910 1225 43728)	dbGAP											0													11.0	16.0	14.0					16																	2029831		2142	4258	6400	-	-	-	SO:0001819	synonymous_variant	0			AF532985	CCDS10454.1, CCDS10455.1, CCDS42101.1, CCDS58406.1	16p13.3	2008-02-05			ENSG00000196408	ENSG00000196408			19404	protein-coding gene	gene with protein product		611256					Standard	NM_144603		Approved	P41NOXA, P41NOXB, P41NOXC, SH3PXD5, SNX28	uc002cnx.4	Q8NFA2	OTTHUMG00000128707	ENST00000397280.4:c.675G>A	16.37:g.2029831C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YM1|Q8NFA3|Q96B73	Silent	SNP	pfam_SH3_domain,pfam_Phox,superfamily_Phox,superfamily_SH3_domain,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.P225	ENST00000397280.4	37	c.675	CCDS42101.1	16																																																																																			NOXO1	-	pfscan_SH3_domain	ENSG00000196408		0.697	NOXO1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOXO1	HGNC	protein_coding	OTTHUMT00000250612.1	21	0.00	0	C			2029831	2029831	-1	no_errors	ENST00000397280	ensembl	human	known	69_37n	silent	25	30.56	11	SNP	0.000	T
NPHS1	4868	genome.wustl.edu	37	19	36322218	36322218	+	Missense_Mutation	SNP	G	G	A	rs373931233		TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr19:36322218G>A	ENST00000378910.5	-	26	3366	c.3367C>T	c.(3367-3369)Cgg>Tgg	p.R1123W	NPHS1_ENST00000353632.6_Missense_Mutation_p.R1083W	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	1123					cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			TGAGTGTCCCGCTCTCCTGTC	0.617																																						dbGAP											0													89.0	82.0	85.0					19																	36322218		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.3367C>T	19.37:g.36322218G>A	ENSP00000368190:p.Arg1123Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDH2|C3RX61	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R1123W	ENST00000378910.5	37	c.3367	CCDS32996.1	19	.	.	.	.	.	.	.	.	.	.	G	9.740	1.164582	0.21538	.	.	ENSG00000161270	ENST00000378910;ENST00000353632	T;T	0.76709	-1.04;-0.9	5.07	1.45	0.22620	.	0.764374	0.12665	N	0.449249	T	0.64382	0.2593	L	0.27053	0.805	0.09310	N	1	D	0.56968	0.978	B	0.41299	0.353	T	0.55636	-0.8110	10	0.48119	T	0.1	-10.0484	11.0874	0.48095	0.0:0.0:0.5204:0.4796	.	1123	O60500	NPHN_HUMAN	W	1123;1083	ENSP00000368190:R1123W;ENSP00000343634:R1083W	ENSP00000343634:R1083W	R	-	1	2	NPHS1	41014058	0.017000	0.18338	0.319000	0.25293	0.004000	0.04260	0.852000	0.27764	0.692000	0.31613	0.442000	0.29010	CGG	NPHS1	-	NULL	ENSG00000161270		0.617	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	70	0.00	0	G			36322218	36322218	-1	no_errors	ENST00000378910	ensembl	human	known	69_37n	missense	52	23.19	16	SNP	0.069	A
NUP98	4928	genome.wustl.edu	37	11	3707308	3707308	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr11:3707308G>A	ENST00000324932.7	-	29	4991	c.4571C>T	c.(4570-4572)tCa>tTa	p.S1524L	NUP98_ENST00000355260.3_Intron|NUP98_ENST00000359171.4_Intron	NM_016320.4|NM_139132.3	NP_057404.2|NP_624358.2	P52948	NUP98_HUMAN	nucleoporin 98kDa	1541					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|DNA replication (GO:0006260)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|nuclear pore organization (GO:0006999)|nucleocytoplasmic transport (GO:0006913)|protein import into nucleus, docking (GO:0000059)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nuclear pore outer ring (GO:0031080)|nucleoplasm (GO:0005654)	peptide binding (GO:0042277)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66		Medulloblastoma(188;0.0025)|Breast(177;0.00328)|all_neural(188;0.0227)		BRCA - Breast invasive adenocarcinoma(625;0.0403)|LUSC - Lung squamous cell carcinoma(625;0.116)|Lung(200;0.199)		ACACTGCGCTGAGAGATGGGT	0.557			T	"""HOXA9, NSD1, WHSC1L1, DDX10, TOP1, HOXD13, PMX1, HOXA13, HOXD11, HOXA11, RAP1GDS1, HOXC11"""	AML																																	dbGAP		Dom	yes		11	11p15	4928	nucleoporin 98kDa		L	0													115.0	104.0	108.0					11																	3707308		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF071076, AF231130, BC012906, BG773331	CCDS7746.1, CCDS31347.1, CCDS41605.1, CCDS41606.1	11p15	2008-02-26	2002-08-29		ENSG00000110713	ENSG00000110713			8068	protein-coding gene	gene with protein product		601021	"""nucleoporin 98kD"""			9166830	Standard	NM_139131		Approved	NUP96	uc001lyh.3	P52948	OTTHUMG00000011846	ENST00000324932.7:c.4571C>T	11.37:g.3707308G>A	ENSP00000316032:p.Ser1524Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUT2|Q8WYB0|Q96E54|Q9H3Q4|Q9NT02|Q9UF57|Q9UHX0|Q9Y6J4|Q9Y6J5	Nonsense_Mutation	SNP	pfam_Nup96	p.Q172*	ENST00000324932.7	37	c.514	CCDS7746.1	11	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194409	0.78902	.	.	ENSG00000110713	ENST00000324932	.	.	.	5.45	4.52	0.55395	.	0.350115	0.26086	N	0.026423	T	0.64023	0.2561	M	0.83774	2.66	0.80722	D	1	P;P	0.36789	0.57;0.493	B;B	0.35413	0.202;0.178	T	0.68017	-0.5520	9	0.52906	T	0.07	-0.6514	11.9385	0.52886	0.0:0.1315:0.7321:0.1364	.	1524;1438	P52948-5;P52948-6	.;.	L	1524	.	ENSP00000316032:S1524L	S	-	2	0	NUP98	3663884	0.997000	0.39634	1.000000	0.80357	0.993000	0.82548	2.302000	0.43637	1.408000	0.46895	0.555000	0.69702	TCA	NUP98	-	pfam_Nup96	ENSG00000110713		0.557	NUP98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP98	HGNC	protein_coding	OTTHUMT00000032766.3	122	0.00	0	G	NM_016320		3707308	3707308	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524563	ensembl	human	known	69_37n	nonsense	103	11.21	13	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123539084	123539084	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chrX:123539084C>G	ENST00000371130.3	-	26	5230	c.5167G>C	c.(5167-5169)Gat>Cat	p.D1723H	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Missense_Mutation_p.D1730H	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1723					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										AGGGAACCATCTGGATTCACC	0.542																																						dbGAP											0													63.0	53.0	57.0					X																	123539084		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.5167G>C	X.37:g.123539084C>G	ENSP00000360171:p.Asp1723His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.D1730H	ENST00000371130.3	37	c.5188	CCDS14609.1	X	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996134	0.74703	.	.	ENSG00000009694	ENST00000371130;ENST00000422452	D;D	0.87256	-2.23;-2.19	5.56	5.56	0.83823	Six-bladed beta-propeller, TolB-like (1);	0.050489	0.85682	D	0.000000	D	0.91962	0.7454	M	0.78637	2.42	0.80722	D	1	D;D;D	0.62365	0.975;0.986;0.991	P;P;P	0.54706	0.594;0.733;0.759	D	0.92962	0.6390	10	0.87932	D	0	.	18.5718	0.91138	0.0:1.0:0.0:0.0	.	1729;1730;1723	B7ZMH4;B2RTR5;Q9UKZ4	.;.;TEN1_HUMAN	H	1723;1730	ENSP00000360171:D1723H;ENSP00000403954:D1730H	ENSP00000360171:D1723H	D	-	1	0	ODZ1	123366765	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	7.451000	0.80668	2.328000	0.79073	0.600000	0.82982	GAT	ODZ1	-	NULL	ENSG00000009694		0.542	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	108	0.00	0	C	NM_014253		123539084	123539084	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	missense	95	28.03	37	SNP	1.000	G
PAN2	9924	genome.wustl.edu	37	12	56718085	56718085	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr12:56718085C>A	ENST00000425394.2	-	12	2297	c.1921G>T	c.(1921-1923)Gga>Tga	p.G641*	PAN2_ENST00000257931.5_Nonsense_Mutation_p.G641*|PAN2_ENST00000440411.3_Nonsense_Mutation_p.G641*|PAN2_ENST00000548043.1_Nonsense_Mutation_p.G641*	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	TACCTGCCTCCAGCACCTCGA	0.448																																						dbGAP											0													94.0	97.0	96.0					12																	56718085		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1921G>T	12.37:g.56718085C>A	ENSP00000401721:p.Gly641*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19	p.G641*	ENST00000425394.2	37	c.1921	CCDS44922.1	12	.	.	.	.	.	.	.	.	.	.	C	41	8.657010	0.98903	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	.	.	.	5.39	5.39	0.77823	.	0.207195	0.50627	D	0.000106	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.14252	T	0.57	-3.5461	18.3112	0.90200	0.0:1.0:0.0:0.0	.	.	.	.	X	641	.	ENSP00000257931:G641X	G	-	1	0	PAN2	55004352	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.717000	0.54911	2.705000	0.92388	0.557000	0.71058	GGA	PAN2	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000135473		0.448	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	183	0.00	0	C	NM_014871		56718085	56718085	-1	no_errors	ENST00000425394	ensembl	human	known	69_37n	nonsense	145	18.99	34	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	260	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	172	25.22	58	SNP	1.000	A
PPP1R21	129285	genome.wustl.edu	37	2	48668100	48668100	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:48668100C>A	ENST00000294952.8	+	1	165	c.8C>A	c.(7-9)tCg>tAg	p.S3*	PPP1R21_ENST00000449090.2_Nonsense_Mutation_p.S3*|RP11-191L17.1_ENST00000609028.1_lincRNA|PPP1R21_ENST00000281394.4_Nonsense_Mutation_p.S3*	NM_001135629.2	NP_001129101.1	Q6ZMI0	PPR21_HUMAN	protein phosphatase 1, regulatory subunit 21	3						membrane (GO:0016020)	phosphatase binding (GO:0019902)			endometrium(2)|kidney(4)|lung(9)	15						GCCATGGCCTCGGCTGAGTTG	0.697																																						dbGAP											0													25.0	26.0	26.0					2																	48668100		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AY134855	CCDS1839.1, CCDS46278.1, CCDS54358.1	2p16.3	2012-04-17	2011-10-11	2011-10-11	ENSG00000162869	ENSG00000162869		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	30595	protein-coding gene	gene with protein product			"""coiled-coil domain containing 128"", ""KLRAQ motif containing 1"""	CCDC128, KLRAQ1		12477932	Standard	NM_001135629		Approved	FLJ16566	uc002rwm.3	Q6ZMI0	OTTHUMG00000129167	ENST00000294952.8:c.8C>A	2.37:g.48668100C>A	ENSP00000294952:p.Ser3*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKY5|B7ZKY7|E1B6W7|Q2TA78|Q6ZMI6|Q8IW83|Q8J029|Q96ES8	Nonsense_Mutation	SNP	pfam_KLRAQ/TTKRSYEDQ_C,pfam_Unchr_KLRAQ/TTKRSYEDQ_N,superfamily_Ferritin/RR-like	p.S3*	ENST00000294952.8	37	c.8	CCDS46278.1	2	.	.	.	.	.	.	.	.	.	.	C	39	7.304632	0.98200	.	.	ENSG00000162869	ENST00000281394;ENST00000294952;ENST00000449090	.	.	.	4.57	4.57	0.56435	.	0.312822	0.32703	N	0.005741	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.5367	14.2049	0.65728	0.0:1.0:0.0:0.0	.	.	.	.	X	3	.	ENSP00000281394:S3X	S	+	2	0	KLRAQ1	48521604	0.995000	0.38212	1.000000	0.80357	0.996000	0.88848	1.479000	0.35453	2.378000	0.81104	0.561000	0.74099	TCG	PPP1R21	-	NULL	ENSG00000162869		0.697	PPP1R21-009	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R21	HGNC	protein_coding	OTTHUMT00000251238.4	27	0.00	0	C	NM_152994		48668100	48668100	+1	no_errors	ENST00000294952	ensembl	human	known	69_37n	nonsense	31	23.81	10	SNP	1.000	A
PLEK	5341	genome.wustl.edu	37	2	68607462	68607462	+	Silent	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:68607462G>C	ENST00000234313.7	+	2	224	c.45G>C	c.(43-45)ggG>ggC	p.G15G		NM_002664.2	NP_002655.2	P08567	PLEK_HUMAN	pleckstrin	15	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton reorganization (GO:0031532)|blood coagulation (GO:0007596)|cell projection organization (GO:0030030)|cortical actin cytoskeleton organization (GO:0030866)|hematopoietic progenitor cell differentiation (GO:0002244)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of calcium-mediated signaling (GO:0050849)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of inositol phosphate biosynthetic process (GO:0010920)|phosphatidylinositol metabolic process (GO:0046488)|phospholipase C-inhibiting G-protein coupled receptor signaling pathway (GO:0030845)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of actin filament bundle assembly (GO:0032233)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of inositol-polyphosphate 5-phosphatase activity (GO:0010925)|positive regulation of integrin activation (GO:0033625)|positive regulation of platelet activation (GO:0010572)|protein kinase C signaling (GO:0070528)|protein secretion by platelet (GO:0070560)|regulation of cell diameter (GO:0060305)|ruffle organization (GO:0031529)|thrombin receptor signaling pathway (GO:0070493)|vesicle docking involved in exocytosis (GO:0006904)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|membrane (GO:0016020)|ruffle membrane (GO:0032587)	phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|protein homodimerization activity (GO:0042803)|protein kinase C binding (GO:0005080)			autonomic_ganglia(1)|endometrium(3)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	24		Ovarian(717;0.0129)		STAD - Stomach adenocarcinoma(1183;0.00159)|READ - Rectum adenocarcinoma(193;0.0419)		CATTACAGGGGAGCGTGTTCA	0.398																																						dbGAP											0													62.0	59.0	60.0					2																	68607462		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X07743	CCDS1887.1	2p13.3	2013-01-10			ENSG00000115956	ENSG00000115956		"""Pleckstrin homology (PH) domain containing"""	9070	protein-coding gene	gene with protein product		173570				2897630, 12054651	Standard	NM_002664		Approved	P47	uc002sen.4	P08567	OTTHUMG00000129562	ENST00000234313.7:c.45G>C	2.37:g.68607462G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9E8|Q53SU8|Q6FGM8|Q6FGQ1|Q8WV81	Silent	SNP	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.G15	ENST00000234313.7	37	c.45	CCDS1887.1	2																																																																																			PLEK	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115956		0.398	PLEK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK	HGNC	protein_coding	OTTHUMT00000251755.1	126	0.00	0	G	NM_002664		68607462	68607462	+1	no_errors	ENST00000234313	ensembl	human	known	69_37n	silent	117	22.00	33	SNP	0.795	C
RANBP6	26953	genome.wustl.edu	37	9	6015273	6015273	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr9:6015273C>G	ENST00000259569.5	-	1	345	c.335G>C	c.(334-336)aGc>aCc	p.S112T	RANBP6_ENST00000485372.1_Intron	NM_001243202.1|NM_001243203.1|NM_012416.3	NP_001230131.1|NP_001230132.1|NP_036548.1	O60518	RNBP6_HUMAN	RAN binding protein 6	112					protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(5)|large_intestine(8)|lung(9)|ovary(7)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	51		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00522)|Lung(218;0.101)		TTTCCTCATGCTAGCATGTGT	0.423																																						dbGAP											0													70.0	72.0	71.0					9																	6015273		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039023	CCDS6467.1	9p24.1	2008-03-26			ENSG00000137040	ENSG00000137040			9851	protein-coding gene	gene with protein product							Standard	NM_001243202		Approved		uc003zjr.3	O60518	OTTHUMG00000019512	ENST00000259569.5:c.335G>C	9.37:g.6015273C>G	ENSP00000259569:p.Ser112Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7X4|Q7Z3V2|Q96E78	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.S112T	ENST00000259569.5	37	c.335	CCDS6467.1	9	.	.	.	.	.	.	.	.	.	.	C	4.072	0.011140	0.07912	.	.	ENSG00000137040	ENST00000259569	T	0.68331	-0.32	4.51	4.51	0.55191	Armadillo-like helical (1);Armadillo-type fold (1);	0.091610	0.85682	D	0.000000	T	0.50360	0.1611	N	0.21194	0.64	0.48135	D	0.999598	B	0.16396	0.017	B	0.13407	0.009	T	0.42137	-0.9469	10	0.11485	T	0.65	-5.3517	15.5306	0.75956	0.0:1.0:0.0:0.0	.	112	O60518	RNBP6_HUMAN	T	112	ENSP00000259569:S112T	ENSP00000259569:S112T	S	-	2	0	RANBP6	6005273	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.631000	0.37092	2.793000	0.96121	0.561000	0.74099	AGC	RANBP6	-	superfamily_ARM-type_fold	ENSG00000137040		0.423	RANBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANBP6	HGNC	protein_coding	OTTHUMT00000051650.1	137	0.00	0	C	NM_012416		6015273	6015273	-1	no_errors	ENST00000259569	ensembl	human	known	69_37n	missense	130	29.35	54	SNP	1.000	G
RBFOX1	54715	genome.wustl.edu	37	16	7568188	7568188	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr16:7568188C>A	ENST00000550418.1	+	5	1055	c.67C>A	c.(67-69)Cag>Aag	p.Q23K	RBFOX1_ENST00000436368.2_Missense_Mutation_p.Q43K|RBFOX1_ENST00000547372.1_Missense_Mutation_p.Q66K|RBFOX1_ENST00000553186.1_Missense_Mutation_p.Q23K|RBFOX1_ENST00000340209.4_Missense_Mutation_p.Q28K|RBFOX1_ENST00000552089.1_Missense_Mutation_p.Q59K|RBFOX1_ENST00000311745.5_Missense_Mutation_p.Q43K|RBFOX1_ENST00000422070.4_Missense_Mutation_p.Q66K|RBFOX1_ENST00000547338.1_Missense_Mutation_p.Q23K|RBFOX1_ENST00000355637.4_Missense_Mutation_p.Q43K|RBFOX1_ENST00000535565.2_Missense_Mutation_p.Q59K	NM_018723.3	NP_061193.2	Q9NWB1	RFOX1_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 1	23					mRNA processing (GO:0006397)|neuromuscular process controlling balance (GO:0050885)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|trans-Golgi network (GO:0005802)	nucleotide binding (GO:0000166)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(11)|lung(17)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)	55						CACAATGGCTCAGCCTTACGC	0.592																																					Ovarian(157;934 2567 15163 39509)	dbGAP											0													148.0	150.0	149.0					16																	7568188		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF107203	CCDS10531.1, CCDS10532.1, CCDS45405.1, CCDS55983.1, CCDS55984.1	16p13.3	2013-02-12			ENSG00000078328	ENSG00000078328		"""RNA binding motif (RRM) containing"""	18222	protein-coding gene	gene with protein product	"""ataxin 2-binding protein 1"", ""hexaribonucleotide binding protein 1"""	605104				10814712, 16260614	Standard	NM_018723		Approved	A2BP1, FOX-1, HRNBP1	uc002cyy.2	Q9NWB1	OTTHUMG00000129551	ENST00000550418.1:c.67C>A	16.37:g.7568188C>A	ENSP00000450031:p.Gln23Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7I7|Q8TAE3|Q8TAF2|Q8WYB2|Q9NS20	Missense_Mutation	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.Q66K	ENST00000550418.1	37	c.196	CCDS55983.1	16	.	.	.	.	.	.	.	.	.	.	C	28.8	4.952968	0.92660	.	.	ENSG00000078328	ENST00000547605;ENST00000550418;ENST00000553186;ENST00000547372;ENST00000422070;ENST00000535565;ENST00000552089;ENST00000551752;ENST00000547338;ENST00000436368;ENST00000311745;ENST00000355637;ENST00000352951;ENST00000340209	T;T;T;T;T;T;T;T;T;T;T	0.34859	1.83;1.34;1.74;1.63;1.62;1.73;1.34;1.5;1.65;1.64;1.34	4.99	4.99	0.66335	.	0.067054	0.64402	D	0.000009	T	0.59945	0.2231	M	0.68952	2.095	0.58432	D	0.999999	P;D;D;D;P;P;D;P;D	0.69078	0.813;0.982;0.962;0.993;0.934;0.934;0.996;0.845;0.997	P;D;P;D;P;D;D;P;D	0.75020	0.57;0.968;0.53;0.985;0.888;0.937;0.954;0.593;0.978	T	0.64495	-0.6394	10	0.87932	D	0	-6.7311	18.308	0.90189	0.0:1.0:0.0:0.0	.	43;59;66;43;43;43;23;23;66	F8WAC5;F5H0M1;B7Z1U7;Q9NWB1-2;Q9NWB1-4;Q9NWB1-5;Q9NWB1-3;Q9NWB1;F8VZG9	.;.;.;.;.;.;.;RFOX1_HUMAN;.	K	23;23;23;66;66;59;59;23;23;43;43;43;43;28	ENSP00000450402:Q23K;ENSP00000450031:Q23K;ENSP00000447753:Q23K;ENSP00000446842:Q66K;ENSP00000391269:Q66K;ENSP00000447281:Q23K;ENSP00000447717:Q23K;ENSP00000402745:Q43K;ENSP00000309117:Q43K;ENSP00000347855:Q43K;ENSP00000344196:Q28K	ENSP00000309117:Q43K	Q	+	1	0	RBFOX1	7508189	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.041000	0.76558	2.311000	0.77944	0.557000	0.71058	CAG	RBFOX1	-	pirsf_RNA-bd_Fox-1	ENSG00000078328		0.592	RBFOX1-003	KNOWN	basic|CCDS	protein_coding	RBFOX1	HGNC	protein_coding	OTTHUMT00000409492.2	106	0.00	0	C	NM_145891		7568188	7568188	+1	no_errors	ENST00000547372	ensembl	human	known	69_37n	missense	80	29.57	34	SNP	1.000	A
RIOK2	55781	genome.wustl.edu	37	5	96503693	96503693	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:96503693C>T	ENST00000283109.3	-	8	943	c.875G>A	c.(874-876)aGa>aAa	p.R292K	CTD-2215E18.1_ENST00000509481.1_Intron|RIOK2_ENST00000508447.1_Missense_Mutation_p.R292K	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	292	Protein kinase.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		AGTGTCTTCTCTCCTAGAAAA	0.373																																						dbGAP											0													33.0	35.0	34.0					5																	96503693		2194	4274	6468	-	-	-	SO:0001583	missense	0			AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.875G>A	5.37:g.96503693C>T	ENSP00000283109:p.Arg292Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RDI3|Q9NUT0	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_RIO2_kinase_winged_hlx_N,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase	p.R292K	ENST00000283109.3	37	c.875	CCDS4089.1	5	.	.	.	.	.	.	.	.	.	.	C	9.608	1.130536	0.21041	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.04360	3.75;3.64	5.65	3.78	0.43462	.	0.177335	0.56097	N	0.000040	T	0.04588	0.0125	L	0.39397	1.21	0.50039	D	0.999843	B;B	0.15141	0.011;0.012	B;B	0.18871	0.023;0.02	T	0.40001	-0.9586	10	0.23891	T	0.37	-12.0222	7.9222	0.29852	0.0:0.7244:0.1321:0.1434	.	292;292	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	K	292	ENSP00000283109:R292K;ENSP00000420932:R292K	ENSP00000283109:R292K	R	-	2	0	RIOK2	96529449	0.969000	0.33509	0.965000	0.40720	0.252000	0.25951	1.935000	0.40173	1.354000	0.45846	0.460000	0.39030	AGA	RIOK2	-	NULL	ENSG00000058729		0.373	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK2	HGNC	protein_coding	OTTHUMT00000250628.1	40	0.00	0	C	NM_018343		96503693	96503693	-1	no_errors	ENST00000283109	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	0.995	T
RLF	6018	genome.wustl.edu	37	1	40703390	40703390	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr1:40703390G>A	ENST00000372771.4	+	8	3043	c.3016G>A	c.(3016-3018)Gaa>Aaa	p.E1006K		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	1006					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TCAGACAACTGAAAAGTTGGA	0.383																																						dbGAP											0													57.0	56.0	57.0					1																	40703390		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.3016G>A	1.37:g.40703390G>A	ENSP00000361857:p.Glu1006Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E1006K	ENST00000372771.4	37	c.3016	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430782	0.25726	.	.	ENSG00000117000	ENST00000372771;ENST00000535839	T	0.13778	2.56	5.28	5.28	0.74379	.	0.647409	0.16519	N	0.210897	T	0.09335	0.0230	N	0.22421	0.69	0.27083	N	0.963049	B;B	0.18310	0.027;0.016	B;B	0.19391	0.025;0.007	T	0.14309	-1.0477	10	0.30078	T	0.28	-4.0502	7.8628	0.29520	0.086:0.0:0.7509:0.1631	.	699;1006	F5H2M5;Q13129	.;RLF_HUMAN	K	1006;699	ENSP00000361857:E1006K	ENSP00000361857:E1006K	E	+	1	0	RLF	40475977	0.652000	0.27349	1.000000	0.80357	0.934000	0.57294	2.750000	0.47500	2.745000	0.94114	0.655000	0.94253	GAA	RLF	-	NULL	ENSG00000117000		0.383	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	104	0.00	0	G	NM_012421		40703390	40703390	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	missense	177	36.88	104	SNP	0.992	A
RNF180	285671	genome.wustl.edu	37	5	63621163	63621163	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:63621163C>A	ENST00000389100.4	+	6	1450	c.1378C>A	c.(1378-1380)Ctg>Atg	p.L460M		NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	460	Interaction with ZIC2. {ECO:0000250}.				adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		CTTACGGACTCTGGCCAAAGA	0.423																																						dbGAP											0													252.0	200.0	216.0					5																	63621163		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.1378C>A	5.37:g.63621163C>A	ENSP00000373752:p.Leu460Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L460M	ENST00000389100.4	37	c.1378	CCDS47219.1	5	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680507	0.68042	.	.	ENSG00000164197	ENST00000389100	T	0.68479	-0.33	5.16	4.3	0.51218	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	0.157945	0.42053	D	0.000766	T	0.72471	0.3464	L	0.45422	1.42	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.72649	-0.4229	10	0.56958	D	0.05	-7.8971	8.0149	0.30374	0.1578:0.7621:0.0:0.0801	.	460	Q86T96	RN180_HUMAN	M	460	ENSP00000373752:L460M	ENSP00000373752:L460M	L	+	1	2	RNF180	63656919	0.998000	0.40836	1.000000	0.80357	0.994000	0.84299	3.579000	0.53900	1.313000	0.45069	0.643000	0.83706	CTG	RNF180	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000164197		0.423	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF180	HGNC	protein_coding	OTTHUMT00000368394.1	366	0.00	0	C	NM_178532		63621163	63621163	+1	no_errors	ENST00000389100	ensembl	human	known	69_37n	missense	266	29.26	110	SNP	1.000	A
ROS1	6098	genome.wustl.edu	37	6	117622168	117622168	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr6:117622168G>T	ENST00000368508.3	-	42	6900	c.6702C>A	c.(6700-6702)aaC>aaA	p.N2234K	ROS1_ENST00000368507.3_Missense_Mutation_p.N2228K|RN7SKP51_ENST00000410781.1_RNA|RN7SKP18_ENST00000516005.1_RNA	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2234					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		CTCCACTGTTGTTTGCTTCAT	0.338			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	dbGAP		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													83.0	81.0	82.0					6																	117622168		2203	4300	6503	-	-	-	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6702C>A	6.37:g.117622168G>T	ENSP00000357494:p.Asn2234Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.N2234K	ENST00000368508.3	37	c.6702	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	G	8.831	0.939836	0.18281	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.70749	-0.51;-0.51	4.88	-3.97	0.04094	.	1.238530	0.05383	N	0.537563	T	0.18087	0.0434	N	0.14661	0.345	0.09310	N	1	B	0.23937	0.094	B	0.16722	0.016	T	0.04229	-1.0967	10	0.05959	T	0.93	.	4.3497	0.11150	0.3973:0.0:0.3676:0.235	.	2234	P08922	ROS1_HUMAN	K	2234;2228	ENSP00000357494:N2234K;ENSP00000357493:N2228K	ENSP00000357493:N2228K	N	-	3	2	ROS1	117728861	0.000000	0.05858	0.000000	0.03702	0.926000	0.56050	-1.521000	0.02239	-1.027000	0.03325	-0.254000	0.11334	AAC	ROS1	-	NULL	ENSG00000047936		0.338	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	231	0.00	0	G			117622168	117622168	-1	no_errors	ENST00000368508	ensembl	human	known	69_37n	missense	178	20.89	47	SNP	0.000	T
AVL9	23080	genome.wustl.edu	37	7	32961023	32961023	+	Intron	SNP	A	A	G	rs2893440	byFrequency	TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr7:32961023A>G	ENST00000404479.1	+	11	1215				RP9P_ENST00000381639.3_RNA			Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)						cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TTCGGTGACCATACCATTTGC	0.338													A|||	3464	0.691693	0.677	0.7738	5008	,	,		18313	0.4494		0.8231	False		,,,				2504	0.7679					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000404479.1:c.1216-108199A>G	7.37:g.32961023A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92573	RNA	SNP	-	NULL	ENST00000404479.1	37	NULL		7																																																																																			RP9P	-	-	ENSG00000205763		0.338	AVL9-201	KNOWN	basic	protein_coding	RP9P	HGNC	protein_coding		12	0.00	0	A	NM_015060		32961023	32961023	-1	no_errors	ENST00000381639	ensembl	human	known	69_37n	rna	7	46.15	6	SNP	1.000	G
SCN1A	6323	genome.wustl.edu	37	2	166859083	166859083	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr2:166859083C>T	ENST00000303395.4	-	21	4182	c.4183G>A	c.(4183-4185)Gat>Aat	p.D1395N	SCN1A_ENST00000375405.3_Missense_Mutation_p.D1384N|AC010127.3_ENST00000595647.1_RNA|AC010127.3_ENST00000597623.1_RNA|SCN1A_ENST00000423058.2_Missense_Mutation_p.D1395N|SCN1A_ENST00000409050.1_Missense_Mutation_p.D1367N			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	1395					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	TTTAGGCAATCAGTATGATTA	0.373																																						dbGAP											0													108.0	106.0	107.0					2																	166859083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.4183G>A	2.37:g.166859083C>T	ENSP00000303540:p.Asp1395Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.D1395N	ENST00000303395.4	37	c.4183	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	12.68	2.010211	0.35415	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.96554	-4.05;-4.05;-4.0;-3.98	5.54	4.61	0.57282	Ion transport (1);	0.337422	0.29307	N	0.012530	D	0.96386	0.8821	M	0.83012	2.62	0.48087	D	0.999586	B;B;B	0.27286	0.031;0.001;0.174	B;B;B	0.32864	0.029;0.008;0.154	D	0.95826	0.8854	10	0.72032	D	0.01	.	16.8794	0.86060	0.0:0.8118:0.1882:0.0	.	1384;1367;1395	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	N	1395;1395;1384;1367	ENSP00000407030:D1395N;ENSP00000303540:D1395N;ENSP00000364554:D1384N;ENSP00000386312:D1367N	ENSP00000303540:D1395N	D	-	1	0	SCN1A	166567329	1.000000	0.71417	1.000000	0.80357	0.487000	0.33371	1.361000	0.34136	2.758000	0.94735	0.591000	0.81541	GAT	SCN1A	-	pfam_Ion_trans_dom	ENSG00000144285		0.373	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	287	0.00	0	C	NM_006920		166859083	166859083	-1	no_errors	ENST00000303395	ensembl	human	known	69_37n	missense	197	27.84	76	SNP	1.000	T
SEMA5A	9037	genome.wustl.edu	37	5	9154769	9154769	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:9154769G>A	ENST00000382496.5	-	12	1977	c.1312C>T	c.(1312-1314)Cag>Tag	p.Q438*		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	438	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						CTTGAGGTCTGATTCAGGGGT	0.522																																						dbGAP											0													99.0	96.0	97.0					5																	9154769		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.1312C>T	5.37:g.9154769G>A	ENSP00000371936:p.Gln438*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTC6|O60408|Q1RLL9	Nonsense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.Q438*	ENST00000382496.5	37	c.1312	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	G	43	10.190815	0.99355	.	.	ENSG00000112902	ENST00000382496	.	.	.	5.59	4.72	0.59763	.	0.436525	0.27092	N	0.020963	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	14.0372	0.64651	0.0:0.17:0.83:0.0	.	.	.	.	X	438	.	ENSP00000371936:Q438X	Q	-	1	0	SEMA5A	9207769	0.994000	0.37717	0.002000	0.10522	0.570000	0.35934	4.209000	0.58493	1.335000	0.45486	0.591000	0.81541	CAG	SEMA5A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000112902		0.522	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	108	0.00	0	G			9154769	9154769	-1	no_errors	ENST00000382496	ensembl	human	known	69_37n	nonsense	89	21.24	24	SNP	0.172	A
SLC37A2	219855	genome.wustl.edu	37	11	124954753	124954753	+	Silent	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr11:124954753G>C	ENST00000403796.2	+	13	1459	c.1158G>C	c.(1156-1158)ggG>ggC	p.G386G	SLC37A2_ENST00000525837.1_3'UTR|SLC37A2_ENST00000407458.1_Silent_p.G386G|SLC37A2_ENST00000298280.5_Missense_Mutation_p.D358H|SLC37A2_ENST00000308074.4_Silent_p.G386G	NM_001145290.1	NP_001138762.1	Q8TED4	SPX2_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 2	386					carbohydrate transport (GO:0008643)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	27	all_hematologic(175;0.215)	Breast(109;0.012)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.152)|all_lung(97;0.159)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.61e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0384)		GCCAGGACGGGATTGCCAGCT	0.627																																					Melanoma(11;373 620 21213 26083 47768)	dbGAP											0													70.0	59.0	62.0					11																	124954753		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AK074100	CCDS31714.1, CCDS44757.1	11q24.2	2013-07-17	2013-07-17		ENSG00000134955	ENSG00000134955		"""Solute carriers"""	20644	protein-coding gene	gene with protein product			"""solute carrier family 37 (glycerol-3-phosphate transporter), member 2"""				Standard	NM_198277		Approved	FLJ00171	uc010sau.2	Q8TED4	OTTHUMG00000165879	ENST00000403796.2:c.1158G>C	11.37:g.124954753G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2P9|Q6P599|Q7Z7P8|Q8TEM2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.D358H	ENST00000403796.2	37	c.1072	CCDS44757.1	11	.	.	.	.	.	.	.	.	.	.	G	3.488	-0.104430	0.06967	.	.	ENSG00000134955	ENST00000298280	T	0.26373	1.74	4.89	1.84	0.25277	.	.	.	.	.	T	0.19005	0.0456	.	.	.	0.19945	N	0.999948	.	.	.	.	.	.	T	0.24941	-1.0146	6	0.27785	T	0.31	-19.6232	6.6379	0.22893	0.165:0.408:0.4271:0.0	.	.	.	.	H	358	ENSP00000298280:D358H	ENSP00000298280:D358H	D	+	1	0	SLC37A2	124459963	0.920000	0.31207	0.183000	0.23137	0.156000	0.22039	0.221000	0.17680	0.663000	0.31027	0.563000	0.77884	GAT	SLC37A2	-	pfscan_MFS_dom	ENSG00000134955		0.627	SLC37A2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC37A2	HGNC	protein_coding	OTTHUMT00000386837.1	139	0.00	0	G	XM_166184		124954753	124954753	+1	no_errors	ENST00000298280	ensembl	human	known	69_37n	missense	66	36.54	38	SNP	0.453	C
SLIT2	9353	genome.wustl.edu	37	4	20541118	20541118	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr4:20541118C>T	ENST00000504154.1	+	19	2139	c.1887C>T	c.(1885-1887)ctC>ctT	p.L629L	SLIT2_ENST00000273739.5_Silent_p.L633L|SLIT2_ENST00000503837.1_Silent_p.L625L|SLIT2_ENST00000503823.1_Silent_p.L621L	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)	629					apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TCATAGGACTCAGTTCTGTGC	0.398																																						dbGAP											0													179.0	169.0	173.0					4																	20541118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.1887C>T	4.37:g.20541118C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Silent	SNP	pfam_EGF-like_dom,pfam_Laminin_G,pfam_Leu-rich_rpt,pfam_LRR-contain_N,pfam_Cys-rich_flank_reg_C,superfamily_ConA-like_lec_gl,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Fol_N,smart_Laminin_G,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom,pfscan_Laminin_G	p.L629	ENST00000504154.1	37	c.1887	CCDS3426.1	4																																																																																			SLIT2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000145147		0.398	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	514	0.00	0	C			20541118	20541118	+1	no_errors	ENST00000504154	ensembl	human	known	69_37n	silent	402	21.79	112	SNP	0.807	T
SSH3	54961	genome.wustl.edu	37	11	67077640	67077640	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr11:67077640G>C	ENST00000308127.4	+	13	1691	c.1513G>C	c.(1513-1515)Gag>Cag	p.E505Q	SSH3_ENST00000308298.7_Intron|SSH3_ENST00000376757.5_Nonstop_Mutation_p.*472S	NM_017857.3	NP_060327.3	Q8TE77	SSH3_HUMAN	slingshot protein phosphatase 3	505					protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|DNA binding (GO:0003677)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	19			BRCA - Breast invasive adenocarcinoma(15;2.26e-06)			GCCAGAACCTGAGGGTGGTGG	0.612																																						dbGAP											0													69.0	75.0	73.0					11																	67077640		2200	4295	6495	-	-	-	SO:0001583	missense	0			AF085851	CCDS8157.1	11q13	2013-03-05	2013-03-05		ENSG00000172830	ENSG00000172830		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30581	protein-coding gene	gene with protein product		606780	"""slingshot homolog 3 (Drosophila)"""			11832213	Standard	NM_017857		Approved	FLJ20515, FLJ10928	uc001okj.3	Q8TE77	OTTHUMG00000167105	ENST00000308127.4:c.1513G>C	11.37:g.67077640G>C	ENSP00000312081:p.Glu505Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PK42|Q76I75|Q8N9L8|Q8WYL0|Q9NV45|Q9NWZ7	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.E505Q	ENST00000308127.4	37	c.1513	CCDS8157.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.66|19.66	3.868643|3.868643	0.72065|0.72065	.|.	.|.	ENSG00000172830|ENSG00000172830	ENST00000308127|ENST00000376757	T|.	0.03951|.	3.75|.	4.65|4.65	4.65|4.65	0.58169|0.58169	.|.	0.000000|.	0.39909|.	N|.	0.001233|.	T|.	0.23133|.	0.0559|.	N|N	0.08118|0.08118	0|0	0.09310|0.09310	N|N	1|1	B;B|.	0.10296|.	0.003;0.002|.	B;B|.	0.04013|.	0.001;0.0|.	T|.	0.16100|.	-1.0414|.	10|.	0.11485|.	T|.	0.65|.	-29.0483|-29.0483	13.4394|13.4394	0.61104|0.61104	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	359;505|.	Q8TE77-3;Q8TE77|.	.;SSH3_HUMAN|.	Q|S	505|472	ENSP00000312081:E505Q|.	ENSP00000312081:E505Q|.	E|X	+|+	1|2	0|2	SSH3|SSH3	66834216|66834216	0.935000|0.935000	0.31712|0.31712	0.951000|0.951000	0.38953|0.38953	0.937000|0.937000	0.57800|0.57800	2.678000|2.678000	0.46900|0.46900	2.332000|2.332000	0.79248|0.79248	0.555000|0.555000	0.69702|0.69702	GAG|TGA	SSH3	-	NULL	ENSG00000172830		0.612	SSH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH3	HGNC	protein_coding	OTTHUMT00000393167.1	77	0.00	0	G	NM_018276		67077640	67077640	+1	no_errors	ENST00000308127	ensembl	human	known	69_37n	missense	80	17.53	17	SNP	0.870	C
TBC1D24	57465	genome.wustl.edu	37	16	2548280	2548280	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr16:2548280C>A	ENST00000293970.5	+	4	1158	c.1025C>A	c.(1024-1026)tCg>tAg	p.S342*	RP11-20I23.1_ENST00000564543.1_Intron|TBC1D24_ENST00000567020.1_Nonsense_Mutation_p.S336*|TBC1D24_ENST00000434757.2_Nonsense_Mutation_p.S342*	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	342					neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						AACTTCCGCTCGGAGATCGTC	0.642																																						dbGAP											0													51.0	60.0	57.0					16																	2548280		2127	4250	6377	-	-	-	SO:0001587	stop_gained	0			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.1025C>A	16.37:g.2548280C>A	ENSP00000293970:p.Ser342*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNW3|B9A6M6|Q2KJ08	Nonsense_Mutation	SNP	pfam_TLDc,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,smart_TLDc	p.S342*	ENST00000293970.5	37	c.1025	CCDS55980.1	16	.	.	.	.	.	.	.	.	.	.	C	37	6.172914	0.97348	.	.	ENSG00000162065	ENST00000293970;ENST00000434757	.	.	.	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.1421	18.2004	0.89836	0.0:1.0:0.0:0.0	.	.	.	.	X	336;342	.	ENSP00000293970:S336X	S	+	2	0	TBC1D24	2488281	1.000000	0.71417	0.656000	0.29637	0.218000	0.24690	7.766000	0.85320	2.635000	0.89317	0.650000	0.86243	TCG	TBC1D24	-	smart_TLDc	ENSG00000162065		0.642	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D24	HGNC	protein_coding	OTTHUMT00000435637.1	87	0.00	0	C	NM_020705		2548280	2548280	+1	no_errors	ENST00000293970	ensembl	human	known	69_37n	nonsense	68	26.88	25	SNP	1.000	A
TCF4	6925	genome.wustl.edu	37	18	52899811	52899811	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr18:52899811C>T	ENST00000356073.4	-	17	2189	c.1578G>A	c.(1576-1578)acG>acA	p.T526T	TCF4_ENST00000354452.3_Silent_p.T526T|TCF4_ENST00000457482.3_Silent_p.T366T|TCF4_ENST00000567880.1_Silent_p.T466T|TCF4_ENST00000565018.2_Silent_p.T526T|TCF4_ENST00000570287.2_Silent_p.T366T|TCF4_ENST00000566286.1_Silent_p.T523T|TCF4_ENST00000564403.2_Silent_p.T532T|TCF4_ENST00000544241.2_Silent_p.T455T|TCF4_ENST00000570177.2_Silent_p.T396T|TCF4_ENST00000537856.3_Silent_p.T396T|TCF4_ENST00000564999.1_Silent_p.T526T|TCF4_ENST00000561992.1_Silent_p.T396T|TCF4_ENST00000543082.1_Silent_p.T484T|TCF4_ENST00000564228.1_Silent_p.T455T|TCF4_ENST00000566279.1_Silent_p.T466T|TCF4_ENST00000540999.1_Silent_p.T502T|TCF4_ENST00000568740.1_Silent_p.T501T|TCF4_ENST00000537578.1_Silent_p.T502T|TCF4_ENST00000568673.1_Silent_p.T502T|TCF4_ENST00000398339.1_Silent_p.T628T|TCF4_ENST00000561831.3_Silent_p.T366T	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	526					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		CCGAAGATTTCGTGTCTTGCA	0.453																																						dbGAP											0													147.0	121.0	130.0					18																	52899811		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1578G>A	18.37:g.52899811C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Silent	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.T628	ENST00000356073.4	37	c.1884	CCDS11960.1	18																																																																																			TCF4	-	NULL	ENSG00000196628		0.453	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	256	0.00	0	C	NM_003199		52899811	52899811	-1	no_errors	ENST00000398339	ensembl	human	known	69_37n	silent	186	28.46	74	SNP	0.905	T
TNRC18	84629	genome.wustl.edu	37	7	5410036	5410036	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr7:5410036C>G	ENST00000430969.1	-	11	4537	c.4189G>C	c.(4189-4191)Gag>Cag	p.E1397Q	TNRC18_ENST00000399537.4_Missense_Mutation_p.E1397Q	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1397							chromatin binding (GO:0003682)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		CTCTCCAGCTCCAGCTCTGCG	0.562																																						dbGAP											0													31.0	32.0	31.0					7																	5410036		2131	4198	6329	-	-	-	SO:0001583	missense	0			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4189G>C	7.37:g.5410036C>G	ENSP00000395538:p.Glu1397Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.E1397Q	ENST00000430969.1	37	c.4189	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	C	13.60	2.285700	0.40394	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000327499	T;T	0.20463	2.08;2.07	4.72	4.72	0.59763	.	0.000000	0.33916	N	0.004428	T	0.49592	0.1566	M	0.77820	2.39	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	T	0.56854	-0.7910	10	0.87932	D	0	.	17.6742	0.88226	0.0:1.0:0.0:0.0	.	1397	O15417	TNC18_HUMAN	Q	1397;1397;452;452	ENSP00000382452:E1397Q;ENSP00000395538:E1397Q	ENSP00000330383:E452Q	E	-	1	0	TNRC18	5376562	1.000000	0.71417	1.000000	0.80357	0.806000	0.45545	6.992000	0.76238	2.165000	0.68154	0.313000	0.20887	GAG	TNRC18	-	NULL	ENSG00000182095		0.562	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		107	0.00	0	C			5410036	5410036	-1	no_errors	ENST00000399537	ensembl	human	known	69_37n	missense	104	20.00	26	SNP	1.000	G
TRAPPC2P1	10597	genome.wustl.edu	37	19	57876384	57876384	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr19:57876384G>C	ENST00000596755.1	+	1	1450	c.183G>C	c.(181-183)ttG>ttC	p.L61F	ZNF547_ENST00000282282.3_Intron|AC003002.4_ENST00000597658.1_Intron|TRAPPC2P1_ENST00000543226.1_Missense_Mutation_p.L61F			P0DI82	TPC2B_HUMAN	trafficking protein particle complex 2 pseudogene 1	61					ER to Golgi vesicle-mediated transport (GO:0006888)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)				kidney(1)|lung(2)	3						ACATGTACTTGAAAACTGTGG	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					19q13.43	2009-03-02	2009-03-02	2009-03-02		ENSG00000256060			10710	pseudogene	pseudogene			"""spondyloepiphyseal dysplasia, late, pseudogene"""	SEDLP			Standard	NR_002166		Approved	SEDLP1		P0DI82		ENST00000596755.1:c.183G>C	19.37:g.57876384G>C	ENSP00000469888:p.Leu61Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEG0|O14582|Q9HD16	Missense_Mutation	SNP	pfam_Sedlin,pfam_Sybindin,superfamily_Longin-like_dom	p.L61F	ENST00000596755.1	37	c.183		19	.	.	.	.	.	.	.	.	.	.	G	12.49	1.954968	0.34471	.	.	ENSG00000256060	ENST00000543226	D	0.94457	-3.43	2.83	1.77	0.24775	.	0.000000	0.85682	D	0.000000	D	0.93331	0.7874	.	.	.	0.80722	D	1	.	.	.	.	.	.	D	0.90024	0.4130	7	0.56958	D	0.05	.	4.2372	0.10632	0.1421:0.2397:0.6182:0.0	.	.	.	.	F	61	ENSP00000442778:L61F	ENSP00000442778:L61F	L	+	3	2	AC003002.1	62568196	1.000000	0.71417	0.127000	0.21898	0.686000	0.39977	2.109000	0.41863	0.517000	0.28361	-0.361000	0.07541	TTG	TRAPPC2P1	-	pfam_Sedlin,superfamily_Longin-like_dom	ENSG00000256060		0.448	TRAPPC2P1-003	PUTATIVE	basic|appris_principal	protein_coding	TRAPPC2P1	HGNC	protein_coding	OTTHUMT00000465929.1	145	0.00	0	G			57876384	57876384	+1	no_errors	ENST00000543226	ensembl	human	known	69_37n	missense	91	27.56	35	SNP	1.000	C
TSSK1B	83942	genome.wustl.edu	37	5	112770420	112770420	+	Silent	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr5:112770420C>T	ENST00000390666.3	-	1	308	c.117G>A	c.(115-117)gcG>gcA	p.A39A	CTD-2201G3.1_ENST00000510381.2_RNA|CTD-2201G3.1_ENST00000416046.2_RNA|CTD-2201G3.1_ENST00000383058.4_RNA|MCC_ENST00000408903.3_Intron	NM_032028.3	NP_114417.1	Q9BXA7	TSSK1_HUMAN	testis-specific serine kinase 1B	39	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				multicellular organismal development (GO:0007275)|protein phosphorylation (GO:0006468)|spermatid development (GO:0007286)	cytoplasmic vesicle (GO:0031410)|motile cilium (GO:0031514)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(8)|ovary(2)|skin(2)|stomach(1)	13		all_cancers(142;0.0138)|all_epithelial(76;0.000445)|Colorectal(10;0.00814)|Prostate(80;0.0115)|Ovarian(225;0.156)		Epithelial(69;4.15e-08)|OV - Ovarian serous cystadenocarcinoma(64;4.49e-08)|all cancers(49;3.2e-06)|COAD - Colon adenocarcinoma(37;0.0371)|Colorectal(14;0.0449)		TGATCTTGATCGCCACATTGA	0.498																																						dbGAP											0													51.0	56.0	54.0					5																	112770420		2184	4292	6476	-	-	-	SO:0001819	synonymous_variant	0			AF348076	CCDS4112.1	5q22.2	2008-10-23	2007-01-30	2007-01-30	ENSG00000212122	ENSG00000212122			14968	protein-coding gene	gene with protein product		610709	"""serine/threonine kinase 22D (spermiogenesis associated)"", ""testis-specific serine kinase 1"""	STK22D, TSSK1		15044604	Standard	NM_032028		Approved	SPOGA4, FKSG81	uc003kqm.2	Q9BXA7	OTTHUMG00000128835	ENST00000390666.3:c.117G>A	5.37:g.112770420C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8D9	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A39	ENST00000390666.3	37	c.117	CCDS4112.1	5																																																																																			TSSK1B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000212122		0.498	TSSK1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSK1B	HGNC	protein_coding	OTTHUMT00000250774.2	125	0.00	0	C	NM_032028		112770420	112770420	-1	no_errors	ENST00000390666	ensembl	human	known	69_37n	silent	96	31.43	44	SNP	0.176	T
ZKSCAN8	7745	genome.wustl.edu	37	6	28120897	28120897	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr6:28120897A>T	ENST00000330236.6	+	6	1023	c.839A>T	c.(838-840)cAg>cTg	p.Q280L	ZKSCAN8_ENST00000457389.2_Missense_Mutation_p.Q280L	NM_001278119.1|NM_001278121.1|NM_001278122.1|NM_006298.2	NP_001265048.1|NP_001265050.1|NP_001265051.1|NP_006289.2	Q15776	ZKSC8_HUMAN	zinc finger with KRAB and SCAN domains 8	280	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										ACTGGAATCCAGCCACATGGA	0.463																																						dbGAP											0													83.0	84.0	84.0					6																	28120897		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4645.1	6p21	2013-01-09	2013-01-09	2013-01-09	ENSG00000198315	ENSG00000198315		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12983	protein-coding gene	gene with protein product		602240	"""zinc finger protein 192"""	ZNF192			Standard	NM_001278119		Approved	LD5-1, ZSCAN40	uc003nkn.2	Q15776	OTTHUMG00000014510	ENST00000330236.6:c.839A>T	6.37:g.28120897A>T	ENSP00000332750:p.Gln280Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3D4|B4DYF1|Q4VAR1|Q4VAR2|Q4VAR3|Q9H4T1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.Q280L	ENST00000330236.6	37	c.839	CCDS4645.1	6	.	.	.	.	.	.	.	.	.	.	A	9.466	1.094362	0.20471	.	.	ENSG00000198315	ENST00000330236;ENST00000457389	T;T	0.06218	3.33;3.33	5.93	4.72	0.59763	Krueppel-associated box (1);	0.245857	0.29034	N	0.013343	T	0.01287	0.0042	N	0.11427	0.14	0.41292	D	0.986985	P	0.38922	0.651	B	0.29785	0.107	T	0.58440	-0.7636	10	0.35671	T	0.21	.	10.3942	0.44190	0.8547:0.0:0.0:0.1453	.	280	Q15776	ZN192_HUMAN	L	280	ENSP00000332750:Q280L;ENSP00000402948:Q280L	ENSP00000332750:Q280L	Q	+	2	0	ZNF192	28228876	0.010000	0.17322	0.934000	0.37439	0.389000	0.30415	2.650000	0.46665	2.268000	0.75426	0.455000	0.32223	CAG	ZNF192	-	pfscan_Krueppel-associated_box	ENSG00000198315		0.463	ZKSCAN8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF192	HGNC	protein_coding	OTTHUMT00000040178.2	143	0.00	0	A			28120897	28120897	+1	no_errors	ENST00000330236	ensembl	human	known	69_37n	missense	95	25.20	32	SNP	0.118	T
USP45	85015	genome.wustl.edu	37	6	99936655	99936655	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr6:99936655C>T	ENST00000327681.6	-	6	1052	c.520G>A	c.(520-522)Gaa>Aaa	p.E174K	USP45_ENST00000329966.6_Missense_Mutation_p.E174K|USP45_ENST00000369233.2_Missense_Mutation_p.E174K|USP45_ENST00000472914.2_Missense_Mutation_p.E174K|USP45_ENST00000500704.2_Missense_Mutation_p.E174K|USP45_ENST00000392738.2_5'UTR	NM_001080481.1	NP_001073950.1	Q70EL2	UBP45_HUMAN	ubiquitin specific peptidase 45	174					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)	p.E174Q(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|large_intestine(6)|lung(2)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	22		all_cancers(76;0.000208)|Acute lymphoblastic leukemia(125;8.41e-11)|all_hematologic(75;2.56e-07)|all_epithelial(107;0.122)|Colorectal(196;0.133)		BRCA - Breast invasive adenocarcinoma(108;0.0718)		TCATCTGTTTCACATTTTTCT	0.303																																						dbGAP											1	Substitution - Missense(1)	NS(1)											66.0	63.0	64.0					6																	99936655		2201	4295	6496	-	-	-	SO:0001583	missense	0			AL832030	CCDS34501.1	6q16.2	2008-02-05	2005-08-08		ENSG00000123552	ENSG00000123552		"""Ubiquitin-specific peptidases"""	20080	protein-coding gene	gene with protein product			"""ubiquitin specific protease 45"""			12838346	Standard	NM_001080481		Approved	MGC14793	uc003ppx.2	Q70EL2	OTTHUMG00000015267	ENST00000327681.6:c.520G>A	6.37:g.99936655C>T	ENSP00000333376:p.Glu174Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXG0|Q5T062|Q86T44|Q86TC0|Q9BRU1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Znf_UBP,superfamily_Znf_FYVE_PHD,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.E174K	ENST00000327681.6	37	c.520	CCDS34501.1	6	.	.	.	.	.	.	.	.	.	.	C	13.78	2.337881	0.41398	.	.	ENSG00000123552	ENST00000500704;ENST00000327681;ENST00000369233;ENST00000329966;ENST00000472914	T;T;T;T;T	0.18657	3.63;3.63;3.65;2.2;2.2	5.3	5.3	0.74995	.	0.277989	0.39759	N	0.001268	T	0.07954	0.0199	L	0.49640	1.575	0.80722	D	1	B;B	0.30870	0.003;0.298	B;B	0.21708	0.01;0.036	T	0.05386	-1.0888	10	0.12103	T	0.63	.	12.3139	0.54944	0.0:0.9211:0.0:0.0789	.	174;174	D6RBV3;Q70EL2	.;UBP45_HUMAN	K	174	ENSP00000424372:E174K;ENSP00000333376:E174K;ENSP00000358236:E174K;ENSP00000330540:E174K;ENSP00000423993:E174K	ENSP00000333376:E174K	E	-	1	0	USP45	100043376	1.000000	0.71417	0.998000	0.56505	0.791000	0.44710	4.184000	0.58323	2.638000	0.89438	0.591000	0.81541	GAA	USP45	-	NULL	ENSG00000123552		0.303	USP45-003	KNOWN	basic|appris_principal|CCDS	protein_coding	USP45	HGNC	protein_coding	OTTHUMT00000041609.2	326	0.00	0	C	NM_032929		99936655	99936655	-1	no_errors	ENST00000327681	ensembl	human	known	69_37n	missense	223	22.30	64	SNP	1.000	T
ZNF394	84124	genome.wustl.edu	37	7	99091324	99091324	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18J-01A-11D-A12B-09	TCGA-BH-A18J-11A-31D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fd9923db-2a27-432e-a0c6-4c44e6ee1f53	c5149cdb-2765-4c64-8f19-308562782032	g.chr7:99091324C>T	ENST00000337673.6	-	3	1717	c.1514G>A	c.(1513-1515)cGc>cAc	p.R505H	ZNF789_ENST00000493485.1_Intron|ZNF394_ENST00000394177.3_5'Flank|ZNF789_ENST00000494186.1_Intron|ZNF394_ENST00000426306.2_3'UTR	NM_032164.2	NP_115540.2	Q53GI3	ZN394_HUMAN	zinc finger protein 394	505					transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|liver(1)|lung(5)|stomach(1)|urinary_tract(1)	16	all_cancers(62;2.54e-08)|all_epithelial(64;2.55e-09)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0166)					CTGATTGAAGCGTTTCCCACA	0.453																																					Ovarian(24;589 697 9939 12704 40742)	dbGAP											0													155.0	149.0	151.0					7																	99091324		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025241	CCDS5666.1	7q22.1	2014-01-28			ENSG00000160908	ENSG00000160908		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	18832	protein-coding gene	gene with protein product							Standard	NM_032164		Approved	ZKSCAN14, FLJ12298, ZSCAN46	uc003uqs.3	Q53GI3	OTTHUMG00000154660	ENST00000337673.6:c.1514G>A	7.37:g.99091324C>T	ENSP00000337363:p.Arg505His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D281|Q05DA6|Q6P5X9|Q8TB27|Q9HA37|Q9UD51	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.R505H	ENST00000337673.6	37	c.1514	CCDS5666.1	7	.	.	.	.	.	.	.	.	.	.	C	16.42	3.118405	0.56505	.	.	ENSG00000160908	ENST00000337673	T	0.53640	0.61	3.76	1.96	0.26148	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.458295	0.20962	N	0.082551	T	0.32971	0.0847	L	0.41824	1.3	0.09310	N	0.999999	B	0.19445	0.036	B	0.12837	0.008	T	0.26950	-1.0088	10	0.66056	D	0.02	.	4.0952	0.09988	0.0:0.5883:0.195:0.2167	.	505	Q53GI3	ZN394_HUMAN	H	505	ENSP00000337363:R505H	ENSP00000337363:R505H	R	-	2	0	ZNF394	98929260	0.000000	0.05858	0.952000	0.39060	0.946000	0.59487	0.292000	0.19011	0.575000	0.29434	-0.136000	0.14681	CGC	ZNF394	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160908		0.453	ZNF394-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF394	HGNC	protein_coding	OTTHUMT00000336498.1	404	0.00	0	C	NM_032164		99091324	99091324	-1	no_errors	ENST00000337673	ensembl	human	known	69_37n	missense	370	23.87	116	SNP	0.158	T
