#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACYP1	97	genome.wustl.edu	37	14	75520314	75520314	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr14:75520314G>A	ENST00000238618.3	-	3	236	c.133C>T	c.(133-135)Cgg>Tgg	p.R45W	MLH3_ENST00000238662.7_5'Flank|MLH3_ENST00000355774.2_5'Flank|MLH3_ENST00000556257.1_5'Flank|ACYP1_ENST00000357971.3_3'UTR|ACYP1_ENST00000555694.1_Missense_Mutation_p.R45W|MLH3_ENST00000380968.2_5'Flank|ACYP1_ENST00000555463.1_Missense_Mutation_p.R75W	NM_001107.3	NP_001098.1	P07311	ACYP1_HUMAN	acylphosphatase 1, erythrocyte (common) type	45	Acylphosphatase-like. {ECO:0000255|PROSITE-ProRule:PRU00520}.				phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)	acylphosphatase activity (GO:0003998)			large_intestine(2)	2				BRCA - Breast invasive adenocarcinoma(234;0.00646)		ACTGTGCCCCGGTCAGTGTTC	0.488																																						dbGAP											0													184.0	164.0	171.0					14																	75520314		2203	4300	6503	-	-	-	SO:0001583	missense	0			X84194	CCDS9838.1, CCDS45137.1	14q24.3	2014-08-08			ENSG00000119640	ENSG00000119640	3.6.1.7		179	protein-coding gene	gene with protein product		600875				7796909, 9730610	Standard	NM_001107		Approved		uc001xrg.3	P07311	OTTHUMG00000171767	ENST00000238618.3:c.133C>T	14.37:g.75520314G>A	ENSP00000238618:p.Arg45Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDV8|B2R590	Missense_Mutation	SNP	pfam_Acylphosphatase-like,superfamily_Acylphosphatase-like,prints_Acylphosphatase,pfscan_Acylphosphatase-like	p.R45W	ENST00000238618.3	37	c.133	CCDS9838.1	14	.	.	.	.	.	.	.	.	.	.	G	19.06	3.754147	0.69648	.	.	ENSG00000119640	ENST00000238618;ENST00000555463;ENST00000555694	.	.	.	5.85	3.03	0.35002	Acylphosphatase-like (3);Acylphosphatase, conserved site (1);	0.673409	0.15028	N	0.284607	T	0.50000	0.1590	.	.	.	0.80722	D	1	D	0.53745	0.962	P	0.46320	0.512	T	0.47394	-0.9121	8	0.72032	D	0.01	-1.2739	5.826	0.18554	0.0651:0.1222:0.5595:0.2533	.	45	P07311	ACYP1_HUMAN	W	45;75;45	.	ENSP00000238618:R45W	R	-	1	2	ACYP1	74590067	0.521000	0.26258	0.996000	0.52242	0.960000	0.62799	2.050000	0.41297	0.386000	0.24997	0.558000	0.71614	CGG	ACYP1	-	pfam_Acylphosphatase-like,superfamily_Acylphosphatase-like,prints_Acylphosphatase,pfscan_Acylphosphatase-like	ENSG00000119640		0.488	ACYP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACYP1	HGNC	protein_coding	OTTHUMT00000415013.1	291	0.34	1	G			75520314	75520314	-1	no_errors	ENST00000238618	ensembl	human	known	69_37n	missense	267	11.88	36	SNP	0.994	A
AIDA	64853	genome.wustl.edu	37	1	222876531	222876531	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr1:222876531G>A	ENST00000340020.6	-	2	345	c.139C>T	c.(139-141)Caa>Taa	p.Q47*	AIDA_ENST00000355727.2_Nonsense_Mutation_p.Q47*|AIDA_ENST00000474863.1_5'UTR|AIDA_ENST00000541237.1_Nonsense_Mutation_p.Q23*	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	47					dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TGTTGAGCTTGGGCCTCCTTT	0.313																																						dbGAP											0													127.0	119.0	121.0					1																	222876531		2201	4298	6499	-	-	-	SO:0001587	stop_gained	0			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.139C>T	1.37:g.222876531G>A	ENSP00000339161:p.Gln47*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Nonsense_Mutation	SNP	pfam_AIDA,superfamily_AIDA_N	p.Q47*	ENST00000340020.6	37	c.139	CCDS1533.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.149858	0.97324	.	.	ENSG00000186063	ENST00000340020;ENST00000355727;ENST00000541237	.	.	.	5.66	5.66	0.87406	.	0.148612	0.64402	D	0.000008	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	.	19.7203	0.96139	0.0:0.0:1.0:0.0	.	.	.	.	X	47;47;23	.	ENSP00000339161:Q47X	Q	-	1	0	AIDA	220943154	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.886000	0.75611	2.832000	0.97577	0.655000	0.94253	CAA	AIDA	-	pfam_AIDA,superfamily_AIDA_N	ENSG00000186063		0.313	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AIDA	HGNC	protein_coding	OTTHUMT00000091818.1	553	0.00	0	G	NM_022831		222876531	222876531	-1	no_errors	ENST00000340020	ensembl	human	known	69_37n	nonsense	721	23.20	219	SNP	1.000	A
AKR1B1	231	genome.wustl.edu	37	7	134135680	134135680	+	Intron	SNP	A	A	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr7:134135680A>T	ENST00000285930.4	-	3	314				AKR1B1_ENST00000489022.1_Intron	NM_001628.2	NP_001619.1	P15121	ALDR_HUMAN	aldo-keto reductase family 1, member B1 (aldose reductase)						C21-steroid hormone biosynthetic process (GO:0006700)|carbohydrate metabolic process (GO:0005975)|daunorubicin metabolic process (GO:0044597)|doxorubicin metabolic process (GO:0044598)|response to stress (GO:0006950)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|aldo-keto reductase (NADP) activity (GO:0004033)|electron carrier activity (GO:0009055)|glyceraldehyde oxidoreductase activity (GO:0043795)			kidney(1)|large_intestine(5)|lung(2)|ovary(3)|prostate(1)|skin(2)	14					Sulindac(DB00605)	GGCACATGTCATCATTGCCAG	0.547																																						dbGAP											0													51.0	40.0	44.0					7																	134135680		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			J04795	CCDS5831.1	7q35	2010-04-08			ENSG00000085662	ENSG00000085662	1.1.1.21	"""Aldo-keto reductases"""	381	protein-coding gene	gene with protein product		103880		ALDR1		1901827	Standard	NM_001628		Approved	AR	uc003vrp.1	P15121	OTTHUMG00000155322	ENST00000285930.4:c.235-26T>A	7.37:g.134135680A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8N3|Q5U031|Q6FGA4|Q6ICP2|Q9BS21|Q9UCI9	Missense_Mutation	SNP	pfam_NADP_OxRdtase_dom,superfamily_NADP_OxRdtase_dom	p.D88E	ENST00000285930.4	37	c.264	CCDS5831.1	7																																																																																			AKR1B1	-	NULL	ENSG00000085662		0.547	AKR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1B1	HGNC	protein_coding	OTTHUMT00000339448.2	68	0.00	0	A	NM_001628		134135680	134135680	-1	no_errors	ENST00000426422	ensembl	human	known	69_37n	missense	14	65.00	26	SNP	0.000	T
ANKH	56172	genome.wustl.edu	37	5	14758638	14758638	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr5:14758638G>A	ENST00000284268.6	-	3	713	c.383C>T	c.(382-384)aCg>aTg	p.T128M	ANKH_ENST00000503939.1_5'Flank	NM_054027.4	NP_473368.1	Q9HCJ1	ANKH_HUMAN	ANKH inorganic pyrophosphate transport regulator	128					locomotory behavior (GO:0007626)|regulation of bone mineralization (GO:0030500)|skeletal system development (GO:0001501)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|outer membrane (GO:0019867)|plasma membrane (GO:0005886)	inorganic diphosphate transmembrane transporter activity (GO:0030504)|inorganic phosphate transmembrane transporter activity (GO:0005315)|phosphate ion transmembrane transporter activity (GO:0015114)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(13)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	29						GGCCCTTCTCGTCTTGCTCCC	0.448																																						dbGAP											0													133.0	120.0	124.0					5																	14758638		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF274753	CCDS3885.1	5p15.2	2013-06-19	2013-06-19		ENSG00000154122	ENSG00000154122			15492	protein-coding gene	gene with protein product		605145	"""ankylosis, progressive (mouse) homolog"", ""craniometaphyseal dysplasia, Jackson type (dominant)"", ""ankylosis, progressive homolog (mouse)"""	CCAL2, CMDJ		10894769, 12297989, 11326338	Standard	NM_054027		Approved	HANK, ANK, CPPDD	uc003jfm.4	Q9HCJ1	OTTHUMG00000090539	ENST00000284268.6:c.383C>T	5.37:g.14758638G>A	ENSP00000284268:p.Thr128Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCA7|B3KMG4|D3DTD4|Q9NQW2	Missense_Mutation	SNP	pfam_ANKH	p.T128M	ENST00000284268.6	37	c.383	CCDS3885.1	5	.	.	.	.	.	.	.	.	.	.	G	28.4	4.914968	0.92178	.	.	ENSG00000154122	ENST00000284268	D	0.95724	-3.79	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.97173	0.9076	L	0.59436	1.845	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.97742	1.0209	10	0.87932	D	0	-42.0035	18.4049	0.90532	0.0:0.0:1.0:0.0	.	128	Q9HCJ1	ANKH_HUMAN	M	128	ENSP00000284268:T128M	ENSP00000284268:T128M	T	-	2	0	ANKH	14811638	1.000000	0.71417	0.880000	0.34516	0.932000	0.56968	9.790000	0.99075	2.588000	0.87417	0.563000	0.77884	ACG	ANKH	-	pfam_ANKH	ENSG00000154122		0.448	ANKH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKH	HGNC	protein_coding	OTTHUMT00000207063.1	255	0.00	0	G	NM_054027		14758638	14758638	-1	no_errors	ENST00000284268	ensembl	human	known	69_37n	missense	284	11.76	38	SNP	1.000	A
APOBEC3G	60489	genome.wustl.edu	37	22	39475005	39475005	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr22:39475005G>A	ENST00000407997.3	+	2	443	c.86G>A	c.(85-87)cGt>cAt	p.R29H	APOBEC3G_ENST00000461827.1_3'UTR|APOBEC3G_ENST00000452957.2_Missense_Mutation_p.R29H	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	29	Essential for cytoplasmic localization.				base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					ATCCTTTCTCGTCGGAATACC	0.488																																						dbGAP											0													55.0	52.0	53.0					22																	39475005		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.86G>A	22.37:g.39475005G>A	ENSP00000385057:p.Arg29His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Missense_Mutation	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.R29H	ENST00000407997.3	37	c.86	CCDS13984.1	22	.	.	.	.	.	.	.	.	.	.	.	4.384	0.070839	0.08436	.	.	ENSG00000239713	ENST00000452957;ENST00000407997	T;T	0.65732	-0.17;-0.17	1.89	-2.01	0.07410	APOBEC-like, N-terminal (1);	.	.	.	.	T	0.42449	0.1203	L	0.31926	0.97	0.09310	N	1	B	0.17038	0.02	B	0.12156	0.007	T	0.24584	-1.0156	9	0.39692	T	0.17	.	2.2241	0.03980	0.3262:0.0:0.4305:0.2434	.	29	Q9HC16	ABC3G_HUMAN	H	29	ENSP00000413376:R29H;ENSP00000385057:R29H	ENSP00000385057:R29H	R	+	2	0	APOBEC3G	37804951	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.415000	0.07106	-0.416000	0.07473	-2.420000	0.00218	CGT	APOBEC3G	-	pfam_APOBEC_N	ENSG00000239713		0.488	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3G	HGNC	protein_coding	OTTHUMT00000321219.1	238	0.00	0	G	NM_021822		39475005	39475005	+1	no_errors	ENST00000407997	ensembl	human	known	69_37n	missense	17	83.17	84	SNP	0.000	A
ARHGAP36	158763	genome.wustl.edu	37	X	130218365	130218365	+	Silent	SNP	A	A	G			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chrX:130218365A>G	ENST00000276211.5	+	5	1077	c.732A>G	c.(730-732)caA>caG	p.Q244Q	ARHGAP36_ENST00000370922.1_Silent_p.Q232Q|ARHGAP36_ENST00000370921.1_Silent_p.Q108Q	NM_144967.3	NP_659404.2	Q6ZRI8	RHG36_HUMAN	Rho GTPase activating protein 36	244	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(2)|endometrium(5)|kidney(3)|large_intestine(16)|lung(31)|ovary(4)|prostate(4)|skin(3)|urinary_tract(2)	71						CTTGCTGCCAATTCATTGAAA	0.468																																						dbGAP											0													38.0	36.0	37.0					X																	130218365		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS14628.1, CCDS65320.1	Xq26.1	2011-06-29			ENSG00000147256	ENSG00000147256		"""Rho GTPase activating proteins"""	26388	protein-coding gene	gene with protein product							Standard	NM_144967		Approved	FLJ30058	uc004evz.3	Q6ZRI8	OTTHUMG00000022402	ENST00000276211.5:c.732A>G	X.37:g.130218365A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z234|B7Z439|Q5JRL9|Q5JRM0|Q5JRM1|Q96NU6	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Q244	ENST00000276211.5	37	c.732	CCDS14628.1	X																																																																																			ARHGAP36	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000147256		0.468	ARHGAP36-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP36	HGNC	protein_coding	OTTHUMT00000355073.1	134	0.00	0	A	NM_144967		130218365	130218365	+1	no_errors	ENST00000276211	ensembl	human	known	69_37n	silent	68	17.86	15	SNP	0.004	G
ASH1L	55870	genome.wustl.edu	37	1	155450526	155450527	+	Frame_Shift_Ins	INS	-	-	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr1:155450526_155450527insT	ENST00000368346.3	-	3	2773_2774	c.2134_2135insA	c.(2134-2136)agafs	p.R712fs	ASH1L_ENST00000392403.3_Frame_Shift_Ins_p.R712fs			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)	712					cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			TCTTCCTTTTCTTTTTTTTAAT	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.2135dupA	1.37:g.155450534_155450534dupT	ENSP00000357330:p.Arg712fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	Frame_Shift_Ins	INS	pfam_SET_dom,pfam_BAH_dom,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_AT_hook_DNA-bd_motif,smart_AWS,smart_SET_dom,smart_Bromodomain,smart_Znf_PHD,smart_BAH_dom,pfscan_AWS,pfscan_BAH_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Bromodomain	p.R712fs	ENST00000368346.3	37	c.2135_2134		1																																																																																			ASH1L	-	NULL	ENSG00000116539		0.401	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L	HGNC	protein_coding	OTTHUMT00000039400.1	111	0.00	0	-	NM_018489		155450526	155450527	-1	no_errors	ENST00000368346	ensembl	human	known	69_37n	frame_shift_ins	186	10.58	22	INS	1.000:1.000	T
ATG2B	55102	genome.wustl.edu	37	14	96792113	96792113	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr14:96792113C>G	ENST00000359933.4	-	15	3203	c.2310G>C	c.(2308-2310)tgG>tgC	p.W770C	snoU13_ENST00000458931.1_RNA	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	770					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		ACTTCTTAAACCATGGTCCTC	0.383																																						dbGAP											0													99.0	90.0	93.0					14																	96792113		1878	4108	5986	-	-	-	SO:0001583	missense	0			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2310G>C	14.37:g.96792113C>G	ENSP00000353010:p.Trp770Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.W770C	ENST00000359933.4	37	c.2310	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	C	23.6	4.438405	0.83885	.	.	ENSG00000066739	ENST00000359933	T	0.15834	2.39	5.6	5.6	0.85130	.	0.000000	0.64402	U	0.000003	T	0.44973	0.1319	M	0.71036	2.16	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.35549	-0.9784	10	0.87932	D	0	.	19.6287	0.95691	0.0:1.0:0.0:0.0	.	770	Q96BY7	ATG2B_HUMAN	C	770	ENSP00000353010:W770C	ENSP00000353010:W770C	W	-	3	0	ATG2B	95861866	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.601000	0.82783	2.652000	0.90054	0.563000	0.77884	TGG	ATG2B	-	NULL	ENSG00000066739		0.383	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1	259	0.00	0	C	NM_018036		96792113	96792113	-1	no_errors	ENST00000359933	ensembl	human	known	69_37n	missense	147	45.35	122	SNP	1.000	G
C14orf80	283643	genome.wustl.edu	37	14	105958575	105958575	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr14:105958575C>G	ENST00000392523.4	+	3	479	c.358C>G	c.(358-360)Cga>Gga	p.R120G	C14orf80_ENST00000334656.7_Missense_Mutation_p.R79G|C14orf80_ENST00000354560.6_Missense_Mutation_p.R120G|C14orf80_ENST00000392522.3_Missense_Mutation_p.R120G|C14orf80_ENST00000392527.1_Missense_Mutation_p.R79G|C14orf80_ENST00000329886.7_Missense_Mutation_p.R81G|C14orf80_ENST00000450383.1_5'UTR|C14orf80_ENST00000551054.1_3'UTR			Q86SX3	CN080_HUMAN	chromosome 14 open reading frame 80	120										central_nervous_system(1)	1		Melanoma(154;0.226)	OV - Ovarian serous cystadenocarcinoma(23;0.00596)|Epithelial(46;0.0188)	Epithelial(152;0.239)		GCTCTTGGCCCGAGGACCTGT	0.662																																						dbGAP											0													73.0	71.0	72.0					14																	105958575		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS45180.1, CCDS45181.1, CCDS45182.1, CCDS55955.1	14q32.33	2012-09-25			ENSG00000185347	ENSG00000185347			20127	protein-coding gene	gene with protein product							Standard	NM_001134875		Approved		uc001yrn.3	Q86SX3	OTTHUMG00000170426	ENST00000392523.4:c.358C>G	14.37:g.105958575C>G	ENSP00000376308:p.Arg120Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDG3|E9PAQ4|Q86TT3|Q86TT4|Q86TT5|Q96B41|Q9H7H4	Missense_Mutation	SNP	NULL	p.R120G	ENST00000392523.4	37	c.358		14	.	.	.	.	.	.	.	.	.	.	C	17.03	3.283808	0.59867	.	.	ENSG00000185347	ENST00000329886;ENST00000427614;ENST00000455454;ENST00000432805;ENST00000392527;ENST00000443229;ENST00000334656;ENST00000392522;ENST00000392523;ENST00000354560;ENST00000548920	.	.	.	5.22	1.11	0.20524	.	0.777662	0.11173	N	0.591759	T	0.32346	0.0826	L	0.56769	1.78	0.09310	N	1	B;P;B;B;B	0.40302	0.011;0.712;0.013;0.004;0.004	B;B;B;B;B	0.40165	0.011;0.321;0.009;0.008;0.008	T	0.22243	-1.0222	9	0.59425	D	0.04	-2.2902	4.4147	0.11450	0.2257:0.3447:0.3544:0.0752	.	120;120;120;79;81	Q86SX3-2;E9PAQ4;Q86SX3;B5MDG3;Q86SX3-3	.;.;CN080_HUMAN;.;.	G	81;79;79;79;79;79;79;120;120;120;101	.	ENSP00000333010:R81G	R	+	1	2	C14orf80	105029620	0.000000	0.05858	0.744000	0.31058	0.931000	0.56810	0.097000	0.15168	0.169000	0.19679	0.561000	0.74099	CGA	C14orf80	-	NULL	ENSG00000185347		0.662	C14orf80-017	KNOWN	basic	protein_coding	C14orf80	HGNC	protein_coding	OTTHUMT00000409090.1	69	0.00	0	C	NM_001134875		105958575	105958575	+1	no_errors	ENST00000392523	ensembl	human	known	69_37n	missense	26	40.91	18	SNP	0.002	G
CFAP45	25790	genome.wustl.edu	37	1	159846491	159846491	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr1:159846491G>A	ENST00000368099.4	-	10	1271	c.1207C>T	c.(1207-1209)Cgc>Tgc	p.R403C	CCDC19_ENST00000476696.1_5'UTR|CCDC19_ENST00000426543.2_Missense_Mutation_p.R318C	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			TCCTTTCTGCGCCACTCTCTG	0.557																																						dbGAP											0													113.0	87.0	96.0					1																	159846491		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000368099.4:c.1207C>T	1.37:g.159846491G>A	ENSP00000357079:p.Arg403Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R403C	ENST00000368099.4	37	c.1207	CCDS30914.1	1	.	.	.	.	.	.	.	.	.	.	g	22.0	4.230781	0.79688	.	.	ENSG00000213085	ENST00000368099;ENST00000426543	T;T	0.23147	1.92;1.92	5.12	5.12	0.69794	.	0.051067	0.85682	D	0.000000	T	0.48205	0.1487	M	0.85197	2.74	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.52275	-0.8597	9	.	.	.	-11.6015	16.5119	0.84288	0.0:0.0:1.0:0.0	.	403	Q9UL16	CCD19_HUMAN	C	403;318	ENSP00000357079:R403C;ENSP00000403044:R318C	.	R	-	1	0	CCDC19	158113115	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.338000	0.43957	2.567000	0.86603	0.480000	0.44947	CGC	CCDC19	-	NULL	ENSG00000213085		0.557	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	HGNC	protein_coding	OTTHUMT00000085979.1	222	0.00	0	G			159846491	159846491	-1	no_errors	ENST00000368099	ensembl	human	known	69_37n	missense	296	16.57	59	SNP	1.000	A
CDH26	60437	genome.wustl.edu	37	20	58563973	58563973	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr20:58563973G>C	ENST00000244047.5	+	9	1349	c.1038G>C	c.(1036-1038)gaG>gaC	p.E346D	CDH26_ENST00000348616.4_Missense_Mutation_p.E346D			Q8IXH8	CAD26_HUMAN	cadherin 26	346	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(11)|lung(14)|ovary(4)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	44	all_lung(29;0.00963)		BRCA - Breast invasive adenocarcinoma(7;5.58e-09)			TGGATTATGAGACTCGCCCAG	0.552																																						dbGAP											0													49.0	53.0	51.0					20																	58563973		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169690, AK055202	CCDS13485.1, CCDS13486.1	20q13.33	2010-01-26	2009-11-20		ENSG00000124215	ENSG00000124215		"""Cadherins / Major cadherins"""	15902	protein-coding gene	gene with protein product			"""cadherin-like 26"""				Standard	NM_177980		Approved	VR20	uc002ybe.3	Q8IXH8	OTTHUMG00000032874	ENST00000244047.5:c.1038G>C	20.37:g.58563973G>C	ENSP00000244047:p.Glu346Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2M5|B3KNX3|Q6P5Y6|Q8TCH3|Q9BQN4|Q9NRU1	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E346D	ENST00000244047.5	37	c.1038		20	.	.	.	.	.	.	.	.	.	.	G	16.69	3.192537	0.58017	.	.	ENSG00000124215	ENST00000244047;ENST00000348616	T;T	0.72394	-0.65;-0.65	5.31	-9.75	0.00506	.	0.171732	0.49916	D	0.000130	T	0.78704	0.4325	M	0.91920	3.255	0.09310	N	1	D	0.63046	0.992	D	0.65684	0.937	T	0.73591	-0.3934	10	0.87932	D	0	.	6.6721	0.23074	0.2152:0.1031:0.5802:0.1015	.	346	Q8IXH8-4	.	D	346	ENSP00000244047:E346D;ENSP00000339390:E346D	ENSP00000244047:E346D	E	+	3	2	CDH26	57997368	0.056000	0.20664	0.000000	0.03702	0.002000	0.02628	0.098000	0.15189	-2.239000	0.00711	-0.768000	0.03414	GAG	CDH26	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000124215		0.552	CDH26-201	KNOWN	basic	protein_coding	CDH26	HGNC	protein_coding		95	0.00	0	G	NM_177980		58563973	58563973	+1	no_errors	ENST00000244047	ensembl	human	known	69_37n	missense	96	26.52	35	SNP	0.000	C
CNOT3	4849	genome.wustl.edu	37	19	54647208	54647208	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr19:54647208G>A	ENST00000406403.1	+	3	1727	c.124G>A	c.(124-126)Gaa>Aaa	p.E42K	CNOT3_ENST00000221232.5_Missense_Mutation_p.E42K|CNOT3_ENST00000358389.3_5'UTR			O75175	CNOT3_HUMAN	CCR4-NOT transcription complex, subunit 3	42					gene expression (GO:0010467)|gene silencing by RNA (GO:0031047)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|transcription, DNA-templated (GO:0006351)|trophectodermal cell differentiation (GO:0001829)	CCR4-NOT complex (GO:0030014)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)				endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(3)|prostate(7)|urinary_tract(3)	28	all_cancers(19;0.0065)|all_epithelial(19;0.00348)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					GAACCAGAAAGAAAAGTATGA	0.532																																						dbGAP											0													86.0	86.0	86.0					19																	54647208		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180474	CCDS12880.1	19q13.4	2011-02-14			ENSG00000088038	ENSG00000088038			7879	protein-coding gene	gene with protein product	"""NOT3 (negative regulator of transcription 3, yeast) homolog"""	604910		NOT3		10637334, 9734811	Standard	NM_014516		Approved	NOT3H, KIAA0691, LENG2	uc002qdj.2	O75175	OTTHUMG00000066468	ENST00000406403.1:c.124G>A	19.37:g.54647208G>A	ENSP00000383954:p.Glu42Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NZN7|Q9UF76	Missense_Mutation	SNP	pfam_Not_N,pfam_NOT,pirsf_CCR4-NOT_su3/5	p.E42K	ENST00000406403.1	37	c.124	CCDS12880.1	19	.	.	.	.	.	.	.	.	.	.	G	34	5.326847	0.95708	.	.	ENSG00000088038	ENST00000221232;ENST00000406403	T;T	0.67523	-0.27;-0.27	4.52	4.52	0.55395	Not CCR4-Not complex component, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.84147	0.5408	M	0.88906	2.99	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	D	0.87432	0.2389	10	0.72032	D	0.01	-16.5699	16.5341	0.84368	0.0:0.0:1.0:0.0	.	42;42	B7Z6J7;O75175	.;CNOT3_HUMAN	K	42	ENSP00000221232:E42K;ENSP00000383954:E42K	ENSP00000221232:E42K	E	+	1	0	CNOT3	59339020	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.010000	0.93611	2.512000	0.84698	0.655000	0.94253	GAA	CNOT3	-	pfam_Not_N,pirsf_CCR4-NOT_su3/5	ENSG00000088038		0.532	CNOT3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CNOT3	HGNC	protein_coding	OTTHUMT00000142130.3	125	0.00	0	G	NM_014516		54647208	54647208	+1	no_errors	ENST00000221232	ensembl	human	known	69_37n	missense	100	17.36	21	SNP	1.000	A
EEF1A1	1915	genome.wustl.edu	37	6	74227940	74227940	+	Silent	SNP	A	A	C	rs11556677	byFrequency	TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr6:74227940A>C	ENST00000316292.9	-	6	2068	c.1077T>G	c.(1075-1077)ccT>ccG	p.P359P	EEF1A1_ENST00000309268.6_Silent_p.P359P|EEF1A1_ENST00000331523.2_Silent_p.P359P|EEF1A1_ENST00000491404.1_Intron	NM_001402.5	NP_001393.1	P68104	EF1A1_HUMAN	eukaryotic translation elongation factor 1 alpha 1	359					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|translation (GO:0006412)|translational elongation (GO:0006414)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation elongation factor 1 complex (GO:0005853)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|translation elongation factor activity (GO:0003746)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|prostate(2)|skin(3)	18						AATCCAATACAGGGGCATAGC	0.448																																						dbGAP											0													36.0	40.0	38.0					6																	74227940		2195	4298	6493	-	-	-	SO:0001819	synonymous_variant	0			BC019669	CCDS4980.1	6q14.1	2010-06-30	2004-11-19		ENSG00000156508	ENSG00000156508			3189	protein-coding gene	gene with protein product		130590	"""leukocyte receptor cluster (LRC) member 7"""	EF1A, EEF1A, LENG7		8812466, 10941842	Standard	NM_001402		Approved	EE1A1	uc003phj.3	P68104	OTTHUMG00000015031	ENST00000316292.9:c.1077T>G	6.37:g.74227940A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	P04719|P04720|Q6IQ15	Silent	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_Transl_elong_EF1A_euk/arc	p.P359	ENST00000316292.9	37	c.1077	CCDS4980.1	6																																																																																			EEF1A1	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C,tigrfam_Transl_elong_EF1A_euk/arc	ENSG00000156508		0.448	EEF1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A1	HGNC	protein_coding	OTTHUMT00000041210.2	103	0.96	1	A	NM_001402		74227940	74227940	-1	no_errors	ENST00000309268	ensembl	human	known	69_37n	silent	51	10.53	6	SNP	1.000	C
EHMT1	79813	genome.wustl.edu	37	9	140672361	140672361	+	Silent	SNP	C	C	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr9:140672361C>T	ENST00000460843.1	+	13	2073	c.2046C>T	c.(2044-2046)gaC>gaT	p.D682D	EHMT1_ENST00000462484.1_Silent_p.D682D|EHMT1_ENST00000334856.6_Silent_p.D651D|EHMT1_ENST00000371394.2_3'UTR	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	682					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		TCTCGGAGGACGACAAGCTGC	0.622																																						dbGAP											0													102.0	117.0	112.0					9																	140672361		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.2046C>T	9.37:g.140672361C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Silent	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.D682	ENST00000460843.1	37	c.2046	CCDS7050.2	9																																																																																			EHMT1	-	NULL	ENSG00000181090		0.622	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	62	0.00	0	C	NM_024757		140672361	140672361	+1	no_errors	ENST00000460843	ensembl	human	known	69_37n	silent	39	15.22	7	SNP	0.201	T
NANOS1	340719	genome.wustl.edu	37	10	120795555	120795555	+	IGR	SNP	C	C	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr10:120795555C>T	ENST00000425699.1	+	0	4627				EIF3A_ENST00000541549.1_Missense_Mutation_p.R1348H|EIF3A_ENST00000369144.3_Missense_Mutation_p.R1382H	NM_199461.2	NP_955631.1	Q8WY41	NANO1_HUMAN	nanos homolog 1 (Drosophila)						cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			lung(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0193)		TGAGACTTAACGTCGTACTGT	0.383																																						dbGAP											0													130.0	119.0	123.0					10																	120795555		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF275269	CCDS7607.1	10q26.13	2003-12-01			ENSG00000188613	ENSG00000188613			23044	protein-coding gene	gene with protein product		608226				12690449	Standard	NM_199461		Approved	NOS1	uc009xzf.1	Q8WY41	OTTHUMG00000019141		10.37:g.120795555C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.R1382H	ENST00000425699.1	37	c.4145	CCDS7607.1	10	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769176	0.69992	.	.	ENSG00000107581	ENST00000369144;ENST00000541549	T;T	0.51325	0.71;0.78	6.03	6.03	0.97812	.	0.000000	0.40222	N	0.001145	T	0.58177	0.2104	N	0.19112	0.55	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	T	0.61705	-0.7008	10	0.87932	D	0	.	20.5568	0.99304	0.0:1.0:0.0:0.0	.	1382	Q14152	EIF3A_HUMAN	H	1382;1348	ENSP00000358140:R1382H;ENSP00000438178:R1348H	ENSP00000358140:R1382H	R	-	2	0	EIF3A	120785545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.474000	0.81024	2.861000	0.98227	0.655000	0.94253	CGT	EIF3A	-	NULL	ENSG00000107581		0.383	NANOS1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000110794.1	234	0.00	0	C			120795555	120795555	-1	no_errors	ENST00000369144	ensembl	human	known	69_37n	missense	220	15.06	39	SNP	1.000	T
FAM127B	26071	genome.wustl.edu	37	X	134185956	134185956	+	Silent	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chrX:134185956G>A	ENST00000370775.2	-	1	249	c.183C>T	c.(181-183)gaC>gaT	p.D61D	FAM127B_ENST00000520964.1_5'UTR	NM_001078172.1	NP_001071640.1	Q9BWD3	F127B_HUMAN	family with sequence similarity 127, member B	61										breast(3)|endometrium(2)|large_intestine(3)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(192;0.000127)					CCTTCAGGGCGTCGTTGGAGA	0.592																																						dbGAP											0													74.0	78.0	77.0					X																	134185956		2164	4239	6403	-	-	-	SO:0001819	synonymous_variant	0			AL117556	CCDS43998.1	Xq26.3	2014-05-16			ENSG00000203950	ENSG00000203950			24514	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078172		Approved	DKFZP564B147, MAR8A, CXX1b	uc004eyf.3	Q9BWD3	OTTHUMG00000022466	ENST00000370775.2:c.183C>T	X.37:g.134185956G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2V9|Q8TBU2	Silent	SNP	NULL	p.D61	ENST00000370775.2	37	c.183	CCDS43998.1	X																																																																																			FAM127B	-	NULL	ENSG00000203950		0.592	FAM127B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127B	HGNC	protein_coding	OTTHUMT00000058393.2	126	0.00	0	G	NM_001078172		134185956	134185956	-1	no_errors	ENST00000370775	ensembl	human	known	69_37n	silent	53	22.06	15	SNP	0.304	A
FAM169A	26049	genome.wustl.edu	37	5	74078857	74078857	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr5:74078857C>A	ENST00000389156.4	-	12	1453	c.1363G>T	c.(1363-1365)Gaa>Taa	p.E455*	FAM169A_ENST00000510496.1_Nonsense_Mutation_p.E395*|FAM169A_ENST00000380515.3_3'UTR	NM_015566.2	NP_056381.1	Q9Y6X4	F169A_HUMAN	family with sequence similarity 169, member A	455	Asp/Glu-rich.					membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	27						AATTTTAATTCTTCATCTAAA	0.383																																						dbGAP											0													76.0	76.0	76.0					5																	74078857		1816	4083	5899	-	-	-	SO:0001587	stop_gained	0				CCDS43330.1	5q13.3	2008-08-08			ENSG00000198780	ENSG00000198780			29138	protein-coding gene	gene with protein product		615769				10048485	Standard	NM_015566		Approved	KIAA0888	uc003kdm.4	Q9Y6X4	OTTHUMG00000162930	ENST00000389156.4:c.1363G>T	5.37:g.74078857C>A	ENSP00000373808:p.Glu455*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T9|Q6MZT0|Q9H989	Nonsense_Mutation	SNP	NULL	p.E455*	ENST00000389156.4	37	c.1363	CCDS43330.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.436717	0.96168	.	.	ENSG00000198780	ENST00000389156;ENST00000510496	.	.	.	5.4	4.53	0.55603	.	0.193039	0.35646	N	0.003078	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-10.0636	12.7151	0.57111	0.0:0.9222:0.0:0.0778	.	.	.	.	X	455;395	.	ENSP00000373808:E455X	E	-	1	0	FAM169A	74114613	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	3.484000	0.53201	2.533000	0.85409	0.563000	0.77884	GAA	FAM169A	-	NULL	ENSG00000198780		0.383	FAM169A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM169A	HGNC	protein_coding	OTTHUMT00000371092.2	146	0.00	0	C			74078857	74078857	-1	no_errors	ENST00000389156	ensembl	human	known	69_37n	nonsense	186	13.89	30	SNP	1.000	A
FAM98A	25940	genome.wustl.edu	37	2	33809886	33809886	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr2:33809886T>G	ENST00000238823.8	-	8	1654	c.1514A>C	c.(1513-1515)tAt>tCt	p.Y505S	FAM98A_ENST00000498340.1_5'Flank|FAM98A_ENST00000441530.2_Missense_Mutation_p.Y310S|FAM98A_ENST00000403368.1_3'UTR			Q8NCA5	FA98A_HUMAN	family with sequence similarity 98, member A	506	Gly-rich.						poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(1)	24	all_hematologic(175;0.115)					AGAATGATTATACTGATAACC	0.458																																						dbGAP											0													203.0	197.0	199.0					2																	33809886		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33179.1	2p22.3	2006-11-29		2005-11-20	ENSG00000119812	ENSG00000119812			24520	protein-coding gene	gene with protein product						12477932	Standard	NM_015475		Approved	DKFZP564F0522	uc002rpa.1	Q8NCA5	OTTHUMG00000152152	ENST00000238823.8:c.1514A>C	2.37:g.33809886T>G	ENSP00000238823:p.Tyr505Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNA2|Q9Y3Y6	Missense_Mutation	SNP	pfam_Uncharacterised_FAM98	p.Y505S	ENST00000238823.8	37	c.1514	CCDS33179.1	2	.	.	.	.	.	.	.	.	.	.	T	13.22	2.171223	0.38315	.	.	ENSG00000119812	ENST00000238823;ENST00000395190;ENST00000441530	T;T	0.52526	0.66;0.71	6.06	4.89	0.63831	.	0.062794	0.64402	D	0.000004	T	0.45558	0.1348	L	0.44542	1.39	0.51767	D	0.999938	P;P;P;P	0.43231	0.7;0.7;0.801;0.7	B;B;P;B	0.45558	0.27;0.27;0.485;0.27	T	0.28138	-1.0053	10	0.33141	T	0.24	-8.2796	12.6636	0.56828	0.1239:0.0:0.0:0.8761	.	506;336;505;343	Q8NCA5;B4DY25;Q8NCA5-2;B3KTW4	FA98A_HUMAN;.;.;.	S	505;506;310	ENSP00000238823:Y505S;ENSP00000408716:Y310S	ENSP00000238823:Y505S	Y	-	2	0	FAM98A	33663390	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.418000	0.80167	1.091000	0.41335	0.533000	0.62120	TAT	FAM98A	-	NULL	ENSG00000119812		0.458	FAM98A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM98A	HGNC	protein_coding	OTTHUMT00000325457.2	292	0.00	0	T	NM_015475		33809886	33809886	-1	no_errors	ENST00000238823	ensembl	human	known	69_37n	missense	155	43.48	120	SNP	1.000	G
FER	2241	genome.wustl.edu	37	5	108290582	108290582	+	Silent	SNP	T	T	C			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr5:108290582T>C	ENST00000281092.4	+	12	1866	c.1482T>C	c.(1480-1482)ctT>ctC	p.L494L	FER_ENST00000438717.2_Silent_p.L319L|FER_ENST00000536402.1_Intron	NM_005246.2	NP_005237.2	P16591	FER_HUMAN	fer (fps/fes related) tyrosine kinase	494	SH2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				actin cytoskeleton reorganization (GO:0031532)|cell proliferation (GO:0008283)|cell-cell adhesion mediated by cadherin (GO:0044331)|cellular response to insulin stimulus (GO:0032869)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to reactive oxygen species (GO:0034614)|chemotaxis (GO:0006935)|cytokine-mediated signaling pathway (GO:0019221)|diapedesis (GO:0050904)|extracellular matrix-cell signaling (GO:0035426)|Fc-epsilon receptor signaling pathway (GO:0038095)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|interleukin-6-mediated signaling pathway (GO:0070102)|intracellular signal transduction (GO:0035556)|Kit signaling pathway (GO:0038109)|microtubule cytoskeleton organization (GO:0000226)|mitotic cell cycle (GO:0000278)|negative regulation of mast cell activation involved in immune response (GO:0033007)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|regulation of fibroblast migration (GO:0010762)|regulation of lamellipodium assembly (GO:0010591)|regulation of protein phosphorylation (GO:0001932)|response to lipopolysaccharide (GO:0032496)|response to platelet-derived growth factor (GO:0036119)|substrate adhesion-dependent cell spreading (GO:0034446)|tyrosine phosphorylation of Stat3 protein (GO:0042503)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	ATP binding (GO:0005524)|epidermal growth factor receptor binding (GO:0005154)|lipid binding (GO:0008289)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			NS(2)|biliary_tract(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(2)	32		all_cancers(142;2.86e-06)|all_epithelial(76;9.81e-08)|Prostate(80;0.00972)|Lung NSC(167;0.039)|Ovarian(225;0.0448)|all_lung(232;0.0496)|Colorectal(57;0.0986)|Breast(839;0.152)		OV - Ovarian serous cystadenocarcinoma(64;6.77e-10)|Epithelial(69;4.13e-08)|COAD - Colon adenocarcinoma(37;0.0174)		AATATGTCCTTTCTGTATATT	0.368																																					Colon(146;1051 1799 9836 27344 47401)	dbGAP											0													125.0	127.0	126.0					5																	108290582		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			J03358	CCDS4098.1	5q21	2013-02-14	2008-02-07		ENSG00000151422	ENSG00000151422	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""SH2 domain containing"""	3655	protein-coding gene	gene with protein product	"""phosphoprotein NCP94"", ""protein phosphatase 1, regulatory subunit 74"""	176942					Standard	NM_005246		Approved	TYK3, PPP1R74	uc003kop.1	P16591	OTTHUMG00000128751	ENST00000281092.4:c.1482T>C	5.37:g.108290582T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCR4|B4DSQ2|H2FLB8	Silent	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_FCH,superfamily_Kinase-like_dom,smart_FCH,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FCH,pfscan_SH2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.L494	ENST00000281092.4	37	c.1482	CCDS4098.1	5																																																																																			FER	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_SH2,smart_SH2,pfscan_SH2,prints_SH2	ENSG00000151422		0.368	FER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER	HGNC	protein_coding	OTTHUMT00000250664.1	195	0.00	0	T	NM_005246		108290582	108290582	+1	no_errors	ENST00000281092	ensembl	human	known	69_37n	silent	222	12.20	31	SNP	1.000	C
GRIK1	2897	genome.wustl.edu	37	21	30934056	30934056	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr21:30934056C>T	ENST00000399907.1	-	15	2656	c.2245G>A	c.(2245-2247)Gcg>Acg	p.A749T	GRIK1_ENST00000399913.1_Missense_Mutation_p.A749T|GRIK1_ENST00000399909.1_Missense_Mutation_p.A734T|GRIK1_ENST00000327783.4_Missense_Mutation_p.A749T|GRIK1_ENST00000399914.1_Missense_Mutation_p.A734T|GRIK1_ENST00000389124.2_Missense_Mutation_p.A749T|GRIK1_ENST00000535441.1_Missense_Mutation_p.A751T|GRIK1_ENST00000309434.7_Missense_Mutation_p.A751T|GRIK1_ENST00000389125.3_Missense_Mutation_p.A734T	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	749					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	ATCAGCAGCGCGTAGTCTGTG	0.547																																						dbGAP											0													148.0	120.0	129.0					21																	30934056		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.2245G>A	21.37:g.30934056C>T	ENSP00000382791:p.Ala749Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13001|Q86SU9	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A751T	ENST00000399907.1	37	c.2251	CCDS42913.1	21	.	.	.	.	.	.	.	.	.	.	C	34	5.398761	0.96030	.	.	ENSG00000171189	ENST00000327783;ENST00000389125;ENST00000399913;ENST00000399914;ENST00000535441;ENST00000541508;ENST00000389124;ENST00000399907;ENST00000399909;ENST00000309434	T;T;T;T;T;T;T;T;T	0.20200	2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09;2.09	4.96	4.96	0.65561	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.65585	0.2705	H	0.98507	4.25	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;0.999	T	0.80379	-0.1407	10	0.87932	D	0	.	18.367	0.90394	0.0:1.0:0.0:0.0	.	734;749;749;734	E7EPY9;E9PD61;P39086;P39086-2	.;.;GRIK1_HUMAN;.	T	749;734;749;734;751;610;749;749;734;751	ENSP00000327687:A749T;ENSP00000373777:A734T;ENSP00000382797:A749T;ENSP00000382798:A734T;ENSP00000446326:A751T;ENSP00000373776:A749T;ENSP00000382791:A749T;ENSP00000382793:A734T;ENSP00000311646:A751T	ENSP00000311646:A751T	A	-	1	0	GRIK1	29855927	1.000000	0.71417	0.985000	0.45067	0.925000	0.55904	7.573000	0.82421	2.733000	0.93635	0.655000	0.94253	GCG	GRIK1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000171189		0.547	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIK1	HGNC	protein_coding	OTTHUMT00000171979.1	289	0.34	1	C			30934056	30934056	-1	no_errors	ENST00000535441	ensembl	human	known	69_37n	missense	138	36.99	81	SNP	1.000	T
JMJD1C	221037	genome.wustl.edu	37	10	64974081	64974081	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr10:64974081G>A	ENST00000399262.2	-	8	2064	c.1846C>T	c.(1846-1848)Cga>Tga	p.R616*	JMJD1C_ENST00000489372.2_5'Flank|JMJD1C_ENST00000542921.1_Nonsense_Mutation_p.R434*|JMJD1C_ENST00000402544.1_Nonsense_Mutation_p.R397*|JMJD1C_ENST00000399251.1_Nonsense_Mutation_p.R397*	NM_032776.1	NP_116165.1	Q15652	JHD2C_HUMAN	jumonji domain containing 1C	616					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleoplasm (GO:0005654)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)|thyroid hormone receptor binding (GO:0046966)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(9)|lung(27)|ovary(6)|prostate(4)|skin(4)|stomach(3)|upper_aerodigestive_tract(3)	77	Prostate(12;0.0119)|all_hematologic(501;0.191)					GGTGGACTTCGCTTATGCAGC	0.363																																						dbGAP											0													116.0	105.0	108.0					10																	64974081		1855	4103	5958	-	-	-	SO:0001587	stop_gained	0			L40411	CCDS41532.1, CCDS60538.1	10q22.1	2011-05-25	2004-03-31	2004-04-01	ENSG00000171988	ENSG00000171988			12313	protein-coding gene	gene with protein product		604503	"""thyroid hormone receptor interactor 8"""	TRIP8		7776974	Standard	XM_005269624		Approved	DKFZp761F0118, KIAA1380, FLJ14374	uc001jmn.3	Q15652	OTTHUMG00000018311	ENST00000399262.2:c.1846C>T	10.37:g.64974081G>A	ENSP00000382204:p.Arg616*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0T124|Q5SQZ8|Q5SQZ9|Q5SR00|Q7Z3E7|Q8N3U0|Q96KB9|Q9P2G7	Nonsense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.R616*	ENST00000399262.2	37	c.1846	CCDS41532.1	10	.	.	.	.	.	.	.	.	.	.	G	46	12.406819	0.99665	.	.	ENSG00000171988	ENST00000399262;ENST00000402544;ENST00000399251;ENST00000542921	.	.	.	6.17	6.17	0.99709	.	0.747397	0.13035	N	0.418951	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.9189	20.8794	0.99867	0.0:0.0:1.0:0.0	.	.	.	.	X	616;397;397;434	.	ENSP00000382195:R397X	R	-	1	2	JMJD1C	64644087	0.959000	0.32827	1.000000	0.80357	0.998000	0.95712	3.896000	0.56266	2.941000	0.99782	0.655000	0.94253	CGA	JMJD1C	-	NULL	ENSG00000171988		0.363	JMJD1C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	JMJD1C	HGNC	protein_coding	OTTHUMT00000048249.2	211	0.00	0	G	NM_004241		64974081	64974081	-1	no_errors	ENST00000399262	ensembl	human	known	69_37n	nonsense	113	47.95	105	SNP	1.000	A
MEOX2	4223	genome.wustl.edu	37	7	15652133	15652133	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr7:15652133C>T	ENST00000262041.5	-	3	1203	c.794G>A	c.(793-795)gGa>gAa	p.G265E		NM_005924.4	NP_005915.2	P50222	MEOX2_HUMAN	mesenchyme homeobox 2	265					angiogenesis (GO:0001525)|blood circulation (GO:0008015)|limb development (GO:0060173)|multicellular organismal development (GO:0007275)|neuron death (GO:0070997)|palate development (GO:0060021)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle tissue development (GO:0007519)|somite specification (GO:0001757)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (126;0.0822)		GAGAAGTGTTCCCTTTTTCAC	0.522																																					Esophageal Squamous(140;197 1769 16409 18257 29929)	dbGAP											0													198.0	187.0	191.0					7																	15652133		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34605.1	7p22.1-p21.3	2014-07-15	2005-12-22		ENSG00000106511	ENSG00000106511		"""Homeoboxes / ANTP class : HOXL subclass"""	7014	protein-coding gene	gene with protein product	"""growth arrest-specific homeobox"""	600535	"""mesenchyme homeo box 2 (growth arrest-specific homeo box)"", ""mesenchyme homeobox 2 (growth arrest-specific homeo box)"""	GAX		7713505	Standard	NM_005924		Approved	MOX2	uc003stc.3	P50222	OTTHUMG00000152390	ENST00000262041.5:c.794G>A	7.37:g.15652133C>T	ENSP00000262041:p.Gly265Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8I7|O75263|Q9UPL6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.G265E	ENST00000262041.5	37	c.794	CCDS34605.1	7	.	.	.	.	.	.	.	.	.	.	C	17.64	3.440486	0.63067	.	.	ENSG00000106511	ENST00000262041	D	0.89681	-2.55	5.51	5.51	0.81932	.	0.000000	0.85682	D	0.000000	D	0.91005	0.7171	L	0.27053	0.805	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89895	0.4040	10	0.33141	T	0.24	-13.5118	19.4309	0.94765	0.0:1.0:0.0:0.0	.	265	P50222	MEOX2_HUMAN	E	265	ENSP00000262041:G265E	ENSP00000262041:G265E	G	-	2	0	MEOX2	15618658	1.000000	0.71417	0.996000	0.52242	0.286000	0.27126	7.456000	0.80751	2.595000	0.87683	0.563000	0.77884	GGA	MEOX2	-	NULL	ENSG00000106511		0.522	MEOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEOX2	HGNC	protein_coding	OTTHUMT00000326058.2	256	0.00	0	C	NM_005924		15652133	15652133	-1	no_errors	ENST00000262041	ensembl	human	known	69_37n	missense	121	53.76	143	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9062672	9062672	+	Silent	SNP	G	G	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr19:9062672G>T	ENST00000397910.4	-	3	24977	c.24774C>A	c.(24772-24774)tcC>tcA	p.S8258S		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8260	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTCCACAGAGGATTGACTAG	0.507																																						dbGAP											0													72.0	76.0	75.0					19																	9062672		2042	4185	6227	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24774C>A	19.37:g.9062672G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S8258	ENST00000397910.4	37	c.24774	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	172	0.00	0	G	NM_024690		9062672	9062672	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	50	28.57	20	SNP	0.000	T
LINC01317	104355287	genome.wustl.edu	37	2	33952282	33952282	+	lincRNA	SNP	G	G	A	rs149035002	byFrequency	TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr2:33952282G>A	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							CATACTTCTCGTTGAACTGGT	0.597													G|||	5	0.000998403	0.0038	0.0	5008	,	,		18721	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0																															2.37:g.33952282G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-	ENSG00000239649		0.597	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	37	0.00	0	G			33952282	33952282	-1	no_errors	ENST00000474610	ensembl	human	known	69_37n	rna	17	19.05	4	SNP	0.810	A
MYBBP1A	10514	genome.wustl.edu	37	17	4442756	4442756	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr17:4442756C>T	ENST00000254718.4	-	26	4247	c.3941G>A	c.(3940-3942)aGt>aAt	p.S1314N	MYBBP1A_ENST00000381556.2_Missense_Mutation_p.S1314N			Q9BQG0	MBB1A_HUMAN	MYB binding protein (P160) 1a	1314	Required for nuclear and nucleolar localization. {ECO:0000250}.				cellular response to glucose starvation (GO:0042149)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|osteoblast differentiation (GO:0001649)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|NLS-dependent protein nuclear import complex (GO:0042564)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(7)|ovary(3)|prostate(2)|skin(2)|stomach(1)	24						CTTGGCCCCACTCTGAAGCAG	0.597																																						dbGAP											0													123.0	127.0	126.0					17																	4442756		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF147709	CCDS11046.1, CCDS42238.1	17p13.3	2008-07-18			ENSG00000132382	ENSG00000132382			7546	protein-coding gene	gene with protein product	"""p53-activated protein-2"""	604885				10644447	Standard	NM_014520		Approved	P160, PAP2, FLJ37886	uc002fxz.4	Q9BQG0	OTTHUMG00000090747	ENST00000254718.4:c.3941G>A	17.37:g.4442756C>T	ENSP00000254718:p.Ser1314Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VM3|Q9BW49|Q9P0V5|Q9UF99	Missense_Mutation	SNP	pfam_DNA_pol_V,superfamily_ARM-type_fold	p.S1314N	ENST00000254718.4	37	c.3941	CCDS11046.1	17	.	.	.	.	.	.	.	.	.	.	c	11.92	1.781870	0.31502	.	.	ENSG00000132382	ENST00000381556;ENST00000254718	T;T	0.23147	1.92;1.92	4.84	0.312	0.15837	.	0.848789	0.10495	N	0.667974	T	0.15478	0.0373	L	0.29908	0.895	0.09310	N	1	B;B	0.15141	0.007;0.012	B;B	0.12156	0.003;0.007	T	0.27739	-1.0065	10	0.38643	T	0.18	0.0172	3.5462	0.07829	0.1633:0.4295:0.3171:0.0901	.	1314;1314	Q9BQG0;Q9BQG0-2	MBB1A_HUMAN;.	N	1314	ENSP00000370968:S1314N;ENSP00000254718:S1314N	ENSP00000254718:S1314N	S	-	2	0	MYBBP1A	4389505	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.039000	0.12124	0.028000	0.15324	0.651000	0.88453	AGT	MYBBP1A	-	NULL	ENSG00000132382		0.597	MYBBP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBBP1A	HGNC	protein_coding	OTTHUMT00000207488.2	105	0.94	1	C	NM_014520		4442756	4442756	-1	no_errors	ENST00000381556	ensembl	human	known	69_37n	missense	53	10.17	6	SNP	0.000	T
MYRIP	25924	genome.wustl.edu	37	3	40192554	40192554	+	Missense_Mutation	SNP	A	A	T	rs111363654		TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr3:40192554A>T	ENST00000302541.6	+	4	690	c.348A>T	c.(346-348)caA>caT	p.Q116H	MYRIP_ENST00000459828.1_3'UTR|MYRIP_ENST00000539167.1_5'UTR|MYRIP_ENST00000444716.1_Missense_Mutation_p.Q116H|MYRIP_ENST00000396217.3_Intron|MYRIP_ENST00000425621.1_Missense_Mutation_p.Q116H	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	116	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		TGAGGGCCCAATCTCTGGAAT	0.453																																						dbGAP											0													38.0	39.0	39.0					3																	40192554		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.348A>T	3.37:g.40192554A>T	ENSP00000301972:p.Gln116His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.Q116H	ENST00000302541.6	37	c.348	CCDS2689.1	3	.	.	.	.	.	.	.	.	.	.	G	23.0	4.366735	0.82463	.	.	ENSG00000170011	ENST00000444716;ENST00000302541;ENST00000425621	T;T;T	0.77358	-1.09;-1.09;-1.09	5.95	5.07	0.68467	Zinc finger, RING/FYVE/PHD-type (1);Rab-binding domain (1);Zinc finger, FYVE/PHD-type (1);	0.064485	0.64402	D	0.000005	D	0.84061	0.5389	M	0.64997	1.995	0.80722	D	1	D;D;D	0.71674	0.994;0.997;0.998	D;D;D	0.76071	0.969;0.986;0.987	D	0.83663	0.0162	9	.	.	.	.	8.8594	0.35247	0.2314:0.0:0.7686:0.0	.	116;116;116	B3KWW4;G3XAI8;Q8NFW9	.;.;MYRIP_HUMAN	H	116	ENSP00000398665:Q116H;ENSP00000301972:Q116H;ENSP00000389323:Q116H	.	Q	+	3	2	MYRIP	40167558	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.321000	0.59209	1.544000	0.49359	-0.119000	0.15052	CAA	MYRIP	-	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	ENSG00000170011		0.453	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	90	0.00	0	A	NM_015460		40192554	40192554	+1	no_errors	ENST00000302541	ensembl	human	known	69_37n	missense	53	14.29	9	SNP	1.000	T
NEK6	10783	genome.wustl.edu	37	9	127089686	127089686	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr9:127089686G>A	ENST00000320246.5	+	7	729	c.584G>A	c.(583-585)cGc>cAc	p.R195H	NEK6_ENST00000539416.1_Missense_Mutation_p.R220H|NEK6_ENST00000394199.2_Missense_Mutation_p.R229H|NEK6_ENST00000545174.1_Missense_Mutation_p.R195H|NEK6_ENST00000373603.1_Missense_Mutation_p.R195H|NEK6_ENST00000373600.3_Missense_Mutation_p.R229H|NEK6_ENST00000546191.1_Missense_Mutation_p.R195H|NEK6_ENST00000540326.1_Missense_Mutation_p.R213H	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6	195	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						GGTCTGGGCCGCTTCTTCAGC	0.632																																					NSCLC(122;934 1785 18647 44295 45571)	dbGAP											0													209.0	184.0	193.0					9																	127089686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.584G>A	9.37:g.127089686G>A	ENSP00000319734:p.Arg195His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R229H	ENST00000320246.5	37	c.686	CCDS6854.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.975019	0.97162	.	.	ENSG00000119408	ENST00000373603;ENST00000540326;ENST00000373600;ENST00000320246;ENST00000373601;ENST00000545174;ENST00000444973;ENST00000454453;ENST00000373596;ENST00000425237;ENST00000394199;ENST00000546191;ENST00000422297;ENST00000539416	T;T;T;T;T;T;T;T;T;T;T;T;T	0.47869	2.89;2.89;2.89;2.89;2.89;1.6;0.83;2.89;1.6;2.89;2.89;1.6;2.89	5.95	5.95	0.96441	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.72622	0.3483	M	0.79926	2.475	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.996;0.998;0.993	T	0.74624	-0.3603	10	0.87932	D	0	.	19.3735	0.94500	0.0:0.0:1.0:0.0	.	220;229;195;213	Q9HC98-4;Q9HC98-2;Q9HC98;Q9HC98-3	.;.;NEK6_HUMAN;.	H	195;213;229;195;127;195;195;127;195;195;229;195;195;220	ENSP00000362705:R195H;ENSP00000441469:R213H;ENSP00000362702:R229H;ENSP00000319734:R195H;ENSP00000442636:R195H;ENSP00000389517:R195H;ENSP00000405215:R127H;ENSP00000362698:R195H;ENSP00000403087:R195H;ENSP00000377749:R229H;ENSP00000441426:R195H;ENSP00000411401:R195H;ENSP00000439651:R220H	ENSP00000319734:R195H	R	+	2	0	NEK6	126129507	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.274000	0.95731	2.825000	0.97269	0.655000	0.94253	CGC	NEK6	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000119408		0.632	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK6	HGNC	protein_coding	OTTHUMT00000054016.1	193	0.00	0	G	NM_014397		127089686	127089686	+1	no_errors	ENST00000373600	ensembl	human	known	69_37n	missense	92	29.55	39	SNP	1.000	A
NEK9	91754	genome.wustl.edu	37	14	75551376	75551376	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr14:75551376G>A	ENST00000238616.5	-	22	2989	c.2831C>T	c.(2830-2832)tCc>tTc	p.S944F	NEK9_ENST00000555763.1_5'UTR	NM_033116.4	NP_149107.4	Q8TD19	NEK9_HUMAN	NIMA-related kinase 9	944					mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|kidney(2)|large_intestine(4)|lung(13)|ovary(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00718)		AGTTCCTTTGGAATGCATCCC	0.468																																						dbGAP											0													174.0	159.0	164.0					14																	75551376		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY048580	CCDS9839.1	14q24.2	2012-11-15	2012-11-15		ENSG00000119638	ENSG00000119638			18591	protein-coding gene	gene with protein product		609798	"""NIMA (never in mitosis gene a)- related kinase 9"""			11864968	Standard	NM_033116		Approved	Nek8, NERCC, DKFZp434D0935, MGC16714	uc001xrl.3	Q8TD19	OTTHUMG00000171768	ENST00000238616.5:c.2831C>T	14.37:g.75551376G>A	ENSP00000238616:p.Ser944Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LK6|Q8NCN0|Q8TCY4|Q9UPI4|Q9Y6S4|Q9Y6S5|Q9Y6S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Reg_chr_condens,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Reg_chr_condens,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S944F	ENST00000238616.5	37	c.2831	CCDS9839.1	14	.	.	.	.	.	.	.	.	.	.	G	15.96	2.986225	0.53934	.	.	ENSG00000119638	ENST00000238616	T	0.72725	-0.68	6.02	6.02	0.97574	.	0.207925	0.41396	D	0.000899	T	0.74711	0.3752	L	0.27053	0.805	0.49798	D	0.999828	P;D	0.63880	0.94;0.993	P;P	0.59487	0.564;0.858	T	0.76586	-0.2905	10	0.72032	D	0.01	.	18.7212	0.91694	0.0:0.0:1.0:0.0	.	944;287	Q8TD19;Q6PKF2	NEK9_HUMAN;.	F	944	ENSP00000238616:S944F	ENSP00000238616:S944F	S	-	2	0	NEK9	74621129	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.773000	0.62331	2.865000	0.98341	0.655000	0.94253	TCC	NEK9	-	NULL	ENSG00000119638		0.468	NEK9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK9	HGNC	protein_coding	OTTHUMT00000415021.1	276	0.36	1	G	NM_033116		75551376	75551376	-1	no_errors	ENST00000238616	ensembl	human	known	69_37n	missense	222	20.07	56	SNP	1.000	A
OR2T3	343173	genome.wustl.edu	37	1	248637260	248637260	+	Silent	SNP	C	C	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr1:248637260C>A	ENST00000359594.2	+	1	634	c.609C>A	c.(607-609)ctC>ctA	p.L203L		NM_001005495.1	NP_001005495.1	Q8NH03	OR2T3_HUMAN	olfactory receptor, family 2, subfamily T, member 3	203						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(5)|lung(19)|ovary(1)|prostate(1)|skin(3)	31	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ATAAGACGCTCATGTACCTGT	0.522																																						dbGAP											0													213.0	167.0	183.0					1																	248637260		2087	4200	6287	-	-	-	SO:0001819	synonymous_variant	0				CCDS31117.1	1q44	2012-08-09			ENSG00000196539	ENSG00000196539		"""GPCR / Class A : Olfactory receptors"""	14727	protein-coding gene	gene with protein product							Standard	NM_001005495		Approved		uc001iel.1	Q8NH03	OTTHUMG00000040452	ENST00000359594.2:c.609C>A	1.37:g.248637260C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L203	ENST00000359594.2	37	c.609	CCDS31117.1	1																																																																																			OR2T3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196539		0.522	OR2T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T3	HGNC	protein_coding	OTTHUMT00000097348.1	359	0.00	0	C	NM_001005495		248637260	248637260	+1	no_errors	ENST00000359594	ensembl	human	known	69_37n	silent	411	14.49	70	SNP	0.000	A
OXGR1	27199	genome.wustl.edu	37	13	97639726	97639726	+	Silent	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr13:97639726G>A	ENST00000298440.1	-	4	531	c.288C>T	c.(286-288)ggC>ggT	p.G96G	OXGR1_ENST00000543457.1_Silent_p.G96G	NM_080818.3	NP_543008.3	Q96P68	OXGR1_HUMAN	oxoglutarate (alpha-ketoglutarate) receptor 1	96					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|large_intestine(1)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	15	all_neural(89;0.0982)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.186)			TCCAGTTTTCGCCACTGGCAT	0.478																																						dbGAP											0													73.0	67.0	69.0					13																	97639726		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF411109	CCDS9482.1	13q32.2	2014-04-09	2004-07-08	2004-07-09	ENSG00000165621	ENSG00000165621		"""GPCR / Class A : Orphans"""	4531	protein-coding gene	gene with protein product	"""2-oxoglutarate receptor 1"", ""alpha-ketoglutarate receptor 1"""	606922	"""G protein-coupled receptor 80"""	GPR99, GPR80		15141213, 12098360	Standard	NM_080818		Approved	P2RY15, P2Y15, aKGR	uc001vmx.1	Q96P68	OTTHUMG00000017236	ENST00000298440.1:c.288C>T	13.37:g.97639726G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T5A7|Q86TL1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.G96	ENST00000298440.1	37	c.288	CCDS9482.1	13																																																																																			OXGR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000165621		0.478	OXGR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXGR1	HGNC	protein_coding	OTTHUMT00000045521.3	178	0.56	1	G	NM_080818		97639726	97639726	-1	no_errors	ENST00000298440	ensembl	human	known	69_37n	silent	46	53.47	54	SNP	0.000	A
PER1	5187	genome.wustl.edu	37	17	8047052	8047054	+	In_Frame_Del	DEL	CCA	CCA	-			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr17:8047052_8047054delCCA	ENST00000317276.4	-	19	2839_2841	c.2602_2604delTGG	c.(2602-2604)tggdel	p.W868del	PER1_ENST00000581082.1_In_Frame_Del_p.W845del|PER1_ENST00000578089.1_5'UTR	NM_002616.2	NP_002607.2	O15534	PER1_HUMAN	period circadian clock 1	868	Pro-rich.				circadian regulation of gene expression (GO:0032922)|circadian regulation of translation (GO:0097167)|circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|entrainment of circadian clock by photoperiod (GO:0043153)|histone H3 acetylation (GO:0043966)|histone H3 deacetylation (GO:0070932)|histone H4 acetylation (GO:0043967)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|posttranscriptional regulation of gene expression (GO:0010608)|regulation of circadian rhythm (GO:0042752)|regulation of cytokine production involved in inflammatory response (GO:1900015)|regulation of hair cycle (GO:0042634)|regulation of p38MAPK cascade (GO:1900744)|regulation of sodium ion transport (GO:0002028)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|E-box binding (GO:0070888)|kinase binding (GO:0019900)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|signal transducer activity (GO:0004871)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(15)|ovary(4)|pancreas(1)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						GTGGGGTGGGCCAGGGGGTGGAG	0.675			T	ETV6	"""AML, CMML"""			Other conserved DNA damage response genes																														dbGAP		Dom	yes		17	17p13.1-17p12	5187	period homolog 1 (Drosophila)		L	0																																										-	-	-	SO:0001651	inframe_deletion	0			AB002107	CCDS11131.1	17p13.1	2012-12-13	2012-12-13			ENSG00000179094			8845	protein-coding gene	gene with protein product		602260	"""period (Drosophila) homolog 1"", ""period homolog 1 (Drosophila)"""	PER		9323128	Standard	NM_002616		Approved	RIGUI	uc002gkd.3	O15534		ENST00000317276.4:c.2602_2604delTGG	17.37:g.8047052_8047054delCCA	ENSP00000314420:p.Trp868del	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPA8|B4DI49|D3DTR3	In_Frame_Del	DEL	pfam_Period_circadian-like_C,pfam_PAS_fold_3,smart_PAS,pfscan_PAS	p.W868in_frame_del	ENST00000317276.4	37	c.2604_2602	CCDS11131.1	17																																																																																			PER1	-	NULL	ENSG00000179094		0.675	PER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PER1	HGNC	protein_coding	OTTHUMT00000441481.2	31	0.00	0	CCA			8047052	8047054	-1	no_errors	ENST00000317276	ensembl	human	known	69_37n	in_frame_del	3	33.33	2	DEL	1.000:1.000:0.998	-
PIWIL2	55124	genome.wustl.edu	37	8	22136963	22136963	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr8:22136963G>A	ENST00000454009.2	+	2	573	c.64G>A	c.(64-66)Gta>Ata	p.V22I	PIWIL2_ENST00000356766.6_Missense_Mutation_p.V22I|PIWIL2_ENST00000521356.1_Missense_Mutation_p.V22I	NM_001135721.1	NP_001129193.1	Q8TC59	PIWL2_HUMAN	piwi-like RNA-mediated gene silencing 2	22					DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|germ-line stem cell maintenance (GO:0030718)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|oogenesis (GO:0048477)|piRNA metabolic process (GO:0034587)|positive regulation of meiosis I (GO:0060903)|positive regulation of translation (GO:0045727)|RNA 5'-end processing (GO:0000966)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|P granule (GO:0043186)|pi-body (GO:0071546)|polysome (GO:0005844)	mRNA binding (GO:0003729)|piRNA binding (GO:0034584)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(14)|lung(14)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	46				Colorectal(74;0.018)|COAD - Colon adenocarcinoma(73;0.0707)		GTGCCAGGCTGTACGGATGCC	0.577																																						dbGAP											0													121.0	104.0	110.0					8																	22136963		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001213	CCDS6029.1	8p24	2013-02-15	2013-02-15		ENSG00000197181	ENSG00000197181		"""Argonaute/PIWI family"""	17644	protein-coding gene	gene with protein product	"""Hiwi-like"", ""cancer/testis antigen 80"""	610312	"""piwi-like 2 (Drosophila)"""			11279525, 12906857	Standard	NM_018068		Approved	HILI, FLJ10351, Mili, CT80	uc003xbn.2	Q8TC59	OTTHUMG00000097767	ENST00000454009.2:c.64G>A	8.37:g.22136963G>A	ENSP00000406956:p.Val22Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S3|A8K8S5|B0AZN9|B0AZP2|B4DR22|E7ECA4|Q96SW6|Q9NW28	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.V22I	ENST00000454009.2	37	c.64	CCDS6029.1	8	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402379	0.42613	.	.	ENSG00000197181	ENST00000356766;ENST00000521356;ENST00000454009	T;T;T	0.05139	3.51;3.49;3.51	5.93	1.97	0.26223	.	0.196761	0.34725	N	0.003729	T	0.04497	0.0123	L	0.29908	0.895	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.10450	0.003;0.005	T	0.35325	-0.9793	10	0.37606	T	0.19	-1.7544	5.7269	0.18018	0.2481:0.1454:0.6065:0.0	.	22;22	E7ECA4;Q8TC59	.;PIWL2_HUMAN	I	22	ENSP00000349208:V22I;ENSP00000428267:V22I;ENSP00000406956:V22I	ENSP00000349208:V22I	V	+	1	0	PIWIL2	22192908	0.540000	0.26410	0.295000	0.24960	0.836000	0.47400	0.918000	0.28678	0.839000	0.34971	0.655000	0.94253	GTA	PIWIL2	-	NULL	ENSG00000197181		0.577	PIWIL2-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	PIWIL2	HGNC	protein_coding	OTTHUMT00000375438.1	139	0.00	0	G			22136963	22136963	+1	no_errors	ENST00000356766	ensembl	human	known	69_37n	missense	49	28.57	20	SNP	0.048	A
PLIN1	5346	genome.wustl.edu	37	15	90212738	90212738	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr15:90212738A>T	ENST00000300055.5	-	6	929	c.764T>A	c.(763-765)gTg>gAg	p.V255E	PLIN1_ENST00000430628.2_Missense_Mutation_p.V255E	NM_002666.4	NP_002657.3	O60240	PLIN1_HUMAN	perilipin 1	255					lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|lipid particle (GO:0005811)	lipid binding (GO:0008289)			NS(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(2)	13						TACCAGGGGCACCACGCCTGG	0.662																																						dbGAP											0													51.0	50.0	50.0					15																	90212738		2200	4299	6499	-	-	-	SO:0001583	missense	0			AB005293	CCDS10353.1	15q26	2009-08-12	2009-08-12	2009-08-12	ENSG00000166819	ENSG00000166819		"""Perilipins"""	9076	protein-coding gene	gene with protein product		170290	"""perilipin"""	PLIN		9521880, 19638644	Standard	NM_002666		Approved		uc010upx.1	O60240	OTTHUMG00000149813	ENST00000300055.5:c.764T>A	15.37:g.90212738A>T	ENSP00000300055:p.Val255Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5Y6	Missense_Mutation	SNP	pfam_Perilipin,pirsf_Perilipin	p.V255E	ENST00000300055.5	37	c.764	CCDS10353.1	15	.	.	.	.	.	.	.	.	.	.	A	9.025	0.985901	0.18889	.	.	ENSG00000166819	ENST00000300055;ENST00000430628	T;T	0.07021	3.23;3.23	5.2	4.28	0.50868	.	0.486277	0.21562	N	0.072557	T	0.07234	0.0183	L	0.27053	0.805	0.28701	N	0.904094	B	0.26147	0.143	B	0.27380	0.079	T	0.13522	-1.0506	10	0.59425	D	0.04	-12.6849	10.0635	0.42288	0.0946:0.0:0.9054:0.0	.	255	O60240	PLIN1_HUMAN	E	255	ENSP00000300055:V255E;ENSP00000402167:V255E	ENSP00000300055:V255E	V	-	2	0	PLIN1	88013742	0.675000	0.27558	0.883000	0.34634	0.051000	0.14879	0.968000	0.29357	1.189000	0.43028	-0.414000	0.06135	GTG	PLIN1	-	pfam_Perilipin,pirsf_Perilipin	ENSG00000166819		0.662	PLIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLIN1	HGNC	protein_coding	OTTHUMT00000313424.2	44	0.00	0	A	NM_002666		90212738	90212738	-1	no_errors	ENST00000300055	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.933	T
PLXDC2	84898	genome.wustl.edu	37	10	20357104	20357104	+	Silent	SNP	G	G	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr10:20357104G>T	ENST00000377252.4	+	4	1318	c.477G>T	c.(475-477)gtG>gtT	p.V159V	PLXDC2_ENST00000377238.2_3'UTR|PLXDC2_ENST00000377242.3_Silent_p.V110V|RP11-575A19.2_ENST00000451584.1_RNA	NM_001282736.1|NM_032812.7	NP_001269665.1|NP_116201.7	Q6UX71	PXDC2_HUMAN	plexin domain containing 2	159					multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|liver(1)|lung(9)|ovary(2)|skin(3)|stomach(1)	34						TGCAGAGAGTGAATCTGTCCT	0.383																																						dbGAP											0													118.0	108.0	111.0					10																	20357104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF378757	CCDS7132.1, CCDS60497.1	10p12.33	2006-04-12			ENSG00000120594	ENSG00000120594			21013	protein-coding gene	gene with protein product	"""tumor endothelial marker 7-related precursor"""	606827				11559528	Standard	NM_001282736		Approved	TEM7R, FLJ14623	uc001iqg.1	Q6UX71	OTTHUMG00000017781	ENST00000377252.4:c.477G>T	10.37:g.20357104G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96E59|Q96PD9|Q96SU9	Silent	SNP	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	p.V159	ENST00000377252.4	37	c.477	CCDS7132.1	10																																																																																			PLXDC2	-	NULL	ENSG00000120594		0.383	PLXDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXDC2	HGNC	protein_coding	OTTHUMT00000047101.2	270	0.00	0	G	NM_032812		20357104	20357104	+1	no_errors	ENST00000377252	ensembl	human	known	69_37n	silent	173	39.51	113	SNP	1.000	T
RCOR2	283248	genome.wustl.edu	37	11	63683048	63683048	+	Missense_Mutation	SNP	C	C	A	rs143904903	byFrequency	TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr11:63683048C>A	ENST00000301459.4	-	2	550	c.163G>T	c.(163-165)Gta>Tta	p.V55L		NM_173587.3	NP_775858.2	Q8IZ40	RCOR2_HUMAN	REST corepressor 2	55	ELM2. {ECO:0000255|PROSITE- ProRule:PRU00512}.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromatin (GO:0000785)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			kidney(2)|large_intestine(3)|liver(1)|lung(5)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	17						TCCGGAATTACGGCCTGGTAA	0.687																																						dbGAP											0													25.0	20.0	22.0					11																	63683048		2186	4281	6467	-	-	-	SO:0001583	missense	0			BC010608	CCDS8052.1	11q13.1	2008-02-05			ENSG00000167771	ENSG00000167771			27455	protein-coding gene	gene with protein product						12477932	Standard	NM_173587		Approved		uc001nyc.3	Q8IZ40	OTTHUMG00000150472	ENST00000301459.4:c.163G>T	11.37:g.63683048C>A	ENSP00000301459:p.Val55Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96FP3	Missense_Mutation	SNP	pfam_SANT/Myb,pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.V55L	ENST00000301459.4	37	c.163	CCDS8052.1	11	.	.	.	.	.	.	.	.	.	.	C	12.44	1.938714	0.34189	.	.	ENSG00000167771	ENST00000301459	T	0.30448	1.53	4.51	3.56	0.40772	ELM2 domain (2);	0.398566	0.24783	N	0.035625	T	0.27419	0.0673	L	0.60455	1.87	0.29440	N	0.859193	B	0.31227	0.314	B	0.31016	0.123	T	0.14337	-1.0476	10	0.29301	T	0.29	.	8.7841	0.34809	0.1706:0.6643:0.1651:0.0	.	55	Q8IZ40	RCOR2_HUMAN	L	55	ENSP00000301459:V55L	ENSP00000301459:V55L	V	-	1	0	RCOR2	63439624	0.988000	0.35896	0.978000	0.43139	0.990000	0.78478	2.487000	0.45268	0.963000	0.38082	0.462000	0.41574	GTA	RCOR2	-	pfam_ELM2_dom,pfscan_ELM2_dom	ENSG00000167771		0.687	RCOR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCOR2	HGNC	protein_coding	OTTHUMT00000318233.1	30	0.00	0	C	NM_173587		63683048	63683048	-1	no_errors	ENST00000301459	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.931	A
ROR2	4920	genome.wustl.edu	37	9	94487328	94487328	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr9:94487328C>T	ENST00000375708.3	-	9	1646	c.1448G>A	c.(1447-1449)cGg>cAg	p.R483Q	ROR2_ENST00000550066.1_5'UTR|ROR2_ENST00000375715.1_Missense_Mutation_p.R343Q	NM_004560.3	NP_004551.2	Q01974	ROR2_HUMAN	receptor tyrosine kinase-like orphan receptor 2	483	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|embryonic genitalia morphogenesis (GO:0030538)|inner ear morphogenesis (GO:0042472)|JNK cascade (GO:0007254)|multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)|somitogenesis (GO:0001756)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	clathrin-coated endocytic vesicle membrane (GO:0030669)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|Wnt-protein binding (GO:0017147)			autonomic_ganglia(1)|breast(1)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	71						TTTCCCAAACCGGTCCTCTCC	0.577																																						dbGAP											0													201.0	230.0	220.0					9																	94487328		2203	4300	6503	-	-	-	SO:0001583	missense	0			M97639	CCDS6691.1	9q22	2013-01-11			ENSG00000169071	ENSG00000169071		"""Immunoglobulin superfamily / I-set domain containing"""	10257	protein-coding gene	gene with protein product		602337		NTRKR2, BDB, BDB1		1334494, 10700182	Standard	NM_004560		Approved		uc004arj.2	Q01974	OTTHUMG00000020211	ENST00000375708.3:c.1448G>A	9.37:g.94487328C>T	ENSP00000364860:p.Arg483Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GF5|Q5SPI5|Q9HAY7|Q9HB61	Missense_Mutation	SNP	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Kringle,pfam_Frizzled_dom,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Kringle-like,superfamily_Frizzled_dom,smart_Ig_sub,smart_Ig_sub2,smart_Kringle,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Frizzled_dom,pfscan_Kringle,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R483Q	ENST00000375708.3	37	c.1448	CCDS6691.1	9	.	.	.	.	.	.	.	.	.	.	C	12.72	2.021834	0.35701	.	.	ENSG00000169071	ENST00000375715;ENST00000375708	D;D	0.89050	-2.46;-2.46	4.47	4.47	0.54385	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.39909	N	0.001233	T	0.63850	0.2546	N	0.00569	-1.365	0.58432	D	0.999999	P;B	0.51449	0.945;0.045	B;B	0.33960	0.173;0.013	T	0.77156	-0.2691	10	0.59425	D	0.04	.	12.1984	0.54311	0.0:0.9174:0.0:0.0826	.	483;343	Q01974;B1APY4	ROR2_HUMAN;.	Q	343;483	ENSP00000364867:R343Q;ENSP00000364860:R483Q	ENSP00000364860:R483Q	R	-	2	0	ROR2	93527149	0.989000	0.36119	0.997000	0.53966	0.761000	0.43186	2.816000	0.48026	2.478000	0.83669	0.491000	0.48974	CGG	ROR2	-	pirsf_Tyr_kinase_rcpt_ROR,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169071		0.577	ROR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROR2	HGNC	protein_coding	OTTHUMT00000053040.1	127	0.00	0	C			94487328	94487328	-1	no_errors	ENST00000375708	ensembl	human	known	69_37n	missense	50	37.35	31	SNP	0.981	T
KHNYN	23351	genome.wustl.edu	37	14	24910979	24910980	+	IGR	INS	-	-	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr14:24910979_24910980insT	ENST00000251343.5	+	0	6225				SDR39U1_ENST00000538105.2_Intron|SDR39U1_ENST00000555561.1_5'Flank|SDR39U1_ENST00000554698.1_Intron|SDR39U1_ENST00000555365.1_5'UTR|SDR39U1_ENST00000553930.1_5'UTR|SDR39U1_ENST00000399395.3_Frame_Shift_Ins_p.E77fs|SDR39U1_ENST00000399390.1_5'Flank			O15037	KHNYN_HUMAN	KH and NYN domain containing								RNA binding (GO:0003723)			kidney(1)|large_intestine(3)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(3)	24						CCGATTACCTCTTTTTGGAAGG	0.495																																						dbGAP											0																																										-	-	-	SO:0001628	intergenic_variant	0			AB002321	CCDS32058.1	14q11.2	2010-11-23	2009-10-14	2009-10-14	ENSG00000100441	ENSG00000100441			20166	protein-coding gene	gene with protein product			"""KIAA0323"""	KIAA0323		17114934	Standard	NM_015299		Approved		uc001wph.4	O15037			14.37:g.24910984_24910984dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86TZ6|Q8IUQ2|Q96BA9	Frame_Shift_Ins	INS	pfam_DUF1731_C,pfam_Epimerase_deHydtase,tigrfam_Sugar_nucleotide_Epase_put	p.E76fs	ENST00000251343.5	37	c.229_228	CCDS32058.1	14																																																																																			SDR39U1	-	pfam_Epimerase_deHydtase,tigrfam_Sugar_nucleotide_Epase_put	ENSG00000100445		0.495	KHNYN-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SDR39U1	HGNC	protein_coding	OTTHUMT00000412928.1	200	0.00	0	-			24910979	24910980	-1	no_errors	ENST00000399395	ensembl	human	known	69_37n	frame_shift_ins	164	19.21	39	INS	1.000:0.994	T
RPL23A	6147	genome.wustl.edu	37	17	27047625	27047625	+	Intron	SNP	A	A	G			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr17:27047625A>G	ENST00000422514.2	+	2	638				AC010761.8_ENST00000582718.1_RNA|SNORD42B_ENST00000458893.1_RNA|RPL23A_ENST00000472628.1_5'UTR|SNORD42A_ENST00000459584.1_RNA|RAB34_ENST00000447716.1_5'Flank|RAB34_ENST00000301043.6_5'Flank|RPL23A_ENST00000496182.1_Intron|RAB34_ENST00000453384.3_5'Flank|RAB34_ENST00000395243.3_5'Flank|RAB34_ENST00000395242.2_5'Flank|RAB34_ENST00000415040.2_5'Flank|RAB34_ENST00000395245.3_5'Flank|RAB34_ENST00000450529.1_5'Flank|SNORD4A_ENST00000459174.1_RNA|RAB34_ENST00000436730.3_5'Flank|RPL23A_ENST00000394938.4_Intron	NM_000984.5	NP_000975.2	P62750	RL23A_HUMAN	ribosomal protein L23a						cell proliferation (GO:0008283)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|rRNA binding (GO:0019843)|structural constituent of ribosome (GO:0003735)			endometrium(1)|lung(3)|ovary(1)	5	Lung NSC(42;0.00431)					CAAAGGAACCACTGATGCACC	0.502											OREG0024282	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													112.0	112.0	112.0					17																	27047625		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			U43701	CCDS11241.1	17q11.2	2011-04-06			ENSG00000198242	ENSG00000198242		"""L ribosomal proteins"""	10317	protein-coding gene	gene with protein product		602326				9417910	Standard	NM_000984		Approved	L23A	uc002hci.3	P62750	OTTHUMG00000132684	ENST00000422514.2:c.26-100A>G	17.37:g.27047625A>G		Somatic	791	WXS	Illumina GAIIx	Phase_IV	B2R5B2|P29316|P39024|Q92774	RNA	SNP	-	NULL	ENST00000422514.2	37	NULL	CCDS11241.1	17																																																																																			SNORD42B	-	-	ENSG00000238423		0.502	RPL23A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD42B	HGNC	protein_coding	OTTHUMT00000255975.1	374	0.00	0	A	NM_000984		27047625	27047625	+1	no_errors	ENST00000458893	ensembl	human	known	69_37n	rna	307	29.20	127	SNP	0.944	G
TMEM132D	121256	genome.wustl.edu	37	12	129559467	129559467	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr12:129559467G>T	ENST00000422113.2	-	9	2579	c.2253C>A	c.(2251-2253)ttC>ttA	p.F751L	TMEM132D_ENST00000389441.4_Missense_Mutation_p.F289L	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	751					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		TAGGCCACTTGAATTTGGGGT	0.488																																						dbGAP											0													111.0	102.0	105.0					12																	129559467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.2253C>A	12.37:g.129559467G>T	ENSP00000408581:p.Phe751Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.F751L	ENST00000422113.2	37	c.2253	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	G	5.959	0.360878	0.11296	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.08984	3.03;3.82	4.2	3.3	0.37823	.	0.325934	0.29956	N	0.010773	T	0.05181	0.0138	L	0.27053	0.805	0.26591	N	0.973199	B;B	0.09022	0.002;0.002	B;B	0.11329	0.006;0.005	T	0.37033	-0.9723	9	.	.	.	-23.3803	4.8851	0.13699	0.1803:0.0:0.6497:0.17	.	751;289	Q14C87;Q14C87-2	T132D_HUMAN;.	L	289;751	ENSP00000374092:F289L;ENSP00000408581:F751L	.	F	-	3	2	TMEM132D	128125420	1.000000	0.71417	0.910000	0.35882	0.632000	0.37999	2.343000	0.44001	0.868000	0.35678	0.462000	0.41574	TTC	TMEM132D	-	NULL	ENSG00000151952		0.488	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	198	0.00	0	G	NM_133448		129559467	129559467	-1	no_errors	ENST00000422113	ensembl	human	known	69_37n	missense	123	18.42	28	SNP	0.882	T
TRPC7	57113	genome.wustl.edu	37	5	135587470	135587470	+	Silent	SNP	G	G	A	rs368396777		TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr5:135587470G>A	ENST00000513104.1	-	6	1728	c.1446C>T	c.(1444-1446)ttC>ttT	p.F482F	TRPC7_ENST00000426057.2_Silent_p.F366F|TRPC7_ENST00000355180.3_Silent_p.F421F	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	482					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)			NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			AGGAGGCCACGAAGATGGACA	0.572																																						dbGAP											0													78.0	86.0	83.0					5																	135587470		2122	4244	6366	-	-	-	SO:0001819	synonymous_variant	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.1446C>T	5.37:g.135587470G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.R427C	ENST00000513104.1	37	c.1279	CCDS47267.2	5	.	.	.	.	.	.	.	.	.	.	G	9.650	1.141258	0.21205	.	.	ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753	.	.	.	4.91	0.892	0.19230	.	.	.	.	.	T	0.59224	0.2178	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54761	-0.8245	4	.	.	.	-21.3137	11.176	0.48598	0.3641:0.0:0.6359:0.0	.	.	.	.	C	366;421;427	.	.	R	-	1	0	TRPC7	135615369	0.062000	0.20869	1.000000	0.80357	0.995000	0.86356	-0.640000	0.05440	0.291000	0.22468	-0.143000	0.13931	CGT	TRPC7	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel,tigrfam_TRP_channel	ENSG00000069018		0.572	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	68	0.00	0	G	NM_020389		135587470	135587470	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000502753	ensembl	human	novel	69_37n	missense	36	52.63	40	SNP	0.992	A
ZNF391	346157	genome.wustl.edu	37	6	27368399	27368399	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18L-01A-32D-A12B-09	TCGA-BH-A18L-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	883cd3c9-2681-4822-8b22-29149a027514	dc231f7a-c0b8-4639-9885-06ec9a0405a0	g.chr6:27368399C>G	ENST00000244576.4	+	3	795	c.250C>G	c.(250-252)Cca>Gca	p.P84A		NM_001076781.1	NP_001070249.1	Q9UJN7	ZN391_HUMAN	zinc finger protein 391	84					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|large_intestine(6)|lung(7)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	21						ACATGGATCCCCAATATCTAG	0.378																																						dbGAP											0													74.0	69.0	70.0					6																	27368399		1832	4090	5922	-	-	-	SO:0001583	missense	0			BC132797	CCDS43429.1	6p21	2013-01-08			ENSG00000124613	ENSG00000124613		"""Zinc fingers, C2H2-type"""	18779	protein-coding gene	gene with protein product							Standard	NM_001076781		Approved	dJ153G14.3	uc003njf.1	Q9UJN7	OTTHUMG00000014477	ENST00000244576.4:c.250C>G	6.37:g.27368399C>G	ENSP00000244576:p.Pro84Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DH77	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P84A	ENST00000244576.4	37	c.250	CCDS43429.1	6	.	.	.	.	.	.	.	.	.	.	C	7.315	0.615874	0.14129	.	.	ENSG00000124613	ENST00000244576;ENST00000461521	T;T	0.07567	3.18;6.02	4.06	-0.119	0.13543	.	.	.	.	.	T	0.02193	0.0068	M	0.71206	2.165	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47560	-0.9108	9	0.12103	T	0.63	.	2.7767	0.05349	0.3427:0.3577:0.0:0.2996	.	84	Q9UJN7	ZN391_HUMAN	A	84	ENSP00000244576:P84A;ENSP00000419498:P84A	ENSP00000244576:P84A	P	+	1	0	ZNF391	27476378	0.000000	0.05858	0.001000	0.08648	0.042000	0.13812	0.061000	0.14366	0.039000	0.15632	0.655000	0.94253	CCA	ZNF391	-	NULL	ENSG00000124613		0.378	ZNF391-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF391	HGNC	protein_coding	OTTHUMT00000040145.2	125	0.00	0	C	NM_001076781		27368399	27368399	+1	no_errors	ENST00000244576	ensembl	human	known	69_37n	missense	141	14.55	24	SNP	0.000	G
