#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A1CF	29974	genome.wustl.edu	37	10	52595937	52595937	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr10:52595937G>A	ENST00000373993.1	-	4	545	c.501C>T	c.(499-501)atC>atT	p.I167I	A1CF_ENST00000395495.1_Silent_p.I167I|A1CF_ENST00000395489.2_Silent_p.I160I|A1CF_ENST00000282641.2_Silent_p.I167I|A1CF_ENST00000373997.3_Silent_p.I167I|A1CF_ENST00000374001.2_Silent_p.I167I|A1CF_ENST00000373995.3_Silent_p.I175I			Q9NQ94	A1CF_HUMAN	APOBEC1 complementation factor	167	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytidine to uridine editing (GO:0016554)|gene expression (GO:0010467)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|protein stabilization (GO:0050821)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|single-stranded RNA binding (GO:0003727)			NS(1)|breast(1)|central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(14)|prostate(2)|skin(3)	29						TTGGGTAGACGATGACATCGA	0.468																																						dbGAP											0													169.0	160.0	163.0					10																	52595937		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF271790	CCDS7241.1, CCDS7242.1, CCDS7243.1, CCDS73133.1	10q21.1	2013-02-12			ENSG00000148584	ENSG00000148584		"""RNA binding motif (RRM) containing"""	24086	protein-coding gene	gene with protein product						11815617, 11072063	Standard	NM_014576		Approved	ACF, ASP, ACF64, ACF65, APOBEC1CF	uc001jjj.3	Q9NQ94	OTTHUMG00000018240	ENST00000373993.1:c.501C>T	10.37:g.52595937G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4F2|A8K7G7|B7ZM14|Q5SZQ0|Q9NQ93|Q9NQX8|Q9NQX9|Q9NXC9|Q9NZD3	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.I167	ENST00000373993.1	37	c.501	CCDS7242.1	10																																																																																			A1CF	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	ENSG00000148584		0.468	A1CF-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	A1CF	HGNC	protein_coding	OTTHUMT00000048086.2	239	0.00	0	G	NM_014576		52595937	52595937	-1	no_errors	ENST00000282641	ensembl	human	known	69_37n	silent	174	17.06	36	SNP	0.615	A
ABCA12	26154	genome.wustl.edu	37	2	215815648	215815648	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:215815648C>G	ENST00000272895.7	-	45	7026	c.6807G>C	c.(6805-6807)aaG>aaC	p.K2269N	AC072062.1_ENST00000607412.1_RNA|ABCA12_ENST00000389661.4_Missense_Mutation_p.K1951N	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2269	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		CAGCTATAATCTTTTTGTGGA	0.403																																					Ovarian(66;664 1488 5121 34295)	dbGAP											0													159.0	157.0	158.0					2																	215815648		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6807G>C	2.37:g.215815648C>G	ENSP00000272895:p.Lys2269Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.K2269N	ENST00000272895.7	37	c.6807	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	C	13.51	2.258605	0.39896	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	T;T	0.76186	-1.0;-1.0	5.61	5.61	0.85477	ABC transporter-like (1);	0.092747	0.45606	D	0.000360	T	0.65207	0.2669	L	0.41492	1.28	0.80722	D	1	B;B	0.11235	0.001;0.004	B;B	0.16289	0.003;0.015	T	0.60193	-0.7311	10	0.37606	T	0.19	.	11.2304	0.48910	0.1325:0.7228:0.1447:0.0	.	2269;1951	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	N	2269;1951	ENSP00000272895:K2269N;ENSP00000374312:K1951N	ENSP00000272895:K2269N	K	-	3	2	ABCA12	215523893	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.667000	0.37471	2.639000	0.89480	0.555000	0.69702	AAG	ABCA12	-	pfscan_ABC_transporter-like	ENSG00000144452		0.403	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	432	0.00	0	C	NM_173076		215815648	215815648	-1	no_errors	ENST00000272895	ensembl	human	known	69_37n	missense	359	18.04	79	SNP	1.000	G
ABL2	27	genome.wustl.edu	37	1	179095776	179095776	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:179095776C>T	ENST00000502732.1	-	4	626	c.423G>A	c.(421-423)caG>caA	p.Q141Q	ABL2_ENST00000344730.3_Silent_p.Q126Q|ABL2_ENST00000507173.1_Silent_p.Q120Q|ABL2_ENST00000392043.3_Silent_p.Q120Q|ABL2_ENST00000367623.4_Silent_p.Q120Q|ABL2_ENST00000512653.1_Silent_p.Q126Q|ABL2_ENST00000504405.1_Silent_p.Q105Q|ABL2_ENST00000408940.3_Silent_p.Q105Q|ABL2_ENST00000511413.1_Silent_p.Q141Q	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	141	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	ACTCACCATTCTGGTTGTAAC	0.468			T	ETV6	AML																																	dbGAP		Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0													82.0	66.0	71.0					1																	179095776		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.423G>A	1.37:g.179095776C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.Q141	ENST00000502732.1	37	c.423	CCDS30947.1	1																																																																																			ABL2	-	pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000143322		0.468	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	HGNC	protein_coding	OTTHUMT00000085174.3	70	0.00	0	C	NM_005158		179095776	179095776	-1	no_errors	ENST00000502732	ensembl	human	known	69_37n	silent	82	36.43	47	SNP	1.000	T
ACAT1	38	genome.wustl.edu	37	11	108002665	108002665	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:108002665C>T	ENST00000265838.4	+	2	195	c.104C>T	c.(103-105)tCa>tTa	p.S35L	ACAT1_ENST00000526119.1_3'UTR|ACAT1_ENST00000299355.6_Missense_Mutation_p.S35L	NM_000019.3	NP_000010.1	P24752	THIL_HUMAN	acetyl-CoA acetyltransferase 1	35					adipose tissue development (GO:0060612)|brain development (GO:0007420)|branched-chain amino acid catabolic process (GO:0009083)|cellular ketone body metabolic process (GO:0046950)|cellular lipid metabolic process (GO:0044255)|cellular nitrogen compound metabolic process (GO:0034641)|ketone body biosynthetic process (GO:0046951)|ketone body catabolic process (GO:0046952)|liver development (GO:0001889)|metanephric proximal convoluted tubule development (GO:0072229)|protein homooligomerization (GO:0051260)|response to hormone (GO:0009725)|response to organic cyclic compound (GO:0014070)|response to starvation (GO:0042594)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	acetyl-CoA C-acetyltransferase activity (GO:0003985)|coenzyme binding (GO:0050662)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(3)|ovary(3)|prostate(2)	10		all_cancers(61;6.41e-10)|all_epithelial(67;2.83e-06)|Melanoma(852;1.46e-05)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;2.96e-05)|Epithelial(105;4.35e-05)|all cancers(92;0.00108)|OV - Ovarian serous cystadenocarcinoma(223;0.192)	Sulfasalazine(DB00795)	AGTTATGTATCAAAACCCACT	0.224																																						dbGAP											0													38.0	44.0	42.0					11																	108002665		2178	4264	6442	-	-	-	SO:0001583	missense	0			D90228	CCDS8339.1	11q22.3	2010-04-30	2010-04-30		ENSG00000075239	ENSG00000075239	2.3.1.9		93	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	607809	"""acetyl-Coenzyme A acetyltransferase 1"""	ACAT		1979337	Standard	NM_000019		Approved	THIL	uc001pjy.3	P24752	OTTHUMG00000166381	ENST00000265838.4:c.104C>T	11.37:g.108002665C>T	ENSP00000265838:p.Ser35Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6H1|G3XAB4|Q96FG8	Missense_Mutation	SNP	pfam_Thiolase_N,pfam_Thiolase_C,pfam_Ketoacyl_synth_N,superfamily_Thiolase-like,pirsf_Thiolase,tigrfam_Thiolase	p.S35L	ENST00000265838.4	37	c.104	CCDS8339.1	11	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156190	0.38021	.	.	ENSG00000075239	ENST00000265838;ENST00000299355	D;D	0.93307	-3.05;-3.2	4.96	4.05	0.47172	.	0.281721	0.34879	N	0.003615	D	0.84705	0.5531	N	0.08118	0	0.46478	D	0.999061	B;B	0.16166	0.002;0.016	B;B	0.22880	0.008;0.042	T	0.79720	-0.1685	10	0.40728	T	0.16	0.9581	10.735	0.46120	0.0:0.9108:0.0:0.0892	.	35;35	P24752;G3XAB4	THIL_HUMAN;.	L	35	ENSP00000265838:S35L;ENSP00000299355:S35L	ENSP00000265838:S35L	S	+	2	0	ACAT1	107507875	0.998000	0.40836	0.977000	0.42913	0.692000	0.40212	1.825000	0.39081	1.320000	0.45209	0.467000	0.42956	TCA	ACAT1	-	NULL	ENSG00000075239		0.224	ACAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT1	HGNC	protein_coding	OTTHUMT00000389474.1	85	0.00	0	C	NM_000019		108002665	108002665	+1	no_errors	ENST00000265838	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.991	T
ADAM21	8747	genome.wustl.edu	37	14	70924304	70924304	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:70924304C>G	ENST00000603540.1	+	2	346	c.88C>G	c.(88-90)Cag>Gag	p.Q30E	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.Q30E	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	30					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CGGCTACTGTCAGGCTGGGCC	0.547																																						dbGAP											0													102.0	109.0	107.0					14																	70924304		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.88C>G	14.37:g.70924304C>G	ENSP00000474385:p.Gln30Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q30E	ENST00000603540.1	37	c.88	CCDS9804.1	14	.	.	.	.	.	.	.	.	.	.	C	9.199	1.027981	0.19512	.	.	ENSG00000139985	ENST00000267499	T	0.01106	5.33	3.77	0.309	0.15820	.	0.528246	0.14239	N	0.332223	T	0.00637	0.0021	N	0.08118	0	0.09310	N	1	B	0.27316	0.175	B	0.28553	0.091	T	0.47560	-0.9108	10	0.16896	T	0.51	.	2.9505	0.05860	0.2679:0.3782:0.2638:0.0901	.	30	Q9UKJ8	ADA21_HUMAN	E	30	ENSP00000267499:Q30E	ENSP00000267499:Q30E	Q	+	1	0	ADAM21	69994057	0.000000	0.05858	0.004000	0.12327	0.004000	0.04260	-0.024000	0.12435	0.301000	0.22738	0.563000	0.77884	CAG	ADAM21	-	NULL	ENSG00000139985		0.547	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	194	0.00	0	C			70924304	70924304	+1	no_errors	ENST00000267499	ensembl	human	known	69_37n	missense	192	17.95	42	SNP	0.000	G
ADAM21	8747	genome.wustl.edu	37	14	70924844	70924844	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:70924844C>T	ENST00000603540.1	+	2	886	c.628C>T	c.(628-630)Ctg>Ttg	p.L210L	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Silent_p.L210L	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	210	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		TGCATGGTTTCTGGAGCTAGT	0.438																																						dbGAP											0													63.0	67.0	66.0					14																	70924844		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.628C>T	14.37:g.70924844C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O43507|Q2VPC6|Q32MR0	Silent	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.L210	ENST00000603540.1	37	c.628	CCDS9804.1	14																																																																																			ADAM21	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000139985		0.438	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	106	0.00	0	C			70924844	70924844	+1	no_errors	ENST00000267499	ensembl	human	known	69_37n	silent	98	22.83	29	SNP	0.997	T
ACOT1	641371	genome.wustl.edu	37	14	74010102	74010102	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:74010102G>A	ENST00000311148.4	+	3	1317	c.1009G>A	c.(1009-1011)Gag>Aag	p.E337K	ACOT1_ENST00000557556.1_Missense_Mutation_p.E311K|HEATR4_ENST00000553558.1_Intron|HEATR4_ENST00000560393.1_Intron|HEATR4_ENST00000334988.2_Intron	NM_001037161.1	NP_001032238.1	Q86TX2	ACOT1_HUMAN	acyl-CoA thioesterase 1	337					acyl-CoA metabolic process (GO:0006637)|long-chain fatty acid metabolic process (GO:0001676)|very long-chain fatty acid metabolic process (GO:0000038)	cytosol (GO:0005829)	acyl-CoA hydrolase activity (GO:0047617)|carboxylic ester hydrolase activity (GO:0052689)|palmitoyl-CoA hydrolase activity (GO:0016290)			endometrium(1)|large_intestine(1)|lung(2)	4				OV - Ovarian serous cystadenocarcinoma(108;1.37e-45)|BRCA - Breast invasive adenocarcinoma(234;0.0033)		CTATGCTAATGAGGCCTGTAA	0.522																																						dbGAP											0													6.0	5.0	5.0					14																	74010102		1882	3766	5648	-	-	-	SO:0001583	missense	0			DQ082754	CCDS32117.1	14q24.3	2013-09-20			ENSG00000184227	ENSG00000184227		"""Acyl CoA thioesterases"""	33128	protein-coding gene	gene with protein product		614313				16103133, 16940157	Standard	NM_001037161		Approved	ACH2, CTE-1, LACH2		Q86TX2	OTTHUMG00000171607	ENST00000311148.4:c.1009G>A	14.37:g.74010102G>A	ENSP00000311224:p.Glu337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L173|Q3I5F9	Missense_Mutation	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pfam_Dienelactn_hydro,pirsf_Acyl-CoA_thioEstase_long-chain	p.E337K	ENST00000311148.4	37	c.1009	CCDS32117.1	14	.	.	.	.	.	.	.	.	.	.	-	1.445	-0.566503	0.03910	.	.	ENSG00000184227	ENST00000311148;ENST00000557556	T;T	0.42131	0.98;0.98	3.91	3.0	0.34707	BAAT/Acyl-CoA thioester hydrolase C-terminal (1);	0.572326	0.19845	N	0.104772	T	0.34600	0.0903	L	0.53249	1.67	0.21740	N	0.999561	B	0.13594	0.008	B	0.21708	0.036	T	0.34925	-0.9809	10	0.02654	T	1	-24.411	13.7978	0.63182	0.0:0.1551:0.8449:0.0	.	337	Q86TX2	ACOT1_HUMAN	K	337;311	ENSP00000311224:E337K;ENSP00000451764:E311K	ENSP00000311224:E337K	E	+	1	0	ACOT1	73079855	0.001000	0.12720	0.681000	0.30009	0.853000	0.48598	0.930000	0.28858	0.979000	0.38497	0.393000	0.25936	GAG	ACOT1	-	pfam_BAAT_C,pfam_Dienelactn_hydro,pirsf_Acyl-CoA_thioEstase_long-chain	ENSG00000184227		0.522	ACOT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACOT1	HGNC	protein_coding	OTTHUMT00000414432.1	47	0.00	0	G	NM_001037161		74010102	74010102	+1	no_errors	ENST00000311148	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.239	A
ADCY7	113	genome.wustl.edu	37	16	50341017	50341017	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:50341017C>G	ENST00000394697.2	+	15	2149	c.1809C>G	c.(1807-1809)atC>atG	p.I603M	ADCY7_ENST00000566433.2_Missense_Mutation_p.I603M|ADCY7_ENST00000538642.1_Missense_Mutation_p.I603M|ADCY7_ENST00000254235.3_Missense_Mutation_p.I603M|ADCY7_ENST00000537579.1_3'UTR			P51828	ADCY7_HUMAN	adenylate cyclase 7	603					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to ethanol (GO:0071361)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|maternal process involved in female pregnancy (GO:0060135)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of cAMP biosynthetic process (GO:0030819)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(5)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(3)	35		all_cancers(37;0.0127)		GBM - Glioblastoma multiforme(240;0.195)		CCAGCCTGATCTTCGTCTGCA	0.677																																						dbGAP											0													57.0	50.0	52.0					16																	50341017		2198	4300	6498	-	-	-	SO:0001583	missense	0			D25538	CCDS10741.1, CCDS73882.1	16q12.1	2013-02-04			ENSG00000121281	ENSG00000121281	4.6.1.1	"""Adenylate cyclases"""	238	protein-coding gene	gene with protein product		600385				7860067	Standard	NM_001286057		Approved	KIAA0037, AC7	uc002egd.1	P51828	OTTHUMG00000133172	ENST00000394697.2:c.1809C>G	16.37:g.50341017C>G	ENSP00000378187:p.Ile603Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVA6	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.I603M	ENST00000394697.2	37	c.1809	CCDS10741.1	16	.	.	.	.	.	.	.	.	.	.	C	9.395	1.076631	0.20227	.	.	ENSG00000121281	ENST00000538642;ENST00000394697;ENST00000254235	T;D;D	0.83992	0.73;-1.79;-1.79	4.76	0.348	0.16026	.	0.441048	0.15548	U	0.256590	D	0.84165	0.5412	L	0.49126	1.545	0.80722	D	1	P;D	0.61697	0.852;0.99	P;D	0.68621	0.792;0.959	T	0.78523	-0.2171	10	0.59425	D	0.04	.	3.3721	0.07224	0.1748:0.393:0.2958:0.1364	.	603;603	P51828;F5H4D1	ADCY7_HUMAN;.	M	603	ENSP00000445046:I603M;ENSP00000378187:I603M;ENSP00000254235:I603M	ENSP00000254235:I603M	I	+	3	3	ADCY7	48898518	0.880000	0.30214	0.006000	0.13384	0.000000	0.00434	-0.059000	0.11731	-0.340000	0.08388	-2.511000	0.00188	ATC	ADCY7	-	NULL	ENSG00000121281		0.677	ADCY7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY7	HGNC	protein_coding	OTTHUMT00000256877.3	109	0.00	0	C			50341017	50341017	+1	no_errors	ENST00000254235	ensembl	human	known	69_37n	missense	31	32.61	15	SNP	0.440	G
AKAP9	10142	genome.wustl.edu	37	7	91709273	91709273	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:91709273C>T	ENST00000359028.2	+	32	8087	c.7862C>T	c.(7861-7863)tCa>tTa	p.S2621L	AKAP9_ENST00000356239.3_Missense_Mutation_p.S2609L|AKAP9_ENST00000358100.2_Missense_Mutation_p.S2621L			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	2621	Glu-rich.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TTGAGAATATCAGAATTAGAA	0.294			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													69.0	75.0	73.0					7																	91709273		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.7862C>T	7.37:g.91709273C>T	ENSP00000351922:p.Ser2621Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.S2621L	ENST00000359028.2	37	c.7862		7	.	.	.	.	.	.	.	.	.	.	C	12.62	1.991244	0.35131	.	.	ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534	T;T;T;T	0.03441	4.02;4.02;4.01;3.93	4.27	4.27	0.50696	.	0.274240	0.19705	N	0.107959	T	0.03695	0.0105	L	0.43152	1.355	0.20638	N	0.999872	B;B;B;B	0.29136	0.005;0.005;0.234;0.009	B;B;B;B	0.25506	0.005;0.002;0.061;0.005	T	0.38308	-0.9667	10	0.25751	T	0.34	.	8.3129	0.32082	0.0:0.7385:0.172:0.0895	.	2613;2621;2609;2601	Q99996-6;Q99996;Q99996-2;Q99996-3	.;AKAP9_HUMAN;.;.	L	2609;2621;2621;2613;455	ENSP00000348573:S2609L;ENSP00000351922:S2621L;ENSP00000350813:S2621L;ENSP00000378042:S455L	ENSP00000348573:S2609L	S	+	2	0	AKAP9	91547209	0.976000	0.34144	1.000000	0.80357	0.990000	0.78478	1.025000	0.30090	2.331000	0.79229	0.591000	0.81541	TCA	AKAP9	-	NULL	ENSG00000127914		0.294	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		158	0.00	0	C	NM_005751		91709273	91709273	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	163	11.41	21	SNP	0.995	T
ALDH1A1	216	genome.wustl.edu	37	9	75516128	75516128	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:75516128G>A	ENST00000297785.3	-	13	1556	c.1502C>T	c.(1501-1503)tCa>tTa	p.S501L		NM_000689.4	NP_000680.2	P00352	AL1A1_HUMAN	aldehyde dehydrogenase 1 family, member A1	501					cellular aldehyde metabolic process (GO:0006081)|ethanol oxidation (GO:0006069)|positive regulation of Ras GTPase activity (GO:0032320)|retinol metabolic process (GO:0042572)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	aldehyde dehydrogenase (NAD) activity (GO:0004029)|androgen binding (GO:0005497)|Ras GTPase activator activity (GO:0005099)|retinal dehydrogenase activity (GO:0001758)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)	17					Tretinoin(DB00755)|Vitamin A(DB00162)	TTTTCTTTATGAGTTCTTCTG	0.353																																						dbGAP											0													131.0	124.0	126.0					9																	75516128		2202	4300	6502	-	-	-	SO:0001583	missense	0			K03000	CCDS6644.1	9q21.13	2010-08-05			ENSG00000165092	ENSG00000165092	1.2.1.36, 1.2.1.3	"""Aldehyde dehydrogenases"""	402	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 1"""	100640		PUMB1, ALDH1		1709013	Standard	NM_000689		Approved	RALDH1	uc004ajd.3	P00352	OTTHUMG00000020019	ENST00000297785.3:c.1502C>T	9.37:g.75516128G>A	ENSP00000297785:p.Ser501Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O00768|Q5SYR1	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Acyl-CoA_reduct_LuxC,superfamily_Ald_DH/histidinol_DH	p.S501L	ENST00000297785.3	37	c.1502	CCDS6644.1	9	.	.	.	.	.	.	.	.	.	.	G	33	5.238159	0.95240	.	.	ENSG00000165092	ENST00000297785	T	0.75938	-0.98	5.64	5.64	0.86602	Aldehyde/histidinol dehydrogenase (1);	0.280575	0.25566	N	0.029791	T	0.76278	0.3965	N	0.08118	0	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.82153	-0.0598	10	0.87932	D	0	.	19.7002	0.96049	0.0:0.0:1.0:0.0	.	501	P00352	AL1A1_HUMAN	L	501	ENSP00000297785:S501L	ENSP00000297785:S501L	S	-	2	0	ALDH1A1	74705948	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.847000	0.92166	2.646000	0.89796	0.650000	0.86243	TCA	ALDH1A1	-	superfamily_Ald_DH/histidinol_DH	ENSG00000165092		0.353	ALDH1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A1	HGNC	protein_coding	OTTHUMT00000052679.1	489	0.00	0	G			75516128	75516128	-1	no_errors	ENST00000297785	ensembl	human	known	69_37n	missense	360	20.70	94	SNP	1.000	A
ANKHD1	54882	genome.wustl.edu	37	5	139908070	139908070	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:139908070C>G	ENST00000360839.2	+	29	5693	c.5539C>G	c.(5539-5541)Cta>Gta	p.L1847V	ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.L1847V|SNORD45_ENST00000363181.1_RNA|ANKHD1_ENST00000544120.1_Missense_Mutation_p.L230V|ANKHD1_ENST00000297183.6_Missense_Mutation_p.L1847V	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1847						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCAGTTTCTCTACCCTTAGC	0.453																																						dbGAP											0													150.0	147.0	148.0					5																	139908070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5539C>G	5.37:g.139908070C>G	ENSP00000354085:p.Leu1847Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.L1847V	ENST00000360839.2	37	c.5539	CCDS4225.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.72|14.72	2.621135|2.621135	0.46736|0.46736	.|.	.|.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996|ENSG00000131503	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000536646;ENST00000433049;ENST00000544120;ENST00000532219|ENST00000435794;ENST00000432301	T;T;T;T;T;T|T;T	0.70986|0.29917	-0.5;-0.53;1.54;1.46;1.02;-0.53|1.56;1.55	4.85|4.85	3.9|3.9	0.45041|0.45041	.|.	0.000000|.	0.64402|.	D|.	0.000001|.	T|T	0.42743|0.42743	0.1216|0.1216	L|L	0.58101|0.58101	1.795|1.795	0.45250|0.45250	D|D	0.998255|0.998255	D;D;D;P;P|.	0.69078|.	0.997;0.989;0.978;0.849;0.849|.	P;P;P;B;B|.	0.60415|.	0.874;0.775;0.649;0.301;0.301|.	T|T	0.38628|0.38628	-0.9652|-0.9652	10|7	0.62326|0.87932	D|D	0.03|0	.|.	11.7459|11.7459	0.51819|0.51819	0.0:0.9049:0.0:0.0951|0.0:0.9049:0.0:0.0951	.|.	230;277;1847;1847;1847|.	Q8IWG5;Q9H059;E9PF56;Q8IWZ2;Q8IWZ3|.	.;.;.;.;ANKH1_HUMAN|.	V|C	1847;1847;1847;503;282;369;230;1847|337;297	ENSP00000354085:L1847V;ENSP00000297183:L1847V;ENSP00000393204:L503V;ENSP00000390034:L369V;ENSP00000437687:L230V;ENSP00000432016:L1847V|ENSP00000410959:S337C;ENSP00000415887:S297C	ENSP00000432016:L1847V|ENSP00000415887:S297C	L|S	+|+	1|2	2|0	ANKHD1-EIF4EBP3;ANKHD1|ANKHD1	139888254|139888254	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	4.518000|4.518000	0.60510|0.60510	1.119000|1.119000	0.41883|0.41883	0.557000|0.557000	0.71058|0.71058	CTA|TCT	ANKHD1	-	NULL	ENSG00000131503		0.453	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	331	0.00	0	C	NM_017747		139908070	139908070	+1	no_errors	ENST00000297183	ensembl	human	known	69_37n	missense	308	21.03	82	SNP	1.000	G
ANKRD30B	374860	genome.wustl.edu	37	18	14850226	14850226	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:14850226C>G	ENST00000358984.4	+	35	3232	c.3052C>G	c.(3052-3054)Caa>Gaa	p.Q1018E		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	1018										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						GACTTTAAATCAAGAAGAAGA	0.284																																						dbGAP											0													25.0	21.0	22.0					18																	14850226		691	1572	2263	-	-	-	SO:0001583	missense	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.3052C>G	18.37:g.14850226C>G	ENSP00000351875:p.Gln1018Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGP1|F8WAG3|Q4G175	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Q1018E	ENST00000358984.4	37	c.3052	CCDS54182.1	18	.	.	.	.	.	.	.	.	.	.	C	4.884	0.164234	0.09287	.	.	ENSG00000180777	ENST00000358984;ENST00000320584;ENST00000277669	T	0.20200	2.09	1.48	1.48	0.22813	.	.	.	.	.	T	0.32645	0.0836	M	0.68952	2.095	0.80722	D	1	P;P	0.46578	0.88;0.877	P;P	0.53518	0.636;0.728	T	0.17715	-1.0360	9	0.66056	D	0.02	.	8.9515	0.35792	0.0:1.0:0.0:0.0	.	1103;1018	Q9BXX2;F8WAG3	AN30B_HUMAN;.	E	1018;412;438	ENSP00000351875:Q1018E	ENSP00000277669:Q438E	Q	+	1	0	ANKRD30B	14840226	0.999000	0.42202	0.775000	0.31657	0.182000	0.23217	1.726000	0.38085	1.139000	0.42245	0.173000	0.16961	CAA	ANKRD30B	-	NULL	ENSG00000180777		0.284	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	49	0.00	0	C	NM_001145029		14850226	14850226	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	missense	44	46.43	39	SNP	0.995	G
APOB	338	genome.wustl.edu	37	2	21242743	21242743	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:21242743C>G	ENST00000233242.1	-	19	2978	c.2851G>C	c.(2851-2853)Gag>Cag	p.E951Q		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	951	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGATCACCTCCGTTTTGGTG	0.453																																						dbGAP											0													153.0	141.0	145.0					2																	21242743		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.2851G>C	2.37:g.21242743C>G	ENSP00000233242:p.Glu951Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.E951Q	ENST00000233242.1	37	c.2851	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	11.00	1.508953	0.27036	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.14391	2.51	4.83	4.83	0.62350	Lipid transport protein, beta-sheet shell (1);Vitellinogen, open beta-sheet, subdomain 2 (1);	0.089006	0.48767	D	0.000177	T	0.27454	0.0674	L	0.61036	1.89	0.80722	D	1	D	0.57899	0.981	P	0.52109	0.69	T	0.01013	-1.1481	10	0.41790	T	0.15	.	18.797	0.91999	0.0:1.0:0.0:0.0	.	951	P04114	APOB_HUMAN	Q	951	ENSP00000233242:E951Q	ENSP00000233242:E951Q	E	-	1	0	APOB	21096248	0.993000	0.37304	0.189000	0.23252	0.026000	0.11368	3.091000	0.50199	2.622000	0.88805	0.655000	0.94253	GAG	APOB	-	superfamily_Lipid_transp_b-sht_shell	ENSG00000084674		0.453	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	229	0.00	0	C			21242743	21242743	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	222	20.07	56	SNP	0.694	G
ANXA4	307	genome.wustl.edu	37	2	70033627	70033627	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:70033627G>A	ENST00000394295.4	+	5	551	c.303G>A	c.(301-303)atG>atA	p.M101I	ANXA4_ENST00000409920.1_Intron|ANXA4_ENST00000536030.1_Missense_Mutation_p.M17I	NM_001153.3	NP_001144.1	P09525	ANXA4_HUMAN	annexin A4	99					epithelial cell differentiation (GO:0030855)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|identical protein binding (GO:0042802)|NF-kappaB binding (GO:0051059)|phospholipase inhibitor activity (GO:0004859)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)	11						GAAGGGCCATGAAGGTCTGTG	0.512																																						dbGAP											0													189.0	123.0	145.0					2																	70033627		2203	4300	6503	-	-	-	SO:0001583	missense	0			M82809	CCDS1894.1	2p13.3	2008-02-05			ENSG00000196975	ENSG00000196975		"""Annexins"""	542	protein-coding gene	gene with protein product		106491		ANX4		1346776	Standard	NM_001153		Approved		uc002sfr.4	P09525	OTTHUMG00000129649	ENST00000394295.4:c.303G>A	2.37:g.70033627G>A	ENSP00000377833:p.Met101Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDF9|Q96F33|Q9BWK1	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinIV,prints_AnnexinV	p.M101I	ENST00000394295.4	37	c.303	CCDS1894.1	2	.	.	.	.	.	.	.	.	.	.	G	4.075	0.011873	0.07912	.	.	ENSG00000196975	ENST00000394295;ENST00000536030	T;T	0.03386	3.95;3.95	4.97	4.97	0.65823	.	0.080411	0.85682	D	0.000000	T	0.03263	0.0095	N	0.16862	0.45	0.51767	D	0.99993	B;B	0.10296	0.003;0.001	B;B	0.17979	0.02;0.009	T	0.54351	-0.8307	9	.	.	.	.	16.086	0.81049	0.0:0.0:1.0:0.0	.	99;101	P09525;Q6LES2	ANXA4_HUMAN;.	I	101;17	ENSP00000377833:M101I;ENSP00000441931:M17I	.	M	+	3	0	ANXA4	69887131	1.000000	0.71417	1.000000	0.80357	0.151000	0.21798	3.674000	0.54598	2.471000	0.83476	0.555000	0.69702	ATG	ANXA4	-	pfam_Annexin_repeat,superfamily_Annexin,prints_Annexin	ENSG00000196975		0.512	ANXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA4	HGNC	protein_coding	OTTHUMT00000251848.2	191	0.00	0	G	NM_001153		70033627	70033627	+1	no_errors	ENST00000394295	ensembl	human	known	69_37n	missense	148	20.74	39	SNP	1.000	A
ARAP1	116985	genome.wustl.edu	37	11	72409112	72409112	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:72409112C>T	ENST00000393609.3	-	19	2783	c.2581G>A	c.(2581-2583)Gat>Aat	p.D861N	ARAP1-AS2_ENST00000500163.2_RNA|ARAP1_ENST00000455638.2_Missense_Mutation_p.D861N|ARAP1_ENST00000429686.1_Missense_Mutation_p.D555N|ARAP1_ENST00000426523.1_Missense_Mutation_p.D616N|ARAP1_ENST00000495878.1_5'UTR|ARAP1_ENST00000334211.8_Missense_Mutation_p.D616N|ARAP1_ENST00000393605.3_Missense_Mutation_p.D621N|ARAP1_ENST00000359373.5_Missense_Mutation_p.D861N	NM_001040118.2	NP_001035207.1	Q96P48	ARAP1_HUMAN	ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1	861					actin filament reorganization involved in cell cycle (GO:0030037)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of Cdc42 GTPase activity (GO:0043089)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of receptor recycling (GO:0001921)|regulation of ARF GTPase activity (GO:0032312)|regulation of cell shape (GO:0008360)|regulation of cellular component movement (GO:0051270)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|Rho GTPase activator activity (GO:0005100)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|large_intestine(10)|lung(8)|ovary(1)|skin(3)|urinary_tract(1)	27						CGCTCAAAATCCCGGGCCAGC	0.667																																					Ovarian(102;1198 1520 13195 17913 37529)	dbGAP											0													17.0	22.0	21.0					11																	72409112		2200	4293	6493	-	-	-	SO:0001583	missense	0			AF411983	CCDS8217.2, CCDS41687.1, CCDS44671.1	11q13.3	2013-01-11	2008-09-22	2008-09-22	ENSG00000186635	ENSG00000186635		"""ADP-ribosylation factor GTPase activating proteins"", ""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16925	protein-coding gene	gene with protein product		606646	"""centaurin, delta 2"""	CENTD2			Standard	NM_001040118		Approved		uc001osu.3	Q96P48	OTTHUMG00000157102	ENST00000393609.3:c.2581G>A	11.37:g.72409112C>T	ENSP00000377233:p.Asp861Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KLL7|B2RTS2|O94879|Q4LDD5|Q59FI7|Q6PHS3|Q8WU51|Q96HP6|Q96L71	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_ArfGAP,pfam_SAM_type1,pfam_Ras-assoc,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,superfamily_ArfGAP,superfamily_SAM/pointed,smart_SAM,smart_Pleckstrin_homology,smart_ArfGAP,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SAM,pfscan_ArfGAP,pfscan_RhoGAP_dom,prints_ArfGAP	p.D861N	ENST00000393609.3	37	c.2581	CCDS41687.1	11	.	.	.	.	.	.	.	.	.	.	C	16.54	3.152040	0.57151	.	.	ENSG00000186635	ENST00000359373;ENST00000455638;ENST00000393605;ENST00000334211;ENST00000393609;ENST00000426523;ENST00000429686;ENST00000427971;ENST00000452383	T;T;T;T;T;T;T;T;T	0.57907	3.13;3.13;3.13;3.18;3.12;3.19;3.16;0.37;1.55	5.44	5.44	0.79542	.	0.397141	0.27206	N	0.020429	T	0.60728	0.2291	L	0.59436	1.845	0.24018	N	0.996152	B;D;B;B;P	0.54207	0.349;0.965;0.241;0.349;0.48	B;P;B;B;B	0.50049	0.1;0.629;0.082;0.17;0.204	T	0.58538	-0.7619	10	0.54805	T	0.06	.	17.844	0.88724	0.0:1.0:0.0:0.0	.	616;555;861;861;621	E7EU13;B2RTS2;Q96P48-3;Q96P48;Q96P48-1	.;.;.;ARAP1_HUMAN;.	N	861;861;621;616;861;616;555;149;149	ENSP00000352332:D861N;ENSP00000390461:D861N;ENSP00000377230:D621N;ENSP00000335506:D616N;ENSP00000377233:D861N;ENSP00000392264:D616N;ENSP00000403127:D555N;ENSP00000411452:D149N;ENSP00000399118:D149N	ENSP00000335506:D616N	D	-	1	0	ARAP1	72086760	0.949000	0.32298	0.987000	0.45799	0.722000	0.41435	4.833000	0.62766	2.572000	0.86782	0.563000	0.77884	GAT	ARAP1	-	NULL	ENSG00000186635		0.667	ARAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARAP1	HGNC	protein_coding	OTTHUMT00000347428.1	40	0.00	0	C	NM_001040118		72409112	72409112	-1	no_errors	ENST00000393609	ensembl	human	known	69_37n	missense	25	26.47	9	SNP	0.652	T
AS3MT	57412	genome.wustl.edu	37	10	104638240	104638240	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr10:104638240C>T	ENST00000369880.3	+	8	792	c.715C>T	c.(715-717)Caa>Taa	p.Q239*	C10orf32-ASMT_ENST00000299353.6_3'UTR	NM_020682.3	NP_065733.2	Q9HBK9	AS3MT_HUMAN	arsenite methyltransferase	239					arsonoacetate metabolic process (GO:0018872)|toxin metabolic process (GO:0009404)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	arsenite methyltransferase activity (GO:0030791)|methylarsonite methyltransferase activity (GO:0030792)			large_intestine(1)|lung(6)	7		Colorectal(252;0.122)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;5.87e-09)|all cancers(201;1.58e-07)|BRCA - Breast invasive adenocarcinoma(275;0.223)		CATTACAATTCAAAACAAGGA	0.408																																						dbGAP											0													158.0	148.0	151.0					10																	104638240		1866	4129	5995	-	-	-	SO:0001587	stop_gained	0			AF226730	CCDS41567.1	10q24.33	2014-05-09	2014-05-09		ENSG00000214435	ENSG00000214435	2.1.1.137		17452	protein-coding gene	gene with protein product		611806	"""arsenic (+3 oxidation state) methyltransferase"""			11790780	Standard	NM_020682		Approved	CYT19	uc001kwk.3	Q9HBK9	OTTHUMG00000018972	ENST00000369880.3:c.715C>T	10.37:g.104638240C>T	ENSP00000358896:p.Gln239*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NP79|Q0VDK3|Q0VDK4|Q5PZ02	Nonsense_Mutation	SNP	pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pfam_Methyltransf_12,pfam_PCMT,pfam_Methyltransferase-rel	p.Q239*	ENST00000369880.3	37	c.715	CCDS41567.1	10	.	.	.	.	.	.	.	.	.	.	C	29.2	4.986833	0.93106	.	.	ENSG00000214435	ENST00000369880	.	.	.	5.48	3.45	0.39498	.	0.554717	0.18810	N	0.130557	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	-0.8161	13.86	0.63554	0.0:0.6119:0.3881:0.0	.	.	.	.	X	239	.	ENSP00000358896:Q239X	Q	+	1	0	AS3MT	104628230	0.038000	0.19896	0.986000	0.45419	0.913000	0.54294	0.983000	0.29552	1.267000	0.44247	0.561000	0.74099	CAA	AS3MT	-	NULL	ENSG00000214435		0.408	AS3MT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AS3MT	HGNC	protein_coding	OTTHUMT00000050107.1	293	0.00	0	C	NM_020682		104638240	104638240	+1	no_errors	ENST00000369880	ensembl	human	known	69_37n	nonsense	274	11.58	36	SNP	0.898	T
ASB6	140459	genome.wustl.edu	37	9	132402823	132402823	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:132402823C>T	ENST00000277458.4	-	2	457	c.292G>A	c.(292-294)Gaa>Aaa	p.E98K	ASB6_ENST00000277459.4_Missense_Mutation_p.E98K|ASB6_ENST00000450050.2_Intron|RP11-483H20.4_ENST00000455074.1_RNA	NM_017873.3	NP_060343.1	Q9NWX5	ASB6_HUMAN	ankyrin repeat and SOCS box containing 6	98					intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)				NS(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)	15		Ovarian(14;0.00556)				CGCTGACCTTCAAAGTTGAGA	0.652																																						dbGAP											0													32.0	34.0	33.0					9																	132402823		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6924.1, CCDS6925.1, CCDS75919.1	9q34.13	2013-01-10	2011-01-25		ENSG00000148331	ENSG00000148331		"""Ankyrin repeat domain containing"""	17181	protein-coding gene	gene with protein product		615051	"""ankyrin repeat and SOCS box-containing 6"""				Standard	NM_017873		Approved		uc004byf.2	Q9NWX5	OTTHUMG00000020787	ENST00000277458.4:c.292G>A	9.37:g.132402823C>T	ENSP00000277458:p.Glu98Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZB7|Q9BV15	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.E98K	ENST00000277458.4	37	c.292	CCDS6924.1	9	.	.	.	.	.	.	.	.	.	.	C	20.9	4.070128	0.76301	.	.	ENSG00000148331	ENST00000277459;ENST00000277458	T;T	0.61510	0.1;0.1	5.15	4.25	0.50352	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.39627	0.1085	N	0.01197	-0.965	0.80722	D	1	B;D;B	0.63880	0.107;0.993;0.06	B;P;B	0.61275	0.096;0.886;0.067	T	0.45425	-0.9262	10	0.02654	T	1	.	12.7502	0.57304	0.0:0.9203:0.0:0.0797	.	98;98;98	A8K9U2;Q9NWX5-2;Q9NWX5	.;.;ASB6_HUMAN	K	98	ENSP00000277459:E98K;ENSP00000277458:E98K	ENSP00000277458:E98K	E	-	1	0	ASB6	131442644	1.000000	0.71417	0.996000	0.52242	0.988000	0.76386	7.008000	0.76341	1.176000	0.42840	0.561000	0.74099	GAA	ASB6	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	ENSG00000148331		0.652	ASB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB6	HGNC	protein_coding	OTTHUMT00000054594.1	44	0.00	0	C	NM_017873		132402823	132402823	-1	no_errors	ENST00000277458	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	1.000	T
ASPM	259266	genome.wustl.edu	37	1	197071299	197071299	+	Missense_Mutation	SNP	G	G	A	rs368151024		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:197071299G>A	ENST00000367409.4	-	18	7338	c.7082C>T	c.(7081-7083)tCc>tTc	p.S2361F	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	2361	IQ 23. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						GATCACAACGGAGGCCTGTTT	0.458																																						dbGAP											0													143.0	140.0	141.0					1																	197071299		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.7082C>T	1.37:g.197071299G>A	ENSP00000356379:p.Ser2361Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.S2361F	ENST00000367409.4	37	c.7082	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	g	12.18	1.861846	0.32884	.	.	ENSG00000066279	ENST00000367409;ENST00000367406	T	0.71698	-0.59	4.39	3.46	0.39613	.	0.137772	0.32852	N	0.005566	D	0.82586	0.5069	M	0.84433	2.695	0.80722	D	1	P;D	0.69078	0.931;0.997	D;D	0.68943	0.958;0.961	D	0.83768	0.0218	10	0.72032	D	0.01	.	9.3361	0.38051	0.0834:0.1486:0.7681:0.0	.	347;2361	E7EQ84;Q8IZT6	.;ASPM_HUMAN	F	2361;347	ENSP00000356379:S2361F	ENSP00000356376:S347F	S	-	2	0	ASPM	195337922	0.983000	0.35010	0.098000	0.21074	0.320000	0.28249	6.223000	0.72257	1.165000	0.42670	0.558000	0.71614	TCC	ASPM	-	superfamily_ARM-type_fold,pfscan_IQ_motif_EF-hand-BS	ENSG00000066279		0.458	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	179	0.00	0	G	NM_018136		197071299	197071299	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	missense	221	38.40	139	SNP	0.788	A
ATAD5	79915	genome.wustl.edu	37	17	29221881	29221881	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:29221881C>G	ENST00000321990.4	+	23	5863	c.5485C>G	c.(5485-5487)Ctt>Gtt	p.L1829V	TEFM_ENST00000579183.1_5'Flank	NM_024857.3	NP_079133.3	Q96QE3	ATAD5_HUMAN	ATPase family, AAA domain containing 5	1829					cellular response to DNA damage stimulus (GO:0006974)	nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(18)|lung(13)|ovary(3)|pancreas(1)	51		all_hematologic(16;0.0202)|Acute lymphoblastic leukemia(14;0.0238)|Myeloproliferative disorder(56;0.0393)				AGGAATTCATCTTGACATTCC	0.294																																						dbGAP											0													85.0	85.0	85.0					17																	29221881		2202	4295	6497	-	-	-	SO:0001583	missense	0				CCDS11260.1	17q11.2	2010-04-21	2007-02-08	2007-02-08	ENSG00000176208	ENSG00000176208		"""ATPases / AAA-type"""	25752	protein-coding gene	gene with protein product	"""enhanced level of genomic instability 1 homolog (S. cerevisiae)"""	609534	"""chromosome 17 open reading frame 41"""	C17orf41		15983387, 11468690, 19755857	Standard	NM_024857		Approved	FLJ12735, FRAG1, ELG1	uc002hfs.1	Q96QE3	OTTHUMG00000132794	ENST00000321990.4:c.5485C>G	17.37:g.29221881C>G	ENSP00000313171:p.Leu1829Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DH0|Q69YR6|Q9H9I1	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.L1829V	ENST00000321990.4	37	c.5485	CCDS11260.1	17	.	.	.	.	.	.	.	.	.	.	C	19.59	3.856843	0.71834	.	.	ENSG00000176208	ENST00000321990	T	0.19250	2.16	5.38	5.38	0.77491	.	0.060793	0.64402	D	0.000002	T	0.47655	0.1457	M	0.68952	2.095	0.54753	D	0.999983	D	0.76494	0.999	D	0.78314	0.991	T	0.46693	-0.9173	10	0.87932	D	0	.	19.1318	0.93410	0.0:1.0:0.0:0.0	.	1829	Q96QE3	ATAD5_HUMAN	V	1829	ENSP00000313171:L1829V	ENSP00000313171:L1829V	L	+	1	0	ATAD5	26246007	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.215000	0.58534	2.521000	0.84997	0.585000	0.79938	CTT	ATAD5	-	NULL	ENSG00000176208		0.294	ATAD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD5	HGNC	protein_coding	OTTHUMT00000256206.2	301	0.00	0	C	NM_024857		29221881	29221881	+1	no_errors	ENST00000321990	ensembl	human	known	69_37n	missense	159	25.70	55	SNP	1.000	G
ATP10B	23120	genome.wustl.edu	37	5	160059229	160059229	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:160059229C>T	ENST00000327245.5	-	13	2373	c.1527G>A	c.(1525-1527)caG>caA	p.Q509Q	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	509					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			CCCGGGCACTCTGGCTCCTCC	0.582																																						dbGAP											0													54.0	57.0	56.0					5																	160059229		1947	4145	6092	-	-	-	SO:0001819	synonymous_variant	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1527G>A	5.37:g.160059229C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.Q509	ENST00000327245.5	37	c.1527	CCDS43394.1	5																																																																																			ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.582	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	117	0.00	0	C	NM_025153		160059229	160059229	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	silent	63	20.25	16	SNP	0.952	T
ATP12A	479	genome.wustl.edu	37	13	25264553	25264553	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:25264553C>T	ENST00000381946.3	+	6	791	c.624C>T	c.(622-624)gtC>gtT	p.V208V	ATP12A_ENST00000218548.6_Silent_p.V208V			P54707	AT12A_HUMAN	ATPase, H+/K+ transporting, nongastric, alpha polypeptide	208					ATP biosynthetic process (GO:0006754)|ion transmembrane transport (GO:0034220)|potassium ion homeostasis (GO:0055075)|regulation of pH (GO:0006885)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|hydrogen:potassium-exchanging ATPase complex (GO:0005889)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|hydrogen:potassium-exchanging ATPase activity (GO:0008900)|metal ion binding (GO:0046872)			breast(6)|central_nervous_system(4)|endometrium(3)|kidney(5)|large_intestine(23)|lung(23)|ovary(2)|pancreas(1)|prostate(2)|skin(5)	74		Lung SC(185;0.0225)|Breast(139;0.077)		all cancers(112;0.0307)|Epithelial(112;0.086)|OV - Ovarian serous cystadenocarcinoma(117;0.228)		TTGTGGAGGTCAAAGGAGGAG	0.547																																					Pancreas(156;1582 1935 18898 22665 26498)	dbGAP											0													98.0	91.0	93.0					13																	25264553		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42558	CCDS31948.1, CCDS53858.1	13q11-q12.1	2010-04-20	2002-02-25		ENSG00000075673	ENSG00000075673	3.6.3.10	"""ATPases / P-type"""	13816	protein-coding gene	gene with protein product	"""ATPase, Na+K+ transporting, alpha-1 polypeptide-like"", ""potassium-transporting ATPase alpha chain 2"", ""proton pump"", ""non-gastric H(+)/K(+) ATPase alpha subunit"", ""sodium/potassium ATPase, alpha polypeptide-like"""	182360	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 1"""	ATP1AL1		8838794, 2842249	Standard	NM_001676		Approved		uc010aaa.3	P54707	OTTHUMG00000016588	ENST00000381946.3:c.624C>T	13.37:g.25264553C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13816|Q13817|Q16734|Q5W035|Q8N5U2	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.V208	ENST00000381946.3	37	c.624	CCDS31948.1	13																																																																																			ATP12A	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000075673		0.547	ATP12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP12A	HGNC	protein_coding	OTTHUMT00000044199.1	133	0.00	0	C	NM_001676		25264553	25264553	+1	no_errors	ENST00000218548	ensembl	human	known	69_37n	silent	102	18.25	23	SNP	1.000	T
ATP8B3	148229	genome.wustl.edu	37	19	1783041	1783041	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:1783041T>C	ENST00000310127.6	-	29	4127	c.3889A>G	c.(3889-3891)Aaa>Gaa	p.K1297E	ATP8B3_ENST00000539485.1_Missense_Mutation_p.K1307E|ATP8B3_ENST00000525591.1_Missense_Mutation_p.K1260E	NM_138813.3	NP_620168.1	O60423	AT8B3_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 3	1297					binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(9)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGACTCTTTTGGGCTCGAA	0.567																																						dbGAP											0													64.0	63.0	63.0					19																	1783041		2029	4205	6234	-	-	-	SO:0001583	missense	0			AA827939	CCDS45901.1, CCDS54196.1	19p13.3	2010-04-28	2010-04-28		ENSG00000130270	ENSG00000130270		"""ATPases / P-type"""	13535	protein-coding gene	gene with protein product	"""aminophospholipid translocase ATP8B3"", ""potential phospholipid-transporting ATPase IK"""	605866	"""ATPase, Class I, type 8B, member 3"", ""ATPase, class I, type 8B, member 3"""			11015572	Standard	NM_138813		Approved	ATPIK	uc002ltw.4	O60423	OTTHUMG00000166189	ENST00000310127.6:c.3889A>G	19.37:g.1783041T>C	ENSP00000311336:p.Lys1297Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z485|Q8IVB8|Q8N4Y8|Q96M22	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.K1307E	ENST00000310127.6	37	c.3919	CCDS45901.1	19	.	.	.	.	.	.	.	.	.	.	T	6.851	0.526222	0.13066	.	.	ENSG00000130270	ENST00000310127;ENST00000539485;ENST00000525591	T;T;T	0.59083	0.29;0.41;0.4	4.05	-4.28	0.03732	.	2.809240	0.02533	U	0.093795	T	0.41305	0.1153	L	0.44542	1.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.09228	-1.0684	10	0.12766	T	0.61	.	2.0184	0.03503	0.1518:0.396:0.1552:0.2971	.	1297;1260	O60423;Q7Z485	AT8B3_HUMAN;.	E	1297;1307;1260	ENSP00000311336:K1297E;ENSP00000443574:K1307E;ENSP00000437115:K1260E	ENSP00000311336:K1297E	K	-	1	0	ATP8B3	1734041	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-4.150000	0.00285	-1.107000	0.03004	0.459000	0.35465	AAA	ATP8B3	-	NULL	ENSG00000130270		0.567	ATP8B3-002	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	ATP8B3	HGNC	protein_coding	OTTHUMT00000388279.1	124	0.00	0	T	NM_138813		1783041	1783041	-1	no_errors	ENST00000539485	ensembl	human	known	69_37n	missense	62	47.46	56	SNP	0.000	C
ATRN	8455	genome.wustl.edu	37	20	3541448	3541448	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:3541448C>G	ENST00000262919.5	+	8	1411	c.1343C>G	c.(1342-1344)tCt>tGt	p.S448C	ATRN_ENST00000446916.2_Missense_Mutation_p.S448C	NM_139321.2	NP_647537.1	O75882	ATRN_HUMAN	attractin	448					cerebellum development (GO:0021549)|inflammatory response (GO:0006954)|myelination (GO:0042552)|pigmentation (GO:0043473)|regulation of multicellular organism growth (GO:0040014)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)			breast(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	59						GTTGGGCACTCTGCACACATT	0.453																																						dbGAP											0													253.0	206.0	222.0					20																	3541448		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034957	CCDS13053.1, CCDS13054.1	20p13	2008-07-02			ENSG00000088812	ENSG00000088812			885	protein-coding gene	gene with protein product	"""mahogany protein"""	603130				9736737, 8596018	Standard	NM_139321		Approved	DPPT-L, MGCA	uc002wim.2	O75882	OTTHUMG00000031746	ENST00000262919.5:c.1343C>G	20.37:g.3541448C>G	ENSP00000262919:p.Ser448Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE5|O60295|O95414|Q3MIT3|Q5TDA2|Q5TDA4|Q5VYW3|Q9NTQ3|Q9NTQ4|Q9NU01|Q9NZ57|Q9NZ58|Q9UC75|Q9UDF5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Plexin_repeat,pfam_CUB,superfamily_C-type_lectin_fold,superfamily_CUB,superfamily_Plexin-like_fold,smart_EGF-like,smart_CUB,smart_Plexin-like,smart_C-type_lectin,smart_EGF_laminin,pfscan_CUB,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_C-type_lectin	p.S448C	ENST00000262919.5	37	c.1343	CCDS13053.1	20	.	.	.	.	.	.	.	.	.	.	C	19.09	3.760139	0.69763	.	.	ENSG00000088812	ENST00000262919;ENST00000446916;ENST00000340500	T;T	0.75154	-0.91;-0.39	4.85	4.85	0.62838	Kelch-type beta propeller (1);	0.135191	0.51477	D	0.000083	D	0.85146	0.5630	M	0.68593	2.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.984;0.998	D	0.86376	0.1726	10	0.62326	D	0.03	-8.3478	17.7384	0.88401	0.0:1.0:0.0:0.0	.	448;448	O75882;O75882-2	ATRN_HUMAN;.	C	448;448;374	ENSP00000262919:S448C;ENSP00000416587:S448C	ENSP00000262919:S448C	S	+	2	0	ATRN	3489448	1.000000	0.71417	0.951000	0.38953	0.482000	0.33219	7.620000	0.83070	2.505000	0.84491	0.555000	0.69702	TCT	ATRN	-	NULL	ENSG00000088812		0.453	ATRN-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRN	HGNC	protein_coding	OTTHUMT00000077740.2	502	0.00	0	C	NM_139321		3541448	3541448	+1	no_errors	ENST00000262919	ensembl	human	known	69_37n	missense	408	19.80	101	SNP	1.000	G
AUTS2	26053	genome.wustl.edu	37	7	69064930	69064930	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:69064930C>T	ENST00000342771.4	+	1	612	c.291C>T	c.(289-291)gtC>gtT	p.V97V	AUTS2_ENST00000406775.2_Silent_p.V97V|RP5-942I16.1_ENST00000436600.2_lincRNA|AUTS2_ENST00000403018.2_Silent_p.V97V	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	97										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		CCAGCTTTGTCACTTTTGAAG	0.657																																						dbGAP											0													24.0	26.0	25.0					7																	69064930		2143	4156	6299	-	-	-	SO:0001819	synonymous_variant	0			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.291C>T	7.37:g.69064930C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	prints_AUTS2	p.V97	ENST00000342771.4	37	c.291	CCDS5539.1	7																																																																																			AUTS2	-	NULL	ENSG00000158321		0.657	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	26	0.00	0	C			69064930	69064930	+1	no_errors	ENST00000342771	ensembl	human	known	69_37n	silent	12	25.00	4	SNP	1.000	T
BRWD3	254065	genome.wustl.edu	37	X	79978166	79978166	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:79978166C>G	ENST00000373275.4	-	17	1987	c.1771G>C	c.(1771-1773)Gat>Cat	p.D591H	BRWD3_ENST00000473691.1_5'Flank	NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	591					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						CCATCAACATCCACCAAAAAT	0.448																																						dbGAP											0													130.0	114.0	119.0					X																	79978166		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.1771G>C	X.37:g.79978166C>G	ENSP00000362372:p.Asp591His	Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.D591H	ENST00000373275.4	37	c.1771	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442566	0.83993	.	.	ENSG00000165288	ENST00000373275	T	0.67865	-0.29	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.84977	0.5592	M	0.90759	3.145	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.88244	0.2912	9	.	.	.	-17.2087	17.0991	0.86644	0.0:1.0:0.0:0.0	.	591	Q6RI45	BRWD3_HUMAN	H	591	ENSP00000362372:D591H	.	D	-	1	0	BRWD3	79864822	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.278000	0.78587	2.304000	0.77564	0.544000	0.68410	GAT	BRWD3	-	NULL	ENSG00000165288		0.448	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	334	0.00	0	C	NM_153252		79978166	79978166	-1	no_errors	ENST00000373275	ensembl	human	known	69_37n	missense	285	18.57	65	SNP	1.000	G
C11orf58	10944	genome.wustl.edu	37	11	16776434	16776434	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:16776434G>C	ENST00000228136.4	+	5	713	c.335G>C	c.(334-336)gGa>gCa	p.G112A	C11orf58_ENST00000422258.2_Missense_Mutation_p.G68A|C11orf58_ENST00000525684.1_3'UTR			O00193	SMAP_HUMAN	chromosome 11 open reading frame 58	112	Asp-rich.									NS(1)|endometrium(1)|lung(3)|prostate(1)|skin(1)	7						GACCATGATGGAGAAGGTGAT	0.398																																						dbGAP											0													73.0	68.0	69.0					11																	16776434		2200	4294	6494	-	-	-	SO:0001583	missense	0			BC007103	CCDS7822.1	11p15.1	2012-05-30			ENSG00000110696	ENSG00000110696			16990	protein-coding gene	gene with protein product	"""small acidic protein"""					9263035	Standard	NM_014267		Approved	SMAP	uc001mmk.2	O00193	OTTHUMG00000165910	ENST00000228136.4:c.335G>C	11.37:g.16776434G>C	ENSP00000228136:p.Gly112Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD28	Missense_Mutation	SNP	NULL	p.G112A	ENST00000228136.4	37	c.335	CCDS7822.1	11	.	.	.	.	.	.	.	.	.	.	G	9.559	1.117870	0.20877	.	.	ENSG00000110696	ENST00000228136;ENST00000524439;ENST00000422258	.	.	.	5.21	4.27	0.50696	.	0.264172	0.44097	D	0.000495	T	0.26122	0.0637	N	0.22421	0.69	0.33782	D	0.624364	B	0.26744	0.158	B	0.27608	0.081	T	0.30446	-0.9978	9	0.02654	T	1	.	6.5314	0.22330	0.0913:0.0:0.7275:0.1813	.	112	O00193	SMAP_HUMAN	A	112;84;68	.	ENSP00000228136:G112A	G	+	2	0	C11orf58	16733010	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.624000	0.46444	1.119000	0.41883	0.650000	0.86243	GGA	C11orf58	-	NULL	ENSG00000110696		0.398	C11orf58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf58	HGNC	protein_coding	OTTHUMT00000387023.2	204	0.00	0	G	NM_014267		16776434	16776434	+1	no_errors	ENST00000228136	ensembl	human	known	69_37n	missense	159	18.37	36	SNP	1.000	C
C12orf40	283461	genome.wustl.edu	37	12	40041721	40041721	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:40041721C>T	ENST00000324616.5	+	6	666	c.512C>T	c.(511-513)aCa>aTa	p.T171I	C12orf40_ENST00000405531.3_Missense_Mutation_p.T171I|C12orf40_ENST00000398716.1_Missense_Mutation_p.T94I	NM_001031748.2	NP_001026918.2	Q86WS4	CL040_HUMAN	chromosome 12 open reading frame 40	171										breast(4)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(14)|ovary(6)|prostate(1)|skin(2)	38						CTAAATTTCACATCTGGAATA	0.343																																						dbGAP											0													84.0	80.0	81.0					12																	40041721		1826	4079	5905	-	-	-	SO:0001583	missense	0			AK097445	CCDS41770.1	12q12	2008-08-04			ENSG00000180116	ENSG00000180116			26846	protein-coding gene	gene with protein product						12477932	Standard	XM_005268806		Approved	FLJ40126	uc001rmc.3	Q86WS4	OTTHUMG00000133567	ENST00000324616.5:c.512C>T	12.37:g.40041721C>T	ENSP00000317671:p.Thr171Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNU1|Q8IXY6|Q8N818|V9HW02	Missense_Mutation	SNP	NULL	p.T171I	ENST00000324616.5	37	c.512	CCDS41770.1	12	.	.	.	.	.	.	.	.	.	.	C	0.304	-0.972178	0.02215	.	.	ENSG00000180116	ENST00000405531;ENST00000398716;ENST00000324616	T;T	0.42513	0.97;0.98	3.98	0.822	0.18806	.	0.687987	0.12578	N	0.456653	T	0.19127	0.0459	N	0.14661	0.345	0.09310	N	1	B	0.13594	0.008	B	0.16289	0.015	T	0.20773	-1.0265	10	0.17369	T	0.5	.	2.026	0.03519	0.2567:0.3911:0.0:0.3522	.	171	Q86WS4	CL040_HUMAN	I	171;94;171	ENSP00000383897:T171I;ENSP00000317671:T171I	ENSP00000317671:T171I	T	+	2	0	C12orf40	38327988	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	0.122000	0.15687	0.155000	0.19261	0.557000	0.71058	ACA	C12orf40	-	NULL	ENSG00000180116		0.343	C12orf40-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf40	HGNC	protein_coding	OTTHUMT00000257664.2	231	0.00	0	C	NM_173599		40041721	40041721	+1	no_errors	ENST00000324616	ensembl	human	known	69_37n	missense	168	16.00	32	SNP	0.001	T
LRRC74A	145497	genome.wustl.edu	37	14	77304305	77304305	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:77304305G>C	ENST00000393774.3	+	5	710	c.586G>C	c.(586-588)Gag>Cag	p.E196Q	C14orf166B_ENST00000460005.1_3'UTR|C14orf166B_ENST00000450042.2_Missense_Mutation_p.E179Q	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		CTGGAGCCTTGAGCTTTCAGG	0.448																																					Ovarian(165;1056 1958 32571 36789 48728)	dbGAP											0													46.0	40.0	42.0					14																	77304305		2200	4299	6499	-	-	-	SO:0001583	missense	0																														ENST00000393774.3:c.586G>C	14.37:g.77304305G>C	ENSP00000377369:p.Glu196Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E196Q	ENST00000393774.3	37	c.586	CCDS9853.2	14	.	.	.	.	.	.	.	.	.	.	G	2.076	-0.411789	0.04799	.	.	ENSG00000100565	ENST00000393774;ENST00000450042	T;T	0.52526	0.66;2.3	5.57	3.55	0.40652	.	.	.	.	.	T	0.21267	0.0512	N	0.04148	-0.265	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.04607	-1.0939	9	0.11485	T	0.65	.	8.1118	0.30920	0.2274:0.6218:0.1508:0.0	.	196	Q0VAA2	CN16B_HUMAN	Q	196;179	ENSP00000377369:E196Q;ENSP00000396260:E179Q	ENSP00000377369:E196Q	E	+	1	0	C14orf166B	76374058	0.557000	0.26546	0.688000	0.30117	0.872000	0.50106	0.395000	0.20850	0.518000	0.28383	0.555000	0.69702	GAG	C14orf166B	-	smart_Leu-rich_rpt_RNase_inh_sub-typ	ENSG00000100565		0.448	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166B	HGNC	protein_coding	OTTHUMT00000316592.1	328	0.00	0	G			77304305	77304305	+1	no_errors	ENST00000393774	ensembl	human	known	69_37n	missense	228	20.14	58	SNP	0.954	C
C19orf33	64073	genome.wustl.edu	37	19	38794918	38794918	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:38794918G>A	ENST00000301246.5	+	1	118	c.17G>A	c.(16-18)gGa>gAa	p.G6E	CTB-102L5.4_ENST00000591889.1_Intron|C19orf33_ENST00000588605.1_Missense_Mutation_p.G6E	NM_033520.1	NP_277055.1	Q9GZP8	IMUP_HUMAN	chromosome 19 open reading frame 33	6						nucleus (GO:0005634)						all_cancers(60;1.07e-06)		Lung(45;0.000246)|LUSC - Lung squamous cell carcinoma(53;0.000292)			TTCGACCTGGGAGCAGGTGAG	0.652																																						dbGAP											0													47.0	46.0	46.0					19																	38794918		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF213678	CCDS12511.1	19q13.2	2012-10-26			ENSG00000167644	ENSG00000167644			16668	protein-coding gene	gene with protein product	"""immortalization-upregulated protein"", ""HAI-2 related small protein"", ""hepatocyte growth factor activator inhibitor type 2-related small protein"""					11080599	Standard	NM_033520		Approved	IMUP-1, IMUP-2, H2RSP, IMUP	uc002ohu.1	Q9GZP8	OTTHUMG00000181894	ENST00000301246.5:c.17G>A	19.37:g.38794918G>A	ENSP00000301246:p.Gly6Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P6G2|Q96H58|Q9HCR4	Missense_Mutation	SNP	NULL	p.G6E	ENST00000301246.5	37	c.17	CCDS12511.1	19	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229086	0.39399	.	.	ENSG00000167644	ENST00000301246	.	.	.	4.06	-2.98	0.05513	.	1.132320	0.06750	N	0.779938	T	0.17408	0.0418	N	0.14661	0.345	0.09310	N	1	B;B	0.33103	0.397;0.397	B;B	0.28638	0.059;0.092	T	0.24870	-1.0148	9	0.66056	D	0.02	-1.2224	3.9986	0.09569	0.1508:0.2657:0.4815:0.102	.	6;6	Q9GZP8-2;Q9GZP8	.;IMUP_HUMAN	E	6	.	ENSP00000301246:G6E	G	+	2	0	C19orf33	43486758	0.000000	0.05858	0.000000	0.03702	0.170000	0.22686	-0.363000	0.07593	-0.145000	0.11294	-0.519000	0.04390	GGA	C19orf33	-	NULL	ENSG00000167644		0.652	C19orf33-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C19orf33	HGNC	protein_coding	OTTHUMT00000458168.1	75	0.00	0	G	NM_033520		38794918	38794918	+1	no_errors	ENST00000301246	ensembl	human	known	69_37n	missense	53	23.19	16	SNP	0.000	A
CIART	148523	genome.wustl.edu	37	1	150255964	150255964	+	Missense_Mutation	SNP	G	G	C	rs377608254		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:150255964G>C	ENST00000290363.5	+	1	736	c.287G>C	c.(286-288)aGa>aCa	p.R96T	C1orf51_ENST00000469255.1_3'UTR|C1orf51_ENST00000369094.1_Missense_Mutation_p.R8T|C1orf51_ENST00000369095.1_Missense_Mutation_p.R96T	NM_144697.2	NP_653298.1	Q8N365	CIART_HUMAN		96					circadian regulation of gene expression (GO:0032922)|locomotor rhythm (GO:0045475)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|E-box binding (GO:0070888)			endometrium(3)|large_intestine(2)|lung(3)|urinary_tract(2)	10	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GGGGCGAAAAGATCAAGAGAT	0.527																																						dbGAP											0													100.0	95.0	97.0					1																	150255964		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000290363.5:c.287G>C	1.37:g.150255964G>C	ENSP00000290363:p.Arg96Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD43|D3DV01|Q8N795|Q96MG6	Missense_Mutation	SNP	NULL	p.R96T	ENST00000290363.5	37	c.287	CCDS949.1	1	.	.	.	.	.	.	.	.	.	.	G	17.06	3.293430	0.60086	.	.	ENSG00000159208	ENST00000447007;ENST00000369095;ENST00000369094;ENST00000417398;ENST00000290363	.	.	.	4.97	3.12	0.35913	.	0.629275	0.16795	N	0.199218	T	0.35595	0.0937	L	0.54323	1.7	0.32926	D	0.516529	D	0.53619	0.961	P	0.51324	0.666	T	0.29761	-1.0001	9	0.72032	D	0.01	-7.749	7.4699	0.27342	0.1933:0.0:0.8067:0.0	.	96	Q8N365	CA051_HUMAN	T	8;96;8;8;96	.	ENSP00000290363:R96T	R	+	2	0	C1orf51	148522588	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	2.260000	0.43267	0.695000	0.31675	0.655000	0.94253	AGA	C1orf51	-	NULL	ENSG00000159208		0.527	C1orf51-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C1orf51	HGNC	protein_coding	OTTHUMT00000035058.1	69	0.00	0	G			150255964	150255964	+1	no_errors	ENST00000290363	ensembl	human	known	69_37n	missense	83	21.50	23	SNP	1.000	C
C9orf131	138724	genome.wustl.edu	37	9	35043842	35043842	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:35043842G>A	ENST00000312292.5	+	2	1263	c.1216G>A	c.(1216-1218)Gat>Aat	p.D406N	C9orf131_ENST00000421362.2_Missense_Mutation_p.D358N|C9orf131_ENST00000354479.5_Missense_Mutation_p.D333N|FLJ00273_ENST00000595331.1_5'Flank	NM_001040410.1|NM_203299.2	NP_001035500.1|NP_976044.2	Q5VYM1	CI131_HUMAN	chromosome 9 open reading frame 131	406										cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(23)|prostate(2)|skin(2)|stomach(1)	39	all_epithelial(49;0.22)		LUSC - Lung squamous cell carcinoma(32;0.00117)|Lung(28;0.00309)			TTCCCTGGAAGATCCATCCAG	0.537																																						dbGAP											0													74.0	83.0	80.0					9																	35043842		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045643	CCDS6572.2, CCDS47961.1, CCDS47962.1	9p13.3	2008-02-05			ENSG00000174038	ENSG00000174038			31418	protein-coding gene	gene with protein product							Standard	NM_001287391		Approved	MGC41945	uc003zvw.3	Q5VYM1	OTTHUMG00000019853	ENST00000312292.5:c.1216G>A	9.37:g.35043842G>A	ENSP00000308279:p.Asp406Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLE6|E9PB26|Q86XC6|Q9UF74	Missense_Mutation	SNP	NULL	p.D406N	ENST00000312292.5	37	c.1216	CCDS6572.2	9	.	.	.	.	.	.	.	.	.	.	G	8.083	0.772816	0.16051	.	.	ENSG00000174038	ENST00000421362;ENST00000354479;ENST00000312292	T;T;T	0.18174	2.24;2.23;2.25	4.37	1.45	0.22620	.	0.433346	0.19683	N	0.108473	T	0.08492	0.0211	N	0.17474	0.49	0.09310	N	1	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.17433	0.018;0.018;0.018	T	0.34329	-0.9833	10	0.23302	T	0.38	-0.2828	5.6382	0.17548	0.1883:0.0:0.653:0.1587	.	406;333;358	Q5VYM1;A6NLE6;E9PB26	CI131_HUMAN;.;.	N	358;333;406	ENSP00000393683:D358N;ENSP00000346472:D333N;ENSP00000308279:D406N	ENSP00000308279:D406N	D	+	1	0	C9orf131	35033842	0.061000	0.20836	0.008000	0.14137	0.075000	0.17131	0.590000	0.23954	0.212000	0.20703	-2.067000	0.00394	GAT	C9orf131	-	NULL	ENSG00000174038		0.537	C9orf131-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C9orf131	HGNC	protein_coding	OTTHUMT00000052283.5	100	0.00	0	G	NM_203299		35043842	35043842	+1	no_errors	ENST00000312292	ensembl	human	known	69_37n	missense	53	26.03	19	SNP	0.002	A
CACNG3	10368	genome.wustl.edu	37	16	24372874	24372874	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:24372874C>T	ENST00000005284.3	+	4	1840	c.638C>T	c.(637-639)tCg>tTg	p.S213L		NM_006539.3	NP_006530.1	O60359	CCG3_HUMAN	calcium channel, voltage-dependent, gamma subunit 3	213					calcium ion transport (GO:0006816)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(1)|endometrium(4)|kidney(2)|large_intestine(10)|lung(13)|ovary(2)|prostate(4)|skin(2)	40				GBM - Glioblastoma multiforme(48;0.0809)		AAATCCCACTCGGAGTTCCTG	0.507																																						dbGAP											0													113.0	105.0	108.0					16																	24372874		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF131911	CCDS10620.1	16p12.1	2008-05-14			ENSG00000006116	ENSG00000006116		"""Calcium channel subunits"""	1407	protein-coding gene	gene with protein product		606403				10221464, 10493829	Standard	NM_006539		Approved		uc002dmf.3	O60359	OTTHUMG00000131651	ENST00000005284.3:c.638C>T	16.37:g.24372874C>T	ENSP00000005284:p.Ser213Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_VDCC_gsu	p.S213L	ENST00000005284.3	37	c.638	CCDS10620.1	16	.	.	.	.	.	.	.	.	.	.	C	16.20	3.056790	0.55325	.	.	ENSG00000006116	ENST00000005284	T	0.55760	0.5	4.96	4.96	0.65561	.	0.185480	0.47852	D	0.000212	T	0.38108	0.1028	L	0.43152	1.355	0.42068	D	0.991197	P	0.43750	0.816	B	0.28011	0.085	T	0.39313	-0.9620	10	0.11182	T	0.66	-4.7479	17.8423	0.88718	0.0:1.0:0.0:0.0	.	213	O60359	CCG3_HUMAN	L	213	ENSP00000005284:S213L	ENSP00000005284:S213L	S	+	2	0	CACNG3	24280375	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.487000	0.81328	2.274000	0.75844	0.655000	0.94253	TCG	CACNG3	-	NULL	ENSG00000006116		0.507	CACNG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNG3	HGNC	protein_coding	OTTHUMT00000254548.1	207	0.00	0	C	NM_006539		24372874	24372874	+1	no_errors	ENST00000005284	ensembl	human	known	69_37n	missense	148	16.38	29	SNP	1.000	T
CAD	790	genome.wustl.edu	37	2	27449092	27449092	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:27449092C>T	ENST00000264705.4	+	13	2098	c.1936C>T	c.(1936-1938)Cag>Tag	p.Q646*	CAD_ENST00000403525.1_Intron	NM_004341.3	NP_004332.2	O76075	DFFB_HUMAN	carbamoyl-phosphate synthetase 2, aspartate transcarbamylase, and dihydroorotase	0					apoptotic chromosome condensation (GO:0030263)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|brain development (GO:0007420)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)			NS(1)|breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(40)|ovary(6)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	92	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CAGGGAGTATCAGCTCCTGAG	0.537																																						dbGAP											0													114.0	107.0	110.0					2																	27449092		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D78586	CCDS1742.1	2p22-p21	2012-10-02			ENSG00000084774	ENSG00000084774	2.1.3.2, 3.5.2.-		1424	protein-coding gene	gene with protein product		114010				8619816, 2565865	Standard	NM_004341		Approved		uc002rji.3	P27708	OTTHUMG00000097070	ENST00000264705.4:c.1936C>T	2.37:g.27449092C>T	ENSP00000264705:p.Gln646*	Somatic		WXS	Illumina GAIIx	Phase_IV	O60521|Q5SR22|Q9BYI4|Q9BYI5|Q9BYI6	Nonsense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_Asp/Orn_carbamoyltranf_P-bd,pfam_GATASE_1,pfam_Asp_carbamoyltransf_Asp/Orn-bd,pfam_CarbamoylP_synth_lsu_oligo,pfam_CarbamoylP_synth_lsu_N,pfam_ATP-grasp_carboxylate-amine,pfam_MGS-like_dom,pfam_Dala_Dala_lig_C,pfam_Amidohydro_1,superfamily_Asp/Orn_carbamoylTrfase,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,superfamily_Metal-dep_hydrolase_composite,smart_MGS-like_dom,pfscan_ATP-grasp,prints_CbamoylP_synth_lsu_CPSase_dom,prints_Asp_carbamoyltransf_euk,prints_Asp/Orn_carbamoylTrfase,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu,tigrfam_Asp_carbamoyltransf_euk	p.Q646*	ENST00000264705.4	37	c.1936	CCDS1742.1	2	.	.	.	.	.	.	.	.	.	.	C	42	9.431006	0.99169	.	.	ENSG00000084774	ENST00000264705	.	.	.	5.63	5.63	0.86233	.	0.352418	0.31660	N	0.007273	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	7.6471	0.28327	0.1648:0.7533:0.0:0.0819	.	.	.	.	X	646	.	ENSP00000264705:Q646X	Q	+	1	0	CAD	27302596	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	1.842000	0.39250	2.662000	0.90505	0.555000	0.69702	CAG	CAD	-	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu	ENSG00000084774		0.537	CAD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAD	HGNC	protein_coding	OTTHUMT00000214186.2	220	0.00	0	C			27449092	27449092	+1	no_errors	ENST00000264705	ensembl	human	known	69_37n	nonsense	133	45.31	111	SNP	1.000	T
CADPS	8618	genome.wustl.edu	37	3	62477092	62477092	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:62477092C>G	ENST00000383710.4	-	21	3297	c.2948G>C	c.(2947-2949)aGa>aCa	p.R983T	CADPS_ENST00000283269.9_Missense_Mutation_p.R993T|CADPS_ENST00000357948.3_Missense_Mutation_p.R953T	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	983	Interaction with DRD2.|MHD1. {ECO:0000255|PROSITE- ProRule:PRU00587}.				catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		ATCCACATATCTAACAACAAG	0.418																																						dbGAP											0													157.0	152.0	154.0					3																	62477092		2203	4300	6503	-	-	-	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.2948G>C	3.37:g.62477092C>G	ENSP00000373215:p.Arg983Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R983T	ENST00000383710.4	37	c.2948	CCDS46858.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.084035|5.084035	0.94100|0.94100	.|.	.|.	ENSG00000163618|ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269|ENST00000491424	T;T;T|.	0.31510|.	1.49;1.49;1.49|.	5.79|5.79	5.79|5.79	0.91817|0.91817	Munc13 homology 1 (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|.	0.82019|.	0.4946|.	M|M	0.79693|0.79693	2.465|2.465	0.80722|0.80722	D|D	1|1	D;D;P;D|.	0.89917|.	1.0;0.981;0.666;0.99|.	D;D;B;P|.	0.91635|.	0.999;0.962;0.162;0.897|.	T|.	0.81484|.	-0.0912|.	10|.	0.87932|.	D|.	0|.	.|.	20.0371|20.0371	0.97565|0.97565	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	953;993;983;983|.	Q9ULU8-2;Q9ULU8-3;Q9ULU8;Q9ULU8-4|.	.;.;CAPS1_HUMAN;.|.	T|Y	983;983;953;993|285	ENSP00000373215:R983T;ENSP00000350632:R953T;ENSP00000283269:R993T|.	ENSP00000283269:R993T|.	R|X	-|-	2|3	0|2	CADPS|CADPS	62452132|62452132	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.818000|7.818000	0.86416|0.86416	2.734000|2.734000	0.93682|0.93682	0.655000|0.655000	0.94253|0.94253	AGA|TAG	CADPS	-	NULL	ENSG00000163618		0.418	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	265	0.00	0	C	NM_003716, NM_183393, NM_183394		62477092	62477092	-1	no_errors	ENST00000383710	ensembl	human	known	69_37n	missense	118	19.73	29	SNP	1.000	G
CAMTA1	23261	genome.wustl.edu	37	1	7309644	7309644	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:7309644G>A	ENST00000303635.7	+	5	603	c.396G>A	c.(394-396)acG>acA	p.T132T	CAMTA1_ENST00000439411.2_Silent_p.T132T	NM_015215.2	NP_056030.1	Q9Y6Y1	CMTA1_HUMAN	calmodulin binding transcription activator 1	132					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(11)|lung(29)|ovary(5)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	85	Ovarian(185;0.0634)	all_epithelial(116;8.38e-23)|all_lung(118;5.87e-07)|Lung NSC(185;3.43e-06)|Renal(390;0.000219)|Breast(487;0.000307)|Colorectal(325;0.000615)|Hepatocellular(190;0.0088)|Myeloproliferative disorder(586;0.0303)|Ovarian(437;0.0388)		UCEC - Uterine corpus endometrioid carcinoma (279;0.101)|Colorectal(212;1.33e-05)|COAD - Colon adenocarcinoma(227;0.000235)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|Kidney(185;0.00244)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0179)|READ - Rectum adenocarcinoma(331;0.133)		ATGGGAAAACGACCAGAGAGG	0.458			T	WWTR1	epitheliod hemangioendothelioma																																	dbGAP		Dom	yes		1	1p36.31-p36.23	611501	calmodulin binding transcription activator 1		M	0													126.0	114.0	118.0					1																	7309644		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020640	CCDS30576.1, CCDS55574.1, CCDS55575.1	1p36.31-p36.23	2008-07-18			ENSG00000171735	ENSG00000171735			18806	protein-coding gene	gene with protein product		611501				11925432	Standard	NM_001195563		Approved	KIAA0833	uc001aoi.3	Q9Y6Y1	OTTHUMG00000001212	ENST00000303635.7:c.396G>A	1.37:g.7309644G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM4|G3V3Z7|Q5VUE1|Q6V701|Q8WYI3|Q96S92	Silent	SNP	pfam_CG-1_dom,pfam_IPT_TIG_rcpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ig_E-set,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS	p.T132	ENST00000303635.7	37	c.396	CCDS30576.1	1																																																																																			CAMTA1	-	pfam_CG-1_dom	ENSG00000171735		0.458	CAMTA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CAMTA1	HGNC	protein_coding	OTTHUMT00000003588.3	271	0.00	0	G	NM_015215		7309644	7309644	+1	no_errors	ENST00000303635	ensembl	human	known	69_37n	silent	168	22.22	48	SNP	1.000	A
CARD6	84674	genome.wustl.edu	37	5	40854270	40854270	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:40854270C>T	ENST00000254691.5	+	3	3035	c.2836C>T	c.(2836-2838)Cag>Tag	p.Q946*	CARD6_ENST00000381677.3_Intron	NM_032587.3	NP_115976.2	Q9BX69	CARD6_HUMAN	caspase recruitment domain family, member 6	946					apoptotic process (GO:0006915)|regulation of apoptotic process (GO:0042981)					NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(2)|lung(29)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	62						CAAATCCGATCAGTCCAACCC	0.507																																						dbGAP											0													190.0	209.0	202.0					5																	40854270		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF356193	CCDS3935.1	5p13.1	2008-05-23			ENSG00000132357	ENSG00000132357			16394	protein-coding gene	gene with protein product		609986				12775719	Standard	NM_032587		Approved	CINCIN1	uc003jmg.3	Q9BX69	OTTHUMG00000094775	ENST00000254691.5:c.2836C>T	5.37:g.40854270C>T	ENSP00000254691:p.Gln946*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LR2	Nonsense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,smart_CARD,pfscan_CARD	p.Q946*	ENST00000254691.5	37	c.2836	CCDS3935.1	5	.	.	.	.	.	.	.	.	.	.	C	37	6.159282	0.97334	.	.	ENSG00000132357	ENST00000254691	.	.	.	3.49	2.61	0.31194	.	0.824381	0.10321	N	0.688808	.	.	.	.	.	.	0.20638	N	0.999879	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	0.8061	7.0907	0.25282	0.0:0.8748:0.0:0.1252	.	.	.	.	X	946	.	ENSP00000254691:Q946X	Q	+	1	0	CARD6	40890027	0.888000	0.30383	0.001000	0.08648	0.066000	0.16364	4.364000	0.59479	1.060000	0.40578	0.313000	0.20887	CAG	CARD6	-	NULL	ENSG00000132357		0.507	CARD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD6	HGNC	protein_coding	OTTHUMT00000211584.3	426	0.23	1	C			40854270	40854270	+1	no_errors	ENST00000254691	ensembl	human	known	69_37n	nonsense	363	19.51	88	SNP	0.003	T
CCDC101	112869	genome.wustl.edu	37	16	28602948	28602948	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:28602948C>T	ENST00000317058.3	+	10	990	c.803C>T	c.(802-804)tCc>tTc	p.S268F		NM_138414.2	NP_612423.1	Q96ES7	SGF29_HUMAN	coiled-coil domain containing 101	268	SGF29 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00851}.				chromatin organization (GO:0006325)|establishment of protein localization to chromatin (GO:0071169)|histone H3 acetylation (GO:0043966)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|SAGA-type complex (GO:0070461)	methylated histone binding (GO:0035064)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(4)|skin(1)	10						GAAGACACCTCCTATGCAGAT	0.592																																						dbGAP											0													147.0	131.0	137.0					16																	28602948		2197	4300	6497	-	-	-	SO:0001583	missense	0			AK057008	CCDS10635.1	16p11.2	2010-08-03			ENSG00000176476	ENSG00000176476			25156	protein-coding gene	gene with protein product	"""SAGA-associated factor 29 homolog (yeast)"""	613374				17334388	Standard	NM_138414		Approved	FLJ32446, SGF29	uc002dqf.3	Q96ES7	OTTHUMG00000131763	ENST00000317058.3:c.803C>T	16.37:g.28602948C>T	ENSP00000316114:p.Ser268Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MF5	Missense_Mutation	SNP	pfam_SGF29_tudor-like_dom	p.S268F	ENST00000317058.3	37	c.803	CCDS10635.1	16	.	.	.	.	.	.	.	.	.	.	.	15.58	2.876531	0.51801	.	.	ENSG00000176476	ENST00000317058	T	0.34072	1.38	4.73	3.76	0.43208	SGF29 tudor-like domain (2);	0.210414	0.42172	D	0.000744	T	0.36082	0.0954	L	0.56769	1.78	0.80722	D	1	B	0.24092	0.097	B	0.26416	0.069	T	0.30822	-0.9965	10	0.72032	D	0.01	.	11.9372	0.52880	0.1753:0.8247:0.0:0.0	.	268	Q96ES7	SGF29_HUMAN	F	268	ENSP00000316114:S268F	ENSP00000316114:S268F	S	+	2	0	CCDC101	28510449	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.887000	0.63156	1.170000	0.42753	0.561000	0.74099	TCC	CCDC101	-	pfam_SGF29_tudor-like_dom	ENSG00000176476		0.592	CCDC101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC101	HGNC	protein_coding	OTTHUMT00000254691.1	260	0.00	0	C	NM_138414		28602948	28602948	+1	no_errors	ENST00000317058	ensembl	human	known	69_37n	missense	153	41.15	107	SNP	1.000	T
DRC7	84229	genome.wustl.edu	37	16	57760057	57760057	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:57760057G>A	ENST00000360716.3	+	14	2057	c.1836G>A	c.(1834-1836)gcG>gcA	p.A612A	CCDC135_ENST00000336825.8_Silent_p.A547A|CCDC135_ENST00000394337.4_Silent_p.A612A			Q8IY82	CC135_HUMAN		612					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)				breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						TTCTGGTCGCGGAGGAGCGCA	0.632																																						dbGAP											0													59.0	51.0	53.0					16																	57760057		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000360716.3:c.1836G>A	16.37:g.57760057G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	NULL	p.R202Q	ENST00000360716.3	37	c.605	CCDS10787.1	16																																																																																			CCDC135	-	NULL	ENSG00000159625		0.632	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC135	HGNC	protein_coding	OTTHUMT00000433323.2	49	0.00	0	G			57760057	57760057	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000562250	ensembl	human	putative	69_37n	missense	9	59.09	13	SNP	0.003	A
CCDC82	79780	genome.wustl.edu	37	11	96117522	96117522	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:96117522T>A	ENST00000278520.5	-	3	818	c.390A>T	c.(388-390)ttA>ttT	p.L130F	CCDC82_ENST00000542662.1_Missense_Mutation_p.L130F|CCDC82_ENST00000423339.2_Missense_Mutation_p.L130F|CCDC82_ENST00000525786.1_5'Flank			Q8N4S0	CCD82_HUMAN	coiled-coil domain containing 82	130										endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	19		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)		BRCA - Breast invasive adenocarcinoma(274;0.154)		CCTCTTGACTTAAATGTTTTT	0.323																																						dbGAP											0													172.0	173.0	173.0					11																	96117522		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF245436	CCDS8307.1	11q21	2006-03-09			ENSG00000149231	ENSG00000149231			26282	protein-coding gene	gene with protein product						12477932	Standard	NM_024725		Approved	FLJ23518	uc001pfx.4	Q8N4S0	OTTHUMG00000167678	ENST00000278520.5:c.390A>T	11.37:g.96117522T>A	ENSP00000278520:p.Leu130Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPU7|Q8WV71|Q9H2Q5|Q9H5E3	Missense_Mutation	SNP	NULL	p.L130F	ENST00000278520.5	37	c.390	CCDS8307.1	11	.	.	.	.	.	.	.	.	.	.	T	3.770	-0.047872	0.07407	.	.	ENSG00000149231	ENST00000278520;ENST00000542662;ENST00000423339;ENST00000538597	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.59	-4.87	0.03123	.	1.197140	0.05825	N	0.616421	T	0.17195	0.0413	L	0.34521	1.04	0.09310	N	1	B;B	0.33777	0.372;0.425	B;B	0.39419	0.299;0.229	T	0.25082	-1.0142	10	0.35671	T	0.21	.	1.0179	0.01511	0.217:0.2748:0.1133:0.3949	.	130;130	Q8N4S0-2;Q8N4S0	.;CCD82_HUMAN	F	130	ENSP00000278520:L130F;ENSP00000444010:L130F;ENSP00000397156:L130F;ENSP00000442723:L130F	ENSP00000278520:L130F	L	-	3	2	CCDC82	95757170	0.000000	0.05858	0.000000	0.03702	0.048000	0.14542	-0.682000	0.05185	-1.060000	0.03189	0.528000	0.53228	TTA	CCDC82	-	NULL	ENSG00000149231		0.323	CCDC82-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC82	HGNC	protein_coding	OTTHUMT00000395542.2	612	0.33	2	T	NM_024725		96117522	96117522	-1	no_errors	ENST00000278520	ensembl	human	known	69_37n	missense	160	64.52	291	SNP	0.000	A
CCDC88A	55704	genome.wustl.edu	37	2	55591121	55591121	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:55591121C>G	ENST00000436346.1	-	6	1292	c.451G>C	c.(451-453)Gat>Cat	p.D151H	CCDC88A_ENST00000413716.2_Missense_Mutation_p.D151H|CCDC88A_ENST00000336838.6_Missense_Mutation_p.D151H|CCDC88A_ENST00000263630.8_Missense_Mutation_p.D151H	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	151					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						GCTTTTGTATCAAAATCTAAA	0.299																																						dbGAP											0													67.0	70.0	69.0					2																	55591121		2203	4296	6499	-	-	-	SO:0001583	missense	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.451G>C	2.37:g.55591121C>G	ENSP00000410608:p.Asp151His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_t-SNARE	p.D151H	ENST00000436346.1	37	c.451		2	.	.	.	.	.	.	.	.	.	.	C	23.9	4.465054	0.84425	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716;ENST00000430086	T;T;T;T;T	0.17854	2.25;2.25;2.25;2.25;2.25	5.28	5.28	0.74379	.	0.000000	0.46758	U	0.000272	T	0.45357	0.1338	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.91635	0.984;0.998;0.999	T	0.45071	-0.9286	10	0.87932	D	0	-20.2445	18.919	0.92518	0.0:1.0:0.0:0.0	.	151;151;151	B7ZM78;Q3V6T2-2;Q3V6T2-3	.;.;.	H	151;151;151;151;76	ENSP00000338728:D151H;ENSP00000263630:D151H;ENSP00000410608:D151H;ENSP00000404431:D151H;ENSP00000399237:D76H	ENSP00000263630:D151H	D	-	1	0	CCDC88A	55444625	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.384000	0.79751	2.483000	0.83821	0.563000	0.77884	GAT	CCDC88A	-	pfam_HOOK	ENSG00000115355		0.299	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		228	0.00	0	C	NM_017571		55591121	55591121	-1	no_errors	ENST00000436346	ensembl	human	known	69_37n	missense	158	19.80	39	SNP	1.000	G
CD151	977	genome.wustl.edu	37	11	837971	837971	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:837971C>A	ENST00000397420.3	+	8	894	c.645C>A	c.(643-645)ttC>ttA	p.F215L	CD151_ENST00000322008.4_Missense_Mutation_p.F215L|CD151_ENST00000528011.1_Missense_Mutation_p.F213L|CD151_ENST00000397421.1_Missense_Mutation_p.F215L			P48509	CD151_HUMAN	CD151 molecule (Raph blood group)	215					cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|T cell proliferation (GO:0042098)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)			large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	3		all_cancers(49;2.31e-08)|all_epithelial(84;3.72e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.179)|all_lung(207;0.227)		all cancers(45;1.54e-25)|Epithelial(43;1.22e-24)|OV - Ovarian serous cystadenocarcinoma(40;6.91e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGGAGACCTTCATCCAGGAGC	0.667																																					Esophageal Squamous(14;501 559 15826 37823 38305)	dbGAP											0													90.0	79.0	83.0					11																	837971		2197	4295	6492	-	-	-	SO:0001583	missense	0			AL161965, BC013302, D29963	CCDS7719.1	11p15.5	2014-07-18	2006-03-28		ENSG00000177697	ENSG00000177697		"""CD molecules"", ""Blood group antigens"", ""Tetraspanins"""	1630	protein-coding gene	gene with protein product		602243	"""CD151 antigen"", ""CD151 antigen (Raph blood group)"""			9070943	Standard	NM_004357		Approved	SFA-1, PETA-3, TSPAN24, RAPH	uc001lsb.3	P48509	OTTHUMG00000133311	ENST00000397420.3:c.645C>A	11.37:g.837971C>A	ENSP00000380565:p.Phe215Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAK8|E9PI15|Q14826|Q86U54|Q96TE3	Missense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.F215L	ENST00000397420.3	37	c.645	CCDS7719.1	11	.	.	.	.	.	.	.	.	.	.	C	19.76	3.888399	0.72524	.	.	ENSG00000177697	ENST00000397420;ENST00000322008;ENST00000397421;ENST00000528143;ENST00000528011	T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33	4.57	3.66	0.41972	Tetraspanin, EC2 domain (1);	0.088728	0.85682	D	0.000000	D	0.83110	0.5183	L	0.58510	1.815	0.80722	D	1	P	0.51933	0.949	P	0.58331	0.837	T	0.80779	-0.1230	10	0.36615	T	0.2	.	8.9109	0.35552	0.0:0.8271:0.0:0.1729	.	215	P48509	CD151_HUMAN	L	215;215;215;91;213	ENSP00000380565:F215L;ENSP00000324101:F215L;ENSP00000380566:F215L;ENSP00000432990:F213L	ENSP00000324101:F215L	F	+	3	2	CD151	827971	1.000000	0.71417	1.000000	0.80357	0.520000	0.34377	1.779000	0.38624	1.148000	0.42385	-0.258000	0.10820	TTC	CD151	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000177697		0.667	CD151-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD151	HGNC	protein_coding	OTTHUMT00000257108.1	352	0.28	1	C	NM_004357		837971	837971	+1	no_errors	ENST00000322008	ensembl	human	known	69_37n	missense	178	23.93	56	SNP	1.000	A
CD1D	912	genome.wustl.edu	37	1	158152865	158152865	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:158152865G>A	ENST00000368171.3	+	5	1304	c.805G>A	c.(805-807)Gtg>Atg	p.V269M		NM_001766.3	NP_001757.1	P15813	CD1D_HUMAN	CD1d molecule	269	Ig-like.				antigen processing and presentation, endogenous lipid antigen via MHC class Ib (GO:0048006)|detection of bacterium (GO:0016045)|heterotypic cell-cell adhesion (GO:0034113)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of T cell proliferation (GO:0042102)|T cell selection (GO:0045058)|viral process (GO:0016032)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)	beta-2-microglobulin binding (GO:0030881)|cell adhesion molecule binding (GO:0050839)|exogenous lipid antigen binding (GO:0030884)|histone binding (GO:0042393)|lipid antigen binding (GO:0030882)|receptor activity (GO:0004872)			endometrium(1)|kidney(2)|large_intestine(2)|lung(19)|ovary(1)|prostate(3)|urinary_tract(2)	30	all_hematologic(112;0.0378)					AACCCTGGATGTGGTGGCTGG	0.622																																						dbGAP											0													109.0	97.0	101.0					1																	158152865		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC027926	CCDS1173.1	1q23.1	2014-01-14	2006-03-28		ENSG00000158473	ENSG00000158473		"""CD molecules"", ""Immunoglobulin superfamily / C1-set domain containing"""	1637	protein-coding gene	gene with protein product		188410	"""CD1D antigen, d polypeptide"", ""CD1d antigen"""			2463622	Standard	NM_001766		Approved		uc001frr.3	P15813	OTTHUMG00000022436	ENST00000368171.3:c.805G>A	1.37:g.158152865G>A	ENSP00000357153:p.Val269Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVD5|Q5W0J3|Q9UMM3|Q9Y5M4	Missense_Mutation	SNP	pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.V269M	ENST00000368171.3	37	c.805	CCDS1173.1	1	.	.	.	.	.	.	.	.	.	.	G	11.79	1.743808	0.30865	.	.	ENSG00000158473	ENST00000368171	T	0.03607	3.87	5.18	3.17	0.36434	Immunoglobulin-like (1);MHC class I-like antigen recognition (1);Immunoglobulin C1-set (2);	0.000000	0.45126	D	0.000392	T	0.06735	0.0172	M	0.72353	2.195	0.09310	N	0.999997	D	0.89917	1.0	D	0.97110	1.0	T	0.10613	-1.0622	10	0.72032	D	0.01	-27.2391	5.3296	0.15924	0.1024:0.0:0.6946:0.2029	.	269	P15813	CD1D_HUMAN	M	269	ENSP00000357153:V269M	ENSP00000357153:V269M	V	+	1	0	CD1D	156419489	0.980000	0.34600	0.307000	0.25127	0.038000	0.13279	1.871000	0.39539	2.562000	0.86427	0.655000	0.94253	GTG	CD1D	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000158473		0.622	CD1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD1D	HGNC	protein_coding	OTTHUMT00000058340.1	242	0.00	0	G	NM_001766		158152865	158152865	+1	no_errors	ENST00000368171	ensembl	human	known	69_37n	missense	315	12.26	44	SNP	0.102	A
CD83	9308	genome.wustl.edu	37	6	14131891	14131891	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:14131891C>T	ENST00000379153.3	+	3	465	c.294C>T	c.(292-294)acC>acT	p.T98T		NM_001040280.1|NM_001251901.1|NM_004233.3	NP_001035370.1|NP_001238830.1|NP_004224.1	Q01151	CD83_HUMAN	CD83 molecule	98	Ig-like V-type.				defense response (GO:0006952)|humoral immune response (GO:0006959)|negative regulation of interleukin-4 production (GO:0032713)|positive regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043372)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-2 production (GO:0032743)|response to organic cyclic compound (GO:0014070)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(2)|endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)	12	Breast(50;0.00245)|Ovarian(93;0.137)	all_hematologic(90;0.117)				GAAACACTACCAGCTGCAACT	0.537																																						dbGAP											0													148.0	135.0	140.0					6																	14131891		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z11697	CCDS4532.1, CCDS75403.1	6p23	2013-01-11	2006-03-31		ENSG00000112149	ENSG00000112149		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1703	protein-coding gene	gene with protein product		604534	"""CD83 antigen (activated B lymphocytes, immunoglobulin superfamily)"", ""CD83 molecule """			1378080, 8422464	Standard	NM_001251901		Approved	HB15, BL11	uc003nbi.3	Q01151	OTTHUMG00000014283	ENST00000379153.3:c.294C>T	6.37:g.14131891C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5THX9	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.T98	ENST00000379153.3	37	c.294	CCDS4532.1	6																																																																																			CD83	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	ENSG00000112149		0.537	CD83-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD83	HGNC	protein_coding	OTTHUMT00000039916.1	257	0.00	0	C			14131891	14131891	+1	no_errors	ENST00000379153	ensembl	human	known	69_37n	silent	199	19.35	48	SNP	0.024	T
CDC42BPB	9578	genome.wustl.edu	37	14	103442325	103442325	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:103442325C>T	ENST00000361246.2	-	10	1570	c.1282G>A	c.(1282-1284)Gag>Aag	p.E428K		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		TGCACATCCTCATCTTTGGTT	0.498																																						dbGAP											0													102.0	103.0	103.0					14																	103442325		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.1282G>A	14.37:g.103442325C>T	ENSP00000355237:p.Glu428Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.E428K	ENST00000361246.2	37	c.1282	CCDS9978.1	14	.	.	.	.	.	.	.	.	.	.	C	10.12	1.262595	0.23051	.	.	ENSG00000198752	ENST00000361246	T	0.63913	-0.07	5.59	5.59	0.84812	.	0.259824	0.43110	D	0.000614	T	0.54549	0.1865	L	0.54323	1.7	0.50039	D	0.999849	B	0.19583	0.037	B	0.20184	0.028	T	0.50329	-0.8841	10	0.07175	T	0.84	.	14.7689	0.69659	0.0:0.9291:0.0:0.0709	.	428	Q9Y5S2	MRCKB_HUMAN	K	428	ENSP00000355237:E428K	ENSP00000355237:E428K	E	-	1	0	CDC42BPB	102512078	0.003000	0.15002	0.411000	0.26484	0.951000	0.60555	1.323000	0.33701	2.622000	0.88805	0.650000	0.86243	GAG	CDC42BPB	-	NULL	ENSG00000198752		0.498	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	262	0.00	0	C	NM_006035		103442325	103442325	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	missense	180	20.70	47	SNP	0.988	T
CDH1	999	genome.wustl.edu	37	16	68772257	68772257	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:68772257delA	ENST00000261769.5	+	2	297	c.106delA	c.(106-108)agcfs	p.S36fs	CDH1_ENST00000422392.2_Frame_Shift_Del_p.S36fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	36					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.V17fs*1(3)|p.?(2)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TGACGCCGAGAGCTACACGTT	0.701			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	5	Deletion - Frameshift(3)|Unknown(2)	breast(5)											16.0	17.0	17.0					16																	68772257		1863	3508	5371	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.106delA	16.37:g.68772257delA	ENSP00000261769:p.Ser36fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S36fs	ENST00000261769.5	37	c.106	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000039068		0.701	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	30	0.00	0	A	NM_004360		68772257	68772257	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	8	63.64	14	DEL	0.989	-
CDH22	64405	genome.wustl.edu	37	20	44828148	44828148	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:44828148G>T	ENST00000372262.3	-	7	1737	c.1337C>A	c.(1336-1338)gCg>gAg	p.A446E	CDH22_ENST00000537909.1_Missense_Mutation_p.A446E	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	446	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				GCCTGTGTCCGCATCGATATC	0.637																																						dbGAP											0													65.0	49.0	54.0					20																	44828148		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.1337C>A	20.37:g.44828148G>T	ENSP00000361336:p.Ala446Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK7|O43205	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A446E	ENST00000372262.3	37	c.1337	CCDS13395.1	20	.	.	.	.	.	.	.	.	.	.	G	10.32	1.316325	0.23908	.	.	ENSG00000149654	ENST00000372262;ENST00000537909	T;T	0.50277	0.75;0.75	5.0	1.77	0.24775	Cadherin (4);Cadherin-like (1);	0.126896	0.53938	D	0.000048	T	0.33411	0.0862	N	0.21508	0.67	0.36308	D	0.857474	B	0.12013	0.005	B	0.20184	0.028	T	0.21724	-1.0237	10	0.36615	T	0.2	.	13.4137	0.60956	0.0:0.0:0.6658:0.3342	.	446	Q9UJ99	CAD22_HUMAN	E	446	ENSP00000361336:A446E;ENSP00000437790:A446E	ENSP00000361336:A446E	A	-	2	0	CDH22	44261555	0.996000	0.38824	0.997000	0.53966	0.077000	0.17291	3.133000	0.50531	0.186000	0.20125	-0.226000	0.12346	GCG	CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000149654		0.637	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	62	0.00	0	G	NM_021248		44828148	44828148	-1	no_errors	ENST00000372262	ensembl	human	known	69_37n	missense	35	37.50	21	SNP	0.980	T
MMP23B	8510	genome.wustl.edu	37	1	1572319	1572319	+	IGR	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:1572319G>C	ENST00000356026.5	+	0	1326				CDK11B_ENST00000341832.6_Silent_p.A536A|CDK11B_ENST00000340677.5_Silent_p.A570A|CDK11B_ENST00000407249.3_Silent_p.A583A|CDK11B_ENST00000317673.7_Silent_p.A581A			O75900	MMP23_HUMAN	matrix metallopeptidase 23B						proteolysis (GO:0006508)|reproduction (GO:0000003)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			large_intestine(1)	1	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.61e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;5.26e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.54e-23)|GBM - Glioblastoma multiforme(42;9e-08)|Colorectal(212;0.000155)|COAD - Colon adenocarcinoma(227;0.000193)|Kidney(185;0.00227)|STAD - Stomach adenocarcinoma(132;0.00644)|BRCA - Breast invasive adenocarcinoma(365;0.00786)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)	Marimastat(DB00786)	CCGGGGTGTAGGCCTTCAGAG	0.682																																						dbGAP											0													41.0	51.0	48.0					1																	1572319		2068	4192	6260	-	-	-	SO:0001628	intergenic_variant	0				CCDS30559.1	1p36.3	2013-01-11	2005-08-08		ENSG00000189409	ENSG00000189409		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7171	protein-coding gene	gene with protein product	"""matrix metalloproteinase 22"", ""femalysin"", ""matrix metalloproteinase in the female reproductive tract"""	603321	"""matrix metalloproteinase 23B"""	MMP22		9740677, 9750192	Standard	XM_005244810		Approved	MIFR, MIFR-1	uc001agp.3	O75900	OTTHUMG00000074713		1.37:g.1572319G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2AGN0|A2AGN1|O75894|O75895|Q5QPQ8|Q76P96|Q7LDM6|Q7LDM7|Q9UBR9|Q9UJK8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L416V	ENST00000356026.5	37	c.1246	CCDS30559.1	1																																																																																			CDK11B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000248333		0.682	MMP23B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK11B	HGNC	protein_coding	OTTHUMT00000158492.2	115	0.00	0	G	NM_006983		1572319	1572319	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000513088	ensembl	human	putative	69_37n	missense	57	29.63	24	SNP	1.000	C
CDK11A	728642	genome.wustl.edu	37	1	1647791	1647791	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:1647791C>T	ENST00000378633.1	-	5	531	c.452G>A	c.(451-453)aGa>aAa	p.R151K	CDK11A_ENST00000356200.3_Missense_Mutation_p.R127K|CDK11A_ENST00000404249.3_Missense_Mutation_p.R161K|RP1-283E3.8_ENST00000598846.1_RNA|CDK11A_ENST00000358779.5_Missense_Mutation_p.R151K|CDK11A_ENST00000357760.2_Missense_Mutation_p.R151K|CDK11A_ENST00000378635.3_Missense_Mutation_p.R151K|CDK11A_ENST00000378638.2_Missense_Mutation_p.R127K			Q9UQ88	CD11A_HUMAN	cyclin-dependent kinase 11A	151	Glu-rich.				apoptotic process (GO:0006915)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(1)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(4)|stomach(1)|urinary_tract(1)	18						TCACCTTTCTCTCCTGGAATG	0.498																																					Pancreas(186;965 2119 30274 40311 50569)	dbGAP											0													209.0	210.0	210.0					1																	1647791		2011	4174	6185	-	-	-	SO:0001583	missense	0			AF067522	CCDS44042.1, CCDS44043.1	1p36.33	2011-11-08	2009-12-16	2009-12-16	ENSG00000008128	ENSG00000008128		"""Cyclin-dependent kinases"""	1730	protein-coding gene	gene with protein product		116951	"""cell division cycle 2-like 2"", ""cell division cycle 2-like 2 (PITSLRE proteins)"""	CDC2L3, CDC2L2		7920654, 9750192, 19884882	Standard	NM_033529		Approved	PITSLRE, CDK11-p110, CDK11-p58, CDK11-p46, p58GTA		Q9UQ88	OTTHUMG00000000703	ENST00000378633.1:c.452G>A	1.37:g.1647791C>T	ENSP00000367900:p.Arg151Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95227|O95228|O96012|Q12821|Q12853|Q12854|Q2TAJ0|Q5QPR0|Q5QPR1|Q5QPR2|Q9UBC4|Q9UBI3|Q9UEI1|Q9UEI2|Q9UP53|Q9UP54|Q9UP55|Q9UP56|Q9UQ86|Q9UQ87|Q9UQ89	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R161K	ENST00000378633.1	37	c.482		1	.	.	.	.	.	.	.	.	.	.	-	17.72	3.459489	0.63401	.	.	ENSG00000008128	ENST00000356200;ENST00000404249;ENST00000357760;ENST00000358779;ENST00000378633;ENST00000378638;ENST00000378630;ENST00000378635;ENST00000479362	T;T;T;T;T;T;T;T	0.12147	2.71;2.71;2.71;2.71;2.71;2.71;2.71;2.71	4.56	3.64	0.41730	.	0.671525	0.12570	U	0.457391	T	0.23926	0.0579	L	0.29908	0.895	0.43959	D	0.996633	B;D;D;D;D;P;D;D;D;B;D;P	0.71674	0.43;0.982;0.958;0.972;0.99;0.902;0.972;0.998;0.994;0.234;0.996;0.85	B;D;P;P;P;D;P;D;P;B;D;P	0.81914	0.365;0.952;0.799;0.615;0.848;0.91;0.615;0.995;0.907;0.042;0.936;0.463	T	0.01283	-1.1396	10	0.30854	T	0.27	.	11.68	0.51453	0.0:0.9143:0.0:0.0857	.	161;151;161;151;161;151;127;153;151;119;163;163	B4E0M9;B4E0N4;E7ESP2;Q5QPR3;Q9UQ88-2;Q9UQ88-4;Q5QPR4;P21127-3;Q9UQ88;P21127-6;P21127-2;P21127	.;.;.;.;.;.;.;.;CD11A_HUMAN;.;.;CD11B_HUMAN	K	127;161;151;151;151;127;127;151;151	ENSP00000348529:R127K;ENSP00000384442:R161K;ENSP00000350403:R151K;ENSP00000351629:R151K;ENSP00000367900:R151K;ENSP00000367905:R127K;ENSP00000367902:R151K;ENSP00000423900:R151K	ENSP00000348529:R127K	R	-	2	0	CDK11A	1637651	1.000000	0.71417	0.996000	0.52242	0.215000	0.24574	6.260000	0.72502	1.132000	0.42129	0.543000	0.68304	AGA	CDK11A	-	NULL	ENSG00000008128		0.498	CDK11A-005	NOVEL	basic	protein_coding	CDK11A	HGNC	protein_coding	OTTHUMT00000001735.1	993	0.00	0	C	NM_024011		1647791	1647791	-1	no_errors	ENST00000404249	ensembl	human	known	69_37n	missense	685	15.52	126	SNP	1.000	T
CHD9	80205	genome.wustl.edu	37	16	53337714	53337714	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:53337714G>A	ENST00000398510.3	+	30	5883	c.5796G>A	c.(5794-5796)agG>agA	p.R1932R	CHD9_ENST00000447540.1_Silent_p.R1932R|CHD9_ENST00000564845.1_Silent_p.R1932R|CHD9_ENST00000566029.1_Silent_p.R1932R			Q3L8U1	CHD9_HUMAN	chromodomain helicase DNA binding protein 9	1932					cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(21)|lung(32)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	78		all_cancers(37;0.0212)				AACTTCTAAGGAAAGTACGGG	0.443																																						dbGAP											0													57.0	55.0	56.0					16																	53337714		1880	4110	5990	-	-	-	SO:0001819	synonymous_variant	0			AK022240	CCDS45485.1	16q12.2	2006-04-12				ENSG00000177200			25701	protein-coding gene	gene with protein product						9205841	Standard	XM_005256168		Approved	FLJ12178, KIAA0308, BC022889	uc002egy.3	Q3L8U1		ENST00000398510.3:c.5796G>A	16.37:g.53337714G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU2|B9ZVQ0|O15025|Q1WF12|Q6DTK9|Q9H9V7|Q9UHM2	Silent	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R1932	ENST00000398510.3	37	c.5796		16																																																																																			CHD9	-	NULL	ENSG00000177200		0.443	CHD9-020	KNOWN	basic	protein_coding	CHD9	HGNC	protein_coding	OTTHUMT00000422345.1	65	0.00	0	G	NM_025134		53337714	53337714	+1	no_errors	ENST00000398510	ensembl	human	known	69_37n	silent	19	38.71	12	SNP	0.968	A
CIT	11113	genome.wustl.edu	37	12	120166328	120166328	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:120166328G>A	ENST00000261833.7	-	27	3496	c.3444C>T	c.(3442-3444)ctC>ctT	p.L1148L	CIT_ENST00000537607.1_5'UTR|CIT_ENST00000392521.2_Silent_p.L1190L	NM_007174.2	NP_009105.1	O14578	CTRO_HUMAN	citron rho-interacting serine/threonine kinase	1148	Interaction with Rho/Rac.				cytokinesis (GO:0000910)|dendrite development (GO:0016358)|G2/M transition of mitotic cell cycle (GO:0000086)|generation of neurons (GO:0048699)|Golgi organization (GO:0007030)|intracellular signal transduction (GO:0035556)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|negative regulation of dendrite morphogenesis (GO:0050774)|regulation of actin polymerization or depolymerization (GO:0008064)|spermatogenesis (GO:0007283)	actin cytoskeleton (GO:0015629)|Golgi cisterna (GO:0031985)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|vacuole (GO:0005773)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(6)|endometrium(9)|kidney(4)|large_intestine(15)|liver(1)|lung(29)|ovary(7)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	86	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)	Myeloproliferative disorder(1001;0.0255)		BRCA - Breast invasive adenocarcinoma(302;0.211)		GCCTCTGTTTGAGCTCTCGTT	0.433																																						dbGAP											0													234.0	236.0	236.0					12																	120166328		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023166	CCDS9192.1, CCDS55891.1	12q24.23	2014-04-23	2014-04-23		ENSG00000122966	ENSG00000122966			1985	protein-coding gene	gene with protein product	"""serine/threonine kinase 21"""	605629	"""citron (rho-interacting, serine/threonine kinase 21)"""			9792683	Standard	NM_001206999		Approved	KIAA0949, STK21, CRIK	uc001txj.2	O14578	OTTHUMG00000134325	ENST00000261833.7:c.3444C>T	12.37:g.120166328G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M5E1|Q6XUH8|Q86UQ9|Q9UPZ7	Missense_Mutation	SNP	pfam_Citron,pfam_Pkinase_C,superfamily_HR1_rho-bd,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.S776L	ENST00000261833.7	37	c.2327	CCDS9192.1	12	.	.	.	.	.	.	.	.	.	.	G	9.468	1.094991	0.20471	.	.	ENSG00000122966	ENST00000392520	.	.	.	5.59	4.7	0.59300	.	.	.	.	.	T	0.60038	0.2238	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57963	-0.7720	4	.	.	.	.	9.3737	0.38270	0.0723:0.0:0.7849:0.1429	.	.	.	.	L	776	.	.	S	-	2	0	CIT	118650711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.176000	0.50863	1.375000	0.46248	0.655000	0.94253	TCA	CIT	-	NULL	ENSG00000122966		0.433	CIT-001	KNOWN	basic|CCDS	protein_coding	CIT	HGNC	protein_coding	OTTHUMT00000259410.4	392	0.00	0	G	NM_007174		120166328	120166328	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000392520	ensembl	human	novel	69_37n	missense	281	18.97	66	SNP	1.000	A
COL6A2	1292	genome.wustl.edu	37	21	47549150	47549150	+	Intron	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr21:47549150C>G	ENST00000300527.4	+	27	2565				COL6A2_ENST00000310645.5_3'UTR|COL6A2_ENST00000397763.1_Silent_p.L834L|COL6A2_ENST00000357838.4_Silent_p.L834L|COL6A2_ENST00000409416.1_3'UTR	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2						axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		TCACCTTCCTCCGCACGGAAG	0.672																																						dbGAP											0													67.0	70.0	69.0					21																	47549150		2202	4299	6501	-	-	-	SO:0001627	intron_variant	0			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2461+2695C>G	21.37:g.47549150C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.L834	ENST00000300527.4	37	c.2502	CCDS13728.1	21																																																																																			COL6A2	-	NULL	ENSG00000142173		0.672	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	21	0.00	0	C			47549150	47549150	+1	no_errors	ENST00000357838	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	1.000	G
CPB1	1360	genome.wustl.edu	37	3	148559668	148559668	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:148559668G>A	ENST00000491148.1	+	7	867	c.533G>A	c.(532-534)aGa>aAa	p.R178K	CPB1_ENST00000282957.4_Missense_Mutation_p.R178K			P15086	CBPB1_HUMAN	carboxypeptidase B1 (tissue)	178						extracellular region (GO:0005576)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	38			LUSC - Lung squamous cell carcinoma(72;0.0934)|Lung(72;0.115)			TTCCATGCCAGAGAGTGGATT	0.393																																						dbGAP											0													176.0	168.0	170.0					3																	148559668		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ224866	CCDS33874.1	3q24	2012-02-10			ENSG00000153002	ENSG00000153002	3.4.17.2		2299	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase B"", ""tissue carboxypeptidase B"", ""protaminase"""	114852					Standard	XM_005247124		Approved		uc003ewl.3	P15086	OTTHUMG00000159520	ENST00000491148.1:c.533G>A	3.37:g.148559668G>A	ENSP00000417222:p.Arg178Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60834|Q53XJ0|Q96BQ8	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.R178K	ENST00000491148.1	37	c.533	CCDS33874.1	3	.	.	.	.	.	.	.	.	.	.	G	28.6	4.935443	0.92458	.	.	ENSG00000153002	ENST00000491148;ENST00000282957;ENST00000468341	T;T;T	0.37584	1.19;1.19;1.19	5.28	5.28	0.74379	Peptidase M14, carboxypeptidase A (4);	0.000000	0.85682	D	0.000000	T	0.74566	0.3733	H	0.96576	3.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.83848	0.0261	10	0.87932	D	0	.	19.2751	0.94029	0.0:0.0:1.0:0.0	.	178	P15086	CBPB1_HUMAN	K	178;178;144	ENSP00000417222:R178K;ENSP00000282957:R178K;ENSP00000419427:R144K	ENSP00000282957:R178K	R	+	2	0	CPB1	150042358	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.141000	0.94612	2.644000	0.89710	0.655000	0.94253	AGA	CPB1	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14	ENSG00000153002		0.393	CPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPB1	HGNC	protein_coding	OTTHUMT00000355928.1	587	0.00	0	G	NM_001871		148559668	148559668	+1	no_errors	ENST00000282957	ensembl	human	known	69_37n	missense	411	18.25	92	SNP	1.000	A
CPQ	10404	genome.wustl.edu	37	8	98041678	98041678	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:98041678G>A	ENST00000220763.5	+	6	1219	c.1009G>A	c.(1009-1011)Gaa>Aaa	p.E337K		NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	337					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										GACTGCAGAAGAACAAGGTGG	0.393																																						dbGAP											0													77.0	73.0	74.0					8																	98041678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.1009G>A	8.37:g.98041678G>A	ENSP00000220763:p.Glu337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.E337K	ENST00000220763.5	37	c.1009	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	G	26.6	4.753668	0.89753	.	.	ENSG00000104324	ENST00000220763	T	0.77877	-1.13	5.64	5.64	0.86602	Peptidase M28 (1);	0.000000	0.85682	D	0.000000	D	0.92260	0.7545	H	0.97707	4.06	0.51767	D	0.999933	D	0.89917	1.0	D	0.97110	1.0	D	0.94464	0.7679	10	0.87932	D	0	-15.4992	15.2088	0.73202	0.0:0.0:1.0:0.0	.	337	Q9Y646	PGCP_HUMAN	K	337	ENSP00000220763:E337K	ENSP00000220763:E337K	E	+	1	0	AC010859.1	98110854	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.445000	0.80570	2.646000	0.89796	0.655000	0.94253	GAA	CPQ	-	pfam_Peptidase_M28,pfam_Peptidase_M20	ENSG00000104324		0.393	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	206	0.48	1	G	NM_016134		98041678	98041678	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	missense	128	16.88	26	SNP	1.000	A
CSF2RB	1439	genome.wustl.edu	37	22	37325762	37325762	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr22:37325762C>T	ENST00000403662.3	+	6	853	c.631C>T	c.(631-633)Cga>Tga	p.R211*	CSF2RB_ENST00000536485.1_Nonsense_Mutation_p.R152*|CSF2RB_ENST00000262825.5_Nonsense_Mutation_p.R211*|CSF2RB_ENST00000406230.1_Nonsense_Mutation_p.R211*			P32927	IL3RB_HUMAN	colony stimulating factor 2 receptor, beta, low-affinity (granulocyte-macrophage)	211	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interleukin-3 (GO:0036016)|interleukin-3-mediated signaling pathway (GO:0038156)|interleukin-5-mediated signaling pathway (GO:0038043)|respiratory gaseous exchange (GO:0007585)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)	granulocyte macrophage colony-stimulating factor receptor complex (GO:0030526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(18)|ovary(3)|pancreas(1)|skin(5)|upper_aerodigestive_tract(2)	42					Sargramostim(DB00020)	CTACGTGGCCCGAGTACGGAC	0.652																																						dbGAP											0													44.0	44.0	44.0					22																	37325762		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M59941	CCDS13936.1	22q12.3	2014-09-09			ENSG00000100368	ENSG00000100368		"""CD molecules"", ""Fibronectin type III domain containing"""	2436	protein-coding gene	gene with protein product		138981		IL3RB		1833064, 1424804	Standard	NM_000395		Approved	IL5RB, CD131	uc003aqa.4	P32927	OTTHUMG00000150546	ENST00000403662.3:c.631C>T	22.37:g.37325762C>T	ENSP00000384053:p.Arg211*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZI1|Q6ICE0	Nonsense_Mutation	SNP	pirsf_IL3_rcpt_beta,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R211*	ENST00000403662.3	37	c.631	CCDS13936.1	22	.	.	.	.	.	.	.	.	.	.	C	17.15	3.316444	0.60524	.	.	ENSG00000100368	ENST00000403662;ENST00000539104;ENST00000262825;ENST00000406230;ENST00000421539;ENST00000536485	.	.	.	5.37	4.28	0.50868	.	0.861165	0.09692	N	0.768213	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.0941	12.4254	0.55544	0.1677:0.8323:0.0:0.0	.	.	.	.	X	211;211;211;211;131;152	.	ENSP00000262825:R211X	R	+	1	2	CSF2RB	35655708	1.000000	0.71417	1.000000	0.80357	0.061000	0.15899	2.660000	0.46749	2.659000	0.90383	0.655000	0.94253	CGA	CSF2RB	-	pirsf_IL3_rcpt_beta,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000100368		0.652	CSF2RB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSF2RB	HGNC	protein_coding	OTTHUMT00000318854.1	59	0.00	0	C	NM_000395		37325762	37325762	+1	no_errors	ENST00000262825	ensembl	human	known	69_37n	nonsense	39	18.75	9	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113364680	113364680	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:113364680C>T	ENST00000297405.5	-	39	6464	c.6220G>A	c.(6220-6222)Gta>Ata	p.V2074I	CSMD3_ENST00000455883.2_Missense_Mutation_p.V1970I|CSMD3_ENST00000343508.3_Missense_Mutation_p.V2034I|CSMD3_ENST00000352409.3_Missense_Mutation_p.V2004I	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2074	Sushi 11. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						TGAAAGGATACTACATCTCCA	0.338										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													108.0	99.0	102.0					8																	113364680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.6220G>A	8.37:g.113364680C>T	ENSP00000297405:p.Val2074Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.V2074I	ENST00000297405.5	37	c.6220	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962051	0.92791	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.68331	-0.32;-0.32;-0.32;-0.32;-0.32	4.96	4.96	0.65561	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000005	T	0.74473	0.3721	L	0.60455	1.87	0.54753	D	0.999987	P;P;P	0.47910	0.902;0.499;0.653	P;B;B	0.53760	0.734;0.306;0.409	T	0.72187	-0.4366	10	0.35671	T	0.21	.	18.7468	0.91795	0.0:1.0:0.0:0.0	.	1970;2074;2034	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	I	2034;2074;1344;1970;2004	ENSP00000345799:V2034I;ENSP00000297405:V2074I;ENSP00000341558:V1344I;ENSP00000412263:V1970I;ENSP00000343124:V2004I	ENSP00000297405:V2074I	V	-	1	0	CSMD3	113433856	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	7.609000	0.82925	2.731000	0.93534	0.655000	0.94253	GTA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.338	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	188	0.00	0	C	NM_052900		113364680	113364680	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	137	32.51	66	SNP	1.000	T
CTRC	11330	genome.wustl.edu	37	1	15767045	15767045	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:15767045G>C	ENST00000375949.4	+	3	215	c.189G>C	c.(187-189)ttG>ttC	p.L63F	CTRC_ENST00000483406.1_3'UTR|CTRC_ENST00000375943.2_Intron	NM_007272.2	NP_009203.2	Q99895	CTRC_HUMAN	chymotrypsin C (caldecrin)	63	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				proteolysis (GO:0006508)		peptidase activity (GO:0008233)|serine-type endopeptidase activity (GO:0004252)			endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|prostate(1)	13		Breast(348;0.000207)|all_lung(284;0.00021)|Colorectal(325;0.000257)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)|Hepatocellular(190;0.0634)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.56e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|KIRC - Kidney renal clear cell carcinoma(229;0.00244)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		GCGGGACTTTGATTGCTAGCA	0.612																																						dbGAP											0													143.0	95.0	111.0					1																	15767045		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015118	CCDS156.1	1p36.21	2009-02-18			ENSG00000162438	ENSG00000162438	3.4.21.2		2523	protein-coding gene	gene with protein product	"""elastase 4"""	601405				8635596	Standard	NM_007272		Approved	CLCR, ELA4	uc001awi.1	Q99895	OTTHUMG00000002255	ENST00000375949.4:c.189G>C	1.37:g.15767045G>C	ENSP00000365116:p.Leu63Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K082|O00765|Q9NUH5	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	p.L63F	ENST00000375949.4	37	c.189	CCDS156.1	1	.	.	.	.	.	.	.	.	.	.	.	12.17	1.856619	0.32791	.	.	ENSG00000162438	ENST00000375949	D	0.97404	-4.37	5.05	3.09	0.35607	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.066033	0.56097	D	0.000039	D	0.98485	0.9495	M	0.89478	3.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.99129	1.0852	10	0.87932	D	0	-24.6535	14.5646	0.68165	0.0:0.5881:0.4119:0.0	.	63;63	A8MTQ9;Q99895	.;CTRC_HUMAN	F	63	ENSP00000365116:L63F	ENSP00000365116:L63F	L	+	3	2	CTRC	15639632	0.907000	0.30839	0.419000	0.26584	0.046000	0.14306	-0.060000	0.11712	0.651000	0.30788	0.563000	0.77884	TTG	CTRC	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_Peptidase_S1_S6	ENSG00000162438		0.612	CTRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTRC	HGNC	protein_coding	OTTHUMT00000006435.1	91	0.00	0	G	NM_007272		15767045	15767045	+1	no_errors	ENST00000375949	ensembl	human	known	69_37n	missense	64	22.62	19	SNP	0.997	C
CTSO	1519	genome.wustl.edu	37	4	156849527	156849527	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:156849527C>T	ENST00000433477.3	-	7	961	c.892G>A	c.(892-894)Gat>Aat	p.D298N		NM_001334.2	NP_001325.1	P43235	CATK_HUMAN	cathepsin O	305					bone resorption (GO:0045453)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|intramembranous ossification (GO:0001957)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|toll-like receptor signaling pathway (GO:0002224)	endolysosome lumen (GO:0036021)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	collagen binding (GO:0005518)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|fibronectin binding (GO:0001968)|proteoglycan binding (GO:0043394)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(3)|prostate(1)	16	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.05)|Kidney(143;0.0627)|COAD - Colon adenocarcinoma(41;0.148)		GCATAACCATCTACTCCCCAA	0.343																																					Pancreas(148;2303 2598 8989 35298)	dbGAP											0													110.0	103.0	105.0					4																	156849527		2203	4300	6503	-	-	-	SO:0001583	missense	0			X77383	CCDS3794.1	4q32.1	2012-10-03			ENSG00000256043	ENSG00000256043		"""Cathepsins"""	2542	protein-coding gene	gene with protein product		600550		CTSO1		9790772	Standard	NM_001334		Approved		uc003ipg.3	P43234	OTTHUMG00000161942	ENST00000433477.3:c.892G>A	4.37:g.156849527C>T	ENSP00000414904:p.Asp298Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHS6	Missense_Mutation	SNP	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C,prints_Peptidase_C1A_C	p.D298N	ENST00000433477.3	37	c.892	CCDS3794.1	4	.	.	.	.	.	.	.	.	.	.	C	15.62	2.886471	0.51908	.	.	ENSG00000256043	ENST00000433477	T	0.27256	1.68	5.32	4.47	0.54385	Peptidase C1A, papain C-terminal (2);	0.220251	0.46145	D	0.000302	T	0.15046	0.0363	N	0.22421	0.69	0.45852	D	0.998714	B	0.12013	0.005	B	0.17979	0.02	T	0.04029	-1.0983	10	0.02654	T	1	.	13.3601	0.60650	0.0:0.9238:0.0:0.0762	.	298	P43234	CATO_HUMAN	N	298	ENSP00000414904:D298N	ENSP00000281527:D298N	D	-	1	0	CTSO	157068977	0.967000	0.33354	0.175000	0.22980	0.956000	0.61745	2.769000	0.47654	2.507000	0.84556	0.650000	0.86243	GAT	CTSO	-	pfam_Peptidase_C1A_C,smart_Peptidase_C1A_C	ENSG00000256043		0.343	CTSO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTSO	HGNC	protein_coding	OTTHUMT00000366469.1	300	0.00	0	C	NM_001334		156849527	156849527	-1	no_errors	ENST00000433477	ensembl	human	known	69_37n	missense	177	38.33	110	SNP	0.977	T
CXorf22	170063	genome.wustl.edu	37	X	35966471	35966471	+	Silent	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:35966471C>G	ENST00000297866.5	+	4	624	c.558C>G	c.(556-558)ctC>ctG	p.L186L		NM_152632.3	NP_689845.2	Q6ZTR5	CX022_HUMAN	chromosome X open reading frame 22	186										breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(3)	44						TACCCATCCTCATTTTTCCAA	0.403																																						dbGAP											0													206.0	162.0	177.0					X																	35966471		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC027936	CCDS14237.2	Xp21.1	2014-08-07			ENSG00000165164	ENSG00000165164			28546	protein-coding gene	gene with protein product						12477932	Standard	NM_152632		Approved	MGC34831	uc004ddj.3	Q6ZTR5	OTTHUMG00000021350	ENST00000297866.5:c.558C>G	X.37:g.35966471C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRM8|Q8N6X8	Silent	SNP	superfamily_PapD-like	p.L186	ENST00000297866.5	37	c.558	CCDS14237.2	X																																																																																			CXorf22	-	superfamily_PapD-like	ENSG00000165164		0.403	CXorf22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf22	HGNC	protein_coding	OTTHUMT00000056216.2	438	0.00	0	C	NM_152632		35966471	35966471	+1	no_errors	ENST00000297866	ensembl	human	known	69_37n	silent	348	22.84	103	SNP	0.000	G
DCBLD1	285761	genome.wustl.edu	37	6	117846569	117846569	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:117846569C>T	ENST00000338728.5	+	5	677	c.557C>T	c.(556-558)tCt>tTt	p.S186F	DCBLD1_ENST00000368503.4_Missense_Mutation_p.S186F|GOPC_ENST00000467125.1_Intron|DCBLD1_ENST00000296955.8_Missense_Mutation_p.S186F			Q8N8Z6	DCBD1_HUMAN	discoidin, CUB and LCCL domain containing 1	186	LCCL. {ECO:0000255|PROSITE- ProRule:PRU00123}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_cancers(87;0.171)		GBM - Glioblastoma multiforme(226;0.0447)|OV - Ovarian serous cystadenocarcinoma(136;0.0921)|all cancers(137;0.125)		GGAGACATTTCTGGGAATATG	0.318																																						dbGAP											0													125.0	130.0	129.0					6																	117846569		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055462	CCDS34522.1	6q22.31	2003-06-20			ENSG00000164465	ENSG00000164465			21479	protein-coding gene	gene with protein product							Standard	NM_173674		Approved	MGC46341, dJ94G16.1	uc003pxs.3	Q8N8Z6	OTTHUMG00000015455	ENST00000338728.5:c.557C>T	6.37:g.117846569C>T	ENSP00000342422:p.Ser186Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H992|Q8IYK5|Q8N7L9|Q96NH2	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_LCCL,pfam_CUB,superfamily_Galactose-bd-like,superfamily_LCCL,superfamily_CUB,smart_CUB,smart_LCCL,smart_Coagulation_fac_5/8-C_type_dom,pfscan_CUB,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_LCCL	p.S186F	ENST00000338728.5	37	c.557		6	.	.	.	.	.	.	.	.	.	.	C	13.87	2.365130	0.41902	.	.	ENSG00000164465	ENST00000296955;ENST00000368503;ENST00000338728	D;D;D	0.89270	-2.49;-2.49;-2.49	5.37	0.478	0.16789	LCCL (4);	0.339062	0.32671	N	0.005787	T	0.68961	0.3058	L	0.41492	1.28	0.30046	N	0.81221	B;B	0.22746	0.074;0.026	B;B	0.28011	0.085;0.027	T	0.59134	-0.7511	10	0.87932	D	0	-3.5117	3.1812	0.06586	0.1225:0.5571:0.1188:0.2015	.	186;186	Q8N8Z6-2;Q8N8Z6	.;DCBD1_HUMAN	F	186	ENSP00000296955:S186F;ENSP00000357489:S186F;ENSP00000342422:S186F	ENSP00000296955:S186F	S	+	2	0	DCBLD1	117953262	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	0.919000	0.28692	-0.214000	0.10078	0.460000	0.39030	TCT	DCBLD1	-	pfam_LCCL,superfamily_LCCL,smart_LCCL,pfscan_LCCL	ENSG00000164465		0.318	DCBLD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	DCBLD1	HGNC	protein_coding	OTTHUMT00000041979.2	320	0.00	0	C	NM_173674		117846569	117846569	+1	no_errors	ENST00000338728	ensembl	human	known	69_37n	missense	244	20.26	62	SNP	0.999	T
DENND5B	160518	genome.wustl.edu	37	12	31545273	31545273	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:31545273C>G	ENST00000389082.5	-	19	3658	c.3394G>C	c.(3394-3396)Gag>Cag	p.E1132Q	DENND5B_ENST00000306833.6_Missense_Mutation_p.E1167Q|DENND5B_ENST00000536562.1_Missense_Mutation_p.E1167Q	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	1132	RUN 2. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						AAAACTTGCTCAAGGGCTGCA	0.448																																						dbGAP											0													59.0	57.0	58.0					12																	31545273		1905	4119	6024	-	-	-	SO:0001583	missense	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.3394G>C	12.37:g.31545273C>G	ENSP00000373734:p.Glu1132Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.E1167Q	ENST00000389082.5	37	c.3499	CCDS44857.1	12	.	.	.	.	.	.	.	.	.	.	C	17.65	3.442074	0.63067	.	.	ENSG00000170456	ENST00000389082;ENST00000306833;ENST00000536562	T;T;T	0.28255	1.62;1.62;1.62	4.59	3.7	0.42460	RUN (2);	0.000000	0.85682	D	0.000000	T	0.54013	0.1832	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.994	T	0.57260	-0.7842	10	0.48119	T	0.1	-23.2782	12.6867	0.56952	0.0:0.92:0.0:0.08	.	1132;1167	Q6ZUT9;G3V1S3	DEN5B_HUMAN;.	Q	1132;1167;1167	ENSP00000373734:E1132Q;ENSP00000306482:E1167Q;ENSP00000444889:E1167Q	ENSP00000306482:E1167Q	E	-	1	0	DENND5B	31436540	1.000000	0.71417	0.058000	0.19502	0.553000	0.35397	7.452000	0.80683	1.281000	0.44480	0.561000	0.74099	GAG	DENND5B	-	pfam_Run,pfscan_Run	ENSG00000170456		0.448	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	102	0.00	0	C	NM_144973		31545273	31545273	-1	no_errors	ENST00000306833	ensembl	human	known	69_37n	missense	62	37.00	37	SNP	1.000	G
DEPDC4	120863	genome.wustl.edu	37	12	100660753	100660753	+	Silent	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:100660753C>G	ENST00000416321.1	-	1	104	c.102G>C	c.(100-102)ctG>ctC	p.L34L	SCYL2_ENST00000360820.2_5'Flank	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	34				L -> G (in Ref. 2; AAH15117). {ECO:0000305}.	intracellular signal transduction (GO:0035556)					NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TTGGCCCGTTCAGCCCTGGGC	0.587																																						dbGAP											0													105.0	108.0	107.0					12																	100660753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.102G>C	12.37:g.100660753C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q496C8|Q96BW0	Silent	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.L34	ENST00000416321.1	37	c.102	CCDS9075.1	12																																																																																			DEPDC4	-	NULL	ENSG00000166153		0.587	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC4	HGNC	protein_coding	OTTHUMT00000408482.1	70	0.00	0	C	NM_152317		100660753	100660753	-1	no_errors	ENST00000378244	ensembl	human	known	69_37n	silent	40	23.08	12	SNP	0.000	G
DHRS7	51635	genome.wustl.edu	37	14	60616218	60616218	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:60616218G>A	ENST00000216500.5	-	7	1280	c.825C>T	c.(823-825)atC>atT	p.I275I	DHRS7_ENST00000536410.2_Silent_p.I225I|DHRS7_ENST00000557185.1_Silent_p.I275I|PCNXL4_ENST00000406949.1_Intron|PCNXL4_ENST00000553898.1_Intron|DHRS7_ENST00000553986.1_5'UTR			Q9Y394	DHRS7_HUMAN	dehydrogenase/reductase (SDR family) member 7	275						membrane (GO:0016020)	oxidoreductase activity (GO:0016491)			endometrium(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	5				OV - Ovarian serous cystadenocarcinoma(108;0.121)		TGGCCATGCTGATTAACATCA	0.393																																						dbGAP											0													105.0	100.0	102.0					14																	60616218		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF151844	CCDS9743.1	14q23.1	2011-09-20			ENSG00000100612	ENSG00000100612		"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 3"""	21524	protein-coding gene	gene with protein product	"""retinal short-chain dehydrogenase/reductase 4"", ""short chain dehydrogenase/reductase family 34C, member 1"""	612833				10800688, 10810093, 19027726	Standard	NM_016029		Approved	retDSR4, SDR34C1	uc001xes.3	Q9Y394	OTTHUMG00000140331	ENST00000216500.5:c.825C>T	14.37:g.60616218G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R896|Q9UKU2	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,prints_Glc/ribitol_DH,prints_DH_sc/Rdtase_SDR	p.S270L	ENST00000216500.5	37	c.809	CCDS9743.1	14	.	.	.	.	.	.	.	.	.	.	G	7.374	0.627423	0.14257	.	.	ENSG00000100612	ENST00000557751;ENST00000554101	.	.	.	5.7	1.87	0.25490	.	.	.	.	.	T	0.42108	0.1188	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24835	-1.0149	4	.	.	.	.	0.6441	0.00815	0.2831:0.129:0.3503:0.2376	.	.	.	.	L	143;270	.	.	S	-	2	0	DHRS7	59685971	0.011000	0.17503	0.011000	0.14972	0.986000	0.74619	-0.012000	0.12699	0.084000	0.17077	0.655000	0.94253	TCA	DHRS7	-	NULL	ENSG00000100612		0.393	DHRS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRS7	HGNC	protein_coding	OTTHUMT00000276947.2	189	0.00	0	G	NM_016029		60616218	60616218	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000554101	ensembl	human	putative	69_37n	missense	175	18.06	39	SNP	0.030	A
DIP2B	57609	genome.wustl.edu	37	12	51097988	51097988	+	Silent	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:51097988G>T	ENST00000301180.5	+	20	2425	c.2391G>T	c.(2389-2391)ctG>ctT	p.L797L		NM_173602.2	NP_775873.2	Q9P265	DIP2B_HUMAN	DIP2 disco-interacting protein 2 homolog B (Drosophila)	797						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(4)|large_intestine(15)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(6)|urinary_tract(2)	60						CAGGATTGCTGGGGTTTGTAG	0.393																																						dbGAP											0													168.0	156.0	160.0					12																	51097988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040896	CCDS31799.1	12q13.12	2012-10-02	2006-01-13		ENSG00000066084	ENSG00000066084			29284	protein-coding gene	gene with protein product		611379					Standard	XM_005269044		Approved	KIAA1463, FLJ34278	uc001rwv.3	Q9P265	OTTHUMG00000169475	ENST00000301180.5:c.2391G>T	12.37:g.51097988G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6B011|Q8N1L5|Q8NB38	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.L797	ENST00000301180.5	37	c.2391	CCDS31799.1	12																																																																																			DIP2B	-	pfam_AMP-dep_Synth/Lig	ENSG00000066084		0.393	DIP2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2B	HGNC	protein_coding	OTTHUMT00000404243.1	523	0.19	1	G	NM_173602		51097988	51097988	+1	no_errors	ENST00000301180	ensembl	human	known	69_37n	silent	259	45.82	219	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118464937	118464937	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:118464937G>A	ENST00000311085.8	+	10	1214	c.1134G>A	c.(1132-1134)ctG>ctA	p.L378L	DMXL1_ENST00000539542.1_Silent_p.L378L	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	378										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		TTACATCTCTGAGTCTAAATG	0.308																																						dbGAP											0													63.0	67.0	65.0					5																	118464937		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1134G>A	5.37:g.118464937G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L378	ENST00000311085.8	37	c.1134	CCDS4125.1	5																																																																																			DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.308	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	174	0.00	0	G	NM_005509		118464937	118464937	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	silent	134	21.18	36	SNP	0.999	A
DMXL1	1657	genome.wustl.edu	37	5	118582789	118582789	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:118582789G>C	ENST00000311085.8	+	43	9039	c.8959G>C	c.(8959-8961)Gag>Cag	p.E2987Q	DMXL1_ENST00000539542.1_Missense_Mutation_p.E3008Q|DMXL1_ENST00000505312.1_3'UTR	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	2987										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GATGCAAATTGAGACAGGGCC	0.408																																						dbGAP											0													100.0	101.0	101.0					5																	118582789		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.8959G>C	5.37:g.118582789G>C	ENSP00000309690:p.Glu2987Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E3008Q	ENST00000311085.8	37	c.9022	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	G	19.46	3.831100	0.71258	.	.	ENSG00000172869	ENST00000311085;ENST00000539542	T;T	0.01287	5.05;5.05	5.82	5.82	0.92795	WD40 repeat-like-containing domain (1);	0.050740	0.85682	D	0.000000	T	0.05823	0.0152	L	0.49350	1.555	0.80722	D	1	D;D	0.71674	0.998;0.995	D;P	0.64877	0.93;0.78	T	0.60078	-0.7333	10	0.18276	T	0.48	-15.0747	20.0989	0.97860	0.0:0.0:1.0:0.0	.	3008;2987	F5H269;Q9Y485	.;DMXL1_HUMAN	Q	2987;3008	ENSP00000309690:E2987Q;ENSP00000439479:E3008Q	ENSP00000309690:E2987Q	E	+	1	0	DMXL1	118610688	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.471000	0.97696	2.750000	0.94351	0.655000	0.94253	GAG	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.408	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	232	0.00	0	G	NM_005509		118582789	118582789	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	228	16.18	44	SNP	1.000	C
DNAH11	8701	genome.wustl.edu	37	7	21599382	21599382	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:21599382G>C	ENST00000409508.3	+	4	885	c.854G>C	c.(853-855)aGa>aCa	p.R285T	DNAH11_ENST00000328843.6_Missense_Mutation_p.R285T	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	285	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ATGATGAGGAGAGAAAATCTG	0.353									Kartagener syndrome																													dbGAP											0													58.0	54.0	56.0					7																	21599382		1859	4090	5949	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.854G>C	7.37:g.21599382G>C	ENSP00000475939:p.Arg285Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.R285T	ENST00000409508.3	37	c.854		7	.	.	.	.	.	.	.	.	.	.	G	9.316	1.056696	0.19907	.	.	ENSG00000105877	ENST00000328843	T	0.55760	0.5	5.93	-0.228	0.13098	Dynein heavy chain, domain-1 (1);	0.766687	0.12062	N	0.503032	T	0.45196	0.1330	L	0.40543	1.245	0.09310	N	1	B	0.32010	0.351	B	0.40199	0.322	T	0.41610	-0.9499	10	0.22109	T	0.4	.	10.1553	0.42818	0.5535:0.0:0.4465:0.0	.	285	Q96DT5	DYH11_HUMAN	T	285	ENSP00000330671:R285T	ENSP00000330671:R285T	R	+	2	0	DNAH11	21565907	0.050000	0.20438	0.477000	0.27303	0.930000	0.56654	-0.065000	0.11617	-0.108000	0.12066	-0.253000	0.11424	AGA	DNAH11	-	pfam_Dynein_heavy_dom-1	ENSG00000105877		0.353	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	223	0.00	0	G	NM_003777		21599382	21599382	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	192	19.92	48	SNP	0.006	C
DNAJA3	9093	genome.wustl.edu	37	16	4484516	4484516	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:4484516C>T	ENST00000262375.6	+	2	420	c.343C>T	c.(343-345)Cag>Tag	p.Q115*	DNAJA3_ENST00000572139.1_3'UTR|DNAJA3_ENST00000431375.2_Intron|DNAJA3_ENST00000355296.4_Nonsense_Mutation_p.Q115*	NM_005147.5	NP_005138.3	Q96EY1	DNJA3_HUMAN	DnaJ (Hsp40) homolog, subfamily A, member 3	115	J.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation-induced cell death of T cells (GO:0006924)|cell aging (GO:0007569)|mitochondrial DNA replication (GO:0006264)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of programmed cell death (GO:0043069)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of T cell proliferation (GO:0042102)|protein folding (GO:0006457)|protein stabilization (GO:0050821)|response to heat (GO:0009408)|response to interferon-gamma (GO:0034341)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|small GTPase mediated signal transduction (GO:0007264)|T cell differentiation in thymus (GO:0033077)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of plasma membrane (GO:0019897)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|interferon-gamma receptor binding (GO:0005133)|metal ion binding (GO:0046872)|NF-kappaB binding (GO:0051059)|protein kinase binding (GO:0019901)|small GTPase regulator activity (GO:0005083)|transcription factor binding (GO:0008134)			NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|upper_aerodigestive_tract(2)	15						AGCCTATTATCAGGTCTGTAT	0.433																																						dbGAP											0													163.0	151.0	155.0					16																	4484516		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			AF061749	CCDS10515.1, CCDS45400.1, CCDS66930.1	16p13.3	2011-09-02			ENSG00000103423	ENSG00000103423		"""Heat shock proteins / DNAJ (HSP40)"""	11808	protein-coding gene	gene with protein product		608382		TID1		9683573	Standard	NM_005147		Approved	hTid-1	uc002cwk.3	Q96EY1	OTTHUMG00000129470	ENST00000262375.6:c.343C>T	16.37:g.4484516C>T	ENSP00000262375:p.Gln115*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAJ5|B4DI33|E7ES32|O75472|Q8WUJ6|Q8WXJ3|Q96D76|Q96IV1|Q9NYH8	Nonsense_Mutation	SNP	pfam_DnaJ_N,pfam_DnaJ_C,pfam_HSP_DnaJ_Cys-rich_dom,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,superfamily_HSP_DnaJ_Cys-rich_dom,smart_DnaJ_N,pfscan_DnaJ_N,pfscan_HSP_DnaJ_Cys-rich_dom,prints_Hsp_DnaJ	p.Q115*	ENST00000262375.6	37	c.343	CCDS10515.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.820082	0.96989	.	.	ENSG00000103423	ENST00000262375;ENST00000355296	.	.	.	5.2	4.21	0.49690	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	-15.4331	14.2395	0.65948	0.1493:0.8507:0.0:0.0	.	.	.	.	X	115	.	ENSP00000262375:Q115X	Q	+	1	0	DNAJA3	4424517	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	5.803000	0.69129	2.413000	0.81919	0.655000	0.94253	CAG	DNAJA3	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	ENSG00000103423		0.433	DNAJA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNAJA3	HGNC	protein_coding	OTTHUMT00000251633.1	190	0.00	0	C			4484516	4484516	+1	no_errors	ENST00000262375	ensembl	human	known	69_37n	nonsense	150	23.08	45	SNP	1.000	T
DNAJB1	3337	genome.wustl.edu	37	19	14629014	14629014	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:14629014C>G	ENST00000254322.2	-	1	218	c.148G>C	c.(148-150)Gag>Cag	p.E50Q	DNAJB1_ENST00000396969.4_Intron	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	50	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)			NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		TCGTAGGCCTCAGCGATCTCC	0.682																																						dbGAP											0													53.0	36.0	42.0					19																	14629014		2203	4300	6503	-	-	-	SO:0001583	missense	0			D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.148G>C	19.37:g.14629014C>G	ENSP00000254322:p.Glu50Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX52	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E50Q	ENST00000254322.2	37	c.148	CCDS12312.1	19	.	.	.	.	.	.	.	.	.	.	N	36	5.665393	0.96745	.	.	ENSG00000132002	ENST00000254322	T	0.33216	1.42	4.9	4.9	0.64082	Heat shock protein DnaJ, N-terminal (5);Heat shock protein DnaJ, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.43255	0.1239	L	0.28740	0.885	0.80722	D	1	D	0.67145	0.996	D	0.69479	0.964	T	0.42649	-0.9439	10	0.87932	D	0	.	15.6186	0.76787	0.0:1.0:0.0:0.0	.	50	P25685	DNJB1_HUMAN	Q	50	ENSP00000254322:E50Q	ENSP00000254322:E50Q	E	-	1	0	DNAJB1	14490014	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.445000	0.80570	2.284000	0.76573	0.478000	0.44815	GAG	DNAJB1	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	ENSG00000132002		0.682	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB1	HGNC	protein_coding	OTTHUMT00000465987.1	21	0.00	0	C	NM_006145		14629014	14629014	-1	no_errors	ENST00000254322	ensembl	human	known	69_37n	missense	20	31.03	9	SNP	1.000	G
DNHD1	144132	genome.wustl.edu	37	11	6541509	6541509	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:6541509G>A	ENST00000527990.2	+	8	1827	c.1827G>A	c.(1825-1827)ctG>ctA	p.L609L	DNHD1_ENST00000354685.3_3'UTR|DNHD1_ENST00000254579.6_Silent_p.L609L			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	609					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		CGGATTCCCTGTATTCTGAAG	0.517																																						dbGAP											0													67.0	58.0	61.0					11																	6541509		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.1827G>A	11.37:g.6541509G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Silent	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.L609	ENST00000527990.2	37	c.1827	CCDS44532.1	11																																																																																			DNHD1	-	NULL	ENSG00000179532		0.517	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	189	0.00	0	G	NM_144666		6541509	6541509	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	silent	112	38.80	71	SNP	0.001	A
DNM2	1785	genome.wustl.edu	37	19	10870471	10870471	+	Silent	SNP	C	C	T	rs372012614		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:10870471C>T	ENST00000355667.6	+	2	299	c.219C>T	c.(217-219)ctC>ctT	p.L73L	DNM2_ENST00000359692.6_Silent_p.L73L|DNM2_ENST00000389253.4_Silent_p.L73L|DNM2_ENST00000314646.5_Silent_p.L73L|DNM2_ENST00000408974.4_Silent_p.L73L|DNM2_ENST00000585892.1_Silent_p.L73L	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	73	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TTCTGCAGCTCATCTTCTCAA	0.582			"""F, N, Splice, Mis, O"""		ETP ALL																																	dbGAP		Rec	yes		19	19p13.2	1785	dynamin 2		L	0													116.0	124.0	121.0					19																	10870471		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.219C>T	19.37:g.10870471C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.L73	ENST00000355667.6	37	c.219	CCDS45968.1	19																																																																																			DNM2	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin	ENSG00000079805		0.582	DNM2-001	KNOWN	basic|CCDS	protein_coding	DNM2	HGNC	protein_coding	OTTHUMT00000452592.1	288	0.00	0	C	NM_004945		10870471	10870471	+1	no_errors	ENST00000314646	ensembl	human	known	69_37n	silent	199	20.87	53	SNP	1.000	T
DUOX1	53905	genome.wustl.edu	37	15	45440507	45440507	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:45440507G>A	ENST00000321429.4	+	22	3087	c.2680G>A	c.(2680-2682)Gcc>Acc	p.A894T	DUOX1_ENST00000389037.3_Missense_Mutation_p.A894T|DUOX1_ENST00000561166.1_Missense_Mutation_p.A540T	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	894					cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		CCTGTCCAAGGCCCAGCTGGC	0.592																																						dbGAP											0													101.0	86.0	91.0					15																	45440507		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.2680G>A	15.37:g.45440507G>A	ENSP00000317997:p.Ala894Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.A894T	ENST00000321429.4	37	c.2680	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	G	12.15	1.851228	0.32699	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	T;T	0.64085	-0.08;-0.08	5.04	2.15	0.27550	EF-hand-like domain (1);	1.022720	0.07720	N	0.943563	T	0.56934	0.2019	L	0.55990	1.75	0.25838	N	0.984095	B;B	0.19445	0.036;0.001	B;B	0.24006	0.05;0.002	T	0.46638	-0.9177	10	0.31617	T	0.26	-6.4401	8.3881	0.32512	0.2594:0.0:0.7406:0.0	.	27;894	Q9NT13;Q9NRD9	.;DUOX1_HUMAN	T	894	ENSP00000317997:A894T;ENSP00000373689:A894T	ENSP00000317997:A894T	A	+	1	0	DUOX1	43227799	0.992000	0.36948	0.994000	0.49952	0.998000	0.95712	2.409000	0.44583	0.401000	0.25424	0.655000	0.94253	GCC	DUOX1	-	NULL	ENSG00000137857		0.592	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	296	0.00	0	G	NM_017434		45440507	45440507	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	171	41.30	121	SNP	0.519	A
DYRK1A	1859	genome.wustl.edu	37	21	38884772	38884772	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr21:38884772G>C	ENST00000398960.2	+	11	2305	c.2230G>C	c.(2230-2232)Gat>Cat	p.D744H	DYRK1A_ENST00000338785.3_3'UTR|DYRK1A_ENST00000339659.4_Missense_Mutation_p.D735H|DYRK1A_ENST00000455387.2_Missense_Mutation_p.D516H	NM_001396.3|NM_130438.2	NP_001387.2|NP_569122.1	Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A	744					circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						GCAAGGGGCTGATAGAGAAGA	0.443																																					Melanoma(114;464 1602 31203 43785 45765)	dbGAP											0													104.0	106.0	105.0					21																	38884772		2203	4300	6503	-	-	-	SO:0001583	missense	0			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000398960.2:c.2230G>C	21.37:g.38884772G>C	ENSP00000381932:p.Asp744His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D744H	ENST00000398960.2	37	c.2230	CCDS42925.1	21	.	.	.	.	.	.	.	.	.	.	G	17.48	3.399453	0.62177	.	.	ENSG00000157540	ENST00000339659;ENST00000398960;ENST00000455387	T;T;T	0.60171	0.21;0.25;0.81	5.23	5.23	0.72850	.	0.000000	0.85682	D	0.000000	T	0.65585	0.2705	N	0.19112	0.55	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.83275	0.99;0.996	T	0.70927	-0.4739	10	0.87932	D	0	.	19.1552	0.93507	0.0:0.0:1.0:0.0	.	744;735	Q13627;Q13627-2	DYR1A_HUMAN;.	H	735;744;516	ENSP00000340373:D735H;ENSP00000381932:D744H;ENSP00000407854:D516H	ENSP00000340373:D735H	D	+	1	0	DYRK1A	37806642	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	9.691000	0.98679	2.604000	0.88044	0.655000	0.94253	GAT	DYRK1A	-	NULL	ENSG00000157540		0.443	DYRK1A-006	KNOWN	basic|appris_principal|CCDS	protein_coding	DYRK1A	HGNC	protein_coding	OTTHUMT00000194804.1	159	0.00	0	G	NM_001396		38884772	38884772	+1	no_errors	ENST00000398960	ensembl	human	known	69_37n	missense	151	20.94	40	SNP	1.000	C
EPHA5	2044	genome.wustl.edu	37	4	66231763	66231763	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:66231763C>T	ENST00000273854.3	-	11	2537	c.1937G>A	c.(1936-1938)gGa>gAa	p.G646E	EPHA5_ENST00000511294.1_Missense_Mutation_p.G647E|EPHA5_ENST00000354839.4_Missense_Mutation_p.G624E|EPHA5_ENST00000432638.2_Missense_Mutation_p.G483E	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	646					axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						AGTTCTTACTCCTGGCAGTTT	0.353										TSP Lung(17;0.13)																												dbGAP											0													144.0	124.0	131.0					4																	66231763		2203	4299	6502	-	-	-	SO:0001583	missense	0			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1937G>A	4.37:g.66231763C>T	ENSP00000273854:p.Gly646Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G646E	ENST00000273854.3	37	c.1937	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	C	16.02	3.003504	0.54254	.	.	ENSG00000145242	ENST00000273854;ENST00000432638;ENST00000354839;ENST00000511294	T;T;T;T	0.11604	2.76;2.76;2.76;2.76	5.69	5.69	0.88448	.	0.000000	0.56097	D	0.000032	T	0.19846	0.0477	N	0.13299	0.325	0.50313	D	0.999864	D;P;D;P	0.71674	0.997;0.517;0.998;0.629	D;P;D;B	0.70487	0.931;0.45;0.969;0.139	T	0.08310	-1.0728	10	0.46703	T	0.11	.	19.8167	0.96571	0.0:1.0:0.0:0.0	.	625;647;624;646	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	E	646;483;624;647	ENSP00000273854:G646E;ENSP00000389208:G483E;ENSP00000346899:G624E;ENSP00000427638:G647E	ENSP00000273854:G646E	G	-	2	0	EPHA5	65914358	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	3.950000	0.56676	2.685000	0.91497	0.557000	0.71058	GGA	EPHA5	-	pirsf_Tyr_kinase_ephrin_rcpt	ENSG00000145242		0.353	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	296	0.00	0	C	NM_004439		66231763	66231763	-1	no_errors	ENST00000273854	ensembl	human	known	69_37n	missense	276	18.10	61	SNP	1.000	T
ERBB2	2064	genome.wustl.edu	37	17	37880220	37880220	+	Missense_Mutation	SNP	T	T	C	rs121913470|rs121913469		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:37880220T>C	ENST00000269571.5	+	19	2423	c.2264T>C	c.(2263-2265)tTg>tCg	p.L755S	ERBB2_ENST00000445658.2_Missense_Mutation_p.L479S|ERBB2_ENST00000584601.1_Missense_Mutation_p.L725S|ERBB2_ENST00000406381.2_Missense_Mutation_p.L725S|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000540147.1_Missense_Mutation_p.L725S|ERBB2_ENST00000541774.1_Missense_Mutation_p.L740S|ERBB2_ENST00000584450.1_Missense_Mutation_p.L755S			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	755	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		L -> P (in a lung adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:15457249}.		axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.L755S(10)|p.L755P(2)|p.L755_S760>A(1)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	ATCAAAGTGTTGAGGGAAAAC	0.532	L755S(LN229_CENTRAL_NERVOUS_SYSTEM)	1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	13	Substitution - Missense(12)|Complex - insertion inframe(1)	breast(7)|lung(3)|stomach(2)|large_intestine(1)											112.0	97.0	102.0					17																	37880220		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2264T>C	17.37:g.37880220T>C	ENSP00000269571:p.Leu755Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L755S	ENST00000269571.5	37	c.2264	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	T	32	5.190536	0.94923	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	T;T;T;T;T	0.67865	-0.29;-0.29;-0.29;-0.29;-0.29	5.18	5.18	0.71444	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.83644	0.5299	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.86913	0.2062	9	0.87932	D	0	.	14.7238	0.69329	0.0:0.0:0.0:1.0	.	479;740;755	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	S	725;740;479;755;725	ENSP00000385185:L725S;ENSP00000446466:L740S;ENSP00000404047:L479S;ENSP00000269571:L755S;ENSP00000443562:L725S	ENSP00000269571:L755S	L	+	2	0	ERBB2	35133746	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.040000	0.89188	1.955000	0.56771	0.379000	0.24179	TTG	ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141736		0.532	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	290	0.00	0	T			37880220	37880220	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	missense	110	68.66	241	SNP	1.000	C
ERBB3	2065	genome.wustl.edu	37	12	56482607	56482607	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:56482607C>T	ENST00000267101.3	+	9	1504	c.1064C>T	c.(1063-1065)aCc>aTc	p.T355I	ERBB3_ENST00000415288.2_Missense_Mutation_p.T296I|ERBB3_ENST00000450146.2_Intron	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	355					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			GTGAACTGCACCAAGATCCTG	0.552																																						dbGAP											0													152.0	138.0	143.0					12																	56482607		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1064C>T	12.37:g.56482607C>T	ENSP00000267101:p.Thr355Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.T355I	ENST00000267101.3	37	c.1064	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484368	0.84854	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	D;D	0.82526	-1.62;-1.62	5.52	4.63	0.57726	EGF receptor, L domain (1);	0.000000	0.64402	D	0.000004	D	0.93096	0.7802	H	0.94658	3.565	0.80722	D	1	P;D	0.89917	0.873;1.0	B;D	0.97110	0.403;1.0	D	0.94648	0.7836	10	0.87932	D	0	.	13.3701	0.60709	0.0:0.9237:0.0:0.0763	.	35;355	O75810;P21860	.;ERBB3_HUMAN	I	355;296	ENSP00000267101:T355I;ENSP00000408340:T296I	ENSP00000267101:T355I	T	+	2	0	ERBB3	54768874	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.269000	0.78482	1.577000	0.49804	-0.251000	0.11542	ACC	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_EGF_rcpt_L	ENSG00000065361		0.552	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	218	0.00	0	C			56482607	56482607	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	108	58.08	151	SNP	1.000	T
ESCO1	114799	genome.wustl.edu	37	18	19146114	19146114	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:19146114C>A	ENST00000269214.5	-	6	2636	c.1699G>T	c.(1699-1701)Gat>Tat	p.D567Y		NM_052911.2	NP_443143.2	Q5FWF5	ESCO1_HUMAN	establishment of sister chromatid cohesion N-acetyltransferase 1	567					mitotic cell cycle (GO:0000278)|post-translational protein acetylation (GO:0034421)|regulation of DNA replication (GO:0006275)|sister chromatid cohesion (GO:0007062)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)	metal ion binding (GO:0046872)|transferase activity, transferring acyl groups (GO:0016746)			breast(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(10)|prostate(3)|upper_aerodigestive_tract(1)	35						TACCTGTTATCACTGCTTTTA	0.333																																						dbGAP											0													152.0	161.0	158.0					18																	19146114		2203	4296	6499	-	-	-	SO:0001583	missense	0			AL832041	CCDS32800.1	18q11.2	2013-05-02	2013-05-02		ENSG00000141446	ENSG00000141446			24645	protein-coding gene	gene with protein product		609674	"""establishment of cohesion 1 homolog 1 (S. cerevisiae)"""			11572484, 14576321, 15958495	Standard	NM_052911		Approved	ESO1, EFO1, KIAA1911	uc002kth.1	Q5FWF5		ENST00000269214.5:c.1699G>T	18.37:g.19146114C>A	ENSP00000269214:p.Asp567Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ11|B0YJ12|Q69YG4|Q69YS3|Q6IMD7|Q8N3Z5|Q8NBG2|Q96PX7	Missense_Mutation	SNP	NULL	p.D567Y	ENST00000269214.5	37	c.1699	CCDS32800.1	18	.	.	.	.	.	.	.	.	.	.	C	12.19	1.863209	0.32884	.	.	ENSG00000141446	ENST00000269214;ENST00000383276	T;T	0.59772	0.24;1.81	4.55	3.66	0.41972	.	0.654909	0.14084	N	0.342506	T	0.52885	0.1762	L	0.56769	1.78	0.25361	N	0.988782	P	0.38642	0.641	B	0.38500	0.275	T	0.50508	-0.8820	10	0.72032	D	0.01	-7.6459	8.0156	0.30379	0.0:0.8816:0.0:0.1184	.	567	Q5FWF5	ESCO1_HUMAN	Y	567	ENSP00000269214:D567Y;ENSP00000372763:D567Y	ENSP00000269214:D567Y	D	-	1	0	ESCO1	17400112	1.000000	0.71417	0.753000	0.31225	0.609000	0.37215	2.316000	0.43761	0.995000	0.38917	0.462000	0.41574	GAT	ESCO1	-	NULL	ENSG00000141446		0.333	ESCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESCO1	HGNC	protein_coding	OTTHUMT00000443942.1	507	0.20	1	C	NM_052911		19146114	19146114	-1	no_errors	ENST00000269214	ensembl	human	known	69_37n	missense	361	17.31	76	SNP	0.999	A
ESYT2	57488	genome.wustl.edu	37	7	158560422	158560422	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:158560422G>C	ENST00000251527.5	-	8	1056	c.991C>G	c.(991-993)Ctg>Gtg	p.L331V		NM_020728.2	NP_065779.1	A0FGR8	ESYT2_HUMAN	extended synaptotagmin-like protein 2	359	Glycerophospholipid-binding barrel-like domain.				endocytosis (GO:0006897)|lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|membrane (GO:0016020)|organelle membrane contact site (GO:0044232)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|identical protein binding (GO:0042802)|phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|phosphatidylinositol binding (GO:0035091)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(16)|prostate(2)	32						GGAAGCACCAGATAGTTTGAT	0.418																																						dbGAP											0													103.0	96.0	99.0					7																	158560422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033054	CCDS34791.1	7q36.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000117868	ENSG00000117868		"""Synaptotagmins"""	22211	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member B"""	FAM62B		17672888	Standard	NM_020728		Approved	KIAA1228, CHR2SYT	uc003wob.1	A0FGR8	OTTHUMG00000151436	ENST00000251527.5:c.991C>G	7.37:g.158560422G>C	ENSP00000251527:p.Leu331Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D229|Q69YJ2|Q6UKI4|Q6ZTU0|Q6ZVU1|Q9BQS0|Q9NW47|Q9ULJ2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L331V	ENST00000251527.5	37	c.991	CCDS34791.1	7	.	.	.	.	.	.	.	.	.	.	G	17.43	3.387786	0.61956	.	.	ENSG00000117868	ENST00000251527;ENST00000421679;ENST00000275418;ENST00000429474	T;T	0.19806	2.12;2.12	4.6	2.75	0.32379	.	0.000000	0.85682	D	0.000000	T	0.31979	0.0814	L	0.42581	1.335	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.64687	0.928;0.928	T	0.02026	-1.1227	10	0.39692	T	0.17	-11.6663	10.7444	0.46172	0.1638:0.0:0.8362:0.0	.	359;331	A0FGR8-6;A0FGR8-2	.;.	V	331;359;301;155	ENSP00000251527:L331V;ENSP00000275418:L301V	ENSP00000251527:L331V	L	-	1	2	ESYT2	158253183	0.284000	0.24287	0.996000	0.52242	0.957000	0.61999	0.186000	0.16978	1.065000	0.40693	0.655000	0.94253	CTG	ESYT2	-	NULL	ENSG00000117868		0.418	ESYT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT2	HGNC	protein_coding	OTTHUMT00000322647.1	174	0.00	0	G	NM_020728		158560422	158560422	-1	no_errors	ENST00000251527	ensembl	human	known	69_37n	missense	132	15.38	24	SNP	1.000	C
FAM155A	728215	genome.wustl.edu	37	13	108518787	108518787	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:108518787G>C	ENST00000375915.2	-	1	296	c.158C>G	c.(157-159)tCt>tGt	p.S53C		NM_001080396.2	NP_001073865.1	B1AL88	F155A_HUMAN	family with sequence similarity 155, member A	53						integral component of membrane (GO:0016021)				breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	33						CAAGTGATCAGAGAGCAGGAC	0.602																																						dbGAP											0													100.0	109.0	106.0					13																	108518787		2203	4300	6503	-	-	-	SO:0001583	missense	0			L10374	CCDS32006.1	13q33.3	2008-04-15			ENSG00000204442	ENSG00000204442			33877	protein-coding gene	gene with protein product							Standard	NM_001080396		Approved		uc001vql.3	B1AL88	OTTHUMG00000017326	ENST00000375915.2:c.158C>G	13.37:g.108518787G>C	ENSP00000365080:p.Ser53Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUV1|B7Z334	Missense_Mutation	SNP	NULL	p.S53C	ENST00000375915.2	37	c.158	CCDS32006.1	13	.	.	.	.	.	.	.	.	.	.	G	14.67	2.604051	0.46423	.	.	ENSG00000204442	ENST00000375915	T	0.14516	2.5	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	T	0.32466	0.0830	L	0.48642	1.525	0.52501	D	0.999954	D	0.71674	0.998	D	0.79108	0.992	T	0.02743	-1.1116	10	0.87932	D	0	.	17.5822	0.87971	0.0:0.0:1.0:0.0	.	53	B1AL88	F155A_HUMAN	C	53	ENSP00000365080:S53C	ENSP00000365080:S53C	S	-	2	0	FAM155A	107316788	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.111000	0.94308	2.390000	0.81377	0.650000	0.86243	TCT	FAM155A	-	NULL	ENSG00000204442		0.602	FAM155A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM155A	HGNC	protein_coding	OTTHUMT00000045736.2	68	0.00	0	G	NM_001080396		108518787	108518787	-1	no_errors	ENST00000375915	ensembl	human	known	69_37n	missense	50	20.63	13	SNP	1.000	C
FAM21A	387680	genome.wustl.edu	37	10	51827768	51827768	+	Splice_Site	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr10:51827768G>A	ENST00000282633.5	+	1	48	c.3G>A	c.(1-3)atG>atA	p.M1I	FAM21A_ENST00000351071.6_Splice_Site_p.M1I|RP11-324H6.5_ENST00000456967.1_RNA|FAM21A_ENST00000314664.7_Splice_Site_p.M1I	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	1					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						CGGCTAGGATGGTGAGGGCGC	0.701																																						dbGAP											0													9.0	13.0	12.0					10																	51827768		1853	4082	5935	-	-	-	SO:0001630	splice_region_variant	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.3+1G>A	10.37:g.51827768G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.M1I	ENST00000282633.5	37	c.3	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	G	16.15	3.041315	0.55003	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000282633	.	.	.	3.08	3.08	0.35506	.	30.734400	0.04603	U	0.398899	T	0.50735	0.1633	.	.	.	0.80722	D	1	B;B;B	0.15930	0.015;0.015;0.015	B;B;B	0.09377	0.004;0.004;0.004	T	0.41752	-0.9491	8	0.54805	T	0.06	.	9.8251	0.40908	0.0:0.0:1.0:0.0	.	1;1;1	E7ESD2;Q641Q2-2;Q641Q2	.;.;FA21A_HUMAN	I	1	.	ENSP00000282633:M1I	M	+	3	0	FAM21A	51497774	0.996000	0.38824	0.988000	0.46212	0.144000	0.21451	1.601000	0.36773	1.722000	0.51474	0.194000	0.17425	ATG	FAM21A	-	NULL	ENSG00000099290		0.701	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	16	0.00	0	G	NM_001005751	Missense_Mutation	51827768	51827768	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	0.993	A
GAREM	64762	genome.wustl.edu	37	18	29848311	29848311	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:29848311C>T	ENST00000269209.6	-	6	2157	c.2154G>A	c.(2152-2154)caG>caA	p.Q718Q	GAREM_ENST00000399218.4_Silent_p.Q717Q			Q9H706	GAREM_HUMAN	GRB2 associated, regulator of MAPK1	718					cellular response to epidermal growth factor stimulus (GO:0071364)|epidermal growth factor receptor signaling pathway (GO:0007173)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)										ATGACGTACTCTGCTTTGTCA	0.522																																						dbGAP											0													105.0	103.0	104.0					18																	29848311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025263	CCDS11905.1, CCDS56057.1	18q12.1	2012-11-30	2012-11-30	2012-11-30	ENSG00000141441	ENSG00000141441			26136	protein-coding gene	gene with protein product	"""Grb2-associated and regulator of Erk/MAPK"""		"""chromosome 18 open reading frame 11"", ""family with sequence similarity 59, member A"""	C18orf11, FAM59A		19509291	Standard	NM_001242409		Approved	FLJ21610	uc002kxl.3	Q9H706	OTTHUMG00000132273	ENST00000269209.6:c.2154G>A	18.37:g.29848311C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAG3|Q0VAG4|Q8ND03|Q9BSF5	Silent	SNP	superfamily_SAM/pointed	p.Q718	ENST00000269209.6	37	c.2154	CCDS56057.1	18																																																																																			FAM59A	-	NULL	ENSG00000141441		0.522	GAREM-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM59A	HGNC	protein_coding	OTTHUMT00000255365.1	151	0.00	0	C	NM_022751		29848311	29848311	-1	no_errors	ENST00000269209	ensembl	human	known	69_37n	silent	130	18.75	30	SNP	1.000	T
FAM73B	84895	genome.wustl.edu	37	9	131830567	131830567	+	Missense_Mutation	SNP	G	G	A	rs28365557	byFrequency	TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:131830567G>A	ENST00000358369.4	+	13	1586	c.1360G>A	c.(1360-1362)Gcc>Acc	p.A454T	FAM73B_ENST00000277475.5_3'UTR|FAM73B_ENST00000406926.2_3'UTR	NM_032809.2	NP_116198.2	Q7L4E1	FA73B_HUMAN	family with sequence similarity 73, member B	454					bone development (GO:0060348)	integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)	13						CTCGGTGCTCGCCGTCCTGCG	0.607													G|||	38	0.00758786	0.0	0.0	5008	,	,		17634	0.0377		0.0	False		,,,				2504	0.0					dbGAP											0													79.0	65.0	70.0					9																	131830567		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074127	CCDS6917.1	9q34.13	2008-02-05	2005-08-11	2005-08-11	ENSG00000148343	ENSG00000148343			23621	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 54"""	C9orf54			Standard	NM_032809		Approved	FLJ14596, FLJ00199	uc004bxa.3	Q7L4E1	OTTHUMG00000020770	ENST00000358369.4:c.1360G>A	9.37:g.131830567G>A	ENSP00000351138:p.Ala454Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBM3|Q8TEJ6|Q969E6	Missense_Mutation	SNP	pfam_DUF2217	p.A454T	ENST00000358369.4	37	c.1360	CCDS6917.1	9	27	0.012362637362637362	0	0.0	0	0.0	27	0.0472027972027972	0	0.0	G	16.74	3.207001	0.58343	.	.	ENSG00000148343	ENST00000358369	T	0.27256	1.68	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.13243	0.0321	M	0.70595	2.14	0.80722	D	1	D;P	0.89917	1.0;0.814	D;P	0.91635	0.999;0.49	T	0.06409	-1.0828	10	0.16420	T	0.52	-14.3969	17.967	0.89102	0.0:0.0:1.0:0.0	rs28365557	518;454	B4DZP8;Q7L4E1	.;FA73B_HUMAN	T	454	ENSP00000351138:A454T	ENSP00000351138:A454T	A	+	1	0	FAM73B	130870388	1.000000	0.71417	0.776000	0.31678	0.651000	0.38670	9.203000	0.95033	2.491000	0.84063	0.561000	0.74099	GCC	FAM73B	-	pfam_DUF2217	ENSG00000148343		0.607	FAM73B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM73B	HGNC	protein_coding	OTTHUMT00000054542.7	61	0.00	0	G	NM_032809		131830567	131830567	+1	no_errors	ENST00000358369	ensembl	human	known	69_37n	missense	48	34.25	25	SNP	0.997	A
FANCA	2175	genome.wustl.edu	37	16	89809343	89809343	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:89809343G>A	ENST00000389301.3	-	37	3660	c.3630C>T	c.(3628-3630)ttC>ttT	p.F1210F	FANCA_ENST00000568369.1_Silent_p.F1210F	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	1210					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CAGGGGAGAGGAAACTGGGAC	0.552			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0			GRCh37	CI993092	FANCA	I							66.0	66.0	66.0					16																	89809343		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.3630C>T	16.37:g.89809343G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Silent	SNP	pfam_Fanconia,prints_Fanconia	p.F1210	ENST00000389301.3	37	c.3630	CCDS32515.1	16																																																																																			FANCA	-	NULL	ENSG00000187741		0.552	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	258	0.00	0	G			89809343	89809343	-1	no_errors	ENST00000389301	ensembl	human	known	69_37n	silent	90	39.19	58	SNP	0.949	A
FAP	2191	genome.wustl.edu	37	2	163044822	163044822	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:163044822C>T	ENST00000188790.4	-	20	1878	c.1671G>A	c.(1669-1671)tgG>tgA	p.W557*	FAP_ENST00000443424.1_Nonsense_Mutation_p.W532*	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.W557C(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						GATAAGATATCCAATTAACAG	0.403																																						dbGAP											1	Substitution - Missense(1)	lung(1)											114.0	105.0	108.0					2																	163044822		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.1671G>A	2.37:g.163044822C>T	ENSP00000188790:p.Trp557*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.W557*	ENST00000188790.4	37	c.1671	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.116297	0.97296	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.1402	20.6593	0.99626	0.0:1.0:0.0:0.0	.	.	.	.	X	557;532	.	ENSP00000188790:W557X	W	-	3	0	FAP	162753068	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.267000	0.78462	2.885000	0.99019	0.655000	0.94253	TGG	FAP	-	pfam_Peptidase_S9	ENSG00000078098		0.403	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	HGNC	protein_coding	OTTHUMT00000332852.2	169	0.00	0	C			163044822	163044822	-1	no_errors	ENST00000188790	ensembl	human	known	69_37n	nonsense	179	17.51	38	SNP	1.000	T
FARSA	2193	genome.wustl.edu	37	19	13041152	13041152	+	Missense_Mutation	SNP	C	C	G	rs372267237		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:13041152C>G	ENST00000314606.4	-	4	406	c.388G>C	c.(388-390)Gac>Cac	p.D130H	FARSA_ENST00000423140.2_Missense_Mutation_p.D130H|FARSA_ENST00000588025.1_Missense_Mutation_p.D170H|CTC-425F1.2_ENST00000592636.1_RNA	NM_004461.2	NP_004452.1	Q9Y285	SYFA_HUMAN	phenylalanyl-tRNA synthetase, alpha subunit	130					gene expression (GO:0010467)|phenylalanyl-tRNA aminoacylation (GO:0006432)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|phenylalanine-tRNA ligase activity (GO:0004826)|poly(A) RNA binding (GO:0044822)|tRNA binding (GO:0000049)			NS(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(3)|upper_aerodigestive_tract(1)	20					L-Phenylalanine(DB00120)	TCCATGCTGTCCACCTGCCAG	0.662																																						dbGAP											0													76.0	68.0	71.0					19																	13041152		2203	4300	6503	-	-	-	SO:0001583	missense	0			U07424	CCDS12287.1	19p13.2	2014-05-06	2007-02-23	2007-02-23	ENSG00000179115	ENSG00000179115	6.1.1.20	"""Aminoacyl tRNA synthetases / Class II"""	3592	protein-coding gene	gene with protein product	"""phenylalanine tRNA ligase 1, alpha, cytoplasmic"""	602918	"""phenylalanine-tRNA synthetase-like"", ""phenylalanyl-tRNA synthetase-like, alpha subunit"""	FARSL, FARSLA		9177188	Standard	NM_004461		Approved	CML33	uc002mvs.2	Q9Y285	OTTHUMG00000180569	ENST00000314606.4:c.388G>C	19.37:g.13041152C>G	ENSP00000320309:p.Asp130His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E363|Q9NSD8|Q9Y4W8	Missense_Mutation	SNP	pfam_Phenylalanyl-tRNA_Synthase,pfam_aa-tRNA-synt_IIb_cons-dom,pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,tigrfam_Phe-tRNA-synth_IIc_asu	p.D130H	ENST00000314606.4	37	c.388	CCDS12287.1	19	.	.	.	.	.	.	.	.	.	.	C	15.46	2.840987	0.51057	.	.	ENSG00000179115	ENST00000314606;ENST00000423140	T;T	0.65732	-0.17;0.39	5.38	4.35	0.52113	.	0.270197	0.40818	N	0.001005	T	0.66470	0.2792	M	0.82517	2.595	0.54753	D	0.999982	P;B;B	0.43519	0.809;0.08;0.08	B;B;B	0.41723	0.365;0.131;0.131	T	0.72721	-0.4208	10	0.72032	D	0.01	-12.0353	12.7728	0.57432	0.0:0.9191:0.0:0.0809	.	130;130;130	B4E363;Q6IBR2;Q9Y285	.;.;SYFA_HUMAN	H	130	ENSP00000320309:D130H;ENSP00000396548:D130H	ENSP00000320309:D130H	D	-	1	0	FARSA	12902152	1.000000	0.71417	0.979000	0.43373	0.938000	0.57974	3.112000	0.50368	1.278000	0.44430	0.462000	0.41574	GAC	FARSA	-	NULL	ENSG00000179115		0.662	FARSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARSA	HGNC	protein_coding	OTTHUMT00000451935.1	89	0.00	0	C	NM_004461		13041152	13041152	-1	no_errors	ENST00000314606	ensembl	human	known	69_37n	missense	79	17.71	17	SNP	1.000	G
FBXL2	25827	genome.wustl.edu	37	3	33420176	33420176	+	Splice_Site	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:33420176G>C	ENST00000484457.1	+	13	985		c.e13-1		FBXL2_ENST00000283627.6_Splice_Site|FBXL2_ENST00000446237.3_Splice_Site|FBXL2_ENST00000542085.1_Splice_Site|FBXL2_ENST00000538892.1_Splice_Site|FBXL2_ENST00000538181.1_Splice_Site|FBXL2_ENST00000507198.1_Splice_Site	NM_012157.3	NP_036289.3			F-box and leucine-rich repeat protein 2											endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|urinary_tract(1)	15						TTTCTCTCCAGATAACCGACA	0.428																																						dbGAP											0													184.0	158.0	166.0					3																	33420176		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF174589	CCDS2658.1, CCDS54560.1	3p22.3	2011-06-09			ENSG00000153558	ENSG00000153558		"""F-boxes / Leucine-rich repeats"""	13598	protein-coding gene	gene with protein product		605652				10508920, 10531035	Standard	NM_012157		Approved	FBL2, FBL3	uc003cfp.3	Q9UKC9	OTTHUMG00000130745	ENST00000484457.1:c.895-1G>C	3.37:g.33420176G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e13-1	ENST00000484457.1	37	c.895-1	CCDS2658.1	3	.	.	.	.	.	.	.	.	.	.	G	25.8	4.677965	0.88445	.	.	ENSG00000153558	ENST00000484457;ENST00000538892;ENST00000538181;ENST00000446237;ENST00000507198;ENST00000542085	.	.	.	4.56	4.56	0.56223	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2853	0.90112	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FBXL2	33395180	1.000000	0.71417	0.998000	0.56505	0.989000	0.77384	9.750000	0.98875	2.465000	0.83290	0.650000	0.86243	.	FBXL2	-	-	ENSG00000153558		0.428	FBXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL2	HGNC	protein_coding	OTTHUMT00000253245.2	340	0.00	0	G	NM_012157	Intron	33420176	33420176	+1	no_errors	ENST00000484457	ensembl	human	known	69_37n	splice_site	230	23.76	72	SNP	1.000	C
FGF13	2258	genome.wustl.edu	37	X	137717749	137717749	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:137717749G>A	ENST00000315930.6	-	4	1131	c.470C>T	c.(469-471)tCa>tTa	p.S157L	FGF13_ENST00000441825.2_Missense_Mutation_p.S138L|FGF13_ENST00000541469.1_Missense_Mutation_p.S111L|FGF13_ENST00000305414.4_Missense_Mutation_p.S104L|FGF13_ENST00000370603.3_Missense_Mutation_p.S167L	NM_004114.3	NP_004105.1	Q92913	FGF13_HUMAN	fibroblast growth factor 13	157	Mediates interaction with sodium channels.				cell-cell signaling (GO:0007267)|cerebral cortex cell migration (GO:0021795)|establishment of neuroblast polarity (GO:0045200)|hippocampus development (GO:0021766)|learning (GO:0007612)|MAPK cascade (GO:0000165)|memory (GO:0007613)|microtubule polymerization (GO:0046785)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of microtubule depolymerization (GO:0007026)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|positive regulation of protein kinase activity (GO:0045860)|protein localization to plasma membrane (GO:0072659)|signal transduction (GO:0007165)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular region (GO:0005576)|filopodium (GO:0030175)|growth cone (GO:0030426)|intercalated disc (GO:0014704)|microtubule (GO:0005874)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-tubulin binding (GO:0048487)|growth factor activity (GO:0008083)|ion channel binding (GO:0044325)|microtubule binding (GO:0008017)|protein kinase activator activity (GO:0030295)|sodium channel regulator activity (GO:0017080)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)	24	Acute lymphoblastic leukemia(192;0.000127)					GTATATCATTGATGAATATGT	0.393																																						dbGAP											0													127.0	108.0	114.0					X																	137717749		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC034340	CCDS14664.1, CCDS14665.1, CCDS55511.1	Xq26.3	2008-02-05			ENSG00000129682	ENSG00000129682			3670	protein-coding gene	gene with protein product	"""fibroblast growth factor homologous factor 2"""	300070				8790420	Standard	NM_033642		Approved	FHF2, FGF2	uc011mwj.2	Q92913	OTTHUMG00000022532	ENST00000315930.6:c.470C>T	X.37:g.137717749G>A	ENSP00000322390:p.Ser157Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK18|B7Z4M7|B7Z8N0|D3DWH4|O95830|Q9NZH9|Q9NZI0	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF,prints_GF_heparin-bd	p.S167L	ENST00000315930.6	37	c.500	CCDS14665.1	X	.	.	.	.	.	.	.	.	.	.	G	27.2	4.811715	0.90707	.	.	ENSG00000129682	ENST00000315930;ENST00000305414;ENST00000441825;ENST00000370603;ENST00000541469;ENST00000436198;ENST00000455663	T;T;T;T;T;T;T	0.73789	-0.78;-0.78;-0.78;-0.78;-0.78;-0.78;-0.78	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.91472	0.7308	H	0.97077	3.935	0.58432	D	0.999999	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93773	0.7077	10	0.87932	D	0	.	18.5888	0.91200	0.0:0.0:1.0:0.0	.	111;167;104;157	B7Z8N0;B7Z4M7;Q92913-2;Q92913	.;.;.;FGF13_HUMAN	L	157;104;138;167;111;167;173	ENSP00000322390:S157L;ENSP00000303391:S104L;ENSP00000409276:S138L;ENSP00000359635:S167L;ENSP00000437903:S111L;ENSP00000396198:S167L;ENSP00000406916:S173L	ENSP00000303391:S104L	S	-	2	0	FGF13	137545415	1.000000	0.71417	0.182000	0.23118	0.985000	0.73830	9.476000	0.97823	2.618000	0.88619	0.600000	0.82982	TCA	FGF13	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF,prints_GF_heparin-bd	ENSG00000129682		0.393	FGF13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF13	HGNC	protein_coding	OTTHUMT00000058534.2	428	0.00	0	G	NM_004114		137717749	137717749	-1	no_errors	ENST00000370603	ensembl	human	known	69_37n	missense	196	44.51	158	SNP	0.974	A
FILIP1	27145	genome.wustl.edu	37	6	76024427	76024427	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:76024427G>C	ENST00000237172.7	-	5	1451	c.1121C>G	c.(1120-1122)tCt>tGt	p.S374C	FILIP1_ENST00000393004.2_Missense_Mutation_p.S374C|FILIP1_ENST00000498523.1_5'UTR|FILIP1_ENST00000370020.1_Missense_Mutation_p.S275C	NM_015687.2	NP_056502.1	Q7Z7B0	FLIP1_HUMAN	filamin A interacting protein 1	374										breast(3)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)	80						CATGAGGCTAGAGTTTCCACA	0.413																																						dbGAP											0													171.0	172.0	172.0					6																	76024427		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033101	CCDS4984.1, CCDS75480.1	6q14.1	2008-02-05			ENSG00000118407	ENSG00000118407			21015	protein-coding gene	gene with protein product		607307				10574462	Standard	XM_005248713		Approved	FILIP, KIAA1275	uc003pia.3	Q7Z7B0	OTTHUMG00000015056	ENST00000237172.7:c.1121C>G	6.37:g.76024427G>C	ENSP00000237172:p.Ser374Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMU6|Q5VUL6|Q86TC3|Q8N8B9|Q96SK6|Q9NVI8|Q9ULE5	Missense_Mutation	SNP	pfam_Cortactin-binding_p2_N,prints_Tropomyosin	p.S374C	ENST00000237172.7	37	c.1121	CCDS4984.1	6	.	.	.	.	.	.	.	.	.	.	G	13.16	2.153286	0.38021	.	.	ENSG00000118407	ENST00000393004;ENST00000237172;ENST00000370020	T;T;T	0.26660	1.73;1.72;1.72	5.65	5.65	0.86999	.	0.057661	0.64402	D	0.000001	T	0.43366	0.1244	M	0.74647	2.275	0.58432	D	0.999992	D;B;B	0.76494	0.999;0.07;0.403	P;B;B	0.59703	0.862;0.127;0.211	T	0.35699	-0.9778	10	0.66056	D	0.02	-11.7903	20.0965	0.97849	0.0:0.0:1.0:0.0	.	374;374;374	A8K2G7;Q7Z7B0;Q7Z7B0-2	.;FLIP1_HUMAN;.	C	374;374;275	ENSP00000376728:S374C;ENSP00000237172:S374C;ENSP00000359037:S275C	ENSP00000237172:S374C	S	-	2	0	FILIP1	76081147	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.585000	0.82584	2.824000	0.97209	0.655000	0.94253	TCT	FILIP1	-	NULL	ENSG00000118407		0.413	FILIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FILIP1	HGNC	protein_coding	OTTHUMT00000041263.1	375	0.00	0	G	XM_029179		76024427	76024427	-1	no_errors	ENST00000237172	ensembl	human	known	69_37n	missense	327	21.20	88	SNP	1.000	C
FKBP9	11328	genome.wustl.edu	37	7	33035890	33035890	+	Silent	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:33035890G>C	ENST00000242209.4	+	7	1324	c.1155G>C	c.(1153-1155)ctG>ctC	p.L385L	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000490776.2_Silent_p.L153L|FKBP9_ENST00000538443.1_Silent_p.L247L|FKBP9_ENST00000538336.1_Silent_p.L438L	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	385					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			GCTCAGTGCTGAGTAAGAAGG	0.527																																						dbGAP											0													120.0	92.0	102.0					7																	33035890		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1155G>C	7.37:g.33035890G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Silent	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.L438	ENST00000242209.4	37	c.1314	CCDS5439.1	7																																																																																			FKBP9	-	pfam_PPIase_FKBP_dom	ENSG00000122642		0.527	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP9	HGNC	protein_coding	OTTHUMT00000215137.1	253	0.00	0	G	NM_007270		33035890	33035890	+1	no_errors	ENST00000538336	ensembl	human	known	69_37n	silent	179	20.44	46	SNP	0.977	C
FLT1	2321	genome.wustl.edu	37	13	29005385	29005385	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:29005385G>C	ENST00000282397.4	-	7	1127	c.876C>G	c.(874-876)ttC>ttG	p.F292L	FLT1_ENST00000541932.1_Missense_Mutation_p.F292L|FLT1_ENST00000539099.1_Missense_Mutation_p.F292L	NM_002019.4	NP_002010.2	P17948	VGFR1_HUMAN	fms-related tyrosine kinase 1	292	Ig-like C2-type 3.				blood vessel morphogenesis (GO:0048514)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|embryonic morphogenesis (GO:0048598)|monocyte chemotaxis (GO:0002548)|patterning of blood vessels (GO:0001569)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|sprouting angiogenesis (GO:0002040)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)|vascular endothelial growth factor receptor-1 signaling pathway (GO:0036323)|vascular endothelial growth factor signaling pathway (GO:0038084)	endosome (GO:0005768)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|placental growth factor-activated receptor activity (GO:0036332)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|vascular endothelial growth factor-activated receptor activity (GO:0005021)|VEGF-A-activated receptor activity (GO:0036326)|VEGF-B-activated receptor activity (GO:0036327)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(8)|kidney(3)|large_intestine(20)|lung(55)|ovary(3)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	115	Acute lymphoblastic leukemia(6;0.04)	Lung SC(185;0.0262)|Breast(139;0.188)	Colorectal(13;0.000674)	all cancers(112;0.0301)|Epithelial(112;0.155)|GBM - Glioblastoma multiforme(144;0.184)|OV - Ovarian serous cystadenocarcinoma(117;0.205)|Lung(94;0.207)	Axitinib(DB06626)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GAACACTGTAGAATATGTTGG	0.373																																						dbGAP											0													185.0	160.0	169.0					13																	29005385		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063657	CCDS9330.1, CCDS53860.1, CCDS53861.1, CCDS73556.1	13q12	2014-09-17	2012-11-19		ENSG00000102755	ENSG00000102755	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3763	protein-coding gene	gene with protein product	"""vascular endothelial growth factor receptor 1"", ""vascular permeability factor receptor"""	165070	"""fms-related tyrosine kinase 1 (vascular endothelial growth factor/vascular permeability factor receptor)"""	FLT		2158038	Standard	NM_001159920		Approved	VEGFR1	uc001usb.3	P17948	OTTHUMG00000016648	ENST00000282397.4:c.876C>G	13.37:g.29005385G>C	ENSP00000282397:p.Phe292Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A3E342|A3E344|A8KA71|B0LPF1|B2BF46|B2BF47|B2BF48|B3FR89|B5A923|F5H5L6|O60722|P16057|Q12954	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR1_rcpt_N,prints_Tyr_kinase_VEGFR_rcpt_N	p.F292L	ENST00000282397.4	37	c.876	CCDS9330.1	13	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238344	0.58886	.	.	ENSG00000102755	ENST00000282397;ENST00000541932;ENST00000539099	T;T;T	0.26518	1.73;1.73;1.73	5.54	4.7	0.59300	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.112628	0.64402	D	0.000011	T	0.50240	0.1604	M	0.85373	2.75	0.53688	D	0.999979	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.51403	-0.8710	10	0.27082	T	0.32	.	9.4414	0.38670	0.2056:0.0:0.7944:0.0	.	292;292;292;292	P17948-4;P17948-3;P17948-2;P17948	.;.;.;VGFR1_HUMAN	L	292	ENSP00000282397:F292L;ENSP00000437631:F292L;ENSP00000442630:F292L	ENSP00000282397:F292L	F	-	3	2	FLT1	27903385	1.000000	0.71417	1.000000	0.80357	0.314000	0.28054	4.177000	0.58276	1.465000	0.48006	0.585000	0.79938	TTC	FLT1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000102755		0.373	FLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLT1	HGNC	protein_coding	OTTHUMT00000044322.1	346	0.00	0	G			29005385	29005385	-1	no_errors	ENST00000282397	ensembl	human	known	69_37n	missense	266	21.30	72	SNP	1.000	C
FNDC1	84624	genome.wustl.edu	37	6	159653669	159653669	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:159653669G>A	ENST00000297267.9	+	11	2325	c.2125G>A	c.(2125-2127)Gat>Aat	p.D709N	FNDC1_ENST00000340366.6_Missense_Mutation_p.D646N	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	709	Ser-rich.				cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGCAGAGGAAGATTCCAGTGC	0.657																																						dbGAP											0													18.0	22.0	20.0					6																	159653669		1941	4117	6058	-	-	-	SO:0001583	missense	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2125G>A	6.37:g.159653669G>A	ENSP00000297267:p.Asp709Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.D709N	ENST00000297267.9	37	c.2125	CCDS47512.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.53|10.53	1.376877|1.376877	0.24857|0.24857	.|.	.|.	ENSG00000164694|ENSG00000164694	ENST00000297267;ENST00000340366|ENST00000329629	T;T|.	0.07567|.	3.18;3.94|.	5.03|5.03	2.07|2.07	0.26955|0.26955	.|.	1.607220|.	0.03073|.	N|.	0.157484|.	T|T	0.02571|0.02571	0.0078|0.0078	N|N	0.01874|0.01874	-0.695|-0.695	0.18873|0.18873	N|N	0.999983|0.999983	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.09377|.	0.004;0.002|.	T|T	0.45614|0.45614	-0.9249|-0.9249	10|5	0.17369|.	T|.	0.5|.	-1.4841|-1.4841	5.8494|5.8494	0.18683|0.18683	0.4863:0.0:0.5137:0.0|0.4863:0.0:0.5137:0.0	.|.	646;709|.	Q4ZHG4-2;Q4ZHG4|.	.;FNDC1_HUMAN|.	N|K	709;646|604	ENSP00000297267:D709N;ENSP00000342460:D646N|.	ENSP00000297267:D709N|.	D|R	+|+	1|2	0|0	FNDC1|FNDC1	159573659|159573659	0.085000|0.085000	0.21516|0.21516	0.009000|0.009000	0.14445|0.14445	0.091000|0.091000	0.18340|0.18340	1.980000|1.980000	0.40618|0.40618	0.191000|0.191000	0.20236|0.20236	0.655000|0.655000	0.94253|0.94253	GAT|AGA	FNDC1	-	NULL	ENSG00000164694		0.657	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	39	0.00	0	G	NM_032532		159653669	159653669	+1	no_errors	ENST00000297267	ensembl	human	known	69_37n	missense	30	28.57	12	SNP	0.370	A
FOXA1	3169	genome.wustl.edu	37	14	38061461	38061461	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:38061461G>C	ENST00000250448.2	-	2	589	c.528C>G	c.(526-528)atC>atG	p.I176M	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.I143M	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	176					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)	p.I176M(2)		breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		TGATGAGCGAGATGTACGAGT	0.657																																						dbGAP											2	Substitution - Missense(2)	lung(2)											96.0	88.0	91.0					14																	38061461		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.528C>G	14.37:g.38061461G>C	ENSP00000250448:p.Ile176Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.I176M	ENST00000250448.2	37	c.528	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	G	16.64	3.179477	0.57800	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95656	-3.77;-3.77	3.88	0.91	0.19337	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (4);Transcription factor, fork head, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.96864	0.8976	M	0.81497	2.545	0.54753	D	0.999983	D	0.89917	1.0	D	0.97110	1.0	D	0.95547	0.8617	10	0.87932	D	0	.	8.7702	0.34728	0.2749:0.0:0.7251:0.0	.	176	P55317	FOXA1_HUMAN	M	176;143	ENSP00000250448:I176M;ENSP00000440178:I143M	ENSP00000250448:I176M	I	-	3	3	FOXA1	37131212	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	2.158000	0.42329	0.318000	0.23185	0.505000	0.49811	ATC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	ENSG00000129514		0.657	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	144	0.00	0	G			38061461	38061461	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	53	55.08	65	SNP	1.000	C
FRMPD1	22844	genome.wustl.edu	37	9	37692653	37692653	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:37692653G>A	ENST00000539465.1	+	2	608	c.15G>A	c.(13-15)gaG>gaA	p.E5E	FRMPD1_ENST00000377765.3_Silent_p.E5E|RP11-613M10.9_ENST00000540557.1_Intron			Q5SYB0	FRPD1_HUMAN	FERM and PDZ domain containing 1	5						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				NS(3)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(22)|lung(34)|ovary(5)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	93				GBM - Glioblastoma multiforme(29;0.00655)		AAGAGCTGGAGACCAGTTTAT	0.458																																						dbGAP											0													108.0	101.0	104.0					9																	37692653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023184	CCDS6612.1	9p13.1	2008-02-05			ENSG00000070601	ENSG00000070601			29159	protein-coding gene	gene with protein product						10231032	Standard	NM_014907		Approved	KIAA0967, FRMD2	uc004aag.1	Q5SYB0	OTTHUMG00000019927	ENST00000539465.1:c.15G>A	9.37:g.37692653G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZC8|B7Z807|D3DRQ3|Q14C73|Q5HY96|Q9Y2H3	Silent	SNP	pfam_FERM_central,pfam_PDZ,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,smart_PDZ,smart_Band_41_domain,pfscan_FERM_domain,pfscan_PDZ	p.E5	ENST00000539465.1	37	c.15	CCDS6612.1	9																																																																																			FRMPD1	-	NULL	ENSG00000070601		0.458	FRMPD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FRMPD1	HGNC	protein_coding	OTTHUMT00000402969.1	163	0.00	0	G	NM_014907		37692653	37692653	+1	no_errors	ENST00000377765	ensembl	human	known	69_37n	silent	76	20.83	20	SNP	0.702	A
FRRS1	391059	genome.wustl.edu	37	1	100185140	100185140	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:100185140G>A	ENST00000414213.1	-	10	1671	c.1070C>T	c.(1069-1071)tCt>tTt	p.S357F	FRRS1_ENST00000287474.5_Missense_Mutation_p.S357F			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	357	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		GTTCTTTGGAGAGTCTGTCAC	0.368																																						dbGAP											0													129.0	119.0	123.0					1																	100185140		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.1070C>T	1.37:g.100185140G>A	ENSP00000393884:p.Ser357Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLN7	Missense_Mutation	SNP	pfam_Reeler_dom,pfam_DOMON_domain,smart_DOMON_domain,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_DOMON_domain,pfscan_Reeler_dom,pfscan_Cyt_b561/ferric_Rdtase_TM	p.S357F	ENST00000414213.1	37	c.1070		1	.	.	.	.	.	.	.	.	.	.	G	3.981	-0.006439	0.07773	.	.	ENSG00000156869	ENST00000414213;ENST00000287474	.	.	.	5.66	-6.89	0.01660	.	2.162330	0.01358	N	0.012134	T	0.13756	0.0333	L	0.28740	0.885	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.10474	-1.0628	9	0.09843	T	0.71	-0.0416	15.3639	0.74503	0.1596:0.0:0.7063:0.1341	.	357	Q6ZNA5-2	.	F	357	.	ENSP00000287474:S357F	S	-	2	0	FRRS1	99957728	0.000000	0.05858	0.000000	0.03702	0.028000	0.11728	-0.715000	0.04997	-0.884000	0.03976	-0.274000	0.10170	TCT	FRRS1	-	smart_DOMON_domain,pfscan_Cyt_b561/ferric_Rdtase_TM	ENSG00000156869		0.368	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	HGNC	protein_coding		291	0.34	1	G	NM_001013660		100185140	100185140	-1	no_errors	ENST00000287474	ensembl	human	known	69_37n	missense	147	25.76	51	SNP	0.000	A
FSHR	2492	genome.wustl.edu	37	2	49195939	49195939	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:49195939T>C	ENST00000406846.2	-	9	871	c.752A>G	c.(751-753)aAc>aGc	p.N251S	FSHR_ENST00000304421.4_Missense_Mutation_p.N225S|FSHR_ENST00000541117.1_5'UTR|FSHR_ENST00000346173.3_Intron|FSHR_ENST00000469138.1_5'UTR	NM_000145.3	NP_000136.2	P23945	FSHR_HUMAN	follicle stimulating hormone receptor	251					female gamete generation (GO:0007292)|female gonad development (GO:0008585)|follicle-stimulating hormone signaling pathway (GO:0042699)|G-protein coupled receptor signaling pathway (GO:0007186)|gonad development (GO:0008406)|male gonad development (GO:0008584)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	follicle-stimulating hormone receptor activity (GO:0004963)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|liver(1)|lung(45)|ovary(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	73		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.181)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)		Choriogonadotropin alfa(DB00097)|Follitropin beta(DB00066)|Menotropins(DB00032)|Suramin(DB04786)|Urofollitropin(DB00094)	CTTTTTTAAGTTGTAAGTCGA	0.463									Gonadal Dysgenesis, 46 XX																													dbGAP											0													102.0	97.0	98.0					2																	49195939		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS1843.1, CCDS1844.1, CCDS1844.2	2p21-p16	2014-09-17			ENSG00000170820	ENSG00000170820		"""GPCR / Class A : Gonadotropin and TSH receptors"""	3969	protein-coding gene	gene with protein product		136435		ODG1		8230163, 8855829	Standard	NM_000145		Approved	FSHRO, LGR1	uc002rww.3	P23945	OTTHUMG00000129259	ENST00000406846.2:c.752A>G	2.37:g.49195939T>C	ENSP00000384708:p.Asn251Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K947|G5CBS7|G5E967|J3KQ00|Q05AH0|Q16225|Q4QRJ3|Q4ZFZ2|Q53RW2	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_GnHR_TM,pfam_LRR-contain_N,pfam_Leu-rich_rpt,smart_LRR-contain_N,pfscan_GPCR_Rhodpsn_supfam,prints_FSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_TSH_rcpt	p.N251S	ENST00000406846.2	37	c.752	CCDS1843.1	2	.	.	.	.	.	.	.	.	.	.	T	3.890	-0.024231	0.07634	.	.	ENSG00000170820	ENST00000406846;ENST00000304421	T;T	0.76839	-1.05;-1.05	5.45	3.11	0.35812	.	0.684114	0.15432	N	0.262675	T	0.64382	0.2593	L	0.33189	0.99	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.52079	-0.8623	9	.	.	.	.	8.5947	0.33707	0.0:0.157:0.0:0.843	.	225;251	Q05AH0;P23945	.;FSHR_HUMAN	S	251;225	ENSP00000384708:N251S;ENSP00000306780:N225S	.	N	-	2	0	FSHR	49049443	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.810000	0.38932	0.527000	0.28560	0.533000	0.62120	AAC	FSHR	-	NULL	ENSG00000170820		0.463	FSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSHR	HGNC	protein_coding	OTTHUMT00000251367.2	277	0.00	0	T			49195939	49195939	-1	no_errors	ENST00000406846	ensembl	human	known	69_37n	missense	153	37.65	93	SNP	1.000	C
FYCO1	79443	genome.wustl.edu	37	3	46007876	46007876	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:46007876G>C	ENST00000296137.2	-	8	3155	c.2950C>G	c.(2950-2952)Cag>Gag	p.Q984E	FYCO1_ENST00000535325.1_Missense_Mutation_p.Q984E	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	984					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		TGCTCTGCCTGGGCGAGCTGG	0.627																																						dbGAP											0													57.0	54.0	55.0					3																	46007876		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.2950C>G	3.37:g.46007876G>C	ENSP00000296137:p.Gln984Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.Q984E	ENST00000296137.2	37	c.2950	CCDS2734.1	3	.	.	.	.	.	.	.	.	.	.	G	5.926	0.354817	0.11239	.	.	ENSG00000163820	ENST00000296137;ENST00000535325	T;T	0.77229	-1.08;-1.08	5.49	5.49	0.81192	.	0.447172	0.22512	N	0.059100	T	0.70552	0.3237	L	0.55103	1.725	0.28354	N	0.920783	P;B	0.39250	0.665;0.098	B;B	0.36244	0.22;0.018	T	0.65471	-0.6160	10	0.21540	T	0.41	-26.0769	12.2426	0.54551	0.0:0.0:0.7857:0.2143	.	984;984	B7ZKT7;Q9BQS8	.;FYCO1_HUMAN	E	984	ENSP00000296137:Q984E;ENSP00000441178:Q984E	ENSP00000296137:Q984E	Q	-	1	0	FYCO1	45982880	1.000000	0.71417	0.999000	0.59377	0.389000	0.30415	3.955000	0.56715	2.592000	0.87571	0.655000	0.94253	CAG	FYCO1	-	NULL	ENSG00000163820		0.627	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	93	0.00	0	G	NM_024513		46007876	46007876	-1	no_errors	ENST00000535325	ensembl	human	known	69_37n	missense	49	23.44	15	SNP	0.993	C
GALNT5	11227	genome.wustl.edu	37	2	158142577	158142577	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:158142577C>T	ENST00000259056.4	+	3	2157	c.1672C>T	c.(1672-1674)Cgg>Tgg	p.R558W		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	558	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						TCCAAAAGTTCGGATTCTTCG	0.378																																						dbGAP											0													67.0	71.0	70.0					2																	158142577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.1672C>T	2.37:g.158142577C>T	ENSP00000259056:p.Arg558Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.R558W	ENST00000259056.4	37	c.1672	CCDS2203.1	2	.	.	.	.	.	.	.	.	.	.	C	24.7	4.560137	0.86335	.	.	ENSG00000136542	ENST00000259056	T	0.63417	-0.04	6.03	6.03	0.97812	Glycosyl transferase, family 2 (1);	0.064498	0.64402	D	0.000006	D	0.84293	0.5440	M	0.94063	3.49	0.50813	D	0.999891	D	0.89917	1.0	D	0.79784	0.993	D	0.87529	0.2451	10	0.87932	D	0	.	15.9988	0.80270	0.1351:0.8649:0.0:0.0	.	558	Q7Z7M9	GALT5_HUMAN	W	558	ENSP00000259056:R558W	ENSP00000259056:R558W	R	+	1	2	GALNT5	157850823	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.551000	0.60740	2.861000	0.98227	0.655000	0.94253	CGG	GALNT5	-	pfam_Glyco_trans_2	ENSG00000136542		0.378	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT5	HGNC	protein_coding	OTTHUMT00000254925.2	259	0.00	0	C	NM_014568		158142577	158142577	+1	no_errors	ENST00000259056	ensembl	human	known	69_37n	missense	195	19.01	46	SNP	1.000	T
GAS2L3	283431	genome.wustl.edu	37	12	101018311	101018311	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:101018311G>A	ENST00000539410.1	+	9	2114	c.1728G>A	c.(1726-1728)caG>caA	p.Q576Q	GAS2L3_ENST00000537247.1_Silent_p.Q472Q|GAS2L3_ENST00000547754.1_Silent_p.Q576Q|GAS2L3_ENST00000266754.5_Silent_p.Q576Q			Q86XJ1	GA2L3_HUMAN	growth arrest-specific 2 like 3	576					actin cytoskeleton organization (GO:0030036)|cell cycle arrest (GO:0007050)|microtubule cytoskeleton organization (GO:0000226)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	actin binding (GO:0003779)|microtubule binding (GO:0008017)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	35						AAGCCACACAGAAATCAAAAG	0.438																																						dbGAP											0													51.0	51.0	51.0					12																	101018311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095594	CCDS9079.1	12q23.1	2014-09-11			ENSG00000139354	ENSG00000139354			27475	protein-coding gene	gene with protein product							Standard	NM_174942		Approved		uc001thu.3	Q86XJ1	OTTHUMG00000170439	ENST00000539410.1:c.1728G>A	12.37:g.101018311G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCN2	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.Q576	ENST00000539410.1	37	c.1728	CCDS9079.1	12																																																																																			GAS2L3	-	NULL	ENSG00000139354		0.438	GAS2L3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS2L3	HGNC	protein_coding	OTTHUMT00000409143.1	135	0.00	0	G	NM_174942		101018311	101018311	+1	no_errors	ENST00000266754	ensembl	human	known	69_37n	silent	69	42.02	50	SNP	0.000	A
GLCE	26035	genome.wustl.edu	37	15	69548380	69548380	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:69548380C>G	ENST00000261858.2	+	3	463	c.235C>G	c.(235-237)Cag>Gag	p.Q79E	GLCE_ENST00000559420.2_Missense_Mutation_p.Q15E	NM_015554.1	NP_056369.1	O94923	GLCE_HUMAN	glucuronic acid epimerase	79					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	heparosan-N-sulfate-glucuronate 5-epimerase activity (GO:0047464)|racemase and epimerase activity, acting on carbohydrates and derivatives (GO:0016857)|UDP-glucuronate 5'-epimerase activity (GO:0050379)			NS(1)|breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	18						AGCATTCCCTCAGGAACAGCA	0.453																																						dbGAP											0													108.0	99.0	102.0					15																	69548380		2200	4298	6498	-	-	-	SO:0001583	missense	0			AB020643	CCDS32277.1	15q23	2007-01-30	2007-01-30			ENSG00000138604	5.1.3.12		17855	protein-coding gene	gene with protein product	"""heparan sulfate epimerase"""	612134	"""D-glucuronyl C5-epimerase"", ""UDP-glucuronic acid epimerase"""			15853773	Standard	NM_015554		Approved	KIAA0836, HSEPI	uc002ary.1	O94923		ENST00000261858.2:c.235C>G	15.37:g.69548380C>G	ENSP00000261858:p.Gln79Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GUQ2	Missense_Mutation	SNP	pfam_C5-epim	p.Q79E	ENST00000261858.2	37	c.235	CCDS32277.1	15	.	.	.	.	.	.	.	.	.	.	C	13.22	2.172837	0.38413	.	.	ENSG00000138604	ENST00000261858	T	0.32023	1.47	5.3	5.3	0.74995	.	0.175620	0.51477	D	0.000086	T	0.25232	0.0613	L	0.36672	1.1	0.50632	D	0.999885	B	0.09022	0.002	B	0.11329	0.006	T	0.07888	-1.0749	10	0.08381	T	0.77	-35.4229	17.8893	0.88866	0.0:1.0:0.0:0.0	.	79	O94923	GLCE_HUMAN	E	79	ENSP00000261858:Q79E	ENSP00000261858:Q79E	Q	+	1	0	GLCE	67335434	1.000000	0.71417	0.996000	0.52242	0.868000	0.49771	5.394000	0.66285	2.628000	0.89032	0.655000	0.94253	CAG	GLCE	-	NULL	ENSG00000138604		0.453	GLCE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCE	HGNC	protein_coding		258	0.39	1	C	NM_015554		69548380	69548380	+1	no_errors	ENST00000261858	ensembl	human	known	69_37n	missense	241	20.46	62	SNP	1.000	G
GLS	2744	genome.wustl.edu	37	2	191760405	191760405	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:191760405C>T	ENST00000320717.3	+	3	817	c.559C>T	c.(559-561)Caa>Taa	p.Q187*	GLS_ENST00000338435.4_Nonsense_Mutation_p.Q187*	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	187					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	ATTAACTCTTCAAACAACATC	0.348																																						dbGAP											0													78.0	81.0	80.0					2																	191760405		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.559C>T	2.37:g.191760405C>T	ENSP00000317379:p.Gln187*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Nonsense_Mutation	SNP	pfam_Glutaminase,pfam_Ankyrin_rpt,superfamily_Beta-lactam/transpept-like,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_Glutaminase	p.Q187*	ENST00000320717.3	37	c.559	CCDS2308.1	2	.	.	.	.	.	.	.	.	.	.	C	38	6.992080	0.97987	.	.	ENSG00000115419	ENST00000320717;ENST00000338435	.	.	.	5.49	5.49	0.81192	.	0.058902	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09084	T	0.74	-12.8016	19.3684	0.94473	0.0:1.0:0.0:0.0	.	.	.	.	X	187	.	ENSP00000317379:Q187X	Q	+	1	0	GLS	191468650	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.864000	0.69575	2.591000	0.87537	0.585000	0.79938	CAA	GLS	-	NULL	ENSG00000115419		0.348	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS	HGNC	protein_coding	OTTHUMT00000255999.2	154	0.65	1	C			191760405	191760405	+1	no_errors	ENST00000320717	ensembl	human	known	69_37n	nonsense	125	16.11	24	SNP	1.000	T
GLYATL1	92292	genome.wustl.edu	37	11	58714563	58714563	+	Start_Codon_SNP	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:58714563G>A	ENST00000317391.4	+	4	343	c.3G>A	c.(1-3)atG>atA	p.M1I	RP11-142C4.6_ENST00000533954.1_RNA|GLYATL1_ENST00000300079.5_Intron	NM_001220494.1	NP_001207423.1	Q969I3	GLYL1_HUMAN	glycine-N-acyltransferase-like 1	1						mitochondrion (GO:0005739)	glutamine N-acyltransferase activity (GO:0047946)|glycine N-acyltransferase activity (GO:0047961)			NS(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|skin(4)|urinary_tract(1)	34					Glycine(DB00145)	CCCACAGAATGATCCTACTGA	0.443																																						dbGAP											0													149.0	136.0	140.0					11																	58714563		2201	4295	6496	-	-	-	SO:0001582	initiator_codon_variant	0			AK091965	CCDS31556.1, CCDS55768.1	11q12.1	2014-08-12			ENSG00000166840	ENSG00000166840			30519	protein-coding gene	gene with protein product		614761				12477932	Standard	NM_080661		Approved	MGC15397, FLJ34646	uc001nnh.2	Q969I3	OTTHUMG00000167221	ENST00000317391.4:c.3G>A	11.37:g.58714563G>A	ENSP00000322223:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDT0|Q7Z510|Q8NAW8	Missense_Mutation	SNP	pfam_Glycine_N-acyltransferase_N,pfam_Glycine_N-acyltransferase_C,superfamily_Acyl_CoA_acyltransferase	p.M1I	ENST00000317391.4	37	c.3	CCDS55768.1	11	.	.	.	.	.	.	.	.	.	.	.	9.777	1.174284	0.21704	.	.	ENSG00000166840	ENST00000525608;ENST00000444580;ENST00000317391;ENST00000532726	T;T;T	0.20332	2.08;2.08;2.08	3.02	-0.308	0.12773	Glycine N-acyltransferase, N-terminal (1);	.	.	.	.	T	0.12518	0.0304	.	.	.	0.80722	D	1	B	0.16396	0.017	B	0.09377	0.004	T	0.16276	-1.0408	8	0.59425	D	0.04	.	1.3406	0.02153	0.1382:0.2182:0.4206:0.223	.	1	Q969I3	GLYL1_HUMAN	I	1	ENSP00000433716:M1I;ENSP00000322223:M1I;ENSP00000436116:M1I	ENSP00000322223:M1I	M	+	3	0	GLYATL1	58471139	0.001000	0.12720	0.000000	0.03702	0.221000	0.24807	0.307000	0.19296	-0.335000	0.08451	0.411000	0.27672	ATG	GLYATL1	-	pfam_Glycine_N-acyltransferase_N	ENSG00000166840		0.443	GLYATL1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLYATL1	HGNC	protein_coding	OTTHUMT00000393783.1	422	0.00	0	G	NM_080661	Missense_Mutation	58714563	58714563	+1	no_errors	ENST00000317391	ensembl	human	known	69_37n	missense	194	33.79	99	SNP	0.000	A
GOLGA2	2801	genome.wustl.edu	37	9	131023779	131023779	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:131023779C>A	ENST00000421699.2	-	15	1217	c.1205G>T	c.(1204-1206)gGa>gTa	p.G402V	GOLGA2_ENST00000609374.1_Missense_Mutation_p.G390V	NM_004486.4	NP_004477.3	Q08379	GOGA2_HUMAN	golgin A2	402					mitotic cell cycle (GO:0000278)	cis-Golgi network (GO:0005801)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	34						GGCGCTCTCTCCTTTGAGATT	0.493																																						dbGAP											0													124.0	128.0	127.0					9																	131023779		2203	4300	6503	-	-	-	SO:0001583	missense	0			L06147	CCDS6896.2	9q34.13	2010-06-28	2010-02-12		ENSG00000167110	ENSG00000167110			4425	protein-coding gene	gene with protein product	"""Golgi matrix protein GM130"", ""SY11 protein"""	602580	"""golgi autoantigen, golgin subfamily a, 2"""			8315394	Standard	NM_004486		Approved	GM130, golgin-95	uc011maw.2	Q08379	OTTHUMG00000020732	ENST00000421699.2:c.1205G>T	9.37:g.131023779C>A	ENSP00000416097:p.Gly402Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6GRM9|Q9BRB0|Q9NYF9	Missense_Mutation	SNP	superfamily_CofA_tubulin-bd	p.G402V	ENST00000421699.2	37	c.1205	CCDS6896.2	9	.	.	.	.	.	.	.	.	.	.	c	23.6	4.430365	0.83776	.	.	ENSG00000167110	ENST00000421699;ENST00000450617	T;T	0.23552	1.9;1.9	5.3	-3.3	0.05003	.	0.598697	0.17780	N	0.162282	T	0.19485	0.0468	M	0.63843	1.955	0.30105	N	0.807054	B	0.26400	0.148	B	0.24394	0.053	T	0.08617	-1.0713	10	0.37606	T	0.19	.	5.7783	0.18292	0.0:0.2578:0.2321:0.51	.	402	Q08379	GOGA2_HUMAN	V	402;429	ENSP00000416097:G402V;ENSP00000409271:G429V	ENSP00000416097:G402V	G	-	2	0	GOLGA2	130063600	0.672000	0.27530	0.000000	0.03702	0.903000	0.53119	0.870000	0.28010	-0.952000	0.03649	0.305000	0.20034	GGA	GOLGA2	-	NULL	ENSG00000167110		0.493	GOLGA2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA2	HGNC	protein_coding	OTTHUMT00000054358.2	175	0.00	0	C	NM_004486		131023779	131023779	-1	no_errors	ENST00000421699	ensembl	human	known	69_37n	missense	223	13.90	36	SNP	0.887	A
GPR112	139378	genome.wustl.edu	37	X	135427024	135427024	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:135427024A>G	ENST00000394143.1	+	6	1450	c.1159A>G	c.(1159-1161)Aca>Gca	p.T387A	GPR112_ENST00000287534.4_Missense_Mutation_p.T324A|GPR112_ENST00000394141.1_Missense_Mutation_p.T182A|GPR112_ENST00000412101.1_Missense_Mutation_p.T182A|GPR112_ENST00000370652.1_Missense_Mutation_p.T387A	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	387					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					AGTTGTATCTACAACTTCAGC	0.363																																						dbGAP											0													80.0	74.0	76.0					X																	135427024		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.1159A>G	X.37:g.135427024A>G	ENSP00000377699:p.Thr387Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.T387A	ENST00000394143.1	37	c.1159	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	a	2.291	-0.362333	0.05103	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000412101;ENST00000287534;ENST00000394141	T;T;T;T;T	0.27557	1.7;1.7;1.66;1.8;1.66	3.95	-2.34	0.06704	.	.	.	.	.	T	0.13927	0.0337	N	0.14661	0.345	0.09310	N	1	B;B;B	0.28801	0.223;0.091;0.055	B;B;B	0.25140	0.058;0.024;0.011	T	0.24548	-1.0157	9	0.27082	T	0.32	.	5.8054	0.18438	0.3676:0.517:0.1154:0.0	.	324;182;387	Q8IZF6-2;Q8IZF6-3;Q8IZF6	.;.;GP112_HUMAN	A	387;387;182;324;182	ENSP00000377699:T387A;ENSP00000359686:T387A;ENSP00000416526:T182A;ENSP00000287534:T324A;ENSP00000377697:T182A	ENSP00000287534:T324A	T	+	1	0	GPR112	135254690	0.005000	0.15991	0.011000	0.14972	0.023000	0.10783	-0.333000	0.07894	-0.674000	0.05253	0.409000	0.27619	ACA	GPR112	-	NULL	ENSG00000156920		0.363	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	146	0.00	0	A			135427024	135427024	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	missense	77	46.15	66	SNP	0.023	G
GPR153	387509	genome.wustl.edu	37	1	6313985	6313985	+	Silent	SNP	G	G	A	rs537787050		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:6313985G>A	ENST00000377893.2	-	3	838	c.579C>T	c.(577-579)atC>atT	p.I193I		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	193						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		GGAAGAGGGCGATGGCTGTGC	0.706													G|||	1	0.000199681	0.0	0.0014	5008	,	,		17371	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													25.0	28.0	27.0					1																	6313985		2199	4296	6495	-	-	-	SO:0001819	synonymous_variant	0			AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.579C>T	1.37:g.6313985G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGR5|Q6AHW8|Q86SP8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_153,prints_GPCR_153/162	p.I193	ENST00000377893.2	37	c.579	CCDS64.1	1																																																																																			GPR153	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_153/162	ENSG00000158292		0.706	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR153	HGNC	protein_coding	OTTHUMT00000003717.2	25	0.00	0	G			6313985	6313985	-1	no_errors	ENST00000377893	ensembl	human	known	69_37n	silent	20	22.22	6	SNP	0.983	A
GSTM3	2947	genome.wustl.edu	37	1	110280959	110280959	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:110280959C>T	ENST00000540225.1	-	5	529	c.219G>A	c.(217-219)aaG>aaA	p.K73K	GSTM3_ENST00000488824.1_5'UTR|RP4-735C1.4_ENST00000431955.1_RNA|GSTM3_ENST00000361066.2_Silent_p.K73K|GSTM3_ENST00000256594.3_Silent_p.K73K			P21266	GSTM3_HUMAN	glutathione S-transferase mu 3 (brain)	73	GST N-terminal.				cellular detoxification of nitrogen compound (GO:0070458)|establishment of blood-nerve barrier (GO:0008065)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|nitrobenzene metabolic process (GO:0018916)|response to estrogen (GO:0043627)|small molecule metabolic process (GO:0044281)|xenobiotic catabolic process (GO:0042178)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)	enzyme binding (GO:0019899)|glutathione binding (GO:0043295)|glutathione transferase activity (GO:0004364)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(2)|skin(1)	9		all_epithelial(167;1.95e-05)|all_lung(203;0.000135)|Lung NSC(277;0.000269)		Colorectal(144;0.0339)|Lung(183;0.0426)|all cancers(265;0.113)|Epithelial(280;0.125)|COAD - Colon adenocarcinoma(174;0.134)|LUSC - Lung squamous cell carcinoma(189;0.228)	Glutathione(DB00143)|Vitamin E(DB00163)	TCTGGGTGATCTTGTTCTTCC	0.542																																						dbGAP											0													180.0	145.0	157.0					1																	110280959		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000088	CCDS812.1	1p13.3	2012-06-21	2008-11-26		ENSG00000134202	ENSG00000134202	2.5.1.18	"""Glutathione S-transferases / Soluble"""	4635	protein-coding gene	gene with protein product		138390	"""glutathione S-transferase M3 (brain)"""			2345169	Standard	NM_000849		Approved	GST5	uc001dyo.2	P21266	OTTHUMG00000011640	ENST00000540225.1:c.219G>A	1.37:g.110280959C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60550|Q96HA3	Silent	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold,prints_GST_mu	p.K73	ENST00000540225.1	37	c.219	CCDS812.1	1																																																																																			GSTM3	-	pfam_Glutathione_S-Trfase_N,superfamily_Thioredoxin-like_fold	ENSG00000134202		0.542	GSTM3-202	KNOWN	basic|appris_principal|CCDS	protein_coding	GSTM3	HGNC	protein_coding	OTTHUMT00000032182.1	373	0.27	1	C	NM_000849		110280959	110280959	-1	no_errors	ENST00000256594	ensembl	human	known	69_37n	silent	216	21.45	59	SNP	1.000	T
GUCY2F	2986	genome.wustl.edu	37	X	108638635	108638635	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:108638635G>A	ENST00000218006.2	-	12	2650	c.2359C>T	c.(2359-2361)Ctg>Ttg	p.L787L		NM_001522.2	NP_001513.2	P51841	GUC2F_HUMAN	guanylate cyclase 2F, retinal	787	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|phototransduction, visible light (GO:0007603)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|nuclear outer membrane (GO:0005640)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|guanylate cyclase activity (GO:0004383)|protein kinase activity (GO:0004672)|receptor activity (GO:0004872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(6)|large_intestine(14)|lung(33)|prostate(3)|skin(1)	67						TGCTTCATCAGCTGGAGACAT	0.478																																						dbGAP											0													187.0	162.0	171.0					X																	108638635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L37378	CCDS14545.1	Xq22	2008-08-01			ENSG00000101890	ENSG00000101890			4691	protein-coding gene	gene with protein product	"""guanylate cyclase 2D-like, membrane (retina-specific)"""	300041				8838319, 7777544	Standard	NM_001522		Approved	GUC2DL, GC-F, RetGC-2, ROS-GC2, CYGF	uc004eod.4	P51841	OTTHUMG00000022184	ENST00000218006.2:c.2359C>T	X.37:g.108638635G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJF1	Silent	SNP	pfam_A/G_cyclase,pfam_ANF_lig-bd_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Haem_no_assoc-bd,superfamily_A/G_cyclase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_A/G_cyclase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_A/G_cyclase	p.L787	ENST00000218006.2	37	c.2359	CCDS14545.1	X																																																																																			GUCY2F	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000101890		0.478	GUCY2F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCY2F	HGNC	protein_coding	OTTHUMT00000057884.1	420	0.00	0	G	NM_001522		108638635	108638635	-1	no_errors	ENST00000218006	ensembl	human	known	69_37n	silent	242	38.79	154	SNP	1.000	A
HCRTR1	3061	genome.wustl.edu	37	1	32090605	32090605	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:32090605G>A	ENST00000373706.5	+	6	1126	c.973G>A	c.(973-975)Ggg>Agg	p.G325R	HCRTR1_ENST00000403528.2_Missense_Mutation_p.G325R|HCRTR1_ENST00000468521.1_3'UTR|HCRTR1_ENST00000373705.1_Missense_Mutation_p.G325R			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	325					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)			breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		TAGGGTGTTCGGGATGTTCCG	0.587																																						dbGAP											0													107.0	91.0	96.0					1																	32090605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.973G>A	1.37:g.32090605G>A	ENSP00000362810:p.Gly325Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3A6|Q9HBV6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Orexin_rcpt_1,prints_NPY_rcpt	p.G325R	ENST00000373706.5	37	c.973	CCDS344.1	1	.	.	.	.	.	.	.	.	.	.	G	25.3	4.619515	0.87460	.	.	ENSG00000121764	ENST00000403528;ENST00000373706;ENST00000373705	T;T;T	0.36878	1.23;1.23;1.23	4.95	4.95	0.65309	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.55893	0.1949	M	0.71206	2.165	0.58432	D	0.999994	D;D	0.69078	0.968;0.997	P;D	0.63597	0.781;0.916	T	0.50021	-0.8876	10	0.27082	T	0.32	.	16.4941	0.84223	0.0:0.0:1.0:0.0	.	325;325	A6NMV7;O43613	.;OX1R_HUMAN	R	325	ENSP00000384387:G325R;ENSP00000362810:G325R;ENSP00000362809:G325R	ENSP00000362809:G325R	G	+	1	0	HCRTR1	31863192	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	8.955000	0.93058	2.677000	0.91161	0.561000	0.74099	GGG	HCRTR1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt	ENSG00000121764		0.587	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011042.1	53	0.00	0	G	NM_001525		32090605	32090605	+1	no_errors	ENST00000373706	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	A
HDHD1	8226	genome.wustl.edu	37	X	7023749	7023749	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:7023749G>A	ENST00000381077.5	-	2	268	c.192C>T	c.(190-192)gtC>gtT	p.V64V	HDHD1_ENST00000424830.2_Silent_p.V87V|HDHD1_ENST00000498474.2_5'UTR|HDHD1_ENST00000540122.1_Silent_p.V64V|HDHD1_ENST00000412827.2_Intron	NM_001178136.1|NM_012080.4	NP_001171607.1|NP_036212.3	Q08623	HDHD1_HUMAN	haloacid dehalogenase-like hydrolase domain containing 1	64					nucleotide metabolic process (GO:0009117)	extracellular vesicular exosome (GO:0070062)	metal ion binding (GO:0046872)|phosphatase activity (GO:0016791)			breast(2)|large_intestine(1)|lung(3)	6						GGAGCTGCAAGACGTCTATTA	0.483																																						dbGAP											0													69.0	66.0	67.0					X																	7023749		1908	4124	6032	-	-	-	SO:0001819	synonymous_variant	0			M86934	CCDS48075.1, CCDS48076.1, CCDS55366.1, CCDS55367.1	Xp22.32	2010-07-21	2010-07-21	2010-07-21	ENSG00000130021	ENSG00000130021			16818	protein-coding gene	gene with protein product		306480	"""family with sequence similarity 16, member A, X-linked"", ""haloacid dehalogenase-like hydrolase domain containing 1A"""	FAM16AX, HDHD1A		1734713, 1284467	Standard	NM_012080		Approved	DXF68S1E, GS1	uc011mhm.1	Q08623	OTTHUMG00000021101	ENST00000381077.5:c.192C>T	X.37:g.7023749G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7X6|B4DV93|B7Z6Q3|E9PAV8|F5GWZ2|Q53F84|Q96EB8	Silent	SNP	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IA_v3	p.V87	ENST00000381077.5	37	c.261	CCDS48075.1	X																																																																																			HDHD1	-	pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom	ENSG00000130021		0.483	HDHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDHD1	HGNC	protein_coding	OTTHUMT00000055683.2	201	0.00	0	G	NM_012080		7023749	7023749	-1	no_errors	ENST00000424830	ensembl	human	known	69_37n	silent	159	20.00	40	SNP	0.006	A
MROH1	727957	genome.wustl.edu	37	8	145246704	145246704	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:145246704C>T	ENST00000528919.1	+	8	922	c.801C>T	c.(799-801)ctC>ctT	p.L267L	MROH1_ENST00000423230.2_Silent_p.L267L|MROH1_ENST00000534366.1_Silent_p.L267L|MROH1_ENST00000326134.5_Silent_p.L267L|MROH1_ENST00000398656.4_Silent_p.L267L	NM_032450.2	NP_115826	Q8NDA8	MROH1_HUMAN	maestro heat-like repeat family member 1	267																	CCAAGCTCCTCCCTGGGATTC	0.612																																						dbGAP											0													46.0	52.0	50.0					8																	145246704		2085	4204	6289	-	-	-	SO:0001819	synonymous_variant	0				CCDS47938.1, CCDS47939.1, CCDS75803.1	8q24.3	2012-12-19	2012-12-19	2012-12-19	ENSG00000179832	ENSG00000179832		"""maestro heat-like repeat containing"""	26958	protein-coding gene	gene with protein product			"""HEAT repeat containing 7A"""	HEATR7A		11347906	Standard	NM_032450		Approved	KIAA1833	uc003zbk.4	Q8NDA8	OTTHUMG00000165781	ENST00000528919.1:c.801C>T	8.37:g.145246704C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JWM5|D3DWL5|Q0P612|Q569G6|Q6NVW4|Q8N230|Q8NAD1|Q8ND95|Q96JJ4	Silent	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.L267	ENST00000528919.1	37	c.801	CCDS47938.1	8																																																																																			HEATR7A	-	superfamily_ARM-type_fold	ENSG00000179832		0.612	MROH1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HEATR7A	HGNC	protein_coding	OTTHUMT00000386183.1	74	0.00	0	C	NM_032450		145246704	145246704	+1	no_errors	ENST00000326134	ensembl	human	known	69_37n	silent	55	12.70	8	SNP	0.997	T
HECW1	23072	genome.wustl.edu	37	7	43580831	43580831	+	Silent	SNP	G	G	C	rs2304320	byFrequency	TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:43580831G>C	ENST00000395891.2	+	25	4694	c.4089G>C	c.(4087-4089)acG>acC	p.T1363T	HECW1_ENST00000453890.1_Silent_p.T1329T	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	1363	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CTTTCTTCACGAGGCCCTTCT	0.547																																						dbGAP											0													148.0	142.0	144.0					7																	43580831		2001	4164	6165	-	-	-	SO:0001819	synonymous_variant	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.4089G>C	7.37:g.43580831G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,pfscan_HECT	p.R87P	ENST00000395891.2	37	c.260	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	G	9.818	1.184971	0.21870	.	.	ENSG00000002746	ENST00000429529	.	.	.	5.83	-5.92	0.02261	.	.	.	.	.	T	0.54727	0.1876	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.57825	-0.7744	4	.	.	.	.	12.5018	0.55960	0.7225:0.0888:0.1887:0.0	.	.	.	.	P	87	.	.	R	+	2	0	HECW1	43547356	0.224000	0.23674	0.764000	0.31436	0.995000	0.86356	-0.377000	0.07456	-1.276000	0.02414	0.563000	0.77884	CGA	HECW1	-	pfam_HECT,superfamily_HECT,pfscan_HECT	ENSG00000002746		0.547	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	276	0.00	0	G	NM_015052		43580831	43580831	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429529	ensembl	human	putative	69_37n	missense	228	21.58	63	SNP	0.504	C
HIF1A	3091	genome.wustl.edu	37	14	62207737	62207737	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:62207737C>T	ENST00000337138.4	+	12	2189	c.1924C>T	c.(1924-1926)Cca>Tca	p.P642S	HIF1A_ENST00000539097.1_Missense_Mutation_p.P666S|HIF1A_ENST00000323441.6_Missense_Mutation_p.P642S|HIF1A-AS2_ENST00000554254.1_lincRNA|HIF1A_ENST00000557538.1_Missense_Mutation_p.P583S|RP11-618G20.1_ENST00000555937.1_RNA|HIF1A_ENST00000394997.1_Missense_Mutation_p.P643S	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)	642	ID.				angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	GATTGCATCTCCATCTCCTAC	0.418																																						dbGAP											0													111.0	103.0	106.0					14																	62207737		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.1924C>T	14.37:g.62207737C>T	ENSP00000338018:p.Pro642Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_DNA-bd,prints_HIF-1_alpha,tigrfam_PAS	p.P666S	ENST00000337138.4	37	c.1996	CCDS9753.1	14	.	.	.	.	.	.	.	.	.	.	C	13.57	2.275925	0.40294	.	.	ENSG00000100644	ENST00000539494;ENST00000394988;ENST00000337138;ENST00000394997;ENST00000323441;ENST00000557538;ENST00000539097	T;T;T;T;T	0.51325	0.71;0.71;0.71;0.71;0.71	5.72	5.72	0.89469	.	2.320480	0.01589	N	0.021458	T	0.37019	0.0988	N	0.11255	0.115	0.42866	D	0.994121	B;B;B	0.16166	0.016;0.016;0.016	B;B;B	0.16289	0.015;0.015;0.015	T	0.03706	-1.1011	10	0.39692	T	0.17	.	12.494	0.55916	0.0:0.9157:0.0:0.0843	.	643;642;642	A8MYV6;D0VY79;Q16665	.;.;HIF1A_HUMAN	S	393;583;642;643;642;583;666	ENSP00000338018:P642S;ENSP00000378446:P643S;ENSP00000323326:P642S;ENSP00000451696:P583S;ENSP00000437955:P666S	ENSP00000323326:P642S	P	+	1	0	HIF1A	61277490	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.038000	0.41184	2.857000	0.98124	0.650000	0.86243	CCA	HIF1A	-	NULL	ENSG00000100644		0.418	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	HGNC	protein_coding	OTTHUMT00000276977.2	189	0.00	0	C	NM_001530		62207737	62207737	+1	no_errors	ENST00000539097	ensembl	human	known	69_37n	missense	145	15.70	27	SNP	1.000	T
HIPK2	28996	genome.wustl.edu	37	7	139288862	139288862	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:139288862C>G	ENST00000406875.3	-	10	2314	c.2220G>C	c.(2218-2220)gaG>gaC	p.E740D	HIPK2_ENST00000342645.6_Missense_Mutation_p.E740D|HIPK2_ENST00000428878.2_Missense_Mutation_p.E713D	NM_022740.4	NP_073577.3	Q9H2X6	HIPK2_HUMAN	homeodomain interacting protein kinase 2	740	Interaction with SKI and SMAD1.				adult walking behavior (GO:0007628)|anterior/posterior pattern specification (GO:0009952)|cellular response to hypoxia (GO:0071456)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|erythrocyte differentiation (GO:0030218)|eye development (GO:0001654)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|iris morphogenesis (GO:0061072)|lens induction in camera-type eye (GO:0060235)|modulation by virus of host morphology or physiology (GO:0019048)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|PML body organization (GO:0030578)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|retina layer formation (GO:0010842)|SMAD protein signal transduction (GO:0060395)|smoothened signaling pathway (GO:0007224)|transforming growth factor beta receptor signaling pathway (GO:0007179)|voluntary musculoskeletal movement (GO:0050882)	cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|virion binding (GO:0046790)			breast(4)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(5)|lung(11)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Melanoma(164;0.205)					CTGCCATGGTCTCGGGAATCA	0.627																																						dbGAP											0													109.0	114.0	112.0					7																	139288862		2131	4236	6367	-	-	-	SO:0001583	missense	0			AF208291	CCDS75666.1, CCDS75667.1	7q32-q34	2004-01-29	2001-11-29		ENSG00000064393	ENSG00000064393			14402	protein-coding gene	gene with protein product		606868	"""homeodomain-interacting protein kinase 2"""			11120354	Standard	NM_001113239		Approved		uc003vvf.4	Q9H2X6	OTTHUMG00000157704	ENST00000406875.3:c.2220G>C	7.37:g.139288862C>G	ENSP00000385571:p.Glu740Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75MR7|Q8WWI4|Q9H2Y1	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E740D	ENST00000406875.3	37	c.2220		7	.	.	.	.	.	.	.	.	.	.	C	11.29	1.595143	0.28445	.	.	ENSG00000064393	ENST00000406875;ENST00000428878;ENST00000342645	T;T;T	0.29397	1.57;1.57;1.57	4.47	4.47	0.54385	.	.	.	.	.	T	0.19765	0.0475	.	.	.	0.44289	D	0.997157	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.05517	-1.0880	8	0.18710	T	0.47	.	11.8705	0.52517	0.0:0.9159:0.0:0.0841	.	740;713	Q9H2X6;Q9H2X6-3	HIPK2_HUMAN;.	D	740;713;740	ENSP00000385571:E740D;ENSP00000413724:E713D;ENSP00000343108:E740D	ENSP00000343108:E740D	E	-	3	2	HIPK2	138939402	1.000000	0.71417	1.000000	0.80357	0.740000	0.42216	2.567000	0.45956	2.319000	0.78375	0.650000	0.86243	GAG	HIPK2	-	NULL	ENSG00000064393		0.627	HIPK2-001	KNOWN	basic|appris_principal	protein_coding	HIPK2	HGNC	protein_coding	OTTHUMT00000349430.3	82	0.00	0	C	NM_022740		139288862	139288862	-1	no_errors	ENST00000406875	ensembl	human	known	69_37n	missense	51	19.05	12	SNP	1.000	G
HIST4H4	121504	genome.wustl.edu	37	12	14923905	14923905	+	Silent	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:14923905G>T	ENST00000539745.1	-	1	160	c.114C>A	c.(112-114)ctC>ctA	p.L38L	HIST4H4_ENST00000541592.1_5'Flank	NM_175054.2	NP_778224.1	P62805	H4_HUMAN	histone cluster 4, H4	38					CENP-A containing nucleosome assembly (GO:0034080)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone H4-K20 demethylation (GO:0035574)|mitotic cell cycle (GO:0000278)|negative regulation of megakaryocyte differentiation (GO:0045653)|nucleosome assembly (GO:0006334)|telomere maintenance (GO:0000723)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|histone demethylase activity (H4-K20 specific) (GO:0035575)|poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)	6						CACGTCGGGCGAGACGGCGAA	0.612											OREG0021698	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													53.0	54.0	54.0					12																	14923905		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY128653	CCDS8665.1	12p12.3	2011-01-27	2006-10-11			ENSG00000197837		"""Histones / Replication-dependent"""	20510	protein-coding gene	gene with protein product		615069	"""histone 4, H4"""			12408966	Standard	NM_175054		Approved	MGC24116	uc001rcf.4	P62805		ENST00000539745.1:c.114C>A	12.37:g.14923905G>T		Somatic	698	WXS	Illumina GAIIx	Phase_IV	A2VCL0|P02304|P02305|Q6DRA9|Q6FGB8|Q6NWP7	Silent	SNP	pfam_Histone_core_D,pfam_TAF_TATA-bd,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	p.L38	ENST00000539745.1	37	c.114	CCDS8665.1	12																																																																																			HIST4H4	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H4,smart_TAF_TATA-bd,prints_Histone_H4	ENSG00000197837		0.612	HIST4H4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST4H4	HGNC	protein_coding	OTTHUMT00000400844.1	70	0.00	0	G	NM_175054		14923905	14923905	-1	no_errors	ENST00000358064	ensembl	human	known	69_37n	silent	64	20.00	16	SNP	0.231	T
HLA-DRB6	3128	genome.wustl.edu	37	6	32522679	32522679	+	RNA	SNP	G	G	C	rs112103446	byFrequency	TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:32522679G>C	ENST00000411500.1	-	0	527					NR_001298.1				major histocompatibility complex, class II, DR beta 6 (pseudogene)																		ACCACTCACAGAGCCGACCAG	0.517													G|||	1613	0.322085	0.4327	0.2709	5008	,	,		9706	0.2976		0.2873	False		,,,				2504	0.2699					dbGAP											0																																										-	-	-			0			L76566		6p21.3	2011-07-08			ENSG00000229391	ENSG00000229391		"""Histocompatibility complex"""	4954	pseudogene	pseudogene						1529427, 10436177	Standard	NR_001298		Approved		uc003obn.1		OTTHUMG00000031028		6.37:g.32522679G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000411500.1	37	NULL		6																																																																																			HLA-DRB6	-	-	ENSG00000229391		0.517	HLA-DRB6-002	KNOWN	basic	processed_transcript	HLA-DRB6	HGNC	pseudogene	OTTHUMT00000272900.1	17	0.00	0	G	NR_001298		32522679	32522679	-1	no_errors	ENST00000411500	ensembl	human	known	69_37n	rna	21	38.24	13	SNP	1.000	C
HNRNPH1	3187	genome.wustl.edu	37	5	179044636	179044636	+	Silent	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:179044636G>T	ENST00000356731.5	-	8	2471	c.936C>A	c.(934-936)ctC>ctA	p.L312L	HNRNPH1_ENST00000510411.1_Silent_p.L312L|HNRNPH1_ENST00000442819.2_Silent_p.L312L|HNRNPH1_ENST00000393432.4_Silent_p.L312L|HNRNPH1_ENST00000511300.2_Silent_p.L42L|HNRNPH1_ENST00000524180.1_5'Flank|HNRNPH1_ENST00000329433.6_Silent_p.L312L			P31943	HNRH1_HUMAN	heterogeneous nuclear ribonucleoprotein H1 (H)	312	2 X 16 AA Gly-rich approximate repeats.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|poly(U) RNA binding (GO:0008266)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(4)|skin(1)	14						TCACAGGGTTGAGCGGTGAAA	0.393																																						dbGAP											0													89.0	87.0	88.0					5																	179044636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001348	CCDS4446.1	5q35.3	2013-02-12		2008-04-18	ENSG00000169045	ENSG00000169045		"""RNA binding motif (RRM) containing"""	5041	protein-coding gene	gene with protein product		601035		HNRPH1		7499401	Standard	NM_005520		Approved	hnRNPH	uc003mkf.5	P31943	OTTHUMG00000130908	ENST00000356731.5:c.936C>A	5.37:g.179044636G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW86|D3DWQ2|Q6IBM4	Nonsense_Mutation	SNP	pfam_Znf_CHHC,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S187*	ENST00000356731.5	37	c.560	CCDS4446.1	5	.	.	.	.	.	.	.	.	.	.	g	4.900	0.167275	0.09339	.	.	ENSG00000169045	ENST00000521173	.	.	.	5.68	0.768	0.18487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-0.1905	2.3748	0.04339	0.2607:0.3383:0.2946:0.1064	.	.	.	.	X	187	.	.	S	-	2	0	HNRNPH1	178977242	1.000000	0.71417	0.980000	0.43619	0.832000	0.47134	1.723000	0.38053	-0.072000	0.12864	0.650000	0.86243	TCA	HNRNPH1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000169045		0.393	HNRNPH1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HNRNPH1	HGNC	protein_coding	OTTHUMT00000253497.3	145	0.00	0	G	NM_005520		179044636	179044636	-1	no_start_codon:pseudogene:no_stop_codon	ENST00000521173	ensembl	human	novel	69_37n	nonsense	122	20.78	32	SNP	0.992	T
HTR1B	3351	genome.wustl.edu	37	6	78172401	78172401	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:78172401C>T	ENST00000369947.2	-	1	1089	c.720G>A	c.(718-720)ttG>ttA	p.L240L		NM_000863.1	NP_000854.1	P28222	5HT1B_HUMAN	5-hydroxytryptamine (serotonin) receptor 1B, G protein-coupled	240					adenylate cyclase-inhibiting serotonin receptor signaling pathway (GO:0007198)|bone remodeling (GO:0046849)|cellular response to alkaloid (GO:0071312)|cellular response to drug (GO:0035690)|cellular response to temperature stimulus (GO:0071502)|drinking behavior (GO:0042756)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of serotonin secretion (GO:0014063)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|vasoconstriction (GO:0042310)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(9)|prostate(2)|upper_aerodigestive_tract(2)	25		all_cancers(76;0.0867)|Acute lymphoblastic leukemia(125;0.00119)|all_hematologic(105;0.0332)		BRCA - Breast invasive adenocarcinoma(397;0.205)	Almotriptan(DB00918)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bopindolol(DB08807)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Clozapine(DB00363)|Dihydroergotamine(DB00320)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Frovatriptan(DB00998)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Methysergide(DB00247)|Naratriptan(DB00952)|Olanzapine(DB00334)|Ondansetron(DB00904)|Penbutolol(DB01359)|Pergolide(DB01186)|Pindolol(DB00960)|Pramipexole(DB00413)|Propranolol(DB00571)|Quetiapine(DB01224)|Rizatriptan(DB00953)|Ropinirole(DB00268)|Sumatriptan(DB00669)|Yohimbine(DB01392)|Ziprasidone(DB00246)|Zolmitriptan(DB00315)	GCGTCTGTTTCAAAATCCGGG	0.607																																						dbGAP											0													51.0	57.0	55.0					6																	78172401		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC069065	CCDS4986.1	6q13	2012-08-08	2012-02-03		ENSG00000135312	ENSG00000135312		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5287	protein-coding gene	gene with protein product		182131	"""5-hydroxytryptamine (serotonin) receptor 1B"""			1348246, 11247661	Standard	NM_000863		Approved	S12, 5-HT1B, HTR1D2, 5-HT1DB	uc003pil.1	P28222	OTTHUMG00000015066	ENST00000369947.2:c.720G>A	6.37:g.78172401C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAY7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_5HT1B_rcpt,prints_5HT_rcpt,prints_Adrnrgc_rcpt	p.L240	ENST00000369947.2	37	c.720	CCDS4986.1	6																																																																																			HTR1B	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000135312		0.607	HTR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR1B	HGNC	protein_coding	OTTHUMT00000041292.1	97	0.00	0	C	NM_000863		78172401	78172401	-1	no_errors	ENST00000369947	ensembl	human	known	69_37n	silent	77	22.22	22	SNP	1.000	T
HUWE1	10075	genome.wustl.edu	37	X	53644041	53644041	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:53644041C>A	ENST00000342160.3	-	20	2304	c.1847G>T	c.(1846-1848)cGa>cTa	p.R616L	HUWE1_ENST00000262854.6_Missense_Mutation_p.R616L|HUWE1_ENST00000218328.8_Missense_Mutation_p.R616L			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	616					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CTGAAGACCTCGGGCATTCAA	0.478																																						dbGAP											0													62.0	55.0	58.0					X																	53644041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.1847G>T	X.37:g.53644041C>A	ENSP00000340648:p.Arg616Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.R616L	ENST00000342160.3	37	c.1847	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	32	5.176442	0.94846	.	.	ENSG00000086758	ENST00000342160;ENST00000262854;ENST00000218328	T;T;T	0.44083	0.93;0.93;0.93	5.45	5.45	0.79879	E3 ubiquitin ligase, domain of unknown function DUF913 (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000005	T	0.67449	0.2894	M	0.80183	2.485	0.54753	D	0.999987	D	0.76494	0.999	D	0.76575	0.988	T	0.72286	-0.4338	10	0.72032	D	0.01	.	17.0476	0.86508	0.0:1.0:0.0:0.0	.	616	Q7Z6Z7	HUWE1_HUMAN	L	616	ENSP00000340648:R616L;ENSP00000262854:R616L;ENSP00000218328:R616L	ENSP00000218328:R616L	R	-	2	0	HUWE1	53660766	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	7.421000	0.80204	2.289000	0.77006	0.594000	0.82650	CGA	HUWE1	-	pfam_E3_Ub_ligase_DUF913,superfamily_ARM-type_fold	ENSG00000086758		0.478	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	242	0.41	1	C	XM_497119		53644041	53644041	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	203	18.73	47	SNP	1.000	A
IK	3550	genome.wustl.edu	37	5	140037204	140037204	+	Silent	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:140037204G>T	ENST00000417647.2	+	10	1006	c.867G>T	c.(865-867)ctG>ctT	p.L289L		NM_006083.3	NP_006074.2	Q13123	RED_HUMAN	IK cytokine, down-regulator of HLA II	289					cell-cell signaling (GO:0007267)|immune response (GO:0006955)	extracellular space (GO:0005615)|nucleus (GO:0005634)	identical protein binding (GO:0042802)			large_intestine(1)	1		all_hematologic(541;4.8e-07)|all_lung(500;0.000434)|Lung NSC(810;0.00161)|Breast(839;0.128)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTTCATACCTGAGGCAGGGAA	0.453																																						dbGAP											0													140.0	125.0	129.0					5																	140037204		1904	4130	6034	-	-	-	SO:0001819	synonymous_variant	0			BC051295	CCDS47280.1	5q31.3	2008-08-07			ENSG00000113141	ENSG00000113141			5958	protein-coding gene	gene with protein product		600549				7970704	Standard	NM_006083		Approved		uc003lgq.3	Q13123	OTTHUMG00000163374	ENST00000417647.2:c.867G>T	5.37:g.140037204G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPD8	Silent	SNP	pfam_RED_N,pfam_RED_C	p.L289	ENST00000417647.2	37	c.867	CCDS47280.1	5																																																																																			IK	-	pfam_RED_N	ENSG00000113141		0.453	IK-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	IK	HGNC	protein_coding	OTTHUMT00000372897.1	207	0.00	0	G	NM_006083		140037204	140037204	+1	no_errors	ENST00000417647	ensembl	human	known	69_37n	silent	145	29.27	60	SNP	1.000	T
ILK	3611	genome.wustl.edu	37	11	6631267	6631267	+	Splice_Site	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:6631267G>A	ENST00000396751.2	+	10	1534		c.e10+1		ILK_ENST00000528995.1_Splice_Site|ILK_ENST00000299421.4_Splice_Site|ILK_ENST00000537806.1_Splice_Site|ILK_ENST00000420936.2_Splice_Site|RP11-732A19.2_ENST00000527398.1_RNA|TAF10_ENST00000531760.1_5'Flank|ILK_ENST00000526711.1_Splice_Site	NM_001014795.1	NP_001014795.1	Q13418	ILK_HUMAN	integrin-linked kinase						branching involved in ureteric bud morphogenesis (GO:0001658)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell junction assembly (GO:0034329)|cell proliferation (GO:0008283)|cell-matrix adhesion (GO:0007160)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|extracellular fibril organization (GO:0043206)|fibroblast migration (GO:0010761)|integrin-mediated signaling pathway (GO:0007229)|myelin assembly (GO:0032288)|myelination in peripheral nervous system (GO:0022011)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of smooth muscle cell proliferation (GO:0048662)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|peptidyl-serine phosphorylation (GO:0018105)|platelet aggregation (GO:0070527)|positive regulation of axon extension (GO:0045773)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterooligomerization (GO:0051291)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)	1		Breast(177;7.61e-05)|Medulloblastoma(188;0.00263)|all_neural(188;0.026)|all_lung(207;0.152)		Epithelial(150;5.49e-24)|BRCA - Breast invasive adenocarcinoma(625;0.00012)|Lung(200;0.00942)|LUSC - Lung squamous cell carcinoma(625;0.0163)		GCCCCCGAAGGTGAGTGAAGT	0.537																																						dbGAP											0													82.0	85.0	84.0					11																	6631267		2201	4296	6497	-	-	-	SO:0001630	splice_region_variant	0			U40282	CCDS7768.1, CCDS60712.1, CCDS60713.1	11p15.4	2014-09-17			ENSG00000166333	ENSG00000166333		"""Ankyrin repeat domain containing"""	6040	protein-coding gene	gene with protein product		602366				8538749	Standard	NM_004517		Approved		uc001mef.3	Q13418	OTTHUMG00000133407	ENST00000396751.2:c.1078+1G>A	11.37:g.6631267G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1I0|B7Z418|D3DQU0|P57043|Q68DZ3	Splice_Site	SNP	-	e10+1	ENST00000396751.2	37	c.1078+1	CCDS7768.1	11	.	.	.	.	.	.	.	.	.	.	G	14.18	2.459142	0.43634	.	.	ENSG00000166333	ENST00000299421;ENST00000537806;ENST00000420936;ENST00000528995;ENST00000396751	.	.	.	4.76	4.76	0.60689	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.4236	0.75035	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ILK	6587843	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.574000	0.90763	2.641000	0.89580	0.563000	0.77884	.	ILK	-	-	ENSG00000166333		0.537	ILK-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ILK	HGNC	protein_coding	OTTHUMT00000384519.1	115	0.00	0	G	NM_004517	Intron	6631267	6631267	+1	no_errors	ENST00000299421	ensembl	human	known	69_37n	splice_site	119	10.53	14	SNP	1.000	A
INO80	54617	genome.wustl.edu	37	15	41384317	41384317	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:41384317delC	ENST00000361937.3	-	5	869	c.445delG	c.(445-447)gaafs	p.E149fs	INO80_ENST00000401393.3_Frame_Shift_Del_p.E149fs			Q9ULG1	INO80_HUMAN	INO80 complex subunit	149	Assembles INO80 complex module with putative regulatory components INO80E, INO80F, UCHL5, NFRKB, MCRS1 and IN80D.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						AGATTGAGTTCTTCTTCATCA	0.378																																						dbGAP											0													172.0	159.0	164.0					15																	41384317		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.445delG	15.37:g.41384317delC	ENSP00000355205:p.Glu149fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X4|Q9NTG6	Frame_Shift_Del	DEL	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E149fs	ENST00000361937.3	37	c.445	CCDS10071.1	15																																																																																			INO80	-	NULL	ENSG00000128908		0.378	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80	HGNC	protein_coding	OTTHUMT00000252527.2	480	0.00	0	C	NM_017553		41384317	41384317	-1	no_errors	ENST00000361937	ensembl	human	known	69_37n	frame_shift_del	445	10.56	53	DEL	1.000	-
IQCA1	79781	genome.wustl.edu	37	2	237374267	237374267	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:237374267C>T	ENST00000409907.3	-	6	1081	c.807G>A	c.(805-807)aaG>aaA	p.K269K	IQCA1_ENST00000431676.2_Silent_p.K269K|IQCA1_ENST00000309507.5_Silent_p.K265K	NM_024726.4	NP_079002.3	Q86XH1	IQCA1_HUMAN	IQ motif containing with AAA domain 1	269							ATP binding (GO:0005524)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(1)	26						CCTCTTCATGCTTTATCTGCA	0.463																																						dbGAP											0													160.0	147.0	151.0					2																	237374267		1963	4147	6110	-	-	-	SO:0001819	synonymous_variant	0			AK026180	CCDS46549.1, CCDS59441.1, CCDS74677.1	2q37.3	2014-07-18	2008-07-02	2008-07-02	ENSG00000132321	ENSG00000132321		"""ATPases / AAA-type"""	26195	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 11"""		"""IQ motif containing with AAA domain"""	IQCA		23427265	Standard	NM_024726		Approved	FLJ22527, DRC11	uc002vwb.3	Q86XH1	OTTHUMG00000153058	ENST00000409907.3:c.807G>A	2.37:g.237374267C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFH9|E7EWQ0|Q4G164|Q53R37|Q53RV3|Q96NS7|Q9H680	Missense_Mutation	SNP	pfscan_IQ_motif_EF-hand-BS	p.A288T	ENST00000409907.3	37	c.862	CCDS46549.1	2	.	.	.	.	.	.	.	.	.	.	C	5.777	0.327678	0.10956	.	.	ENSG00000132321	ENST00000418802	.	.	.	5.37	3.54	0.40534	.	.	.	.	.	T	0.56031	0.1958	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.52223	-0.8604	4	.	.	.	.	7.1246	0.25465	0.0:0.656:0.0:0.344	.	.	.	.	T	288	.	.	A	-	1	0	IQCA1	237039006	0.874000	0.30092	0.347000	0.25668	0.037000	0.13140	0.926000	0.28804	1.236000	0.43740	0.563000	0.77884	GCA	IQCA1	-	NULL	ENSG00000132321		0.463	IQCA1-001	KNOWN	basic|CCDS	protein_coding	IQCA1	HGNC	protein_coding	OTTHUMT00000329266.1	369	0.00	0	C	NM_024726		237374267	237374267	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418802	ensembl	human	putative	69_37n	missense	219	42.06	159	SNP	0.787	T
KAT6A	7994	genome.wustl.edu	37	8	41798588	41798588	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:41798588C>G	ENST00000396930.3	-	16	3354	c.2811G>C	c.(2809-2811)aaG>aaC	p.K937N	KAT6A_ENST00000265713.2_Missense_Mutation_p.K937N|KAT6A_ENST00000406337.1_Missense_Mutation_p.K937N	NM_001099412.1	NP_001092882.1	Q92794	KAT6A_HUMAN	K(lysine) acetyltransferase 6A	937					aorta morphogenesis (GO:0035909)|cellular senescence (GO:0090398)|chromatin organization (GO:0006325)|DNA packaging (GO:0006323)|embryonic hemopoiesis (GO:0035162)|face morphogenesis (GO:0060325)|heart morphogenesis (GO:0003007)|histone acetylation (GO:0016573)|histone H3 acetylation (GO:0043966)|myeloid cell differentiation (GO:0030099)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of transcription, DNA-templated (GO:0045893)|protein acetylation (GO:0006473)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|PML body (GO:0016605)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)										TGAGTCTTCTCTTGGGAAGGT	0.542																																						dbGAP											0													107.0	103.0	104.0					8																	41798588		2203	4300	6503	-	-	-	SO:0001583	missense	0			U47742	CCDS6124.1	8p11	2013-01-28	2011-07-21	2011-07-21	ENSG00000083168	ENSG00000083168		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Zinc fingers, C2HC-type containing"", ""Zinc fingers, PHD-type"""	13013	protein-coding gene	gene with protein product	"""Monocytic leukemia zinc finger protein"""	601408	"""runt-related transcription factor binding protein 2"", ""MYST histone acetyltransferase (monocytic leukemia) 3"""	ZNF220, RUNXBP2, MYST3		8849440, 8782817	Standard	NM_001099412		Approved	MOZ, ZC2HC6A	uc003xon.4	Q92794	OTTHUMG00000150453	ENST00000396930.3:c.2811G>C	8.37:g.41798588C>G	ENSP00000380136:p.Lys937Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q76L81	Missense_Mutation	SNP	pfam_MOZ_SAS,pfam_Znf_PHD-finger,superfamily_Acyl_CoA_acyltransferase,superfamily_Znf_FYVE_PHD,smart_Histone_H1/H5,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K937N	ENST00000396930.3	37	c.2811	CCDS6124.1	8	.	.	.	.	.	.	.	.	.	.	C	1.894	-0.454736	0.04540	.	.	ENSG00000083168	ENST00000265713;ENST00000406337;ENST00000396930;ENST00000418721	T;T;T	0.60299	0.2;0.2;0.2	5.56	-6.23	0.02052	.	0.373357	0.24871	N	0.034925	T	0.38214	0.1032	N	0.24115	0.695	0.20638	N	0.99987	B	0.23735	0.09	B	0.19148	0.024	T	0.08027	-1.0742	10	0.66056	D	0.02	-19.8278	15.8836	0.79222	0.1125:0.7174:0.0:0.1701	.	937	Q92794	KAT6A_HUMAN	N	937;937;937;517	ENSP00000265713:K937N;ENSP00000385888:K937N;ENSP00000380136:K937N	ENSP00000265713:K937N	K	-	3	2	KAT6A	41917745	0.126000	0.22350	0.066000	0.19879	0.011000	0.07611	-0.271000	0.08572	-1.191000	0.02695	-1.728000	0.00702	AAG	KAT6A	-	NULL	ENSG00000083168		0.542	KAT6A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KAT6A	HGNC	protein_coding	OTTHUMT00000318163.1	122	0.00	0	C	NM_006766		41798588	41798588	-1	no_errors	ENST00000265713	ensembl	human	known	69_37n	missense	69	46.92	61	SNP	0.017	G
KCNJ13	3769	genome.wustl.edu	37	2	233633333	233633333	+	Silent	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:233633333G>C	ENST00000233826.3	-	3	790	c.651C>G	c.(649-651)ctC>ctG	p.L217L	GIGYF2_ENST00000373566.3_Intron|GIGYF2_ENST00000409480.1_Intron|GIGYF2_ENST00000452341.2_Intron|KCNJ13_ENST00000410029.1_Silent_p.L217L|GIGYF2_ENST00000409451.3_Intron|GIGYF2_ENST00000409196.3_Intron|GIGYF2_ENST00000373563.4_Intron|AC064852.4_ENST00000427571.1_RNA|GIGYF2_ENST00000409547.1_Intron|KCNJ13_ENST00000409779.1_3'UTR	NM_002242.4	NP_002233.2	O60928	KCJ13_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 13	217					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)	integral component of membrane (GO:0016021)	inward rectifier potassium channel activity (GO:0005242)			endometrium(3)|large_intestine(2)|lung(2)|stomach(1)|urinary_tract(1)	9		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0306)|Lung NSC(271;0.0908)		Epithelial(121;5.9e-17)|BRCA - Breast invasive adenocarcinoma(100;0.000311)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(119;0.00942)|GBM - Glioblastoma multiforme(43;0.0617)		TGGTCTGGTAGAGTTTGCCAT	0.458																																						dbGAP											0													196.0	159.0	172.0					2																	233633333		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ006128	CCDS2498.1, CCDS54437.1	2q37	2014-01-28			ENSG00000115474	ENSG00000115474		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6259	protein-coding gene	gene with protein product		603208				9878260, 9620703, 16382105	Standard	NM_002242		Approved	Kir7.1, Kir1.4, LCA16	uc002vtp.3	O60928	OTTHUMG00000153292	ENST00000233826.3:c.651C>G	2.37:g.233633333G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PGH1|O76023|Q53SA1|Q8N3Y4	Silent	SNP	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir7,prints_K_chnl_inward-rec_Kir_Cr2	p.L217	ENST00000233826.3	37	c.651	CCDS2498.1	2																																																																																			KCNJ13	-	pfam_K_chnl_inward-rec_Kir_Cr2,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir	ENSG00000115474		0.458	KCNJ13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ13	HGNC	protein_coding	OTTHUMT00000257036.1	267	0.00	0	G	NM_002242		233633333	233633333	-1	no_errors	ENST00000233826	ensembl	human	known	69_37n	silent	237	17.87	52	SNP	0.998	C
KCTD20	222658	genome.wustl.edu	37	6	36447445	36447445	+	Silent	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:36447445C>G	ENST00000373731.2	+	5	1006	c.615C>G	c.(613-615)ctC>ctG	p.L205L	KCTD20_ENST00000544295.1_Intron|KCTD20_ENST00000449081.2_Intron|KCTD20_ENST00000536244.1_Silent_p.L60L|KCTD20_ENST00000474988.1_Intron	NM_173562.3	NP_775833.2	Q7Z5Y7	KCD20_HUMAN	potassium channel tetramerization domain containing 20	205				L -> P (in Ref. 6; CAH10583). {ECO:0000305}.	protein homooligomerization (GO:0051260)					central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|skin(1)	15						GTGATTATCTCTGCATTAATT	0.383																																						dbGAP											0													109.0	100.0	103.0					6																	36447445		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC023525	CCDS4821.1, CCDS69096.1, CCDS69097.1	6p21.31	2013-06-20	2013-06-20	2006-06-26	ENSG00000112078	ENSG00000112078			21052	protein-coding gene	gene with protein product		615932	"""chromosome 6 open reading frame 69"", ""potassium channel tetramerisation domain containing 20"""	C6orf69			Standard	NM_001286580		Approved	dJ108K11.3, MGC14254	uc003ome.3	Q7Z5Y7	OTTHUMG00000014597	ENST00000373731.2:c.615C>G	6.37:g.36447445C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZD3|B4E2Q3|F5H3T3|Q5W105|Q69YQ7|Q8IZ55	Missense_Mutation	SNP	NULL	p.S114C	ENST00000373731.2	37	c.341	CCDS4821.1	6																																																																																			KCTD20	-	NULL	ENSG00000112078		0.383	KCTD20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD20	HGNC	protein_coding	OTTHUMT00000040345.2	213	0.00	0	C	NM_173562		36447445	36447445	+1	no_errors	ENST00000265344	ensembl	human	known	69_37n	missense	275	15.08	49	SNP	1.000	G
KIAA0430	9665	genome.wustl.edu	37	16	15728701	15728701	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:15728701G>A	ENST00000396368.3	-	4	1125	c.919C>T	c.(919-921)Ctg>Ttg	p.L307L	KIAA0430_ENST00000540441.2_Silent_p.L307L|KIAA0430_ENST00000551742.1_Silent_p.L307L|KIAA0430_ENST00000548025.1_Silent_p.L307L|KIAA0430_ENST00000602337.1_Silent_p.L307L|KIAA0430_ENST00000344181.3_Silent_p.L129L	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	307					double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CCATTACACAGAGGGACAGCA	0.443																																						dbGAP											0													242.0	226.0	231.0					16																	15728701		1967	4143	6110	-	-	-	SO:0001819	synonymous_variant	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.919C>T	16.37:g.15728701G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Silent	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.L307	ENST00000396368.3	37	c.919	CCDS10562.2	16																																																																																			KIAA0430	-	NULL	ENSG00000166783		0.443	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	722	0.00	0	G	NM_014647		15728701	15728701	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	silent	581	21.06	155	SNP	0.997	A
KIAA1109	84162	genome.wustl.edu	37	4	123201085	123201085	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:123201085C>T	ENST00000264501.4	+	51	9120	c.8747C>T	c.(8746-8748)tCt>tTt	p.S2916F	KIAA1109_ENST00000455637.1_Missense_Mutation_p.S2916F|KIAA1109_ENST00000388738.3_Missense_Mutation_p.S2916F			Q2LD37	K1109_HUMAN	KIAA1109	2916					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GTTCGAAGTTCTCACCAACTA	0.413																																						dbGAP											0													164.0	162.0	162.0					4																	123201085		2005	4191	6196	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.8747C>T	4.37:g.123201085C>T	ENSP00000264501:p.Ser2916Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.S2916F	ENST00000264501.4	37	c.8747	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	C	26.9	4.777841	0.90195	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000455637	T;T;T	0.34667	1.92;1.92;1.35	5.25	5.25	0.73442	.	0.000000	0.64402	D	0.000001	T	0.58736	0.2143	L	0.57536	1.79	0.58432	D	0.999999	D;D	0.69078	0.997;0.995	D;D	0.78314	0.991;0.986	T	0.61491	-0.7052	10	0.87932	D	0	.	18.849	0.92220	0.0:1.0:0.0:0.0	.	2916;2916	Q2LD37-6;Q2LD37	.;K1109_HUMAN	F	2916	ENSP00000264501:S2916F;ENSP00000373390:S2916F;ENSP00000389925:S2916F	ENSP00000264501:S2916F	S	+	2	0	KIAA1109	123420535	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.678000	0.84035	2.455000	0.83008	0.650000	0.86243	TCT	KIAA1109	-	NULL	ENSG00000138688		0.413	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	195	0.00	0	C	NM_020797		123201085	123201085	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	missense	152	18.28	34	SNP	1.000	T
KIAA0922	23240	genome.wustl.edu	37	4	154544085	154544085	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:154544085G>C	ENST00000409663.3	+	29	3944	c.3892G>C	c.(3892-3894)Gac>Cac	p.D1298H	KIAA0922_ENST00000440693.1_Missense_Mutation_p.D1215H|KIAA0922_ENST00000409959.3_Missense_Mutation_p.D1299H	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	1298						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				GAAATGTGTGGACAAGTTCTG	0.547																																						dbGAP											0													113.0	116.0	115.0					4																	154544085		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.3892G>C	4.37:g.154544085G>C	ENSP00000386574:p.Asp1298His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.D1299H	ENST00000409663.3	37	c.3895	CCDS3783.2	4	.	.	.	.	.	.	.	.	.	.	G	16.31	3.087460	0.55968	.	.	ENSG00000121210	ENST00000409663;ENST00000440693;ENST00000409959;ENST00000240487	T;T;T;T	0.20200	2.37;2.09;2.37;2.09	5.69	5.69	0.88448	.	0.437004	0.24063	N	0.041884	T	0.34308	0.0893	L	0.38175	1.15	0.48762	D	0.999707	P;D;D	0.61697	0.853;0.99;0.983	P;P;P	0.56960	0.694;0.81;0.65	T	0.01262	-1.1402	10	0.49607	T	0.09	-15.1102	19.821	0.96592	0.0:0.0:1.0:0.0	.	1215;1299;1298	A2VDJ0-3;A2VDJ0-5;A2VDJ0	.;.;T131L_HUMAN	H	1298;1215;1299;1076	ENSP00000386574:D1298H;ENSP00000409663:D1215H;ENSP00000386787:D1299H;ENSP00000240487:D1076H	ENSP00000240487:D1076H	D	+	1	0	KIAA0922	154763535	1.000000	0.71417	0.959000	0.39883	0.156000	0.22039	5.393000	0.66279	2.683000	0.91414	0.655000	0.94253	GAC	KIAA0922	-	NULL	ENSG00000121210		0.547	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	121	0.00	0	G	NM_015196		154544085	154544085	+1	no_errors	ENST00000409959	ensembl	human	known	69_37n	missense	97	22.40	28	SNP	0.996	C
KIF3B	9371	genome.wustl.edu	37	20	30898414	30898414	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:30898414C>T	ENST00000375712.3	+	2	1001	c.834C>T	c.(832-834)gtC>gtT	p.V278V	KIF3B_ENST00000418717.2_5'UTR	NM_004798.3	NP_004789.1	O15066	KIF3B_HUMAN	kinesin family member 3B	278	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cytoskeleton-dependent intracellular transport (GO:0030705)|determination of left/right symmetry (GO:0007368)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic centrosome separation (GO:0007100)|mitotic spindle organization (GO:0007052)|plus-end-directed vesicle transport along microtubule (GO:0072383)|spindle assembly involved in mitosis (GO:0090307)	centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intraciliary transport particle (GO:0030990)|kinesin II complex (GO:0016939)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|plus-end kinesin complex (GO:0005873)|spindle (GO:0005819)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)|Rho GTPase binding (GO:0017048)			NS(2)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(4)|large_intestine(5)|lung(9)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)			TGGGTAATGTCATCTCTGCTC	0.517																																						dbGAP											0													94.0	87.0	90.0					20																	30898414		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002357	CCDS13200.1	20q11.21	2012-08-01			ENSG00000101350	ENSG00000101350		"""Kinesins"""	6320	protein-coding gene	gene with protein product		603754				9205841	Standard	NM_004798		Approved	KIAA0359, FLA8, KLP-11	uc002wxq.3	O15066	OTTHUMG00000032214	ENST00000375712.3:c.834C>T	20.37:g.30898414C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP4|B4DSR5|E1P5M5	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V278	ENST00000375712.3	37	c.834	CCDS13200.1	20																																																																																			KIF3B	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom	ENSG00000101350		0.517	KIF3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF3B	HGNC	protein_coding	OTTHUMT00000078619.1	170	0.00	0	C	NM_004798		30898414	30898414	+1	no_errors	ENST00000375712	ensembl	human	known	69_37n	silent	145	18.99	34	SNP	1.000	T
KIR3DL1	3811	genome.wustl.edu	37	19	55325488	55325488	+	Intron	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:55325488G>C	ENST00000538269.1	+	2	61				KIR2DL4_ENST00000359085.4_3'UTR|KIR2DL4_ENST00000345540.5_Missense_Mutation_p.L317F|KIR2DL4_ENST00000396293.1_Missense_Mutation_p.L205F|KIR2DL4_ENST00000357494.4_Missense_Mutation_p.L300F|KIR3DL1_ENST00000541392.1_Intron|KIR2DL4_ENST00000463062.1_3'UTR|KIR3DL1_ENST00000358178.4_5'Flank|KIR2DL4_ENST00000346587.4_Missense_Mutation_p.L222F|KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Missense_Mutation_p.L372F|KIR3DL1_ENST00000391728.4_5'Flank|KIR3DL1_ENST00000326542.7_5'Flank			P43629	KI3L1_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 1						immune response (GO:0006955)|regulation of immune response (GO:0050776)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	HLA-B specific inhibitory MHC class I receptor activity (GO:0030109)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	11				GBM - Glioblastoma multiforme(193;0.0192)		GTCAGGCCTTGATGGGATCTT	0.527																																						dbGAP											0													3.0	4.0	3.0					19																	55325488		795	2481	3276	-	-	-	SO:0001627	intron_variant	0			L41269	CCDS42621.1	19q13.4	2014-05-22			ENSG00000167633	ENSG00000167633		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6338	protein-coding gene	gene with protein product		604946		KIR		7716543, 7749980	Standard	NM_013289		Approved	cl-2, NKB1, cl-11, nkat3, NKB1B, AMB11, CD158e1/2, CD158E1, CD158e2		P43629	OTTHUMG00000065933	ENST00000538269.1:c.35-3501G>C	19.37:g.55325488G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O43473|Q14946|Q16541	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub	p.L372F	ENST00000538269.1	37	c.1116		19	.	.	.	.	.	.	.	.	.	.	G	6.057	0.378929	0.11466	.	.	ENSG00000189013	ENST00000396284;ENST00000345540;ENST00000357494;ENST00000396293;ENST00000346587;ENST00000396289	T;T;T;T;T;T	0.00609	6.54;6.35;6.32;6.24;6.36;6.55	0.569	0.569	0.17340	.	.	.	.	.	T	0.00666	0.0022	.	.	.	0.09310	N	1	B;P;P;B;B;P	0.49635	0.295;0.536;0.587;0.437;0.178;0.926	B;B;B;B;B;P	0.44597	0.11;0.154;0.369;0.154;0.165;0.454	T	0.55636	-0.8110	7	0.66056	D	0.02	.	.	.	.	.	352;372;300;222;317;205	Q99706;E7EST5;Q99706-4;Q8N736;Q99706-3;Q8N738	KI2L4_HUMAN;.;.;.;.;.	F	372;317;300;205;222;372	ENSP00000379580:L372F;ENSP00000339634:L317F;ENSP00000350088:L300F;ENSP00000379588:L205F;ENSP00000345331:L222F;ENSP00000379584:L372F	ENSP00000339634:L317F	L	+	3	2	KIR2DL4	60017300	0.001000	0.12720	0.017000	0.16124	0.024000	0.10985	0.228000	0.17814	0.567000	0.29293	0.184000	0.17185	TTG	KIR2DL4	-	NULL	ENSG00000189013		0.527	KIR3DL1-202	KNOWN	basic|appris_candidate	protein_coding	KIR2DL4	HGNC	protein_coding		17	0.00	0	G	NM_013289		55325488	55325488	+1	no_errors	ENST00000396284	ensembl	human	known	69_37n	missense	1	90.00	9	SNP	0.019	C
KLHL30	377007	genome.wustl.edu	37	2	239057647	239057647	+	Splice_Site	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:239057647G>A	ENST00000409223.1	+	7	1446		c.e7-1		KLHL30_ENST00000305959.4_Splice_Site			Q0D2K2	KLH30_HUMAN	kelch-like family member 30											lung(4)	4		Breast(86;7.61e-05)|Renal(207;0.00183)|Ovarian(221;0.0481)|all_hematologic(139;0.158)|all_lung(227;0.198)|Melanoma(123;0.203)|Hepatocellular(293;0.244)		Epithelial(121;4.71e-24)|OV - Ovarian serous cystadenocarcinoma(60;3.02e-12)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;5.63e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000109)|Lung(119;0.0108)|LUSC - Lung squamous cell carcinoma(224;0.0253)		GCCCCCCACAGATGCGTGGAG	0.647																																						dbGAP											0													53.0	66.0	61.0					2																	239057647		2129	4230	6359	-	-	-	SO:0001630	splice_region_variant	0				CCDS46555.1, CCDS46555.2	2q37.3	2013-02-22	2013-02-22		ENSG00000168427	ENSG00000168427		"""Kelch-like"", ""BTB/POZ domain containing"""	24770	protein-coding gene	gene with protein product			"""kelch-like 30 (Drosophila)"""				Standard	NM_198582		Approved	FLJ43374	uc002vxr.2	Q0D2K2	OTTHUMG00000152905	ENST00000409223.1:c.1340-1G>A	2.37:g.239057647G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZUS1	Splice_Site	SNP	-	e6-1	ENST00000409223.1	37	c.1340-1	CCDS46555.2	2	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253536	0.39797	.	.	ENSG00000168427	ENST00000409223;ENST00000305959	.	.	.	4.58	4.58	0.56647	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.2961	0.82769	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KLHL30	238722386	1.000000	0.71417	0.847000	0.33407	0.311000	0.27955	8.866000	0.92307	2.374000	0.81015	0.561000	0.74099	.	KLHL30	-	-	ENSG00000168427		0.647	KLHL30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL30	HGNC	protein_coding	OTTHUMT00000328518.1	54	0.00	0	G	NM_198582	Intron	239057647	239057647	+1	no_errors	ENST00000409223	ensembl	human	known	69_37n	splice_site	58	12.12	8	SNP	1.000	A
KPNA3	3839	genome.wustl.edu	37	13	50276031	50276031	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:50276031C>T	ENST00000261667.3	-	17	1885	c.1471G>A	c.(1471-1473)Gat>Aat	p.D491N		NM_002267.3	NP_002258.2	O00505	IMA4_HUMAN	karyopherin alpha 3 (importin alpha 4)	491					cytokine-mediated signaling pathway (GO:0019221)|NLS-bearing protein import into nucleus (GO:0006607)|protein complex assembly (GO:0006461)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleoplasm (GO:0005654)	nuclear localization sequence binding (GO:0008139)|protein transporter activity (GO:0008565)			cervix(1)|endometrium(3)|large_intestine(4)|liver(1)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(4)	21		Lung NSC(96;2.46e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.42e-09)		GGATCTTCATCAATCTGTAAA	0.308																																						dbGAP											0													111.0	120.0	117.0					13																	50276031		2203	4300	6503	-	-	-	SO:0001583	missense	0			D89618	CCDS9421.1	13q14.3	2013-02-14			ENSG00000102753	ENSG00000102753		"""Importins"", ""Armadillo repeat containing"""	6396	protein-coding gene	gene with protein product		601892				9154134, 9435235	Standard	NM_002267		Approved	SRP1gamma, SRP4, hSRP1, IPOA4	uc001vdj.2	O00505	OTTHUMG00000016922	ENST00000261667.3:c.1471G>A	13.37:g.50276031C>T	ENSP00000261667:p.Asp491Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O00191|O43195|Q5JVM9|Q96AA7	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,pfam_HEAT,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.D491N	ENST00000261667.3	37	c.1471	CCDS9421.1	13	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490899	0.84962	.	.	ENSG00000102753	ENST00000261667	T	0.64803	-0.12	6.17	6.17	0.99709	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64843	0.2635	M	0.64676	1.99	0.80722	D	1	B	0.10296	0.003	B	0.15484	0.013	T	0.58059	-0.7703	10	0.51188	T	0.08	-17.9725	20.8794	0.99867	0.0:1.0:0.0:0.0	.	491	O00505	IMA3_HUMAN	N	491	ENSP00000261667:D491N	ENSP00000261667:D491N	D	-	1	0	KPNA3	49174032	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.744000	0.85034	2.941000	0.99782	0.655000	0.94253	GAT	KPNA3	-	superfamily_ARM-type_fold	ENSG00000102753		0.308	KPNA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPNA3	HGNC	protein_coding	OTTHUMT00000044939.2	198	0.00	0	C	NM_002267		50276031	50276031	-1	no_errors	ENST00000261667	ensembl	human	known	69_37n	missense	156	21.89	44	SNP	1.000	T
KTN1	3895	genome.wustl.edu	37	14	56138368	56138368	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:56138368G>C	ENST00000395314.3	+	36	3501	c.3433G>C	c.(3433-3435)Gaa>Caa	p.E1145Q	KTN1_ENST00000555573.1_Missense_Mutation_p.E150Q|KTN1_ENST00000416613.1_Missense_Mutation_p.E1145Q|KTN1_ENST00000395308.1_Missense_Mutation_p.E1122Q|KTN1_ENST00000395309.3_Missense_Mutation_p.E1145Q|KTN1_ENST00000438792.2_Missense_Mutation_p.E1116Q|KTN1_ENST00000413890.2_Missense_Mutation_p.E1122Q|KTN1_ENST00000554507.1_Missense_Mutation_p.E411Q|KTN1_ENST00000395311.1_Missense_Mutation_p.E1122Q	NM_001079521.1	NP_001072989.1	Q86UP2	KTN1_HUMAN	kinectin 1 (kinesin receptor)	1145					microtubule-based movement (GO:0007018)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(4)|central_nervous_system(1)|large_intestine(8)|lung(1)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	19						CGTCCTTGCAGAAACAGTAGG	0.333			T	RET	papillary thryoid																																	dbGAP		Dom	yes		14	14q22.1	3895	kinectin 1 (kinesin receptor)		E	0													83.0	83.0	83.0					14																	56138368		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS41957.1, CCDS41958.1, CCDS41959.1	14q22.1	2008-05-02			ENSG00000126777	ENSG00000126777			6467	protein-coding gene	gene with protein product		600381				9605849	Standard	NM_001079521		Approved	KIAA0004, CG1	uc001xcc.3	Q86UP2	OTTHUMG00000140312	ENST00000395314.3:c.3433G>C	14.37:g.56138368G>C	ENSP00000378725:p.Glu1145Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ88|Q13999|Q14707|Q15387|Q17RZ5|Q5GGW3|Q86W57	Missense_Mutation	SNP	NULL	p.E1145Q	ENST00000395314.3	37	c.3433	CCDS41957.1	14	.	.	.	.	.	.	.	.	.	.	G	26.9	4.783089	0.90282	.	.	ENSG00000126777	ENST00000413890;ENST00000395309;ENST00000438792;ENST00000395314;ENST00000395308;ENST00000395311;ENST00000416613;ENST00000554507;ENST00000553624;ENST00000555573	T;T;T;T;T;T;T;T;T;T	0.79454	1.23;1.23;1.23;1.23;1.23;1.23;1.23;-1.27;1.23;-1.27	5.52	5.52	0.82312	.	0.000000	0.53938	D	0.000042	D	0.87200	0.6118	M	0.66939	2.045	0.58432	D	0.999998	D;D;D;D;D;D	0.89917	0.999;0.999;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.91635	0.999;0.999;0.999;0.997;0.999;0.999	D	0.84284	0.0496	10	0.31617	T	0.26	-19.373	19.7999	0.96502	0.0:0.0:1.0:0.0	.	150;1145;411;1116;1122;1145	B7Z6P3;B4DZ88;G3V4Y7;Q86UP2-2;Q17RZ5;Q86UP2	.;.;.;.;.;KTN1_HUMAN	Q	1122;1145;1116;1145;1122;1122;1145;411;106;150	ENSP00000394992:E1122Q;ENSP00000378720:E1145Q;ENSP00000391964:E1116Q;ENSP00000378725:E1145Q;ENSP00000378719:E1122Q;ENSP00000378722:E1122Q;ENSP00000388807:E1145Q;ENSP00000452073:E411Q;ENSP00000452445:E106Q;ENSP00000451698:E150Q	ENSP00000378719:E1122Q	E	+	1	0	KTN1	55208121	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	8.984000	0.93482	2.751000	0.94390	0.650000	0.86243	GAA	KTN1	-	NULL	ENSG00000126777		0.333	KTN1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KTN1	HGNC	protein_coding	OTTHUMT00000276912.2	288	0.00	0	G			56138368	56138368	+1	no_errors	ENST00000395309	ensembl	human	known	69_37n	missense	297	15.86	56	SNP	1.000	C
LAMB3	3914	genome.wustl.edu	37	1	209790817	209790817	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:209790817C>T	ENST00000356082.4	-	21	3300	c.3166G>A	c.(3166-3168)Gag>Aag	p.E1056K	LAMB3_ENST00000367030.3_Missense_Mutation_p.E1056K|LAMB3_ENST00000391911.1_Missense_Mutation_p.E1056K	NM_000228.2	NP_000219.2	Q13751	LAMB3_HUMAN	laminin, beta 3	1056	Domain I.				brown fat cell differentiation (GO:0050873)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	extracellular region (GO:0005576)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45				OV - Ovarian serous cystadenocarcinoma(81;0.0519)		TGGACTGCCTCTGCCCCCTGC	0.622																																						dbGAP											0													82.0	81.0	82.0					1																	209790817		2203	4300	6503	-	-	-	SO:0001583	missense	0			D37766	CCDS1487.1	1q32	2013-03-01	2002-08-29		ENSG00000196878	ENSG00000196878		"""Laminins"""	6490	protein-coding gene	gene with protein product		150310	"""laminin, beta 3 (nicein (125kD), kalinin (140kD), BM600 (125kD))"""	LAMNB1		8088808, 7774918	Standard	NM_001127641		Approved	nicein-125kDa, kalinin-140kDa, BM600-125kDa	uc001hhh.3	Q13751	OTTHUMG00000036360	ENST00000356082.4:c.3166G>A	1.37:g.209790817C>T	ENSP00000348384:p.Glu1056Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT88|O14947|Q14733|Q9UJK4|Q9UJL1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,pfscan_EGF_laminin,pfscan_Laminin_N	p.E1056K	ENST00000356082.4	37	c.3166	CCDS1487.1	1	.	.	.	.	.	.	.	.	.	.	C	10.66	1.412480	0.25465	.	.	ENSG00000196878	ENST00000391911;ENST00000356082;ENST00000367030;ENST00000455193	T;T;T;T	0.63744	1.99;1.99;1.99;-0.06	5.77	3.84	0.44239	.	0.335009	0.31061	N	0.008323	T	0.36717	0.0977	N	0.08118	0	0.21105	N	0.99978	B	0.14012	0.009	B	0.06405	0.002	T	0.10222	-1.0639	10	0.06625	T	0.88	.	13.158	0.59529	0.0:0.3071:0.6929:0.0	.	1056	Q13751	LAMB3_HUMAN	K	1056;1056;1056;125	ENSP00000375778:E1056K;ENSP00000348384:E1056K;ENSP00000355997:E1056K;ENSP00000398683:E125K	ENSP00000348384:E1056K	E	-	1	0	LAMB3	207857440	0.992000	0.36948	0.924000	0.36721	0.779000	0.44077	2.240000	0.43088	1.463000	0.47967	-0.401000	0.06369	GAG	LAMB3	-	NULL	ENSG00000196878		0.622	LAMB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB3	HGNC	protein_coding	OTTHUMT00000088525.2	106	0.00	0	C	NM_000228		209790817	209790817	-1	no_errors	ENST00000356082	ensembl	human	known	69_37n	missense	120	13.67	19	SNP	0.946	T
LASP1	3927	genome.wustl.edu	37	17	37054741	37054741	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:37054741G>A	ENST00000318008.6	+	4	657	c.326G>A	c.(325-327)aGa>aAa	p.R109K	LASP1_ENST00000435347.3_Missense_Mutation_p.R109K|LASP1_ENST00000433206.2_Missense_Mutation_p.R53K	NM_006148.2	NP_006139.1	Q14847	LASP1_HUMAN	LIM and SH3 protein 1	109					ion transport (GO:0006811)|positive regulation of signal transduction (GO:0009967)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)	ion transmembrane transporter activity (GO:0015075)|SH3/SH2 adaptor activity (GO:0005070)|zinc ion binding (GO:0008270)			breast(1)|large_intestine(2)|lung(4)|urinary_tract(2)	9						GAGCTCCAGAGAATCAAGAAG	0.587			T	MLL	AML																																	dbGAP		Dom	yes		17	17q11-q21.3	3927	LIM and SH3 protein 1		L	0													83.0	66.0	72.0					17																	37054741		1926	3690	5616	-	-	-	SO:0001583	missense	0				CCDS11331.1, CCDS62164.1	17q11-q21.3	2008-07-18			ENSG00000002834	ENSG00000002834			6513	protein-coding gene	gene with protein product		602920				7490069	Standard	NM_006148		Approved	MLN50, Lasp-1	uc010cvq.3	Q14847	OTTHUMG00000133182	ENST00000318008.6:c.326G>A	17.37:g.37054741G>A	ENSP00000325240:p.Arg109Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGQ0|Q96ED2|Q96IG0	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Znf_LIM,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.R109K	ENST00000318008.6	37	c.326	CCDS11331.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.5|26.5	4.743188|4.743188	0.89663|0.89663	.|.	.|.	ENSG00000002834|ENSG00000002834	ENST00000443937|ENST00000318008;ENST00000433206;ENST00000435347;ENST00000419929	.|T;T;T;T	.|0.53423	.|0.62;0.62;0.62;0.62	5.37|5.37	4.39|4.39	0.52855|0.52855	.|.	.|0.047832	.|0.85682	.|D	.|0.000000	.|T	.|0.69169	.|0.3081	M|M	0.84082|0.84082	2.675|2.675	0.53005|0.53005	D|D	0.999965|0.999965	.|D;D;D	.|0.76494	.|0.981;0.994;0.999	.|D;D;D	.|0.72338	.|0.941;0.977;0.964	.|T	.|0.73011	.|-0.4117	.|10	.|0.48119	.|T	.|0.1	.|.	13.847|13.847	0.63474|0.63474	0.0:0.1542:0.8458:0.0|0.0:0.1542:0.8458:0.0	.|.	.|53;109;109	.|B4DGQ0;B4DJI4;Q14847	.|.;.;LASP1_HUMAN	.|K	-1|109;53;109;73	.|ENSP00000325240:R109K;ENSP00000401048:R53K;ENSP00000392853:R109K;ENSP00000391897:R73K	.|ENSP00000325240:R109K	.|R	+|+	.|2	.|0	LASP1|LASP1	34308267|34308267	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.496000|0.496000	0.33645|0.33645	9.301000|9.301000	0.96167|0.96167	1.482000|1.482000	0.48325|0.48325	-0.175000|-0.175000	0.13238|0.13238	.|AGA	LASP1	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000002834		0.587	LASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LASP1	HGNC	protein_coding	OTTHUMT00000256890.3	156	0.00	0	G	NM_006148		37054741	37054741	+1	no_errors	ENST00000318008	ensembl	human	known	69_37n	missense	139	18.13	31	SNP	1.000	A
LCMT2	9836	genome.wustl.edu	37	15	43621556	43621556	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:43621556C>G	ENST00000305641.5	-	1	1247	c.1132G>C	c.(1132-1134)Gag>Cag	p.E378Q	ADAL_ENST00000389651.4_5'Flank|LCMT2_ENST00000567039.1_3'UTR|LCMT2_ENST00000544735.1_5'UTR|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000428046.3_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	378					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CCCTCCTGCTCTCCAAATCCT	0.547																																						dbGAP											0													59.0	59.0	59.0					15																	43621556		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.1132G>C	15.37:g.43621556C>G	ENSP00000307214:p.Glu378Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	pfam_LCM_MeTrfase	p.E378Q	ENST00000305641.5	37	c.1132	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	C	15.12	2.738789	0.49045	.	.	ENSG00000168806	ENST00000305641	T	0.73789	-0.78	5.54	5.54	0.83059	.	0.226239	0.36482	N	0.002579	T	0.73528	0.3598	M	0.67953	2.075	0.80722	D	1	B	0.29301	0.241	B	0.35813	0.211	T	0.66850	-0.5819	10	0.15499	T	0.54	-18.1214	14.8538	0.70319	0.0:1.0:0.0:0.0	.	378	O60294	LCMT2_HUMAN	Q	378	ENSP00000307214:E378Q	ENSP00000307214:E378Q	E	-	1	0	LCMT2	41408848	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	4.484000	0.60271	2.885000	0.99019	0.655000	0.94253	GAG	LCMT2	-	NULL	ENSG00000168806		0.547	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	115	0.00	0	C	NM_014793		43621556	43621556	-1	no_errors	ENST00000305641	ensembl	human	known	69_37n	missense	99	22.66	29	SNP	1.000	G
LCMT2	9836	genome.wustl.edu	37	15	43621844	43621844	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:43621844C>T	ENST00000305641.5	-	1	959	c.844G>A	c.(844-846)Gaa>Aaa	p.E282K	ADAL_ENST00000389651.4_5'Flank|LCMT2_ENST00000567039.1_Splice_Site|LCMT2_ENST00000544735.1_Splice_Site|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000428046.3_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	282					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CGGCGTTCTTCTGCGGGAAGA	0.552																																						dbGAP											0													39.0	45.0	43.0					15																	43621844		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.844G>A	15.37:g.43621844C>T	ENSP00000307214:p.Glu282Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JFT6|Q96B55|Q9NR10	Splice_Site	SNP	-	e1-1	ENST00000305641.5	37	c.1-1	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311730	0.40895	.	.	ENSG00000168806	ENST00000305641	T	0.23950	1.88	5.39	2.31	0.28768	.	0.268276	0.35436	N	0.003202	T	0.22360	0.0539	L	0.56124	1.755	0.80722	D	1	B	0.25772	0.134	B	0.17433	0.018	T	0.06427	-1.0827	10	0.17832	T	0.49	-21.2837	13.6521	0.62316	0.0:0.5548:0.4452:0.0	.	282	O60294	LCMT2_HUMAN	K	282	ENSP00000307214:E282K	ENSP00000307214:E282K	E	-	1	0	LCMT2	41409136	0.327000	0.24678	0.869000	0.34112	0.940000	0.58332	1.254000	0.32897	0.814000	0.34374	0.655000	0.94253	GAA	LCMT2	-	-	ENSG00000168806		0.552	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	32	0.00	0	C	NM_014793		43621844	43621844	-1	no_errors	ENST00000544735	ensembl	human	known	69_37n	splice_site	35	22.22	10	SNP	0.687	T
LCMT2	9836	genome.wustl.edu	37	15	43622180	43622180	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:43622180C>T	ENST00000305641.5	-	1	623	c.508G>A	c.(508-510)Gag>Aag	p.E170K	ADAL_ENST00000389651.4_5'Flank|LCMT2_ENST00000567039.1_Intron|LCMT2_ENST00000544735.1_Intron|ADAL_ENST00000422466.2_5'Flank|ADAL_ENST00000428046.3_5'Flank	NM_014793.4	NP_055608.2	O60294	TYW4_HUMAN	leucine carboxyl methyltransferase 2	170					tRNA processing (GO:0008033)		methyltransferase activity (GO:0008168)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(2)|liver(1)|lung(9)|skin(1)|urinary_tract(1)	20		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.1e-07)	L-Leucine(DB00149)	CCCAGGGCCTCCTCCACTCGC	0.706																																						dbGAP											0													22.0	28.0	26.0					15																	43622180		2195	4292	6487	-	-	-	SO:0001583	missense	0			AF265443	CCDS10094.1	15q15.3	2007-01-26			ENSG00000168806	ENSG00000168806			17558	protein-coding gene	gene with protein product	"""tRNA-yW synthesizing protein 4"""	611246				9628581, 17150819	Standard	NM_014793		Approved	KIAA0547, MGC9534, TYW4, PPM2	uc001zrg.3	O60294	OTTHUMG00000130705	ENST00000305641.5:c.508G>A	15.37:g.43622180C>T	ENSP00000307214:p.Glu170Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JFT6|Q96B55|Q9NR10	Missense_Mutation	SNP	pfam_LCM_MeTrfase	p.E170K	ENST00000305641.5	37	c.508	CCDS10094.1	15	.	.	.	.	.	.	.	.	.	.	C	0.957	-0.704545	0.03255	.	.	ENSG00000168806	ENST00000305641	T	0.23552	1.9	5.54	2.52	0.30459	.	0.681528	0.14130	N	0.339426	T	0.16471	0.0396	L	0.27975	0.815	0.22701	N	0.99884	B	0.17268	0.021	B	0.13407	0.009	T	0.20739	-1.0266	10	0.06891	T	0.86	-21.3657	13.9848	0.64326	0.0:0.3922:0.6078:0.0	.	170	O60294	LCMT2_HUMAN	K	170	ENSP00000307214:E170K	ENSP00000307214:E170K	E	-	1	0	LCMT2	41409472	0.009000	0.17119	0.067000	0.19924	0.220000	0.24768	0.228000	0.17814	0.893000	0.36288	-0.176000	0.13171	GAG	LCMT2	-	pfam_LCM_MeTrfase	ENSG00000168806		0.706	LCMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT2	HGNC	protein_coding	OTTHUMT00000253205.1	16	0.00	0	C	NM_014793		43622180	43622180	-1	no_errors	ENST00000305641	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	0.091	T
LIG1	3978	genome.wustl.edu	37	19	48643316	48643316	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:48643316G>A	ENST00000263274.7	-	12	1418	c.999C>T	c.(997-999)ctC>ctT	p.L333L	LIG1_ENST00000536218.1_Silent_p.L265L|LIG1_ENST00000427526.2_Silent_p.L302L	NM_000234.1	NP_000225.1	P18858	DNLI1_HUMAN	ligase I, DNA, ATP-dependent	333					anatomical structure morphogenesis (GO:0009653)|base-excision repair (GO:0006284)|cell division (GO:0051301)|DNA biosynthetic process (GO:0071897)|DNA ligation involved in DNA repair (GO:0051103)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|double-strand break repair via nonhomologous end joining (GO:0006303)|lagging strand elongation (GO:0006273)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|response to hydrogen peroxide (GO:0042542)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA ligase (ATP) activity (GO:0003910)|DNA ligase activity (GO:0003909)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(22)|prostate(2)|skin(1)	44		all_epithelial(76;3.1e-06)|all_lung(116;4.39e-06)|Lung NSC(112;8.96e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)|Breast(70;0.203)		OV - Ovarian serous cystadenocarcinoma(262;8.45e-05)|all cancers(93;0.000423)|Epithelial(262;0.0177)|GBM - Glioblastoma multiforme(486;0.0329)	Bleomycin(DB00290)	GGTTGAGGCTGAGGTAGAGGA	0.662								Nucleotide excision repair (NER)																														dbGAP											0													75.0	63.0	68.0					19																	48643316		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12711.1, CCDS74409.1, CCDS74410.1	19q13.2-q13.3	2014-09-17				ENSG00000105486	6.5.1.1		6598	protein-coding gene	gene with protein product		126391					Standard	XM_005258934		Approved		uc002pia.1	P18858		ENST00000263274.7:c.999C>T	19.37:g.48643316G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAI8|Q2TB12|Q32P23	Silent	SNP	pfam_DNA_ligase_ATP-dep_cent,pfam_DNA_ligase_ATP-dep_N,pfam_DNA_ligase_ATP-dep_C,superfamily_DNA_ligase_ATP-dep_N,superfamily_NA-bd_OB-fold-like,pfscan_DNA_ligase_ATP-dep_cent,tigrfam_DNA_ligase_ATP-dep	p.L333	ENST00000263274.7	37	c.999	CCDS12711.1	19																																																																																			LIG1	-	pfam_DNA_ligase_ATP-dep_N,superfamily_DNA_ligase_ATP-dep_N	ENSG00000105486		0.662	LIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIG1	HGNC	protein_coding	OTTHUMT00000465575.1	78	0.00	0	G	NM_000234		48643316	48643316	-1	no_errors	ENST00000263274	ensembl	human	known	69_37n	silent	58	24.68	19	SNP	1.000	A
LOXHD1	125336	genome.wustl.edu	37	18	44173590	44173590	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:44173590G>A	ENST00000398722.4	-	3	569	c.570C>T	c.(568-570)ttC>ttT	p.F190F	LOXHD1_ENST00000441551.2_Silent_p.F468F|LOXHD1_ENST00000536736.1_Silent_p.F468F			Q8IVV2	LOXH1_HUMAN	lipoxygenase homology domains 1	190	PLAT 2. {ECO:0000255|PROSITE- ProRule:PRU00152}.				calcium ion transmembrane transport (GO:0070588)|detection of mechanical stimulus (GO:0050982)|sensory perception of sound (GO:0007605)	membrane (GO:0016020)|stereocilium (GO:0032420)	calcium channel activity (GO:0005262)			NS(3)|autonomic_ganglia(1)|breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|pancreas(1)|prostate(4)|skin(4)|stomach(1)	36						TGCCGGGTTTGAACCACTTGT	0.498																																						dbGAP											0													190.0	162.0	170.0					18																	44173590		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK057232	CCDS45861.1, CCDS45862.1, CCDS54184.1	18q21.1	2009-09-11			ENSG00000167210	ENSG00000167210			26521	protein-coding gene	gene with protein product		613072	"""deafness, autosomal recessive 77"""	DFNB77		19732867	Standard	NM_144612		Approved	FLJ32670, LH2D1	uc010xcw.1	Q8IVV2	OTTHUMG00000132644	ENST00000398722.4:c.570C>T	18.37:g.44173590G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNN3|B7WNT1|B7WPI9|Q6ZRY7|Q86WW9|Q96DL7	Silent	SNP	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	p.F468	ENST00000398722.4	37	c.1404		18	.	.	.	.	.	.	.	.	.	.	G	8.645	0.896993	0.17686	.	.	ENSG00000167210	ENST00000441551	.	.	.	5.95	2.77	0.32553	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.6121	0.04894	0.1951:0.0:0.31:0.4949	.	.	.	.	X	449	.	.	Q	-	1	0	LOXHD1	42427588	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	2.997000	0.49457	0.819000	0.34492	0.563000	0.77884	CAA	LOXHD1	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000167210		0.498	LOXHD1-201	KNOWN	basic	protein_coding	LOXHD1	HGNC	protein_coding		480	0.00	0	G	NM_144612		44173590	44173590	-1	no_errors	ENST00000536736	ensembl	human	known	69_37n	silent	475	10.88	58	SNP	1.000	A
LOXL2	4017	genome.wustl.edu	37	8	23177557	23177557	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:23177557C>T	ENST00000389131.3	-	8	1680	c.1311G>A	c.(1309-1311)ctG>ctA	p.L437L		NM_002318.2	NP_002309.1	Q9Y4K0	LOXL2_HUMAN	lysyl oxidase-like 2	437	SRCR 4. {ECO:0000255|PROSITE- ProRule:PRU00196}.				aging (GO:0007568)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|collagen fibril organization (GO:0030199)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial to mesenchymal transition (GO:0001837)|histone modification (GO:0016570)|negative regulation of transcription, DNA-templated (GO:0045892)|oxidation-reduction process (GO:0055114)|positive regulation of chondrocyte differentiation (GO:0032332)|protein deamination (GO:0018277)|response to copper ion (GO:0046688)|response to hypoxia (GO:0001666)|sprouting angiogenesis (GO:0002040)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|chromosome (GO:0005694)|extracellular space (GO:0005615)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|electron carrier activity (GO:0009055)|methylated histone binding (GO:0035064)|oligosaccharide binding (GO:0070492)|protein-lysine 6-oxidase activity (GO:0004720)|scavenger receptor activity (GO:0005044)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(5)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35		Prostate(55;0.0453)|Breast(100;0.143)		Colorectal(74;0.0288)|COAD - Colon adenocarcinoma(73;0.096)		GGCCGCCGTTCAGGCGCAGCT	0.637																																						dbGAP											0													58.0	55.0	56.0					8																	23177557		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89942	CCDS34864.1	8p21.3	2008-05-15				ENSG00000134013			6666	protein-coding gene	gene with protein product		606663				9722957	Standard	NM_002318		Approved	WS9-14	uc003xdh.1	Q9Y4K0		ENST00000389131.3:c.1311G>A	8.37:g.23177557C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Q0|Q53HV3|Q9BW70|Q9Y5Y8	Silent	SNP	pfam_Lysyl_oxidase,pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Lysyl_oxidase,prints_Srcr_rcpt	p.L437	ENST00000389131.3	37	c.1311	CCDS34864.1	8																																																																																			LOXL2	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt	ENSG00000134013		0.637	LOXL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOXL2	HGNC	protein_coding	OTTHUMT00000375603.1	163	0.00	0	C			23177557	23177557	-1	no_errors	ENST00000389131	ensembl	human	known	69_37n	silent	83	41.26	59	SNP	1.000	T
LRCH1	23143	genome.wustl.edu	37	13	47127578	47127578	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:47127578C>T	ENST00000389798.3	+	1	244	c.47C>T	c.(46-48)tCg>tTg	p.S16L	LRCH1_ENST00000389797.3_Missense_Mutation_p.S16L|LRCH1_ENST00000311191.6_Missense_Mutation_p.S16L	NM_015116.2	NP_055931	Q9Y2L9	LRCH1_HUMAN	leucine-rich repeats and calponin homology (CH) domain containing 1	16										breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_lung(13;5.61e-07)|Lung NSC(96;0.000117)|Breast(56;0.000141)|Prostate(109;0.0029)|Lung SC(185;0.0367)|Myeloproliferative disorder(33;0.0505)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000123)		CCGGCCCTTTCGGTAGCTACT	0.726																																						dbGAP											0													31.0	22.0	25.0					13																	47127578		1817	3458	5275	-	-	-	SO:0001583	missense	0			AB023233	CCDS31972.1, CCDS53865.1, CCDS53866.1	13q14.11	2008-02-05	2004-05-27	2004-05-28	ENSG00000136141	ENSG00000136141			20309	protein-coding gene	gene with protein product		610368	"""calponin homology (CH) domain containing 1"""	CHDC1		10231032	Standard	NM_015116		Approved	KIAA1016	uc001vbk.3	Q9Y2L9	OTTHUMG00000016877	ENST00000389798.3:c.47C>T	13.37:g.47127578C>T	ENSP00000374448:p.Ser16Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLL5|F8W6F0|Q17R43|Q2KHR1|Q5TBU9|Q7Z5F6|Q7Z5F7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_Leu-rich_rpt_typical-subtyp,smart_CH-domain,pfscan_CH-domain	p.S16L	ENST00000389798.3	37	c.47	CCDS31972.1	13	.	.	.	.	.	.	.	.	.	.	C	12.57	1.976770	0.34848	.	.	ENSG00000136141	ENST00000311191;ENST00000389798;ENST00000389797	T;T;T	0.56611	0.45;0.5;0.48	3.53	3.53	0.40419	.	0.702893	0.11581	N	0.549741	T	0.35480	0.0933	L	0.36672	1.1	0.09310	N	1	B;B;P;B	0.35700	0.013;0.001;0.516;0.001	B;B;B;B	0.24541	0.001;0.001;0.054;0.001	T	0.16660	-1.0395	10	0.41790	T	0.15	-2.3973	6.7053	0.23246	0.0:0.7111:0.1841:0.1048	.	16;16;16;16	Q17R43;Q9Y2L9-2;F8W6F0;Q9Y2L9	.;.;.;LRCH1_HUMAN	L	16	ENSP00000308493:S16L;ENSP00000374448:S16L;ENSP00000374447:S16L	ENSP00000308493:S16L	S	+	2	0	LRCH1	46025579	0.011000	0.17503	0.020000	0.16555	0.786000	0.44442	2.319000	0.43788	1.798000	0.52647	0.591000	0.81541	TCG	LRCH1	-	NULL	ENSG00000136141		0.726	LRCH1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LRCH1	HGNC	protein_coding	OTTHUMT00000044824.2	29	0.00	0	C	NM_015116		47127578	47127578	+1	no_errors	ENST00000389798	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.016	T
LRP1	4035	genome.wustl.edu	37	12	57599437	57599437	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:57599437C>T	ENST00000243077.3	+	75	12033	c.11567C>T	c.(11566-11568)aCg>aTg	p.T3856M		NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	3856	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TTCATGAAGACGCACAACACC	0.617																																						dbGAP											0													62.0	61.0	61.0					12																	57599437		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.11567C>T	12.37:g.57599437C>T	ENSP00000243077:p.Thr3856Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.T3856M	ENST00000243077.3	37	c.11567	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	C	13.97	2.395079	0.42512	.	.	ENSG00000123384	ENST00000243077	D	0.90620	-2.7	4.42	3.52	0.40303	Growth factor, receptor (1);Epidermal growth factor-like (1);	0.246048	0.32372	N	0.006184	T	0.81851	0.4910	N	0.13235	0.315	0.80722	D	1	D	0.56035	0.974	B	0.42692	0.395	T	0.82770	-0.0293	10	0.42905	T	0.14	.	11.9897	0.53168	0.0:0.9082:0.0:0.0918	.	3856	Q07954	LRP1_HUMAN	M	3856	ENSP00000243077:T3856M	ENSP00000243077:T3856M	T	+	2	0	LRP1	55885704	0.981000	0.34729	0.987000	0.45799	0.981000	0.71138	2.345000	0.44018	2.468000	0.83385	0.561000	0.74099	ACG	LRP1	-	superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000123384		0.617	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	85	0.00	0	C	NM_002332		57599437	57599437	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	81	28.70	33	SNP	0.945	T
LRPPRC	10128	genome.wustl.edu	37	2	44202316	44202316	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:44202316C>G	ENST00000260665.7	-	7	835	c.778G>C	c.(778-780)Gat>Cat	p.D260H	LRPPRC_ENST00000409946.1_Missense_Mutation_p.D260H|LRPPRC_ENST00000409659.1_Missense_Mutation_p.D260H	NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	260					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				ATTCCGGCATCTCTCATCACT	0.373																																						dbGAP											0													102.0	89.0	93.0					2																	44202316		2203	4300	6503	-	-	-	SO:0001583	missense	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.778G>C	2.37:g.44202316C>G	ENSP00000260665:p.Asp260His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.D260H	ENST00000260665.7	37	c.778	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	13.50	2.254714	0.39896	.	.	ENSG00000138095	ENST00000465633;ENST00000260665;ENST00000409946;ENST00000409659;ENST00000447246	T;T;T;T	0.66099	0.44;0.4;0.39;-0.19	5.33	2.44	0.29823	.	0.557165	0.20940	N	0.082933	T	0.43656	0.1257	N	0.08118	0	0.19575	N	0.999969	P;B;P	0.36768	0.569;0.431;0.47	B;B;B	0.43916	0.253;0.436;0.29	T	0.31336	-0.9947	10	0.49607	T	0.09	-26.3685	5.8011	0.18414	0.0:0.5047:0.2694:0.2259	.	160;234;260	F5H4J6;C9JCA9;P42704	.;.;LPPRC_HUMAN	H	160;260;260;260;234	ENSP00000260665:D260H;ENSP00000386234:D260H;ENSP00000386562:D260H;ENSP00000403637:D234H	ENSP00000260665:D260H	D	-	1	0	LRPPRC	44055820	0.757000	0.28394	0.996000	0.52242	0.723000	0.41478	1.727000	0.38095	0.279000	0.22186	0.650000	0.86243	GAT	LRPPRC	-	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	ENSG00000138095		0.373	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	210	0.00	0	C	NM_133259		44202316	44202316	-1	no_errors	ENST00000260665	ensembl	human	known	69_37n	missense	146	18.78	34	SNP	0.939	G
LRRC37A6P	387646	genome.wustl.edu	37	10	27537777	27537777	+	lincRNA	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr10:27537777C>T	ENST00000574842.1	+	0	255				LRRC37A6P_ENST00000284414.4_RNA																							AATATAGTTTCCTTGGAAATT	0.408																																						dbGAP											0																																										-	-	-			0																															10.37:g.27537777C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000574842.1	37	NULL		10																																																																																			LRRC37A6P	-	-	ENSG00000230445		0.408	RP11-85G18.6-001	KNOWN	basic	lincRNA	LRRC37A6P	HGNC	lincRNA	OTTHUMT00000436904.1	13	0.00	0	C			27537777	27537777	-1	no_errors	ENST00000284414	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	0.386	T
LUZP1	7798	genome.wustl.edu	37	1	23418627	23418627	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:23418627C>T	ENST00000302291.4	-	4	2929	c.2128G>A	c.(2128-2130)Gat>Aat	p.D710N	LUZP1_ENST00000314174.5_Missense_Mutation_p.D710N|LUZP1_ENST00000418342.1_Missense_Mutation_p.D710N|LUZP1_ENST00000374623.3_Missense_Mutation_p.D710N			Q86V48	LUZP1_HUMAN	leucine zipper protein 1	710					artery development (GO:0060840)|neural fold bending (GO:0021503)|ventricular septum development (GO:0003281)	membrane (GO:0016020)|nucleus (GO:0005634)				NS(1)|breast(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(12)|upper_aerodigestive_tract(2)	31		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Ovarian(437;0.00373)|Breast(348;0.00815)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;4.88e-27)|Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;4.31e-06)|GBM - Glioblastoma multiforme(114;8.64e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00112)|KIRC - Kidney renal clear cell carcinoma(1967;0.00176)|STAD - Stomach adenocarcinoma(196;0.0146)|READ - Rectum adenocarcinoma(331;0.0686)|Lung(427;0.0967)|LUSC - Lung squamous cell carcinoma(448;0.199)		ATTCCAGCATCTTTATCATTC	0.488																																						dbGAP											0													244.0	260.0	255.0					1																	23418627		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051733	CCDS30628.1	1p36	2008-02-05			ENSG00000169641	ENSG00000169641			14985	protein-coding gene	gene with protein product		601422				8812416	Standard	NM_033631		Approved	LUZP	uc010odv.1	Q86V48	OTTHUMG00000003227	ENST00000302291.4:c.2128G>A	1.37:g.23418627C>T	ENSP00000303758:p.Asp710Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TH93|Q8N4X3|Q8TEH1	Missense_Mutation	SNP	NULL	p.D710N	ENST00000302291.4	37	c.2128	CCDS30628.1	1	.	.	.	.	.	.	.	.	.	.	c	1.750	-0.489581	0.04352	.	.	ENSG00000169641	ENST00000418342;ENST00000374623;ENST00000302291;ENST00000314174	T;T;T;T	0.13901	2.76;2.76;2.76;2.55	4.88	2.92	0.33932	.	0.316812	0.22927	N	0.053947	T	0.05044	0.0135	N	0.13043	0.29	0.09310	N	1	B;B	0.06786	0.0;0.001	B;B	0.08055	0.002;0.003	T	0.41928	-0.9481	10	0.02654	T	1	.	2.4169	0.04438	0.2365:0.4736:0.0:0.29	.	710;710	Q86V48-2;Q86V48	.;LUZP1_HUMAN	N	710	ENSP00000393460:D710N;ENSP00000363752:D710N;ENSP00000303758:D710N;ENSP00000313705:D710N	ENSP00000303758:D710N	D	-	1	0	LUZP1	23291214	0.056000	0.20664	0.277000	0.24703	0.274000	0.26718	1.148000	0.31614	0.575000	0.29434	-0.194000	0.12790	GAT	LUZP1	-	NULL	ENSG00000169641		0.488	LUZP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LUZP1	HGNC	protein_coding	OTTHUMT00000008900.3	393	0.00	0	C	NM_033631		23418627	23418627	-1	no_errors	ENST00000302291	ensembl	human	known	69_37n	missense	266	23.71	83	SNP	0.020	T
LRRN2	10446	genome.wustl.edu	37	1	204587427	204587427	+	Missense_Mutation	SNP	C	C	T	rs190535053		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:204587427C>T	ENST00000367175.1	-	1	3906	c.1694G>A	c.(1693-1695)cGg>cAg	p.R565Q	RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000367177.3_Missense_Mutation_p.R565Q|LRRN2_ENST00000367176.3_Missense_Mutation_p.R565Q|LRRN2_ENST00000496057.1_5'Flank			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	565					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			CCCCTGGCCCCGGAGGGAGGA	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		18261	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													62.0	65.0	64.0					1																	204587427		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1694G>A	1.37:g.204587427C>T	ENSP00000356143:p.Arg565Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R565Q	ENST00000367175.1	37	c.1694	CCDS1448.1	1	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	10.13	1.266343	0.23136	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.04454	3.62;3.62;3.62	5.36	-3.72	0.04411	.	0.225800	0.22603	N	0.057931	T	0.02929	0.0087	L	0.44542	1.39	0.09310	N	0.999998	B	0.31435	0.323	B	0.15870	0.014	T	0.32214	-0.9915	10	0.49607	T	0.09	.	4.1918	0.10424	0.0995:0.2222:0.133:0.5453	.	565	O75325	LRRN2_HUMAN	Q	565	ENSP00000356144:R565Q;ENSP00000356145:R565Q;ENSP00000356143:R565Q	ENSP00000356143:R565Q	R	-	2	0	LRRN2	202854050	0.006000	0.16342	0.531000	0.27976	0.883000	0.51084	0.179000	0.16840	-0.500000	0.06614	-0.300000	0.09419	CGG	LRRN2	-	superfamily_Fibronectin_type3	ENSG00000170382		0.652	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	134	0.74	1	C	NM_006338		204587427	204587427	-1	no_errors	ENST00000367175	ensembl	human	known	69_37n	missense	119	40.59	82	SNP	0.066	T
MAP3K1	4214	genome.wustl.edu	37	5	56155605	56155605	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:56155605delC	ENST00000399503.3	+	3	697	c.697delC	c.(697-699)ccafs	p.P233fs	AC008937.2_ENST00000415589.1_RNA|snoU13_ENST00000459264.1_RNA	NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	233					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		AGCTGAGTCTCCAGGAGAGGT	0.463																																						dbGAP											0													43.0	43.0	43.0					5																	56155605		1913	4138	6051	-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.697delC	5.37:g.56155605delC	ENSP00000382423:p.Pro233fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.P233fs	ENST00000399503.3	37	c.697	CCDS43318.1	5																																																																																			MAP3K1	-	NULL	ENSG00000095015		0.463	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	89	0.00	0	C	XM_042066		56155605	56155605	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	56	39.13	36	DEL	0.424	-
MAP3K9	4293	genome.wustl.edu	37	14	71267708	71267708	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:71267708C>T	ENST00000554752.2	-	2	495	c.496G>A	c.(496-498)Gat>Aat	p.D166N	MAP3K9_ENST00000555993.2_Missense_Mutation_p.D166N|MAP3K9_ENST00000381250.4_Missense_Mutation_p.D166N	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	166	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GCAACCTCATCCCCTATCCAG	0.512																																					GBM(114;411 1587 13539 28235 50070)	dbGAP											0													115.0	107.0	110.0					14																	71267708		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.496G>A	14.37:g.71267708C>T	ENSP00000451612:p.Asp166Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_Regulat_G_prot_signal_superfam,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.D166N	ENST00000554752.2	37	c.496		14	.	.	.	.	.	.	.	.	.	.	C	14.65	2.598907	0.46318	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000381250	D;D	0.88896	-2.44;-2.44	6.17	5.29	0.74685	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.531812	0.21749	N	0.069712	D	0.82641	0.5081	N	0.17564	0.495	0.80722	D	1	B;B	0.16802	0.019;0.015	B;B	0.22152	0.038;0.022	T	0.78743	-0.2085	10	0.72032	D	0.01	.	15.763	0.78101	0.0:0.935:0.0:0.065	.	166;166	P80192;P80192-4	M3K9_HUMAN;.	N	166	ENSP00000451612:D166N;ENSP00000370649:D166N	ENSP00000005198:D166N	D	-	1	0	MAP3K9	70337461	0.074000	0.21230	0.998000	0.56505	0.777000	0.43975	1.214000	0.32419	1.628000	0.50416	-0.150000	0.13652	GAT	MAP3K9	-	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000006432		0.512	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	HGNC	protein_coding	OTTHUMT00000412550.2	188	0.00	0	C			71267708	71267708	-1	no_errors	ENST00000555993	ensembl	human	known	69_37n	missense	141	21.11	38	SNP	0.884	T
MAST4	375449	genome.wustl.edu	37	5	66084606	66084606	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:66084606C>T	ENST00000403625.2	+	3	921	c.626C>T	c.(625-627)tCg>tTg	p.S209L	MAST4_ENST00000404260.3_Missense_Mutation_p.S209L|MAST4_ENST00000406039.1_Missense_Mutation_p.S209L|MAST4_ENST00000406374.1_Missense_Mutation_p.S209L	NM_001164664.1	NP_001158136.1	O15021	MAST4_HUMAN	microtubule associated serine/threonine kinase family member 4	209						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|lung(6)|ovary(2)	13		Lung NSC(167;8.56e-06)|Prostate(74;0.00637)|Ovarian(174;0.0563)|Breast(144;0.0586)|Colorectal(97;0.245)		Lung(70;0.011)		TCGGCGCCCTCGCTCACCGCC	0.632																																						dbGAP											0													14.0	15.0	15.0					5																	66084606		1868	4095	5963	-	-	-	SO:0001583	missense	0			AY830839	CCDS47224.1, CCDS47225.1, CCDS54861.1, CCDS75254.1	5q12.3	2007-06-20			ENSG00000069020	ENSG00000069020			19037	protein-coding gene	gene with protein product						9205841	Standard	NM_198828		Approved	KIAA0303	uc021xzk.1	O15021	OTTHUMG00000152471	ENST00000403625.2:c.626C>T	5.37:g.66084606C>T	ENSP00000385727:p.Ser209Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL49|B5ME48|Q05EE6|Q6ZN07|Q8N4X4|Q96LY3	Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.S209L	ENST00000403625.2	37	c.626	CCDS54861.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.01|15.01	2.706754|2.706754	0.48412|0.48412	.|.	.|.	ENSG00000069020|ENSG00000069020	ENST00000452953|ENST00000404260;ENST00000403625;ENST00000406374;ENST00000406039;ENST00000432817;ENST00000434115	.|T;T;T;T;T	.|0.69685	.|-0.41;-0.42;0.15;0.26;-0.17	5.67|5.67	2.95|2.95	0.34219|0.34219	.|.	.|0.000000	.|0.64402	.|D	.|0.000008	T|T	0.50205|0.50205	0.1602|0.1602	L|L	0.41573|0.41573	1.285|1.285	0.29224|0.29224	N|N	0.873743|0.873743	.|P;P	.|0.44734	.|0.842;0.75	.|B;B	.|0.31390	.|0.129;0.073	T|T	0.50734|0.50734	-0.8793|-0.8793	5|10	.|0.62326	.|D	.|0.03	-0.0522|-0.0522	11.1258|11.1258	0.48317|0.48317	0.0:0.8039:0.0:0.1961|0.0:0.8039:0.0:0.1961	.|.	.|209;209	.|E7EX28;O15021-4	.|.;.	C|L	82|209;209;209;209;81;16	.|ENSP00000385048:S209L;ENSP00000385727:S209L;ENSP00000385088:S209L;ENSP00000384547:S209L;ENSP00000413573:S81L	.|ENSP00000385727:S209L	R|S	+|+	1|2	0|0	MAST4|MAST4	66120362|66120362	0.971000|0.971000	0.33674|0.33674	0.631000|0.631000	0.29282|0.29282	0.696000|0.696000	0.40369|0.40369	2.428000|2.428000	0.44749|0.44749	0.349000|0.349000	0.23975|0.23975	-0.484000|-0.484000	0.04775|0.04775	CGC|TCG	MAST4	-	NULL	ENSG00000069020		0.632	MAST4-001	NOVEL	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	MAST4	HGNC	protein_coding	OTTHUMT00000326324.2	41	0.00	0	C			66084606	66084606	+1	no_errors	ENST00000404260	ensembl	human	known	69_37n	missense	29	29.27	12	SNP	0.959	T
MB	4151	genome.wustl.edu	37	22	36031017	36031017	+	Missense_Mutation	SNP	G	G	A	rs538496018		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr22:36031017G>A	ENST00000594060.1	-	1	164	c.10C>T	c.(10-12)Ctc>Ttc	p.L4F	MB_ENST00000472240.1_5'UTR																							tgtgggctgagaagttccata	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		20020	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													108.0	104.0	105.0					22																	36031017		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000594060.1:c.10C>T	22.37:g.36031017G>A	ENSP00000471799:p.Leu4Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000594060.1	37	NULL		22																																																																																			MB	-	-	ENSG00000198125		0.448	AL049747.1-201	NOVEL	basic|appris_principal	protein_coding	MB	HGNC	protein_coding		245	0.00	0	G			36031017	36031017	-1	no_errors	ENST00000472240	ensembl	human	known	69_37n	rna	135	25.82	47	SNP	0.047	A
MBOAT2	129642	genome.wustl.edu	37	2	9000774	9000774	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:9000774G>C	ENST00000305997.3	-	12	1504	c.1306C>G	c.(1306-1308)Ctt>Gtt	p.L436V	MBOAT2_ENST00000486484.1_5'Flank	NM_138799.2	NP_620154.2	Q6ZWT7	MBOA2_HUMAN	membrane bound O-acyltransferase domain containing 2	436					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	1-acylglycerol-3-phosphate O-acyltransferase activity (GO:0003841)		MBOAT2/PRKCE(2)	endometrium(2)|kidney(1)|large_intestine(9)|lung(2)|skin(1)	15	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)					TTTATAGAAAGAAGCACAAAT	0.313																																					Ovarian(194;1699 3813 22401)	dbGAP											0													112.0	107.0	108.0					2																	9000774		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC016005	CCDS1660.1	2p25	2008-02-05	2006-06-29	2006-06-29	ENSG00000143797	ENSG00000143797			25193	protein-coding gene	gene with protein product		611949	"""O-acyltransferase (membrane bound) domain containing 2"""	OACT2			Standard	NM_138799		Approved	FLJ14415, FLJ90298	uc002qzg.1	Q6ZWT7	OTTHUMG00000090363	ENST00000305997.3:c.1306C>G	2.37:g.9000774G>C	ENSP00000302177:p.Leu436Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A9EDR2|Q8NCE7|Q96KY4	Missense_Mutation	SNP	pfam_MBOAT_fam,superfamily_MFS_dom_general_subst_transpt	p.L436V	ENST00000305997.3	37	c.1306	CCDS1660.1	2	.	.	.	.	.	.	.	.	.	.	G	17.30	3.354204	0.61293	.	.	ENSG00000143797	ENST00000305997	T	0.80994	-1.44	5.96	5.96	0.96718	.	0.061452	0.64402	D	0.000004	D	0.91630	0.7355	M	0.92507	3.315	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92831	0.6280	10	0.87932	D	0	-22.1395	13.5822	0.61909	0.0707:0.0:0.9293:0.0	.	436	Q6ZWT7	MBOA2_HUMAN	V	436	ENSP00000302177:L436V	ENSP00000302177:L436V	L	-	1	0	MBOAT2	8918225	1.000000	0.71417	0.936000	0.37596	0.276000	0.26787	6.306000	0.72810	2.826000	0.97356	0.655000	0.94253	CTT	MBOAT2	-	superfamily_MFS_dom_general_subst_transpt	ENSG00000143797		0.313	MBOAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBOAT2	HGNC	protein_coding	OTTHUMT00000206735.1	254	0.00	0	G	NM_138799		9000774	9000774	-1	no_errors	ENST00000305997	ensembl	human	known	69_37n	missense	190	16.67	38	SNP	1.000	C
MBTPS2	51360	genome.wustl.edu	37	X	21900634	21900634	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:21900634C>G	ENST00000379484.5	+	11	1520	c.1421C>G	c.(1420-1422)tCt>tGt	p.S474C		NM_015884.3	NP_056968.1	O43462	MBTP2_HUMAN	membrane-bound transcription factor peptidase, site 2	474					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cholesterol metabolic process (GO:0008203)|endoplasmic reticulum unfolded protein response (GO:0030968)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|endometrium(3)|large_intestine(3)|lung(13)|ovary(1)|skin(2)	24						ATTCTAAACTCTTTCTTGGAT	0.443																																						dbGAP											0													246.0	221.0	230.0					X																	21900634		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF019612	CCDS14201.1	Xp22.12-p22.11	2014-02-03	2005-08-17		ENSG00000012174	ENSG00000012174			15455	protein-coding gene	gene with protein product		300294	"""membrane-bound transcription factor protease, site 2"", ""keratosis follicularis spinulosa decalvans"""	KFSD		9847074, 9659902, 20672378	Standard	NM_015884		Approved	S2P	uc004dae.3	O43462	OTTHUMG00000021237	ENST00000379484.5:c.1421C>G	X.37:g.21900634C>G	ENSP00000368798:p.Ser474Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UM70|Q9UMD3	Missense_Mutation	SNP	pfam_Peptidase_M50,superfamily_PDZ,prints_Pept_M50_SREBP	p.S474C	ENST00000379484.5	37	c.1421	CCDS14201.1	X	.	.	.	.	.	.	.	.	.	.	C	24.1	4.488834	0.84962	.	.	ENSG00000012174	ENST00000379484	D	0.92545	-3.06	5.97	5.97	0.96955	Peptidase M50 (1);	0.106321	0.64402	D	0.000004	D	0.95370	0.8497	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.66847	0.947	D	0.94210	0.7458	10	0.37606	T	0.19	-23.5368	19.3337	0.94306	0.0:1.0:0.0:0.0	.	474	O43462	MBTP2_HUMAN	C	474	ENSP00000368798:S474C	ENSP00000368798:S474C	S	+	2	0	MBTPS2	21810555	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.378000	0.79679	2.519000	0.84933	0.538000	0.68166	TCT	MBTPS2	-	pfam_Peptidase_M50	ENSG00000012174		0.443	MBTPS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTPS2	HGNC	protein_coding	OTTHUMT00000056026.1	506	0.20	1	C			21900634	21900634	+1	no_errors	ENST00000379484	ensembl	human	known	69_37n	missense	375	20.04	94	SNP	1.000	G
MDN1	23195	genome.wustl.edu	37	6	90381945	90381945	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:90381945C>T	ENST00000369393.3	-	82	13883	c.13768G>A	c.(13768-13770)Gag>Aag	p.E4590K	MDN1_ENST00000468568.1_5'UTR|MDN1_ENST00000428876.1_Missense_Mutation_p.E4590K|RP1-122O8.7_ENST00000438877.1_RNA			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	4590					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		GTGCCATCCTCACCGTACGAT	0.483																																						dbGAP											0													123.0	110.0	114.0					6																	90381945		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.13768G>A	6.37:g.90381945C>T	ENSP00000358400:p.Glu4590Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.E4590K	ENST00000369393.3	37	c.13768	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805038	0.70682	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.29917	1.55;1.55	6.06	6.06	0.98353	.	0.059018	0.64402	D	0.000003	T	0.42698	0.1214	M	0.73962	2.25	0.54753	D	0.999986	D	0.67145	0.996	P	0.60541	0.876	T	0.14364	-1.0475	10	0.11794	T	0.64	.	20.6208	0.99490	0.0:1.0:0.0:0.0	.	4590	Q9NU22	MDN1_HUMAN	K	4590	ENSP00000358400:E4590K;ENSP00000413970:E4590K	ENSP00000358400:E4590K	E	-	1	0	MDN1	90438666	1.000000	0.71417	0.972000	0.41901	0.329000	0.28539	5.824000	0.69279	2.882000	0.98803	0.655000	0.94253	GAG	MDN1	-	superfamily_ARM-type_fold,pirsf_Midasin	ENSG00000112159		0.483	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	252	0.00	0	C			90381945	90381945	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	missense	167	21.60	46	SNP	1.000	T
ME2	4200	genome.wustl.edu	37	18	48452266	48452266	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:48452266G>C	ENST00000321341.5	+	12	1584	c.1312G>C	c.(1312-1314)Gag>Cag	p.E438Q	ME2_ENST00000585680.1_3'UTR|ME2_ENST00000382927.3_Missense_Mutation_p.E438Q	NM_002396.4	NP_002387.1	P23368	MAOM_HUMAN	malic enzyme 2, NAD(+)-dependent, mitochondrial	438					malate metabolic process (GO:0006108)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|malate dehydrogenase (decarboxylating) (NAD+) activity (GO:0004471)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|oxaloacetate decarboxylase activity (GO:0008948)			breast(2)|endometrium(1)|kidney(2)|large_intestine(4)|lung(11)|upper_aerodigestive_tract(3)	23		Colorectal(6;0.0273)|all_epithelial(6;0.118)		Colorectal(21;0.0313)|READ - Rectum adenocarcinoma(32;0.105)|STAD - Stomach adenocarcinoma(97;0.184)		TACACTTACAGAGGTATTAAT	0.373																																						dbGAP											0													48.0	44.0	46.0					18																	48452266		2203	4300	6503	-	-	-	SO:0001583	missense	0			M55905	CCDS11948.1, CCDS54187.1	18q21	2012-10-02			ENSG00000082212	ENSG00000082212	1.1.1.40		6984	protein-coding gene	gene with protein product		154270				1993674	Standard	NM_002396		Approved		uc002ley.3	P23368	OTTHUMG00000132694	ENST00000321341.5:c.1312G>C	18.37:g.48452266G>C	ENSP00000321070:p.Glu438Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8J2|Q9BWL6|Q9BYG1|Q9H4B2	Missense_Mutation	SNP	pfam_Malic_NAD-bd,pfam_Malic_N,smart_Malic_NAD-bd,prints_Malic_OxRdtase	p.E438Q	ENST00000321341.5	37	c.1312	CCDS11948.1	18	.	.	.	.	.	.	.	.	.	.	G	10.68	1.417628	0.25552	.	.	ENSG00000082212	ENST00000321341;ENST00000382927	T;T	0.45276	0.9;0.9	5.59	3.81	0.43845	Malic enzyme, NAD-binding (2);NAD(P)-binding domain (1);	0.206988	0.49916	N	0.000128	T	0.30854	0.0778	L	0.35644	1.08	0.45118	D	0.998137	B;B	0.09022	0.002;0.0	B;B	0.15870	0.014;0.006	T	0.05989	-1.0852	10	0.20519	T	0.43	-14.6589	10.6789	0.45802	0.0729:0.1325:0.7946:0.0	.	438;438	Q9BWL6;P23368	.;MAOM_HUMAN	Q	438	ENSP00000321070:E438Q;ENSP00000372384:E438Q	ENSP00000321070:E438Q	E	+	1	0	ME2	46706264	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	3.834000	0.55798	0.720000	0.32209	-0.126000	0.14955	GAG	ME2	-	pfam_Malic_NAD-bd,smart_Malic_NAD-bd	ENSG00000082212		0.373	ME2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ME2	HGNC	protein_coding	OTTHUMT00000255991.1	152	0.00	0	G	NM_002396		48452266	48452266	+1	no_errors	ENST00000321341	ensembl	human	known	69_37n	missense	104	17.46	22	SNP	1.000	C
METTL17	64745	genome.wustl.edu	37	14	21463019	21463019	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:21463019G>A	ENST00000339374.6	+	9	1068	c.835G>A	c.(835-837)Gag>Aag	p.E279K	METTL17_ENST00000382985.4_Missense_Mutation_p.E279K|METTL17_ENST00000556670.2_Missense_Mutation_p.E279K|RP11-84C10.4_ENST00000557335.1_RNA	NM_001029991.1|NM_022734.2	NP_001025162.1|NP_073571.1	Q9H7H0	MET17_HUMAN	methyltransferase like 17	279					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	copper ion binding (GO:0005507)|methyltransferase activity (GO:0008168)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)|skin(2)	20						TGACCGCACTGAGGTAGTTCA	0.448																																						dbGAP											0													153.0	118.0	130.0					14																	21463019		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024512	CCDS9562.1, CCDS41913.1	14q11.2	2011-03-03	2011-03-02	2011-03-02	ENSG00000165792	ENSG00000165792			19280	protein-coding gene	gene with protein product			"""methyltransferase 11 domain containing 1"""	METT11D1		11278769	Standard	XM_006720235		Approved	FLJ20859	uc001vyn.3	Q9H7H0	OTTHUMG00000029610	ENST00000339374.6:c.835G>A	14.37:g.21463019G>A	ENSP00000343041:p.Glu279Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BSH1|Q9BZH2|Q9BZH3	Missense_Mutation	SNP	pfam_Ribosomal_Rsm22_bac-type,pfam_Methyltransf_11	p.E279K	ENST00000339374.6	37	c.835	CCDS9562.1	14	.	.	.	.	.	.	.	.	.	.	G	9.532	1.111142	0.20714	.	.	ENSG00000165792	ENST00000339374;ENST00000382985	T;T	0.40476	1.03;1.03	5.95	5.06	0.68205	.	0.271297	0.40818	N	0.001011	T	0.25680	0.0625	N	0.16266	0.395	0.09310	N	0.999999	B;B;B	0.21147	0.052;0.016;0.037	B;B;B	0.23150	0.044;0.012;0.025	T	0.16837	-1.0389	10	0.14656	T	0.56	.	11.1499	0.48453	0.084:0.0:0.916:0.0	.	279;279;279	Q9H7H0-3;Q9H7H0;Q9H7H0-2	.;MET17_HUMAN;.	K	279	ENSP00000343041:E279K;ENSP00000372445:E279K	ENSP00000343041:E279K	E	+	1	0	METTL17	20532859	0.730000	0.28100	0.136000	0.22124	0.026000	0.11368	2.731000	0.47343	1.535000	0.49220	-0.140000	0.14226	GAG	METTL17	-	pfam_Ribosomal_Rsm22_bac-type,pfam_Methyltransf_11	ENSG00000165792		0.448	METTL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL17	HGNC	protein_coding	OTTHUMT00000073804.4	349	0.00	0	G	NM_022734		21463019	21463019	+1	no_errors	ENST00000382985	ensembl	human	known	69_37n	missense	232	41.56	165	SNP	0.111	A
MGAM	8972	genome.wustl.edu	37	7	141705408	141705408	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:141705408C>T	ENST00000549489.2	+	2	173	c.78C>T	c.(76-78)atC>atT	p.I26I	MGAM_ENST00000475668.2_Silent_p.I26I	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	26					carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	TGTTTATCATCAGTATTGTTC	0.348																																						dbGAP											0													113.0	106.0	108.0					7																	141705408		1852	4096	5948	-	-	-	SO:0001819	synonymous_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.78C>T	7.37:g.141705408C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.I26	ENST00000549489.2	37	c.78	CCDS47727.1	7																																																																																			MGAM	-	NULL	ENSG00000257335		0.348	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	428	0.00	0	C			141705408	141705408	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	silent	357	16.98	73	SNP	0.118	T
MLC1	23209	genome.wustl.edu	37	22	50512736	50512736	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr22:50512736G>C	ENST00000311597.5	-	8	1229	c.623C>G	c.(622-624)tCt>tGt	p.S208C	MLC1_ENST00000450140.2_Missense_Mutation_p.S156C|MLC1_ENST00000535444.1_Missense_Mutation_p.S129C|MLC1_ENST00000538737.1_Missense_Mutation_p.S174C|MLC1_ENST00000431262.2_Missense_Mutation_p.S178C|MLC1_ENST00000483836.1_5'Flank|MLC1_ENST00000395876.2_Missense_Mutation_p.S208C	NM_015166.3	NP_055981.1	Q15049	MLC1_HUMAN	megalencephalic leukoencephalopathy with subcortical cysts 1	208					caveolin-mediated endocytosis (GO:0072584)|cellular response to cholesterol (GO:0071397)|ion transport (GO:0006811)|positive regulation of intracellular transport (GO:0032388)|protein oligomerization (GO:0051259)|regulation of response to osmotic stress (GO:0047484)|transport (GO:0006810)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	protein complex binding (GO:0032403)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(1)|kidney(1)|large_intestine(5)|lung(7)|pancreas(1)|prostate(3)	18		all_cancers(38;7.69e-11)|all_epithelial(38;9.52e-10)|all_lung(38;3.67e-05)|Breast(42;0.000776)|Lung NSC(38;0.000946)|Ovarian(80;0.0365)|Lung SC(80;0.113)		READ - Rectum adenocarcinoma(2;0.000669)|Colorectal(2;0.00242)|LUAD - Lung adenocarcinoma(64;0.0695)|BRCA - Breast invasive adenocarcinoma(115;0.216)		GAGGACGGCAGAGATGCCTGC	0.567																																						dbGAP											0													113.0	78.0	90.0					22																	50512736		2203	4300	6503	-	-	-	SO:0001583	missense	0			D25217	CCDS14083.1	22q13.33	2007-03-20			ENSG00000100427	ENSG00000100427			17082	protein-coding gene	gene with protein product		605908				7584026, 7584028	Standard	XR_430476		Approved	MLC, KIAA0027, LVM, VL	uc003bjg.1	Q15049	OTTHUMG00000150236	ENST00000311597.5:c.623C>G	22.37:g.50512736G>C	ENSP00000310375:p.Ser208Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KW61|B7Z659|Q5JZ83|Q8TAG4|Q96RP5|Q9UGY8	Missense_Mutation	SNP	NULL	p.S208C	ENST00000311597.5	37	c.623	CCDS14083.1	22	.	.	.	.	.	.	.	.	.	.	G	14.40	2.525467	0.44969	.	.	ENSG00000100427	ENST00000395876;ENST00000311597;ENST00000538737;ENST00000431262;ENST00000535444;ENST00000450140;ENST00000442311	D;D;D;D;D;D;D	0.95447	-3.67;-3.67;-3.55;-3.28;-3.5;-3.59;-3.71	5.11	4.07	0.47477	.	0.178318	0.50627	N	0.000101	D	0.96473	0.8849	L	0.54323	1.7	0.51012	D	0.999901	D;D;B;D	0.89917	1.0;1.0;0.053;1.0	D;D;B;D	0.85130	0.997;0.997;0.027;0.997	D	0.95704	0.8752	10	0.45353	T	0.12	-2.0764	12.7206	0.57140	0.0:0.1659:0.834:0.0	.	174;178;156;208	F5H1B9;B7Z659;B7Z1X1;Q15049	.;.;.;MLC1_HUMAN	C	208;208;174;178;129;156;178	ENSP00000379216:S208C;ENSP00000310375:S208C;ENSP00000445805:S174C;ENSP00000415877:S178C;ENSP00000438910:S129C;ENSP00000412448:S156C;ENSP00000401385:S178C	ENSP00000310375:S208C	S	-	2	0	MLC1	48854863	1.000000	0.71417	0.183000	0.23137	0.111000	0.19643	6.480000	0.73604	1.095000	0.41419	0.561000	0.74099	TCT	MLC1	-	NULL	ENSG00000100427		0.567	MLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLC1	HGNC	protein_coding	OTTHUMT00000316979.2	81	0.00	0	G	NM_015166		50512736	50512736	-1	no_errors	ENST00000311597	ensembl	human	known	69_37n	missense	80	13.04	12	SNP	0.999	C
KMT2C	58508	genome.wustl.edu	37	7	151878971	151878971	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:151878971C>G	ENST00000262189.6	-	36	6192	c.5974G>C	c.(5974-5976)Gaa>Caa	p.E1992Q	KMT2C_ENST00000355193.2_Missense_Mutation_p.E1992Q	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	1992	Pro-rich.				histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										GCAGTTTGTTCTGAAACTACA	0.458																																						dbGAP											0													166.0	175.0	172.0					7																	151878971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.5974G>C	7.37:g.151878971C>G	ENSP00000262189:p.Glu1992Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E1992Q	ENST00000262189.6	37	c.5974	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	14.16	2.453353	0.43531	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	T;T	0.42131	0.98;0.98	5.59	5.59	0.84812	.	0.159805	0.28371	U	0.015583	T	0.34803	0.0910	N	0.19112	0.55	0.80722	D	1	D;B	0.54397	0.966;0.42	P;B	0.44860	0.462;0.187	T	0.05178	-1.0901	10	0.23302	T	0.38	.	19.6553	0.95833	0.0:1.0:0.0:0.0	.	1992;1053	Q8NEZ4;Q8NEZ4-2	MLL3_HUMAN;.	Q	1992	ENSP00000262189:E1992Q;ENSP00000347325:E1992Q	ENSP00000262189:E1992Q	E	-	1	0	MLL3	151509904	0.999000	0.42202	0.081000	0.20488	0.915000	0.54546	5.249000	0.65427	2.653000	0.90120	0.558000	0.71614	GAA	MLL3	-	NULL	ENSG00000055609		0.458	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	198	0.00	0	C			151878971	151878971	-1	no_errors	ENST00000355193	ensembl	human	known	69_37n	missense	140	25.93	49	SNP	0.996	G
MLLT4	4301	genome.wustl.edu	37	6	168307891	168307891	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:168307891C>G	ENST00000447894.2	+	13	1691	c.1691C>G	c.(1690-1692)tCt>tGt	p.S564C	MLLT4_ENST00000366806.2_Missense_Mutation_p.S564C|MLLT4_ENST00000392112.1_Missense_Mutation_p.S548C|MLLT4_ENST00000400822.3_Missense_Mutation_p.S563C|MLLT4_ENST00000344191.4_Missense_Mutation_p.S564C|MLLT4_ENST00000351017.4_Missense_Mutation_p.S564C|MLLT4_ENST00000392108.3_Missense_Mutation_p.S564C			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	564					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		TCGTCTGCCTCTAGCACAGCC	0.512			T	MLL	AL																																	dbGAP		Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													120.0	112.0	115.0					6																	168307891		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.1691C>G	6.37:g.168307891C>G	ENSP00000404595:p.Ser564Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.S564C	ENST00000447894.2	37	c.1691		6	.	.	.	.	.	.	.	.	.	.	C	8.770	0.925663	0.18056	.	.	ENSG00000130396	ENST00000344191;ENST00000351017;ENST00000392108;ENST00000366806;ENST00000392112;ENST00000341575;ENST00000400822;ENST00000447894	T;T;T;T;T;T;T	0.04917	3.72;3.58;3.72;3.7;3.53;3.61;3.61	5.14	2.15	0.27550	.	0.687162	0.13902	N	0.354826	T	0.03564	0.0102	L	0.60455	1.87	0.35986	D	0.836358	B;B;B;B	0.16802	0.004;0.019;0.003;0.0	B;B;B;B	0.13407	0.005;0.009;0.006;0.002	T	0.19549	-1.0302	10	0.45353	T	0.12	-15.0325	14.3493	0.66688	0.0:0.5694:0.4306:0.0	.	262;563;564;548	Q96C95;P55196-5;P55196-6;P55196-2	.;.;.;.	C	564;564;564;564;548;564;563;564	ENSP00000341118:S564C;ENSP00000252692:S564C;ENSP00000375956:S564C;ENSP00000355771:S564C;ENSP00000375960:S548C;ENSP00000383623:S563C;ENSP00000404595:S564C	ENSP00000345834:S564C	S	+	2	0	MLLT4	168050740	0.993000	0.37304	0.112000	0.21494	0.534000	0.34807	1.609000	0.36858	0.116000	0.18110	0.650000	0.86243	TCT	MLLT4	-	NULL	ENSG00000130396		0.512	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	171	0.00	0	C	NM_005936		168307891	168307891	+1	no_errors	ENST00000366806	ensembl	human	known	69_37n	missense	155	20.92	41	SNP	0.985	G
MPPE1	65258	genome.wustl.edu	37	18	11886744	11886744	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:11886744G>A	ENST00000588072.1	-	8	1933	c.712C>T	c.(712-714)Ctg>Ttg	p.L238L	MPPE1_ENST00000344987.7_Intron|MPPE1_ENST00000399978.2_Silent_p.L239L|MPPE1_ENST00000592755.1_5'Flank|MPPE1_ENST00000317235.7_Intron|MPPE1_ENST00000309976.9_Intron	NM_023075.5	NP_075563.3	Q53F39	MPPE1_HUMAN	metallophosphoesterase 1	238					ER to Golgi vesicle-mediated transport (GO:0006888)|GPI anchor biosynthetic process (GO:0006506)	cis-Golgi network (GO:0005801)|endoplasmic reticulum exit site (GO:0070971)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	GPI anchor binding (GO:0034235)|manganese ion binding (GO:0030145)|phosphoric diester hydrolase activity (GO:0008081)			endometrium(1)|large_intestine(1)|lung(1)|ovary(1)|skin(1)	5						GTGGGCAGCAGAGGCCCAGGT	0.627																																						dbGAP											0													32.0	32.0	32.0					18																	11886744		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			BC002877	CCDS11853.1, CCDS56054.1	18p11.21	2004-04-30			ENSG00000154889	ENSG00000154889			15988	protein-coding gene	gene with protein product		611900				11978971	Standard	NM_001242904		Approved		uc002kqf.3	Q53F39	OTTHUMG00000131661	ENST00000588072.1:c.712C>T	18.37:g.11886744G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ39|B0YJ40|B0YJ41|B5ME53|B7WNJ3|D3DUI5|D3DUI7|Q6GMP1|Q8TAD6|Q8TE26|Q8WZ32|Q9BU58|Q9H958|Q9HAI4	Silent	SNP	pfam_Metallo_PEstase_dom	p.L238	ENST00000588072.1	37	c.712	CCDS11853.1	18																																																																																			MPPE1	-	NULL	ENSG00000154889		0.627	MPPE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPPE1	HGNC	protein_coding	OTTHUMT00000254562.2	20	0.00	0	G	NM_023075		11886744	11886744	-1	no_errors	ENST00000588072	ensembl	human	known	69_37n	silent	17	37.04	10	SNP	0.000	A
MRVI1	10335	genome.wustl.edu	37	11	10622555	10622555	+	Missense_Mutation	SNP	G	G	C	rs372056400		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:10622555G>C	ENST00000436272.1	-	14	1924	c.1846C>G	c.(1846-1848)Cta>Gta	p.L616V	MRVI1_ENST00000534266.2_Missense_Mutation_p.L328V|MRVI1_ENST00000527509.2_Missense_Mutation_p.L552V|MRVI1-AS1_ENST00000525578.1_RNA|MRVI1_ENST00000423302.2_Missense_Mutation_p.L643V|MRVI1_ENST00000541483.1_Missense_Mutation_p.L437V|MRVI1-AS1_ENST00000529979.1_RNA|MRVI1_ENST00000552103.1_Missense_Mutation_p.L552V|MRVI1_ENST00000558540.1_Missense_Mutation_p.L328V|MRVI1-AS1_ENST00000529829.1_RNA|MRVI1_ENST00000545852.1_Missense_Mutation_p.L328V|MRVI1_ENST00000421747.1_Missense_Mutation_p.L634V|MRVI1_ENST00000424001.1_Missense_Mutation_p.L328V|MRVI1_ENST00000547195.1_Missense_Mutation_p.L552V|MRVI1_ENST00000531107.1_Missense_Mutation_p.L635V|LYVE1_ENST00000531706.1_Intron			Q9Y6F6	MRVI1_HUMAN	murine retrovirus integration site 1 homolog	616					blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|relaxation of vascular smooth muscle (GO:0060087)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|platelet dense tubular network membrane (GO:0031095)|sarcoplasmic reticulum (GO:0016529)				central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(4)|ovary(2)|prostate(2)	22				all cancers(16;2.68e-07)|Epithelial(150;3.04e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0723)		GTCCTCTTTAGATTCTCCACA	0.512																																						dbGAP											0													252.0	248.0	249.0					11																	10622555		1974	4147	6121	-	-	-	SO:0001583	missense	0			AF081249	CCDS44538.1, CCDS44539.1, CCDS44540.1, CCDS44538.2, CCDS55745.1, CCDS55746.1	11p15.4	2014-09-11			ENSG00000072952	ENSG00000072952			7237	protein-coding gene	gene with protein product	"""inositol 1,4,5-triphosphate-associated cGMP kinase substrate"", ""IP3R-associated cGMP kinase substrate"""	604673				10321731	Standard	NM_001098579		Approved	JAW1L, IRAG	uc010rcb.1	Q9Y6F6	OTTHUMG00000165773	ENST00000436272.1:c.1846C>G	11.37:g.10622555G>C	ENSP00000412229:p.Leu616Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3T4|B7Z6I2|B7Z9A3|E9PQY6|F5H6A1|J3KQZ7|Q17S00|Q9UNY1	Missense_Mutation	SNP	pfam_MRVI1	p.L634V	ENST00000436272.1	37	c.1900		11	.	.	.	.	.	.	.	.	.	.	G	19.72	3.880504	0.72294	.	.	ENSG00000072952	ENST00000421747;ENST00000308763;ENST00000436272;ENST00000547195;ENST00000552103;ENST00000545852;ENST00000424001;ENST00000423302;ENST00000541483;ENST00000531107;ENST00000527509	T;T;T;T;T;T;T;T;T;T	0.28255	1.62;1.62;1.62;1.62;1.62;1.62;1.62;1.62;1.62;1.62	5.44	4.53	0.55603	.	0.000000	0.64402	D	0.000012	T	0.54143	0.1840	M	0.78456	2.415	0.50467	D	0.999878	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.87578	0.99;0.998;0.998;0.996	T	0.57700	-0.7766	10	0.66056	D	0.02	-6.8602	10.6196	0.45472	0.203:0.0:0.797:0.0	.	437;616;635;634	F5H6A1;Q9Y6F6;E9PQY6;Q9Y6F6-4	.;MRVI1_HUMAN;.;.	V	634;617;616;552;552;328;328;643;437;635;552	ENSP00000414598:L634V;ENSP00000412229:L616V;ENSP00000448278:L552V;ENSP00000446764:L552V;ENSP00000441971:L328V;ENSP00000401205:L328V;ENSP00000412130:L643V;ENSP00000437784:L437V;ENSP00000432436:L635V;ENSP00000432067:L552V	ENSP00000307885:L617V	L	-	1	2	MRVI1	10579131	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	3.064000	0.49986	1.299000	0.44798	0.557000	0.71058	CTA	MRVI1	-	pfam_MRVI1	ENSG00000072952		0.512	MRVI1-203	KNOWN	basic	protein_coding	MRVI1	HGNC	protein_coding		252	0.00	0	G	NM_001098579		10622555	10622555	-1	no_errors	ENST00000421747	ensembl	human	known	69_37n	missense	185	21.28	50	SNP	1.000	C
MUC16	94025	genome.wustl.edu	37	19	9045834	9045834	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:9045834C>T	ENST00000397910.4	-	5	36000	c.35797G>A	c.(35797-35799)Gaa>Aaa	p.E11933K		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	11935	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTGGAAAATTCTGGGGGTCCA	0.493																																						dbGAP											0													130.0	123.0	125.0					19																	9045834		1918	4127	6045	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.35797G>A	19.37:g.9045834C>T	ENSP00000381008:p.Glu11933Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.E11933K	ENST00000397910.4	37	c.35797	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	C	12.49	1.954732	0.34471	.	.	ENSG00000181143	ENST00000397910	T	0.02158	4.42	3.79	3.79	0.43588	.	.	.	.	.	T	0.05090	0.0136	N	0.24115	0.695	.	.	.	D	0.64830	0.994	D	0.62955	0.909	T	0.37911	-0.9685	8	0.87932	D	0	.	11.459	0.50199	0.0:1.0:0.0:0.0	.	11933	B5ME49	.	K	11933	ENSP00000381008:E11933K	ENSP00000381008:E11933K	E	-	1	0	MUC16	8906834	0.002000	0.14202	0.015000	0.15790	0.184000	0.23303	1.111000	0.31159	2.417000	0.82017	0.555000	0.69702	GAA	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	314	0.32	1	C	NM_024690		9045834	9045834	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	222	20.57	58	SNP	0.019	T
MUC16	94025	genome.wustl.edu	37	19	9075373	9075373	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:9075373C>T	ENST00000397910.4	-	3	12276	c.12073G>A	c.(12073-12075)Gac>Aac	p.D4025N		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	4027	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						GAGCTGGTGTCCATGTAAGGG	0.463																																						dbGAP											0													103.0	99.0	100.0					19																	9075373		2061	4191	6252	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.12073G>A	19.37:g.9075373C>T	ENSP00000381008:p.Asp4025Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.D4025N	ENST00000397910.4	37	c.12073	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	c	6.675	0.493022	0.12702	.	.	ENSG00000181143	ENST00000397910	T	0.02944	4.1	2.18	-3.57	0.04612	.	.	.	.	.	T	0.01489	0.0048	N	0.08118	0	.	.	.	B	0.17268	0.021	B	0.13407	0.009	T	0.46162	-0.9211	8	0.87932	D	0	.	3.718	0.08445	0.0:0.2811:0.2061:0.5128	.	4025	B5ME49	.	N	4025	ENSP00000381008:D4025N	ENSP00000381008:D4025N	D	-	1	0	MUC16	8936373	0.000000	0.05858	0.000000	0.03702	0.031000	0.12232	-1.740000	0.01839	-0.827000	0.04278	0.313000	0.20887	GAC	MUC16	-	NULL	ENSG00000181143		0.463	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	179	0.00	0	C	NM_024690		9075373	9075373	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	154	21.03	41	SNP	0.000	T
MYO10	4651	genome.wustl.edu	37	5	16670938	16670938	+	Silent	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:16670938G>C	ENST00000513610.1	-	39	6034	c.5580C>G	c.(5578-5580)ctC>ctG	p.L1860L	MYO10_ENST00000427430.2_Silent_p.L1217L|MYO10_ENST00000515803.1_Silent_p.L1199L|MYO10_ENST00000505695.1_Silent_p.L1199L|MYO10_ENST00000274203.9_Silent_p.L1217L	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	1860	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						TGCGGGCCTTGAGTCTCTGCA	0.582																																						dbGAP											0													46.0	49.0	48.0					5																	16670938		1956	4147	6103	-	-	-	SO:0001819	synonymous_variant	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.5580C>G	5.37:g.16670938G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.L1860	ENST00000513610.1	37	c.5580	CCDS54834.1	5																																																																																			MYO10	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000145555		0.582	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1	119	0.00	0	G	NM_012334		16670938	16670938	-1	no_errors	ENST00000513610	ensembl	human	known	69_37n	silent	70	37.50	42	SNP	0.991	C
MYO6	4646	genome.wustl.edu	37	6	76576321	76576321	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:76576321G>C	ENST00000369977.3	+	17	1892	c.1753G>C	c.(1753-1755)Gca>Cca	p.A585P	MYO6_ENST00000369981.3_Missense_Mutation_p.A585P|RNA5SP209_ENST00000411237.1_RNA|snoU13_ENST00000459013.1_RNA|MYO6_ENST00000369985.4_Missense_Mutation_p.A585P|MYO6_ENST00000369975.1_Missense_Mutation_p.A585P	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	585	Myosin motor.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		TTTTGCGGGGGCAGTGTGCTA	0.393																																						dbGAP											0													97.0	94.0	95.0					6																	76576321		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.1753G>C	6.37:g.76576321G>C	ENSP00000358994:p.Ala585Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.A585P	ENST00000369977.3	37	c.1753	CCDS34487.1	6	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901309	0.92035	.	.	ENSG00000196586	ENST00000428345;ENST00000369981;ENST00000369985;ENST00000369977;ENST00000369975	D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.90239	0.6948	L	0.47016	1.485	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.81914	0.966;0.995	D	0.87991	0.2749	10	0.38643	T	0.18	.	20.024	0.97514	0.0:0.0:1.0:0.0	.	585;585	Q9UM54-2;Q9UM54-1	.;.	P	585	ENSP00000358998:A585P;ENSP00000359002:A585P;ENSP00000358994:A585P;ENSP00000358992:A585P	ENSP00000358992:A585P	A	+	1	0	MYO6	76633041	1.000000	0.71417	0.999000	0.59377	0.851000	0.48451	7.482000	0.81143	2.809000	0.96659	0.655000	0.94253	GCA	MYO6	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000196586		0.393	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	349	0.00	0	G	NM_004999		76576321	76576321	+1	no_errors	ENST00000369981	ensembl	human	known	69_37n	missense	176	36.00	99	SNP	1.000	C
NAGPA	51172	genome.wustl.edu	37	16	5075523	5075523	+	Missense_Mutation	SNP	C	C	G	rs201559606		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:5075523C>G	ENST00000312251.3	-	10	1523	c.1504G>C	c.(1504-1506)Gag>Cag	p.E502Q	NAGPA_ENST00000381955.3_Missense_Mutation_p.E468Q|RP11-165E7.1_ENST00000588778.1_RNA	NM_016256.3	NP_057340.2	Q9UK23	NAGPA_HUMAN	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase	502					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|lysosome organization (GO:0007040)|protein glycosylation (GO:0006486)|protein targeting to lysosome (GO:0006622)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylglucosamine-1-phosphodiester alpha-N-acetylglucosaminidase activity (GO:0003944)			endometrium(4)|large_intestine(4)|lung(3)|urinary_tract(1)	12					N-Acetyl-D-glucosamine(DB00141)	TGCTCCTTCTCTGCGGCCAGA	0.647																																						dbGAP											0													89.0	102.0	97.0					16																	5075523		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF187072	CCDS10527.1	16p13.3	2008-02-05			ENSG00000103174	ENSG00000103174	3.1.4.45		17378	protein-coding gene	gene with protein product		607985				10551838, 12058031	Standard	NM_016256		Approved	APAA, UCE	uc002cyg.3	Q9UK23	OTTHUMG00000090515	ENST00000312251.3:c.1504G>C	16.37:g.5075523C>G	ENSP00000310998:p.Glu502Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAS1|Q96EJ8	Missense_Mutation	SNP	pfam_DUF2233,pfscan_EG-like_dom	p.E502Q	ENST00000312251.3	37	c.1504	CCDS10527.1	16	.	.	.	.	.	.	.	.	.	.	C	18.72	3.684705	0.68157	.	.	ENSG00000103174	ENST00000312251;ENST00000381955	T;T	0.39787	1.06;1.12	5.18	5.18	0.71444	.	0.290293	0.32687	N	0.005766	T	0.57475	0.2056	L	0.59436	1.845	0.31703	N	0.640548	D;P	0.76494	0.999;0.939	D;P	0.63488	0.915;0.662	T	0.64011	-0.6507	10	0.48119	T	0.1	-16.4084	14.199	0.65690	0.0:1.0:0.0:0.0	.	502;468	Q9UK23;Q9UK23-2	NAGPA_HUMAN;.	Q	502;468	ENSP00000310998:E502Q;ENSP00000371381:E468Q	ENSP00000310998:E502Q	E	-	1	0	NAGPA	5015524	0.948000	0.32251	0.990000	0.47175	0.440000	0.31957	2.020000	0.41010	2.422000	0.82143	0.561000	0.74099	GAG	NAGPA	-	NULL	ENSG00000103174		0.647	NAGPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAGPA	HGNC	protein_coding	OTTHUMT00000207003.1	62	0.00	0	C	NM_016256		5075523	5075523	-1	no_errors	ENST00000312251	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.991	G
NARF	26502	genome.wustl.edu	37	17	80441612	80441612	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:80441612G>A	ENST00000309794.11	+	8	988	c.790G>A	c.(790-792)Gag>Aag	p.E264K	NARF_ENST00000390006.4_Missense_Mutation_p.E205K|NARF_ENST00000345415.7_Missense_Mutation_p.E216K|NARF_ENST00000412079.2_Missense_Mutation_p.E136K|NARF_ENST00000457415.3_Missense_Mutation_p.E310K|NARF-IT1_ENST00000584012.1_RNA	NM_012336.3|NM_031968.2	NP_036468.1|NP_114174.1	Q9UHQ1	NARF_HUMAN	nuclear prelamin A recognition factor	264						lamin filament (GO:0005638)|nuclear lamina (GO:0005652)|nuclear lumen (GO:0031981)|nucleus (GO:0005634)	lamin binding (GO:0005521)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	24	Breast(20;0.00106)|all_neural(118;0.0804)		OV - Ovarian serous cystadenocarcinoma(97;0.0143)|BRCA - Breast invasive adenocarcinoma(99;0.0369)			TCAAATAATGGAGCAAGGTGA	0.522																																						dbGAP											0													132.0	118.0	123.0					17																	80441612		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000438	CCDS32777.1, CCDS42403.1, CCDS42404.1	17q25.3	2011-12-19			ENSG00000141562	ENSG00000141562			29916	protein-coding gene	gene with protein product	"""iron-only hydrogenase-like protein 2"""	605349				10514485, 15667261	Standard	NM_031968		Approved	FLJ10067, DKFZp434G0420, IOP2	uc002kfg.4	Q9UHQ1		ENST00000309794.11:c.790G>A	17.37:g.80441612G>A	ENSP00000309899:p.Glu264Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCJ3|B3KPX2|K4DI98|Q96AY9|Q9BWC6	Missense_Mutation	SNP	pfam_Fe_hydrogenase_lsu_C,pfam_Fe_hydrogenase_ssu-like,superfamily_Fe_hydrogenase,smart_Fe_hydrogenase_ssu-like	p.E264K	ENST00000309794.11	37	c.790	CCDS32777.1	17	.	.	.	.	.	.	.	.	.	.	.	13.04	2.117679	0.37339	.	.	ENSG00000141562	ENST00000390006;ENST00000374611;ENST00000309794;ENST00000345415;ENST00000412079;ENST00000457415	T;T;T;T	0.39787	1.06;1.06;1.06;1.06	5.06	5.06	0.68205	Iron hydrogenase, large subunit, C-terminal (1);Iron hydrogenase (1);	0.095927	0.64402	D	0.000001	T	0.41096	0.1144	N	0.16790	0.44	0.54753	D	0.999989	B;D;D;P;D	0.59767	0.42;0.986;0.982;0.806;0.975	B;P;P;P;P	0.61533	0.326;0.839;0.89;0.788;0.861	T	0.09885	-1.0654	10	0.02654	T	1	-6.6295	17.162	0.86806	0.0:0.0:1.0:0.0	.	136;310;216;311;264	B4DZZ6;Q9UHQ1-2;Q9UHQ1-3;E9PH27;Q9UHQ1	.;.;.;.;NARF_HUMAN	K	205;311;264;216;136;265	ENSP00000374656:E205K;ENSP00000309899:E264K;ENSP00000283996:E216K;ENSP00000409710:E136K	ENSP00000309899:E264K	E	+	1	0	NARF	78034901	1.000000	0.71417	1.000000	0.80357	0.344000	0.29017	5.919000	0.70005	2.630000	0.89119	0.655000	0.94253	GAG	NARF	-	pfam_Fe_hydrogenase_lsu_C,superfamily_Fe_hydrogenase	ENSG00000141562		0.522	NARF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARF	HGNC	protein_coding	OTTHUMT00000443573.2	242	0.00	0	G	NM_031968		80441612	80441612	+1	no_errors	ENST00000309794	ensembl	human	known	69_37n	missense	144	24.21	46	SNP	1.000	A
NBEAL1	65065	genome.wustl.edu	37	2	203995183	203995183	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:203995183G>C	ENST00000449802.1	+	24	3794	c.3461G>C	c.(3460-3462)aGa>aCa	p.R1154T		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	1154										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GACAGACTAAGAGAAATCATT	0.358																																						dbGAP											0													100.0	76.0	83.0					2																	203995183		692	1591	2283	-	-	-	SO:0001583	missense	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.3461G>C	2.37:g.203995183G>C	ENSP00000399903:p.Arg1154Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R1154T	ENST00000449802.1	37	c.3461	CCDS46495.1	2	.	.	.	.	.	.	.	.	.	.	G	13.62	2.291090	0.40494	.	.	ENSG00000144426	ENST00000449802;ENST00000340268	T	0.29142	1.58	5.26	5.26	0.73747	.	.	.	.	.	T	0.31670	0.0804	L	0.55834	1.745	0.34849	D	0.74143	P	0.40144	0.704	B	0.41723	0.365	T	0.46020	-0.9221	9	0.49607	T	0.09	.	9.6254	0.39748	0.1575:0.0:0.8425:0.0	.	1154	Q6ZS30	NBEL1_HUMAN	T	1154	ENSP00000399903:R1154T	ENSP00000344985:R1154T	R	+	2	0	NBEAL1	203703428	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.407000	0.59754	2.598000	0.87819	0.557000	0.71058	AGA	NBEAL1	-	NULL	ENSG00000144426		0.358	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	235	0.00	0	G			203995183	203995183	+1	no_errors	ENST00000449802	ensembl	human	known	69_37n	missense	302	13.92	49	SNP	1.000	C
NCAPH2	29781	genome.wustl.edu	37	22	50961305	50961305	+	Missense_Mutation	SNP	G	G	A	rs567035246		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr22:50961305G>A	ENST00000420993.2	+	18	1603	c.1481G>A	c.(1480-1482)cGc>cAc	p.R494H	NCAPH2_ENST00000395701.3_Missense_Mutation_p.R494H|NCAPH2_ENST00000299821.11_Missense_Mutation_p.R495H|CTA-384D8.36_ENST00000608319.1_RNA	NM_001185011.1|NM_152299.3	NP_001171940.1|NP_689512.2	Q6IBW4	CNDH2_HUMAN	non-SMC condensin II complex, subunit H2	494					chromosome condensation (GO:0030261)|mitotic cell cycle (GO:0000278)	chromosome (GO:0005694)|membrane (GO:0016020)|nucleoplasm (GO:0005654)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|lung(10)|ovary(1)|prostate(2)|skin(3)|stomach(1)	24		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.212)		CTGAGCCAGCGCATCAGGGAC	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		18090	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													38.0	36.0	37.0					22																	50961305		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001937	CCDS14094.2, CCDS43038.1, CCDS54546.1	22q13.33	2008-02-04			ENSG00000025770	ENSG00000025770			25071	protein-coding gene	gene with protein product	"""kleisin beta"", ""CAP-H2 subunit of the condensin II complex"""	611230				10493829	Standard	NM_014551		Approved	384D8-2, hCAP-H2, CAP-H2	uc003blx.4	Q6IBW4	OTTHUMG00000150205	ENST00000420993.2:c.1481G>A	22.37:g.50961305G>A	ENSP00000410088:p.Arg494His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPH1|O43788|Q13391|Q96C14|Q96GJ0|Q9BQ71|Q9BUT3|Q9BVD1	Missense_Mutation	SNP	pfam_Condensin_II_H2-like	p.R495H	ENST00000420993.2	37	c.1484	CCDS14094.2	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.30|15.30	2.792218|2.792218	0.50102|0.50102	.|.	.|.	ENSG00000025770|ENSG00000025770	ENST00000522304|ENST00000420993;ENST00000395701;ENST00000299821	.|.	.|.	.|.	5.24|5.24	4.23|4.23	0.50019|0.50019	.|.	.|0.246775	.|0.38005	.|N	.|0.001842	T|T	0.43344|0.43344	0.1243|0.1243	L|L	0.38838|0.38838	1.175|1.175	0.47511|0.47511	D|D	0.999447|0.999447	.|B;B;B	.|0.32800	.|0.333;0.108;0.385	.|B;B;B	.|0.26614	.|0.042;0.016;0.071	T|T	0.39375|0.39375	-0.9617|-0.9617	5|9	.|0.46703	.|T	.|0.11	-8.7767|-8.7767	9.978|9.978	0.41795|0.41795	0.1655:0.0:0.8345:0.0|0.1655:0.0:0.8345:0.0	.|.	.|495;472;494	.|Q6IBW4-4;Q6IBW4-2;Q6IBW4	.|.;.;CNDH2_HUMAN	T|H	51|494;494;495	.|.	.|ENSP00000299821:R495H	A|R	+|+	1|2	0|0	NCAPH2|NCAPH2	49308171|49308171	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.791000|0.791000	0.44710|0.44710	3.311000|3.311000	0.51919|0.51919	1.220000|1.220000	0.43490|0.43490	0.650000|0.650000	0.86243|0.86243	GCA|CGC	NCAPH2	-	pfam_Condensin_II_H2-like	ENSG00000025770		0.647	NCAPH2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NCAPH2	HGNC	protein_coding	OTTHUMT00000317012.1	37	0.00	0	G	NM_152299		50961305	50961305	+1	no_errors	ENST00000299821	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.998	A
NCOA2	10499	genome.wustl.edu	37	8	71069225	71069225	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:71069225G>A	ENST00000452400.2	-	11	1556	c.1375C>T	c.(1375-1377)Cag>Tag	p.Q459*	NCOA2_ENST00000524223.1_Intron	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	459					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			TTACTACCCTGAGGAGTGGTT	0.527			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""																																	dbGAP		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													158.0	153.0	154.0					8																	71069225		2004	4157	6161	-	-	-	SO:0001587	stop_gained	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1375C>T	8.37:g.71069225G>A	ENSP00000399968:p.Gln459*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CD2	Nonsense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.Q459*	ENST00000452400.2	37	c.1375	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	41	8.651742	0.98901	.	.	ENSG00000140396	ENST00000452400	.	.	.	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	20.3368	0.98748	0.0:0.0:1.0:0.0	.	.	.	.	X	459	.	ENSP00000399968:Q459X	Q	-	1	0	NCOA2	71231779	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.711000	0.84669	2.805000	0.96524	0.655000	0.94253	CAG	NCOA2	-	pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.527	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	491	0.00	0	G			71069225	71069225	-1	no_errors	ENST00000452400	ensembl	human	known	69_37n	nonsense	368	19.43	89	SNP	1.000	A
NEBL	10529	genome.wustl.edu	37	10	21134276	21134276	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr10:21134276C>G	ENST00000377122.4	-	12	1534	c.1138G>C	c.(1138-1140)Gag>Cag	p.E380Q	NEBL_ENST00000377159.4_Intron|NEBL_ENST00000417816.2_Intron	NM_006393.2	NP_006384.1	O76041	NEBL_HUMAN	nebulette	380					cardiac muscle thin filament assembly (GO:0071691)	extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|filamin binding (GO:0031005)|structural constituent of muscle (GO:0008307)|tropomyosin binding (GO:0005523)			NS(2)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(8)|stomach(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	70						ATCTCCTTCTCAAAATCCTCT	0.353																																						dbGAP											0													119.0	116.0	117.0					10																	21134276		2203	4299	6502	-	-	-	SO:0001583	missense	0			Y16241	CCDS7133.1, CCDS7134.1	10p12	2014-09-17			ENSG00000078114	ENSG00000078114			16932	protein-coding gene	gene with protein product		605491				9733644, 10470015	Standard	NM_213569		Approved		uc001iqi.3	O76041	OTTHUMG00000017788	ENST00000377122.4:c.1138G>C	10.37:g.21134276C>G	ENSP00000366326:p.Glu380Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ45|Q2TBD0|Q70I54|Q9UIC4	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_SH3_domain	p.E380Q	ENST00000377122.4	37	c.1138	CCDS7134.1	10	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381586	0.82792	.	.	ENSG00000078114	ENST00000377122	T	0.61510	0.1	5.95	5.95	0.96441	.	0.243308	0.39615	N	0.001303	T	0.79476	0.4452	M	0.87038	2.855	0.80722	D	1	D	0.56035	0.974	D	0.71184	0.972	T	0.80398	-0.1399	10	0.51188	T	0.08	.	17.3748	0.87389	0.0:1.0:0.0:0.0	.	380	O76041	NEBL_HUMAN	Q	380	ENSP00000366326:E380Q	ENSP00000366326:E380Q	E	-	1	0	NEBL	21174282	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	5.161000	0.64935	2.835000	0.97688	0.650000	0.86243	GAG	NEBL	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000078114		0.353	NEBL-004	KNOWN	basic|CCDS	protein_coding	NEBL	HGNC	protein_coding	OTTHUMT00000047113.1	351	0.00	0	C	NM_006393		21134276	21134276	-1	no_errors	ENST00000377122	ensembl	human	known	69_37n	missense	251	22.05	71	SNP	1.000	G
NEO1	4756	genome.wustl.edu	37	15	73428332	73428332	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:73428332G>A	ENST00000339362.5	+	6	1426	c.979G>A	c.(979-981)Gag>Aag	p.E327K	NEO1_ENST00000261908.6_Missense_Mutation_p.E327K|NEO1_ENST00000558964.1_Missense_Mutation_p.E327K|NEO1_ENST00000560262.1_Missense_Mutation_p.E327K			Q92859	NEO1_HUMAN	neogenin 1	327	Ig-like C2-type 3.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						TAATGGAAATGAGACAATTGA	0.373																																						dbGAP											0													119.0	117.0	118.0					15																	73428332		2198	4297	6495	-	-	-	SO:0001583	missense	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.979G>A	15.37:g.73428332G>A	ENSP00000341198:p.Glu327Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E327K	ENST00000339362.5	37	c.979	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	G	12.99	2.103618	0.37145	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T;T	0.68331	-0.32;-0.32	6.04	4.15	0.48705	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.256181	0.44688	N	0.000422	T	0.49898	0.1584	N	0.20807	0.61	0.30512	N	0.76935	B;B;B	0.06786	0.0;0.001;0.0	B;B;B	0.11329	0.001;0.006;0.002	T	0.51513	-0.8696	10	0.56958	D	0.05	-9.9743	9.5589	0.39357	0.1658:0.0:0.8342:0.0	.	327;327;327	B7ZKM9;B7ZKN0;Q92859	.;.;NEO1_HUMAN	K	327;45;327	ENSP00000341198:E327K;ENSP00000261908:E327K	ENSP00000261908:E327K	E	+	1	0	NEO1	71215385	1.000000	0.71417	1.000000	0.80357	0.709000	0.40893	2.477000	0.45180	0.862000	0.35528	0.561000	0.74099	GAG	NEO1	-	pfam_Ig_I-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000067141		0.373	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2	454	0.00	0	G	NM_002499		73428332	73428332	+1	no_errors	ENST00000261908	ensembl	human	known	69_37n	missense	293	19.28	70	SNP	1.000	A
NES	10763	genome.wustl.edu	37	1	156640299	156640299	+	Silent	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:156640299C>A	ENST00000368223.3	-	4	3813	c.3681G>T	c.(3679-3681)ccG>ccT	p.P1227P		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	1227	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)	p.P1227P(1)		central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CTTCCAGGATCGGGGTGTACG	0.627																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											78.0	80.0	79.0					1																	156640299		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.3681G>T	1.37:g.156640299C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00552|Q3LIF5|Q5SYZ6	Silent	SNP	pfam_F	p.P1227	ENST00000368223.3	37	c.3681	CCDS1151.1	1																																																																																			NES	-	NULL	ENSG00000132688		0.627	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	44	0.00	0	C	NM_006617		156640299	156640299	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	silent	49	19.67	12	SNP	0.000	A
B4GALNT3	283358	genome.wustl.edu	37	12	675158	675158	+	IGR	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:675158G>A	ENST00000266383.5	+	0	5068				NINJ2_ENST00000397265.3_Silent_p.L67L|NINJ2_ENST00000305108.4_Silent_p.L120L|NINJ2_ENST00000542920.1_Silent_p.L38L|NINJ2_ENST00000537416.1_Intron|NINJ2_ENST00000433832.2_Silent_p.L38L	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3						metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TGCAGGAGCAGAGAGAGGCTG	0.622																																						dbGAP											0													152.0	111.0	125.0					12																	675158		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283		12.37:g.675158G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNC1|Q8N7T6	Silent	SNP	pfam_Ninjurin	p.L120	ENST00000266383.5	37	c.358	CCDS8504.1	12																																																																																			NINJ2	-	pfam_Ninjurin	ENSG00000171840		0.622	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NINJ2	HGNC	protein_coding	OTTHUMT00000251406.2	155	0.00	0	G	NM_173593		675158	675158	-1	no_errors	ENST00000305108	ensembl	human	known	69_37n	silent	125	17.76	27	SNP	1.000	A
NKAP	79576	genome.wustl.edu	37	X	119059227	119059227	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:119059227G>A	ENST00000371410.3	-	9	1370	c.1204C>T	c.(1204-1206)Cga>Tga	p.R402*	NKAP_ENST00000477789.1_5'UTR|RP3-327A19.5_ENST00000455986.1_RNA|AC002477.1_ENST00000581061.1_RNA	NM_024528.3	NP_078804.2	Q8N5F7	NKAP_HUMAN	NFKB activating protein	402	Necessary for interaction with HDAC3 and transcriptional repression.				granulocyte differentiation (GO:0030851)|hematopoietic stem cell proliferation (GO:0071425)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|stem cell maintenance (GO:0019827)|T cell differentiation in thymus (GO:0033077)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|prostate(1)	20						ACCATTTCTCGAAAACTGGCC	0.388																																						dbGAP											0													171.0	158.0	162.0					X																	119059227		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC012770	CCDS14592.1	Xq24	2010-07-20			ENSG00000101882	ENSG00000101882			29873	protein-coding gene	gene with protein product	"""NF kappaB activating protein"""	300766				14550261	Standard	NM_024528		Approved	FLJ22626	uc004esh.3	Q8N5F7	OTTHUMG00000022284	ENST00000371410.3:c.1204C>T	X.37:g.119059227G>A	ENSP00000360464:p.Arg402*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPW6|Q96BQ2|Q9H638	Nonsense_Mutation	SNP	pfam_DUF926	p.R402*	ENST00000371410.3	37	c.1204	CCDS14592.1	X	.	.	.	.	.	.	.	.	.	.	G	38	6.664284	0.97747	.	.	ENSG00000101882	ENST00000371410	.	.	.	5.74	3.79	0.43588	.	0.094641	0.64402	D	0.000001	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.7154	12.5704	0.56334	0.0:0.0:0.664:0.336	.	.	.	.	X	402	.	ENSP00000360464:R402X	R	-	1	2	NKAP	118943255	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	4.141000	0.58038	2.432000	0.82394	0.600000	0.82982	CGA	NKAP	-	pfam_DUF926	ENSG00000101882		0.388	NKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKAP	HGNC	protein_coding	OTTHUMT00000058072.1	379	0.00	0	G	NM_024528		119059227	119059227	-1	no_errors	ENST00000371410	ensembl	human	known	69_37n	nonsense	228	41.73	164	SNP	1.000	A
NME7	29922	genome.wustl.edu	37	1	169102038	169102038	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:169102038C>G	ENST00000367811.3	-	12	1372	c.1116G>C	c.(1114-1116)aaG>aaC	p.K372N	NME7_ENST00000472647.1_Missense_Mutation_p.K336N	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	372					brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					TATCCAAGATCTTGAAGAAGT	0.373																																						dbGAP											0													123.0	110.0	114.0					1																	169102038		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.1116G>C	1.37:g.169102038C>G	ENSP00000356785:p.Lys372Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Missense_Mutation	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.K372N	ENST00000367811.3	37	c.1116	CCDS1277.1	1	.	.	.	.	.	.	.	.	.	.	C	14.70	2.613159	0.46631	.	.	ENSG00000143156	ENST00000472647;ENST00000367811	T;T	0.56103	0.48;0.48	6.17	6.17	0.99709	.	1.226390	0.05733	N	0.599898	T	0.33381	0.0861	L	0.37850	1.14	0.37103	D	0.899989	B	0.23990	0.095	B	0.19946	0.027	T	0.03306	-1.1050	9	0.28530	T	0.3	-15.195	17.0531	0.86525	0.0:0.8734:0.1266:0.0	.	372	Q9Y5B8	NDK7_HUMAN	N	336;372	ENSP00000433341:K336N;ENSP00000356785:K372N	ENSP00000356785:K372N	K	-	3	2	NME7	167368662	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.301000	0.65727	2.941000	0.99782	0.655000	0.94253	AAG	NME7	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,pirsf_NDK7	ENSG00000143156		0.373	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	209	0.00	0	C	NM_013330		169102038	169102038	-1	no_errors	ENST00000367811	ensembl	human	known	69_37n	missense	288	13.25	44	SNP	1.000	G
NOP2	4839	genome.wustl.edu	37	12	6677069	6677069	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:6677069C>G	ENST00000322166.5	-	2	137	c.16G>C	c.(16-18)Gac>Cac	p.D6H	NOP2_ENST00000382421.3_Missense_Mutation_p.D6H|NOP2_ENST00000537442.1_Missense_Mutation_p.D6H|NOP2_ENST00000540228.1_Missense_Mutation_p.D6H|NOP2_ENST00000545200.1_Missense_Mutation_p.D6H|NOP2_ENST00000399466.2_Missense_Mutation_p.D6H|NOP2_ENST00000542015.1_5'UTR|NOP2_ENST00000541778.1_Missense_Mutation_p.D6H|NOP2_ENST00000545915.1_Missense_Mutation_p.D6H	NM_001258308.1|NM_006170.3	NP_001245237.1|NP_006161.2	P46087	NOP2_HUMAN	NOP2 nucleolar protein	6					positive regulation of cell proliferation (GO:0008284)|rRNA processing (GO:0006364)	nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|kidney(2)|large_intestine(5)|lung(8)|ovary(2)|upper_aerodigestive_tract(1)	19						TTCGTAGGGTCCAACTTGCGC	0.592																																						dbGAP											0													56.0	60.0	59.0					12																	6677069		1982	4159	6141	-	-	-	SO:0001583	missense	0				CCDS44811.1, CCDS58202.1, CCDS58203.1, CCDS58204.1	12p13	2012-12-10	2012-12-10	2008-10-13	ENSG00000111641	ENSG00000111641		"""NOP2/Sun domain containing"""	7867	protein-coding gene	gene with protein product	"""NOP2/Sun domain family, member 1"""	164031	"""nucleolar protein 1 (120kD)"", ""nucleolar protein 1, 120kDa"", ""nucleolar protein 2 homolog (yeast)"", ""NOP2 nucleolar protein homolog (yeast)"""	NOL1		8088812	Standard	NM_006170		Approved	NOP120, NSUN1, p120	uc021qtz.2	P46087	OTTHUMG00000169163	ENST00000322166.5:c.16G>C	12.37:g.6677069C>G	ENSP00000313272:p.Asp6His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4Z3|B3KPD6|Q05BA7|Q0P5S5|Q3KQS4|Q58F30	Missense_Mutation	SNP	pfam_Fmu/NOL1/Nop2p,pfam_P120R,pfam_rRNA_MeTrfase_FtsJ_dom,prints_RCMT,prints_RCMT_NOP2,tigrfam_Nop2p	p.D6H	ENST00000322166.5	37	c.16	CCDS58203.1	12	.	.	.	.	.	.	.	.	.	.	C	18.18	3.567283	0.65651	.	.	ENSG00000111641	ENST00000537442;ENST00000382421;ENST00000545200;ENST00000399466;ENST00000322166;ENST00000541778;ENST00000542867;ENST00000536124;ENST00000545492;ENST00000545915;ENST00000540228	T;T;T;T;T;T;T;T;T;T;T	0.70282	1.4;0.61;1.76;1.38;1.4;1.38;-0.46;-0.41;-0.47;-0.27;-0.27	4.57	4.57	0.56435	.	0.000000	0.85682	D	0.000000	D	0.83912	0.5357	M	0.76002	2.32	0.53688	D	0.99997	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.86232	0.1638	10	0.72032	D	0.01	-25.4966	17.5817	0.87970	0.0:1.0:0.0:0.0	.	6;6	Q3KQS4;P46087-2	.;.	H	6	ENSP00000444437:D6H;ENSP00000371858:D6H;ENSP00000439422:D6H;ENSP00000382392:D6H;ENSP00000313272:D6H;ENSP00000443150:D6H;ENSP00000443035:D6H;ENSP00000442895:D6H;ENSP00000441923:D6H;ENSP00000442742:D6H;ENSP00000445402:D6H	ENSP00000313272:D6H	D	-	1	0	NOP2	6547330	1.000000	0.71417	1.000000	0.80357	0.077000	0.17291	6.396000	0.73234	2.376000	0.81061	0.655000	0.94253	GAC	NOP2	-	NULL	ENSG00000111641		0.592	NOP2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NOP2	HGNC	protein_coding	OTTHUMT00000402614.1	79	0.00	0	C	NM_006170		6677069	6677069	-1	no_errors	ENST00000322166	ensembl	human	known	69_37n	missense	52	30.67	23	SNP	1.000	G
NRCAM	4897	genome.wustl.edu	37	7	107820851	107820851	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:107820851C>T	ENST00000425651.2	-	22	2666	c.2667G>A	c.(2665-2667)caG>caA	p.Q889Q	NRCAM_ENST00000379028.3_Silent_p.Q889Q|NRCAM_ENST00000379024.4_Silent_p.Q870Q|NRCAM_ENST00000379022.4_Silent_p.Q889Q|NRCAM_ENST00000351718.4_Silent_p.Q873Q|NRCAM_ENST00000413765.2_Silent_p.Q870Q	NM_001037132.2	NP_001032209.1	Q92823	NRCAM_HUMAN	neuronal cell adhesion molecule	889	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis (GO:0007409)|central nervous system development (GO:0007417)|clustering of voltage-gated sodium channels (GO:0045162)|heterotypic cell-cell adhesion (GO:0034113)|neuron migration (GO:0001764)|neuronal action potential propagation (GO:0019227)|positive regulation of neuron differentiation (GO:0045666)|protein localization (GO:0008104)|regulation of axon extension (GO:0030516)|retinal ganglion cell axon guidance (GO:0031290)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)	axon initial segment (GO:0043194)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ankyrin binding (GO:0030506)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(1)|lung(36)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(4)	65						TAGATGAACTCTGGGTCTTCC	0.433																																						dbGAP											0													67.0	62.0	64.0					7																	107820851		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5751.1, CCDS47686.1, CCDS55153.1, CCDS75652.1	7q31	2013-02-11			ENSG00000091129	ENSG00000091129		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7994	protein-coding gene	gene with protein product	"""NgCAM-related cell adhesion molecule"""	601581				8812479	Standard	NM_001037132		Approved	KIAA0343, Bravo	uc022aka.1	Q92823	OTTHUMG00000154973	ENST00000425651.2:c.2667G>A	7.37:g.107820851C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0S3|E9PDA4|O15051|O15179|Q14BM2|Q9UHI3|Q9UHI4	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q889	ENST00000425651.2	37	c.2667	CCDS47686.1	7																																																																																			NRCAM	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000091129		0.433	NRCAM-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NRCAM	HGNC	protein_coding	OTTHUMT00000337942.2	188	0.00	0	C	NM_001037132		107820851	107820851	-1	no_errors	ENST00000379028	ensembl	human	known	69_37n	silent	132	16.46	26	SNP	0.000	T
NTAN1	123803	genome.wustl.edu	37	16	15135525	15135525	+	Missense_Mutation	SNP	C	C	G	rs200102960		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:15135525C>G	ENST00000287706.3	-	6	534	c.442G>C	c.(442-444)Gac>Cac	p.D148H	PDXDC1_ENST00000535621.2_Intron	NM_001270766.1|NM_173474.3	NP_001257695.1|NP_775745.1	Q96AB6	NTAN1_HUMAN	N-terminal asparagine amidase	148					adult locomotory behavior (GO:0008344)|memory (GO:0007613)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein-N-terminal asparagine amidohydrolase activity (GO:0008418)			endometrium(1)|large_intestine(4)|lung(3)	8						TCTTGCCTGTCAAATTCACCT	0.453																																						dbGAP											0													171.0	162.0	165.0					16																	15135525		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF092440	CCDS10558.1, CCDS73832.1	16p13	2008-02-05			ENSG00000157045	ENSG00000157045			29909	protein-coding gene	gene with protein product		615367				8910481	Standard	NM_173474		Approved		uc002ddd.4	Q96AB6	OTTHUMG00000129849	ENST00000287706.3:c.442G>C	16.37:g.15135525C>G	ENSP00000287706:p.Asp148His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4Z0	Missense_Mutation	SNP	NULL	p.D148H	ENST00000287706.3	37	c.442	CCDS10558.1	16	.	.	.	.	.	.	.	.	.	.	C	12.33	1.906926	0.33628	.	.	ENSG00000157045	ENST00000287706	T	0.28454	1.61	5.82	5.82	0.92795	.	0.124538	0.56097	D	0.000025	T	0.24509	0.0594	N	0.25789	0.76	0.51482	D	0.999923	B	0.25351	0.124	B	0.31495	0.131	T	0.04752	-1.0929	10	0.08381	T	0.77	-23.1659	17.2587	0.87064	0.0:1.0:0.0:0.0	.	148	Q96AB6	NTAN1_HUMAN	H	148	ENSP00000287706:D148H	ENSP00000287706:D148H	D	-	1	0	NTAN1	15043026	1.000000	0.71417	1.000000	0.80357	0.594000	0.36715	3.521000	0.53472	2.756000	0.94617	0.655000	0.94253	GAC	NTAN1	-	NULL	ENSG00000157045		0.453	NTAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTAN1	HGNC	protein_coding	OTTHUMT00000252089.1	228	0.00	0	C	NM_173474		15135525	15135525	-1	no_errors	ENST00000287706	ensembl	human	known	69_37n	missense	214	15.89	41	SNP	1.000	G
NTSR1	4923	genome.wustl.edu	37	20	61340967	61340967	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:61340967C>T	ENST00000370501.3	+	1	779	c.408C>T	c.(406-408)ttC>ttT	p.F136F		NM_002531.2	NP_002522.2	P30989	NTR1_HUMAN	neurotensin receptor 1 (high affinity)	136					adult locomotory behavior (GO:0008344)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of apoptotic process (GO:0043066)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	G-protein coupled neurotensin receptor activity (GO:0016492)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(16)|prostate(1)|skin(3)	27	Breast(26;3.65e-08)		BRCA - Breast invasive adenocarcinoma(19;3.63e-06)			CCTGGGCCTTCGGCGACGCCG	0.687																																					GBM(37;400 780 6403 19663 35669)	dbGAP											0													42.0	48.0	46.0					20																	61340967		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS13502.1	20q13	2012-08-08			ENSG00000101188	ENSG00000101188		"""GPCR / Class A : Neurotensin receptors"""	8039	protein-coding gene	gene with protein product		162651				8075503	Standard	NM_002531		Approved	NTR	uc002ydf.3	P30989	OTTHUMG00000032932	ENST00000370501.3:c.408C>T	20.37:g.61340967C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4H1|Q9H4T5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_NT1_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NT_rcpt,prints_P2_purnocptor	p.F136	ENST00000370501.3	37	c.408	CCDS13502.1	20																																																																																			NTSR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_NT_rcpt	ENSG00000101188		0.687	NTSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NTSR1	HGNC	protein_coding	OTTHUMT00000080061.1	32	0.00	0	C			61340967	61340967	+1	no_errors	ENST00000370501	ensembl	human	known	69_37n	silent	23	28.12	9	SNP	0.982	T
TENM1	10178	genome.wustl.edu	37	X	123556288	123556288	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:123556288C>T	ENST00000371130.3	-	23	4347	c.4284G>A	c.(4282-4284)gcG>gcA	p.A1428A	TENM1_ENST00000422452.2_Silent_p.A1435A|STAG2_ENST00000469481.1_3'UTR	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1428					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TGATGGCCCTCGCTGACTCTA	0.537																																						dbGAP											0													127.0	102.0	111.0					X																	123556288		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4284G>A	X.37:g.123556288C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.A1435	ENST00000371130.3	37	c.4305	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.537	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	173	0.00	0	C	NM_014253		123556288	123556288	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	114	25.00	38	SNP	0.787	T
TENM3	55714	genome.wustl.edu	37	4	183635307	183635307	+	Silent	SNP	G	G	A	rs571918644		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:183635307G>A	ENST00000511685.1	+	13	2412	c.2289G>A	c.(2287-2289)gtG>gtA	p.V763V	TENM3_ENST00000406950.2_Silent_p.V763V|TENM3_ENST00000502950.1_3'UTR			Q9P273	TEN3_HUMAN	teneurin transmembrane protein 3	763	EGF-like 8. {ECO:0000255|PROSITE- ProRule:PRU00076}.				camera-type eye morphogenesis (GO:0048593)|homophilic cell adhesion (GO:0007156)|positive regulation of neuron projection development (GO:0010976)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										GGCATTGTGTGTGCCAGCCTG	0.493													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18465	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													104.0	104.0	104.0					4																	183635307		2043	4199	6242	-	-	-	SO:0001819	synonymous_variant	0			AF195420	CCDS47165.1	4q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000218336	ENSG00000218336			29944	protein-coding gene	gene with protein product		610083	"""odz, odd Oz/ten-m homolog 3 (Drosophila)"""	ODZ3		10331952, 10625539	Standard	NM_001080477		Approved	Ten-M3, KIAA1455	uc003ivd.1	Q9P273	OTTHUMG00000160682	ENST00000511685.1:c.2289G>A	4.37:g.183635307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XUL9|Q96SY2|Q9NV77|Q9NVW1|Q9NZJ2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Cyt_c_dom,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.V763	ENST00000511685.1	37	c.2289	CCDS47165.1	4																																																																																			ODZ3	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000218336		0.493	TENM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ3	HGNC	protein_coding	OTTHUMT00000361734.1	159	0.00	0	G			183635307	183635307	+1	no_errors	ENST00000406950	ensembl	human	known	69_37n	silent	126	17.65	27	SNP	0.724	A
OFD1	8481	genome.wustl.edu	37	X	13778539	13778539	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:13778539C>G	ENST00000340096.6	+	16	2287	c.1960C>G	c.(1960-1962)Cgg>Ggg	p.R654G	OFD1_ENST00000380550.3_Missense_Mutation_p.R614G|OFD1_ENST00000380567.1_Missense_Mutation_p.R514G|OFD1_ENST00000490265.1_3'UTR	NM_003611.2	NP_003602.1	O75665	OFD1_HUMAN	oral-facial-digital syndrome 1	654	Mediates homooligomerization.|Mediates the interaction with SDCCAG8.				axoneme assembly (GO:0035082)|cilium morphogenesis (GO:0060271)|embryonic body morphogenesis (GO:0010172)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)	centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|gamma-tubulin binding (GO:0043015)	p.R654W(1)		breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	25						AAGTTACCATCGGAGAGTCAT	0.478																																						dbGAP											1	Substitution - Missense(1)	lung(1)											70.0	70.0	70.0					X																	13778539		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y15164	CCDS14157.1	Xp22	2014-06-18			ENSG00000046651	ENSG00000046651			2567	protein-coding gene	gene with protein product		300170	"""retinitis pigmentosa 23 (X-linked recessive)"""	CXorf5, RP23		9722947, 9215688, 22619378	Standard	NM_003611		Approved	71-7A, JBTS10	uc004cvp.4	O75665	OTTHUMG00000021159	ENST00000340096.6:c.1960C>G	X.37:g.13778539C>G	ENSP00000344314:p.Arg654Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVU5|O75666|Q4VAK4	Missense_Mutation	SNP	superfamily_Lipoprotein_6,smart_LisH_dimerisation,pfscan_LisH_dimerisation	p.R654G	ENST00000340096.6	37	c.1960	CCDS14157.1	X	.	.	.	.	.	.	.	.	.	.	.	17.17	3.320985	0.60634	.	.	ENSG00000046651	ENST00000380550;ENST00000340096;ENST00000380567	D;D;D	0.95756	-3.8;-3.79;-1.68	5.67	4.8	0.61643	.	1.117180	0.06736	N	0.777568	D	0.93546	0.7940	L	0.43152	1.355	0.36496	D	0.868747	P;P;P;P;P	0.43578	0.811;0.811;0.6;0.6;0.811	B;B;B;B;B	0.41723	0.365;0.365;0.247;0.247;0.365	D	0.87078	0.2164	10	0.40728	T	0.16	2.6779	10.8217	0.46608	0.1467:0.7151:0.1382:0.0	.	654;614;322;514;654	A8K2T9;O75665-3;B4DLQ3;A6NF31;O75665	.;.;.;.;OFD1_HUMAN	G	614;654;514	ENSP00000369923:R614G;ENSP00000344314:R654G;ENSP00000369941:R514G	ENSP00000344314:R654G	R	+	1	2	OFD1	13688460	0.012000	0.17670	0.005000	0.12908	0.790000	0.44656	2.237000	0.43061	1.147000	0.42369	0.529000	0.55759	CGG	OFD1	-	NULL	ENSG00000046651		0.478	OFD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OFD1	HGNC	protein_coding	OTTHUMT00000055808.1	136	0.00	0	C	NM_003611		13778539	13778539	+1	no_errors	ENST00000340096	ensembl	human	known	69_37n	missense	95	21.49	26	SNP	0.118	G
OR1A1	8383	genome.wustl.edu	37	17	3119721	3119721	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:3119721C>T	ENST00000304094.1	+	1	807	c.807C>T	c.(805-807)gaC>gaT	p.D269D		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						GCCTAAAAGACGCAGTGATCA	0.478																																						dbGAP											0													153.0	135.0	141.0					17																	3119721		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.807C>T	17.37:g.3119721C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D914|Q6IFM1|Q6NTA9|Q96R87	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.D269	ENST00000304094.1	37	c.807	CCDS11022.1	17																																																																																			OR1A1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000172146		0.478	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	HGNC	protein_coding	OTTHUMT00000207292.1	167	0.00	0	C	NM_014565		3119721	3119721	+1	no_errors	ENST00000304094	ensembl	human	known	69_37n	silent	62	49.19	61	SNP	0.002	T
OR1S2	219958	genome.wustl.edu	37	11	57971065	57971065	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:57971065G>C	ENST00000302592.6	-	1	588	c.589C>G	c.(589-591)Ctg>Gtg	p.L197V		NM_001004459.1	NP_001004459.1	Q8NGQ3	OR1S2_HUMAN	olfactory receptor, family 1, subfamily S, member 2	197						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(11)|kidney(1)|large_intestine(4)|lung(23)|ovary(2)|skin(2)|stomach(2)|urinary_tract(1)	46		Breast(21;0.0589)				AGTTTGAGCAGAGGGGCCAAG	0.423																																						dbGAP											0													221.0	205.0	211.0					11																	57971065		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004297	CCDS31545.1	11q12.1	2012-08-09			ENSG00000197887	ENSG00000197887		"""GPCR / Class A : Olfactory receptors"""	15141	protein-coding gene	gene with protein product							Standard	NM_001004459		Approved		uc010rkb.2	Q8NGQ3	OTTHUMG00000167541	ENST00000302592.6:c.589C>G	11.37:g.57971065G>C	ENSP00000305469:p.Leu197Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFG5|Q96R85	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L197V	ENST00000302592.6	37	c.589	CCDS31545.1	11	.	.	.	.	.	.	.	.	.	.	G	9.420	1.082685	0.20309	.	.	ENSG00000197887	ENST00000302592	T	0.00076	8.76	4.75	3.83	0.44106	GPCR, rhodopsin-like superfamily (1);	0.201612	0.24654	N	0.036692	T	0.00144	0.0004	L	0.48174	1.505	0.09310	N	1	P	0.38863	0.65	P	0.45610	0.487	T	0.04900	-1.0919	10	0.05959	T	0.93	.	4.4703	0.11708	0.1832:0.0:0.6384:0.1784	.	197	Q8NGQ3	OR1S2_HUMAN	V	197	ENSP00000305469:L197V	ENSP00000305469:L197V	L	-	1	2	OR1S2	57727641	0.000000	0.05858	0.937000	0.37676	0.418000	0.31294	-0.562000	0.05950	1.348000	0.45733	0.655000	0.94253	CTG	OR1S2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000197887		0.423	OR1S2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S2	HGNC	protein_coding	OTTHUMT00000394703.2	543	0.00	0	G	NM_001004459		57971065	57971065	-1	no_errors	ENST00000302592	ensembl	human	known	69_37n	missense	114	67.97	244	SNP	0.039	C
OR2T27	403239	genome.wustl.edu	37	1	248813395	248813395	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:248813395G>C	ENST00000344889.3	-	1	790	c.791C>G	c.(790-792)tCt>tGt	p.S264C		NM_001001824.1	NP_001001824.1	Q8NH04	O2T27_HUMAN	olfactory receptor, family 2, subfamily T, member 27	264						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|endometrium(2)|large_intestine(4)|lung(20)|skin(3)|stomach(1)	32	all_cancers(71;1.15e-05)|all_epithelial(71;5.29e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.089)|Lung NSC(105;0.0969)|Melanoma(84;0.199)	all_cancers(173;0.237)	OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGTGTGGTAAGAATGAGGCAG	0.532																																						dbGAP											0													54.0	44.0	47.0					1																	248813395		2186	4270	6456	-	-	-	SO:0001583	missense	0				CCDS31124.1	1q44	2012-08-09			ENSG00000187701	ENSG00000187701		"""GPCR / Class A : Olfactory receptors"""	31252	protein-coding gene	gene with protein product							Standard	NM_001001824		Approved		uc010pzo.2	Q8NH04	OTTHUMG00000040376	ENST00000344889.3:c.791C>G	1.37:g.248813395G>C	ENSP00000342008:p.Ser264Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S264C	ENST00000344889.3	37	c.791	CCDS31124.1	1	.	.	.	.	.	.	.	.	.	.	.	6.418	0.445190	0.12164	.	.	ENSG00000187701	ENST00000344889	T	0.00277	8.34	3.27	3.27	0.37495	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39274	N	0.001416	T	0.00784	0.0026	H	0.94222	3.51	0.09310	N	1	D	0.89917	1.0	D	0.80764	0.994	T	0.25641	-1.0126	10	0.87932	D	0	.	6.2144	0.20648	0.0:0.2035:0.5878:0.2087	.	264	Q8NH04	O2T27_HUMAN	C	264	ENSP00000342008:S264C	ENSP00000342008:S264C	S	-	2	0	OR2T27	246880018	0.003000	0.15002	0.010000	0.14722	0.020000	0.10135	1.157000	0.31724	1.841000	0.53522	0.400000	0.26472	TCT	OR2T27	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187701		0.532	OR2T27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T27	HGNC	protein_coding	OTTHUMT00000097124.1	166	0.00	0	G	NM_001001824		248813395	248813395	-1	no_errors	ENST00000344889	ensembl	human	known	69_37n	missense	211	13.11	32	SNP	0.001	C
PARP2	10038	genome.wustl.edu	37	14	20824784	20824784	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:20824784G>A	ENST00000250416.5	+	13	1331	c.1304G>A	c.(1303-1305)tGg>tAg	p.W435*	PARP2_ENST00000429687.3_Nonsense_Mutation_p.W422*|PARP2_ENST00000527915.1_Nonsense_Mutation_p.W435*	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2	435	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		ATGAGTAACTGGGTGGGAATC	0.468								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																														dbGAP											0													277.0	264.0	268.0					14																	20824784		1923	4134	6057	-	-	-	SO:0001587	stop_gained	0			AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106	ENST00000250416.5:c.1304G>A	14.37:g.20824784G>A	ENSP00000250416:p.Trp435*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	Nonsense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.W435*	ENST00000250416.5	37	c.1304	CCDS41910.1	14	.	.	.	.	.	.	.	.	.	.	G	36	5.683067	0.96774	.	.	ENSG00000129484	ENST00000429687;ENST00000250416;ENST00000527915	.	.	.	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-8.8191	18.1605	0.89706	0.0:0.0:1.0:0.0	.	.	.	.	X	422;435;435	.	ENSP00000250416:W435X	W	+	2	0	PARP2	19894624	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.674000	0.61612	2.825000	0.97269	0.655000	0.94253	TGG	PARP2	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000129484		0.468	PARP2-002	KNOWN	basic|CCDS	protein_coding	PARP2	HGNC	protein_coding	OTTHUMT00000387847.2	342	0.00	0	G			20824784	20824784	+1	no_errors	ENST00000250416	ensembl	human	known	69_37n	nonsense	294	21.33	80	SNP	1.000	A
PABPN1	8106	genome.wustl.edu	37	14	23791462	23791462	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:23791462G>A	ENST00000216727.4	+	2	605	c.424G>A	c.(424-426)Gag>Aag	p.E142K	PABPN1_ENST00000557702.1_Missense_Mutation_p.E14K|BCL2L2-PABPN1_ENST00000553781.1_Missense_Mutation_p.E169K|PABPN1_ENST00000556821.1_Missense_Mutation_p.E14K|BCL2L2-PABPN1_ENST00000557008.1_Missense_Mutation_p.E169K|PABPN1_ENST00000397276.2_Missense_Mutation_p.E142K|AL049829.1_ENST00000594872.1_Missense_Mutation_p.S8L	NM_004643.3	NP_004634.1	Q86U42	PABP2_HUMAN	poly(A) binding protein, nuclear 1	142	Interacts with SKIP.|Stimulates PAPOLA. {ECO:0000250}.				gene expression (GO:0010467)|modification by virus of host mRNA processing (GO:0046778)|modulation by virus of host morphology or physiology (GO:0019048)|modulation by virus of host process (GO:0019054)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|muscle contraction (GO:0006936)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)|viral life cycle (GO:0019058)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			large_intestine(1)|lung(1)|ovary(2)	4	all_cancers(95;6.69e-06)			GBM - Glioblastoma multiforme(265;0.00643)		GCTACAGAACGAGGTAGAGAA	0.537																																						dbGAP											0													65.0	54.0	58.0					14																	23791462		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF026029	CCDS9592.1	14q11.2	2013-02-12	2001-11-28		ENSG00000100836	ENSG00000100836		"""RNA binding motif (RRM) containing"""	8565	protein-coding gene	gene with protein product		602279	"""poly(A)-binding protein, nuclear 1"""	OPMD, PABP2		7795598	Standard	NM_004643		Approved	PAB2		Q86U42	OTTHUMG00000028739	ENST00000216727.4:c.424G>A	14.37:g.23791462G>A	ENSP00000216727:p.Glu142Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS49|O43484	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E142K	ENST00000216727.4	37	c.424	CCDS9592.1	14	.	.	.	.	.	.	.	.	.	.	G	23.6	4.431656	0.83776	.	.	ENSG00000258643;ENSG00000258643;ENSG00000100836;ENSG00000100836;ENSG00000100836;ENSG00000100836	ENST00000553781;ENST00000557008;ENST00000216727;ENST00000397276;ENST00000556821;ENST00000557702	T;T;T;T;T;T	0.57273	3.0;3.0;0.41;0.81;2.27;2.28	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	T	0.50171	0.1600	N	0.20574	0.59	0.80722	D	1	B;P;D	0.59767	0.414;0.55;0.986	B;B;P	0.54431	0.126;0.249;0.752	T	0.40961	-0.9535	10	0.20519	T	0.43	-8.7349	17.331	0.87264	0.0:0.0:1.0:0.0	.	142;142;169	Q86U42;Q86U42-2;G3V5R7	PABP2_HUMAN;.;.	K	169;169;142;142;14;14	ENSP00000451320:E169K;ENSP00000452479:E169K;ENSP00000216727:E142K;ENSP00000380446:E142K;ENSP00000451970:E14K;ENSP00000450724:E14K	ENSP00000216727:E142K	E	+	1	0	PABPN1;RP11-124D2.2	22861302	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.114000	0.77103	2.462000	0.83206	0.561000	0.74099	GAG	PABPN1	-	NULL	ENSG00000100836		0.537	PABPN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PABPN1	HGNC	protein_coding	OTTHUMT00000071767.4	221	0.00	0	G	NM_004643		23791462	23791462	+1	no_errors	ENST00000216727	ensembl	human	known	69_37n	missense	180	16.82	37	SNP	1.000	A
PCDH18	54510	genome.wustl.edu	37	4	138451272	138451272	+	Missense_Mutation	SNP	G	G	C	rs190367774		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:138451272G>C	ENST00000344876.4	-	1	2357	c.1971C>G	c.(1969-1971)atC>atG	p.I657M	PCDH18_ENST00000507846.1_Missense_Mutation_p.I437M|PCDH18_ENST00000510305.1_Intron|PCDH18_ENST00000511115.1_Intron|PCDH18_ENST00000412923.2_Missense_Mutation_p.I657M	NM_019035.3	NP_061908.1	Q9HCL0	PCD18_HUMAN	protocadherin 18	657	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(27)|lung(21)|ovary(2)|pancreas(4)|prostate(3)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86	all_hematologic(180;0.24)					TGTCCTGAATGATAACTGACA	0.423																																						dbGAP											0													192.0	174.0	180.0					4																	138451272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137471	CCDS34064.1, CCDS75193.1	4q28.3	2010-01-26			ENSG00000189184	ENSG00000189184		"""Cadherins / Protocadherins : Non-clustered"""	14268	protein-coding gene	gene with protein product		608287				10835267, 11549318	Standard	XM_005263070		Approved	KIAA1562, PCDH68L	uc003ihe.4	Q9HCL0	OTTHUMG00000161348	ENST00000344876.4:c.1971C>G	4.37:g.138451272G>C	ENSP00000355082:p.Ile657Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7K3|B7ZKT1|Q52LS2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.I657M	ENST00000344876.4	37	c.1971	CCDS34064.1	4	.	.	.	.	.	.	.	.	.	.	G	8.335	0.827293	0.16749	.	.	ENSG00000189184	ENST00000344876;ENST00000412923;ENST00000507846	T;T;T	0.59906	0.23;0.23;0.23	5.93	1.86	0.25419	Cadherin (4);Cadherin-like (1);	0.567264	0.14010	N	0.347552	T	0.35624	0.0938	N	0.21583	0.68	0.80722	D	1	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.11329	0.001;0.006;0.003	T	0.34129	-0.9841	10	0.45353	T	0.12	.	0.7799	0.01039	0.2517:0.1134:0.3529:0.282	.	437;657;657	D6RIG4;Q9HCL0-2;Q9HCL0	.;.;PCD18_HUMAN	M	657;657;437	ENSP00000355082:I657M;ENSP00000390688:I657M;ENSP00000425903:I437M	ENSP00000355082:I657M	I	-	3	3	PCDH18	138670722	0.962000	0.33011	0.971000	0.41717	0.960000	0.62799	0.292000	0.19011	0.855000	0.35359	-0.253000	0.11424	ATC	PCDH18	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000189184		0.423	PCDH18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH18	HGNC	protein_coding	OTTHUMT00000364614.1	87	0.00	0	G	NM_019035		138451272	138451272	-1	no_errors	ENST00000344876	ensembl	human	known	69_37n	missense	56	18.84	13	SNP	0.634	C
PCDHA9	9752	genome.wustl.edu	37	5	140229695	140229695	+	Missense_Mutation	SNP	G	G	A	rs545192815		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:140229695G>A	ENST00000532602.1	+	1	2648	c.1615G>A	c.(1615-1617)Gac>Aac	p.D539N	PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA9_ENST00000378122.3_Missense_Mutation_p.D539N|PCDHA7_ENST00000525929.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA5_ENST00000529859.1_Intron	NM_031857.1	NP_114063.1	Q9Y5H5	PCDA9_HUMAN	protocadherin alpha 9	539	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(18)|ovary(4)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	59			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GAGCGCGCGCGACGCGGGCGT	0.672													.|||	1	0.000199681	0.0	0.0	5008	,	,		14844	0.001		0.0	False		,,,				2504	0.0				Melanoma(55;1800 1972 14909)	dbGAP											0													60.0	68.0	65.0					5																	140229695		2195	4269	6464	-	-	-	SO:0001583	missense	0			AF152487	CCDS54920.1	5q31	2010-11-26				ENSG00000204961		"""Cadherins / Protocadherins : Clustered"""	8675	other	complex locus constituent	"""KIAA0345-like 5"""	606315				10380929	Standard	NM_031857		Approved	KIAA0345, PCDH-ALPHA9		Q9Y5H5		ENST00000532602.1:c.1615G>A	5.37:g.140229695G>A	ENSP00000436042:p.Asp539Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15053|Q2M3S5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D539N	ENST00000532602.1	37	c.1615	CCDS54920.1	5	.	.	.	.	.	.	.	.	.	.	G	26.8	4.772761	0.90108	.	.	ENSG00000204961	ENST00000532602;ENST00000378122	T;T	0.79940	-1.32;-1.32	3.56	3.56	0.40772	Cadherin (5);Cadherin-like (1);	0.000000	0.32753	U	0.005685	D	0.92622	0.7656	H	0.95950	3.745	0.42978	D	0.994455	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.95363	0.8457	10	0.87932	D	0	.	15.7535	0.78005	0.0:0.0:1.0:0.0	.	539;539	Q9Y5H5;Q9Y5H5-2	PCDA9_HUMAN;.	N	539	ENSP00000436042:D539N;ENSP00000367362:D539N	ENSP00000367362:D539N	D	+	1	0	PCDHA9	140209879	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	6.978000	0.76147	1.973000	0.57446	0.306000	0.20318	GAC	PCDHA9	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000204961		0.672	PCDHA9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA9	HGNC	protein_coding	OTTHUMT00000372896.2	34	0.00	0	G	NM_031857		140229695	140229695	+1	no_errors	ENST00000532602	ensembl	human	known	69_37n	missense	19	50.00	19	SNP	1.000	A
PDSS1	23590	genome.wustl.edu	37	10	26994296	26994296	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr10:26994296G>C	ENST00000376215.5	+	4	362	c.309G>C	c.(307-309)ttG>ttC	p.L103F	PDSS1_ENST00000376203.5_Missense_Mutation_p.L103F	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	103					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						GGAGAGACTTGAAAGGTCTGT	0.353																																						dbGAP											0													68.0	63.0	65.0					10																	26994296		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	ENST00000376215.5:c.309G>C	10.37:g.26994296G>C	ENSP00000365388:p.Leu103Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.L103F	ENST00000376215.5	37	c.309	CCDS31168.1	10	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604778	0.66445	.	.	ENSG00000148459	ENST00000376215;ENST00000376203;ENST00000396343	T;T	0.68181	-0.31;-0.31	5.33	4.42	0.53409	Terpenoid synthase (2);	0.000000	0.64402	D	0.000001	T	0.77253	0.4103	M	0.63843	1.955	0.58432	D	0.999995	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.973	T	0.78529	-0.2169	10	0.87932	D	0	-9.9813	10.162	0.42858	0.1638:0.0:0.8362:0.0	.	103;103	Q5T2R2-2;Q5T2R2	.;DPS1_HUMAN	F	103;103;64	ENSP00000365388:L103F;ENSP00000365376:L103F	ENSP00000365376:L103F	L	+	3	2	PDSS1	27034302	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.298000	0.51818	1.226000	0.43582	0.650000	0.86243	TTG	PDSS1	-	superfamily_Terpenoid_synth	ENSG00000148459		0.353	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDSS1	HGNC	protein_coding	OTTHUMT00000047276.1	233	0.00	0	G			26994296	26994296	+1	no_errors	ENST00000376215	ensembl	human	known	69_37n	missense	195	16.31	38	SNP	1.000	C
PEG3	5178	genome.wustl.edu	37	19	57325872	57325872	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:57325872G>T	ENST00000326441.9	-	10	4301	c.3938C>A	c.(3937-3939)tCc>tAc	p.S1313Y	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Missense_Mutation_p.S1187Y|PEG3_ENST00000423103.2_Missense_Mutation_p.S1313Y|PEG3_ENST00000598410.1_Missense_Mutation_p.S1189Y|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	1313					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		AGTATAGGAGGACCCGTACTC	0.438																																						dbGAP											0													103.0	100.0	101.0					19																	57325872		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.3938C>A	19.37:g.57325872G>T	ENSP00000326581:p.Ser1313Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S1313Y	ENST00000326441.9	37	c.3938	CCDS12948.1	19	.	.	.	.	.	.	.	.	.	.	G	10.07	1.250139	0.22880	.	.	ENSG00000198300	ENST00000326441;ENST00000423103	T;T	0.02709	4.19;4.19	4.48	2.32	0.28847	.	0.779629	0.11296	N	0.578720	T	0.02688	0.0081	L	0.35341	1.055	.	.	.	B;P;P	0.50943	0.171;0.925;0.94	B;B;B	0.40534	0.032;0.178;0.332	T	0.40327	-0.9569	9	0.72032	D	0.01	-3.8241	5.4906	0.16774	0.1002:0.0:0.7031:0.1967	.	1189;1313;1248	A7E2B8;Q9GZU2;Q96Q96	.;PEG3_HUMAN;.	Y	1313	ENSP00000326581:S1313Y;ENSP00000403051:S1313Y	ENSP00000326581:S1313Y	S	-	2	0	ZIM2	62017684	0.000000	0.05858	0.040000	0.18447	0.718000	0.41266	0.383000	0.20651	0.801000	0.34066	0.655000	0.94253	TCC	PEG3	-	NULL	ENSG00000198300		0.438	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	312	0.32	1	G			57325872	57325872	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	missense	210	24.46	68	SNP	0.024	T
PEG3	5178	genome.wustl.edu	37	19	57327380	57327380	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:57327380G>A	ENST00000326441.9	-	10	2793	c.2430C>T	c.(2428-2430)ttC>ttT	p.F810F	ZIM2_ENST00000601070.1_Intron|ZIM2_ENST00000593711.1_Intron|ZIM2_ENST00000599935.1_Intron|ZIM2_ENST00000221722.5_Intron|PEG3_ENST00000593695.1_Silent_p.F684F|PEG3_ENST00000423103.2_Silent_p.F810F|PEG3_ENST00000598410.1_Silent_p.F686F|ZIM2_ENST00000391708.3_Intron	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3	810					apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.F810F(2)		NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		TGATAGCATCGAAGCTCTGAA	0.468																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(2)											141.0	134.0	136.0					19																	57327380		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2		ENST00000326441.9:c.2430C>T	19.37:g.57327380G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.F810	ENST00000326441.9	37	c.2430	CCDS12948.1	19																																																																																			PEG3	-	NULL	ENSG00000198300		0.468	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PEG3	HGNC	protein_coding	OTTHUMT00000416099.2	169	0.00	0	G			57327380	57327380	-1	no_errors	ENST00000326441	ensembl	human	known	69_37n	silent	148	19.13	35	SNP	0.000	A
PGM2L1	283209	genome.wustl.edu	37	11	74062496	74062496	+	Silent	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:74062496C>G	ENST00000298198.4	-	6	992	c.681G>C	c.(679-681)ctG>ctC	p.L227L		NM_173582.3	NP_775853.2	Q6PCE3	PGM2L_HUMAN	phosphoglucomutase 2-like 1	227					glucose metabolic process (GO:0006006)|phosphorylation (GO:0016310)	cytosol (GO:0005829)	glucose-1,6-bisphosphate synthase activity (GO:0047933)|intramolecular transferase activity, phosphotransferases (GO:0016868)			NS(2)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(11;3.32e-06)					GGTCTCTCTTCAGCGGGCTGG	0.388																																						dbGAP											0													79.0	79.0	79.0					11																	74062496		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			AB019210	CCDS8231.1	11q13.3	2008-12-01			ENSG00000165434	ENSG00000165434			20898	protein-coding gene	gene with protein product	"""glucose-1,6-bisphosphate synthase"""	611610				17804405	Standard	NM_173582		Approved	FLJ32029, BM32A	uc001ovb.1	Q6PCE3	OTTHUMG00000168132	ENST00000298198.4:c.681G>C	11.37:g.74062496C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MQ7|Q9UIK3	Silent	SNP	pfam_A-D-PHexomutase_a/b/a-I,pfam_A-D-PHexomutase_a/b/a-II,pfam_A-D-PHexomutase_a/b/a-III,pfam_A-D-PHexomutase_C,superfamily_A-D-PHexomutase_a/b/a-I/II/III	p.L227	ENST00000298198.4	37	c.681	CCDS8231.1	11																																																																																			PGM2L1	-	superfamily_A-D-PHexomutase_a/b/a-I/II/III	ENSG00000165434		0.388	PGM2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGM2L1	HGNC	protein_coding	OTTHUMT00000398324.1	249	0.00	0	C	NM_173582		74062496	74062496	-1	no_errors	ENST00000298198	ensembl	human	known	69_37n	silent	219	13.04	33	SNP	1.000	G
PHC2	1912	genome.wustl.edu	37	1	33834190	33834190	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:33834190C>G	ENST00000257118.5	-	5	663	c.610G>C	c.(610-612)Gtg>Ctg	p.V204L	PHC2_ENST00000373416.1_5'UTR|PHC2_ENST00000431992.1_Intron|PHC2_ENST00000419414.2_Missense_Mutation_p.V204L	NM_198040.2	NP_932157.1	Q8IXK0	PHC2_HUMAN	polyhomeotic homolog 2 (Drosophila)	204					multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	heterochromatin (GO:0000792)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	31		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.211)				TCAGGCTGCACAGTAGCGACG	0.692																																						dbGAP											0													24.0	26.0	25.0					1																	33834190		1984	3840	5824	-	-	-	SO:0001583	missense	0			AJ419231	CCDS378.1, CCDS379.1	1p34.3	2013-01-10	2006-09-12	2002-11-15	ENSG00000134686	ENSG00000134686		"""Sterile alpha motif (SAM) domain containing"""	3183	protein-coding gene	gene with protein product		602979	"""early development regulator 2 (homolog of polyhomeotic 2)"", ""polyhomeotic-like 2 (Drosophila)"""	EDR2		9121482, 12384788	Standard	NM_198040		Approved	HPH2	uc001bxg.1	Q8IXK0	OTTHUMG00000004133	ENST00000257118.5:c.610G>C	1.37:g.33834190C>G	ENSP00000257118:p.Val204Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q1|A8KA40|D3DPR2|Q2TAL3|Q5T0C1|Q6NUJ6|Q6ZQR1|Q8N306|Q8TAG8|Q96BL4|Q9Y4Y7	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM,pfscan_Znf_FCS	p.V204L	ENST00000257118.5	37	c.610	CCDS378.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.383605	0.82792	.	.	ENSG00000134686	ENST00000257118;ENST00000419414	T;T	0.38401	1.14;1.56	5.35	4.44	0.53790	.	0.069663	0.56097	D	0.000021	T	0.34308	0.0893	M	0.61703	1.905	0.80722	D	1	B;P	0.39480	0.22;0.675	B;B	0.38428	0.235;0.273	T	0.09079	-1.0691	10	0.30854	T	0.27	-15.4606	11.0613	0.47948	0.0:0.9106:0.0:0.0894	.	204;204	A8KA40;Q8IXK0	.;PHC2_HUMAN	L	204	ENSP00000257118:V204L;ENSP00000391440:V204L	ENSP00000257118:V204L	V	-	1	0	PHC2	33606777	0.997000	0.39634	1.000000	0.80357	0.999000	0.98932	3.279000	0.51670	2.504000	0.84457	0.655000	0.94253	GTG	PHC2	-	NULL	ENSG00000134686		0.692	PHC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHC2	HGNC	protein_coding	OTTHUMT00000011895.1	22	0.00	0	C	NM_198040		33834190	33834190	-1	no_errors	ENST00000419414	ensembl	human	known	69_37n	missense	10	47.37	9	SNP	1.000	G
PIK3R1	5295	genome.wustl.edu	37	5	67592087	67592087	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:67592087G>A	ENST00000521381.1	+	15	2519	c.1903G>A	c.(1903-1905)Gaa>Aaa	p.E635K	PIK3R1_ENST00000274335.5_Missense_Mutation_p.E635K|PIK3R1_ENST00000523872.1_Missense_Mutation_p.E272K|PIK3R1_ENST00000320694.8_Missense_Mutation_p.E335K|PIK3R1_ENST00000336483.5_Missense_Mutation_p.E365K|PIK3R1_ENST00000521657.1_Missense_Mutation_p.E635K|PIK3R1_ENST00000396611.1_Missense_Mutation_p.E643K	NM_181523.2	NP_852664.1	P27986	P85A_HUMAN	phosphoinositide-3-kinase, regulatory subunit 1 (alpha)	635	SH2 2. {ECO:0000255|PROSITE- ProRule:PRU00191}.				B cell differentiation (GO:0030183)|blood coagulation (GO:0007596)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|growth hormone receptor signaling pathway (GO:0060396)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|leukocyte migration (GO:0050900)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of osteoclast differentiation (GO:0045671)|neurotrophin TRK receptor signaling pathway (GO:0048011)|NFAT protein import into nucleus (GO:0051531)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose import (GO:0046326)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|protein phosphorylation (GO:0006468)|regulation of phosphatidylinositol 3-kinase activity (GO:0043551)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|membrane (GO:0016020)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	ErbB-3 class receptor binding (GO:0043125)|insulin binding (GO:0043559)|insulin receptor binding (GO:0005158)|insulin receptor substrate binding (GO:0043560)|insulin-like growth factor receptor binding (GO:0005159)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulator activity (GO:0035014)|protein phosphatase binding (GO:0019903)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)	p.0?(1)|p.?(1)		breast(12)|central_nervous_system(31)|cervix(1)|endometrium(68)|haematopoietic_and_lymphoid_tissue(5)|kidney(1)|large_intestine(32)|lung(10)|ovary(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	178		Lung NSC(167;1.99e-05)|Prostate(74;0.00308)|Ovarian(174;0.00473)|Colorectal(97;0.0176)		OV - Ovarian serous cystadenocarcinoma(47;3.76e-51)|Lung(70;0.0211)	Isoprenaline(DB01064)	AAACAAAGCTGAAAACCTGTT	0.483			"""Mis, F, O"""		"""gliobastoma, ovarian, colorectal"""					TCGA GBM(4;<1E-08)																												dbGAP		Rec	yes		5	5q13.1	5295	"""phosphoinositide-3-kinase, regulatory subunit 1 (alpha)"""		"""E, O"""	2	Whole gene deletion(1)|Unknown(1)	large_intestine(1)|lung(1)											191.0	178.0	183.0					5																	67592087		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61906	CCDS3993.1, CCDS3994.1, CCDS3995.1, CCDS56374.1	5q13.1	2014-09-17	2008-02-04		ENSG00000145675	ENSG00000145675		"""SH2 domain containing"""	8979	protein-coding gene	gene with protein product		171833				1314371, 18387942	Standard	NM_181524		Approved	GRB1, p85-ALPHA, p85	uc003jva.3	P27986	OTTHUMG00000131251	ENST00000521381.1:c.1903G>A	5.37:g.67592087G>A	ENSP00000428056:p.Glu635Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT19|D3DWA0|E7EX19|Q15747|Q4VBZ7|Q53EM6|Q8IXA2|Q8N1C5	Missense_Mutation	SNP	pfam_SH2,pfam_RhoGAP_dom,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Guanylate-bd_C,smart_SH3_domain,smart_RhoGAP_dom,smart_SH2,pfscan_SH2,pfscan_SH3_domain,pfscan_RhoGAP_dom,prints_PI3kinase_P85,prints_SH2	p.E643K	ENST00000521381.1	37	c.1927	CCDS3993.1	5	.	.	.	.	.	.	.	.	.	.	G	36	5.720726	0.96839	.	.	ENSG00000145675	ENST00000521381;ENST00000521657;ENST00000396611;ENST00000274335;ENST00000320694;ENST00000336483;ENST00000523872	D;D;D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9;-2.9;-2.9	5.15	5.15	0.70609	SH2 motif (4);	0.000000	0.85682	D	0.000000	D	0.97068	0.9042	M	0.92219	3.285	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.99;0.986;1.0	D	0.97114	0.9806	10	0.51188	T	0.08	-22.6502	18.8075	0.92043	0.0:0.0:1.0:0.0	.	365;335;635	P27986-2;P27986-3;P27986	.;.;P85A_HUMAN	K	635;635;643;635;335;365;272	ENSP00000428056:E635K;ENSP00000429277:E635K;ENSP00000379855:E643K;ENSP00000274335:E635K;ENSP00000323512:E335K;ENSP00000338554:E365K;ENSP00000430098:E272K	ENSP00000274335:E635K	E	+	1	0	PIK3R1	67627843	1.000000	0.71417	0.948000	0.38648	0.979000	0.70002	9.657000	0.98554	2.689000	0.91719	0.650000	0.86243	GAA	PIK3R1	-	pfam_SH2,smart_SH2,pfscan_SH2	ENSG00000145675		0.483	PIK3R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3R1	HGNC	protein_coding	OTTHUMT00000254013.2	325	0.61	2	G	NM_181504		67592087	67592087	+1	no_errors	ENST00000396611	ensembl	human	known	69_37n	missense	247	20.58	64	SNP	1.000	A
PKP4	8502	genome.wustl.edu	37	2	159537087	159537087	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:159537087G>A	ENST00000389759.3	+	22	3589	c.3477G>A	c.(3475-3477)caG>caA	p.Q1159Q	AC005042.4_ENST00000342892.4_RNA|AC005042.4_ENST00000442666.1_RNA|PKP4_ENST00000389757.3_Silent_p.Q1116Q	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4	1159					cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						ACTCAACACAGTATGGACTGA	0.408										HNSCC(62;0.18)																												dbGAP											0													136.0	136.0	136.0					2																	159537087		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.3477G>A	2.37:g.159537087G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86W91	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.Q1159	ENST00000389759.3	37	c.3477	CCDS33305.1	2																																																																																			PKP4	-	NULL	ENSG00000144283		0.408	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	317	0.00	0	G			159537087	159537087	+1	no_errors	ENST00000389759	ensembl	human	known	69_37n	silent	218	15.18	39	SNP	1.000	A
PLCXD3	345557	genome.wustl.edu	37	5	41382448	41382448	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:41382448G>A	ENST00000377801.3	-	2	366	c.292C>T	c.(292-294)Cga>Tga	p.R98*	PLCXD3_ENST00000328457.3_Nonsense_Mutation_p.R98*			Q63HM9	PLCX3_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 3	98	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)	p.R98*(1)		central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(4)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GTGGAAATTCGAAGATCAAAA	0.443																																						dbGAP											1	Substitution - Nonsense(1)	prostate(1)											73.0	77.0	76.0					5																	41382448		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS34150.1	5p13.1	2004-09-09			ENSG00000182836	ENSG00000182836			31822	protein-coding gene	gene with protein product							Standard	NM_001005473		Approved		uc003jmm.1	Q63HM9	OTTHUMG00000162076	ENST00000377801.3:c.292C>T	5.37:g.41382448G>A	ENSP00000367032:p.Arg98*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL04	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.R98*	ENST00000377801.3	37	c.292	CCDS34150.1	5	.	.	.	.	.	.	.	.	.	.	G	37	5.983984	0.97173	.	.	ENSG00000182836	ENST00000377801;ENST00000328457	.	.	.	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4392	15.2559	0.73585	0.0:0.0:0.8274:0.1726	.	.	.	.	X	98	.	ENSP00000333751:R98X	R	-	1	2	PLCXD3	41418205	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.026000	0.70873	2.885000	0.99019	0.655000	0.94253	CGA	PLCXD3	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000182836		0.443	PLCXD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCXD3	HGNC	protein_coding	OTTHUMT00000367109.1	165	0.00	0	G	XM_293875		41382448	41382448	-1	no_errors	ENST00000328457	ensembl	human	known	69_37n	nonsense	128	21.95	36	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	132174147	132174147	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:132174147G>A	ENST00000359827.3	-	3	2237	c.1275C>T	c.(1273-1275)ttC>ttT	p.F425F	PLXNA4_ENST00000321063.4_Silent_p.F425F|PLXNA4_ENST00000378539.5_Silent_p.F425F|PLXNA4_ENST00000423507.2_Silent_p.F425F			Q9HCM2	PLXA4_HUMAN	plexin A4	425	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TGTCCTCCGTGAAGACGGGAA	0.507																																						dbGAP											0													112.0	92.0	99.0					7																	132174147		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.1275C>T	7.37:g.132174147G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.F425	ENST00000359827.3	37	c.1275	CCDS43646.1	7																																																																																			PLXNA4	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000221866		0.507	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	157	0.63	1	G	NM_181775		132174147	132174147	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	silent	139	16.27	27	SNP	1.000	A
POLQ	10721	genome.wustl.edu	37	3	121228970	121228970	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:121228970G>A	ENST00000264233.5	-	11	1860	c.1732C>T	c.(1732-1734)Cag>Tag	p.Q578*		NM_199420.3	NP_955452.3	O75417	DPOLQ_HUMAN	polymerase (DNA directed), theta	578					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA-directed DNA polymerase activity (GO:0003887)|single-stranded DNA-dependent ATPase activity (GO:0043142)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(55)|ovary(5)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	120				GBM - Glioblastoma multiforme(114;0.0915)		GCTCCAAGCTGAACAGACTCT	0.428								DNA polymerases (catalytic subunits)																													Pancreas(152;907 1925 26081 31236 36904)	dbGAP											0													209.0	179.0	189.0					3																	121228970		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF052573	CCDS33833.1	3q13.3	2012-05-18			ENSG00000051341	ENSG00000051341	2.7.7.7	"""DNA polymerases"""	9186	protein-coding gene	gene with protein product		604419				10395804	Standard	NM_199420		Approved	POLH	uc003eee.4	O75417	OTTHUMG00000159396	ENST00000264233.5:c.1732C>T	3.37:g.121228970G>A	ENSP00000264233:p.Gln578*	Somatic		WXS	Illumina GAIIx	Phase_IV	O95160|Q6VMB5	Nonsense_Mutation	SNP	pfam_DNA-dir_DNA_pol_A_palm_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_RNaseH-like_dom,smart_Helicase_ATP-bd,smart_Helicase_C,smart_DNA-dir_DNA_pol_A_palm_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_DNA_polymerase_A	p.Q578*	ENST00000264233.5	37	c.1732	CCDS33833.1	3	.	.	.	.	.	.	.	.	.	.	G	37	6.314051	0.97467	.	.	ENSG00000051341	ENST00000543272;ENST00000264233;ENST00000393672	.	.	.	4.86	1.69	0.24217	.	0.360736	0.28067	N	0.016732	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06365	T	0.9	.	4.1779	0.10360	0.0833:0.2979:0.4655:0.1533	.	.	.	.	X	201;578;714	.	ENSP00000264233:Q578X	Q	-	1	0	POLQ	122711660	0.598000	0.26882	0.787000	0.31911	0.916000	0.54674	2.018000	0.40991	0.390000	0.25115	0.460000	0.39030	CAG	POLQ	-	NULL	ENSG00000051341		0.428	POLQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLQ	HGNC	protein_coding	OTTHUMT00000355097.1	313	0.00	0	G	NM_199420		121228970	121228970	-1	no_errors	ENST00000264233	ensembl	human	known	69_37n	nonsense	230	19.86	57	SNP	0.000	A
POLR1A	25885	genome.wustl.edu	37	2	86258620	86258620	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:86258620C>G	ENST00000263857.6	-	30	4789	c.4411G>C	c.(4411-4413)Gag>Cag	p.E1471Q	POLR1A_ENST00000409681.1_Intron			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1471				Missing (in Ref. 1; AAC99959). {ECO:0000305}.	gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						GGGTCCTCCTCAGTGCCTAAG	0.647																																						dbGAP											0													179.0	187.0	184.0					2																	86258620		2106	4187	6293	-	-	-	SO:0001583	missense	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4411G>C	2.37:g.86258620C>G	ENSP00000263857:p.Glu1471Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.E1471Q	ENST00000263857.6	37	c.4411	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965685	0.74131	.	.	ENSG00000068654	ENST00000263857	T	0.68181	-0.31	4.94	4.94	0.65067	RNA polymerase Rpb1, domain 5 (1);	22.212800	0.00166	N	0.000000	T	0.79257	0.4415	L	0.54908	1.71	0.80722	D	1	D	0.63046	0.992	P	0.60173	0.87	T	0.64478	-0.6398	10	0.19147	T	0.46	-2.1985	16.0301	0.80572	0.0:1.0:0.0:0.0	.	1471	O95602	RPA1_HUMAN	Q	1471	ENSP00000263857:E1471Q	ENSP00000263857:E1471Q	E	-	1	0	POLR1A	86112131	0.179000	0.23135	0.903000	0.35520	0.046000	0.14306	1.873000	0.39558	2.451000	0.82905	0.555000	0.69702	GAG	POLR1A	-	pfam_RNA_pol_Rpb1_5	ENSG00000068654		0.647	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	249	0.40	1	C	NM_015425		86258620	86258620	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	missense	205	17.34	43	SNP	0.986	G
PPP1R36	145376	genome.wustl.edu	37	14	65041213	65041213	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:65041213G>A	ENST00000298705.1	+	8	670	c.574G>A	c.(574-576)Gaa>Aaa	p.E192K	RP11-973N13.3_ENST00000556634.1_RNA|RP11-973N13.3_ENST00000554454.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	192					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										GGTTTTAAGTGAATTAGAAGC	0.428																																						dbGAP											0													114.0	106.0	109.0					14																	65041213		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.574G>A	14.37:g.65041213G>A	ENSP00000298705:p.Glu192Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTH6	Missense_Mutation	SNP	NULL	p.E192K	ENST00000298705.1	37	c.574	CCDS9767.1	14	.	.	.	.	.	.	.	.	.	.	G	2.105	-0.405247	0.04832	.	.	ENSG00000165807	ENST00000298705	T	0.28255	1.62	6.04	4.82	0.62117	.	0.154247	0.45606	N	0.000341	T	0.05823	0.0152	N	0.00170	-1.935	0.22521	N	0.999022	B	0.02656	0.0	B	0.01281	0.0	T	0.34354	-0.9832	10	0.02654	T	1	-22.4588	8.8945	0.35455	0.9152:0.0:0.0848:0.0	.	192	Q96LQ0	PPR36_HUMAN	K	192	ENSP00000298705:E192K	ENSP00000298705:E192K	E	+	1	0	C14orf50	64110966	0.991000	0.36638	0.730000	0.30809	0.550000	0.35303	3.313000	0.51935	1.097000	0.41459	-0.459000	0.05422	GAA	PPP1R36	-	NULL	ENSG00000165807		0.428	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R36	HGNC	protein_coding	OTTHUMT00000280667.1	221	0.00	0	G	NM_172365		65041213	65041213	+1	no_errors	ENST00000298705	ensembl	human	known	69_37n	missense	190	12.79	28	SNP	0.775	A
PRKD2	25865	genome.wustl.edu	37	19	47201003	47201003	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:47201003T>A	ENST00000291281.4	-	8	1451	c.1226A>T	c.(1225-1227)aAc>aTc	p.N409I	PRKD2_ENST00000601806.1_Missense_Mutation_p.N252I|PRKD2_ENST00000433867.1_Missense_Mutation_p.N409I|PRKD2_ENST00000595515.1_Missense_Mutation_p.N409I|PRKD2_ENST00000600194.1_Missense_Mutation_p.N252I			Q9BZL6	KPCD2_HUMAN	protein kinase D2	409	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell death (GO:0008219)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial tube morphogenesis (GO:0061154)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cell adhesion (GO:0045785)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast growth factor receptor signaling pathway (GO:0045743)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of intracellular signal transduction (GO:1902533)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell receptor signaling pathway (GO:0050862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(2)|skin(1)|stomach(2)|urinary_tract(1)	41		Ovarian(192;0.0129)|all_neural(266;0.0459)|Breast(70;0.212)		OV - Ovarian serous cystadenocarcinoma(262;0.000189)|all cancers(93;0.000545)|Epithelial(262;0.0219)|GBM - Glioblastoma multiforme(486;0.0353)		CGTGTCCTTGTTGCTGTAATG	0.657																																						dbGAP											0													102.0	80.0	88.0					19																	47201003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151021	CCDS12689.1, CCDS59401.1	19q13.2	2013-01-10				ENSG00000105287		"""Pleckstrin homology (PH) domain containing"""	17293	protein-coding gene	gene with protein product		607074				11042152, 11062248	Standard	NM_001079880		Approved	PKD2, HSPC187, DKFZP586E0820	uc002pfj.3	Q9BZL6		ENST00000291281.4:c.1226A>T	19.37:g.47201003T>A	ENSP00000291281:p.Asn409Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB08|Q9P0T6|Q9Y3X8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_DAG/PE-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.N409I	ENST00000291281.4	37	c.1226	CCDS12689.1	19	.	.	.	.	.	.	.	.	.	.	t	23.5	4.420620	0.83559	.	.	ENSG00000105287	ENST00000291281;ENST00000433867	T;T	0.25749	1.78;1.78	4.16	1.98	0.26296	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.167512	0.35320	U	0.003295	T	0.37999	0.1024	L	0.42245	1.32	0.37943	D	0.932409	P;P	0.36199	0.517;0.543	P;P	0.59595	0.86;0.679	T	0.35251	-0.9796	10	0.72032	D	0.01	-26.5849	7.0106	0.24861	0.0:0.2868:0.0:0.7132	.	409;409	E7ER94;Q9BZL6	.;KPCD2_HUMAN	I	409	ENSP00000291281:N409I;ENSP00000393978:N409I	ENSP00000291281:N409I	N	-	2	0	PRKD2	51892843	1.000000	0.71417	0.999000	0.59377	0.984000	0.73092	0.775000	0.26689	0.240000	0.21263	0.439000	0.28862	AAC	PRKD2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000105287		0.657	PRKD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKD2	HGNC	protein_coding	OTTHUMT00000466591.1	51	0.00	0	T	NM_016457		47201003	47201003	-1	no_errors	ENST00000291281	ensembl	human	known	69_37n	missense	34	27.66	13	SNP	1.000	A
PRKCG	5582	genome.wustl.edu	37	19	54407909	54407909	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:54407909C>T	ENST00000263431.3	+	16	1959	c.1677C>T	c.(1675-1677)gaC>gaT	p.D559D	PRKCG_ENST00000540413.1_Silent_p.D559D|PRKCG_ENST00000542049.1_Intron	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	559	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)			large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	ATGGGGAGGACGAGGAGGAGC	0.592																																						dbGAP											0													108.0	74.0	85.0					19																	54407909		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1677C>T	19.37:g.54407909C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Q0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.D559	ENST00000263431.3	37	c.1677	CCDS12867.1	19																																																																																			PRKCG	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000126583		0.592	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	HGNC	protein_coding	OTTHUMT00000139233.3	104	0.95	1	C	NM_002739		54407909	54407909	+1	no_errors	ENST00000540413	ensembl	human	known	69_37n	silent	59	46.85	52	SNP	0.986	T
PROKR1	10887	genome.wustl.edu	37	2	68873196	68873196	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:68873196C>T	ENST00000303786.3	+	2	663	c.243C>T	c.(241-243)ttC>ttT	p.F81F	PROKR1_ENST00000394342.2_Silent_p.F81F			Q8TCW9	PKR1_HUMAN	prokineticin receptor 1	81					negative regulation of apoptotic process (GO:0043066)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide Y receptor activity (GO:0004983)			endometrium(3)|kidney(2)|large_intestine(14)|lung(9)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35						TTGGAAACTTCATCTTTATCG	0.532																																						dbGAP											0													206.0	176.0	186.0					2																	68873196		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF506287	CCDS1889.1	2p14	2012-08-08	2006-02-15	2006-02-15	ENSG00000169618	ENSG00000169618		"""GPCR / Class A : Prokineticin receptors"""	4524	protein-coding gene	gene with protein product		607122	"""G protein-coupled receptor 73"""	GPR73		10760605	Standard	NM_138964		Approved	PKR1, ZAQ, GPR73a	uc010yqj.2	Q8TCW9	OTTHUMG00000129567	ENST00000303786.3:c.243C>T	2.37:g.68873196C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUU2|Q53QT9|Q8NFJ7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.F81	ENST00000303786.3	37	c.243	CCDS1889.1	2																																																																																			PROKR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000169618		0.532	PROKR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROKR1	HGNC	protein_coding	OTTHUMT00000251760.2	197	0.00	0	C			68873196	68873196	+1	no_errors	ENST00000303786	ensembl	human	known	69_37n	silent	243	13.52	38	SNP	0.974	T
PSEN1	5663	genome.wustl.edu	37	14	73637628	73637628	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:73637628G>A	ENST00000324501.5	+	4	483	c.211G>A	c.(211-213)Gag>Aag	p.E71K	PSEN1_ENST00000406768.1_5'UTR|PSEN1_ENST00000394157.3_Missense_Mutation_p.E71K|PSEN1_ENST00000344094.3_Missense_Mutation_p.E71K|PSEN1_ENST00000261970.3_Missense_Mutation_p.E71K|PSEN1_ENST00000357710.4_Missense_Mutation_p.E67K|PSEN1_ENST00000557511.1_Missense_Mutation_p.E71K|PSEN1_ENST00000394164.1_Missense_Mutation_p.E67K	NM_000021.3|NM_007318.2	NP_000012.1|NP_015557.2	P49768	PSN1_HUMAN	presenilin 1	71					activation of MAPKK activity (GO:0000186)|amyloid precursor protein catabolic process (GO:0042987)|anagen (GO:0042640)|autophagic vacuole assembly (GO:0000045)|beta-amyloid formation (GO:0034205)|beta-amyloid metabolic process (GO:0050435)|blood vessel development (GO:0001568)|brain morphogenesis (GO:0048854)|Cajal-Retzius cell differentiation (GO:0021870)|calcium ion transmembrane transport (GO:0070588)|canonical Wnt signaling pathway (GO:0060070)|cell fate specification (GO:0001708)|cellular response to DNA damage stimulus (GO:0006974)|cerebral cortex cell migration (GO:0021795)|choline transport (GO:0015871)|dorsal/ventral neural tube patterning (GO:0021904)|embryonic limb morphogenesis (GO:0030326)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|hematopoietic progenitor cell differentiation (GO:0002244)|intracellular signal transduction (GO:0035556)|L-glutamate transport (GO:0015813)|membrane protein ectodomain proteolysis (GO:0006509)|memory (GO:0007613)|mitochondrial transport (GO:0006839)|myeloid leukocyte differentiation (GO:0002573)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of axonogenesis (GO:0050771)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|positive regulation of coagulation (GO:0050820)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of receptor recycling (GO:0001921)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein processing (GO:0016485)|protein transport (GO:0015031)|regulation of phosphorylation (GO:0042325)|regulation of protein binding (GO:0043393)|regulation of resting membrane potential (GO:0060075)|regulation of synaptic plasticity (GO:0048167)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to oxidative stress (GO:0006979)|single organismal cell-cell adhesion (GO:0016337)|skeletal system morphogenesis (GO:0048705)|skin morphogenesis (GO:0043589)|smooth endoplasmic reticulum calcium ion homeostasis (GO:0051563)|somitogenesis (GO:0001756)|synaptic vesicle targeting (GO:0016080)|T cell activation involved in immune response (GO:0002286)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cell cortex (GO:0005938)|cell surface (GO:0009986)|centrosome (GO:0005813)|ciliary rootlet (GO:0035253)|cytoplasmic vesicle (GO:0031410)|dendritic shaft (GO:0043198)|endoplasmic reticulum (GO:0005783)|gamma-secretase complex (GO:0070765)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|kinetochore (GO:0000776)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)|perinuclear region of cytoplasm (GO:0048471)|rough endoplasmic reticulum (GO:0005791)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	aspartic-type endopeptidase activity (GO:0004190)|beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|calcium channel activity (GO:0005262)|endopeptidase activity (GO:0004175)|PDZ domain binding (GO:0030165)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(234;0.00394)|OV - Ovarian serous cystadenocarcinoma(108;0.075)		GGAAGAAGATGAGGAGCTGAC	0.537																																						dbGAP											0													145.0	124.0	131.0					14																	73637628		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ008005	CCDS9812.1, CCDS9813.1	14q24.3	2014-09-17	2008-07-28		ENSG00000080815	ENSG00000080815			9508	protein-coding gene	gene with protein product		104311	"""Alzheimer disease 3"""	AD3		1411576	Standard	NM_007318		Approved	FAD, S182, PS1	uc001xnr.3	P49768	OTTHUMG00000141279	ENST00000324501.5:c.211G>A	14.37:g.73637628G>A	ENSP00000326366:p.Glu71Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6D3|O95465|Q14762|Q15719|Q15720|Q96P33|Q9UIF0	Missense_Mutation	SNP	pfam_Peptidase_A22A,smart_Peptidase_A22,prints_Pept_A22A_PS1,prints_Peptidase_A22A	p.E71K	ENST00000324501.5	37	c.211	CCDS9812.1	14	.	.	.	.	.	.	.	.	.	.	G	35	5.478904	0.96291	.	.	ENSG00000080815	ENST00000557356;ENST00000556533;ENST00000556951;ENST00000557293;ENST00000553719;ENST00000553599;ENST00000394157;ENST00000324501;ENST00000357710;ENST00000555254;ENST00000261970;ENST00000344094;ENST00000554131;ENST00000394164;ENST00000557511	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.99591	-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24;-6.24	5.15	5.15	0.70609	.	0.000000	0.85682	D	0.000000	D	0.99658	0.9873	M	0.87269	2.87	0.80722	D	1	D;D;D	0.76494	0.984;0.999;0.998	D;D;D	0.83275	0.915;0.996;0.994	D	0.97960	1.0337	10	0.66056	D	0.02	-16.7567	18.8208	0.92096	0.0:0.0:1.0:0.0	.	67;71;71	P49768-2;P49768;P49768-4	.;PSN1_HUMAN;.	K	67;67;67;71;67;67;71;71;67;71;71;71;71;67;71	ENSP00000451498:E67K;ENSP00000452128:E67K;ENSP00000450551:E67K;ENSP00000451880:E71K;ENSP00000451674:E67K;ENSP00000452477:E67K;ENSP00000377712:E71K;ENSP00000326366:E71K;ENSP00000350342:E67K;ENSP00000450652:E71K;ENSP00000261970:E71K;ENSP00000339523:E71K;ENSP00000451915:E71K;ENSP00000377719:E67K;ENSP00000451429:E71K	ENSP00000261970:E71K	E	+	1	0	PSEN1	72707381	1.000000	0.71417	1.000000	0.80357	0.746000	0.42486	9.657000	0.98554	2.676000	0.91093	0.563000	0.77884	GAG	PSEN1	-	pfam_Peptidase_A22A,prints_Pept_A22A_PS1	ENSG00000080815		0.537	PSEN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSEN1	HGNC	protein_coding	OTTHUMT00000280500.2	249	0.00	0	G			73637628	73637628	+1	no_errors	ENST00000324501	ensembl	human	known	69_37n	missense	199	14.10	33	SNP	1.000	A
PSG7	5676	genome.wustl.edu	37	19	43433598	43433598	+	RNA	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:43433598G>C	ENST00000406070.2	-	0	801				PSG7_ENST00000446844.3_RNA	NM_002783.2	NP_002774.2	Q13046	PSG7_HUMAN	pregnancy specific beta-1-glycoprotein 7 (gene/pseudogene)						female pregnancy (GO:0007565)	extracellular region (GO:0005576)							Prostate(69;0.00682)				ACTCACGGAGGAGATTCAGGG	0.517																																						dbGAP											0													190.0	207.0	201.0					19																	43433598		2201	4295	6496	-	-	-			0					19q13.2	2013-01-29	2010-02-26		ENSG00000221878	ENSG00000221878		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9524	protein-coding gene	gene with protein product		176396	"""pregnancy specific beta-1-glycoprotein 7"""				Standard	NM_002783		Approved		uc010xwl.2	Q13046	OTTHUMG00000151125		19.37:g.43433598G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15232	Silent	SNP	NULL	p.L235	ENST00000406070.2	37	c.705		19																																																																																			PSG7	-	NULL	ENSG00000221878		0.517	PSG7-001	KNOWN	basic	polymorphic_pseudogene	PSG7	HGNC	polymorphic_pseudogene	OTTHUMT00000321431.2	215	0.00	0	G	NM_001206650		43433598	43433598	-1	pseudogene	ENST00000406070	ensembl	human	known	69_37n	silent	234	20.95	62	SNP	0.498	C
PSMD2	5708	genome.wustl.edu	37	3	184019425	184019425	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:184019425C>T	ENST00000310118.4	+	4	1016	c.458C>T	c.(457-459)tCa>tTa	p.S153L	PSMD2_ENST00000435761.1_5'UTR|PSMD2_ENST00000439383.1_Missense_Mutation_p.S23L|EIF2B5_ENST00000444495.1_Intron|PSMD2_ENST00000459910.1_3'UTR	NM_002808.3	NP_002799.3	Q13200	PSMD2_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 2	153					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(5)|liver(1)|lung(12)|prostate(3)|upper_aerodigestive_tract(2)	27	all_cancers(143;1.54e-10)|Ovarian(172;0.0339)		Epithelial(37;1.53e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)		Bortezomib(DB00188)	GAATTGGCATCATGGGGTCAT	0.498																																					Colon(24;313 636 6917 9932 15554)	dbGAP											0													112.0	109.0	110.0					3																	184019425		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095245	CCDS3258.1, CCDS63853.1, CCDS63854.1	3q27.3	2008-05-22			ENSG00000175166	ENSG00000175166		"""Proteasome (prosome, macropain) subunits"""	9559	protein-coding gene	gene with protein product		606223				8774743	Standard	NM_002808		Approved	S2, P97, TRAP2, MGC14274, Rpn1	uc003fnn.1	Q13200	OTTHUMG00000156796	ENST00000310118.4:c.458C>T	3.37:g.184019425C>T	ENSP00000310129:p.Ser153Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX07|B4DXY1|E7EW34|E9PCS3|Q12932|Q15321|Q53XQ4|Q96I12	Missense_Mutation	SNP	pfam_APC_proteasome,superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	p.S153L	ENST00000310118.4	37	c.458	CCDS3258.1	3	.	.	.	.	.	.	.	.	.	.	C	30	5.056911	0.93846	.	.	ENSG00000175166	ENST00000310118;ENST00000417952;ENST00000538096;ENST00000439383	T;T;T	0.41400	1.14;1.88;1.0	4.48	4.48	0.54585	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.59445	0.2194	M	0.62723	1.935	0.80722	D	1	D	0.54601	0.967	P	0.60789	0.879	T	0.63152	-0.6701	10	0.56958	D	0.05	-6.6942	17.3567	0.87338	0.0:1.0:0.0:0.0	.	153	Q13200	PSMD2_HUMAN	L	153;153;145;23	ENSP00000310129:S153L;ENSP00000414061:S153L;ENSP00000416028:S23L	ENSP00000310129:S153L	S	+	2	0	PSMD2	185502119	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.581000	0.82535	2.317000	0.78254	0.557000	0.71058	TCA	PSMD2	-	superfamily_ARM-type_fold,pirsf_26S_Psome_Rpn1	ENSG00000175166		0.498	PSMD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD2	HGNC	protein_coding	OTTHUMT00000345843.1	188	0.00	0	C	NM_002808		184019425	184019425	+1	no_errors	ENST00000310118	ensembl	human	known	69_37n	missense	138	29.59	58	SNP	0.999	T
PTPRC	5788	genome.wustl.edu	37	1	198711494	198711494	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:198711494G>A	ENST00000367376.2	+	25	2860	c.2689G>A	c.(2689-2691)Gag>Aag	p.E897K	PTPRC_ENST00000442510.2_Missense_Mutation_p.E899K|PTPRC_ENST00000594404.1_Missense_Mutation_p.E736K|PTPRC_ENST00000352140.3_Missense_Mutation_p.E849K|PTPRC_ENST00000348564.6_Missense_Mutation_p.E738K	NM_002838.4	NP_002829.3	P08575	PTPRC_HUMAN	protein tyrosine phosphatase, receptor type, C	897	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				axon guidance (GO:0007411)|B cell proliferation (GO:0042100)|B cell receptor signaling pathway (GO:0050853)|bone marrow development (GO:0048539)|cell cycle phase transition (GO:0044770)|cell surface receptor signaling pathway (GO:0007166)|defense response to virus (GO:0051607)|dephosphorylation (GO:0016311)|hematopoietic progenitor cell differentiation (GO:0002244)|immunoglobulin biosynthetic process (GO:0002378)|negative regulation of cell adhesion involved in substrate-bound cell migration (GO:0006933)|negative regulation of cytokine-mediated signaling pathway (GO:0001960)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of T cell mediated cytotoxicity (GO:0001915)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of antigen receptor-mediated signaling pathway (GO:0050857)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of hematopoietic stem cell migration (GO:2000473)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of T cell proliferation (GO:0042102)|protein dephosphorylation (GO:0006470)|regulation of cell cycle (GO:0051726)|release of sequestered calcium ion into cytosol (GO:0051209)|stem cell development (GO:0048864)|T cell differentiation (GO:0030217)|T cell receptor signaling pathway (GO:0050852)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(7)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(22)|lung(41)|ovary(4)|pancreas(2)|prostate(1)|skin(13)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	111						GGTTCAAGTAGAGGTATGTTC	0.353																																						dbGAP											0													194.0	191.0	192.0					1																	198711494		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00062	CCDS1397.1, CCDS1398.1, CCDS44291.1, CCDS1397.2, CCDS1398.2, CCDS44291.2	1q31-q32	2014-09-17			ENSG00000081237	ENSG00000081237		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9666	protein-coding gene	gene with protein product		151460		CD45		2169617	Standard	NM_001267798		Approved	LCA, T200, GP180	uc001gur.2	P08575	OTTHUMG00000035702	ENST00000367376.2:c.2689G>A	1.37:g.198711494G>A	ENSP00000356346:p.Glu897Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7W6|Q16614|Q9H0Y6	Missense_Mutation	SNP	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Leukocyte_common_ag,pfam_PTP_recept_N,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.E899K	ENST00000367376.2	37	c.2695		1	.	.	.	.	.	.	.	.	.	.	G	36	5.749191	0.96882	.	.	ENSG00000081237	ENST00000367376;ENST00000352140;ENST00000442510;ENST00000348564	T	0.11604	2.76	6.06	6.06	0.98353	Protein-tyrosine phosphatase, receptor/non-receptor type (4);Protein-tyrosine/Dual-specificity phosphatase (1);	0.000000	0.50627	D	0.000104	T	0.31734	0.0806	L	0.52126	1.63	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.00177	-1.1952	10	0.87932	D	0	.	20.6243	0.99512	0.0:0.0:1.0:0.0	.	738;849;897	B1ALS3;E9PC28;P08575	.;.;PTPRC_HUMAN	K	899;849;897;736	ENSP00000193532:E849K	ENSP00000306782:E736K	E	+	1	0	PTPRC	196978117	1.000000	0.71417	1.000000	0.80357	0.872000	0.50106	9.761000	0.98940	2.879000	0.98667	0.650000	0.86243	GAG	PTPRC	-	pirsf_Leukocyte_common_ag,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000081237		0.353	PTPRC-202	KNOWN	basic|appris_candidate	protein_coding	PTPRC	HGNC	protein_coding		421	0.24	1	G			198711494	198711494	+1	no_errors	ENST00000367376	ensembl	human	known	69_37n	missense	481	26.11	170	SNP	1.000	A
PUS1	80324	genome.wustl.edu	37	12	132426061	132426061	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:132426061C>T	ENST00000376649.3	+	5	1269	c.769C>T	c.(769-771)Ccc>Tcc	p.P257S	PUS1_ENST00000542167.2_Missense_Mutation_p.P204S|PUS1_ENST00000440818.2_Missense_Mutation_p.P229S|PUS1_ENST00000535067.1_Intron|PUS1_ENST00000443358.2_Missense_Mutation_p.P229S	NM_025215.5	NP_079491.2	Q9Y606	TRUA_HUMAN	pseudouridylate synthase 1	257					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|tRNA pseudouridine synthesis (GO:0031119)	mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|transcription factor complex (GO:0005667)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|pseudouridylate synthase activity (GO:0004730)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|skin(1)	11	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.05e-08)|Epithelial(86;2.51e-07)|all cancers(50;2.94e-07)		GCCGCAGGATCCCAGTGCCTG	0.612																																					Esophageal Squamous(102;671 2009 17384 45666)	dbGAP											0													82.0	75.0	77.0					12																	132426061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF116238	CCDS9275.2, CCDS31928.1	12q24	2004-05-17			ENSG00000177192	ENSG00000177192			15508	protein-coding gene	gene with protein product		608109				10094309	Standard	NM_001002019		Approved		uc001ujf.3	Q9Y606	OTTHUMG00000128507	ENST00000376649.3:c.769C>T	12.37:g.132426061C>T	ENSP00000365837:p.Pro257Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K877|B3KQC1|Q8WYT2|Q9BU44	Missense_Mutation	SNP	pfam_PsdUridine_synth_TruA_a/b_dom,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_TruA	p.P257S	ENST00000376649.3	37	c.769	CCDS9275.2	12	.	.	.	.	.	.	.	.	.	.	C	15.70	2.911261	0.52439	.	.	ENSG00000177192	ENST00000443358;ENST00000376649;ENST00000322060;ENST00000440818;ENST00000542167	T;T;T;T;T	0.52983	0.64;0.64;0.64;0.64;0.64	5.37	3.42	0.39159	Pseudouridine synthase I, TruA, C-terminal (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase I, TruA, alpha/beta domain (1);	0.108667	0.64402	D	0.000004	T	0.63058	0.2479	M	0.66506	2.035	0.58432	D	0.999999	P;D	0.53151	0.951;0.958	P;P	0.62560	0.784;0.904	T	0.64922	-0.6293	10	0.40728	T	0.16	-20.384	15.224	0.73336	0.0:0.7179:0.2821:0.0	.	204;257	F5H1S9;Q9Y606	.;TRUA_HUMAN	S	229;257;229;229;204	ENSP00000392451:P229S;ENSP00000365837:P257S;ENSP00000324726:P229S;ENSP00000400032:P229S;ENSP00000438948:P204S	ENSP00000324726:P229S	P	+	1	0	PUS1	130992014	1.000000	0.71417	1.000000	0.80357	0.194000	0.23727	4.025000	0.57225	1.255000	0.44051	0.561000	0.74099	CCC	PUS1	-	pfam_PsdUridine_synth_TruA_a/b_dom,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_TruA	ENSG00000177192		0.612	PUS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PUS1	HGNC	protein_coding	OTTHUMT00000250313.2	170	0.00	0	C	NM_025215		132426061	132426061	+1	no_errors	ENST00000376649	ensembl	human	known	69_37n	missense	123	18.42	28	SNP	1.000	T
PYGB	5834	genome.wustl.edu	37	20	25229006	25229006	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:25229006C>T	ENST00000216962.4	+	1	302	c.192C>T	c.(190-192)ctC>ctT	p.L64L		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	64					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						GCGACCACCTCGTGGGCCGCT	0.701																																						dbGAP											0													40.0	30.0	34.0					20																	25229006		2199	4297	6496	-	-	-	SO:0001819	synonymous_variant	0				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.192C>T	20.37:g.25229006C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AK1|Q9NPX8	Silent	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.L64	ENST00000216962.4	37	c.192	CCDS13171.1	20																																																																																			PYGB	-	pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	ENSG00000100994		0.701	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	23	0.00	0	C	NM_002862		25229006	25229006	+1	no_errors	ENST00000216962	ensembl	human	known	69_37n	silent	18	28.00	7	SNP	1.000	T
RALGAPB	57148	genome.wustl.edu	37	20	37117154	37117154	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:37117154G>A	ENST00000262879.6	+	2	363	c.79G>A	c.(79-81)Gag>Aag	p.E27K	RALGAPB_ENST00000537204.1_Missense_Mutation_p.E27K|RALGAPB_ENST00000397040.1_Missense_Mutation_p.E27K|RALGAPB_ENST00000397042.3_Missense_Mutation_p.E27K|RALGAPB_ENST00000397038.1_5'UTR			Q86X10	RLGPB_HUMAN	Ral GTPase activating protein, beta subunit (non-catalytic)	27					activation of Ral GTPase activity (GO:0032859)|membrane organization (GO:0061024)|Ral protein signal transduction (GO:0032484)|regulation of exocyst localization (GO:0060178)		protein heterodimerization activity (GO:0046982)|Ral GTPase activator activity (GO:0017123)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(29)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						CAGCTATCCAGAGAGCGTTGG	0.488																																						dbGAP											0													217.0	187.0	197.0					20																	37117154		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033045	CCDS13305.1, CCDS63272.1	20q11.23	2009-09-09	2009-09-09	2009-09-09	ENSG00000170471	ENSG00000170471			29221	protein-coding gene	gene with protein product			"""KIAA1219"""	KIAA1219		19520869	Standard	XM_005260462		Approved	DKFZp781M2411, RalGAPbeta	uc002xiw.3	Q86X10	OTTHUMG00000140270	ENST00000262879.6:c.79G>A	20.37:g.37117154G>A	ENSP00000262879:p.Glu27Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2E8|A2A2E9|Q5TG31|Q8N3D1|Q8WWC0|Q9H3X8|Q9UJR1|Q9ULK1|Q9Y3G9	Missense_Mutation	SNP	superfamily_ARM-type_fold,pfscan_Rap_GAP	p.E27K	ENST00000262879.6	37	c.79	CCDS13305.1	20	.	.	.	.	.	.	.	.	.	.	G	14.66	2.601109	0.46423	.	.	ENSG00000170471	ENST00000262879;ENST00000397042;ENST00000304939;ENST00000537204;ENST00000397040	.	.	.	5.44	5.44	0.79542	.	0.302038	0.36854	N	0.002372	T	0.52108	0.1714	L	0.36672	1.1	0.80722	D	1	B;B;B;B	0.13145	0.007;0.007;0.007;0.007	B;B;B;B	0.18561	0.015;0.022;0.022;0.022	T	0.50783	-0.8787	9	0.06365	T	0.9	.	19.6344	0.95724	0.0:0.0:1.0:0.0	.	27;27;27;27	B4E2E8;Q86X10-4;A2A2E9;Q86X10	.;.;.;RLGPB_HUMAN	K	27	.	ENSP00000262879:E27K	E	+	1	0	RALGAPB	36550568	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.413000	0.52686	2.709000	0.92574	0.637000	0.83480	GAG	RALGAPB	-	NULL	ENSG00000170471		0.488	RALGAPB-001	KNOWN	basic|CCDS	protein_coding	RALGAPB	HGNC	protein_coding	OTTHUMT00000079191.1	398	0.00	0	G	NM_020336		37117154	37117154	+1	no_errors	ENST00000262879	ensembl	human	known	69_37n	missense	313	19.54	76	SNP	1.000	A
RANBP17	64901	genome.wustl.edu	37	5	170722917	170722917	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:170722917G>A	ENST00000523189.1	+	27	3233	c.3069G>A	c.(3067-3069)ttG>ttA	p.L1023L	RANBP17_ENST00000521759.1_3'UTR	NM_022897.3	NP_075048.1	Q9H2T7	RBP17_HUMAN	RAN binding protein 17	1023					mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)	GTP binding (GO:0005525)	p.L1023F(1)		breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	50	Renal(175;0.000159)|Lung NSC(126;0.00751)|all_lung(126;0.0123)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GAGCAAGTTTGATAAACAGCC	0.527			T	TRD@	ALL																																	dbGAP		Dom	yes		5	5q34	64901	RAN binding protein 17		L	1	Substitution - Missense(1)	lung(1)											123.0	117.0	119.0					5																	170722917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF222747	CCDS34287.1	5q34	2009-01-12			ENSG00000204764	ENSG00000204764			14428	protein-coding gene	gene with protein product		606141				11024021	Standard	NM_022897		Approved		uc003mba.3	Q9H2T7	OTTHUMG00000163203	ENST00000523189.1:c.3069G>A	5.37:g.170722917G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IU74	Silent	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N	p.L1023	ENST00000523189.1	37	c.3069	CCDS34287.1	5																																																																																			RANBP17	-	NULL	ENSG00000204764		0.527	RANBP17-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RANBP17	HGNC	protein_coding	OTTHUMT00000372036.1	251	0.00	0	G	NM_022897		170722917	170722917	+1	no_errors	ENST00000523189	ensembl	human	known	69_37n	silent	185	18.06	41	SNP	0.999	A
RASAL3	64926	genome.wustl.edu	37	19	15563564	15563564	+	Silent	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:15563564G>T	ENST00000343625.7	-	16	2818	c.2733C>A	c.(2731-2733)ctC>ctA	p.L911L	WIZ_ENST00000389282.4_5'Flank|WIZ_ENST00000263381.7_5'Flank	NM_022904.1	NP_075055.1	Q86YV0	RASL3_HUMAN	RAS protein activator like 3	911					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)	Ras GTPase activator activity (GO:0005099)			breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|skin(1)	18						GCGACTCCACGAGGCGGGACA	0.647																																						dbGAP											0													19.0	23.0	21.0					19																	15563564		2132	4235	6367	-	-	-	SO:0001819	synonymous_variant	0				CCDS46006.1	19p13.12	2008-12-18			ENSG00000105122	ENSG00000105122			26129	protein-coding gene	gene with protein product						12477932	Standard	NM_022904		Approved	FLJ21438	uc002nbe.2	Q86YV0		ENST00000343625.7:c.2733C>A	19.37:g.15563564G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2T9|Q9H735	Silent	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RasGAP,pfscan_RasGAP	p.L911	ENST00000343625.7	37	c.2733	CCDS46006.1	19																																																																																			RASAL3	-	NULL	ENSG00000105122		0.647	RASAL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASAL3	HGNC	protein_coding	OTTHUMT00000461331.3	32	0.00	0	G	NM_022904		15563564	15563564	-1	no_errors	ENST00000343625	ensembl	human	known	69_37n	silent	18	25.00	6	SNP	0.954	T
RBM12	10137	genome.wustl.edu	37	20	34241075	34241075	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:34241075G>A	ENST00000374114.3	-	3	2433	c.2170C>T	c.(2170-2172)Cct>Tct	p.P724S	CPNE1_ENST00000397445.1_Intron|CPNE1_ENST00000397446.1_Intron|RBM12_ENST00000374104.3_Missense_Mutation_p.P724S|CPNE1_ENST00000397443.1_Intron|RBM12_ENST00000359646.1_Missense_Mutation_p.P724S|CPNE1_ENST00000317619.3_Intron|CPNE1_ENST00000317677.5_Intron|RP1-309K20.6_ENST00000541176.2_Intron|CPNE1_ENST00000397442.1_Intron|CPNE1_ENST00000352393.4_Intron	NM_001198838.1|NM_001198840.1|NM_006047.5	NP_001185767.1|NP_001185769.1|NP_006038.2	Q9NTZ6	RBM12_HUMAN	RNA binding motif protein 12	724	Gly-rich.|Pro-rich.					nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(7)|kidney(1)|large_intestine(3)|lung(14)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36	Lung NSC(9;0.00608)|all_lung(11;0.00918)		BRCA - Breast invasive adenocarcinoma(18;0.00953)			AAATTACCAGGAAAGTTAAAT	0.517																																						dbGAP											0													62.0	61.0	61.0					20																	34241075		2197	4293	6490	-	-	-	SO:0001583	missense	0			AJ289772	CCDS13261.1	20q11.21	2013-02-12			ENSG00000244462	ENSG00000244462		"""RNA binding motif (RRM) containing"""	9898	protein-coding gene	gene with protein product		607179				11435693	Standard	NM_006047		Approved	HRIHFB2091, KIAA0765, SWAN	uc021wcq.1	Q9NTZ6	OTTHUMG00000032350	ENST00000374114.3:c.2170C>T	20.37:g.34241075G>A	ENSP00000363228:p.Pro724Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRU2|E1P5R6|O94865|Q8N3B1|Q9H196	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P724S	ENST00000374114.3	37	c.2170	CCDS13261.1	20	.	.	.	.	.	.	.	.	.	.	G	11.82	1.752699	0.31046	.	.	ENSG00000244462	ENST00000374114;ENST00000359646;ENST00000374104;ENST00000349942	T;T;T	0.18338	2.22;2.22;2.22	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.14270	0.0345	L	0.32530	0.975	0.80722	D	1	P	0.43750	0.816	B	0.34590	0.186	T	0.03576	-1.1023	10	0.45353	T	0.12	-5.6694	18.5061	0.90898	0.0:0.0:1.0:0.0	.	724	Q9NTZ6	RBM12_HUMAN	S	724;724;724;523	ENSP00000363228:P724S;ENSP00000352668:P724S;ENSP00000363217:P724S	ENSP00000339879:P523S	P	-	1	0	RBM12	33704489	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.761000	0.62243	2.587000	0.87381	0.563000	0.77884	CCT	RBM12	-	NULL	ENSG00000244462		0.517	RBM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM12	HGNC	protein_coding	OTTHUMT00000078894.1	15	0.00	0	G	NM_006047		34241075	34241075	-1	no_errors	ENST00000359646	ensembl	human	known	69_37n	missense	7	36.36	4	SNP	1.000	A
RBM25	58517	genome.wustl.edu	37	14	73570127	73570127	+	Silent	SNP	A	A	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:73570127A>G	ENST00000261973.7	+	10	1380	c.1095A>G	c.(1093-1095)agA>agG	p.R365R	RBM25_ENST00000527432.1_Silent_p.R365R	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	365	Arg-rich.|Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		atcgagagagagaTCGTGACC	0.493																																						dbGAP											0													105.0	90.0	95.0					14																	73570127		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1095A>G	14.37:g.73570127A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Silent	SNP	pfam_PWI,pfam_RRM_dom,superfamily_PWI,smart_RRM_dom,smart_PWI,pfscan_RRM_dom	p.R365	ENST00000261973.7	37	c.1095	CCDS32113.1	14																																																																																			RBM25	-	NULL	ENSG00000119707		0.493	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	HGNC	protein_coding	OTTHUMT00000394966.1	177	0.00	0	A	XM_027330		73570127	73570127	+1	no_errors	ENST00000261973	ensembl	human	known	69_37n	silent	226	20.70	59	SNP	1.000	G
RBP1	5947	genome.wustl.edu	37	3	139244741	139244741	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:139244741C>T	ENST00000483943.2	-	3	442	c.442G>A	c.(442-444)Gaa>Aaa	p.E148K	RBP1_ENST00000232219.2_Intron|RP11-319G6.1_ENST00000515247.1_RNA	NM_001130993.1	NP_001124465.1	P09455	RET1_HUMAN	retinol binding protein 1, cellular	86					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	AAGCCAGTTTCACTCTAAAAG	0.403																																						dbGAP											0													41.0	42.0	42.0					3																	139244741		1567	3573	5140	-	-	-	SO:0001583	missense	0				CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000483943.2:c.442G>A	3.37:g.139244741C>T	ENSP00000424813:p.Glu148Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.E148K	ENST00000483943.2	37	c.442	CCDS46925.1	3	.	.	.	.	.	.	.	.	.	.	C	6.210	0.406960	0.11754	.	.	ENSG00000114115	ENST00000483943	T	0.13778	2.56	3.88	2.08	0.27032	.	.	.	.	.	T	0.04907	0.0132	N	0.01576	-0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34079	-0.9843	9	0.66056	D	0.02	.	6.2919	0.21065	0.0:0.7865:0.0:0.2135	.	148	E7EWV0	.	K	148	ENSP00000424813:E148K	ENSP00000424813:E148K	E	-	1	0	RBP1	140727431	0.000000	0.05858	0.000000	0.03702	0.903000	0.53119	-0.172000	0.09868	0.619000	0.30197	0.561000	0.74099	GAA	RBP1	-	NULL	ENSG00000114115		0.403	RBP1-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	RBP1	HGNC	protein_coding	OTTHUMT00000341497.2	193	0.00	0	C	NM_002899		139244741	139244741	-1	no_errors	ENST00000483943	ensembl	human	putative	69_37n	missense	166	17.82	36	SNP	0.000	T
RBP1	5947	genome.wustl.edu	37	3	139258551	139258551	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:139258551G>A	ENST00000483943.2	-	1	10	c.10C>T	c.(10-12)Ccc>Tcc	p.P4S	RP11-319G6.1_ENST00000381790.3_RNA|RBP1_ENST00000232219.2_Missense_Mutation_p.P4S|RP11-319G6.1_ENST00000515247.1_RNA|RBP1_ENST00000492918.1_Missense_Mutation_p.P4S	NM_001130993.1	NP_001124465.1	P09455	RET1_HUMAN	retinol binding protein 1, cellular	0					phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|vitamin A metabolic process (GO:0006776)	cytosol (GO:0005829)	retinal binding (GO:0016918)|retinoid binding (GO:0005501)|retinol binding (GO:0019841)|transporter activity (GO:0005215)			endometrium(1)|large_intestine(2)|lung(1)|prostate(1)	5					Acitretin(DB00459)|Vitamin A(DB00162)	AAGCCTGCGGGAGGATCCATT	0.711																																						dbGAP											0													6.0	9.0	8.0					3																	139258551		681	1576	2257	-	-	-	SO:0001583	missense	0				CCDS3110.2, CCDS46925.1, CCDS46926.1	3q21-q23	2013-03-01	2001-11-28		ENSG00000114115	ENSG00000114115		"""Fatty acid binding protein family"""	9919	protein-coding gene	gene with protein product		180260	"""retinol-binding protein 1, cellular"""			1654334, 9858824	Standard	NM_002899		Approved	CRABP-I, CRBP1, CRBP, RBPC, CRBPI	uc003eti.2	P09455	OTTHUMG00000155751	ENST00000483943.2:c.10C>T	3.37:g.139258551G>A	ENSP00000424813:p.Pro4Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q0|B7Z7A0|E7EWV0|F2Z2F2|Q6FGX8	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Fatty_acid-bd	p.P4S	ENST00000483943.2	37	c.10	CCDS46925.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.062159	0.76187	.	.	ENSG00000114115	ENST00000232219;ENST00000483943;ENST00000492918	T;T;T	0.27890	1.88;1.65;1.64	3.95	3.95	0.45737	.	.	.	.	.	T	0.28400	0.0702	N	0.08118	0	0.23132	N	0.998241	D;D	0.69078	0.991;0.997	P;P	0.58577	0.766;0.841	T	0.12218	-1.0556	9	0.33141	T	0.24	.	11.6661	0.51374	0.0:0.0:1.0:0.0	.	4;4	F2Z2F2;E7EWV0	.;.	S	4	ENSP00000232219:P4S;ENSP00000424813:P4S;ENSP00000429166:P4S	ENSP00000232219:P4S	P	-	1	0	RBP1	140741241	1.000000	0.71417	0.985000	0.45067	0.881000	0.50899	2.344000	0.44010	2.205000	0.71048	0.655000	0.94253	CCC	RBP1	-	NULL	ENSG00000114115		0.711	RBP1-003	PUTATIVE	basic|exp_conf|CCDS	protein_coding	RBP1	HGNC	protein_coding	OTTHUMT00000341497.2	11	0.00	0	G	NM_002899		139258551	139258551	-1	no_errors	ENST00000232219	ensembl	human	known	69_37n	missense	6	57.14	8	SNP	0.987	A
RCHY1	25898	genome.wustl.edu	37	4	76415808	76415808	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:76415808G>C	ENST00000324439.5	-	8	1038	c.640C>G	c.(640-642)Cag>Gag	p.Q214E	RCHY1_ENST00000514021.1_5'Flank|RCHY1_ENST00000451788.1_3'UTR|RCHY1_ENST00000380840.2_Missense_Mutation_p.Q174E|RCHY1_ENST00000512706.1_Missense_Mutation_p.Q192E|RCHY1_ENST00000513257.1_Missense_Mutation_p.Q205E	NM_001278536.1|NM_001278538.1|NM_001278539.1	NP_001265465.1|NP_001265467.1|NP_001265468.1	Q96PM5	ZN363_HUMAN	ring finger and CHY zinc finger domain containing 1, E3 ubiquitin protein ligase	214					positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(2)|pancreas(1)	3			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			GTCATGTTCTGATATTCTGAT	0.398																																						dbGAP											0													175.0	158.0	163.0					4																	76415808		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF255666	CCDS3567.1, CCDS34012.1, CCDS63990.1, CCDS63991.1, CCDS63992.1	4q21.1-q21.3	2014-02-17	2012-02-23	2004-03-30	ENSG00000163743	ENSG00000163743		"""RING-type (C3HC4) zinc fingers"""	17479	protein-coding gene	gene with protein product	"""androgen-receptor N-terminal-interacting protein"", ""p53-induced protein with a RING-H2 domain"", ""zinc finger, CHY-type"""	607680	"""zinc finger protein 363"", ""ring finger and CHY zinc finger domain containing 1"""	ZNF363		12654245	Standard	NM_015436		Approved	CHIMP, DKFZp586C1620, PRO1996, RNF199, ARNIP, PIRH2, ZCHY	uc003hik.3	Q96PM5	OTTHUMG00000130105	ENST00000324439.5:c.640C>G	4.37:g.76415808G>C	ENSP00000321239:p.Gln214Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRG3|C7E541|C7E542|C7E543|D3YRV2|E7EMC8|E7ETW5|J3KPI0|Q2KN33|Q59GN7|Q86X26|Q96PR5	Missense_Mutation	SNP	pfam_Znf_CHY,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q214E	ENST00000324439.5	37	c.640	CCDS3567.1	4	.	.	.	.	.	.	.	.	.	.	G	13.51	2.259894	0.39995	.	.	ENSG00000163743	ENST00000324439;ENST00000380840;ENST00000512706;ENST00000513257;ENST00000507014	T;T;T	0.29397	1.58;1.57;1.58	5.87	5.87	0.94306	.	0.107337	0.64402	D	0.000004	T	0.25306	0.0615	L	0.29908	0.895	0.80722	D	1	P;P;P;B	0.42871	0.792;0.688;0.792;0.047	B;B;B;B	0.40677	0.337;0.182;0.337;0.032	T	0.02220	-1.1193	10	0.12430	T	0.62	-18.8218	17.7022	0.88298	0.0:0.0:1.0:0.0	.	165;192;205;214	E7EMC8;E7ETW5;Q96PM5-2;Q96PM5	.;.;.;ZN363_HUMAN	E	214;174;192;205;165	ENSP00000321239:Q214E;ENSP00000370220:Q174E;ENSP00000423976:Q192E	ENSP00000321239:Q214E	Q	-	1	0	RCHY1	76634832	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.708000	0.61859	2.774000	0.95407	0.650000	0.86243	CAG	RCHY1	-	NULL	ENSG00000163743		0.398	RCHY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCHY1	HGNC	protein_coding	OTTHUMT00000252411.2	361	0.00	0	G	NM_015436		76415808	76415808	-1	no_errors	ENST00000324439	ensembl	human	known	69_37n	missense	269	17.74	58	SNP	1.000	C
REM1	28954	genome.wustl.edu	37	20	30064441	30064441	+	Missense_Mutation	SNP	G	G	A	rs575287565		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:30064441G>A	ENST00000201979.2	+	2	486	c.193G>A	c.(193-195)Gat>Aat	p.D65N	DEFB124_ENST00000481595.1_5'UTR	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	65					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TGCCCCAGATGATTGGTCTTC	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		16875	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													77.0	72.0	74.0					20																	30064441		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.193G>A	20.37:g.30064441G>A	ENSP00000201979:p.Asp65Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.D65N	ENST00000201979.2	37	c.193	CCDS13181.1	20	.	.	.	.	.	.	.	.	.	.	G	6.286	0.420936	0.11928	.	.	ENSG00000088320	ENST00000201979	T	0.65732	-0.17	4.63	-0.903	0.10534	.	1.107990	0.06729	N	0.776342	T	0.33469	0.0864	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19224	-1.0312	10	0.10636	T	0.68	.	8.1344	0.31046	0.6797:0.0:0.3203:0.0	.	65	O75628	REM1_HUMAN	N	65	ENSP00000201979:D65N	ENSP00000201979:D65N	D	+	1	0	REM1	29528102	0.000000	0.05858	0.000000	0.03702	0.482000	0.33219	-0.202000	0.09451	-0.020000	0.14032	0.563000	0.77884	GAT	REM1	-	pirsf_Small_GTPase_GEM/REM/Rad	ENSG00000088320		0.602	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REM1	HGNC	protein_coding	OTTHUMT00000078508.2	245	0.00	0	G	NM_014012		30064441	30064441	+1	no_errors	ENST00000201979	ensembl	human	known	69_37n	missense	166	25.23	56	SNP	0.000	A
REV3L	5980	genome.wustl.edu	37	6	111695851	111695851	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:111695851C>G	ENST00000358835.3	-	14	4161	c.3707G>C	c.(3706-3708)gGt>gCt	p.G1236A	REV3L_ENST00000368805.1_Missense_Mutation_p.G1236A|REV3L_ENST00000435970.1_Missense_Mutation_p.G1158A|REV3L_ENST00000368802.3_Missense_Mutation_p.G1236A			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1236					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AACCTCAGCACCAGACTGAGA	0.353								DNA polymerases (catalytic subunits)																														dbGAP											0													82.0	84.0	83.0					6																	111695851		2202	4298	6500	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.3707G>C	6.37:g.111695851C>G	ENSP00000351697:p.Gly1236Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.G1236A	ENST00000358835.3	37	c.3707	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	11.57	1.677863	0.29783	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.01455	4.96;4.96;4.96;4.87	4.95	3.13	0.36017	Ribonuclease H-like (1);	0.721431	0.13500	N	0.383367	T	0.00384	0.0012	N	0.12182	0.205	0.22796	N	0.998721	B	0.02656	0.0	B	0.04013	0.001	T	0.41324	-0.9515	10	0.12430	T	0.62	.	8.2876	0.31939	0.0:0.6672:0.1689:0.1639	.	1236	O60673	DPOLZ_HUMAN	A	1236;1236;1236;1158	ENSP00000357792:G1236A;ENSP00000357795:G1236A;ENSP00000351697:G1236A;ENSP00000402003:G1158A	ENSP00000351697:G1236A	G	-	2	0	REV3L	111802544	0.002000	0.14202	1.000000	0.80357	0.993000	0.82548	0.557000	0.23454	1.217000	0.43442	0.655000	0.94253	GGT	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.353	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	164	0.00	0	C	NM_002912		111695851	111695851	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	109	36.78	64	SNP	0.881	G
RHOT1	55288	genome.wustl.edu	37	17	30500868	30500868	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:30500868G>C	ENST00000333942.6	+	3	354	c.115G>C	c.(115-117)Gaa>Caa	p.E39Q	RHOT1_ENST00000583994.1_5'UTR|RHOT1_ENST00000354266.3_Missense_Mutation_p.E18Q|RHOT1_ENST00000545287.2_Missense_Mutation_p.E39Q|RHOT1_ENST00000358365.3_Missense_Mutation_p.E39Q|RHOT1_ENST00000394692.2_Missense_Mutation_p.E39Q|RHOT1_ENST00000580976.1_Intron|RHOT1_ENST00000581094.1_Missense_Mutation_p.E39Q	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	39	Miro 1.				cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				CCGGGCAGAAGAAATCACCAT	0.348																																						dbGAP											0													98.0	97.0	97.0					17																	30500868		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.115G>C	17.37:g.30500868G>C	ENSP00000334724:p.Glu39Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Missense_Mutation	SNP	pfam_MIRO-like,pfam_EF_hand_assoc_2,pfam_EF_hand_assoc_1,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_EF_hand_Ca-bd,pirsf_Small_GTPase_Miro,pfscan_EF_HAND_2,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.E39Q	ENST00000333942.6	37	c.115	CCDS32612.1	17	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958482	0.53400	.	.	ENSG00000126858	ENST00000358365;ENST00000354266;ENST00000394692;ENST00000333942;ENST00000545287	T;T;T;T;T	0.76968	-1.06;-1.03;-1.06;-1.06;-1.06	5.57	5.57	0.84162	Small GTP-binding protein domain (1);MIRO (1);	0.000000	0.85682	D	0.000000	D	0.87892	0.6292	M	0.70842	2.15	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.998;0.999	D;D;D;D	0.79784	0.987;0.993;0.972;0.986	D	0.87441	0.2395	10	0.51188	T	0.08	-15.4554	19.622	0.95660	0.0:0.0:1.0:0.0	.	39;39;39;39	Q8IXI2-2;Q8IXI2;Q8IXI2-5;Q8IXI2-3	.;MIRO1_HUMAN;.;.	Q	39	ENSP00000351132:E39Q;ENSP00000346215:E39Q;ENSP00000378184:E39Q;ENSP00000334724:E39Q;ENSP00000439737:E39Q	ENSP00000334724:E39Q	E	+	1	0	RHOT1	27524981	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	9.563000	0.98148	2.634000	0.89283	0.644000	0.83932	GAA	RHOT1	-	pfam_MIRO-like,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_Miro,tigrfam_Small_GTP-bd_dom	ENSG00000126858		0.348	RHOT1-001	KNOWN	basic|CCDS	protein_coding	RHOT1	HGNC	protein_coding	OTTHUMT00000447097.1	214	0.00	0	G	NM_018307		30500868	30500868	+1	no_errors	ENST00000358365	ensembl	human	known	69_37n	missense	112	23.49	35	SNP	1.000	C
RHOT1	55288	genome.wustl.edu	37	17	30551656	30551656	+	Silent	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:30551656C>G	ENST00000333942.6	+	19	2000	c.1761C>G	c.(1759-1761)ctC>ctG	p.L587L	RHOT1_ENST00000583994.1_Silent_p.L492L|RHOT1_ENST00000354266.3_Silent_p.L566L|RHOT1_ENST00000545287.2_Silent_p.L628L|RHOT1_ENST00000358365.3_Silent_p.L660L|RHOT1_ENST00000394692.2_Silent_p.L619L	NM_018307.3	NP_060777.3	Q8IXI2	MIRO1_HUMAN	ras homolog family member T1	587				L -> P (in Ref. 2; CAD56956). {ECO:0000305}.	cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	28		Myeloproliferative disorder(56;0.0255)|Breast(31;0.116)|Ovarian(249;0.182)				AAGCTGACCTCAAGAGCTCCA	0.368																																						dbGAP											0													148.0	124.0	132.0					17																	30551656		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ517412	CCDS32610.1, CCDS32611.1, CCDS32612.1, CCDS74030.1, CCDS74031.1	17q11.2-q12	2013-01-10	2012-02-27	2004-03-24		ENSG00000126858		"""EF-hand domain containing"""	21168	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 1"""	613888	"""ras homolog gene family, member T1"""	ARHT1		12482879	Standard	NM_001033567		Approved	MIRO-1, FLJ11040	uc002hgw.3	Q8IXI2		ENST00000333942.6:c.1761C>G	17.37:g.30551656C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4FVB6|A6NFV0|B4DG48|J9JIH9|Q6NUR3|Q6P9F8|Q6PJG1|Q6YMW8|Q86UB0|Q8IW28|Q8IXJ7|Q9H067|Q9H9N8|Q9NUZ2	Silent	SNP	pfam_MIRO-like,pfam_EF_hand_assoc_2,pfam_EF_hand_assoc_1,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_EF_hand_Ca-bd,pirsf_Small_GTPase_Miro,pfscan_EF_HAND_2,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L660	ENST00000333942.6	37	c.1980	CCDS32612.1	17																																																																																			RHOT1	-	NULL	ENSG00000126858		0.368	RHOT1-001	KNOWN	basic|CCDS	protein_coding	RHOT1	HGNC	protein_coding	OTTHUMT00000447097.1	369	0.27	1	C	NM_018307		30551656	30551656	+1	no_errors	ENST00000358365	ensembl	human	known	69_37n	silent	221	28.62	89	SNP	1.000	G
RNASE11	122651	genome.wustl.edu	37	14	21052286	21052286	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr14:21052286C>G	ENST00000610205.1	-	3	531	c.348G>C	c.(346-348)tgG>tgC	p.W116C	RNASE11_ENST00000398009.2_Missense_Mutation_p.W116C|RNASE11_ENST00000432835.2_Missense_Mutation_p.W116C|RNASE11_ENST00000553849.1_Missense_Mutation_p.W116C|RNASE11_ENST00000555841.1_Missense_Mutation_p.W116C|RNASE11_ENST00000398008.2_Missense_Mutation_p.W116C	NM_145250.3	NP_660293.1	Q8TAA1	RNS11_HUMAN	ribonuclease, RNase A family, 11 (non-active)	116	Substrate binding. {ECO:0000250}.					extracellular region (GO:0005576)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(6)|lung(7)|ovary(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	21	all_cancers(95;0.00238)	all_lung(585;0.235)	Epithelial(56;1.85e-06)|all cancers(55;1.46e-05)	GBM - Glioblastoma multiforme(265;0.0139)		AGTTATTGCTCCACTTGCACG	0.493																																						dbGAP											0													109.0	92.0	98.0					14																	21052286		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025410	CCDS9553.1	14q11.1	2013-08-05	2004-11-18	2004-11-18	ENSG00000173464	ENSG00000173464		"""Ribonucleases, RNase A"""	19269	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 6"""	C14orf6			Standard	NM_145250		Approved		uc001vxs.3	Q8TAA1	OTTHUMG00000170990	ENST00000610205.1:c.348G>C	14.37:g.21052286C>G	ENSP00000476537:p.Trp116Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain	p.W116C	ENST00000610205.1	37	c.348	CCDS9553.1	14	.	.	.	.	.	.	.	.	.	.	C	8.130	0.782911	0.16189	.	.	ENSG00000173464	ENST00000335950;ENST00000553849;ENST00000555841;ENST00000398009;ENST00000398008;ENST00000432835;ENST00000443456;ENST00000557503;ENST00000557105;ENST00000413502;ENST00000554842	T;T;T;T;T;T;T;T;T;D;T	0.94650	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;-3.48;0.99	3.94	0.0121	0.14090	Ribonuclease A, domain (3);	1.653540	0.03400	N	0.203269	D	0.87434	0.6176	N	0.08118	0	0.09310	N	1	P	0.43392	0.805	B	0.42138	0.377	T	0.81673	-0.0826	10	0.56958	D	0.05	0.0609	3.8662	0.09018	0.0:0.5079:0.1801:0.312	.	116	Q8TAA1	RNS11_HUMAN	C	116	ENSP00000338288:W116C;ENSP00000451318:W116C;ENSP00000451563:W116C;ENSP00000381093:W116C;ENSP00000381092:W116C;ENSP00000395210:W116C;ENSP00000401398:W116C;ENSP00000451839:W116C;ENSP00000452412:W116C;ENSP00000415954:W116C;ENSP00000451466:W116C	ENSP00000338288:W116C	W	-	3	0	RNASE11	20122126	0.000000	0.05858	0.000000	0.03702	0.016000	0.09150	-0.307000	0.08167	-0.003000	0.14444	0.511000	0.50034	TGG	RNASE11	-	pfam_RNaseA_domain,superfamily_RNaseA_domain	ENSG00000173464		0.493	RNASE11-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE11	HGNC	protein_coding	OTTHUMT00000073662.3	205	0.00	0	C	NM_145250		21052286	21052286	-1	no_errors	ENST00000335950	ensembl	human	known	69_37n	missense	154	22.00	44	SNP	0.000	G
RNF43	54894	genome.wustl.edu	37	17	56435317	56435317	+	Missense_Mutation	SNP	G	G	A	rs200066146		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:56435317G>A	ENST00000584437.1	-	8	3775	c.1820C>T	c.(1819-1821)tCg>tTg	p.S607L	RNF43_ENST00000583753.1_Missense_Mutation_p.S566L|RNF43_ENST00000407977.2_Missense_Mutation_p.S607L|RNF43_ENST00000581868.1_Missense_Mutation_p.S480L|RNF43_ENST00000577716.1_Missense_Mutation_p.S607L|RNF43_ENST00000577625.1_Missense_Mutation_p.S480L|BZRAP1-AS1_ENST00000583841.1_RNA|RNF43_ENST00000500597.2_Missense_Mutation_p.S566L			Q68DV7	RNF43_HUMAN	ring finger protein 43	607	Pro-rich.				negative regulation of Wnt signaling pathway (GO:0030178)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|stem cell proliferation (GO:0072089)|Wnt receptor catabolic process (GO:0038018)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	frizzled binding (GO:0005109)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.S607L(2)		NS(1)|biliary_tract(5)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(14)|lung(9)|ovary(2)|pancreas(10)|prostate(1)|skin(4)	60	Medulloblastoma(34;0.127)|all_neural(34;0.237)					GAGCCGCCCCGAAGGGGCTGC	0.647													G|||	1	0.000199681	0.0	0.0	5008	,	,		14248	0.001		0.0	False		,,,				2504	0.0					dbGAP											2	Substitution - Missense(2)	lung(1)|endometrium(1)											52.0	64.0	60.0					17																	56435317		2197	4292	6489	-	-	-	SO:0001583	missense	0				CCDS11607.1	17q23.2	2013-01-09						"""RING-type (C3HC4) zinc fingers"""	18505	protein-coding gene	gene with protein product		612482					Standard	NM_017763		Approved	FLJ20315, DKFZp781H0392, URCC	uc002iwh.4	Q68DV7		ENST00000584437.1:c.1820C>T	17.37:g.56435317G>A	ENSP00000463069:p.Ser607Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4R2|B7Z443|B7Z5D5|B7Z5J5|Q65ZA4|Q6AI04|Q9NXD0	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S607L	ENST00000584437.1	37	c.1820	CCDS11607.1	17	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	9.960	1.222639	0.22457	.	.	ENSG00000108375	ENST00000407977;ENST00000500597	T;T	0.19250	2.16;2.16	5.45	4.48	0.54585	.	0.797881	0.11396	N	0.568346	T	0.16342	0.0393	L	0.27053	0.805	0.09310	N	1	B;B;B	0.18310	0.007;0.027;0.004	B;B;B	0.12837	0.002;0.008;0.001	T	0.16630	-1.0396	10	0.51188	T	0.08	-7.2722	9.977	0.41791	0.0939:0.0:0.9061:0.0	.	566;607;607	Q68DV7-2;Q68DV7-4;Q68DV7	.;.;RNF43_HUMAN	L	607;566	ENSP00000385328:S607L;ENSP00000441969:S566L	ENSP00000385328:S607L	S	-	2	0	RNF43	53790316	0.002000	0.14202	0.077000	0.20336	0.177000	0.22998	1.155000	0.31700	1.309000	0.44985	0.205000	0.17691	TCG	RNF43	-	NULL	ENSG00000108375		0.647	RNF43-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF43	HGNC	protein_coding	OTTHUMT00000444713.1	181	0.00	0	G	NM_017763		56435317	56435317	-1	no_errors	ENST00000407977	ensembl	human	known	69_37n	missense	87	23.68	27	SNP	0.095	A
RNF157	114804	genome.wustl.edu	37	17	74154505	74154505	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:74154505G>A	ENST00000269391.6	-	13	1514	c.1382C>T	c.(1381-1383)tCt>tTt	p.S461F	RNF157_ENST00000319945.6_Missense_Mutation_p.S461F	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	461	Ser-rich.						zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			CGGTCTCTGAGAGAGCTGTGT	0.527																																					GBM(186;507 2120 27388 27773 52994)	dbGAP											0													148.0	129.0	135.0					17																	74154505		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.1382C>T	17.37:g.74154505G>A	ENSP00000269391:p.Ser461Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB72|Q96N56	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.S461F	ENST00000269391.6	37	c.1382	CCDS32740.1	17	.	.	.	.	.	.	.	.	.	.	G	19.33	3.807868	0.70797	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.26660	1.72;1.75	5.7	5.7	0.88788	.	0.243130	0.44688	D	0.000424	T	0.27489	0.0675	L	0.44542	1.39	0.80722	D	1	P;P	0.39903	0.547;0.694	B;B	0.37888	0.26;0.189	T	0.02625	-1.1132	10	0.59425	D	0.04	-10.4518	18.8209	0.92097	0.0:0.0:1.0:0.0	.	461;461	Q96PX1-2;Q96PX1	.;RN157_HUMAN	F	461	ENSP00000269391:S461F;ENSP00000321837:S461F	ENSP00000269391:S461F	S	-	2	0	RNF157	71666100	0.985000	0.35326	0.056000	0.19401	0.702000	0.40608	4.551000	0.60740	2.670000	0.90874	0.655000	0.94253	TCT	RNF157	-	NULL	ENSG00000141576		0.527	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF157	HGNC	protein_coding	OTTHUMT00000255874.2	147	0.00	0	G	XM_290732		74154505	74154505	-1	no_errors	ENST00000269391	ensembl	human	known	69_37n	missense	65	28.26	26	SNP	0.432	A
RPAP1	26015	genome.wustl.edu	37	15	41821754	41821754	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:41821754G>A	ENST00000304330.4	-	9	1188	c.1072C>T	c.(1072-1074)Cga>Tga	p.R358*	RPAP1_ENST00000561603.1_Nonsense_Mutation_p.R358*|RPAP1_ENST00000568413.1_5'UTR	NM_015540.2	NP_056355.2	Q9BWH6	RPAP1_HUMAN	RNA polymerase II associated protein 1	358						nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			NS(1)|breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	45		all_cancers(109;6.59e-20)|all_epithelial(112;7.67e-17)|Lung NSC(122;5.34e-11)|all_lung(180;4.17e-10)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		OV - Ovarian serous cystadenocarcinoma(18;2.84e-17)|GBM - Glioblastoma multiforme(113;1.68e-06)|Colorectal(105;0.0163)|BRCA - Breast invasive adenocarcinoma(123;0.117)		AGACTGAATCGAGCCTGCATC	0.597																																						dbGAP											0													45.0	41.0	42.0					15																	41821754		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC000246	CCDS10079.1	15q14	2004-03-16			ENSG00000103932	ENSG00000103932			24567	protein-coding gene	gene with protein product		611475				10718198	Standard	XM_005254297		Approved	DKFZP727M111, KIAA1403, MGC858, FLJ12732	uc001zod.3	Q9BWH6	OTTHUMG00000130342	ENST00000304330.4:c.1072C>T	15.37:g.41821754G>A	ENSP00000306123:p.Arg358*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9I2|Q9NSQ5|Q9P2E4|Q9UFS7	Nonsense_Mutation	SNP	pfam_RNA_pol_II_AP1_C,pfam_RNA_pol_II_AP1_N,superfamily_ARM-type_fold	p.R358*	ENST00000304330.4	37	c.1072	CCDS10079.1	15	.	.	.	.	.	.	.	.	.	.	G	37	6.531335	0.97641	.	.	ENSG00000103932	ENST00000304330	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.7584	12.2518	0.54601	0.0:0.0:0.8298:0.1702	.	.	.	.	X	358	.	ENSP00000306123:R358X	R	-	1	2	RPAP1	39609046	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.569000	0.60865	2.578000	0.87016	0.655000	0.94253	CGA	RPAP1	-	pfam_RNA_pol_II_AP1_C	ENSG00000103932		0.597	RPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP1	HGNC	protein_coding	OTTHUMT00000252694.2	125	0.00	0	G	NM_015540		41821754	41821754	-1	no_errors	ENST00000304330	ensembl	human	known	69_37n	nonsense	112	18.12	25	SNP	1.000	A
RPAP3	79657	genome.wustl.edu	37	12	48062806	48062806	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:48062806G>A	ENST00000005386.3	-	14	1721	c.1606C>T	c.(1606-1608)Cag>Tag	p.Q536*	RPAP3_ENST00000380650.4_Nonsense_Mutation_p.Q502*|RPAP3_ENST00000432584.3_Nonsense_Mutation_p.Q377*	NM_024604.2	NP_078880.2	Q9H6T3	RPAP3_HUMAN	RNA polymerase II associated protein 3	536										endometrium(2)|large_intestine(4)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16	Lung SC(27;0.192)					GTGGCAAACTGAGCAGGTTTT	0.408																																						dbGAP											0													169.0	170.0	170.0					12																	48062806		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK025561	CCDS8753.1, CCDS53782.1, CCDS53783.1	12q13.11	2013-01-10				ENSG00000005175		"""Tetratricopeptide (TTC) repeat domain containing"""	26151	protein-coding gene	gene with protein product		611477				17643375	Standard	NM_024604		Approved	FLJ21908, spag	uc001rpr.3	Q9H6T3	OTTHUMG00000169668	ENST00000005386.3:c.1606C>T	12.37:g.48062806G>A	ENSP00000005386:p.Gln536*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRW9|Q6PHR5	Nonsense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q536*	ENST00000005386.3	37	c.1606	CCDS8753.1	12	.	.	.	.	.	.	.	.	.	.	G	38	7.134827	0.98085	.	.	ENSG00000005175	ENST00000005386;ENST00000432584;ENST00000380650	.	.	.	5.85	4.95	0.65309	.	3.812180	0.00397	N	0.000056	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	10.759	0.46253	0.0:0.1426:0.7092:0.1481	.	.	.	.	X	536;377;502	.	ENSP00000005386:Q536X	Q	-	1	0	RPAP3	46349073	0.417000	0.25432	0.355000	0.25773	0.311000	0.27955	1.876000	0.39588	1.441000	0.47550	0.643000	0.83706	CAG	RPAP3	-	NULL	ENSG00000005175		0.408	RPAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPAP3	HGNC	protein_coding	OTTHUMT00000405340.1	539	0.00	0	G	NM_024604		48062806	48062806	-1	no_errors	ENST00000005386	ensembl	human	known	69_37n	nonsense	358	19.73	88	SNP	0.032	A
RPL10	6134	genome.wustl.edu	37	X	153628919	153628919	+	Silent	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:153628919G>C	ENST00000369817.2	+	7	1020	c.444G>C	c.(442-444)gtG>gtC	p.V148V	SNORA70_ENST00000384436.1_RNA|RPL10_ENST00000406022.2_Silent_p.V97V|RPL10_ENST00000424325.2_Silent_p.V148V			P27635	RL10_HUMAN	ribosomal protein L10	148					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			large_intestine(1)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					AGGAGCATGTGATTGAGGCCC	0.587																																						dbGAP											0													107.0	102.0	104.0					X																	153628919		2202	4297	6499	-	-	-	SO:0001819	synonymous_variant	0			AB007170	CCDS14746.1, CCDS76059.1	Xq28	2011-04-06			ENSG00000147403	ENSG00000147403		"""L ribosomal proteins"""	10298	protein-coding gene	gene with protein product		312173				9582194	Standard	NM_006013		Approved	NOV, QM, DXS648E, DXS648, FLJ23544, L10	uc004fkm.2	P27635	OTTHUMG00000033189	ENST00000369817.2:c.444G>C	X.37:g.153628919G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A3KQT0|D3DWW6|Q16470|Q2HXT7|Q53FH7|Q6FGN8|Q8TDA5	Silent	SNP	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	p.V148	ENST00000369817.2	37	c.444	CCDS14746.1	X																																																																																			RPL10	-	pfam_Ribosomal_L10e/L16,superfamily_Ribosomal_L10e/L16,pirsf_Ribosomal_L10e,tigrfam_Ribosomal_L10e	ENSG00000147403		0.587	RPL10-008	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10	HGNC	protein_coding	OTTHUMT00000127774.5	196	0.51	1	G	NM_006013		153628919	153628919	+1	no_errors	ENST00000344746	ensembl	human	known	69_37n	silent	162	22.86	48	SNP	1.000	C
RRN3P1	730092	genome.wustl.edu	37	16	21812131	21812131	+	RNA	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:21812131G>C	ENST00000546471.1	-	0	1727							Q2M238	RN3P1_HUMAN	RNA polymerase I transcription factor homolog (S. cerevisiae) pseudogene 1																		TTTTTCCAAAGATGTTCCAAA	0.378																																						dbGAP											0																																										-	-	-			0					16p12.2	2012-10-16			ENSG00000248124	ENSG00000248124			30548	pseudogene	pseudogene						12477932	Standard	NR_003370		Approved		uc010vbl.1	Q2M238	OTTHUMG00000170417		16.37:g.21812131G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T4|B3KWX9|O75704	RNA	SNP	-	NULL	ENST00000546471.1	37	NULL		16																																																																																			RRN3P1	-	-	ENSG00000248124		0.378	RRN3P1-002	KNOWN	basic	processed_transcript	RRN3P1	HGNC	pseudogene	OTTHUMT00000409035.1	107	0.00	0	G	NR_003370		21812131	21812131	-1	no_errors	ENST00000546471	ensembl	human	known	69_37n	rna	61	23.75	19	SNP	1.000	C
RRNAD1	51093	genome.wustl.edu	37	1	156699007	156699007	+	Splice_Site	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:156699007C>G	ENST00000368216.4	+	1	741	c.111C>G	c.(109-111)atC>atG	p.I37M	RRNAD1_ENST00000524343.1_Splice_Site_p.I37M|ISG20L2_ENST00000313146.6_5'Flank|RRNAD1_ENST00000368218.4_Splice_Site_p.I37M|ISG20L2_ENST00000368219.1_5'Flank|RRNAD1_ENST00000476229.1_5'Flank	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	37						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						CCTACATCATCGTGAGGCCAC	0.577																																						dbGAP											0													72.0	56.0	61.0					1																	156699007		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.111+1C>G	1.37:g.156699007C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	NULL	p.I37M	ENST00000368216.4	37	c.111	CCDS1154.1	1	.	.	.	.	.	.	.	.	.	.	C	11.52	1.663120	0.29515	.	.	ENSG00000143303	ENST00000368218;ENST00000368216;ENST00000519086;ENST00000524343	T	0.50001	0.76	4.6	1.44	0.22558	.	0.110120	0.64402	D	0.000015	T	0.43188	0.1236	L	0.50333	1.59	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.71870	0.959;0.975	T	0.44034	-0.9354	10	0.66056	D	0.02	-16.8574	5.5546	0.17109	0.0:0.5047:0.0:0.4953	.	37;37	Q4VX71;Q96FB5	.;RRNAD_HUMAN	M	37	ENSP00000357199:I37M	ENSP00000357199:I37M	I	+	3	3	RRNAD1	154965631	0.988000	0.35896	1.000000	0.80357	0.968000	0.65278	0.071000	0.14594	0.565000	0.29255	0.561000	0.74099	ATC	RRNAD1	-	NULL	ENSG00000143303		0.577	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	122	0.00	0	C	NM_015997	Missense_Mutation	156699007	156699007	+1	no_errors	ENST00000368216	ensembl	human	known	69_37n	missense	139	10.90	17	SNP	1.000	G
RSPH4A	345895	genome.wustl.edu	37	6	116938343	116938343	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:116938343C>G	ENST00000229554.5	+	1	694	c.557C>G	c.(556-558)tCa>tGa	p.S186*	RSPH4A_ENST00000368581.4_Nonsense_Mutation_p.S186*|RSPH4A_ENST00000368580.4_Nonsense_Mutation_p.S186*	NM_001010892.2	NP_001010892.1	Q5TD94	RSH4A_HUMAN	radial spoke head 4 homolog A (Chlamydomonas)	186					axoneme assembly (GO:0035082)|cilium movement (GO:0003341)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleus (GO:0005634)|radial spoke (GO:0001534)				breast(1)|endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GAGGAAGACTCAAACAGTGAC	0.512									Kartagener syndrome																													dbGAP											0													118.0	124.0	122.0					6																	116938343		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome		CCDS34521.1, CCDS55051.1	6q22.1	2012-05-03	2009-02-17	2009-02-17	ENSG00000111834	ENSG00000111834			21558	protein-coding gene	gene with protein product		612647	"""radial spokehead-like 3"""	RSHL3		19200523	Standard	NM_001010892		Approved	dJ412I7.1, FLJ37974, RSPH6B, CILD11	uc003pxe.2	Q5TD94	OTTHUMG00000015444	ENST00000229554.5:c.557C>G	6.37:g.116938343C>G	ENSP00000229554:p.Ser186*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSI1|Q3KP24|Q5TD95	Nonsense_Mutation	SNP	pfam_Radial_spoke	p.S186*	ENST00000229554.5	37	c.557	CCDS34521.1	6	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708964	0.68615	.	.	ENSG00000111834	ENST00000368581;ENST00000229554;ENST00000368580	.	.	.	5.27	3.42	0.39159	.	0.855444	0.09904	N	0.740659	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33940	T	0.23	-3.0693	11.6685	0.51387	0.0:0.6541:0.3459:0.0	.	.	.	.	X	186	.	ENSP00000229554:S186X	S	+	2	0	RSPH4A	117045036	0.007000	0.16637	0.002000	0.10522	0.156000	0.22039	1.285000	0.33261	0.742000	0.32697	0.467000	0.42956	TCA	RSPH4A	-	NULL	ENSG00000111834		0.512	RSPH4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH4A	HGNC	protein_coding	OTTHUMT00000041960.1	181	0.00	0	C	NM_001010892		116938343	116938343	+1	no_errors	ENST00000229554	ensembl	human	known	69_37n	nonsense	170	19.25	41	SNP	0.003	G
RUSC1	23623	genome.wustl.edu	37	1	155294933	155294933	+	Silent	SNP	C	C	T	rs376024390		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:155294933C>T	ENST00000368352.5	+	4	1648	c.1497C>T	c.(1495-1497)atC>atT	p.I499I	RUSC1_ENST00000368349.4_Silent_p.I30I|RUSC1_ENST00000292254.4_Silent_p.I30I|RUSC1_ENST00000462780.1_3'UTR|RUSC1_ENST00000368354.3_Silent_p.I499I|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368347.4_Silent_p.I89I|RUSC1-AS1_ENST00000443642.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1	499	Interaction with TRAF6.				positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			ATAAAATCATCTCGCATTTCG	0.627											OREG0013860	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													97.0	109.0	105.0					1																	155294933		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1497C>T	1.37:g.155294933C>T		Somatic	1769	WXS	Illumina GAIIx	Phase_IV	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	Silent	SNP	pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Run,smart_SH3_domain,pfscan_Run,pfscan_SH3_domain	p.I499	ENST00000368352.5	37	c.1497	CCDS41410.1	1																																																																																			RUSC1	-	NULL	ENSG00000160753		0.627	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1	HGNC	protein_coding	OTTHUMT00000039071.1	176	0.00	0	C			155294933	155294933	+1	no_errors	ENST00000368352	ensembl	human	known	69_37n	silent	186	13.08	28	SNP	1.000	T
SCAF11	9169	genome.wustl.edu	37	12	46321241	46321241	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:46321241G>A	ENST00000369367.3	-	11	2476	c.2243C>T	c.(2242-2244)tCt>tTt	p.S748F	SCAF11_ENST00000549162.1_Missense_Mutation_p.S556F|SCAF11_ENST00000419565.2_Missense_Mutation_p.S748F|SCAF11_ENST00000550629.1_5'Flank|SCAF11_ENST00000465950.1_Missense_Mutation_p.S433F	NM_004719.2	NP_004710.2	Q99590	SCAFB_HUMAN	SR-related CTD-associated factor 11	748					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(8)|large_intestine(17)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	69						GTGTGTCACAGAATTTTCATT	0.358																																						dbGAP											0													135.0	129.0	131.0					12																	46321241		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11251	CCDS8748.2	12q13.11	2013-01-09	2011-01-10	2011-01-10	ENSG00000139218	ENSG00000139218		"""RING-type (C3HC4) zinc fingers"""	10784	protein-coding gene	gene with protein product		603668	"""splicing factor, arginine/serine-rich 2, interacting protein"", ""serine/arginine-rich splicing factor 2, interacting protein"""	SFRS2IP, SRSF2IP		9224939, 9447963	Standard	NM_004719		Approved	SIP1, SRRP129, CASP11	uc001rox.3	Q99590	OTTHUMG00000149930	ENST00000369367.3:c.2243C>T	12.37:g.46321241G>A	ENSP00000358374:p.Ser748Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEU9|A6NLW5|Q8IW59	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.S748F	ENST00000369367.3	37	c.2243	CCDS8748.2	12	.	.	.	.	.	.	.	.	.	.	G	8.123	0.781434	0.16120	.	.	ENSG00000139218	ENST00000465950;ENST00000369367;ENST00000549162;ENST00000419565;ENST00000547018	T;T;T;T;T	0.54279	1.24;1.98;1.24;1.98;0.58	5.21	2.29	0.28610	.	0.390690	0.24884	N	0.034831	T	0.43500	0.1250	L	0.51422	1.61	0.09310	N	1	B;B	0.20671	0.047;0.006	B;B	0.20955	0.032;0.007	T	0.42816	-0.9429	10	0.87932	D	0	-4.1884	7.3577	0.26729	0.14:0.262:0.5979:0.0	.	556;748	F8VXG7;Q99590	.;SCAFB_HUMAN	F	433;748;556;748;688	ENSP00000449812:S433F;ENSP00000358374:S748F;ENSP00000448864:S556F;ENSP00000413036:S748F;ENSP00000446746:S688F	ENSP00000358374:S748F	S	-	2	0	SCAF11	44607508	0.996000	0.38824	0.004000	0.12327	0.159000	0.22180	4.548000	0.60718	0.389000	0.25086	0.655000	0.94253	TCT	SCAF11	-	NULL	ENSG00000139218		0.358	SCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAF11	HGNC	protein_coding	OTTHUMT00000313992.2	259	0.00	0	G	NM_004719		46321241	46321241	-1	no_errors	ENST00000369367	ensembl	human	known	69_37n	missense	255	16.67	51	SNP	0.069	A
SCN5A	6331	genome.wustl.edu	37	3	38627460	38627460	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:38627460C>T	ENST00000333535.4	-	16	2658	c.2509G>A	c.(2509-2511)Ggg>Agg	p.G837R	SCN5A_ENST00000425664.1_Missense_Mutation_p.G837R|SCN5A_ENST00000414099.2_Missense_Mutation_p.G837R|SCN5A_ENST00000443581.1_Missense_Mutation_p.G837R|SCN5A_ENST00000423572.2_Missense_Mutation_p.G837R|SCN5A_ENST00000449557.2_Missense_Mutation_p.G837R|SCN5A_ENST00000413689.1_Missense_Mutation_p.G837R|SCN5A_ENST00000450102.2_Missense_Mutation_p.G837R|SCN5A_ENST00000455624.2_Missense_Mutation_p.G837R|SCN5A_ENST00000451551.2_Missense_Mutation_p.G837R			Q14524	SCN5A_HUMAN	sodium channel, voltage-gated, type V, alpha subunit	837					AV node cell to bundle of His cell communication (GO:0086067)|brainstem development (GO:0003360)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cardiac muscle contraction (GO:0060048)|cardiac ventricle development (GO:0003231)|cellular response to calcium ion (GO:0071277)|cerebellum development (GO:0021549)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane depolarization during SA node cell action potential (GO:0086046)|neuronal action potential (GO:0019228)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of action potential (GO:0045760)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of sodium ion transport (GO:0010765)|regulation of atrial cardiac muscle cell membrane depolarization (GO:0060371)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of ventricular cardiac muscle cell membrane depolarization (GO:0060373)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|telencephalon development (GO:0021537)|ventricular cardiac muscle cell action potential (GO:0086005)	caveola (GO:0005901)|cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	ankyrin binding (GO:0030506)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|fibroblast growth factor binding (GO:0017134)|ion channel binding (GO:0044325)|nitric-oxide synthase binding (GO:0050998)|protein kinase binding (GO:0019901)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)|voltage-gated sodium channel activity (GO:0005248)|voltage-gated sodium channel activity involved in cardiac muscle cell action potential (GO:0086006)			NS(3)|breast(2)|central_nervous_system(3)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(25)|lung(27)|ovary(6)|pancreas(3)|prostate(10)|skin(9)|upper_aerodigestive_tract(4)	107	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0822)|Kidney(284;0.1)	Ajmaline(DB01426)|Aprindine(DB01429)|Benzonatate(DB00868)|Carbamazepine(DB00564)|Cinchocaine(DB00527)|Cocaine(DB00907)|Disopyramide(DB00280)|Encainide(DB01228)|Ethotoin(DB00754)|Flecainide(DB01195)|Fosphenytoin(DB01320)|Hexylcaine(DB00473)|Indecainide(DB00192)|Lidocaine(DB00281)|Mexiletine(DB00379)|Moricizine(DB00680)|Oxcarbazepine(DB00776)|Phenytoin(DB00252)|Prilocaine(DB00750)|Procainamide(DB01035)|Propafenone(DB01182)|Quinidine barbiturate(DB01346)|Quinidine(DB00908)|Ranolazine(DB00243)|Riluzole(DB00740)|Tocainide(DB01056)|Valproic Acid(DB00313)|Verapamil(DB00661)|Zonisamide(DB00909)	CCCAGTGCCCCCACTGAGTTC	0.567																																						dbGAP											0													122.0	120.0	120.0					3																	38627460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ310893	CCDS46796.1, CCDS46797.1, CCDS46798.1, CCDS46799.1, CCDS54569.1, CCDS54570.1	3p21	2014-09-17	2007-01-23		ENSG00000183873	ENSG00000183873		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10593	protein-coding gene	gene with protein product	"""long QT syndrome 3"""	600163	"""sodium channel, voltage-gated, type V, alpha (long QT syndrome 3)"""	CMD1E		7842012, 15466643, 16382098	Standard	NM_198056		Approved	Nav1.5, LQT3, HB1, HBBD, PFHB1, IVF, HB2, HH1, SSS1, CDCD2, CMPD2, ICCD	uc021wvl.1	Q14524	OTTHUMG00000156166	ENST00000333535.4:c.2509G>A	3.37:g.38627460C>T	ENSP00000328968:p.Gly837Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A5H1P8|A6N922|A6N923|B2RTU0|E7ET19|E9PEF3|E9PEK2|E9PFW7|Q59H93|Q75RX9|Q75RY0|Q86UR3|Q8IZC9|Q96J69	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,prints_Na_channel_a5su,prints_Na_channel_asu	p.G837R	ENST00000333535.4	37	c.2509	CCDS46796.1	3	.	.	.	.	.	.	.	.	.	.	C	25.2	4.616972	0.87359	.	.	ENSG00000183873	ENST00000414099;ENST00000423572;ENST00000413689;ENST00000451551;ENST00000443581;ENST00000425664;ENST00000333535;ENST00000455624;ENST00000450102;ENST00000449557	D;D;D;D;D;D;D;D;D;D	0.97041	-4.22;-4.22;-4.22;-4.22;-4.22;-4.22;-4.22;-4.22;-4.22;-4.22	4.44	4.44	0.53790	Ion transport (1);	0.053859	0.85682	D	0.000000	D	0.97980	0.9335	L	0.61036	1.89	0.58432	D	0.999999	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;0.999	D;D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;0.99;1.0;0.934	D	0.99150	1.0858	10	0.87932	D	0	.	17.2413	0.87014	0.0:1.0:0.0:0.0	.	837;837;837;837;837;837;837	E9PEF3;E9PHB6;Q14524-6;E9PG18;Q14524;Q14524-2;E9PEK2	.;.;.;.;SCN5A_HUMAN;.;.	R	837	ENSP00000398962:G837R;ENSP00000398266:G837R;ENSP00000410257:G837R;ENSP00000388797:G837R;ENSP00000397915:G837R;ENSP00000416634:G837R;ENSP00000328968:G837R;ENSP00000399524:G837R;ENSP00000403355:G837R;ENSP00000413996:G837R	ENSP00000328968:G837R	G	-	1	0	SCN5A	38602464	1.000000	0.71417	0.994000	0.49952	0.969000	0.65631	5.915000	0.69973	2.320000	0.78422	0.462000	0.41574	GGG	SCN5A	-	pfam_Ion_trans_dom,pfam_PKD1_2_channel	ENSG00000183873		0.567	SCN5A-014	KNOWN	basic|CCDS	protein_coding	SCN5A	HGNC	protein_coding	OTTHUMT00000377958.1	266	0.00	0	C	NM_198056		38627460	38627460	-1	no_errors	ENST00000333535	ensembl	human	known	69_37n	missense	228	19.72	56	SNP	1.000	T
SCN8A	6334	genome.wustl.edu	37	12	52180367	52180367	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:52180367G>A	ENST00000354534.6	+	22	4162	c.3984G>A	c.(3982-3984)atG>atA	p.M1328I	SCN8A_ENST00000545061.1_Missense_Mutation_p.M1287I	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1328					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CCTCCATCATGAATGTGCTGC	0.488																																						dbGAP											0													87.0	90.0	89.0					12																	52180367		2148	4282	6430	-	-	-	SO:0001583	missense	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.3984G>A	12.37:g.52180367G>A	ENSP00000346534:p.Met1328Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.M1328I	ENST00000354534.6	37	c.3984	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	20.6	4.019141	0.75275	.	.	ENSG00000196876	ENST00000354534;ENST00000545061;ENST00000355133	D;D;D	0.98313	-4.86;-4.86;-4.86	5.31	5.31	0.75309	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.97548	0.9197	M	0.72479	2.2	0.80722	D	1	B;B	0.33212	0.281;0.402	B;B	0.34931	0.155;0.192	D	0.97312	0.9938	10	0.87932	D	0	.	19.5591	0.95366	0.0:0.0:1.0:0.0	.	1287;1328	F8VWM7;Q9UQD0	.;SCN8A_HUMAN	I	1328;1287;1287	ENSP00000346534:M1328I;ENSP00000440360:M1287I;ENSP00000347255:M1287I	ENSP00000346534:M1328I	M	+	3	0	SCN8A	50466634	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.657000	0.98554	2.937000	0.99478	0.650000	0.86243	ATG	SCN8A	-	pfam_Ion_trans_dom	ENSG00000196876		0.488	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	217	0.00	0	G	NM_014191		52180367	52180367	+1	no_errors	ENST00000354534	ensembl	human	known	69_37n	missense	202	16.39	40	SNP	1.000	A
SDAD1	55153	genome.wustl.edu	37	4	76888470	76888470	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:76888470G>C	ENST00000356260.5	-	12	1123	c.1005C>G	c.(1003-1005)ttC>ttG	p.F335L	SDAD1_ENST00000395711.4_Missense_Mutation_p.F298L|SDAD1_ENST00000513089.1_Intron	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	335					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			AAAAGGGATAGAAATTGAAGA	0.418																																						dbGAP											0													59.0	58.0	58.0					4																	76888470		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1005C>G	4.37:g.76888470G>C	ENSP00000348596:p.Phe335Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Missense_Mutation	SNP	pfam_SDA1,pfam_Uncharacterised_NUC130/133_N,superfamily_ARM-type_fold	p.F335L	ENST00000356260.5	37	c.1005	CCDS3573.2	4	.	.	.	.	.	.	.	.	.	.	G	14.64	2.595612	0.46318	.	.	ENSG00000198301	ENST00000356260;ENST00000395711	T;T	0.73681	-0.77;-0.77	4.5	3.66	0.41972	Armadillo-type fold (1);	0.049798	0.85682	D	0.000000	T	0.70116	0.3187	L	0.52759	1.655	0.53688	D	0.999976	P;B	0.38767	0.646;0.398	B;B	0.43413	0.419;0.242	T	0.66232	-0.5975	10	0.28530	T	0.3	-6.7219	10.6631	0.45714	0.0954:0.0:0.9046:0.0	.	298;335	E7EW05;Q9NVU7	.;SDA1_HUMAN	L	335;298	ENSP00000348596:F335L;ENSP00000379061:F298L	ENSP00000348596:F335L	F	-	3	2	SDAD1	77107494	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.802000	0.55553	1.250000	0.43966	0.655000	0.94253	TTC	SDAD1	-	superfamily_ARM-type_fold	ENSG00000198301		0.418	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDAD1	HGNC	protein_coding	OTTHUMT00000252418.3	180	0.00	0	G	NM_018115		76888470	76888470	-1	no_errors	ENST00000356260	ensembl	human	known	69_37n	missense	126	18.71	29	SNP	1.000	C
SEPT7P2	641977	genome.wustl.edu	37	7	45767779	45767779	+	RNA	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:45767779C>T	ENST00000429741.1	-	0	1350									septin 7 pseudogene 2																		ctgatTACCTCAGCTTCAGAG	0.338																																						dbGAP											0																																										-	-	-			0			AL133216		7p12.3	2010-03-24	2010-03-24	2010-03-24	ENSG00000214765	ENSG00000214765			32339	pseudogene	pseudogene		611563	"""septin 7B"", ""septin 13"""	SEPT7B, SEPT13		15915442	Standard	NR_024271		Approved	DKFZp313J1114	uc003tnf.4		OTTHUMG00000155423		7.37:g.45767779C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000429741.1	37	NULL		7																																																																																			SEPT7P2	-	-	ENSG00000214765		0.338	SEPT7P2-001	KNOWN	basic	processed_transcript	SEPT7P2	HGNC	pseudogene	OTTHUMT00000340060.1	248	0.00	0	C	NR_024271		45767779	45767779	-1	no_errors	ENST00000338231	ensembl	human	known	69_37n	rna	209	23.16	63	SNP	1.000	T
SGK2	10110	genome.wustl.edu	37	20	42195143	42195143	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:42195143C>G	ENST00000341458.4	+	1	407	c.188C>G	c.(187-189)tCt>tGt	p.S63C	SGK2_ENST00000373100.1_Missense_Mutation_p.S3C|SGK2_ENST00000423407.3_Missense_Mutation_p.S3C|SGK2_ENST00000373077.1_Missense_Mutation_p.S3C|SGK2_ENST00000426287.1_Missense_Mutation_p.S29C|SGK2_ENST00000373092.3_Missense_Mutation_p.S3C	NM_016276.3	NP_057360.2	Q9HBY8	SGK2_HUMAN	serum/glucocorticoid regulated kinase 2	63					intracellular signal transduction (GO:0035556)|ion transmembrane transport (GO:0034220)|positive regulation of transporter activity (GO:0032411)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell proliferation (GO:0042127)|response to oxidative stress (GO:0006979)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|potassium channel regulator activity (GO:0015459)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(4)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		Myeloproliferative disorder(115;0.00452)	COAD - Colon adenocarcinoma(18;0.0031)			AGAATGAACTCTAGCCCAGCT	0.597																																						dbGAP											0													84.0	85.0	85.0					20																	42195143		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF169034	CCDS13320.1, CCDS13321.1	20q13.2	2008-07-04			ENSG00000101049	ENSG00000101049			13900	protein-coding gene	gene with protein product		607589				10548550	Standard	NM_016276		Approved		uc002xkv.3	Q9HBY8	OTTHUMG00000033054	ENST00000341458.4:c.188C>G	20.37:g.42195143C>G	ENSP00000340608:p.Ser63Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52PK5|Q5H8Y6|Q5H8Z1|Q5TZR3|Q9UKG6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.S63C	ENST00000341458.4	37	c.188	CCDS13320.1	20	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617861	0.28801	.	.	ENSG00000101049	ENST00000373100;ENST00000373092;ENST00000373077;ENST00000412111;ENST00000423407;ENST00000341458;ENST00000426287	T;T;T;T;T;T;T	0.72615	-0.67;-0.67;-0.66;-0.09;-0.67;-0.66;-0.66	3.62	3.62	0.41486	.	1.529490	0.04323	N	0.351077	T	0.65616	0.2708	N	0.14661	0.345	0.30044	N	0.812342	D;D;P	0.57257	0.979;0.964;0.949	B;B;P	0.50490	0.437;0.334;0.642	T	0.61662	-0.7017	10	0.44086	T	0.13	.	11.0888	0.48104	0.0:1.0:0.0:0.0	.	29;63;3	Q9HBY8-3;Q9HBY8;Q9HBY8-2	.;SGK2_HUMAN;.	C	3;3;3;3;3;63;29	ENSP00000362192:S3C;ENSP00000362184:S3C;ENSP00000362168:S3C;ENSP00000396222:S3C;ENSP00000392795:S3C;ENSP00000340608:S63C;ENSP00000412214:S29C	ENSP00000340608:S63C	S	+	2	0	SGK2	41628557	0.734000	0.28142	0.954000	0.39281	0.451000	0.32288	1.682000	0.37628	2.323000	0.78572	0.561000	0.74099	TCT	SGK2	-	NULL	ENSG00000101049		0.597	SGK2-002	KNOWN	basic|CCDS	protein_coding	SGK2	HGNC	protein_coding	OTTHUMT00000080383.1	170	0.00	0	C			42195143	42195143	+1	no_errors	ENST00000341458	ensembl	human	known	69_37n	missense	114	21.77	32	SNP	0.954	G
SH3D19	152503	genome.wustl.edu	37	4	152056281	152056281	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:152056281C>T	ENST00000409252.2	-	15	2367	c.1660G>A	c.(1660-1662)Gat>Aat	p.D554N	SH3D19_ENST00000409598.4_Missense_Mutation_p.D531N|SH3D19_ENST00000424281.1_Missense_Mutation_p.D495N|SH3D19_ENST00000514152.1_Missense_Mutation_p.D531N|SH3D19_ENST00000427414.2_Missense_Mutation_p.D495N|SH3D19_ENST00000455740.1_Missense_Mutation_p.D531N|SH3D19_ENST00000304527.4_Missense_Mutation_p.D554N			Q5HYK7	SH319_HUMAN	SH3 domain containing 19	554	SH3 2. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cytoskeleton organization (GO:0007010)|membrane organization (GO:0061024)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of cell morphogenesis (GO:0022604)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	proline-rich region binding (GO:0070064)			autonomic_ganglia(1)|endometrium(1)|large_intestine(3)|lung(10)|ovary(1)|skin(3)|urinary_tract(1)	20	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.138)				TCTGGGATATCAATCTAGCAA	0.279																																						dbGAP											0													78.0	78.0	78.0					4																	152056281		2202	4298	6500	-	-	-	SO:0001583	missense	0			BX647422	CCDS34077.2, CCDS47143.1, CCDS47144.1	4q31.3	2009-03-05	2009-03-05	2009-03-05	ENSG00000109686	ENSG00000109686			30418	protein-coding gene	gene with protein product	"""EEN binding protein"""	608674				12477932	Standard	NM_001009555		Approved	DKFZp434D0215, EVE1, EBP, Kryn, SH3P19	uc010ipl.1	Q5HYK7	OTTHUMG00000154051	ENST00000409252.2:c.1660G>A	4.37:g.152056281C>T	ENSP00000386848:p.Asp554Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z296|Q08EK1|Q32N10|Q5U3B8|Q86XB3|Q8N5E7|Q9UFC8	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,prints_p67phox,prints_SH3_domain,pfscan_SH3_domain	p.D554N	ENST00000409252.2	37	c.1660	CCDS34077.2	4	.	.	.	.	.	.	.	.	.	.	C	19.43	3.825270	0.71143	.	.	ENSG00000109686	ENST00000409598;ENST00000304527;ENST00000455740;ENST00000424281;ENST00000427414;ENST00000409252;ENST00000514152	T;T;T;T;T;T;T	0.70282	-0.47;0.09;-0.47;-0.46;-0.46;0.09;-0.47	5.99	5.99	0.97316	Src homology-3 domain (2);	3.823050	0.00669	N	0.000624	T	0.76428	0.3986	M	0.63428	1.95	0.51233	D	0.999918	B;B;B;P	0.42483	0.125;0.198;0.34;0.781	B;B;B;B	0.40602	0.186;0.171;0.237;0.334	T	0.63301	-0.6668	10	0.32370	T	0.25	-19.2697	18.2507	0.90002	0.0:1.0:0.0:0.0	.	554;531;495;309	Q5HYK7;Q5HYK7-2;Q5HYK7-3;B3KY23	SH319_HUMAN;.;.;.	N	531;554;531;495;495;554;531	ENSP00000387030:D531N;ENSP00000302913:D554N;ENSP00000416708:D531N;ENSP00000404542:D495N;ENSP00000415694:D495N;ENSP00000386848:D554N;ENSP00000423449:D531N	ENSP00000302913:D554N	D	-	1	0	SH3D19	152275731	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	4.634000	0.61325	2.840000	0.97914	0.655000	0.94253	GAT	SH3D19	-	superfamily_SH3_domain,pfscan_SH3_domain	ENSG00000109686		0.279	SH3D19-002	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	SH3D19	HGNC	protein_coding	OTTHUMT00000335132.3	245	0.00	0	C	NM_001009555		152056281	152056281	-1	no_errors	ENST00000304527	ensembl	human	known	69_37n	missense	179	14.76	31	SNP	1.000	T
SH3TC2	79628	genome.wustl.edu	37	5	148417943	148417943	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:148417943G>A	ENST00000515425.1	-	8	1017	c.916C>T	c.(916-918)Cag>Tag	p.Q306*	SH3TC2_ENST00000394358.2_Nonsense_Mutation_p.Q191*|SH3TC2_ENST00000513340.1_5'Flank|SH3TC2_ENST00000538184.1_5'UTR|SH3TC2_ENST00000512049.1_Nonsense_Mutation_p.Q299*	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	306	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATGAACCACTGAAGCCCAGGT	0.463																																						dbGAP											0													204.0	198.0	200.0					5																	148417943		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.916C>T	5.37:g.148417943G>A	ENSP00000423660:p.Gln306*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Nonsense_Mutation	SNP	pfam_SH3_domain,pfam_TPR-1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.Q306*	ENST00000515425.1	37	c.916	CCDS4293.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.286497	0.97444	.	.	ENSG00000169247	ENST00000515425;ENST00000512049;ENST00000394358	.	.	.	4.88	4.88	0.63580	.	0.614800	0.15650	N	0.251463	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	16.1499	0.81605	0.0:0.0:1.0:0.0	.	.	.	.	X	306;299;191	.	ENSP00000377886:Q191X	Q	-	1	0	SH3TC2	148398136	0.999000	0.42202	0.986000	0.45419	0.967000	0.64934	4.157000	0.58144	2.424000	0.82194	0.561000	0.74099	CAG	SH3TC2	-	pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000169247		0.463	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	179	0.00	0	G	NM_024577		148417943	148417943	-1	no_errors	ENST00000515425	ensembl	human	known	69_37n	nonsense	155	17.11	32	SNP	0.915	A
SLC17A8	246213	genome.wustl.edu	37	12	100813924	100813924	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:100813924C>G	ENST00000323346.5	+	12	2070	c.1757C>G	c.(1756-1758)tCa>tGa	p.S586*	SLC17A8_ENST00000392989.3_Nonsense_Mutation_p.S536*	NM_001145288.1|NM_139319.2	NP_001138760.1|NP_647480.1	Q8NDX2	VGLU3_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 8	586					ion transport (GO:0006811)|neurotransmitter transport (GO:0006836)|sensory perception of sound (GO:0007605)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(25)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	44						AGAAACTTCTCAACTATATCC	0.438																																						dbGAP											0													66.0	59.0	61.0					12																	100813924		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AJ459241	CCDS9077.1, CCDS44957.1	12q23.1	2013-07-18	2013-07-18		ENSG00000179520	ENSG00000179520		"""Solute carriers"""	20151	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 3"""	607557	"""deafness, autosomal dominant 25"", ""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 8"""	DFNA25		12151341	Standard	NM_139319		Approved	VGLUT3	uc010svi.2	Q8NDX2	OTTHUMG00000170358	ENST00000323346.5:c.1757C>G	12.37:g.100813924C>G	ENSP00000316909:p.Ser586*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXZ6|B7ZKV4|Q17RQ8	Nonsense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S586*	ENST00000323346.5	37	c.1757	CCDS9077.1	12	.	.	.	.	.	.	.	.	.	.	C	14.22	2.471050	0.43942	.	.	ENSG00000179520	ENST00000323346;ENST00000392989	.	.	.	5.16	4.25	0.50352	.	1.551050	0.03648	N	0.240609	.	.	.	.	.	.	0.27653	N	0.947312	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.8777	0.35356	0.215:0.6496:0.1353:0.0	.	.	.	.	X	586;536	.	ENSP00000316909:S586X	S	+	2	0	SLC17A8	99338055	1.000000	0.71417	0.120000	0.21714	0.053000	0.15095	1.591000	0.36665	1.285000	0.44548	0.543000	0.68304	TCA	SLC17A8	-	NULL	ENSG00000179520		0.438	SLC17A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A8	HGNC	protein_coding	OTTHUMT00000408673.2	150	0.00	0	C	NM_139319		100813924	100813924	+1	no_errors	ENST00000323346	ensembl	human	known	69_37n	nonsense	99	21.43	27	SNP	1.000	G
SLC23A3	151295	genome.wustl.edu	37	2	220032957	220032957	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:220032957G>A	ENST00000409878.3	-	6	790	c.758C>T	c.(757-759)tCa>tTa	p.S253L	SLC23A3_ENST00000396775.3_Silent_p.V134V|SLC23A3_ENST00000295738.7_Missense_Mutation_p.H243Y|SLC23A3_ENST00000455516.2_Missense_Mutation_p.S261L	NM_001144889.1	NP_001138361.1	Q6PIS1	S23A3_HUMAN	solute carrier family 23, member 3	253					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(3)|kidney(1)|large_intestine(2)|lung(4)|urinary_tract(1)	11		Renal(207;0.0474)		Epithelial(149;9.27e-07)|all cancers(144;0.000156)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GTGAGTTGATGACGTTGAAGC	0.582																																						dbGAP											0													48.0	50.0	50.0					2																	220032957		2076	4231	6307	-	-	-	SO:0001583	missense	0			BC030243	CCDS42819.1, CCDS46517.1, CCDS46518.1	2q35	2013-07-18	2013-07-18		ENSG00000213901	ENSG00000213901		"""Solute carriers"""	20601	protein-coding gene	gene with protein product							Standard	NM_144712		Approved	SVCT3, FLJ31168, Yspl1	uc010zkr.2	Q6PIS1	OTTHUMG00000154616	ENST00000409878.3:c.758C>T	2.37:g.220032957G>A	ENSP00000386473:p.Ser253Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z512|Q2PYN6|Q96NA6	Missense_Mutation	SNP	pfam_Xant/urac/vitC	p.S261L	ENST00000409878.3	37	c.782	CCDS46518.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.62|11.62	1.692905|1.692905	0.30052|0.30052	.|.	.|.	ENSG00000213901|ENSG00000213901	ENST00000295738|ENST00000409878;ENST00000455516;ENST00000409370	T|T;T;T	0.41400|0.47528	1.0|2.35;2.35;0.84	5.0|5.0	5.0|5.0	0.66597|0.66597	.|.	0.549745|.	0.17559|.	N|.	0.169877|.	T|T	0.32615|0.32615	0.0835|0.0835	.|.	.|.	.|.	0.19300|0.19300	N|N	0.99998|0.99998	B|B;P	0.19583|0.35656	0.037|0.292;0.514	B|B;B	0.25987|0.36030	0.065|0.157;0.216	T|T	0.11591|0.11591	-1.0581|-1.0581	8|7	.|.	.|.	.|.	-5.6536|-5.6536	6.3917|6.3917	0.21591|0.21591	0.091:0.0:0.7264:0.1826|0.091:0.0:0.7264:0.1826	.|.	243|253;261	Q6PIS1-2|Q6PIS1;B7Z512	.|S23A3_HUMAN;.	Y|L	243|253;261;253	ENSP00000295738:H243Y|ENSP00000386473:S253L;ENSP00000406546:S261L;ENSP00000386989:S253L	.|.	H|S	-|-	1|2	0|0	SLC23A3|SLC23A3	219741201|219741201	0.872000|0.872000	0.30054|0.30054	0.129000|0.129000	0.21949|0.21949	0.022000|0.022000	0.10575|0.10575	3.078000|3.078000	0.50096|0.50096	2.583000|2.583000	0.87209|0.87209	0.655000|0.655000	0.94253|0.94253	CAT|TCA	SLC23A3	-	pfam_Xant/urac/vitC	ENSG00000213901		0.582	SLC23A3-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SLC23A3	HGNC	protein_coding	OTTHUMT00000336331.2	105	0.00	0	G	NM_144712		220032957	220032957	-1	no_errors	ENST00000455516	ensembl	human	known	69_37n	missense	53	43.62	41	SNP	0.013	A
SLC25A22	79751	genome.wustl.edu	37	11	792383	792383	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:792383C>G	ENST00000320230.5	-	8	1144	c.663G>C	c.(661-663)gaG>gaC	p.E221D	SLC25A22_ENST00000531214.1_Missense_Mutation_p.E221D|CEND1_ENST00000524587.1_5'Flank|CEND1_ENST00000330106.4_5'Flank	NM_001191061.1|NM_024698.5	NP_001177990.1|NP_078974.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22	221					L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		AAGGCGACTTCTCCTCGGACG	0.662																																					Colon(93;848 1468 3270 23355 49636)	dbGAP											0													72.0	81.0	78.0					11																	792383		2203	4298	6501	-	-	-	SO:0001583	missense	0			AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310	ENST00000320230.5:c.663G>C	11.37:g.792383C>G	ENSP00000322020:p.Glu221Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.E221D	ENST00000320230.5	37	c.663	CCDS7715.1	11	.	.	.	.	.	.	.	.	.	.	C	2.086	-0.409530	0.04799	.	.	ENSG00000177542	ENST00000320230;ENST00000531214;ENST00000481290	T;T;D	0.82167	-1.26;-1.26;-1.58	3.77	-0.859	0.10685	Mitochondrial carrier domain (2);	0.193179	0.43579	N	0.000543	T	0.53786	0.1818	N	0.03608	-0.345	0.24816	N	0.992615	B	0.06786	0.001	B	0.15484	0.013	T	0.39251	-0.9623	10	0.27082	T	0.32	-32.5679	1.2277	0.01937	0.132:0.2167:0.2887:0.3626	.	221	Q9H936	GHC1_HUMAN	D	221;221;246	ENSP00000322020:E221D;ENSP00000437236:E221D;ENSP00000431829:E246D	ENSP00000322020:E221D	E	-	3	2	SLC25A22	782383	0.890000	0.30428	0.883000	0.34634	0.196000	0.23810	-0.087000	0.11215	0.046000	0.15833	0.400000	0.26472	GAG	SLC25A22	-	superfamily_Mt_carrier_dom	ENSG00000177542		0.662	SLC25A22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A22	HGNC	protein_coding	OTTHUMT00000257107.2	55	0.00	0	C			792383	792383	-1	no_errors	ENST00000320230	ensembl	human	known	69_37n	missense	44	12.00	6	SNP	0.811	G
SLC25A36	55186	genome.wustl.edu	37	3	140695209	140695209	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:140695209C>T	ENST00000324194.6	+	7	1018	c.850C>T	c.(850-852)Ctg>Ttg	p.L284L	SLC25A36_ENST00000446041.2_Silent_p.L283L|SLC25A36_ENST00000453248.2_Silent_p.L258L			Q96CQ1	S2536_HUMAN	solute carrier family 25 (pyrimidine nucleotide carrier ), member 36	284					response to estradiol (GO:0032355)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				endometrium(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						TTATCGTGGTCTGACAACTCA	0.413																																						dbGAP											0													132.0	123.0	126.0					3																	140695209		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001480	CCDS3114.1, CCDS46927.1	3q23	2013-05-22	2012-03-29		ENSG00000114120	ENSG00000114120		"""Solute carriers"""	25554	protein-coding gene	gene with protein product			"""solute carrier family 25, member 36"""				Standard	NM_001104647		Approved	FLJ10618, PNC2	uc003etr.2	Q96CQ1	OTTHUMG00000160260	ENST00000324194.6:c.850C>T	3.37:g.140695209C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYF7|Q05CY1|Q9H0G8|Q9NVN5	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Mit_uncoupling	p.L284	ENST00000324194.6	37	c.850	CCDS46927.1	3																																																																																			SLC25A36	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000114120		0.413	SLC25A36-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC25A36	HGNC	protein_coding	OTTHUMT00000359929.1	278	0.00	0	C	NM_018155		140695209	140695209	+1	no_errors	ENST00000324194	ensembl	human	known	69_37n	silent	243	18.87	57	SNP	1.000	T
SLC25A6	293	genome.wustl.edu	37	X	1508405	1508405	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:1508405G>A	ENST00000381401.5	-	2	1041	c.327C>T	c.(325-327)ttC>ttT	p.F109F	SLC25A6_ENST00000475167.1_5'UTR	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	109					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	AGTACCTCCAGAACTGCGTGT	0.617																																						dbGAP											0													183.0	182.0	182.0					X																	1508405		2203	4296	6499	-	-	-	SO:0001819	synonymous_variant	0			AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.327C>T	X.37:g.1508405G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96C49	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor,prints_Mit_uncoupling	p.F109	ENST00000381401.5	37	c.327	CCDS14114.1	X																																																																																			SLC25A6	-	superfamily_Mt_carrier_dom	ENSG00000169100		0.617	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A6	HGNC	protein_coding	OTTHUMT00000055596.1	252	0.00	0	G	NM_001636		1508405	1508405	-1	no_errors	ENST00000381401	ensembl	human	known	69_37n	silent	217	13.49	34	SNP	1.000	A
SLC26A5	375611	genome.wustl.edu	37	7	103020959	103020959	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:103020959C>T	ENST00000306312.3	-	15	1813	c.1552G>A	c.(1552-1554)Gat>Aat	p.D518N	SLC26A5_ENST00000393727.1_Missense_Mutation_p.D518N|SLC26A5_ENST00000393735.2_Intron|SLC26A5_ENST00000356767.4_Intron|SLC26A5_ENST00000393730.1_Missense_Mutation_p.D486N|SLC26A5_ENST00000354356.4_Intron|SLC26A5_ENST00000393723.1_Missense_Mutation_p.D486N|SLC26A5_ENST00000393729.1_Missense_Mutation_p.D481N|SLC26A5_ENST00000432958.2_Missense_Mutation_p.D486N|SLC26A5_ENST00000339444.6_Missense_Mutation_p.D518N	NM_198999.2	NP_945350.1	P58743	S26A5_HUMAN	solute carrier family 26 (anion exchanger), member 5	518					regulation of cell shape (GO:0008360)|regulation of membrane potential (GO:0042391)|sensory perception of sound (GO:0007605)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)	secondary active sulfate transmembrane transporter activity (GO:0008271)			endometrium(5)|kidney(2)|large_intestine(9)|lung(15)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(5)	43						ATATACACATCAGTTTCAGGA	0.388																																						dbGAP											0													148.0	131.0	137.0					7																	103020959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC005064	CCDS5733.1, CCDS43630.1, CCDS55150.1, CCDS5732.1, CCDS43629.1	7q22	2013-07-18	2013-07-18	2005-09-13	ENSG00000170615	ENSG00000170615		"""Solute carriers"""	9359	protein-coding gene	gene with protein product	"""deafness, neurosensory, autosomal recessive, 61"""	604943	"""prestin (motor protein)"""	PRES		10821263	Standard	NM_206883		Approved	DFNB61	uc003vbz.3	P58743	OTTHUMG00000149911	ENST00000306312.3:c.1552G>A	7.37:g.103020959C>T	ENSP00000304783:p.Asp518Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q496J2|Q7Z7F3|Q86UF8|Q86UF9|Q86UG0	Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.D518N	ENST00000306312.3	37	c.1552	CCDS5733.1	7	.	.	.	.	.	.	.	.	.	.	c	23.9	4.474313	0.84640	.	.	ENSG00000170615	ENST00000339444;ENST00000306312;ENST00000393730;ENST00000432958;ENST00000393729;ENST00000393727;ENST00000393723	D;D;D;D;D;D;D	0.93488	-3.19;-3.23;-3.19;-3.19;-3.16;-3.23;-3.19	4.49	4.49	0.54785	.	0.049484	0.85682	D	0.000000	D	0.95303	0.8476	L	0.52266	1.64	0.80722	D	1	D;B;D	0.71674	0.998;0.266;0.998	D;B;D	0.73380	0.98;0.201;0.956	D	0.95317	0.8417	10	0.49607	T	0.09	.	17.1853	0.86865	0.0:1.0:0.0:0.0	.	518;486;518	P58743;Q496J2;P58743-2	S26A5_HUMAN;.;.	N	518;518;486;486;481;518;486	ENSP00000342396:D518N;ENSP00000304783:D518N;ENSP00000377331:D486N;ENSP00000389733:D486N;ENSP00000377330:D481N;ENSP00000377328:D518N;ENSP00000377324:D486N	ENSP00000304783:D518N	D	-	1	0	SLC26A5	102808195	1.000000	0.71417	0.971000	0.41717	0.840000	0.47671	5.517000	0.67061	2.210000	0.71456	0.435000	0.28638	GAT	SLC26A5	-	tigrfam_SulP_transpt	ENSG00000170615		0.388	SLC26A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A5	HGNC	protein_coding	OTTHUMT00000313860.1	307	0.00	0	C	NM_198999		103020959	103020959	-1	no_errors	ENST00000306312	ensembl	human	known	69_37n	missense	258	17.83	56	SNP	0.999	T
SLC30A5	64924	genome.wustl.edu	37	5	68410315	68410315	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:68410315G>A	ENST00000396591.3	+	7	1214	c.604G>A	c.(604-606)Gat>Aat	p.D202N	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	202					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		AGGTGTGGCAGATCACAAGGT	0.348																																						dbGAP											0													118.0	109.0	112.0					5																	68410315		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.604G>A	5.37:g.68410315G>A	ENSP00000379836:p.Asp202Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.D202N	ENST00000396591.3	37	c.604	CCDS3996.1	5	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943698	0.92593	.	.	ENSG00000145740	ENST00000396591	T	0.70749	-0.51	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.84037	0.5384	M	0.72894	2.215	0.80722	D	1	D;B	0.71674	0.998;0.261	D;B	0.81914	0.995;0.028	D	0.84749	0.0755	10	0.62326	D	0.03	-9.8482	19.1726	0.93585	0.0:0.0:1.0:0.0	.	31;202	Q8TAD4-2;Q8TAD4	.;ZNT5_HUMAN	N	202	ENSP00000379836:D202N	ENSP00000379836:D202N	D	+	1	0	SLC30A5	68446071	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.805000	0.86005	2.632000	0.89209	0.655000	0.94253	GAT	SLC30A5	-	NULL	ENSG00000145740		0.348	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	270	0.00	0	G			68410315	68410315	+1	no_errors	ENST00000396591	ensembl	human	known	69_37n	missense	239	18.98	56	SNP	1.000	A
SLC34A2	10568	genome.wustl.edu	37	4	25677836	25677836	+	Missense_Mutation	SNP	G	G	A	rs115874588		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:25677836G>A	ENST00000382051.3	+	13	1588	c.1538G>A	c.(1537-1539)cGc>cAc	p.R513H	SLC34A2_ENST00000504570.1_Missense_Mutation_p.R512H|SLC34A2_ENST00000503434.1_Missense_Mutation_p.R512H	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	513					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)		SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				CTGCCCATCCGCATGGCCAAG	0.562			T	ROS1	NSCLC								G|||	1	0.000199681	0.0	0.0	5008	,	,		17834	0.001		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	0													151.0	129.0	136.0					4																	25677836		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1538G>A	4.37:g.25677836G>A	ENSP00000371483:p.Arg513His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	p.R513H	ENST00000382051.3	37	c.1538	CCDS3435.1	4	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	G	15.14	2.745338	0.49151	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	T;T;T	0.25250	1.81;1.83;1.81	5.18	4.34	0.51931	.	0.173029	0.51477	D	0.000092	T	0.21022	0.0506	L	0.49513	1.565	0.49798	D	0.999824	B;B	0.34161	0.439;0.057	B;B	0.31016	0.123;0.077	T	0.03673	-1.1014	10	0.23891	T	0.37	-8.3591	10.1571	0.42829	0.1537:0.0:0.8463:0.0	.	512;513	O95436-2;O95436	.;NPT2B_HUMAN	H	512;513;512	ENSP00000425501:R512H;ENSP00000371483:R513H;ENSP00000423021:R512H	ENSP00000371483:R513H	R	+	2	0	SLC34A2	25286934	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	4.082000	0.57635	1.311000	0.45024	0.561000	0.74099	CGC	SLC34A2	-	tigrfam_Na/Pi_transpt	ENSG00000157765		0.562	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	HGNC	protein_coding	OTTHUMT00000214990.1	232	0.00	0	G	NM_006424		25677836	25677836	+1	no_errors	ENST00000382051	ensembl	human	known	69_37n	missense	151	35.86	85	SNP	1.000	A
SLC39A5	283375	genome.wustl.edu	37	12	56626564	56626564	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:56626564C>T	ENST00000266980.4	+	3	672	c.379C>T	c.(379-381)Cac>Tac	p.H127Y	SLC39A5_ENST00000454355.2_Missense_Mutation_p.H127Y	NM_001135195.1	NP_001128667.1	Q6ZMH5	S39A5_HUMAN	solute carrier family 39 (zinc transporter), member 5	127					cellular response to zinc ion starvation (GO:0034224)|G1 to G0 transition involved in cell differentiation (GO:0070315)|neural precursor cell proliferation (GO:0061351)|transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			NS(1)|cervix(6)|endometrium(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	27						AAAGGCCCCTCACCTACCCCG	0.617																																						dbGAP											0													61.0	62.0	62.0					12																	56626564		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8912.2	12q13.3	2013-07-17	2013-07-17		ENSG00000139540	ENSG00000139540		"""Solute carriers"""	20502	protein-coding gene	gene with protein product		608730	"""solute carrier family 39 (metal ion transporter), member 5"""				Standard	NM_173596		Approved		uc010sqj.2	Q6ZMH5	OTTHUMG00000156962	ENST00000266980.4:c.379C>T	12.37:g.56626564C>T	ENSP00000266980:p.His127Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R808|Q8N6Y3	Missense_Mutation	SNP	pfam_ZIP	p.H127Y	ENST00000266980.4	37	c.379	CCDS8912.2	12	.	.	.	.	.	.	.	.	.	.	C	12.14	1.849484	0.32699	.	.	ENSG00000139540	ENST00000419753;ENST00000454355;ENST00000417965;ENST00000436633;ENST00000266980	T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91	5.26	-1.38	0.09027	.	1.630070	0.03228	N	0.178573	T	0.20210	0.0486	L	0.38175	1.15	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21690	-1.0238	9	.	.	.	-9.6411	7.454	0.27255	0.0:0.2818:0.4817:0.2365	.	127;18	Q6ZMH5;B4DPG8	S39A5_HUMAN;.	Y	127;127;127;98;127	ENSP00000402891:H127Y;ENSP00000405360:H127Y;ENSP00000414868:H127Y;ENSP00000391711:H98Y;ENSP00000266980:H127Y	.	H	+	1	0	SLC39A5	54912831	0.000000	0.05858	0.000000	0.03702	0.972000	0.66771	-0.516000	0.06282	-0.214000	0.10078	0.644000	0.83932	CAC	SLC39A5	-	NULL	ENSG00000139540		0.617	SLC39A5-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A5	HGNC	protein_coding	OTTHUMT00000346834.1	75	0.00	0	C	NM_173596		56626564	56626564	+1	no_errors	ENST00000266980	ensembl	human	known	69_37n	missense	99	10.81	12	SNP	0.000	T
SLC41A1	254428	genome.wustl.edu	37	1	205779276	205779276	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:205779276G>A	ENST00000367137.3	-	2	1308	c.294C>T	c.(292-294)atC>atT	p.I98I		NM_173854.4	NP_776253.3	Q8IVJ1	S41A1_HUMAN	solute carrier family 41 (magnesium transporter), member 1	98					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation transmembrane transporter activity (GO:0008324)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(4)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	17	Breast(84;0.0799)		BRCA - Breast invasive adenocarcinoma(75;0.0252)			CTTGCAGCCCGATGGAAAAGG	0.607																																						dbGAP											0													140.0	127.0	131.0					1																	205779276		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ514402	CCDS30988.1	1q32.1	2013-07-17	2013-07-17		ENSG00000133065	ENSG00000133065		"""Solute carriers"""	19429	protein-coding gene	gene with protein product		610801				12810078, 18367447	Standard	NM_173854		Approved	MgtE	uc001hdh.1	Q8IVJ1	OTTHUMG00000036000	ENST00000367137.3:c.294C>T	1.37:g.205779276G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HJ4|Q658Z5|Q659A4|Q6MZK2	Silent	SNP	pfam_MgtE_Mg_transptr_membr	p.I98	ENST00000367137.3	37	c.294	CCDS30988.1	1																																																																																			SLC41A1	-	NULL	ENSG00000133065		0.607	SLC41A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC41A1	HGNC	protein_coding	OTTHUMT00000087731.1	216	0.00	0	G			205779276	205779276	-1	no_errors	ENST00000367137	ensembl	human	known	69_37n	silent	267	18.29	60	SNP	0.975	A
SMC4	10051	genome.wustl.edu	37	3	160122246	160122246	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:160122246G>A	ENST00000357388.3	+	5	1092	c.641G>A	c.(640-642)cGa>cAa	p.R214Q	RP11-432B6.3_ENST00000483754.1_Intron|SMC4_ENST00000462787.1_Missense_Mutation_p.R214Q|MIR16-2_ENST00000362117.1_RNA|SMC4_ENST00000344722.5_Missense_Mutation_p.R214Q|SMC4_ENST00000469762.1_Missense_Mutation_p.R189Q|MIR15B_ENST00000385045.1_RNA|SMC4_ENST00000470240.1_3'UTR|SMC4_ENST00000360111.2_Missense_Mutation_p.R214Q	NM_001002800.1	NP_001002800.1	Q9NTJ3	SMC4_HUMAN	structural maintenance of chromosomes 4	214					kinetochore organization (GO:0051383)|meiotic chromosome condensation (GO:0010032)|meiotic chromosome segregation (GO:0045132)|mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)|mitotic sister chromatid segregation (GO:0000070)	condensin complex (GO:0000796)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein heterodimerization activity (GO:0046982)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(15)|lung(20)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			AATCTTCTTCGAAGCCATGGA	0.308																																						dbGAP											0													70.0	75.0	73.0					3																	160122246		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF092564	CCDS3189.1, CCDS75046.1	3q26.1	2006-07-06	2006-07-06	2006-07-06	ENSG00000113810	ENSG00000113810		"""Structural maintenance of chromosomes proteins"""	14013	protein-coding gene	gene with protein product		605575	"""SMC4 (structural maintenance of chromosomes 4, yeast)-like 1"", ""SMC4 structural maintenance of chromosomes 4-like 1 (yeast)"""	SMC4L1		9789013, 10319587	Standard	NM_005496		Approved	hCAP-C, CAP-C	uc003fdh.3	Q9NTJ3	OTTHUMG00000159006	ENST00000357388.3:c.641G>A	3.37:g.160122246G>A	ENSP00000349961:p.Arg214Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLT9|D3DNL8|O95752|Q8NDL4|Q9UNT9	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_Chemotax_Me-accpt_rcpt_lig-bd,superfamily_Prefoldin,smart_SMC_hinge	p.R214Q	ENST00000357388.3	37	c.641	CCDS3189.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.524708	0.96431	.	.	ENSG00000113810	ENST00000357388;ENST00000360111;ENST00000392788;ENST00000472991;ENST00000467468;ENST00000469762;ENST00000489573;ENST00000462787;ENST00000485867;ENST00000344722	T;T;T;T;T;T;T;T;T	0.67171	2.87;2.87;-0.25;-0.25;2.87;-0.25;2.87;-0.25;2.87	6.16	6.16	0.99307	RecF/RecN/SMC (1);	0.061018	0.64402	D	0.000002	T	0.80019	0.4547	M	0.68317	2.08	0.80722	D	1	P;D;P	0.76494	0.746;0.999;0.937	B;P;B	0.62560	0.14;0.904;0.315	T	0.75235	-0.3389	10	0.34782	T	0.22	-14.0965	20.8598	0.99761	0.0:0.0:1.0:0.0	.	214;189;214	Q9NTJ3-2;E9PD53;Q9NTJ3	.;.;SMC4_HUMAN	Q	214;214;214;89;89;189;214;214;142;214	ENSP00000349961:R214Q;ENSP00000353225:R214Q;ENSP00000417999:R89Q;ENSP00000419360:R89Q;ENSP00000417964:R189Q;ENSP00000420121:R214Q;ENSP00000420734:R214Q;ENSP00000417612:R142Q;ENSP00000341382:R214Q	ENSP00000341382:R214Q	R	+	2	0	SMC4	161604940	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.823000	0.99369	2.937000	0.99478	0.650000	0.86243	CGA	SMC4	-	pfam_RecF/RecN/SMC	ENSG00000113810		0.308	SMC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC4	HGNC	protein_coding	OTTHUMT00000352862.1	166	0.00	0	G			160122246	160122246	+1	no_errors	ENST00000344722	ensembl	human	known	69_37n	missense	130	23.08	39	SNP	1.000	A
SPN	6693	genome.wustl.edu	37	16	29675524	29675524	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr16:29675524G>T	ENST00000360121.3	+	2	567	c.475G>T	c.(475-477)Gag>Tag	p.E159*	SPN_ENST00000395389.2_Nonsense_Mutation_p.E159*	NM_001030288.2|NM_003123.4	NP_001025459.1|NP_003114.1	O75398	DEAF1_HUMAN	sialophorin	0					anatomical structure morphogenesis (GO:0009653)|embryonic skeletal system development (GO:0048706)|germ cell development (GO:0007281)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube closure (GO:0001843)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mammary gland epithelial cell proliferation (GO:0033599)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)|stomach(1)	15						TAGCTCTCTGGAGACCTCCAG	0.567																																						dbGAP											0													82.0	83.0	83.0					16																	29675524		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			J04536	CCDS10650.1	16p11.2	2008-07-31	2008-07-31		ENSG00000197471	ENSG00000197471		"""CD molecules"""	11249	protein-coding gene	gene with protein product	"""leukosialin"""	182160	"""sialophorin (gpL115, leukosialin, CD43)"""			2784859, 2521952	Standard	NM_001030288		Approved	LSN, CD43, GPL115	uc002dtm.4	P16150	OTTHUMG00000097765	ENST00000360121.3:c.475G>T	16.37:g.29675524G>T	ENSP00000353238:p.Glu159*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F8|A8K5R8|C7T5V5|O15152|O75399|O75510|O75511|O75512|O75513|Q9UET1	Nonsense_Mutation	SNP	NULL	p.E159*	ENST00000360121.3	37	c.475	CCDS10650.1	16	.	.	.	.	.	.	.	.	.	.	.	19.80	3.894331	0.72639	.	.	ENSG00000197471	ENST00000395389;ENST00000436527;ENST00000360121	.	.	.	4.88	2.88	0.33553	.	1.629460	0.03573	N	0.228917	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-1.0181	7.3221	0.26533	0.2138:0.0:0.7862:0.0	.	.	.	.	X	159	.	ENSP00000353238:E159X	E	+	1	0	SPN	29583025	0.972000	0.33761	0.019000	0.16419	0.035000	0.12851	2.212000	0.42835	0.713000	0.32060	0.585000	0.79938	GAG	SPN	-	NULL	ENSG00000197471		0.567	SPN-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SPN	HGNC	protein_coding	OTTHUMT00000215001.2	146	0.00	0	G			29675524	29675524	+1	no_errors	ENST00000360121	ensembl	human	known	69_37n	nonsense	109	17.42	23	SNP	0.042	T
ST6GALNAC1	55808	genome.wustl.edu	37	17	74623561	74623561	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:74623561C>G	ENST00000156626.7	-	3	1135	c.936G>C	c.(934-936)caG>caC	p.Q312H	ST6GALNAC1_ENST00000590878.1_5'UTR	NM_018414.3	NP_060884.1	Q9NSC7	SIA7A_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 1	312					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	alpha-N-acetylgalactosaminide alpha-2,6-sialyltransferase activity (GO:0001665)|sialyltransferase activity (GO:0008373)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|prostate(1)|upper_aerodigestive_tract(1)	22						CCCACTCACTCTGGTTGAAGT	0.552																																						dbGAP											0													128.0	113.0	118.0					17																	74623561		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y11339	CCDS11748.1	17q25.3	2013-03-01	2005-02-07	2005-02-07	ENSG00000070526	ENSG00000070526		"""Sialyltransferases"""	23614	protein-coding gene	gene with protein product		610138	"""sialyltransferase 7 ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase) A"""	SIAT7A			Standard	NM_001289107		Approved	ST6GalNAcI	uc002jsh.3	Q9NSC7	OTTHUMG00000180369	ENST00000156626.7:c.936G>C	17.37:g.74623561C>G	ENSP00000156626:p.Gln312His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW90|Q9NSC6	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.Q312H	ENST00000156626.7	37	c.936	CCDS11748.1	17	.	.	.	.	.	.	.	.	.	.	C	8.717	0.913443	0.17907	.	.	ENSG00000070526	ENST00000156626;ENST00000359088	T;T	0.30448	1.53;1.53	5.03	2.93	0.34026	.	0.284450	0.31601	N	0.007373	T	0.39733	0.1089	L	0.60455	1.87	0.47183	D	0.999349	P	0.43477	0.808	P	0.54312	0.748	T	0.09487	-1.0672	10	0.44086	T	0.13	-11.8151	7.7486	0.28883	0.0:0.5471:0.3545:0.0984	.	312	Q9NSC7	SIA7A_HUMAN	H	312	ENSP00000156626:Q312H;ENSP00000351991:Q312H	ENSP00000156626:Q312H	Q	-	3	2	ST6GALNAC1	72135156	0.854000	0.29725	0.998000	0.56505	0.048000	0.14542	0.760000	0.26475	2.490000	0.84030	0.563000	0.77884	CAG	ST6GALNAC1	-	pfam_Glyco_trans_29	ENSG00000070526		0.552	ST6GALNAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC1	HGNC	protein_coding	OTTHUMT00000450974.1	144	0.00	0	C	NM_018414		74623561	74623561	-1	no_errors	ENST00000156626	ensembl	human	known	69_37n	missense	96	26.15	34	SNP	0.687	G
ST8SIA3	51046	genome.wustl.edu	37	18	55020080	55020080	+	Start_Codon_SNP	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:55020080G>A	ENST00000324000.3	+	1	2037	c.3G>A	c.(1-3)atG>atA	p.M1I		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	1					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)			breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		AGCCCGGGATGAGAAACTGCA	0.577																																						dbGAP											0													40.0	42.0	41.0					18																	55020080		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.3G>A	18.37:g.55020080G>A	ENSP00000320431:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.M1I	ENST00000324000.3	37	c.3	CCDS32834.1	18	.	.	.	.	.	.	.	.	.	.	G	16.52	3.147098	0.57151	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.14022	2.54	4.76	3.9	0.45041	.	0.140929	0.48767	D	0.000170	T	0.12390	0.0301	.	.	.	0.29034	N	0.885515	B	0.15719	0.014	B	0.12156	0.007	T	0.09796	-1.0658	9	0.87932	D	0	.	11.9049	0.52705	0.0863:0.0:0.9137:0.0	.	1	O43173	SIA8C_HUMAN	I	108;1	ENSP00000320431:M1I	ENSP00000320431:M1I	M	+	3	0	ST8SIA3	53171078	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.909000	0.63314	1.018000	0.39521	0.491000	0.48974	ATG	ST8SIA3	-	NULL	ENSG00000177511		0.577	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	69	0.00	0	G	NM_015879	Missense_Mutation	55020080	55020080	+1	no_errors	ENST00000324000	ensembl	human	known	69_37n	missense	43	30.16	19	SNP	1.000	A
STAP2	55620	genome.wustl.edu	37	19	4325220	4325220	+	Silent	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:4325220G>C	ENST00000594605.1	-	11	1188	c.1065C>G	c.(1063-1065)ccC>ccG	p.P355P	STAP2_ENST00000600324.1_Silent_p.P355P|STAP2_ENST00000597593.1_5'UTR	NM_001013841.1	NP_001013863.1	Q9UGK3	STAP2_HUMAN	signal transducing adaptor family member 2	355	Pro-rich.					cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)	23		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		AACCTGGCTTGGGTCCAACGG	0.537																																						dbGAP											0													37.0	31.0	33.0					19																	4325220		2203	4293	6496	-	-	-	SO:0001819	synonymous_variant	0			AJ245719	CCDS12128.1, CCDS45926.1	19p13.3	2011-05-03	2007-08-09		ENSG00000178078	ENSG00000178078			30430	protein-coding gene	gene with protein product		607881				10980601, 11441184	Standard	XM_005259592		Approved	STAP-2, BKS	uc002mac.3	Q9UGK3		ENST00000594605.1:c.1065C>G	19.37:g.4325220G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKK3|Q9NXI2	Silent	SNP	pfscan_SH2	p.P355	ENST00000594605.1	37	c.1065	CCDS45926.1	19																																																																																			STAP2	-	NULL	ENSG00000178078		0.537	STAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAP2	HGNC	protein_coding	OTTHUMT00000458114.2	112	0.00	0	G	NM_001013841		4325220	4325220	-1	no_errors	ENST00000314714	ensembl	human	known	69_37n	silent	88	20.87	24	SNP	0.812	C
STXBP5	134957	genome.wustl.edu	37	6	147684754	147684754	+	Silent	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:147684754G>C	ENST00000321680.6	+	24	2829	c.2829G>C	c.(2827-2829)tcG>tcC	p.S943S	STXBP5_ENST00000179882.6_Silent_p.S598S|STXBP5_ENST00000367480.3_Silent_p.S890S|STXBP5_ENST00000367481.3_Silent_p.S907S	NM_001127715.2	NP_001121187.1	Q5T5C0	STXB5_HUMAN	syntaxin binding protein 5 (tomosyn)	943					exocytosis (GO:0006887)|negative regulation of exocytosis (GO:0045920)|positive regulation of exocytosis (GO:0045921)|protein transport (GO:0015031)|regulation of blood coagulation (GO:0030193)|regulation of gene expression (GO:0010468)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|synapse (GO:0045202)	syntaxin-1 binding (GO:0017075)			breast(2)|endometrium(4)|kidney(3)|large_intestine(6)|lung(21)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	42		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;1.77e-09)|GBM - Glioblastoma multiforme(68;0.0694)		CAGAGACCTCGTTTGTGCTTC	0.388																																						dbGAP											0													111.0	103.0	106.0					6																	147684754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055484	CCDS5211.1, CCDS47499.1	6q24.3	2013-01-10			ENSG00000164506	ENSG00000164506		"""WD repeat domain containing"""	19665	protein-coding gene	gene with protein product		604586				9620695, 14767561	Standard	NM_139244		Approved	tomosyn, LLGL3	uc010khz.2	Q5T5C0	OTTHUMG00000015766	ENST00000321680.6:c.2829G>C	6.37:g.147684754G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14DF3|Q5T5C1|Q5T5C2|Q8NBG8|Q96NG9	Silent	SNP	pfam_LLGL2,pfam_WD40_repeat,pfam_Lgl_C,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,pfscan_Synaptobrevin,prints_Lethal2_giant	p.S943	ENST00000321680.6	37	c.2829	CCDS47499.1	6																																																																																			STXBP5	-	pfam_Lgl_C,superfamily_WD40_repeat_dom	ENSG00000164506		0.388	STXBP5-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STXBP5	HGNC	protein_coding	OTTHUMT00000042606.1	171	0.00	0	G			147684754	147684754	+1	no_errors	ENST00000321680	ensembl	human	known	69_37n	silent	157	14.13	26	SNP	0.009	C
SUGT1P3	283507	genome.wustl.edu	37	13	41495642	41495642	+	RNA	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:41495642G>A	ENST00000304932.4	-	0	181					NR_003365.2				SUGT1 pseudogene 3																		TGGTCGATTAGAGCATCTGAG	0.542											OREG0022377	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-			0					13q14.11	2013-10-18	2013-10-18	2010-10-27	ENSG00000239827	ENSG00000239827			20513	pseudogene	pseudogene			"""SGT1, suppressor of G2 allele of SKP1 like 1 (S. cerevisiae)"", ""suppressor of G2 allele of SKP1 (S. cerevisiae) pseudogene 3"""	SUGT1L1			Standard	NR_003365		Approved		uc001uxq.3		OTTHUMG00000016780		13.37:g.41495642G>A		Somatic	901	WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfscan_TPR-contain_dom	p.L22	ENST00000304932.4	37	c.64		13																																																																																			SUGT1P3	-	NULL	ENSG00000239827		0.542	SUGT1P3-002	KNOWN	basic	processed_transcript	SUGT1P3	HGNC	pseudogene	OTTHUMT00000044647.3	114	0.85	1	G			41495642	41495642	-1	no_errors	ENST00000494063	ensembl	human	known	69_37n	silent	100	17.36	21	SNP	0.942	A
SYNE1	23345	genome.wustl.edu	37	6	152650988	152650988	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:152650988C>T	ENST00000367255.5	-	78	15433	c.14832G>A	c.(14830-14832)ctG>ctA	p.L4944L	SYNE1_ENST00000448038.1_Silent_p.L4873L|SYNE1_ENST00000341594.5_Silent_p.L4691L|SYNE1_ENST00000265368.4_Silent_p.L4944L|SYNE1_ENST00000423061.1_Silent_p.L4873L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	4944			L -> M (in dbSNP:rs2306916).		cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCTTGTGACTCAGCGCATTCA	0.478										HNSCC(10;0.0054)																												dbGAP											0													271.0	264.0	267.0					6																	152650988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.14832G>A	6.37:g.152650988C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L4944	ENST00000367255.5	37	c.14832	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.478	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	439	0.23	1	C	NM_182961		152650988	152650988	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	369	15.95	70	SNP	1.000	T
SZT2	23334	genome.wustl.edu	37	1	43892993	43892993	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:43892993C>G	ENST00000562955.1	+	24	3304	c.3304C>G	c.(3304-3306)Caa>Gaa	p.Q1102E	SZT2_ENST00000372442.1_Missense_Mutation_p.Q260E	NM_015284.3	NP_056099.3	Q5T011	SZT2_HUMAN	seizure threshold 2 homolog (mouse)	1159					central nervous system development (GO:0007417)|corpus callosum morphogenesis (GO:0021540)|embryo development (GO:0009790)|pigmentation (GO:0043473)|post-embryonic development (GO:0009791)|regulation of superoxide dismutase activity (GO:1901668)	extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)				NS(2)|breast(9)|central_nervous_system(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(39)|ovary(4)|pancreas(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	113						GGGACCCCCTCAAGAGGAGAC	0.567																																						dbGAP											0													41.0	45.0	44.0					1																	43892993		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007936	CCDS30694.1, CCDS30694.2	1p34.2	2012-11-19	2011-06-10	2011-06-10	ENSG00000198198	ENSG00000198198			29040	protein-coding gene	gene with protein product	"""seizure threshold 2 homolog A (mouse)"", ""seizure threshold 2 homolog B (mouse)"""	615463	"""chromosome 1 open reading frame 84"", ""KIAA0467"""	C1orf84, KIAA0467		9455484	Standard	NM_015284		Approved	FLJ10387, SZT2B, RP11-506B15.1, FLJ34502, SZT2A	uc001cjk.3	Q5T011	OTTHUMG00000007423	ENST00000562955.1:c.3304C>G	1.37:g.43892993C>G	ENSP00000457168:p.Gln1102Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJK5|A7E2X4|O75055|Q5JUY7|Q5T012|Q5XKC7|Q6ZNI8|Q6ZT24|Q7Z636|Q8NAY9|Q9H5H7|Q9UFQ8	Missense_Mutation	SNP	NULL	p.Q1102E	ENST00000562955.1	37	c.3304	CCDS30694.2	1	.	.	.	.	.	.	.	.	.	.	C	11.63	1.695572	0.30052	.	.	ENSG00000198198	ENST00000372442	.	.	.	5.64	5.64	0.86602	.	0.523113	0.20019	N	0.100955	T	0.41143	0.1146	L	0.54323	1.7	0.20926	N	0.999824	B	0.13145	0.007	B	0.18561	0.022	T	0.28299	-1.0048	9	0.10902	T	0.67	.	12.2457	0.54568	0.1695:0.8305:0.0:0.0	.	1102	Q5T011-5	.	E	260	.	ENSP00000361519:Q260E	Q	+	1	0	SZT2	43665580	0.955000	0.32602	0.996000	0.52242	0.718000	0.41266	1.975000	0.40569	2.653000	0.90120	0.655000	0.94253	CAA	SZT2	-	NULL	ENSG00000198198		0.567	SZT2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SZT2	HGNC	protein_coding	OTTHUMT00000019517.3	93	0.00	0	C	NM_015284		43892993	43892993	+1	no_errors	ENST00000562955	ensembl	human	known	69_37n	missense	70	22.22	20	SNP	0.995	G
TAAR2	9287	genome.wustl.edu	37	6	132939037	132939037	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:132939037C>G	ENST00000367931.1	-	2	307	c.308G>C	c.(307-309)aGa>aCa	p.R103T	TAAR2_ENST00000275191.2_Missense_Mutation_p.R58T|TAAR2_ENST00000537809.1_Missense_Mutation_p.R58T			Q9P1P5	TAAR2_HUMAN	trace amine associated receptor 2	103					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)	p.R103T(1)		breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(15)|ovary(1)|skin(1)	23	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00608)|GBM - Glioblastoma multiforme(226;0.0151)		CTCCACCGATCTGATCATACT	0.413																																						dbGAP											1	Substitution - Missense(1)	lung(1)											107.0	100.0	102.0					6																	132939037		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112460	CCDS34541.1, CCDS5157.1	6q24	2012-08-08	2005-02-23	2005-02-24	ENSG00000146378	ENSG00000146378		"""GPCR / Class A : Trace amine associated receptors"""	4514	protein-coding gene	gene with protein product		604849	"""G protein-coupled receptor 58"""	GPR58		10684976, 15718104	Standard	NM_014626		Approved		uc003qdl.1	Q9P1P5	OTTHUMG00000015585	ENST00000367931.1:c.308G>C	6.37:g.132939037C>G	ENSP00000356908:p.Arg103Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QD02|Q6NWS1|Q6NWS2|Q6NWS3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.R103T	ENST00000367931.1	37	c.308	CCDS34541.1	6	.	.	.	.	.	.	.	.	.	.	C	14.85	2.657846	0.47467	.	.	ENSG00000146378	ENST00000275191;ENST00000367931;ENST00000537809	T;T;T	0.15487	2.42;2.42;2.42	6.0	6.0	0.97389	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.39759	0.1090	M	0.79011	2.435	0.40252	D	0.978087	D	0.76494	0.999	D	0.74674	0.984	T	0.17776	-1.0358	10	0.66056	D	0.02	-40.9793	20.4946	0.99205	0.0:1.0:0.0:0.0	.	103	Q9P1P5	TAAR2_HUMAN	T	58;103;58	ENSP00000275191:R58T;ENSP00000356908:R103T;ENSP00000441263:R58T	ENSP00000275191:R58T	R	-	2	0	TAAR2	132980730	0.039000	0.19947	0.998000	0.56505	0.286000	0.27126	2.404000	0.44539	2.846000	0.97976	0.650000	0.86243	AGA	TAAR2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Trace_amine_rcpt	ENSG00000146378		0.413	TAAR2-002	KNOWN	basic|CCDS	protein_coding	TAAR2	HGNC	protein_coding	OTTHUMT00000390735.1	253	0.39	1	C	NM_014626		132939037	132939037	-1	no_errors	ENST00000367931	ensembl	human	known	69_37n	missense	183	22.46	53	SNP	1.000	G
TBC1D4	9882	genome.wustl.edu	37	13	75866384	75866384	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:75866384C>T	ENST00000377636.3	-	19	3686	c.3340G>A	c.(3340-3342)Gaa>Aaa	p.E1114K	TBC1D4_ENST00000425511.1_Missense_Mutation_p.E278K|TBC1D4_ENST00000431480.2_Missense_Mutation_p.E1106K|TBC1D4_ENST00000478591.1_5'Flank|TBC1D4_ENST00000377625.2_Missense_Mutation_p.E1051K	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	1114					cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		AATATAACTTCAGTTCCCTGA	0.338																																						dbGAP											0													58.0	56.0	56.0					13																	75866384		1812	4069	5881	-	-	-	SO:0001583	missense	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.3340G>A	13.37:g.75866384C>T	ENSP00000366863:p.Glu1114Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.E1114K	ENST00000377636.3	37	c.3340	CCDS41901.1	13	.	.	.	.	.	.	.	.	.	.	C	28.7	4.943169	0.92526	.	.	ENSG00000136111	ENST00000377636;ENST00000431480;ENST00000377625;ENST00000425511	T;T;T;T	0.09817	2.94;2.94;2.94;2.94	5.44	5.44	0.79542	Rab-GAP/TBC domain (3);	0.152578	0.44902	D	0.000404	T	0.12646	0.0307	N	0.25060	0.705	0.58432	D	0.999995	P;P;B;P	0.39903	0.694;0.55;0.025;0.668	B;B;B;B	0.43301	0.219;0.415;0.023;0.211	T	0.05468	-1.0883	10	0.46703	T	0.11	-19.8089	19.2605	0.93966	0.0:1.0:0.0:0.0	.	278;1051;1106;1114	O60343-4;O60343-2;O60343-3;O60343	.;.;.;TBCD4_HUMAN	K	1114;1106;1051;278	ENSP00000366863:E1114K;ENSP00000395986:E1106K;ENSP00000366852:E1051K;ENSP00000390654:E278K	ENSP00000366852:E1051K	E	-	1	0	TBC1D4	74764385	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.487000	0.81328	2.534000	0.85438	0.585000	0.79938	GAA	TBC1D4	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom	ENSG00000136111		0.338	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	159	0.00	0	C	NM_014832		75866384	75866384	-1	no_errors	ENST00000377636	ensembl	human	known	69_37n	missense	73	42.97	55	SNP	1.000	T
TBL1XR1	79718	genome.wustl.edu	37	3	176769295	176769296	+	Frame_Shift_Ins	INS	-	-	TA	rs564623938		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:176769295_176769296insTA	ENST00000430069.1	-	5	682_683	c.423_424insTA	c.(421-426)atagcafs	p.A142fs	TBL1XR1_ENST00000457928.2_Frame_Shift_Ins_p.A142fs			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	142					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.I141fs*3(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			AGCTCACTTGCTATAGTATGTG	0.391																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.422_423dupTA	3.37:g.176769298_176769299dupTA	ENSP00000405574:p.Ala142fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A141fs	ENST00000430069.1	37	c.424_423	CCDS46961.1	3																																																																																			TBL1XR1	-	NULL	ENSG00000177565		0.391	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	HGNC	protein_coding	OTTHUMT00000347587.3	271	0.00	0	-	NM_024665		176769295	176769296	-1	no_errors	ENST00000430069	ensembl	human	known	69_37n	frame_shift_ins	140	32.04	66	INS	1.000:1.000	TA
TDRD5	163589	genome.wustl.edu	37	1	179632576	179632576	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr1:179632576G>C	ENST00000367614.1	+	15	2796	c.2437G>C	c.(2437-2439)Gaa>Caa	p.E813Q	TDRD5_ENST00000444136.1_Missense_Mutation_p.E867Q|TDRD5_ENST00000294848.8_Missense_Mutation_p.E813Q	NM_001199091.1	NP_001186020.1	Q8NAT2	TDRD5_HUMAN	tudor domain containing 5	813					DNA methylation involved in gamete generation (GO:0043046)|P granule organization (GO:0030719)|spermatid development (GO:0007286)	chromatoid body (GO:0033391)|pi-body (GO:0071546)				NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(44)|ovary(2)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)	77						TCATAAGCCAGAAGTACTGGG	0.413																																						dbGAP											0													82.0	79.0	80.0					1																	179632576		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092142	CCDS1332.1, CCDS55663.1	1q24.2	2013-01-23			ENSG00000162782	ENSG00000162782		"""Tudor domain containing"""	20614	protein-coding gene	gene with protein product							Standard	NM_001199085		Approved	FLJ34823, TUDOR3	uc010pnp.2	Q8NAT2	OTTHUMG00000035259	ENST00000367614.1:c.2437G>C	1.37:g.179632576G>C	ENSP00000356586:p.Glu813Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4G5|B7ZLV0|Q5EBN4|Q5VTV0|Q6ZSK2	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.E867Q	ENST00000367614.1	37	c.2599	CCDS1332.1	1	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118762	0.37436	.	.	ENSG00000162782	ENST00000367614;ENST00000294848;ENST00000444136;ENST00000417329	T;T;T;T	0.36340	2.43;2.43;2.65;1.26	5.08	5.08	0.68730	.	0.882356	0.10012	N	0.727135	T	0.58104	0.2099	L	0.57536	1.79	0.22562	N	0.998988	D;D	0.76494	0.999;0.999	D;D	0.76575	0.988;0.941	T	0.49643	-0.8918	10	0.62326	D	0.03	-36.3302	13.9527	0.64129	0.0:0.0:1.0:0.0	.	867;813	Q8NAT2-1;Q8NAT2	.;TDRD5_HUMAN	Q	813;813;867;323	ENSP00000356586:E813Q;ENSP00000294848:E813Q;ENSP00000406052:E867Q;ENSP00000410744:E323Q	ENSP00000294848:E813Q	E	+	1	0	TDRD5	177899199	0.968000	0.33430	0.543000	0.28128	0.080000	0.17528	2.887000	0.48586	2.343000	0.79666	0.637000	0.83480	GAA	TDRD5	-	NULL	ENSG00000162782		0.413	TDRD5-002	KNOWN	basic|CCDS	protein_coding	TDRD5	HGNC	protein_coding	OTTHUMT00000085295.1	247	0.00	0	G	NM_173533		179632576	179632576	+1	no_errors	ENST00000444136	ensembl	human	known	69_37n	missense	353	14.90	62	SNP	0.720	C
THOC2	57187	genome.wustl.edu	37	X	122771967	122771967	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:122771967G>C	ENST00000245838.8	-	18	1879	c.1848C>G	c.(1846-1848)atC>atG	p.I616M	THOC2_ENST00000355725.4_Missense_Mutation_p.I616M|THOC2_ENST00000491737.1_Missense_Mutation_p.I501M	NM_001081550.1	NP_001075019.1	Q8NI27	THOC2_HUMAN	THO complex 2	616					mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|poly(A)+ mRNA export from nucleus (GO:0016973)|RNA splicing (GO:0008380)|viral mRNA export from host cell nucleus (GO:0046784)	THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	RNA binding (GO:0003723)			breast(2)|endometrium(13)|kidney(4)|large_intestine(11)|lung(26)|ovary(3)|skin(1)|upper_aerodigestive_tract(3)	63						AAGCTTCAATGATACAATCTT	0.323																																						dbGAP											0													107.0	88.0	93.0					X																	122771967		1820	4071	5891	-	-	-	SO:0001583	missense	0			AF441770	CCDS43988.1	Xq25-q26.3	2013-02-11	2004-08-09		ENSG00000125676	ENSG00000125676		"""THO complex subunits"""	19073	protein-coding gene	gene with protein product		300395	"""chromosome X open reading frame 3"""	CXorf3		11979277	Standard	NM_001081550		Approved	THO2, dJ506G2.1	uc004etu.3	Q8NI27	OTTHUMG00000022334	ENST00000245838.8:c.1848C>G	X.37:g.122771967G>C	ENSP00000245838:p.Ile616Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM50|Q5JZ12|Q6IN92|Q9H8I6	Missense_Mutation	SNP	pfam_THO_THOC2_C,pfam_THO_THOC2_N	p.I616M	ENST00000245838.8	37	c.1848	CCDS43988.1	X	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772354	0.49680	.	.	ENSG00000125676	ENST00000245838;ENST00000355725;ENST00000491737;ENST00000408933	.	.	.	5.48	2.73	0.32206	THO complex, subunitTHOC2, N-terminal (1);	0.000000	0.64402	D	0.000002	T	0.68384	0.2995	M	0.73962	2.25	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.79108	0.984;0.992	T	0.65059	-0.6260	9	0.42905	T	0.14	-6.9492	4.1888	0.10411	0.2343:0.0:0.4982:0.2674	.	541;616	B4DKZ6;Q8NI27	.;THOC2_HUMAN	M	616;616;501;541	.	ENSP00000245838:I616M	I	-	3	3	THOC2	122599648	0.994000	0.37717	1.000000	0.80357	0.890000	0.51754	0.295000	0.19065	0.597000	0.29811	-0.268000	0.10319	ATC	THOC2	-	pfam_THO_THOC2_N	ENSG00000125676		0.323	THOC2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC2	HGNC	protein_coding	OTTHUMT00000058153.3	285	0.00	0	G			122771967	122771967	-1	no_errors	ENST00000245838	ensembl	human	known	69_37n	missense	243	21.36	66	SNP	1.000	C
TIPARP	25976	genome.wustl.edu	37	3	156422677	156422677	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr3:156422677G>C	ENST00000461166.1	+	6	2319	c.1731G>C	c.(1729-1731)aaG>aaC	p.K577N	TIPARP_ENST00000486483.1_Missense_Mutation_p.K577N|TIPARP_ENST00000295924.7_Missense_Mutation_p.K577N|TIPARP_ENST00000542783.1_Missense_Mutation_p.K577N	NM_001184717.1	NP_001171646.1	Q7Z3E1	PARPT_HUMAN	TCDD-inducible poly(ADP-ribose) polymerase	577	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.				androgen metabolic process (GO:0008209)|cellular response to organic cyclic compound (GO:0071407)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|multicellular organismal metabolic process (GO:0044236)|negative regulation of gene expression (GO:0010629)|nitrogen compound metabolic process (GO:0006807)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of protein catabolic process (GO:0045732)|post-embryonic development (GO:0009791)|protein ADP-ribosylation (GO:0006471)|skeletal system morphogenesis (GO:0048705)|smooth muscle tissue development (GO:0048745)|vasculogenesis (GO:0001570)	nucleus (GO:0005634)	enhancer binding (GO:0035326)|metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			NS(1)|breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			ACTTTTCTAAGAAGTCCTCCA	0.473																																					Ovarian(171;276 1987 3319 6837 11197)	dbGAP											0													128.0	132.0	131.0					3																	156422677		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537965	CCDS3177.1	3q25.31	2011-06-22			ENSG00000163659	ENSG00000163659		"""Poly (ADP-ribose) polymerases"""	23696	protein-coding gene	gene with protein product		612480				12851707	Standard	NM_001184717		Approved	DKFZP434J214, DKFZp686N0351, DDF1, PARP7, PARP-7, PARP-1, pART14, RM1	uc021xgg.1	Q7Z3E1	OTTHUMG00000158646	ENST00000461166.1:c.1731G>C	3.37:g.156422677G>C	ENSP00000420612:p.Lys577Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNK6|Q68CY9|Q86VP4|Q9Y4P7	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.K577N	ENST00000461166.1	37	c.1731	CCDS3177.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.50|17.50	3.405683|3.405683	0.62288|0.62288	.|.	.|.	ENSG00000163659|ENSG00000163659	ENST00000495891|ENST00000486483;ENST00000295924;ENST00000461166;ENST00000481853;ENST00000542783	.|T;T;T;T;T	.|0.14766	.|2.48;2.48;2.48;2.48;2.48	5.67|5.67	5.67|5.67	0.87782|0.87782	.|Poly(ADP-ribose) polymerase, catalytic domain (2);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.28830|0.28830	0.0715|0.0715	M|M	0.63208|0.63208	1.945|1.945	0.52099|0.52099	D|D	0.999941|0.999941	.|D	.|0.59357	.|0.985	.|P	.|0.60415	.|0.874	T|T	0.00641|0.00641	-1.1631|-1.1631	5|10	.|0.62326	.|D	.|0.03	.|.	10.3025|10.3025	0.43661|0.43661	0.1475:0.0:0.8525:0.0|0.1475:0.0:0.8525:0.0	.|.	.|577	.|Q7Z3E1	.|PARPT_HUMAN	Q|N	280|577	.|ENSP00000418757:K577N;ENSP00000295924:K577N;ENSP00000420612:K577N;ENSP00000418829:K577N;ENSP00000438345:K577N	.|ENSP00000295924:K577N	E|K	+|+	1|3	0|2	TIPARP|TIPARP	157905371|157905371	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.260000|3.260000	0.51523|0.51523	2.669000|2.669000	0.90835|0.90835	0.650000|0.650000	0.86243|0.86243	GAA|AAG	TIPARP	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000163659		0.473	TIPARP-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TIPARP	HGNC	protein_coding	OTTHUMT00000351618.1	151	0.00	0	G	NM_015508		156422677	156422677	+1	no_errors	ENST00000295924	ensembl	human	known	69_37n	missense	100	24.24	32	SNP	1.000	C
TJP3	27134	genome.wustl.edu	37	19	3750636	3750636	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:3750636C>T	ENST00000541714.2	+	21	3176	c.2714C>T	c.(2713-2715)tCc>tTc	p.S905F	TJP3_ENST00000587686.1_Missense_Mutation_p.S924F|TJP3_ENST00000382008.3_Missense_Mutation_p.S919F|TJP3_ENST00000587641.1_3'UTR|TJP3_ENST00000589378.1_Missense_Mutation_p.S914F|TJP3_ENST00000539908.2_Missense_Mutation_p.S869F|TJP3_ENST00000262968.9_Missense_Mutation_p.S938F	NM_001267560.1	NP_001254489.1	O95049	ZO3_HUMAN	tight junction protein 3	905					regulation of G1/S transition of mitotic cell cycle (GO:2000045)	apical plasma membrane (GO:0016324)|nucleus (GO:0005634)|tight junction (GO:0005923)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	26				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0118)|STAD - Stomach adenocarcinoma(1328;0.18)		GATGCGGAGTCCTCCGATGAA	0.567																																						dbGAP											0													71.0	65.0	67.0					19																	3750636		2202	4298	6500	-	-	-	SO:0001583	missense	0			AC005954	CCDS32873.1, CCDS32873.2, CCDS59332.1	19p13.3	2012-07-12	2012-07-12			ENSG00000105289			11829	protein-coding gene	gene with protein product	"""zona occludens 3"""	612689					Standard	NM_001267560		Approved	ZO-3	uc010xhu.3	O95049		ENST00000541714.2:c.2714C>T	19.37:g.3750636C>T	ENSP00000439278:p.Ser905Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFP3|B3KR73|B3KXZ0|B4E2W6|F5H2X0|F5H4S9|K7EK22|Q32N01	Missense_Mutation	SNP	pfam_PDZ,pfam_SH3_2,pfam_Guanylate_kin,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculS3,prints_ZonOcculdens	p.S938F	ENST00000541714.2	37	c.2813	CCDS32873.2	19	.	.	.	.	.	.	.	.	.	.	C	13.66	2.303604	0.40795	.	.	ENSG00000105289	ENST00000541714;ENST00000539908;ENST00000382008;ENST00000262968	T;T;T;T	0.11277	2.82;2.99;2.79;2.88	4.59	4.59	0.56863	.	0.393006	0.25500	N	0.030246	T	0.31167	0.0788	M	0.67953	2.075	0.48288	D	0.999629	D;D;D;D	0.89917	1.0;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.974;0.956;0.98	T	0.02047	-1.1223	10	0.56958	D	0.05	.	14.9176	0.70810	0.0:1.0:0.0:0.0	.	924;938;919;905	O95049-3;O95049-2;O95049;F5H2X0	.;.;ZO3_HUMAN;.	F	905;869;919;938	ENSP00000439278:S905F;ENSP00000439991:S869F;ENSP00000371438:S919F;ENSP00000262968:S938F	ENSP00000262968:S938F	S	+	2	0	TJP3	3701636	0.991000	0.36638	1.000000	0.80357	0.062000	0.15995	3.786000	0.55431	2.268000	0.75426	0.462000	0.41574	TCC	TJP3	-	NULL	ENSG00000105289		0.567	TJP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP3	HGNC	protein_coding	OTTHUMT00000453434.1	259	0.00	0	C			3750636	3750636	+1	no_errors	ENST00000262968	ensembl	human	known	69_37n	missense	204	17.41	43	SNP	0.997	T
TLR4	7099	genome.wustl.edu	37	9	120474783	120474783	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:120474783C>G	ENST00000355622.6	+	3	478	c.377C>G	c.(376-378)tCa>tGa	p.S126*	TLR4_ENST00000394487.4_Nonsense_Mutation_p.S86*|TLR4_ENST00000472304.1_3'UTR	NM_138554.4|NM_138557.2	NP_612564.1|NP_612567.1	O00206	TLR4_HUMAN	toll-like receptor 4	126					activation of MAPK activity (GO:0000187)|B cell proliferation involved in immune response (GO:0002322)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to lipoteichoic acid (GO:0071223)|cellular response to mechanical stimulus (GO:0071260)|defense response to bacterium (GO:0042742)|defense response to Gram-negative bacterium (GO:0050829)|detection of fungus (GO:0016046)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|innate immune response (GO:0045087)|interferon-gamma production (GO:0032609)|intestinal epithelial structure maintenance (GO:0060729)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of interleukin-23 production (GO:0032707)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of tumor necrosis factor production (GO:0032720)|nitric oxide production involved in inflammatory response (GO:0002537)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of chemokine production (GO:0032722)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 production (GO:0032732)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of JNK cascade (GO:0046330)|positive regulation of macrophage cytokine production (GO:0060907)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of nitric-oxide synthase biosynthetic process (GO:0051770)|positive regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070430)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|positive regulation of platelet activation (GO:0010572)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cytokine secretion (GO:0050707)|response to lipopolysaccharide (GO:0032496)|T-helper 1 type immune response (GO:0042088)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|lipopolysaccharide receptor complex (GO:0046696)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	lipopolysaccharide binding (GO:0001530)|lipopolysaccharide receptor activity (GO:0001875)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)	p.S126L(1)		breast(2)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(12)|lung(66)|ovary(4)|pancreas(1)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	103					Naloxone(DB01183)	TCTGGACTATCAAGTTTACAG	0.448																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											68.0	70.0	69.0					9																	120474783		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U88880	CCDS6818.1	9q33.1	2013-01-23			ENSG00000136869	ENSG00000136869		"""CD molecules"""	11850	protein-coding gene	gene with protein product		603030				9435236, 9237759	Standard	NM_138554		Approved	hToll, CD284, TLR-4, ARMD10	uc004bjz.4	O00206	OTTHUMG00000021046	ENST00000355622.6:c.377C>G	9.37:g.120474783C>G	ENSP00000363089:p.Ser126*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y8|A9XLP9|A9XLQ0|A9XLQ1|B4E194|D1CS52|D1CS53|Q5VZI8|Q5VZI9|Q9UK78|Q9UM57	Nonsense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.S126*	ENST00000355622.6	37	c.377	CCDS6818.1	9	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502070	0.85176	.	.	ENSG00000136869	ENST00000394487;ENST00000355622	.	.	.	5.08	3.12	0.35913	.	1.258120	0.05590	N	0.574440	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	.	4.4379	0.11559	0.16:0.5999:0.0:0.24	.	.	.	.	X	86;126	.	ENSP00000363089:S126X	S	+	2	0	TLR4	119514604	0.000000	0.05858	0.131000	0.22000	0.947000	0.59692	0.220000	0.17660	1.138000	0.42230	0.655000	0.94253	TCA	TLR4	-	pirsf_Toll-like_receptor	ENSG00000136869		0.448	TLR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR4	HGNC	protein_coding	OTTHUMT00000055549.3	171	0.00	0	C	NM_138554		120474783	120474783	+1	no_errors	ENST00000355622	ensembl	human	known	69_37n	nonsense	111	18.84	26	SNP	0.000	G
TMIGD2	126259	genome.wustl.edu	37	19	4292689	4292689	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:4292689G>A	ENST00000301272.2	-	5	801	c.756C>T	c.(754-756)ccC>ccT	p.P252P	TMIGD2_ENST00000600114.1_Silent_p.P132P|TMIGD2_ENST00000595645.1_Silent_p.P248P|TMIGD2_ENST00000600349.1_Silent_p.P80P	NM_001169126.1|NM_144615.2	NP_001162597.1|NP_653216.2	Q96BF3	TMIG2_HUMAN	transmembrane and immunoglobulin domain containing 2	252	Pro-rich.				positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of cytokine production (GO:0001819)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(1)|skin(2)	19				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0339)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGGGTggccgggcctggggc	0.662																																						dbGAP											0													35.0	45.0	42.0					19																	4292689		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0			BC015655	CCDS12126.1, CCDS59334.1	19p13.3	2014-02-12	2006-07-05					"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28324	protein-coding gene	gene with protein product		614715					Standard	NM_144615		Approved	MGC23244	uc002lzx.2	Q96BF3		ENST00000301272.2:c.756C>T	19.37:g.4292689G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UW59	Silent	SNP	smart_Ig_sub,pfscan_Ig-like	p.P252	ENST00000301272.2	37	c.756	CCDS12126.1	19																																																																																			TMIGD2	-	NULL	ENSG00000167664		0.662	TMIGD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMIGD2	HGNC	protein_coding	OTTHUMT00000458088.1	101	0.00	0	G	NM_144615		4292689	4292689	-1	no_errors	ENST00000301272	ensembl	human	known	69_37n	silent	39	42.86	30	SNP	0.000	A
TNFSF13B	10673	genome.wustl.edu	37	13	108922524	108922524	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:108922524G>A	ENST00000375887.4	+	1	459	c.281G>A	c.(280-282)gGa>gAa	p.G94E	TNFSF13B_ENST00000430559.1_Missense_Mutation_p.G94E|TNFSF13B_ENST00000542136.1_Missense_Mutation_p.G94E	NM_006573.4	NP_006564.1	Q9Y275	TN13B_HUMAN	tumor necrosis factor (ligand) superfamily, member 13b	94					B cell costimulation (GO:0031296)|B cell homeostasis (GO:0001782)|cell proliferation (GO:0008283)|immune response (GO:0006955)|immunoglobulin secretion (GO:0048305)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cell proliferation (GO:0008284)|positive regulation of germinal center formation (GO:0002636)|positive regulation of T cell proliferation (GO:0042102)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			large_intestine(1)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	all_lung(23;0.000396)|all_neural(89;0.00256)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00902)|Lung SC(71;0.104)		all cancers(43;0.184)|BRCA - Breast invasive adenocarcinoma(86;0.19)		Belimumab(DB08879)	CTGCCAGCAGGAGCAGGAGCC	0.662																																						dbGAP											0													21.0	26.0	24.0					13																	108922524		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF136293	CCDS9509.1, CCDS45067.1	13q32-q34	2008-05-14			ENSG00000102524	ENSG00000102524		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11929	protein-coding gene	gene with protein product		603969		TNFSF20		10331498, 10359578	Standard	NM_006573		Approved	BAFF, THANK, BLYS, TALL-1, TALL1, CD257	uc001vqr.3	Q9Y275	OTTHUMG00000017329	ENST00000375887.4:c.281G>A	13.37:g.108922524G>A	ENSP00000365048:p.Gly94Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E0ADT7|Q6FHD6|Q7Z5J2	Missense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,pfscan_TNF	p.G94E	ENST00000375887.4	37	c.281	CCDS9509.1	13	.	.	.	.	.	.	.	.	.	.	G	8.034	0.762487	0.15914	.	.	ENSG00000102524	ENST00000430559;ENST00000375887;ENST00000542136	T;T;T	0.44881	0.91;0.91;0.91	4.79	1.59	0.23543	.	3.094980	0.00810	N	0.001490	T	0.20251	0.0487	N	0.08118	0	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.001	T	0.22661	-1.0210	10	0.05721	T	0.95	-0.1576	3.2569	0.06835	0.5087:0.2662:0.2251:0.0	.	94;94	Q9Y275-2;Q9Y275	.;TN13B_HUMAN	E	94	ENSP00000389540:G94E;ENSP00000365048:G94E;ENSP00000445334:G94E	ENSP00000365048:G94E	G	+	2	0	TNFSF13B	107720525	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.468000	0.22051	0.038000	0.15604	-0.219000	0.12488	GGA	TNFSF13B	-	NULL	ENSG00000102524		0.662	TNFSF13B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNFSF13B	HGNC	protein_coding	OTTHUMT00000045739.3	39	0.00	0	G			108922524	108922524	+1	no_errors	ENST00000375887	ensembl	human	known	69_37n	missense	29	28.57	12	SNP	0.000	A
TPCN1	53373	genome.wustl.edu	37	12	113704123	113704123	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr12:113704123G>A	ENST00000335509.6	+	4	690	c.376G>A	c.(376-378)Gag>Aag	p.E126K	TPCN1_ENST00000550785.1_Missense_Mutation_p.E198K|TPCN1_ENST00000392569.4_Missense_Mutation_p.E58K|TPCN1_ENST00000541517.1_Missense_Mutation_p.E198K	NM_017901.4	NP_060371.2	Q9ULQ1	TPC1_HUMAN	two pore segment channel 1	126					calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|NAADP-sensitive calcium-release channel activity (GO:0072345)|voltage-gated calcium channel activity (GO:0005245)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(1)	40						CTCCCTGTGCGAGGCCCCCGC	0.652																																						dbGAP											0													180.0	191.0	187.0					12																	113704123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032995	CCDS31908.1, CCDS44985.1	12q24.21	2011-07-05			ENSG00000186815	ENSG00000186815		"""Voltage-gated ion channels / Two-pore channels"""	18182	protein-coding gene	gene with protein product		609666				10574461, 10753632, 16382101	Standard	XM_005253905		Approved	KIAA1169, FLJ20612, TPC1	uc001tux.3	Q9ULQ1	OTTHUMG00000169625	ENST00000335509.6:c.376G>A	12.37:g.113704123G>A	ENSP00000335300:p.Glu126Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E258|Q86XS9|Q8NC20	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.E198K	ENST00000335509.6	37	c.592	CCDS31908.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.511724	0.96402	.	.	ENSG00000186815	ENST00000552642;ENST00000552985;ENST00000335509;ENST00000552897;ENST00000550785;ENST00000541517;ENST00000392569;ENST00000552542;ENST00000548465	T;D;D;D;D	0.97976	-0.45;-4.49;-4.62;-4.62;-4.64	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	D	0.98670	0.9554	M	0.78456	2.415	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.981;0.999;0.999	D	0.99494	1.0951	10	0.56958	D	0.05	-25.8538	19.1947	0.93682	0.0:0.0:1.0:0.0	.	126;198;126	A5PKY2;Q9ULQ1-3;Q9ULQ1	.;.;TPC1_HUMAN	K	102;212;126;58;198;198;58;58;58	ENSP00000447569:E212K;ENSP00000335300:E126K;ENSP00000448083:E198K;ENSP00000438125:E198K;ENSP00000376350:E58K	ENSP00000335300:E126K	E	+	1	0	TPCN1	112188506	1.000000	0.71417	1.000000	0.80357	0.795000	0.44927	9.428000	0.97476	2.532000	0.85374	0.561000	0.74099	GAG	TPCN1	-	NULL	ENSG00000186815		0.652	TPCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPCN1	HGNC	protein_coding	OTTHUMT00000405156.3	46	0.00	0	G	NM_017901		113704123	113704123	+1	no_errors	ENST00000541517	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	1.000	A
TRIM24	8805	genome.wustl.edu	37	7	138210052	138210052	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:138210052G>A	ENST00000343526.4	+	5	1046	c.831G>A	c.(829-831)ctG>ctA	p.L277L	TRIM24_ENST00000497516.1_3'UTR|TRIM24_ENST00000415680.2_Silent_p.L277L			O15164	TIF1A_HUMAN	tripartite motif containing 24	277					calcium ion homeostasis (GO:0055074)|cellular response to estrogen stimulus (GO:0071391)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein catabolic process (GO:0030163)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of protein stability (GO:0031647)|regulation of signal transduction by p53 class mediator (GO:1901796)|regulation of vitamin D receptor signaling pathway (GO:0070562)|response to peptide hormone (GO:0043434)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nuclear euchromatin (GO:0005719)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|ligase activity (GO:0016874)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein kinase activity (GO:0004672)|receptor binding (GO:0005102)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(5)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|ovary(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	40						TCACCAAACTGATGGAAAAAA	0.239																																					Pancreas(179;936 2074 16128 47811 50326)|Colon(136;168 1735 9344 12243 52014)	dbGAP											0													37.0	38.0	38.0					7																	138210052		2190	4249	6439	-	-	-	SO:0001819	synonymous_variant	0			AF009353	CCDS5847.1, CCDS47720.1	7q32-q34	2013-01-28	2011-01-25	2005-06-02	ENSG00000122779	ENSG00000122779		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	11812	protein-coding gene	gene with protein product		603406	"""transcriptional intermediary factor 1"", ""tripartite motif-containing 24"""	TIF1		9115274, 9191165	Standard	NM_003852		Approved	hTIF1, Tif1a, RNF82, TIF1A	uc003vuc.3	O15164	OTTHUMG00000155820	ENST00000343526.4:c.831G>A	7.37:g.138210052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1R7|A4D1R8|O95854	Silent	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_Bromodomain,prints_Bromodomain	p.L277	ENST00000343526.4	37	c.831	CCDS5847.1	7																																																																																			TRIM24	-	smart_Bbox_C	ENSG00000122779		0.239	TRIM24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM24	HGNC	protein_coding	OTTHUMT00000341814.1	152	0.00	0	G	NM_015905		138210052	138210052	+1	no_errors	ENST00000343526	ensembl	human	known	69_37n	silent	120	20.53	31	SNP	0.999	A
TSPAN17	26262	genome.wustl.edu	37	5	176081937	176081937	+	Silent	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:176081937C>G	ENST00000503045.1	+	5	484	c.429C>G	c.(427-429)ctC>ctG	p.L143L	TSPAN17_ENST00000515708.1_Silent_p.L166L|TSPAN17_ENST00000298564.10_Intron|TSPAN17_ENST00000310032.8_Silent_p.L166L|TSPAN17_ENST00000405525.2_Silent_p.L166L|TSPAN17_ENST00000508164.1_Silent_p.L166L			Q96FV3	TSN17_HUMAN	tetraspanin 17	166					establishment of protein localization to organelle (GO:0072594)|protein ubiquitination (GO:0016567)	integral component of membrane (GO:0016021)|ubiquitin ligase complex (GO:0000151)	enzyme binding (GO:0019899)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(4)|kidney(1)|large_intestine(2)|lung(5)|urinary_tract(1)	13	all_cancers(89;0.00141)|Renal(175;0.000269)|Lung NSC(126;0.00814)|all_lung(126;0.0133)	Medulloblastoma(196;0.00498)|all_neural(177;0.0212)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			ACTGGAACCTCAATATCTACT	0.662																																						dbGAP											0													43.0	44.0	44.0					5																	176081937		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF174603	CCDS34298.1, CCDS47346.1, CCDS47346.2, CCDS54952.1	5q35.3	2013-02-14	2005-03-21	2005-03-21	ENSG00000048140	ENSG00000048140		"""Tetraspanins"""	13594	protein-coding gene	gene with protein product			"""F-box only protein 23, transmembrane 4 superfamily member 17"""	FBXO23, TM4SF17		10531035, 10531037	Standard	NM_012171		Approved	FBX23	uc003met.3	Q96FV3	OTTHUMG00000163230	ENST00000503045.1:c.429C>G	5.37:g.176081937C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NXF7|Q96S98|Q9UKB9	Nonsense_Mutation	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.S99*	ENST00000503045.1	37	c.296		5	.	.	.	.	.	.	.	.	.	.	C	9.965	1.223964	0.22457	.	.	ENSG00000048140	ENST00000507471	.	.	.	5.23	3.44	0.39384	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-22.8134	9.097	0.36645	0.1471:0.7748:0.0:0.0781	.	.	.	.	X	99	.	.	S	+	2	0	TSPAN17	176014543	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.788000	0.38714	0.588000	0.29660	0.462000	0.41574	TCA	TSPAN17	-	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2	ENSG00000048140		0.662	TSPAN17-008	NOVEL	basic|exp_conf	protein_coding	TSPAN17	HGNC	protein_coding	OTTHUMT00000372215.1	112	0.00	0	C			176081937	176081937	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000507471	ensembl	human	putative	69_37n	nonsense	62	25.30	21	SNP	1.000	G
TSPAN7	7102	genome.wustl.edu	37	X	38420832	38420832	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:38420832G>A	ENST00000378482.2	+	1	210	c.33G>A	c.(31-33)gtG>gtA	p.V11V	TSPAN7_ENST00000422612.2_5'UTR|TSPAN7_ENST00000286824.6_Silent_p.V11V|TSPAN7_ENST00000545599.1_5'UTR|TM4SF2_ENST00000465127.1_Intron	NM_004615.3	NP_004606.2	P41732	TSN7_HUMAN	tetraspanin 7	11					viral process (GO:0016032)	integral component of plasma membrane (GO:0005887)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	11						CCAAACCTGTGATAACCTGTC	0.657																																						dbGAP											0													175.0	119.0	138.0					X																	38420832		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			D29808	CCDS14248.1	Xp11.4	2013-02-14	2005-03-21	2005-03-21	ENSG00000156298	ENSG00000156298		"""CD molecules"", ""Tetraspanins"""	11854	protein-coding gene	gene with protein product		300096	"""transmembrane 4 superfamily member 2"", ""mental retardation, X-linked 58"""	MXS1, TM4SF2, MRX58		12070254	Standard	NM_004615		Approved	DXS1692E, TALLA-1, A15, CD231	uc004deg.4	P41732	OTTHUMG00000024090	ENST00000378482.2:c.33G>A	X.37:g.38420832G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5W7|D3DWB1|Q8WVG5|Q9UEY9	Silent	SNP	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Tetraspanin	p.V11	ENST00000378482.2	37	c.33	CCDS14248.1	X																																																																																			TSPAN7	-	NULL	ENSG00000156298		0.657	TSPAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN7	HGNC	protein_coding	OTTHUMT00000356412.1	105	0.00	0	G			38420832	38420832	+1	no_errors	ENST00000378482	ensembl	human	known	69_37n	silent	78	19.59	19	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179483183	179483183	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:179483183C>A	ENST00000591111.1	-	202	42303	c.42079G>T	c.(42079-42081)Gaa>Taa	p.E14027*	TTN_ENST00000460472.2_Nonsense_Mutation_p.E6603*|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Nonsense_Mutation_p.E6795*|TTN_ENST00000589042.1_Nonsense_Mutation_p.E15668*|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000342992.6_Nonsense_Mutation_p.E13100*|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000359218.5_Nonsense_Mutation_p.E6728*|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	14027	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAAATGTTTCTGTCACTTCT	0.388																																						dbGAP											0													60.0	56.0	58.0					2																	179483183		1892	4120	6012	-	-	-	SO:0001587	stop_gained	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.42079G>T	2.37:g.179483183C>A	ENSP00000465570:p.Glu14027*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E13100*	ENST00000591111.1	37	c.39298		2	.	.	.	.	.	.	.	.	.	.	C	58	33.513142	0.99981	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	.	.	.	5.55	5.55	0.83447	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.864	0.96798	0.0:1.0:0.0:0.0	.	.	.	.	X	13100;6603;6795;6728;6603	.	ENSP00000340554:E6795X	E	-	1	0	TTN	179191428	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.729000	0.84864	2.772000	0.95346	0.650000	0.86243	GAA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	105	0.00	0	C	NM_133378		179483183	179483183	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	nonsense	106	19.70	26	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179483357	179483357	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:179483357C>G	ENST00000591111.1	-	201	42221	c.41997G>C	c.(41995-41997)caG>caC	p.Q13999H	TTN_ENST00000460472.2_Missense_Mutation_p.Q6575H|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.Q6767H|TTN_ENST00000589042.1_Missense_Mutation_p.Q15640H|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000589830.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000342992.6_Missense_Mutation_p.Q13072H|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.Q6700H|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA			Q8WZ42	TITIN_HUMAN	titin	13999	Ig-like 95.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CATGTTTGTTCTGAAGCACAA	0.353																																						dbGAP											0													170.0	155.0	160.0					2																	179483357		1831	4075	5906	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41997G>C	2.37:g.179483357C>G	ENSP00000465570:p.Gln13999His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.Q13072H	ENST00000591111.1	37	c.39216		2	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928831	0.34002	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.67698	-0.28;-0.28;-0.28;-0.28	5.75	4.86	0.63082	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.45357	0.1338	N	0.12182	0.205	0.32346	N	0.559082	B;B;B;B	0.12630	0.006;0.006;0.006;0.006	B;B;B;B	0.17433	0.018;0.018;0.018;0.018	T	0.49273	-0.8957	9	0.87932	D	0	.	4.2806	0.10831	0.2162:0.6314:0.0:0.1524	.	6575;6700;6767;13999	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	H	13072;6575;6767;6700;6575	ENSP00000343764:Q13072H;ENSP00000434586:Q6575H;ENSP00000340554:Q6767H;ENSP00000352154:Q6700H	ENSP00000340554:Q6767H	Q	-	3	2	TTN	179191602	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.612000	0.24283	2.878000	0.98634	0.650000	0.86243	CAG	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2	ENSG00000155657		0.353	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	483	0.00	0	C	NM_133378		179483357	179483357	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	399	11.73	53	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179640575	179640575	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:179640575C>G	ENST00000591111.1	-	28	6240	c.6016G>C	c.(6016-6018)Gaa>Caa	p.E2006Q	TTN_ENST00000460472.2_Missense_Mutation_p.E1960Q|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E1960Q|TTN_ENST00000589042.1_Missense_Mutation_p.E2006Q|TTN_ENST00000342992.6_Missense_Mutation_p.E2006Q|TTN-AS1_ENST00000610005.1_RNA|RP11-88L24.4_ENST00000582038.2_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E2006Q|TTN_ENST00000359218.5_Missense_Mutation_p.E1960Q|TTN-AS1_ENST00000584485.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12808					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TAGCCCTCTTCTGTTCTGCGC	0.438																																						dbGAP											0													119.0	124.0	122.0					2																	179640575		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.6016G>C	2.37:g.179640575C>G	ENSP00000465570:p.Glu2006Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E2006Q	ENST00000591111.1	37	c.6016		2	.	.	.	.	.	.	.	.	.	.	C	12.72	2.022336	0.35701	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.68025	-0.3;-0.04;-0.07;-0.07;0.1	5.12	5.12	0.69794	Ribonuclease H-like (1);	.	.	.	.	T	0.73281	0.3567	N	0.24115	0.695	0.38246	D	0.941463	D;D;D;D;D	0.89917	0.999;0.999;0.999;0.999;1.0	D;D;D;D;D	0.87578	0.994;0.994;0.994;0.994;0.998	T	0.79374	-0.1830	9	0.87932	D	0	.	18.5589	0.91094	0.0:1.0:0.0:0.0	.	1960;1960;1960;2006;2006	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	Q	2006;1960;1960;1960;1960;2006	ENSP00000343764:E2006Q;ENSP00000434586:E1960Q;ENSP00000340554:E1960Q;ENSP00000352154:E1960Q;ENSP00000354117:E2006Q	ENSP00000340554:E1960Q	E	-	1	0	TTN	179348820	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	7.779000	0.85648	2.387000	0.81309	0.609000	0.83330	GAA	TTN	-	superfamily_RNaseH-like_dom	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	174	0.00	0	C	NM_133378		179640575	179640575	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	161	19.90	40	SNP	1.000	G
UBE4A	9354	genome.wustl.edu	37	11	118255641	118255642	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:118255641_118255642delTT	ENST00000431736.2	+	15	2486_2487	c.2414_2415delTT	c.(2413-2415)cttfs	p.L806fs	UBE4A_ENST00000252108.3_Frame_Shift_Del_p.L799fs|UBE4A_ENST00000545354.1_Frame_Shift_Del_p.L271fs					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		GCCATCTTCCTTTTGGATGAAG	0.347																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.2414_2415delTT	11.37:g.118255643_118255644delTT	ENSP00000387362:p.Leu806fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.L806fs	ENST00000431736.2	37	c.2414_2415	CCDS8396.1	11																																																																																			UBE4A	-	pfam_Ub_conjug_fac_E4_core	ENSG00000110344		0.347	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBE4A	HGNC	protein_coding	OTTHUMT00000398143.1	118	0.00	0	TT	NM_004788		118255641	118255642	+1	no_errors	ENST00000431736	ensembl	human	known	69_37n	frame_shift_del	29	62.82	49	DEL	1.000:0.986	-
UGT2B15	7366	genome.wustl.edu	37	4	69536210	69536210	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:69536210G>T	ENST00000338206.5	-	1	136	c.127C>A	c.(127-129)Ctg>Atg	p.L43M		NM_001076.3	NP_001067.2	P54855	UDB15_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B15	43					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)									Acetaminophen(DB00316)|Dabigatran etexilate(DB06695)|Ezetimibe(DB00973)|Lorazepam(DB00186)|Morphine(DB00295)|Oxazepam(DB00842)|Valproic Acid(DB00313)	AGCTCTTCCAGGATTGTCTTC	0.433																																						dbGAP											0													243.0	255.0	251.0					4																	69536210		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180322	CCDS3524.1	4q13	2008-02-05	2005-07-20		ENSG00000196620	ENSG00000196620		"""UDP glucuronosyltransferases"""	12546	protein-coding gene	gene with protein product		600069	"""UDP glycosyltransferase 2 family, polypeptide B15"""			7835904	Standard	NM_001076		Approved	UGT2B8	uc021xow.1	P54855	OTTHUMG00000161507	ENST00000338206.5:c.127C>A	4.37:g.69536210G>T	ENSP00000341045:p.Leu43Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDX0|A6NNJ4|A8K054|P23765|Q9UK63	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.L43M	ENST00000338206.5	37	c.127	CCDS3524.1	4	.	.	.	.	.	.	.	.	.	.	g	12.61	1.991041	0.35131	.	.	ENSG00000196620	ENST00000338206	T	0.62232	0.04	2.79	2.79	0.32731	.	0.000000	0.46442	U	0.000286	T	0.73489	0.3593	M	0.81802	2.56	0.23930	N	0.996433	P	0.49358	0.923	P	0.56648	0.803	T	0.65841	-0.6070	10	0.72032	D	0.01	.	11.3195	0.49412	0.0:0.0:1.0:0.0	.	43	P54855	UDB15_HUMAN	M	43	ENSP00000341045:L43M	ENSP00000341045:L43M	L	-	1	2	UGT2B15	69218805	0.000000	0.05858	0.267000	0.24556	0.647000	0.38526	-0.609000	0.05635	1.536000	0.49237	0.442000	0.29010	CTG	UGT2B15	-	pfam_UDP_glucos_trans	ENSG00000196620		0.433	UGT2B15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B15	HGNC	protein_coding	OTTHUMT00000365172.1	204	0.00	0	G	NM_001076		69536210	69536210	-1	no_errors	ENST00000338206	ensembl	human	known	69_37n	missense	102	46.03	87	SNP	0.974	T
UGT2B11	10720	genome.wustl.edu	37	4	70070294	70070294	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr4:70070294G>A	ENST00000446444.1	-	5	1172	c.1164C>T	c.(1162-1164)atC>atT	p.I388I	RP11-704M14.1_ENST00000504301.1_RNA|RP11-704M14.1_ENST00000505646.1_RNA	NM_001073.1	NP_001064.1	O75310	UDB11_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B11	388					estrogen metabolic process (GO:0008210)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	42						CCACCATAGGGATCCCATGGT	0.423																																						dbGAP											0													109.0	110.0	110.0					4																	70070294		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF016492	CCDS3527.1	4q13.3	2008-02-05	2005-07-20		ENSG00000213759	ENSG00000213759		"""UDP glucuronosyltransferases"""	12545	protein-coding gene	gene with protein product		603064	"""UDP glycosyltransferase 2 family, polypeptide B11"""			9675083	Standard	NM_001073		Approved		uc003heh.3	O75310	OTTHUMG00000129395	ENST00000446444.1:c.1164C>T	4.37:g.70070294G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KNV9	Silent	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.I388	ENST00000446444.1	37	c.1164	CCDS3527.1	4																																																																																			UGT2B11	-	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	ENSG00000213759		0.423	UGT2B11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B11	HGNC	protein_coding	OTTHUMT00000251551.2	413	0.00	0	G	NM_001073		70070294	70070294	-1	no_errors	ENST00000446444	ensembl	human	known	69_37n	silent	347	11.00	43	SNP	0.993	A
ULBP3	79465	genome.wustl.edu	37	6	150387087	150387087	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr6:150387087C>G	ENST00000367339.2	-	2	328	c.300G>C	c.(298-300)caG>caC	p.Q100H	ULBP3_ENST00000438272.2_Missense_Mutation_p.Q100H			Q9BZM4	N2DL3_HUMAN	UL16 binding protein 3	100	MHC class I alpha-1 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)|viral process (GO:0016032)	anchored component of plasma membrane (GO:0046658)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			central_nervous_system(1)|lung(4)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	9		Ovarian(120;0.12)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.45e-12)		GTCTGAGCCTCTGCCCCACCT	0.542																																						dbGAP											0													146.0	143.0	144.0					6																	150387087		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF304379	CCDS5225.1	6q25	2008-04-11			ENSG00000131019	ENSG00000131019			14895	protein-coding gene	gene with protein product		605699				11239445, 11827464	Standard	NM_024518		Approved	RAET1N	uc003qns.3	Q9BZM4	OTTHUMG00000015811	ENST00000367339.2:c.300G>C	6.37:g.150387087C>G	ENSP00000356308:p.Gln100His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VY82|Q8IZX5|Q8TE75	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.Q100H	ENST00000367339.2	37	c.300	CCDS5225.1	6	.	.	.	.	.	.	.	.	.	.	C	10.52	1.373979	0.24857	.	.	ENSG00000131019	ENST00000399812;ENST00000253335;ENST00000367339;ENST00000438272	T;T	0.09073	3.02;3.02	3.49	-6.99	0.01605	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	.	.	.	.	T	0.02848	0.0085	L	0.60455	1.87	0.09310	N	1	P;P	0.40931	0.733;0.733	P;P	0.47626	0.552;0.552	T	0.14811	-1.0459	9	0.62326	D	0.03	0.0145	0.4717	0.00533	0.2744:0.3154:0.1267:0.2835	.	100;100	Q5VY82;Q9BZM4	.;N2DL3_HUMAN	H	51;100;100;100	ENSP00000356308:Q100H;ENSP00000403562:Q100H	ENSP00000253335:Q100H	Q	-	3	2	ULBP3	150428780	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-7.227000	0.00041	-3.787000	0.00107	0.478000	0.44815	CAG	ULBP3	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	ENSG00000131019		0.542	ULBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP3	HGNC	protein_coding	OTTHUMT00000042678.2	318	0.31	1	C			150387087	150387087	-1	no_errors	ENST00000367339	ensembl	human	known	69_37n	missense	230	20.14	58	SNP	0.000	G
UNC13C	440279	genome.wustl.edu	37	15	54307326	54307326	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr15:54307326G>T	ENST00000260323.11	+	1	2226	c.2226G>T	c.(2224-2226)caG>caT	p.Q742H	UNC13C_ENST00000545554.1_Missense_Mutation_p.Q742H|UNC13C_ENST00000537900.1_Missense_Mutation_p.Q742H	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	742					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		ATTCTTATCAGGGAGCTAATT	0.428																																						dbGAP											0													38.0	35.0	36.0					15																	54307326		1879	4113	5992	-	-	-	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.2226G>T	15.37:g.54307326G>T	ENSP00000260323:p.Gln742His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.Q742H	ENST00000260323.11	37	c.2226	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	7.766	0.706331	0.15239	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	T;T;T	0.79454	-1.27;-1.27;-1.27	5.69	-1.09	0.09904	.	.	.	.	.	T	0.57548	0.2061	N	0.19112	0.55	0.09310	N	1	B	0.22480	0.07	B	0.24541	0.054	T	0.46762	-0.9168	9	0.49607	T	0.09	.	1.7095	0.02889	0.272:0.2245:0.3886:0.1149	.	742	Q8NB66	UN13C_HUMAN	H	742	ENSP00000260323:Q742H;ENSP00000438156:Q742H;ENSP00000442569:Q742H	ENSP00000260323:Q742H	Q	+	3	2	UNC13C	52094618	0.288000	0.24324	0.144000	0.22314	0.951000	0.60555	-0.047000	0.11963	-0.178000	0.10672	-0.145000	0.13849	CAG	UNC13C	-	NULL	ENSG00000137766		0.428	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	75	0.00	0	G	NM_173166		54307326	54307326	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	missense	49	38.75	31	SNP	0.103	T
URB1	9875	genome.wustl.edu	37	21	33732208	33732208	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr21:33732208G>C	ENST00000382751.3	-	14	1881	c.1766C>G	c.(1765-1767)tCt>tGt	p.S589C		NM_014825.2	NP_055640.2	O60287	NPA1P_HUMAN	URB1 ribosome biogenesis 1 homolog (S. cerevisiae)	589						nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(9)|kidney(3)|skin(1)|stomach(1)	19						GCCCTGCTCAGAGATGACACC	0.562																																						dbGAP											0													34.0	33.0	33.0					21																	33732208		692	1591	2283	-	-	-	SO:0001583	missense	0			AB011111	CCDS46645.1	21q22.11	2006-11-28	2006-11-28	2006-11-28	ENSG00000142207	ENSG00000142207			17344	protein-coding gene	gene with protein product	nucleolar preribosomal-associated protein 1	608865	"""chromosome 21 open reading frame 108"""	C21orf108		9628581	Standard	NM_014825		Approved	KIAA0539, NPA1	uc002ypn.2	O60287	OTTHUMG00000064919	ENST00000382751.3:c.1766C>G	21.37:g.33732208G>C	ENSP00000372199:p.Ser589Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSE5|Q96NX1|Q9NYQ1	Missense_Mutation	SNP	pfam_Npa1_N,superfamily_ARM-type_fold	p.S589C	ENST00000382751.3	37	c.1766	CCDS46645.1	21	.	.	.	.	.	.	.	.	.	.	G	12.92	2.081067	0.36758	.	.	ENSG00000142207	ENST00000382751	T	0.35048	1.33	4.84	1.86	0.25419	.	0.248541	0.34906	N	0.003591	T	0.39759	0.1090	L	0.60455	1.87	0.24214	N	0.995461	D	0.69078	0.997	P	0.52710	0.707	T	0.24368	-1.0162	10	0.62326	D	0.03	-4.2205	5.1872	0.15189	0.0741:0.2686:0.5188:0.1385	.	589	O60287	NPA1P_HUMAN	C	589	ENSP00000372199:S589C	ENSP00000372199:S589C	S	-	2	0	URB1	32654079	1.000000	0.71417	0.316000	0.25252	0.193000	0.23685	3.118000	0.50414	0.195000	0.20347	0.655000	0.94253	TCT	URB1	-	NULL	ENSG00000142207		0.562	URB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URB1	HGNC	protein_coding	OTTHUMT00000139400.2	51	0.00	0	G			33732208	33732208	-1	no_errors	ENST00000382751	ensembl	human	known	69_37n	missense	34	43.33	26	SNP	0.700	C
USP20	10868	genome.wustl.edu	37	9	132637592	132637592	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:132637592G>A	ENST00000315480.4	+	20	2210	c.2052G>A	c.(2050-2052)aaG>aaA	p.K684K	USP20_ENST00000372429.3_Silent_p.K684K|USP20_ENST00000358355.1_Silent_p.K684K			Q9Y2K6	UBP20_HUMAN	ubiquitin specific peptidase 20	684	USP.				endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|urinary_tract(1)	11		Ovarian(14;0.00556)				CCCACAGGAAGAGCAGCGAGG	0.687																																						dbGAP											0													20.0	27.0	25.0					9																	132637592		2104	4208	6312	-	-	-	SO:0001819	synonymous_variant	0			AB023220	CCDS43892.1	9q34.2	2014-07-15	2005-08-08		ENSG00000136878	ENSG00000136878		"""Ubiquitin-specific peptidases"""	12619	protein-coding gene	gene with protein product		615143	"""ubiquitin specific protease 20"""			12838346	Standard	NM_006676		Approved	KIAA1003	uc004byr.3	Q9Y2K6	OTTHUMG00000020793	ENST00000315480.4:c.2052G>A	9.37:g.132637592G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q541F1|Q8IXQ1|Q96LG5|Q9UQN8|Q9UQP0	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.K684	ENST00000315480.4	37	c.2052	CCDS43892.1	9																																																																																			USP20	-	pfscan_Peptidase_C19	ENSG00000136878		0.687	USP20-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	USP20	HGNC	protein_coding	OTTHUMT00000054604.2	28	0.00	0	G			132637592	132637592	+1	no_errors	ENST00000315480	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	1.000	A
VPS54	51542	genome.wustl.edu	37	2	64148438	64148438	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:64148438C>G	ENST00000272322.4	-	13	1925	c.1771G>C	c.(1771-1773)Gag>Cag	p.E591Q	VPS54_ENST00000409558.4_Missense_Mutation_p.E579Q|VPS54_ENST00000354504.3_Missense_Mutation_p.E438Q			Q9P1Q0	VPS54_HUMAN	vacuolar protein sorting 54 homolog (S. cerevisiae)	591					growth (GO:0040007)|homeostasis of number of cells within a tissue (GO:0048873)|musculoskeletal movement (GO:0050881)|neurofilament cytoskeleton organization (GO:0060052)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	GARP complex (GO:0000938)				endometrium(3)|kidney(4)|large_intestine(8)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	27						TTTCCTAGCTCTGAGTCAGTT	0.363																																						dbGAP											0													56.0	58.0	57.0					2																	64148438		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF102177	CCDS33208.1, CCDS46302.1	2p15-p14	2014-06-13	2006-12-19		ENSG00000143952	ENSG00000143952			18652	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 164"""	614633	"""vacuolar protein sorting 54 (yeast)"""			12039048	Standard	NM_016516		Approved	HCC8, PPP1R164	uc002scq.3	Q9P1Q0	OTTHUMG00000152627	ENST00000272322.4:c.1771G>C	2.37:g.64148438C>G	ENSP00000272322:p.Glu591Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VIR5|Q86YF7|Q8N6G3|Q9NPV0|Q9NT07|Q9NUJ0	Missense_Mutation	SNP	pfam_Vps54,pfam_Vacuolar_sorting-assoc_54	p.E591Q	ENST00000272322.4	37	c.1771	CCDS33208.1	2	.	.	.	.	.	.	.	.	.	.	C	25.2	4.617853	0.87359	.	.	ENSG00000143952	ENST00000354504;ENST00000272322;ENST00000409558;ENST00000483277;ENST00000394400	T;T;T	0.34472	1.36;1.4;1.4	5.8	5.8	0.92144	.	0.000000	0.85682	D	0.000000	T	0.58481	0.2125	M	0.72894	2.215	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.69824	0.958;0.925;0.966	T	0.49409	-0.8943	10	0.12430	T	0.62	.	20.0734	0.97734	0.0:1.0:0.0:0.0	.	438;591;579	Q9P1Q0-3;Q9P1Q0;Q9P1Q0-4	.;VPS54_HUMAN;.	Q	438;591;579;579;591	ENSP00000346499:E438Q;ENSP00000272322:E591Q;ENSP00000386980:E579Q	ENSP00000272322:E591Q	E	-	1	0	VPS54	64001942	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.328000	0.79160	2.748000	0.94277	0.655000	0.94253	GAG	VPS54	-	NULL	ENSG00000143952		0.363	VPS54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS54	HGNC	protein_coding	OTTHUMT00000327062.2	207	0.00	0	C	NM_016516		64148438	64148438	-1	no_errors	ENST00000272322	ensembl	human	known	69_37n	missense	143	15.88	27	SNP	1.000	G
VWCE	220001	genome.wustl.edu	37	11	61026446	61026446	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:61026446G>C	ENST00000335613.5	-	20	2955	c.2569C>G	c.(2569-2571)Cta>Gta	p.L857V	VWCE_ENST00000535710.1_Missense_Mutation_p.L322V	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	857	Pro-rich.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						GCTAGAGGTAGAGTGGGGGCT	0.652																																						dbGAP											0													26.0	31.0	29.0					11																	61026446		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.2569C>G	11.37:g.61026446G>C	ENSP00000334186:p.Leu857Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV0|Q7Z7L6|Q86WK8	Missense_Mutation	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.L857V	ENST00000335613.5	37	c.2569	CCDS8002.1	11	.	.	.	.	.	.	.	.	.	.	G	15.01	2.705977	0.48412	.	.	ENSG00000167992	ENST00000335613;ENST00000535710	T;T	0.72167	-0.63;3.26	4.64	4.64	0.57946	.	0.000000	0.28683	N	0.014500	T	0.65238	0.2672	L	0.50333	1.59	0.30372	N	0.782779	P	0.47302	0.893	B	0.40825	0.341	T	0.71813	-0.4479	10	0.66056	D	0.02	.	13.3742	0.60728	0.0:0.0:1.0:0.0	.	857	Q96DN2	VWCE_HUMAN	V	857;322	ENSP00000334186:L857V;ENSP00000442570:L322V	ENSP00000334186:L857V	L	-	1	2	VWCE	60783022	1.000000	0.71417	0.930000	0.37139	0.039000	0.13416	4.294000	0.59043	2.268000	0.75426	0.655000	0.94253	CTA	VWCE	-	NULL	ENSG00000167992		0.652	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	85	0.00	0	G	NM_152718		61026446	61026446	-1	no_errors	ENST00000335613	ensembl	human	known	69_37n	missense	24	41.46	17	SNP	0.978	C
WASL	8976	genome.wustl.edu	37	7	123324635	123324635	+	Splice_Site	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr7:123324635C>G	ENST00000223023.4	-	11	1789		c.e11-1			NM_003941.2	NP_003932.3	O00401	WASL_HUMAN	Wiskott-Aldrich syndrome-like						actin polymerization or depolymerization (GO:0008154)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cellular protein complex localization (GO:0034629)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane budding (GO:0006900)|mitotic nuclear division (GO:0007067)|nitric oxide metabolic process (GO:0046209)|positive regulation of clathrin-mediated endocytosis (GO:2000370)|positive regulation of filopodium assembly (GO:0051491)|protein complex assembly (GO:0006461)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|response to bacterium (GO:0009617)|small molecule metabolic process (GO:0044281)|spindle localization (GO:0051653)|transcription, DNA-templated (GO:0006351)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	actin cap (GO:0030478)|actin cytoskeleton (GO:0015629)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	small GTPase regulator activity (GO:0005083)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						tcatcttcatctACAAGAAAA	0.274																																						dbGAP											0													49.0	46.0	47.0					7																	123324635		1768	3333	5101	-	-	-	SO:0001630	splice_region_variant	0			D88460	CCDS34743.1	7q31.3	2008-02-01			ENSG00000106299	ENSG00000106299			12735	protein-coding gene	gene with protein product		605056				9422512, 9322739	Standard	NM_003941		Approved	N-WASP, NWASP	uc003vkz.3	O00401	OTTHUMG00000157346	ENST00000223023.4:c.1457-1G>C	7.37:g.123324635C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1JUI9|Q7Z746	Splice_Site	SNP	-	e11-1	ENST00000223023.4	37	c.1457-1	CCDS34743.1	7																																																																																			WASL	-	-	ENSG00000106299		0.274	WASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WASL	HGNC	protein_coding	OTTHUMT00000348522.1	297	0.00	0	C	NM_003941	Intron	123324635	123324635	-1	no_errors	ENST00000223023	ensembl	human	known	69_37n	splice_site	234	16.73	47	SNP	1.000	G
WDFY2	115825	genome.wustl.edu	37	13	52325491	52325491	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr13:52325491G>A	ENST00000298125.5	+	8	951	c.771G>A	c.(769-771)ttG>ttA	p.L257L	WDFY2_ENST00000460145.2_3'UTR	NM_052950.3	NP_443182.1	Q96P53	WDFY2_HUMAN	WD repeat and FYVE domain containing 2	257							metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	16		Breast(56;0.000208)|Lung NSC(96;0.000517)|Prostate(109;0.0041)|Hepatocellular(98;0.0652)|Myeloproliferative disorder(33;0.164)|all_neural(104;0.191)		GBM - Glioblastoma multiforme(99;9e-08)		CGCGACAATTGATCTCCTGTG	0.562																																						dbGAP											0													134.0	105.0	115.0					13																	52325491		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF411978	CCDS9429.1	13q14.12	2013-01-09	2003-03-13		ENSG00000139668	ENSG00000139668		"""Zinc fingers, FYVE domain containing"", ""WD repeat domain containing"""	20482	protein-coding gene	gene with protein product		610418	"""WD40 and FYVE domain containing 2"""				Standard	NM_052950		Approved	ZFYVE22	uc001vfp.3	Q96P53	OTTHUMG00000017407	ENST00000298125.5:c.771G>A	13.37:g.52325491G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AL86|Q96CS1	Silent	SNP	pfam_WD40_repeat,pfam_Znf_FYVE,superfamily_WD40_repeat_dom,superfamily_Znf_FYVE_PHD,smart_WD40_repeat,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.L257	ENST00000298125.5	37	c.771	CCDS9429.1	13																																																																																			WDFY2	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000139668		0.562	WDFY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY2	HGNC	protein_coding	OTTHUMT00000045985.3	407	0.24	1	G	NM_052950		52325491	52325491	+1	no_errors	ENST00000298125	ensembl	human	known	69_37n	silent	313	16.98	64	SNP	1.000	A
WDR45B	56270	genome.wustl.edu	37	17	80583301	80583301	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:80583301G>A	ENST00000392325.4	-	5	585	c.391C>T	c.(391-393)Cag>Tag	p.Q131*	WDR45B_ENST00000571835.1_5'UTR	NM_019613.3	NP_062559.2	Q5MNZ6	WIPI3_HUMAN	WD repeat domain 45B	131																	ACGTGCAACTGATGGGGATTG	0.483																																						dbGAP											0													153.0	126.0	135.0					17																	80583301		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF091083	CCDS11815.2	17q25.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000141580	ENSG00000141580		"""WD repeat domain containing"""	25072	protein-coding gene	gene with protein product		609226	"""WDR45-like"""	WDR45L		12477932	Standard	NM_019613		Approved	WIPI3	uc002kfq.3	Q5MNZ6	OTTHUMG00000150146	ENST00000392325.4:c.391C>T	17.37:g.80583301G>A	ENSP00000376139:p.Gln131*	Somatic		WXS	Illumina GAIIx	Phase_IV	O95328|Q2MCP6|Q6IBN2	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.Q131*	ENST00000392325.4	37	c.391	CCDS11815.2	17	.	.	.	.	.	.	.	.	.	.	-	36	5.843995	0.97016	.	.	ENSG00000141580	ENST00000392325;ENST00000539012	.	.	.	4.54	4.54	0.55810	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.23891	T	0.37	-19.6718	17.664	0.88199	0.0:0.0:1.0:0.0	.	.	.	.	X	131;103	.	ENSP00000376139:Q131X	Q	-	1	0	WDR45L	78176590	1.000000	0.71417	0.978000	0.43139	0.684000	0.39900	9.152000	0.94680	2.244000	0.73946	0.552000	0.68991	CAG	WDR45L	-	superfamily_WD40_repeat_dom	ENSG00000141580		0.483	WDR45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR45L	HGNC	protein_coding	OTTHUMT00000316536.1	285	0.00	0	G	NM_019613		80583301	80583301	-1	no_errors	ENST00000392325	ensembl	human	known	69_37n	nonsense	158	23.92	50	SNP	1.000	A
WDR7	23335	genome.wustl.edu	37	18	54606599	54606599	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr18:54606599C>T	ENST00000254442.3	+	25	4250	c.4039C>T	c.(4039-4041)Caa>Taa	p.Q1347*	WDR7_ENST00000357574.3_Nonsense_Mutation_p.Q1314*|WDR7_ENST00000589935.1_Intron	NM_015285.2	NP_056100.2	Q9Y4E6	WDR7_HUMAN	WD repeat domain 7	1347					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|breast(5)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|lung(37)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	78				Lung(128;0.0238)|Colorectal(16;0.0296)		GAAAGGTCTTCAAGAATGTTT	0.308																																						dbGAP											0													50.0	51.0	51.0					18																	54606599		2203	4297	6500	-	-	-	SO:0001587	stop_gained	0			AB011113	CCDS11962.1, CCDS11963.1	18q21.31	2013-01-09			ENSG00000091157	ENSG00000091157		"""WD repeat domain containing"""	13490	protein-coding gene	gene with protein product		613473				10828621	Standard	XM_005266674		Approved	KIAA0541, TRAG	uc002lgk.1	Q9Y4E6	OTTHUMG00000132721	ENST00000254442.3:c.4039C>T	18.37:g.54606599C>T	ENSP00000254442:p.Gln1347*	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C8|Q86UX5|Q86VP2|Q96PS7	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Q1347*	ENST00000254442.3	37	c.4039	CCDS11962.1	18	.	.	.	.	.	.	.	.	.	.	C	45	11.337778	0.99548	.	.	ENSG00000091157	ENST00000254442;ENST00000357574;ENST00000444065;ENST00000398311	.	.	.	4.96	4.96	0.65561	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	.	17.8445	0.88725	0.0:1.0:0.0:0.0	.	.	.	.	X	1347;1314;672;1314	.	ENSP00000254442:Q1347X	Q	+	1	0	WDR7	52757597	1.000000	0.71417	0.996000	0.52242	0.979000	0.70002	5.749000	0.68704	2.294000	0.77228	0.650000	0.86243	CAA	WDR7	-	NULL	ENSG00000091157		0.308	WDR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR7	HGNC	protein_coding	OTTHUMT00000256062.1	129	0.00	0	C			54606599	54606599	+1	no_errors	ENST00000254442	ensembl	human	known	69_37n	nonsense	117	20.95	31	SNP	1.000	T
WFDC11	259239	genome.wustl.edu	37	20	44279195	44279195	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr20:44279195G>C	ENST00000356562.2	-	3	266	c.45C>G	c.(43-45)ttC>ttG	p.F15L	WFDC11_ENST00000324384.3_Missense_Mutation_p.F15L			Q8NEX6	WFD11_HUMAN	WAP four-disulfide core domain 11	15						extracellular region (GO:0005576)				endometrium(1)|lung(4)	5		Myeloproliferative disorder(115;0.0122)				CCGTACAGAAGAATGTCATGA	0.478																																						dbGAP											0													234.0	197.0	210.0					20																	44279195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY047609	CCDS13364.1	20q13.12	2013-01-21			ENSG00000180083	ENSG00000180083		"""WAP four-disulfide core domain containing"""	20478	protein-coding gene	gene with protein product						12206714	Standard	NM_147197		Approved	WAP11	uc002xpa.3	Q8NEX6	OTTHUMG00000046330	ENST00000356562.2:c.45C>G	20.37:g.44279195G>C	ENSP00000348968:p.Phe15Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P624|Q5TGZ6	Missense_Mutation	SNP	NULL	p.F15L	ENST00000356562.2	37	c.45	CCDS13364.1	20	.	.	.	.	.	.	.	.	.	.	G	4.664	0.123542	0.08931	.	.	ENSG00000180083	ENST00000356562;ENST00000324384	T;T	0.28454	1.61;1.61	3.53	1.48	0.22813	.	1.265210	0.05899	N	0.629724	T	0.11922	0.0290	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.28681	-1.0036	9	0.02654	T	1	-1.6925	4.5361	0.12032	0.1176:0.0:0.6668:0.2157	.	15	Q8NEX6	WFD11_HUMAN	L	15	ENSP00000348968:F15L;ENSP00000318753:F15L	ENSP00000318753:F15L	F	-	3	2	WFDC11	43712609	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.053000	0.11846	0.451000	0.26802	0.563000	0.77884	TTC	WFDC11	-	NULL	ENSG00000180083		0.478	WFDC11-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	WFDC11	HGNC	protein_coding	OTTHUMT00000106943.1	608	0.00	0	G			44279195	44279195	-1	no_errors	ENST00000324384	ensembl	human	known	69_37n	missense	470	18.26	105	SNP	0.000	C
WIPF2	147179	genome.wustl.edu	37	17	38421179	38421179	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:38421179C>A	ENST00000323571.4	+	5	991	c.751C>A	c.(751-753)Cct>Act	p.P251T	WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000585043.1_Missense_Mutation_p.P251T|WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000583130.1_Missense_Mutation_p.P251T	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	251	Poly-Pro.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)		p.P251T(1)		NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						TCTGGCTCCTCCTCCTCCGCC	0.597										HNSCC(43;0.11)																												dbGAP											1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											160.0	148.0	152.0					17																	38421179		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.751C>A	17.37:g.38421179C>A	ENSP00000320924:p.Pro251Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	smart_WH2_dom,pfscan_WH2_dom	p.P251T	ENST00000323571.4	37	c.751	CCDS11364.1	17	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561932	0.86335	.	.	ENSG00000171475	ENST00000323571	T	0.66099	-0.19	5.69	5.69	0.88448	.	0.053388	0.85682	D	0.000000	T	0.80423	0.4620	M	0.75615	2.305	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.81468	-0.0919	10	0.72032	D	0.01	-7.3705	19.4683	0.94952	0.0:1.0:0.0:0.0	.	251	Q8TF74	WIPF2_HUMAN	T	251	ENSP00000320924:P251T	ENSP00000320924:P251T	P	+	1	0	WIPF2	35674705	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.769000	0.74985	2.698000	0.92095	0.456000	0.33151	CCT	WIPF2	-	NULL	ENSG00000171475		0.597	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WIPF2	HGNC	protein_coding	OTTHUMT00000257157.2	126	0.00	0	C	NM_133264		38421179	38421179	+1	no_errors	ENST00000323571	ensembl	human	known	69_37n	missense	101	12.17	14	SNP	1.000	A
WIPF2	147179	genome.wustl.edu	37	17	38421273	38421273	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:38421273C>G	ENST00000323571.4	+	5	1085	c.845C>G	c.(844-846)tCt>tGt	p.S282C	WIPF2_ENST00000494757.1_3'UTR|WIPF2_ENST00000394103.3_Intron|WIPF2_ENST00000585043.1_Missense_Mutation_p.S282C|WIPF2_ENST00000536600.1_Intron|WIPF2_ENST00000583130.1_Missense_Mutation_p.S282C	NM_133264.4	NP_573571.1	Q8TF74	WIPF2_HUMAN	WAS/WASL interacting protein family, member 2	282					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)				NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|ovary(1)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	30						AGACACAATTCTTTGCATAGG	0.612										HNSCC(43;0.11)																												dbGAP											0													91.0	103.0	99.0					17																	38421273		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC025965	CCDS11364.1	17q21.2	2006-10-12			ENSG00000171475	ENSG00000171475			30923	protein-coding gene	gene with protein product		609692				12213210, 11829459	Standard	XM_005257083		Approved	WICH, WIRE	uc002hug.1	Q8TF74	OTTHUMG00000133331	ENST00000323571.4:c.845C>G	17.37:g.38421273C>G	ENSP00000320924:p.Ser282Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0L3|Q658J8|Q71RE1|Q8TE44	Missense_Mutation	SNP	smart_WH2_dom,pfscan_WH2_dom	p.S282C	ENST00000323571.4	37	c.845	CCDS11364.1	17	.	.	.	.	.	.	.	.	.	.	C	23.3	4.404434	0.83230	.	.	ENSG00000171475	ENST00000323571	T	0.38887	1.11	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.66761	0.2822	M	0.73962	2.25	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.66252	-0.5970	10	0.51188	T	0.08	-23.1063	19.5328	0.95235	0.0:1.0:0.0:0.0	.	282	Q8TF74	WIPF2_HUMAN	C	282	ENSP00000320924:S282C	ENSP00000320924:S282C	S	+	2	0	WIPF2	35674799	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	6.831000	0.75324	2.710000	0.92621	0.555000	0.69702	TCT	WIPF2	-	NULL	ENSG00000171475		0.612	WIPF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WIPF2	HGNC	protein_coding	OTTHUMT00000257157.2	76	0.00	0	C	NM_133264		38421273	38421273	+1	no_errors	ENST00000323571	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	1.000	G
WT1	7490	genome.wustl.edu	37	11	32414250	32414250	+	Missense_Mutation	SNP	C	C	T	rs121907901		TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:32414250C>T	ENST00000379079.2	-	8	938	c.665G>A	c.(664-666)cGt>cAt	p.R222H	WT1_ENST00000332351.3_Missense_Mutation_p.R434H|WT1_ENST00000448076.3_Missense_Mutation_p.R434H|WT1_ENST00000530998.1_Missense_Mutation_p.R205H	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	366					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.S367fs*23(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			CTGGTCTGAACGAGAAAACCT	0.443			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																													dbGAP	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	1	Insertion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)	GRCh37	CM910410|CM962746	WT1	M	rs121907901						188.0	158.0	168.0					11																	32414250		2202	4299	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.665G>A	11.37:g.32414250C>T	ENSP00000368370:p.Arg222His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,prints_Wilms_tumour,pfscan_Znf_C2H2	p.R434H	ENST00000379079.2	37	c.1301	CCDS55751.1	11	.	.	.	.	.	.	.	.	.	.	C	36	5.633418	0.96682	.	.	ENSG00000184937	ENST00000379079;ENST00000332351;ENST00000530998;ENST00000452863;ENST00000448076	T;T;T;T;T	0.35973	1.28;1.28;1.28;1.28;1.28	5.73	5.73	0.89815	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.64402	U	0.000005	T	0.53867	0.1823	L	0.38531	1.155	0.80722	A	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.999;0.999;0.999	T	0.51458	-0.8703	9	0.62326	D	0.03	.	20.263	0.98456	0.0:1.0:0.0:0.0	.	422;366;439;205;222	P19544-8;P19544;P19544-7;B3KSA5;P19544-6	.;WT1_HUMAN;.;.;.	H	222;434;205;417;434	ENSP00000368370:R222H;ENSP00000331327:R434H;ENSP00000435307:R205H;ENSP00000415516:R417H;ENSP00000413452:R434H	ENSP00000331327:R434H	R	-	2	0	WT1	32370826	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.773000	0.85462	2.868000	0.98415	0.555000	0.69702	CGT	WT1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184937		0.443	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095434.1	331	0.00	0	C	NM_000378		32414250	32414250	-1	no_errors	ENST00000332351	ensembl	human	known	69_37n	missense	180	43.96	142	SNP	1.000	T
XIRP2	129446	genome.wustl.edu	37	2	167760155	167760155	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:167760155C>T	ENST00000409728.1	+	2	252	c.163C>T	c.(163-165)Caa>Taa	p.Q55*	XIRP2_ENST00000409195.1_Nonsense_Mutation_p.Q55*|XIRP2_ENST00000409043.1_Nonsense_Mutation_p.Q55*|XIRP2_ENST00000295237.9_Nonsense_Mutation_p.Q55*|XIRP2_ENST00000409756.2_Nonsense_Mutation_p.Q55*|XIRP2_ENST00000420519.1_Nonsense_Mutation_p.Q55*	NM_001199143.1	NP_001186072.1	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	0					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATCAGCACCTCAATCTTTGGA	0.493																																						dbGAP											0													75.0	74.0	74.0					2																	167760155		1952	4133	6085	-	-	-	SO:0001587	stop_gained	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409728.1:c.163C>T	2.37:g.167760155C>T	ENSP00000386619:p.Gln55*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Nonsense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.Q55*	ENST00000409728.1	37	c.163	CCDS56143.1	2	.	.	.	.	.	.	.	.	.	.	c	34	5.308960	0.95629	.	.	ENSG00000163092	ENST00000409043;ENST00000409728;ENST00000409195;ENST00000409756;ENST00000420519;ENST00000295237	.	.	.	5.36	3.57	0.40892	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08381	T	0.77	5.9521	7.7057	0.28648	0.0882:0.1647:0.7471:0.0	.	.	.	.	X	55	.	ENSP00000295237:Q55X	Q	+	1	0	XIRP2	167468401	0.009000	0.17119	0.002000	0.10522	0.092000	0.18411	1.657000	0.37366	0.657000	0.30906	-0.123000	0.14984	CAA	XIRP2	-	NULL	ENSG00000163092		0.493	XIRP2-006	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333552.1	180	0.00	0	C	NM_152381		167760155	167760155	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	nonsense	155	20.00	39	SNP	0.015	T
YIPF6	286451	genome.wustl.edu	37	X	67742612	67742612	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:67742612C>G	ENST00000462683.1	+	6	1189	c.445C>G	c.(445-447)Cag>Gag	p.Q149E	YIPF6_ENST00000374622.2_Missense_Mutation_p.Q106E	NM_173834.3	NP_776195.2	Q96EC8	YIPF6_HUMAN	Yip1 domain family, member 6	149					intestinal epithelial cell development (GO:0060576)	cis-Golgi network (GO:0005801)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle (GO:0030134)|integral component of membrane (GO:0016021)|trans-Golgi network (GO:0005802)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|urinary_tract(1)	7						ATCTTTTTTTCAGAGCCTCTG	0.373																																						dbGAP											0													133.0	113.0	120.0					X																	67742612		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC012469	CCDS14389.1, CCDS56604.1	Xq13.1	2008-02-05			ENSG00000181704	ENSG00000181704		"""Yip1 domain family"""	28304	protein-coding gene	gene with protein product						12477932	Standard	NM_173834		Approved	MGC21416, FinGER6	uc004dwz.3	Q96EC8	OTTHUMG00000021745	ENST00000462683.1:c.445C>G	X.37:g.67742612C>G	ENSP00000417573:p.Gln149Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1U7|G5E997|Q5JP08	Missense_Mutation	SNP	pfam_Yip1	p.Q149E	ENST00000462683.1	37	c.445	CCDS14389.1	X	.	.	.	.	.	.	.	.	.	.	C	23.7	4.442048	0.83993	.	.	ENSG00000181704	ENST00000462683;ENST00000451537;ENST00000374622	T;T;T	0.80566	-1.39;0.95;0.95	5.01	5.01	0.66863	Yip1 domain (1);	0.000000	0.85682	D	0.000000	D	0.92257	0.7544	H	0.94345	3.525	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.987;0.997	D	0.94306	0.7541	10	0.87932	D	0	-2.9808	14.9454	0.71026	0.0:1.0:0.0:0.0	.	106;149	G5E997;Q96EC8	.;YIPF6_HUMAN	E	149;106;106	ENSP00000417573:Q149E;ENSP00000401799:Q106E;ENSP00000363751:Q106E	ENSP00000363751:Q106E	Q	+	1	0	YIPF6	67659337	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	7.081000	0.76844	2.203000	0.70933	0.429000	0.28392	CAG	YIPF6	-	pfam_Yip1	ENSG00000181704		0.373	YIPF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF6	HGNC	protein_coding	OTTHUMT00000057016.1	560	0.00	0	C	NM_173834		67742612	67742612	+1	no_errors	ENST00000462683	ensembl	human	known	69_37n	missense	489	17.54	104	SNP	1.000	G
ZBTB44	29068	genome.wustl.edu	37	11	130131407	130131407	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:130131407G>A	ENST00000357899.4	-	2	634	c.362C>T	c.(361-363)tCa>tTa	p.S121L	ZBTB44_ENST00000525842.1_Missense_Mutation_p.S121L|ZBTB44_ENST00000530205.1_Missense_Mutation_p.S121L|ZBTB44_ENST00000397753.1_Missense_Mutation_p.S121L			Q8NCP5	ZBT44_HUMAN	zinc finger and BTB domain containing 44	121					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			autonomic_ganglia(1)|breast(1)|kidney(2)|large_intestine(4)|lung(4)|ovary(1)|prostate(2)	15	all_hematologic(175;0.0429)	Lung NSC(97;0.000601)|Breast(109;0.000962)|all_lung(97;0.00125)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0192)|Lung(977;0.235)		CATGAACTCTGAGCAGGTGCT	0.383																																						dbGAP											0													79.0	77.0	77.0					11																	130131407		1921	4130	6051	-	-	-	SO:0001583	missense	0			AK024659	CCDS44776.1, CCDS73414.1, CCDS73415.1	11q24.3	2013-01-08	2006-09-19	2006-09-19		ENSG00000196323		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	25001	protein-coding gene	gene with protein product			"""BTB (POZ) domain containing 15"""	BTBD15		11042152	Standard	NM_014155		Approved	HSPC063, ZNF851	uc001qgb.4	Q8NCP5		ENST00000357899.4:c.362C>T	11.37:g.130131407G>A	ENSP00000350574:p.Ser121Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IPT8|Q86VJ7|Q86XX5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S121L	ENST00000357899.4	37	c.362		11	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353926	0.82243	.	.	ENSG00000196323	ENST00000525842;ENST00000397753;ENST00000445008;ENST00000357899;ENST00000530205;ENST00000338191	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33	5.85	5.85	0.93711	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	T	0.77150	0.4088	L	0.38649	1.16	0.80722	D	1	D;D;D;D	0.62365	0.989;0.989;0.991;0.989	D;D;D;D	0.76071	0.985;0.985;0.987;0.985	T	0.78064	-0.2350	10	0.87932	D	0	.	20.1731	0.98165	0.0:0.0:1.0:0.0	.	121;121;121;121	Q8NCP5-4;Q8NCP5-3;Q8NCP5;Q8NCP5-2	.;.;ZBT44_HUMAN;.	L	121;121;121;121;121;33	ENSP00000433457:S121L;ENSP00000380861:S121L;ENSP00000408079:S121L;ENSP00000350574:S121L;ENSP00000434177:S121L	ENSP00000341618:S33L	S	-	2	0	ZBTB44	129636617	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.434000	0.97515	2.768000	0.95171	0.655000	0.94253	TCA	ZBTB44	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	ENSG00000196323		0.383	ZBTB44-003	KNOWN	basic|appris_principal	protein_coding	ZBTB44	HGNC	protein_coding	OTTHUMT00000386126.1	176	0.00	0	G	NM_014155		130131407	130131407	-1	no_errors	ENST00000357899	ensembl	human	known	69_37n	missense	61	39.00	39	SNP	1.000	A
ZDBF2	57683	genome.wustl.edu	37	2	207170370	207170370	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr2:207170370C>T	ENST00000374423.3	+	5	1504	c.1118C>T	c.(1117-1119)tCa>tTa	p.S373L		NM_020923.1	NP_065974.1	Q9HCK1	ZDBF2_HUMAN	zinc finger, DBF-type containing 2	373							nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(5)|large_intestine(28)|lung(50)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	95						TCTCTTCAGTCAGCATCTGAT	0.408																																						dbGAP											0													79.0	76.0	77.0					2																	207170370		1875	4109	5984	-	-	-	SO:0001583	missense	0			AB046791	CCDS46501.1, CCDS74637.1	2q33.3	2013-01-10			ENSG00000204186	ENSG00000204186		"""Zinc fingers, DBF-type"""	29313	protein-coding gene	gene with protein product						10997877	Standard	XM_005246711		Approved	FLJ45338, KIAA1571	uc002vbp.2	Q9HCK1	OTTHUMG00000154648	ENST00000374423.3:c.1118C>T	2.37:g.207170370C>T	ENSP00000363545:p.Ser373Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNP7|Q6ZSN8	Missense_Mutation	SNP	pfam_Znf_DBF,smart_Znf_DBF	p.S373L	ENST00000374423.3	37	c.1118	CCDS46501.1	2	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881789	0.91740	.	.	ENSG00000204186	ENST00000374423	T	0.56103	0.48	3.93	3.93	0.45458	.	0.000000	0.30329	N	0.009874	T	0.66117	0.2757	M	0.64404	1.975	0.26465	N	0.975386	D	0.76494	0.999	D	0.67725	0.953	T	0.57551	-0.7792	10	0.38643	T	0.18	.	13.8953	0.63768	0.0:1.0:0.0:0.0	.	373	Q9HCK1	ZDBF2_HUMAN	L	373	ENSP00000363545:S373L	ENSP00000363545:S373L	S	+	2	0	ZDBF2	206878615	0.997000	0.39634	0.458000	0.27068	0.704000	0.40688	2.321000	0.43805	2.447000	0.82792	0.650000	0.86243	TCA	ZDBF2	-	NULL	ENSG00000204186		0.408	ZDBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZDBF2	HGNC	protein_coding	OTTHUMT00000336458.1	227	0.00	0	C	NM_020923		207170370	207170370	+1	no_errors	ENST00000374423	ensembl	human	known	69_37n	missense	199	32.54	96	SNP	0.981	T
ZFP92	139735	genome.wustl.edu	37	X	152686582	152686582	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chrX:152686582C>T	ENST00000338647.5	+	4	748	c.747C>T	c.(745-747)ttC>ttT	p.F249F	U82695.10_ENST00000569962.1_lincRNA	NM_001136273.1	NP_001129745.1	A6NM28	ZFP92_HUMAN	ZFP92 zinc finger protein	249					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(4)	6						GCCGCAGCTTCGCGCTCCTGG	0.692																																						dbGAP											0													23.0	20.0	21.0					X																	152686582		692	1588	2280	-	-	-	SO:0001819	synonymous_variant	0			U82695	CCDS59177.1	Xq28	2013-01-08	2012-11-27		ENSG00000189420	ENSG00000189420		"""Zinc fingers, C2H2-type"", ""-"""	12865	protein-coding gene	gene with protein product			"""zinc finger protein homologous to Zfp92 in mouse"", ""zinc finger protein 92 homolog (mouse)"""				Standard	NM_001136273		Approved	ZNF897	uc011myo.2	A6NM28	OTTHUMG00000024198	ENST00000338647.5:c.747C>T	X.37:g.152686582C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F249	ENST00000338647.5	37	c.747	CCDS59177.1	X																																																																																			ZFP92	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000189420		0.692	ZFP92-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP92	HGNC	protein_coding	OTTHUMT00000332220.2	36	0.00	0	C			152686582	152686582	+1	no_errors	ENST00000338647	ensembl	human	known	69_37n	silent	23	34.29	12	SNP	0.508	T
ZFR	51663	genome.wustl.edu	37	5	32364313	32364313	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr5:32364313C>T	ENST00000265069.8	-	18	3006	c.2904G>A	c.(2902-2904)ctG>ctA	p.L968L	ZFR_ENST00000510369.1_5'UTR	NM_016107.3	NP_057191.2	Q96KR1	ZFR_HUMAN	zinc finger RNA binding protein	968	DZF. {ECO:0000255|PROSITE- ProRule:PRU01040}.				multicellular organismal development (GO:0007275)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(14)|upper_aerodigestive_tract(2)	32				STAD - Stomach adenocarcinoma(35;0.19)		AAACTCTTCTCAGTGCATCCC	0.358																																						dbGAP											0													83.0	87.0	86.0					5																	32364313		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100742	CCDS34139.1	5p15.2	2014-03-03			ENSG00000056097	ENSG00000056097			17277	protein-coding gene	gene with protein product		615635				11574164, 24482476	Standard	NM_016107		Approved	ZFR1, SPG71	uc003jhr.1	Q96KR1	OTTHUMG00000161979	ENST00000265069.8:c.2904G>A	5.37:g.32364313C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNR5|Q05C08|Q3B7X5|Q6P5A3|Q86UA0|Q9H6V4|Q9NTI1|Q9Y687	Silent	SNP	pfam_DZF,pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like,smart_DZF	p.L968	ENST00000265069.8	37	c.2904	CCDS34139.1	5																																																																																			ZFR	-	pfam_DZF,smart_DZF	ENSG00000056097		0.358	ZFR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR	HGNC	protein_coding	OTTHUMT00000366586.1	174	0.00	0	C			32364313	32364313	-1	no_errors	ENST00000265069	ensembl	human	known	69_37n	silent	110	15.91	21	SNP	0.997	T
ZNF135	7694	genome.wustl.edu	37	19	58578710	58578710	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:58578710C>T	ENST00000313434.5	+	5	959	c.858C>T	c.(856-858)atC>atT	p.I286I	ZNF135_ENST00000506786.1_Silent_p.I244I|RN7SL526P_ENST00000469492.2_RNA|ZNF135_ENST00000401053.4_Silent_p.I310I|ZNF135_ENST00000439855.2_Silent_p.I286I|ZNF135_ENST00000359978.6_Silent_p.I298I|ZNF135_ENST00000511556.1_Silent_p.I298I	NM_003436.3	NP_003427.3	P52742	ZN135_HUMAN	zinc finger protein 135	286					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(26)|ovary(1)|skin(1)|urinary_tract(1)	41		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.147)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0161)		CCCCACTGATCCAGCACCAGA	0.507																																						dbGAP											0													99.0	98.0	98.0					19																	58578710		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U09413	CCDS12970.1, CCDS12970.2, CCDS54329.1, CCDS54330.1, CCDS74471.1, CCDS74472.1	19q13.4	2013-01-08	2006-05-12			ENSG00000176293		"""Zinc fingers, C2H2-type"", ""-"""	12919	protein-coding gene	gene with protein product		604077	"""zinc finger protein 61"", ""zinc finger protein 135 (clone pHZ-17)"""	ZNF61, ZNF78L1		7557990, 1505991	Standard	NM_003436		Approved	pHZ-17	uc002qrg.3	P52742		ENST00000313434.5:c.858C>T	19.37:g.58578710C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHH9|E9PEV2|F5GYY9|I3L0B3|Q5U5L3|Q8N1I7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S304F	ENST00000313434.5	37	c.911		19	.	.	.	.	.	.	.	.	.	.	C	0.024	-1.386944	0.01194	.	.	ENSG00000176293	ENST00000391699	.	.	.	3.19	0.982	0.19762	.	.	.	.	.	T	0.45074	0.1324	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.29150	-1.0021	4	.	.	.	.	4.0693	0.09874	0.2152:0.5941:0.0:0.1907	.	.	.	.	F	304	.	.	S	+	2	0	ZNF135	63270522	0.000000	0.05858	0.826000	0.32828	0.015000	0.08874	-0.158000	0.10070	0.658000	0.30925	-0.311000	0.09066	TCC	ZNF135	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000176293		0.507	ZNF135-003	KNOWN	basic|appris_candidate	protein_coding	ZNF135	HGNC	protein_coding	OTTHUMT00000361899.2	135	0.00	0	C	NM_003436		58578710	58578710	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000391699	ensembl	human	putative	69_37n	missense	155	22.11	44	SNP	0.755	T
ZNF143	7702	genome.wustl.edu	37	11	9546936	9546936	+	Intron	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr11:9546936G>A	ENST00000396602.2	+	15	1952				ZNF143_ENST00000299606.2_Intron|ZNF143_ENST00000396604.1_Intron|ZNF143_ENST00000396597.3_Intron|ZNF143_ENST00000530463.1_Intron	NM_001282656.1|NM_001282657.1|NM_003442.5	NP_001269585.1|NP_001269586.1|NP_003433.3	P52747	ZN143_HUMAN	zinc finger protein 143						gene expression (GO:0010467)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	13				all cancers(16;4.12e-09)|Epithelial(150;2.29e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0212)		CAGTTCAGGTGAGTACCAAGG	0.483																																						dbGAP											0													223.0	168.0	187.0					11																	9546936		2201	4294	6495	-	-	-	SO:0001627	intron_variant	0			U09850	CCDS7799.2, CCDS60720.1, CCDS60721.1	11p15.4	2013-01-08	2006-06-13		ENSG00000166478	ENSG00000166478		"""Zinc fingers, C2H2-type"""	12928	protein-coding gene	gene with protein product		603433	"""zinc finger protein 143 (clone pHZ-1)"""				Standard	NM_003442		Approved	SBF, pHZ-1, STAF	uc001mhr.3	P52747	OTTHUMG00000149922	ENST00000396602.2:c.1833+3G>A	11.37:g.9546936G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K518|B4DLY5|E7ER34|O75559|Q8WUK9	Missense_Mutation	SNP	NULL	p.E138K	ENST00000396602.2	37	c.412	CCDS7799.2	11	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025534	0.35701	.	.	ENSG00000166478	ENST00000447186	.	.	.	5.73	3.65	0.41850	.	.	.	.	.	T	0.47948	0.1473	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42999	-0.9418	4	.	.	.	.	4.172	0.10334	0.4607:0.0:0.5392:0.0	.	.	.	.	K	138	.	.	E	+	1	0	ZNF143	9503512	1.000000	0.71417	0.999000	0.59377	0.845000	0.48019	2.250000	0.43178	1.422000	0.47177	0.655000	0.94253	GAG	ZNF143	-	NULL	ENSG00000166478		0.483	ZNF143-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF143	HGNC	protein_coding	OTTHUMT00000313921.2	322	0.00	0	G	NM_003442		9546936	9546936	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000447186	ensembl	human	putative	69_37n	missense	249	23.38	76	SNP	1.000	A
ZNF230	7773	genome.wustl.edu	37	19	44512960	44512960	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:44512960G>A	ENST00000429154.2	+	3	262	c.34G>A	c.(34-36)Gat>Aat	p.D12N	ZNF230_ENST00000585632.1_Missense_Mutation_p.D12N	NM_006300.3	NP_006291.2	Q9UIE0	ZN230_HUMAN	zinc finger protein 230	12	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(10)|skin(1)|stomach(3)|urinary_tract(2)	22		Prostate(69;0.0352)				GACCTTCAAGGATGTGGCTGT	0.527																																					GBM(175;914 2069 22996 47111 52600)	dbGAP											0													271.0	239.0	250.0					19																	44512960		2203	4300	6503	-	-	-	SO:0001583	missense	0			U95044	CCDS33044.1	19q13.31	2013-01-08				ENSG00000159882		"""Zinc fingers, C2H2-type"", ""-"""	13024	protein-coding gene	gene with protein product							Standard	NM_006300		Approved	FDZF2	uc002oyb.1	Q9UIE0		ENST00000429154.2:c.34G>A	19.37:g.44512960G>A	ENSP00000409318:p.Asp12Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15322|Q504X7|Q86W84|Q9P1U6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D12N	ENST00000429154.2	37	c.34	CCDS33044.1	19	.	.	.	.	.	.	.	.	.	.	G	12.53	1.966877	0.34659	.	.	ENSG00000159882	ENST00000429154	T	0.11169	2.8	2.41	2.41	0.29592	Krueppel-associated box (4);	.	.	.	.	T	0.45716	0.1356	H	0.97564	4.03	0.24562	N	0.993967	D	0.89917	1.0	D	0.97110	1.0	T	0.40757	-0.9546	9	0.87932	D	0	.	10.5262	0.44950	0.0:0.0:1.0:0.0	.	12	Q9UIE0	ZN230_HUMAN	N	12	ENSP00000409318:D12N	ENSP00000409318:D12N	D	+	1	0	ZNF230	49204800	0.994000	0.37717	0.402000	0.26371	0.035000	0.12851	4.956000	0.63645	1.338000	0.45544	0.405000	0.27470	GAT	ZNF230	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000159882		0.527	ZNF230-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF230	HGNC	protein_coding	OTTHUMT00000460456.1	556	0.00	0	G			44512960	44512960	+1	no_errors	ENST00000429154	ensembl	human	known	69_37n	missense	570	15.28	103	SNP	0.769	A
ZNF34	80778	genome.wustl.edu	37	8	145999827	145999827	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:145999827C>T	ENST00000343459.4	-	6	572	c.507G>A	c.(505-507)ctG>ctA	p.L169L	ZNF34_ENST00000429371.2_Silent_p.L148L			Q8IZ26	ZNF34_HUMAN	zinc finger protein 34	169					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11	all_cancers(97;3.54e-11)|all_epithelial(106;2.65e-10)|Lung NSC(106;4.08e-05)|all_lung(105;0.000125)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.221)	OV - Ovarian serous cystadenocarcinoma(54;2.75e-39)|Epithelial(56;5.18e-38)|all cancers(56;4.41e-33)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.11)	GBM - Glioblastoma multiforme(99;0.0179)		CCCCGTTGGTCAGTGTGACTG	0.547																																						dbGAP											0													52.0	53.0	53.0					8																	145999827		1973	4140	6113	-	-	-	SO:0001819	synonymous_variant	0			BC028136	CCDS47945.1, CCDS69562.1	8q24	2013-01-08	2006-05-11					"""Zinc fingers, C2H2-type"", ""-"""	13098	protein-coding gene	gene with protein product		194526	"""zinc finger protein 34 (KOX 32)"""			8104631, 2014798	Standard	XM_005272349		Approved	KOX32	uc003zdy.4	Q8IZ26		ENST00000343459.4:c.507G>A	8.37:g.145999827C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWN1|Q9BSZ0	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L169	ENST00000343459.4	37	c.507	CCDS47945.1	8																																																																																			ZNF34	-	NULL	ENSG00000196378		0.547	ZNF34-006	KNOWN	basic|CCDS	protein_coding	ZNF34	HGNC	protein_coding	OTTHUMT00000382936.1	180	0.00	0	C	NM_030580		145999827	145999827	-1	no_errors	ENST00000343459	ensembl	human	known	69_37n	silent	85	40.14	57	SNP	0.008	T
ZNF345	25850	genome.wustl.edu	37	19	37368413	37368413	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:37368413G>C	ENST00000529555.1	+	2	1469	c.681G>C	c.(679-681)gaG>gaC	p.E227D	ZNF345_ENST00000589046.1_Missense_Mutation_p.E227D|ZNF345_ENST00000420450.1_Missense_Mutation_p.E227D|ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron			Q14585	ZN345_HUMAN	zinc finger protein 345	227					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|kidney(1)|large_intestine(13)|lung(5)|ovary(2)|prostate(1)	24	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ATACTGGTGAGAAACCTTATG	0.423																																						dbGAP											0													74.0	72.0	73.0					19																	37368413		2203	4300	6503	-	-	-	SO:0001583	missense	0			X78933	CCDS12497.1	19q13.12	2013-01-08			ENSG00000251247	ENSG00000251247		"""Zinc fingers, C2H2-type"""	16367	protein-coding gene	gene with protein product						7865130	Standard	NM_003419		Approved	HZF10	uc002oey.4	Q14585	OTTHUMG00000048162	ENST00000529555.1:c.681G>C	19.37:g.37368413G>C	ENSP00000431202:p.Glu227Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E227D	ENST00000529555.1	37	c.681	CCDS12497.1	19	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211209	0.58343	.	.	ENSG00000251247	ENST00000420450;ENST00000529555	T;T	0.26810	1.71;1.71	4.14	4.14	0.48551	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.29817	0.0745	L	0.53671	1.685	0.25133	N	0.990556	B	0.21821	0.061	B	0.27076	0.076	T	0.22765	-1.0207	9	0.72032	D	0.01	.	14.2701	0.66147	0.0:0.0:1.0:0.0	.	227	Q14585	ZN345_HUMAN	D	227	ENSP00000431216:E227D;ENSP00000431202:E227D	ENSP00000431216:E227D	E	+	3	2	ZNF345	42060253	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.561000	0.36342	2.280000	0.76307	0.561000	0.74099	GAG	ZNF345	-	pfscan_Znf_C2H2	ENSG00000251247		0.423	ZNF345-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF345	HGNC	protein_coding	OTTHUMT00000388258.1	180	0.00	0	G			37368413	37368413	+1	no_errors	ENST00000420450	ensembl	human	known	69_37n	missense	138	27.98	54	SNP	1.000	C
ZNF415	55786	genome.wustl.edu	37	19	53612832	53612832	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:53612832C>T	ENST00000500065.4	-	4	799	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K	ZNF415_ENST00000455735.2_Missense_Mutation_p.E204K|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.E168K|ZNF415_ENST00000448501.1_Missense_Mutation_p.E204K|ZNF415_ENST00000243643.4_Missense_Mutation_p.E156K|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.E143K|ZNF415_ENST00000601493.1_5'UTR	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		ATTTTCCCTTCAGCTTGAAAC	0.403																																						dbGAP											0													116.0	110.0	112.0					19																	53612832		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.466G>A	19.37:g.53612832C>T	ENSP00000439435:p.Glu156Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.E204K	ENST00000500065.4	37	c.610	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	C	13.19	2.163672	0.38217	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.08720	3.06;3.06;3.06;3.06;3.06;3.06	2.74	-0.931	0.10438	.	.	.	.	.	T	0.08582	0.0213	L	0.41079	1.255	0.09310	N	1	B;P;B;P;B;B	0.48640	0.001;0.913;0.001;0.75;0.001;0.147	B;P;B;B;B;B	0.48873	0.002;0.593;0.001;0.173;0.003;0.082	T	0.33394	-0.9870	9	0.16420	T	0.52	.	6.3451	0.21345	0.0:0.629:0.0:0.371	.	156;204;204;156;143;168	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	K	156;156;204;168;204;143	ENSP00000243643:E156K;ENSP00000439435:E156K;ENSP00000396492:E204K;ENSP00000395055:E168K;ENSP00000388787:E204K;ENSP00000414601:E143K	ENSP00000243643:E156K	E	-	1	0	ZNF415	58304644	0.000000	0.05858	0.000000	0.03702	0.317000	0.28152	-0.401000	0.07232	-0.221000	0.09973	-0.657000	0.03884	GAA	ZNF415	-	NULL	ENSG00000170954		0.403	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	194	0.00	0	C	NM_018355		53612832	53612832	-1	no_errors	ENST00000448501	ensembl	human	known	69_37n	missense	207	17.20	43	SNP	0.000	T
ZNF585B	92285	genome.wustl.edu	37	19	37676695	37676695	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:37676695C>G	ENST00000532828.2	-	5	1995	c.1744G>C	c.(1744-1746)Gag>Cag	p.E582Q	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_Missense_Mutation_p.E170Q|ZNF585B_ENST00000531805.1_Missense_Mutation_p.E527Q|ZNF585B_ENST00000527838.1_3'UTR	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	582					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			CTTCCACACTCAGTGCATACA	0.403																																					Melanoma(93;882 1454 18863 28917 48427)	dbGAP											0													24.0	26.0	25.0					19																	37676695		2193	4270	6463	-	-	-	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1744G>C	19.37:g.37676695C>G	ENSP00000433773:p.Glu582Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E582Q	ENST00000532828.2	37	c.1744	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	C	8.881	0.951748	0.18431	.	.	ENSG00000245680	ENST00000531805;ENST00000532828;ENST00000312908	T;T;T	0.41400	3.19;3.19;1.0	2.49	2.49	0.30216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37857	N	0.001918	T	0.45196	0.1330	N	0.25789	0.76	0.09310	N	1	P;D	0.58970	0.929;0.984	P;D	0.70487	0.456;0.969	T	0.31641	-0.9936	10	0.19590	T	0.45	.	12.0676	0.53596	0.0:1.0:0.0:0.0	.	527;582	E9PQH3;Q52M93	.;Z585B_HUMAN	Q	527;582;170	ENSP00000436774:E527Q;ENSP00000433773:E582Q;ENSP00000442139:E170Q	ENSP00000442139:E170Q	E	-	1	0	ZNF585B	42368535	0.000000	0.05858	0.253000	0.24343	0.733000	0.41908	-0.264000	0.08658	1.380000	0.46344	0.305000	0.20034	GAG	ZNF585B	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000245680		0.403	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	138	0.00	0	C	NM_152279		37676695	37676695	-1	no_errors	ENST00000532828	ensembl	human	known	69_37n	missense	126	19.75	31	SNP	0.077	G
ZNF613	79898	genome.wustl.edu	37	19	52448430	52448430	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:52448430G>A	ENST00000293471.6	+	6	1973	c.1294G>A	c.(1294-1296)Gaa>Aaa	p.E432K	ZNF613_ENST00000601794.1_3'UTR|ZNF613_ENST00000391794.4_Missense_Mutation_p.E396K	NM_001031721.3	NP_001026891.2	Q6PF04	ZN613_HUMAN	zinc finger protein 613	432					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	19		all_neural(266;0.117)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.0183)		TGTATGCAATGAATGTGGGAA	0.423																																						dbGAP											0													80.0	75.0	77.0					19																	52448430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027565	CCDS12844.1, CCDS33089.1	19q13.41	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	25827	protein-coding gene	gene with protein product						12477932	Standard	NM_001031721		Approved	FLJ13590	uc002pxz.2	Q6PF04		ENST00000293471.6:c.1294G>A	19.37:g.52448430G>A	ENSP00000293471:p.Glu432Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96SS9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E432K	ENST00000293471.6	37	c.1294	CCDS33089.1	19	.	.	.	.	.	.	.	.	.	.	G	12.38	1.919997	0.33908	.	.	ENSG00000176024	ENST00000293471;ENST00000391794;ENST00000535279	T;T	0.35605	1.3;1.3	3.36	3.36	0.38483	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.639709	0.12930	N	0.427445	T	0.24314	0.0589	N	0.04805	-0.155	0.09310	N	1	P	0.45957	0.869	P	0.46629	0.522	T	0.07462	-1.0771	10	0.66056	D	0.02	.	10.2852	0.43562	0.0:0.2022:0.7978:0.0	.	432	Q6PF04	ZN613_HUMAN	K	432;396;106	ENSP00000293471:E432K;ENSP00000375671:E396K	ENSP00000293471:E432K	E	+	1	0	ZNF613	57140242	0.002000	0.14202	0.815000	0.32552	0.991000	0.79684	1.293000	0.33353	1.890000	0.54733	0.655000	0.94253	GAA	ZNF613	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000176024		0.423	ZNF613-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF613	HGNC	protein_coding	OTTHUMT00000461104.2	148	0.00	0	G	NM_024840		52448430	52448430	+1	no_errors	ENST00000293471	ensembl	human	known	69_37n	missense	147	24.49	48	SNP	0.027	A
ZNF544	27300	genome.wustl.edu	37	19	58773061	58773061	+	Silent	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:58773061C>T	ENST00000596652.1	+	6	1323	c.1089C>T	c.(1087-1089)ttC>ttT	p.F363F	ZNF544_ENST00000415203.2_Silent_p.F335F|ZNF544_ENST00000599227.1_3'UTR|CTD-3138B18.5_ENST00000597230.1_RNA|ZNF544_ENST00000600220.1_Silent_p.F335F|ZNF544_ENST00000596929.1_Intron|ZNF544_ENST00000595981.1_Intron|CTD-3138B18.4_ENST00000600029.1_Intron|ZNF544_ENST00000596825.1_3'UTR|ZNF544_ENST00000599953.1_Silent_p.F221F|ZNF544_ENST00000269829.4_Silent_p.F363F|ZNF544_ENST00000600044.1_Silent_p.F335F			Q6NX49	ZN544_HUMAN	zinc finger protein 544	363					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|skin(1)|urinary_tract(1)	18		all_cancers(17;4.17e-12)|all_epithelial(17;1.25e-08)|Colorectal(82;0.000256)|Lung NSC(17;0.000607)|all_lung(17;0.0024)|all_neural(62;0.0412)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.17)|GBM - Glioblastoma multiforme(193;0.018)		GAAAATCTTTCAGCTGTTGTA	0.448																																						dbGAP											0													81.0	78.0	79.0					19																	58773061		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF020591	CCDS12973.1	19q13.43	2013-01-08				ENSG00000198131		"""Zinc fingers, C2H2-type"", ""-"""	16759	protein-coding gene	gene with protein product	"""zinc finger protein AF020591"""						Standard	NM_014480		Approved	AF020591	uc010euo.3	Q6NX49		ENST00000596652.1:c.1089C>T	19.37:g.58773061C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J1|Q9UEX4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F363	ENST00000596652.1	37	c.1089	CCDS12973.1	19																																																																																			ZNF544	-	pfscan_Znf_C2H2	ENSG00000198131		0.448	ZNF544-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF544	HGNC	protein_coding	OTTHUMT00000466754.1	151	0.00	0	C	NM_014480		58773061	58773061	+1	no_errors	ENST00000269829	ensembl	human	known	69_37n	silent	89	37.32	53	SNP	0.228	T
ZNF618	114991	genome.wustl.edu	37	9	116811020	116811020	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr9:116811020G>A	ENST00000374126.5	+	15	1537	c.1438G>A	c.(1438-1440)Gac>Aac	p.D480N	ZNF618_ENST00000470105.1_3'UTR|ZNF618_ENST00000288466.7_Missense_Mutation_p.D387N			Q5T7W0	ZN618_HUMAN	zinc finger protein 618	480					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|lung(10)|urinary_tract(1)	16						CATGTGTGCCGACCTGGGTGC	0.587																																						dbGAP											0													78.0	84.0	82.0					9																	116811020		2041	4188	6229	-	-	-	SO:0001583	missense	0			BC012922	CCDS48008.1	9q33.1	2010-04-21			ENSG00000157657	ENSG00000157657		"""Zinc fingers, C2H2-type"""	29416	protein-coding gene	gene with protein product	"""neural precursor cell expressed, developmentally down-regulated 10"""					11853319	Standard	NM_133374		Approved	KIAA1952, NEDD10	uc004bic.3	Q5T7W0	OTTHUMG00000020532	ENST00000374126.5:c.1438G>A	9.37:g.116811020G>A	ENSP00000363241:p.Asp480Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EG82|Q4G0X6|Q5T7W1|Q6ZT53|Q7Z6B9|Q8TF49|Q96E49	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D480N	ENST00000374126.5	37	c.1438		9	.	.	.	.	.	.	.	.	.	.	G	22.4	4.280329	0.80692	.	.	ENSG00000157657	ENST00000374126;ENST00000288466	T	0.07216	3.21	5.16	5.16	0.70880	.	0.000000	0.85682	D	0.000000	T	0.29093	0.0723	.	.	.	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.981;0.996;0.997	T	0.00814	-1.1555	9	0.40728	T	0.16	-36.2423	17.637	0.88125	0.0:0.0:1.0:0.0	.	447;480;387	B9EG82;Q5T7W0;Q5T7W0-2	.;ZN618_HUMAN;.	N	480;387	ENSP00000288466:D387N	ENSP00000288466:D387N	D	+	1	0	ZNF618	115850841	1.000000	0.71417	0.994000	0.49952	0.975000	0.68041	9.188000	0.94921	2.402000	0.81655	0.561000	0.74099	GAC	ZNF618	-	NULL	ENSG00000157657		0.587	ZNF618-004	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF618	HGNC	protein_coding	OTTHUMT00000053749.1	111	0.89	1	G	XM_054983		116811020	116811020	+1	no_errors	ENST00000374126	ensembl	human	known	69_37n	missense	90	27.42	34	SNP	1.000	A
ZNF623	9831	genome.wustl.edu	37	8	144732325	144732325	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:144732325C>G	ENST00000501748.2	+	1	372	c.283C>G	c.(283-285)Caa>Gaa	p.Q95E	ZNF623_ENST00000458270.2_Missense_Mutation_p.Q55E|ZNF623_ENST00000526926.1_Missense_Mutation_p.Q55E	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			AGAGACAGCTCAAGTGTGCAC	0.512																																						dbGAP											0													84.0	85.0	85.0					8																	144732325		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.283C>G	8.37:g.144732325C>G	ENSP00000445979:p.Gln95Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU80|B4DGP3|E7ENV5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q95E	ENST00000501748.2	37	c.283	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	C	4.809	0.150369	0.09185	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	T;T;T	0.14893	2.47;2.47;2.47	4.35	1.52	0.23074	.	.	.	.	.	T	0.09774	0.0240	N	0.19112	0.55	0.09310	N	1	B	0.17038	0.02	B	0.14578	0.011	T	0.30001	-0.9993	9	0.87932	D	0	-0.3419	3.3137	0.07026	0.0:0.4893:0.208:0.3027	.	95	O75123	ZN623_HUMAN	E	55;55;55;95;95	ENSP00000435232:Q55E;ENSP00000411139:Q55E;ENSP00000445979:Q95E	ENSP00000330358:Q55E	Q	+	1	0	ZNF623	144803468	0.000000	0.05858	0.001000	0.08648	0.031000	0.12232	0.015000	0.13355	0.572000	0.29383	-0.176000	0.13171	CAA	ZNF623	-	NULL	ENSG00000183309		0.512	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	78	0.00	0	C	NM_014789		144732325	144732325	+1	no_errors	ENST00000501748	ensembl	human	known	69_37n	missense	56	21.13	15	SNP	0.001	G
ZNF623	9831	genome.wustl.edu	37	8	144732550	144732550	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:144732550C>T	ENST00000501748.2	+	1	597	c.508C>T	c.(508-510)Cag>Tag	p.Q170*	ZNF623_ENST00000458270.2_Nonsense_Mutation_p.Q130*|ZNF623_ENST00000526926.1_Nonsense_Mutation_p.Q130*	NM_014789.3	NP_055604	O75123	ZN623_HUMAN	zinc finger protein 623	170					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(3)|large_intestine(6)|lung(11)|prostate(1)|stomach(1)|urinary_tract(3)	27	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;5.28e-40)|all cancers(56;5.23e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			TATGGAGCATCAGAGAATTCA	0.493																																						dbGAP											0													88.0	73.0	78.0					8																	144732550		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB014528	CCDS34957.1, CCDS47931.1	8q24.3	2013-01-08				ENSG00000183309		"""Zinc fingers, C2H2-type"""	29084	protein-coding gene	gene with protein product						9734811	Standard	NM_014789		Approved	KIAA0628	uc003yzd.2	O75123		ENST00000501748.2:c.508C>T	8.37:g.144732550C>T	ENSP00000445979:p.Gln170*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4FU80|B4DGP3|E7ENV5	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q170*	ENST00000501748.2	37	c.508	CCDS34957.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.532369	0.96446	.	.	ENSG00000183309	ENST00000526926;ENST00000328466;ENST00000458270;ENST00000532796;ENST00000501748	.	.	.	4.32	3.44	0.39384	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-18.4946	10.2688	0.43470	0.0:0.9016:0.0:0.0984	.	.	.	.	X	130;130;130;170;170	.	ENSP00000330358:Q130X	Q	+	1	0	ZNF623	144803693	0.000000	0.05858	0.021000	0.16686	0.580000	0.36256	0.657000	0.24963	1.172000	0.42781	-0.140000	0.14226	CAG	ZNF623	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000183309		0.493	ZNF623-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF623	HGNC	protein_coding	OTTHUMT00000382522.3	137	0.00	0	C	NM_014789		144732550	144732550	+1	no_errors	ENST00000501748	ensembl	human	known	69_37n	nonsense	132	19.51	32	SNP	0.941	T
ZNF675	171392	genome.wustl.edu	37	19	23836556	23836556	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:23836556C>G	ENST00000359788.4	-	4	1347	c.1179G>C	c.(1177-1179)gaG>gaC	p.E393D	ZNF675_ENST00000601935.1_Intron|ZNF675_ENST00000596211.1_Intron|ZNF675_ENST00000600313.1_Intron	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	393					bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TGTAGGGTTTCTCTTCGGTAT	0.403																																						dbGAP											0													65.0	64.0	65.0					19																	23836556		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.1179G>C	19.37:g.23836556C>G	ENSP00000352836:p.Glu393Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N211	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E393D	ENST00000359788.4	37	c.1179	CCDS32981.1	19	.	.	.	.	.	.	.	.	.	.	.	10.88	1.474223	0.26423	.	.	ENSG00000197372	ENST00000359788	T	0.26810	1.71	0.225	0.225	0.15325	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24275	0.0588	L	0.46885	1.475	0.35710	D	0.81634	B	0.23854	0.092	B	0.33690	0.168	T	0.28332	-1.0047	9	0.72032	D	0.01	.	7.9744	0.30147	0.0:0.9999:0.0:1.0E-4	.	393	Q8TD23	ZN675_HUMAN	D	393	ENSP00000352836:E393D	ENSP00000352836:E393D	E	-	3	2	ZNF675	23628396	0.936000	0.31750	0.007000	0.13788	0.007000	0.05969	0.638000	0.24674	0.300000	0.22699	0.305000	0.20034	GAG	ZNF675	-	pfscan_Znf_C2H2	ENSG00000197372		0.403	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF675	HGNC	protein_coding	OTTHUMT00000466433.1	189	0.00	0	C	NM_138330		23836556	23836556	-1	no_errors	ENST00000359788	ensembl	human	known	69_37n	missense	143	25.91	50	SNP	1.000	G
ZNF704	619279	genome.wustl.edu	37	8	81599539	81599539	+	Silent	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr8:81599539G>A	ENST00000327835.3	-	4	711	c.480C>T	c.(478-480)ccC>ccT	p.P160P	ZNF704_ENST00000520336.1_5'UTR	NM_001033723.2	NP_001028895.1	Q6ZNC4	ZN704_HUMAN	zinc finger protein 704	160							metal ion binding (GO:0046872)			lung(9)|skin(1)|upper_aerodigestive_tract(1)	11	all_cancers(3;8.53e-08)|all_epithelial(4;4.59e-10)|Breast(3;2.56e-06)|Lung NSC(7;2.58e-06)|all_lung(9;9.4e-06)		BRCA - Breast invasive adenocarcinoma(6;0.00401)|Epithelial(68;0.00448)|all cancers(69;0.0277)			CTGGCTGCGCGGGGCTGCGGA	0.682											OREG0018841	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													39.0	41.0	40.0					8																	81599539		2187	4266	6453	-	-	-	SO:0001819	synonymous_variant	0			AK131274	CCDS34913.1	8q21.13	2008-05-02			ENSG00000164684	ENSG00000164684			32291	protein-coding gene	gene with protein product							Standard	NM_001033723		Approved	FLJ16218, Gig1	uc003yby.2	Q6ZNC4	OTTHUMG00000164733	ENST00000327835.3:c.480C>T	8.37:g.81599539G>A		Somatic	1207	WXS	Illumina GAIIx	Phase_IV	B2RNE6|B9EGW6	Silent	SNP	pfscan_Znf_C2H2	p.P160	ENST00000327835.3	37	c.480	CCDS34913.1	8																																																																																			ZNF704	-	NULL	ENSG00000164684		0.682	ZNF704-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF704	HGNC	protein_coding	OTTHUMT00000379964.2	12	0.00	0	G	NM_001033723		81599539	81599539	-1	no_errors	ENST00000327835	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	0.298	A
ZNF90	7643	genome.wustl.edu	37	19	20229984	20229984	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr19:20229984G>C	ENST00000418063.2	+	4	1733	c.1621G>C	c.(1621-1623)Gaa>Caa	p.E541Q	ZNF90_ENST00000474284.1_Intron	NM_007138.1	NP_009069.1	Q03938	ZNF90_HUMAN	zinc finger protein 90	541					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|lung(2)|ovary(1)|skin(1)	5						CAAATGTGAAGAATGTGGCAA	0.413																																						dbGAP											0													21.0	19.0	20.0					19																	20229984		692	1590	2282	-	-	-	SO:0001583	missense	0			M61870	CCDS46028.1	19p12	2013-01-08	2006-02-01		ENSG00000213988	ENSG00000213988		"""Zinc fingers, C2H2-type"", ""-"""	13165	protein-coding gene	gene with protein product		603973	"""zinc finger protein 90 (HTF9)"""			8467795	Standard	NM_007138		Approved	HTF9	uc002nor.2	Q03938	OTTHUMG00000158057	ENST00000418063.2:c.1621G>C	19.37:g.20229984G>C	ENSP00000410466:p.Glu541Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH87	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E541Q	ENST00000418063.2	37	c.1621	CCDS46028.1	19	.	.	.	.	.	.	.	.	.	.	G	13.32	2.202668	0.38905	.	.	ENSG00000213988	ENST00000418063	T	0.07444	3.19	1.05	1.05	0.20165	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05135	0.0137	L	0.33792	1.035	0.18873	N	0.999987	P	0.46220	0.874	B	0.34038	0.174	T	0.39210	-0.9625	8	.	.	.	.	7.2719	0.26262	0.0:0.0:1.0:0.0	.	541	Q03938	ZNF90_HUMAN	Q	541	ENSP00000410466:E541Q	.	E	+	1	0	ZNF90	20090984	0.371000	0.25056	0.415000	0.26534	0.416000	0.31233	1.249000	0.32839	0.119000	0.18210	0.121000	0.15741	GAA	ZNF90	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000213988		0.413	ZNF90-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF90	HGNC	protein_coding	OTTHUMT00000350101.1	66	0.00	0	G	NM_007138		20229984	20229984	+1	no_errors	ENST00000418063	ensembl	human	known	69_37n	missense	52	25.71	18	SNP	0.688	C
ZZEF1	23140	genome.wustl.edu	37	17	3981281	3981281	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18P-01A-11D-A12B-09	TCGA-BH-A18P-11A-43D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	add624a3-57e9-46be-9bcc-3e53d7c2dfb7	5cae8dca-b28a-4483-9c03-6f0645161c04	g.chr17:3981281G>A	ENST00000381638.2	-	19	3009	c.2885C>T	c.(2884-2886)tCc>tTc	p.S962F	ZZEF1_ENST00000574474.1_5'UTR	NM_015113.3	NP_055928.3	O43149	ZZEF1_HUMAN	zinc finger, ZZ-type with EF-hand domain 1	962							calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(19)|ovary(3)|pancreas(1)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	84						CCAGAACAGGGAGAAGAGCAC	0.557																																						dbGAP											0													80.0	73.0	75.0					17																	3981281		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035319	CCDS11043.1	17p13.3	2013-01-10	2004-11-03		ENSG00000074755	ENSG00000074755		"""Zinc fingers, ZZ-type"", ""EF-hand domain containing"""	29027	protein-coding gene	gene with protein product			"""zinc finger, ZZ-type with EF hand domain 1"""			9455477	Standard	XM_005256560		Approved	KIAA0399, ZZZ4, FLJ10821	uc002fxe.3	O43149	OTTHUMG00000090741	ENST00000381638.2:c.2885C>T	17.37:g.3981281G>A	ENSP00000371051:p.Ser962Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBM5|Q6NXG0|Q6ZRA1|Q6ZSF4|Q9NVB9	Missense_Mutation	SNP	pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_CUB,smart_EF_hand_Ca-bd,smart_Znf_ZZ,pfscan_EF_HAND_2,pfscan_Znf_ZZ	p.S962F	ENST00000381638.2	37	c.2885	CCDS11043.1	17	.	.	.	.	.	.	.	.	.	.	G	28.0	4.881693	0.91740	.	.	ENSG00000074755	ENST00000381638	T	0.25912	1.77	5.98	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.40719	0.1128	L	0.32530	0.975	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.76071	0.987;0.982	T	0.34403	-0.9830	10	0.87932	D	0	-16.2683	15.0566	0.71917	0.0678:0.0:0.9322:0.0	.	963;962	O43149-3;O43149	.;ZZEF1_HUMAN	F	962	ENSP00000371051:S962F	ENSP00000371051:S962F	S	-	2	0	ZZEF1	3928030	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.391000	0.79828	1.537000	0.49254	0.591000	0.81541	TCC	ZZEF1	-	NULL	ENSG00000074755		0.557	ZZEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZZEF1	HGNC	protein_coding	OTTHUMT00000207480.1	118	0.00	0	G	NM_015113		3981281	3981281	-1	no_errors	ENST00000381638	ensembl	human	known	69_37n	missense	58	31.40	27	SNP	1.000	A
