#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACOXL	55289	genome.wustl.edu	37	2	111875316	111875316	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr2:111875316T>A	ENST00000439055.1	+	18	1890	c.1666T>A	c.(1666-1668)Ttc>Atc	p.F556I	AC096670.3_ENST00000418615.1_RNA	NM_001142807.1	NP_001136279.1	Q9NUZ1	ACOXL_HUMAN	acyl-CoA oxidase-like	0					fatty acid beta-oxidation (GO:0006635)	peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)			kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(2)|skin(2)|urinary_tract(1)	21						CGCGTGGGCTTTCTACCCTGC	0.657																																						dbGAP											0													47.0	43.0	44.0					2																	111875316		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46389.1	2q13	2010-06-30	2010-04-30		ENSG00000153093	ENSG00000153093			25621	protein-coding gene	gene with protein product			"""acyl-Coenzyme A oxidase-like"""				Standard	NM_001142807		Approved	FLJ11042	uc010yxk.1	Q9NUZ1	OTTHUMG00000131257	ENST00000439055.1:c.1666T>A	2.37:g.111875316T>A	ENSP00000407761:p.Phe556Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRB7|B7WPB3|B7WPP7|E9PB20|Q53R27|Q53R31|Q53SC6|Q8TCE7	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,pfam_Acyl-CoA_Oxase/DH_1,superfamily_AcylCoA_DH/oxidase,superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	p.F556I	ENST00000439055.1	37	c.1666	CCDS46389.1	2	.	.	.	.	.	.	.	.	.	.	T	16.68	3.191818	0.58017	.	.	ENSG00000153093	ENST00000439055;ENST00000422487	T	0.49139	0.79	5.31	2.87	0.33458	.	.	.	.	.	T	0.27900	0.0687	N	0.19112	0.55	0.80722	D	1	B	0.30793	0.295	B	0.30782	0.12	T	0.03981	-1.0987	9	0.27082	T	0.32	-9.7185	5.5597	0.17135	0.0:0.091:0.1728:0.7362	.	556	E9PB20	.	I	556;407	ENSP00000407761:F556I	ENSP00000404255:F407I	F	+	1	0	ACOXL	111591787	0.905000	0.30787	0.972000	0.41901	0.530000	0.34684	1.236000	0.32683	0.299000	0.22661	0.459000	0.35465	TTC	ACOXL	-	superfamily_AcylCo_DH/oxidase_C,pirsf_Acyl-CoA_oxidase	ENSG00000153093		0.657	ACOXL-013	KNOWN	basic|CCDS	protein_coding	ACOXL	HGNC	protein_coding	OTTHUMT00000376017.1	43	0.00	0	T	NM_018308		111875316	111875316	+1	no_errors	ENST00000439055	ensembl	human	known	69_37n	missense	28	23.08	9	SNP	0.996	A
ADGB	79747	genome.wustl.edu	37	6	147123111	147123111	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr6:147123111A>C	ENST00000397944.3	+	35	4858	c.4782A>C	c.(4780-4782)ttA>ttC	p.L1594F	ADGB_ENST00000367488.1_3'UTR|ADGB_ENST00000367493.3_3'UTR|KATNBL1P6_ENST00000562413.2_RNA	NM_024694.3	NP_078970.3	Q8N7X0	ADGB_HUMAN	androglobin	1594					oxygen transport (GO:0015671)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxygen binding (GO:0019825)			breast(1)|endometrium(2)|kidney(2)	5						GGTTGAAGTTAAAGGATGAAG	0.383																																						dbGAP											0													109.0	104.0	105.0					6																	147123111		692	1591	2283	-	-	-	SO:0001583	missense	0			AK026774		6q24.2	2012-02-03	2012-02-03	2012-02-03	ENSG00000118492	ENSG00000118492			21212	protein-coding gene	gene with protein product		614630	"""chromosome 6 open reading frame 103"""	C6orf103		22115833	Standard	NM_024694		Approved	FLJ23121, dJ408K24.1	uc010khx.3	Q8N7X0	OTTHUMG00000015758	ENST00000397944.3:c.4782A>C	6.37:g.147123111A>C	ENSP00000381036:p.Leu1594Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T402|Q5T904|Q5T905	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,superfamily_Globin-like,smart_Peptidase_C2_calpain_cat,pfscan_IQ_motif_EF-hand-BS,pfscan_Peptidase_C2_calpain_cat	p.L1594F	ENST00000397944.3	37	c.4782		6	.	.	.	.	.	.	.	.	.	.	A	15.77	2.931736	0.52866	.	.	ENSG00000118492	ENST00000397944;ENST00000367490;ENST00000367489	T;T;T	0.52983	1.21;0.64;0.72	5.07	-4.98	0.03019	.	.	.	.	.	T	0.15652	0.0377	N	0.19112	0.55	0.09310	N	1	P;P	0.46706	0.883;0.815	P;B	0.45037	0.467;0.299	T	0.14727	-1.0462	9	0.48119	T	0.1	.	9.686	0.40098	0.2819:0.0:0.5885:0.1296	.	1594;539	Q8N7X0;Q8N7X0-2	CAN7L_HUMAN;.	F	1594;552;39	ENSP00000381036:L1594F;ENSP00000356460:L552F;ENSP00000356459:L39F	ENSP00000356459:L39F	L	+	3	2	C6orf103	147164804	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-0.439000	0.06897	-1.171000	0.02765	0.460000	0.39030	TTA	ADGB	-	NULL	ENSG00000118492		0.383	ADGB-009	KNOWN	basic|appris_principal	protein_coding	ADGB	HGNC	protein_coding	OTTHUMT00000376350.2	244	0.00	0	A	NM_024694		147123111	147123111	+1	no_errors	ENST00000397944	ensembl	human	known	69_37n	missense	236	12.59	34	SNP	0.000	C
AKAP12	9590	genome.wustl.edu	37	6	151672994	151672994	+	Silent	SNP	G	G	A			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr6:151672994G>A	ENST00000253332.1	+	3	3657	c.3468G>A	c.(3466-3468)caG>caA	p.Q1156Q	AKAP12_ENST00000402676.2_Silent_p.Q1156Q|AKAP12_ENST00000354675.6_Silent_p.Q1058Q|AKAP12_ENST00000359755.5_Silent_p.Q1051Q			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1156					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		TGATGGAACAGGCTATCCCCC	0.537																																					Melanoma(141;1616 1805 10049 24534 51979)	dbGAP											0													104.0	103.0	103.0					6																	151672994		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.3468G>A	6.37:g.151672994G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Silent	SNP	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.Q1156	ENST00000253332.1	37	c.3468	CCDS5229.1	6																																																																																			AKAP12	-	NULL	ENSG00000131016		0.537	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1	120	0.00	0	G			151672994	151672994	+1	no_errors	ENST00000253332	ensembl	human	known	69_37n	silent	97	21.77	27	SNP	0.030	A
ARHGEF39	84904	genome.wustl.edu	37	9	35664108	35664108	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr9:35664108T>G	ENST00000378387.3	-	4	487	c.370A>C	c.(370-372)Aat>Cat	p.N124H	ARHGEF39_ENST00000343259.3_Missense_Mutation_p.N124H|ARHGEF39_ENST00000490970.1_5'UTR|ARHGEF39_ENST00000378395.2_Missense_Mutation_p.N88H	NM_032818.2	NP_116207.2	Q8N4T4	ARG39_HUMAN	Rho guanine nucleotide exchange factor (GEF) 39	124	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				positive regulation of cell migration (GO:0030335)	plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)										AAACCTTTATTTTTCTTTAGC	0.532																																						dbGAP											0													63.0	74.0	71.0					9																	35664108		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001187	CCDS6584.2	9p13.3	2012-08-08	2012-08-08	2012-08-08	ENSG00000137135	ENSG00000137135			25909	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 100"""	C9orf100		22327280	Standard	XR_242516		Approved	FLJ14642	uc003zxm.1	Q8N4T4	OTTHUMG00000019869	ENST00000378387.3:c.370A>C	9.37:g.35664108T>G	ENSP00000367638:p.Asn124His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AG0|Q6TPQ2|Q96ST6	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.N124H	ENST00000378387.3	37	c.370	CCDS6584.2	9	.	.	.	.	.	.	.	.	.	.	T	21.5	4.156473	0.78114	.	.	ENSG00000137135	ENST00000378387;ENST00000378395;ENST00000343259	T;T;T	0.65549	-0.16;-0.16;-0.16	5.62	5.62	0.85841	Dbl homology (DH) domain (5);	0.330479	0.39274	N	0.001410	T	0.72859	0.3513	L	0.54323	1.7	0.46113	D	0.998877	D;P	0.69078	0.997;0.902	D;P	0.66847	0.947;0.781	T	0.75216	-0.3396	10	0.66056	D	0.02	-17.8729	12.21	0.54373	0.0:0.0:0.0:1.0	.	124;124	B4E0T1;Q8N4T4	.;CI100_HUMAN	H	124;88;124	ENSP00000367638:N124H;ENSP00000367648:N88H;ENSP00000344922:N124H	ENSP00000344922:N124H	N	-	1	0	C9orf100	35654108	1.000000	0.71417	0.927000	0.36925	0.986000	0.74619	4.780000	0.62382	2.142000	0.66516	0.460000	0.39030	AAT	ARHGEF39	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000137135		0.532	ARHGEF39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF39	HGNC	protein_coding	OTTHUMT00000052330.1	187	0.00	0	T	NM_032818		35664108	35664108	-1	no_errors	ENST00000378387	ensembl	human	known	69_37n	missense	96	21.31	26	SNP	0.732	G
BFSP1	631	genome.wustl.edu	37	20	17474951	17474951	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr20:17474951G>C	ENST00000377873.3	-	8	1805	c.1766C>G	c.(1765-1767)cCa>cGa	p.P589R	BFSP1_ENST00000536626.1_Missense_Mutation_p.P450R|BFSP1_ENST00000544874.1_Missense_Mutation_p.P450R|BFSP1_ENST00000377868.2_Missense_Mutation_p.P464R	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	589	Tail.				cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						CGCAGGCTTTGGAGGCTCAGG	0.577																																						dbGAP											0													112.0	113.0	113.0					20																	17474951		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1766C>G	20.37:g.17474951G>C	ENSP00000367104:p.Pro589Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin	p.P589R	ENST00000377873.3	37	c.1766	CCDS13126.1	20	.	.	.	.	.	.	.	.	.	.	G	1.128	-0.653199	0.03480	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	4.74	-1.02	0.10135	.	0.651463	0.15802	N	0.243894	T	0.23806	0.0576	L	0.36672	1.1	0.09310	N	1	B;B	0.32829	0.386;0.346	B;B	0.31101	0.124;0.049	T	0.27054	-1.0085	10	0.09590	T	0.72	0.032	7.2608	0.26201	0.1353:0.0:0.4506:0.4141	.	464;589	Q12934-2;Q12934	.;BFSP1_HUMAN	R	589;464;450;450	ENSP00000367104:P589R;ENSP00000367099:P464R;ENSP00000442522:P450R;ENSP00000439870:P450R	ENSP00000367099:P464R	P	-	2	0	BFSP1	17422951	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	0.122000	0.15687	-0.053000	0.13289	-0.262000	0.10625	CCA	BFSP1	-	NULL	ENSG00000125864		0.577	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFSP1	HGNC	protein_coding	OTTHUMT00000078119.6	181	0.00	0	G	NM_001195		17474951	17474951	-1	no_errors	ENST00000377873	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	0.000	C
CCDC18	343099	genome.wustl.edu	37	1	93701816	93701816	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr1:93701816delG	ENST00000343253.7	+	19	2971	c.2469delG	c.(2467-2469)ctgfs	p.L823fs	CCDC18_ENST00000401026.3_Frame_Shift_Del_p.L824fs|CCDC18_ENST00000557479.1_Frame_Shift_Del_p.L942fs|CCDC18_ENST00000334652.5_Frame_Shift_Del_p.L119fs|CCDC18_ENST00000338949.4_Frame_Shift_Del_p.L579fs|CCDC18_ENST00000421014.2_Intron			Q5T9S5	CCD18_HUMAN	coiled-coil domain containing 18	823										breast(5)|endometrium(3)|kidney(1)|large_intestine(6)|lung(19)|ovary(3)|pancreas(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	42		all_lung(203;0.00196)|Lung NSC(277;0.00903)|Melanoma(281;0.099)|all_neural(321;0.185)|Glioma(108;0.203)		all cancers(265;0.00166)|GBM - Glioblastoma multiforme(16;0.00551)|Epithelial(280;0.0967)		TGTCAAAACTGGAACAAGAAC	0.323																																						dbGAP											0													77.0	69.0	71.0					1																	93701816		1815	4076	5891	-	-	-	SO:0001589	frameshift_variant	0					1p22.1	2008-02-05			ENSG00000122483	ENSG00000122483			30370	protein-coding gene	gene with protein product						12601173	Standard	XM_006710609		Approved	NY-SAR-41	uc021opx.1	Q5T9S5	OTTHUMG00000010598	ENST00000343253.7:c.2469delG	1.37:g.93701816delG	ENSP00000343377:p.Leu823fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU17	Frame_Shift_Del	DEL	superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.E943fs	ENST00000343253.7	37	c.2826		1																																																																																			CCDC18	-	NULL	ENSG00000122483		0.323	CCDC18-008	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	CCDC18	HGNC	protein_coding	OTTHUMT00000382327.1	267	0.00	0	G	NM_206886		93701816	93701816	+1	no_errors	ENST00000557479	ensembl	human	known	69_37n	frame_shift_del	129	22.49	38	DEL	1.000	-
DGKI	9162	genome.wustl.edu	37	7	137374734	137374734	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr7:137374734C>T	ENST00000288490.5	-	2	416	c.416G>A	c.(415-417)cGg>cAg	p.R139Q	DGKI_ENST00000453654.2_Intron|DGKI_ENST00000446122.1_Missense_Mutation_p.R139Q|DGKI_ENST00000424189.2_Missense_Mutation_p.R139Q	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	139					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)	p.R139Q(1)		breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						GAGGCCTGCCCGGGAGATTGC	0.498																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											59.0	61.0	60.0					7																	137374734		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.416G>A	7.37:g.137374734C>T	ENSP00000288490:p.Arg139Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.R139Q	ENST00000288490.5	37	c.416	CCDS5845.1	7	.	.	.	.	.	.	.	.	.	.	C	34	5.398092	0.96030	.	.	ENSG00000157680	ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T	0.36878	1.23;1.42	5.83	5.83	0.93111	.	0.175120	0.51477	D	0.000099	T	0.44498	0.1296	L	0.42245	1.32	0.58432	D	0.999999	D	0.61697	0.99	P	0.50270	0.636	T	0.30090	-0.9990	10	0.59425	D	0.04	.	18.9089	0.92474	0.0:1.0:0.0:0.0	.	139	O75912	DGKI_HUMAN	Q	87;139;139;139	ENSP00000288490:R139Q;ENSP00000399131:R139Q	ENSP00000288490:R139Q	R	-	2	0	DGKI	137025274	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.377000	0.66184	2.763000	0.94921	0.563000	0.77884	CGG	DGKI	-	NULL	ENSG00000157680		0.498	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	110	0.00	0	C	NM_004717		137374734	137374734	-1	no_errors	ENST00000424189	ensembl	human	known	69_37n	missense	46	33.33	23	SNP	1.000	T
DNAH10	196385	genome.wustl.edu	37	12	124349244	124349244	+	Silent	SNP	C	C	A			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr12:124349244C>A	ENST00000409039.3	+	39	6682	c.6657C>A	c.(6655-6657)atC>atA	p.I2219I		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2219	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GGGAACGCATCCGGCTCCAAG	0.388																																						dbGAP											0													112.0	108.0	109.0					12																	124349244		2015	4186	6201	-	-	-	SO:0001819	synonymous_variant	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6657C>A	12.37:g.124349244C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.I2219	ENST00000409039.3	37	c.6657	CCDS9255.2	12																																																																																			DNAH10	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000197653		0.388	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	339	0.29	1	C			124349244	124349244	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	silent	205	43.84	160	SNP	0.971	A
FAM107A	11170	genome.wustl.edu	37	3	58552971	58552971	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr3:58552971C>G	ENST00000394481.1	-	4	849	c.291G>C	c.(289-291)gaG>gaC	p.E97D	FAM107A_ENST00000447756.2_Missense_Mutation_p.E125D|FAM107A_ENST00000360997.2_Missense_Mutation_p.E97D|FAM107A_ENST00000464064.1_Missense_Mutation_p.E97D|FAM107A_ENST00000474531.1_Missense_Mutation_p.E128D	NM_001282713.1|NM_007177.2	NP_001269642.1|NP_009108.1	O95990	F107A_HUMAN	family with sequence similarity 107, member A	97					regulation of cell growth (GO:0001558)	neuron projection (GO:0043005)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				BRCA - Breast invasive adenocarcinoma(55;0.000189)|Kidney(10;0.000536)|KIRC - Kidney renal clear cell carcinoma(10;0.000716)|OV - Ovarian serous cystadenocarcinoma(275;0.154)		GCAGCTCCTGCTCAAAGGGGC	0.637																																						dbGAP											0													44.0	37.0	39.0					3																	58552971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF089854	CCDS2892.1, CCDS63672.1, CCDS63673.1	3p14.2	2006-02-03			ENSG00000168309	ENSG00000168309			30827	protein-coding gene	gene with protein product		608295				10564580, 10702698	Standard	XM_005264835		Approved	DRR1, TU3A	uc003dkn.3	O95990	OTTHUMG00000159159	ENST00000394481.1:c.291G>C	3.37:g.58552971C>G	ENSP00000377991:p.Glu97Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNQ4|B7ZAY5|J3KR61|Q96NH4	Missense_Mutation	SNP	pfam_DUF1151	p.E97D	ENST00000394481.1	37	c.291	CCDS2892.1	3	.	.	.	.	.	.	.	.	.	.	C	17.17	3.321984	0.60634	.	.	ENSG00000168309	ENST00000360997;ENST00000394481;ENST00000464064;ENST00000474531;ENST00000447756;ENST00000465970	T;T;T;T;T;T	0.55234	0.53;0.53;0.53;0.53;0.53;0.53	5.05	4.16	0.48862	.	0.048594	0.85682	D	0.000000	T	0.63046	0.2478	M	0.86573	2.825	0.43054	D	0.994661	P;P;P;P	0.51240	0.662;0.731;0.943;0.662	P;B;P;B	0.52066	0.476;0.343;0.689;0.277	T	0.68292	-0.5447	10	0.59425	D	0.04	-23.8972	5.3473	0.16016	0.0:0.7115:0.0:0.2885	.	125;97;128;97	B7ZAY5;O95990-2;B3KNQ4;O95990	.;.;.;F107A_HUMAN	D	97;97;97;128;125;97	ENSP00000354270:E97D;ENSP00000377991:E97D;ENSP00000419529:E97D;ENSP00000419124:E128D;ENSP00000400858:E125D;ENSP00000418038:E97D	ENSP00000354270:E97D	E	-	3	2	FAM107A	58528011	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	0.910000	0.28571	2.512000	0.84698	0.591000	0.81541	GAG	FAM107A	-	pfam_DUF1151	ENSG00000168309		0.637	FAM107A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM107A	HGNC	protein_coding	OTTHUMT00000353585.1	30	0.00	0	C	NM_007177		58552971	58552971	-1	no_errors	ENST00000360997	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	G
ERICH6B	220081	genome.wustl.edu	37	13	46124100	46124100	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr13:46124100A>T	ENST00000298738.2	-	13	1738	c.1574T>A	c.(1573-1575)cTa>cAa	p.L525Q	RNA5SP27_ENST00000363839.1_RNA|FAM194B_ENST00000504261.1_5'UTR	NM_182542.2	NP_872348.2	Q5W0A0	ERI6B_HUMAN		525										breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)	5						CCTCCCTTCTAGACTGTCTTC	0.433																																						dbGAP											0													169.0	140.0	149.0					13																	46124100		692	1591	2283	-	-	-	SO:0001583	missense	0																														ENST00000298738.2:c.1574T>A	13.37:g.46124100A>T	ENSP00000298738:p.Leu525Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96MB5	Missense_Mutation	SNP	NULL	p.L525Q	ENST00000298738.2	37	c.1574	CCDS45045.1	13	.	.	.	.	.	.	.	.	.	.	A	6.075	0.382190	0.11524	.	.	ENSG00000165837	ENST00000298738	T	0.11604	2.76	5.69	-11.4	0.00090	.	.	.	.	.	T	0.03053	0.0090	N	0.03608	-0.345	0.09310	N	1	B	0.26577	0.153	B	0.28139	0.086	T	0.46345	-0.9198	9	0.87932	D	0	0.6093	1.6402	0.02750	0.2719:0.1369:0.4131:0.1781	.	525	Q5W0A0	F194B_HUMAN	Q	525	ENSP00000298738:L525Q	ENSP00000298738:L525Q	L	-	2	0	FAM194B	45022101	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.950000	0.00327	-1.394000	0.02077	-1.545000	0.00906	CTA	FAM194B	-	NULL	ENSG00000165837		0.433	FAM194B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM194B	HGNC	protein_coding	OTTHUMT00000044781.3	361	0.00	0	A			46124100	46124100	-1	no_errors	ENST00000298738	ensembl	human	known	69_37n	missense	192	32.87	94	SNP	0.000	T
RP11-383M4.6	0	genome.wustl.edu	37	9	84547625	84547625	+	lincRNA	SNP	C	C	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr9:84547625C>T	ENST00000585776.1	-	0	1039				RP11-383M4.2_ENST00000427387.1_lincRNA|SPATA31D4_ENST00000341875.4_RNA																							GTGCATAGTTCATGGCACTCA	0.443																																						dbGAP											0													23.0	20.0	21.0					9																	84547625		675	1521	2196	-	-	-			0																															9.37:g.84547625C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000585776.1	37	NULL		9																																																																																			FAM75D4	-	-	ENSG00000189357		0.443	RP11-383M4.6-001	KNOWN	basic	lincRNA	FAM75D4	HGNC	lincRNA	OTTHUMT00000453562.1	339	0.00	0	C			84547625	84547625	+1	no_errors	ENST00000341875	ensembl	human	known	69_37n	rna	230	11.54	30	SNP	0.040	T
FMN2	56776	genome.wustl.edu	37	1	240371328	240371328	+	Silent	SNP	G	G	A	rs71646895	byFrequency	TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr1:240371328G>A	ENST00000319653.9	+	5	3446	c.3216G>A	c.(3214-3216)gcG>gcA	p.A1072A		NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1072	FH1.|Pro-rich.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			TACCCGGAGCGGGCATACCCC	0.736																																						dbGAP											0													2.0	3.0	3.0					1																	240371328		1326	2694	4020	-	-	-	SO:0001819	synonymous_variant	0			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.3216G>A	1.37:g.240371328G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Silent	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.A1072	ENST00000319653.9	37	c.3216	CCDS31069.2	1																																																																																			FMN2	-	pfam_Formin_homology_1,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000155816		0.736	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	8	0.00	0	G	XM_371352		240371328	240371328	+1	no_errors	ENST00000319653	ensembl	human	known	69_37n	silent	2	57.14	4	SNP	0.002	A
HLA-DRB1	3123	genome.wustl.edu	37	6	32552137	32552137	+	Missense_Mutation	SNP	G	G	A	rs17878703	byFrequency	TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr6:32552137G>A	ENST00000360004.5	-	2	224	c.119C>T	c.(118-120)cCt>cTt	p.P40L		NM_002124.3	NP_002115.2	Q30167	2B1A_HUMAN	major histocompatibility complex, class II, DR beta 1	40	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)				large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)|stomach(1)	10						CTCCCTCTTAGGCTGCCACAG	0.607										Multiple Myeloma(14;0.17)																												dbGAP											0													11.0	12.0	12.0					6																	32552137		1725	3516	5241	-	-	-	SO:0001583	missense	0			AJ297583	CCDS47409.1	6p21.3	2013-01-11			ENSG00000196126	ENSG00000196126		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4948	protein-coding gene	gene with protein product		142857		HLA-DR1B			Standard	NM_001243965		Approved		uc011eri.2	P01911	OTTHUMG00000031196	ENST00000360004.5:c.119C>T	6.37:g.32552137G>A	ENSP00000353099:p.Pro40Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	P01914|Q9MYF5	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.P40L	ENST00000360004.5	37	c.119	CCDS47409.1	6	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.348909	0.00016	.	.	ENSG00000196126	ENST00000360004	T	0.00202	8.56	3.52	-7.04	0.01578	MHC class II, alpha/beta chain, N-terminal (1);MHC classes I/II-like antigen recognition protein (1);	.	.	.	.	T	0.00012	0.0000	N	0.14661	0.345	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.53851	-0.8380	9	0.10902	T	0.67	.	1.2468	0.01974	0.2915:0.1251:0.1506:0.4328	rs17878703;rs28724103	40	P01911	2B1F_HUMAN	L	40	ENSP00000353099:P40L	ENSP00000353099:P40L	P	-	2	0	HLA-DRB1	32660115	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-14.273000	0.00000	-7.109000	0.00001	-5.042000	0.00002	CCT	HLA-DRB1	-	superfamily_MHC_I/II-like_Ag-recog	ENSG00000196126		0.607	HLA-DRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DRB1	HGNC	protein_coding	OTTHUMT00000076393.3	9	0.00	0	G	NM_002124		32552137	32552137	-1	no_errors	ENST00000360004	ensembl	human	known	69_37n	missense	2	71.43	5	SNP	0.000	A
MUC16	94025	genome.wustl.edu	37	19	9063011	9063011	+	Silent	SNP	C	C	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr19:9063011C>T	ENST00000397910.4	-	3	24638	c.24435G>A	c.(24433-24435)gtG>gtA	p.V8145V		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	8147	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CACCAGTGGGCACTCCAGAAA	0.542																																						dbGAP											0													119.0	116.0	117.0					19																	9063011		2024	4186	6210	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.24435G>A	19.37:g.9063011C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.V8145	ENST00000397910.4	37	c.24435	CCDS54212.1	19																																																																																			MUC16	-	NULL	ENSG00000181143		0.542	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	277	0.00	0	C	NM_024690		9063011	9063011	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	125	23.31	38	SNP	0.000	T
PITX2	5308	genome.wustl.edu	37	4	111539734	111539734	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr4:111539734G>C	ENST00000354925.2	-	7	2206	c.501C>G	c.(499-501)taC>taG	p.Y167*	PITX2_ENST00000306732.3_Nonsense_Mutation_p.Y174*|PITX2_ENST00000394595.3_Missense_Mutation_p.R99G|PITX2_ENST00000355080.5_Nonsense_Mutation_p.Y121*|PITX2_ENST00000394598.2_Nonsense_Mutation_p.Y167*|PITX2_ENST00000556049.1_5'UTR	NM_001204397.1	NP_001191326.1	Q99697	PITX2_HUMAN	paired-like homeodomain 2	167					atrial cardiac muscle tissue morphogenesis (GO:0055009)|atrioventricular valve development (GO:0003171)|camera-type eye development (GO:0043010)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|deltoid tuberosity development (GO:0035993)|determination of left/right symmetry (GO:0007368)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic hindlimb morphogenesis (GO:0035116)|endodermal digestive tract morphogenesis (GO:0061031)|extraocular skeletal muscle development (GO:0002074)|female gonad development (GO:0008585)|hair cell differentiation (GO:0035315)|hypothalamus cell migration (GO:0021855)|in utero embryonic development (GO:0001701)|iris morphogenesis (GO:0061072)|left lung morphogenesis (GO:0060460)|left/right axis specification (GO:0070986)|male gonad development (GO:0008584)|myoblast fusion (GO:0007520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|odontogenesis (GO:0042476)|odontogenesis of dentin-containing tooth (GO:0042475)|patterning of blood vessels (GO:0001569)|positive regulation of DNA binding (GO:0043388)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prolactin secreting cell differentiation (GO:0060127)|pulmonary myocardium development (GO:0003350)|pulmonary vein morphogenesis (GO:0060577)|regulation of cell migration (GO:0030334)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|response to hormone (GO:0009725)|response to vitamin A (GO:0033189)|somatotropin secreting cell differentiation (GO:0060126)|spleen development (GO:0048536)|subthalamic nucleus development (GO:0021763)|superior vena cava morphogenesis (GO:0060578)|vascular smooth muscle cell differentiation (GO:0035886)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell development (GO:0055015)|ventricular septum morphogenesis (GO:0060412)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin DNA binding (GO:0031490)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)|ribonucleoprotein complex binding (GO:0043021)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|endometrium(3)|large_intestine(1)|lung(5)	10		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00222)		ACATGTCGTCGTAGGGCTGCA	0.562																																						dbGAP											0			GRCh37	CM066170	PITX2	M							82.0	74.0	77.0					4																	111539734		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U69961	CCDS3692.1, CCDS3693.1, CCDS3694.1	4q25	2011-06-20	2007-07-12		ENSG00000164093	ENSG00000164093		"""Homeoboxes / PRD class"""	9005	protein-coding gene	gene with protein product		601542	"""paired-like homeodomain transcription factor 2"""	IRID2, IHG2, RIEG, RIEG1, RGS		9539779, 7581385	Standard	NM_000325		Approved	IGDS, RS, Brx1, Otlx2, ARP1	uc021xqr.1	Q99697	OTTHUMG00000132837	ENST00000354925.2:c.501C>G	4.37:g.111539734G>C	ENSP00000347004:p.Tyr167*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6C6|B2RA02|B3KXS0|O60578|O60579|O60580|Q3KQX9|Q9BY17	Nonsense_Mutation	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pirsf_Homeobox_Pitx/unc30,pfscan_OAR_dom,pfscan_Homeodomain	p.Y174*	ENST00000354925.2	37	c.522	CCDS3692.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.0|22.0	4.224512|4.224512	0.79576|0.79576	.|.	.|.	ENSG00000164093|ENSG00000164093	ENST00000394595|ENST00000306732;ENST00000394598;ENST00000355080;ENST00000354925;ENST00000511837;ENST00000556049	.|.	.|.	.|.	4.89|4.89	1.9|1.9	0.25705|0.25705	.|.	.|0.173767	.|0.52532	.|D	.|0.000066	T|.	0.23611|.	0.0571|.	.|.	.|.	.|.	0.33384|0.33384	D|D	0.575224|0.575224	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37776|.	-0.9691|.	5|.	0.87932|0.02654	D|T	0|1	.|.	10.5195|10.5195	0.44910|0.44910	0.2969:0.0:0.7031:0.0|0.2969:0.0:0.7031:0.0	.|.	.|.	.|.	.|.	G|X	99|174;167;121;167;167;91	.|.	ENSP00000378095:R99G|ENSP00000304169:Y174X	R|Y	-|-	1|3	2|2	PITX2|PITX2	111759183|111759183	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.973000|0.973000	0.67179|0.67179	2.055000|2.055000	0.41345|0.41345	0.251000|0.251000	0.21505|0.21505	0.563000|0.563000	0.77884|0.77884	CGA|TAC	PITX2	-	pirsf_Homeobox_Pitx/unc30	ENSG00000164093		0.562	PITX2-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	PITX2	HGNC	protein_coding	OTTHUMT00000256308.2	81	0.00	0	G			111539734	111539734	-1	no_errors	ENST00000306732	ensembl	human	known	69_37n	nonsense	49	23.44	15	SNP	1.000	C
POGK	57645	genome.wustl.edu	37	1	166819372	166819372	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr1:166819372G>C	ENST00000367875.1	+	5	1916	c.1556G>C	c.(1555-1557)cGg>cCg	p.R519P	POGK_ENST00000537173.1_Missense_Mutation_p.R401P|POGK_ENST00000367876.4_Missense_Mutation_p.R519P|POGK_ENST00000536514.1_Missense_Mutation_p.R434P			Q9P215	POGK_HUMAN	pogo transposable element with KRAB domain	519	DDE.				multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(1)|large_intestine(8)|lung(4)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	22						gacagtgtgcgggcccagtac	0.577																																					GBM(76;192 1530 30153 48742)	dbGAP											0													34.0	28.0	30.0					1																	166819372		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB040946	CCDS1254.1	1q23.2	2013-01-08			ENSG00000143157	ENSG00000143157		"""-"""	18800	protein-coding gene	gene with protein product	"""KRAB box domain containing 2"""						Standard	NM_017542		Approved	KIAA15131, LST003, BASS2, KRBOX2	uc001gdt.1	Q9P215	OTTHUMG00000034325	ENST00000367875.1:c.1556G>C	1.37:g.166819372G>C	ENSP00000356849:p.Arg519Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TIJ1|Q8TE07	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_Brinker_DNA-bd,pfam_HTH_CenpB_DNA-bd_dom,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,superfamily_Homeodomain-like,smart_Krueppel-associated_box,smart_HTH_CenpB_DNA-bd_dom,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.R519P	ENST00000367875.1	37	c.1556	CCDS1254.1	1	.	.	.	.	.	.	.	.	.	.	G	17.98	3.521753	0.64747	.	.	ENSG00000143157	ENST00000537173;ENST00000536514;ENST00000367876;ENST00000367875	T;T;T;T	0.62364	0.03;0.03;0.03;0.03	5.49	3.58	0.41010	.	0.000000	0.43260	D	0.000598	T	0.58764	0.2145	L	0.46819	1.47	0.40053	D	0.975795	D;D;D	0.76494	0.999;0.999;0.991	D;D;D	0.79784	0.987;0.993;0.917	T	0.61098	-0.7131	8	.	.	.	-34.9227	9.1533	0.36976	0.0804:0.1474:0.7722:0.0	.	401;434;519	G3V1P0;B4DS22;Q9P215	.;.;POGK_HUMAN	P	401;434;519;519	ENSP00000442763:R401P;ENSP00000441187:R434P;ENSP00000356850:R519P;ENSP00000356849:R519P	.	R	+	2	0	POGK	165085996	0.995000	0.38212	0.988000	0.46212	0.943000	0.58893	2.851000	0.48302	0.835000	0.34877	0.650000	0.86243	CGG	POGK	-	pfam_DDE_SF_endonuclease_CENPB-like	ENSG00000143157		0.577	POGK-003	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	POGK	HGNC	protein_coding	OTTHUMT00000082888.1	101	0.00	0	G	NM_017542		166819372	166819372	+1	no_errors	ENST00000367875	ensembl	human	known	69_37n	missense	32	53.62	37	SNP	0.997	C
POLR1B	84172	genome.wustl.edu	37	2	113317039	113317039	+	Silent	SNP	G	G	A			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr2:113317039G>A	ENST00000263331.5	+	9	2080	c.1500G>A	c.(1498-1500)gtG>gtA	p.V500V	POLR1B_ENST00000537335.1_Silent_p.V289V|POLR1B_ENST00000417433.2_Silent_p.V444V|POLR1B_ENST00000541869.1_Silent_p.V538V|POLR1B_ENST00000409894.3_Intron	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	500					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TTTGTCCCGTGCATACCCCAG	0.562																																					Ovarian(16;256 576 9537 23969 41147)	dbGAP											0													93.0	89.0	90.0					2																	113317039		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.1500G>A	2.37:g.113317039G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Silent	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.V538	ENST00000263331.5	37	c.1614	CCDS2097.1	2																																																																																			POLR1B	-	pfam_RNA_pol_Rpb2_3	ENSG00000125630		0.562	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	144	0.00	0	G	NM_019014		113317039	113317039	+1	no_errors	ENST00000541869	ensembl	human	known	69_37n	silent	70	37.50	42	SNP	1.000	A
PSG8	440533	genome.wustl.edu	37	19	43262178	43262178	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr19:43262178C>G	ENST00000306511.4	-	3	782	c.685G>C	c.(685-687)Gac>Cac	p.D229H	PSG8_ENST00000600709.1_5'UTR|PSG8_ENST00000401467.2_Intron|PSG8_ENST00000406636.3_Missense_Mutation_p.D107H|PSG8_ENST00000404209.4_Missense_Mutation_p.D229H	NM_182707.2	NP_874366.1	Q9UQ74	PSG8_HUMAN	pregnancy specific beta-1-glycoprotein 8	229	Ig-like C2-type 1.					extracellular region (GO:0005576)				breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(19)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	40		Prostate(69;0.00899)				GTGAATGGGTCACTGCGGCTG	0.527																																						dbGAP											0													210.0	219.0	216.0					19																	43262178		2203	4299	6502	-	-	-	SO:0001583	missense	0			M74106	CCDS33037.1, CCDS46090.1, CCDS46091.1	19q13.2	2013-01-29			ENSG00000124467	ENSG00000124467		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9525	protein-coding gene	gene with protein product		176397				1672663, 1572651	Standard	NM_182707		Approved		uc002ouo.2	Q9UQ74	OTTHUMG00000151118	ENST00000306511.4:c.685G>C	19.37:g.43262178C>G	ENSP00000305005:p.Asp229His	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKV3|B2RPL4|B4DTI6|O60410|Q68CR6	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D229H	ENST00000306511.4	37	c.685	CCDS33037.1	19	.	.	.	.	.	.	.	.	.	.	c	12.64	1.998829	0.35226	.	.	ENSG00000124467	ENST00000404209;ENST00000292109;ENST00000406636;ENST00000426252;ENST00000306511	T;T;T	0.12984	2.63;2.63;2.63	1.53	1.53	0.23141	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37128	0.0992	M	0.87547	2.89	0.21445	N	0.999683	P;D;D;D	0.89917	0.942;1.0;1.0;1.0	P;D;D;D	0.91635	0.847;0.998;0.998;0.999	T	0.05989	-1.0852	9	0.72032	D	0.01	.	6.4485	0.21890	0.0:1.0:0.0:0.0	.	107;229;229;229	Q9UQ74-2;Q9UQ74;Q9UQ74-3;A5PKV3	.;PSG8_HUMAN;.;.	H	229;104;107;41;229	ENSP00000385869:D229H;ENSP00000385081:D107H;ENSP00000305005:D229H	ENSP00000292109:D104H	D	-	1	0	PSG8	47954018	0.846000	0.29590	0.172000	0.22920	0.089000	0.18198	1.915000	0.39976	0.835000	0.34877	0.298000	0.19748	GAC	PSG8	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000124467		0.527	PSG8-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSG8	HGNC	protein_coding	OTTHUMT00000464526.1	314	0.00	0	C			43262178	43262178	-1	no_errors	ENST00000306511	ensembl	human	known	69_37n	missense	144	26.90	53	SNP	0.666	G
RECK	8434	genome.wustl.edu	37	9	36052308	36052308	+	Silent	SNP	T	T	C			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr9:36052308T>C	ENST00000377966.3	+	2	713	c.147T>C	c.(145-147)gaT>gaC	p.D49D	RECK_ENST00000479053.1_3'UTR	NM_021111.2	NP_066934.1	O95980	RECK_HUMAN	reversion-inducing-cysteine-rich protein with kazal motifs	49	5 X Knot repeats.				blood vessel maturation (GO:0001955)|embryo implantation (GO:0007566)|extracellular matrix organization (GO:0030198)|negative regulation of endopeptidase activity (GO:0010951)	anchored component of membrane (GO:0031225)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|metalloendopeptidase inhibitor activity (GO:0008191)|serine-type endopeptidase inhibitor activity (GO:0004867)			cervix(1)|endometrium(7)|kidney(3)|large_intestine(6)|lung(10)|ovary(1)|pancreas(1)|skin(2)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(32;0.112)|STAD - Stomach adenocarcinoma(86;0.228)			TGTGCCGTGATGTATGTGAAC	0.413																																						dbGAP											0													158.0	135.0	143.0					9																	36052308		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			E13833	CCDS6597.1	9p13.3	2008-05-15			ENSG00000122707	ENSG00000122707			11345	protein-coding gene	gene with protein product		605227		ST15		9789069	Standard	NM_021111		Approved	hRECK	uc003zyv.3	O95980	OTTHUMG00000019898	ENST00000377966.3:c.147T>C	9.37:g.36052308T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS1|Q5W0K6|Q8WX37	Silent	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,superfamily_Prot_inh_PMP,smart_Prot_inh_Kazal	p.D49	ENST00000377966.3	37	c.147	CCDS6597.1	9																																																																																			RECK	-	NULL	ENSG00000122707		0.413	RECK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECK	HGNC	protein_coding	OTTHUMT00000052409.1	350	0.00	0	T			36052308	36052308	+1	no_errors	ENST00000377966	ensembl	human	known	69_37n	silent	213	26.55	77	SNP	0.999	C
RYR3	6263	genome.wustl.edu	37	15	34113500	34113500	+	Silent	SNP	C	C	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr15:34113500C>T	ENST00000389232.4	+	79	10915	c.10845C>T	c.(10843-10845)ctC>ctT	p.L3615L	RYR3_ENST00000415757.3_Silent_p.L3610L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	3615					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AAAAAACCCTCTATCAGCAAG	0.493																																						dbGAP											0													34.0	34.0	34.0					15																	34113500		1932	4140	6072	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.10845C>T	15.37:g.34113500C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L3615	ENST00000389232.4	37	c.10845	CCDS45210.1	15																																																																																			RYR3	-	superfamily_ARM-type_fold	ENSG00000198838		0.493	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	140	0.00	0	C			34113500	34113500	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	74	19.57	18	SNP	0.046	T
SLC30A9	10463	genome.wustl.edu	37	4	42069113	42069113	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr4:42069113C>G	ENST00000264451.7	+	14	1336	c.1156C>G	c.(1156-1158)Cgt>Ggt	p.R386G		NM_006345.3	NP_006336.3	Q6PML9	ZNT9_HUMAN	solute carrier family 30 (zinc transporter), member 9	386					nucleotide-excision repair (GO:0006289)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)|zinc ion transport (GO:0006829)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cation transmembrane transporter activity (GO:0008324)|chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(8)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						AATGGAAAGTCGTGATCCTAG	0.348																																						dbGAP											0													146.0	150.0	149.0					4																	42069113		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006621	CCDS3465.1	4p13	2013-05-22	2003-09-09	2003-09-10	ENSG00000014824	ENSG00000014824		"""Solute carriers"""	1329	protein-coding gene	gene with protein product	"""GRIP1-dependent nuclear receptor coactivator"""	604604	"""chromosome 4 open reading frame 1"""	C4orf1		10409434, 11906820	Standard	NM_006345		Approved	HUEL, ZNT9, GAC63	uc003gwl.3	Q6PML9	OTTHUMG00000099387	ENST00000264451.7:c.1156C>G	4.37:g.42069113C>G	ENSP00000264451:p.Arg386Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5B6|Q7Z5I7|Q8TBB2|Q9Y6R2	Missense_Mutation	SNP	pfam_Cation_efflux,superfamily_DNA-bd_dom_put,tigrfam_Cation_efflux	p.R386G	ENST00000264451.7	37	c.1156	CCDS3465.1	4	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711034	0.89112	.	.	ENSG00000014824	ENST00000264451;ENST00000536881	T	0.64618	-0.11	6.17	6.17	0.99709	.	0.047766	0.85682	D	0.000000	T	0.72518	0.3470	M	0.72576	2.205	0.80722	D	1	P	0.39376	0.67	P	0.45946	0.498	T	0.71836	-0.4472	10	0.59425	D	0.04	-11.8343	20.8794	0.99867	0.0:1.0:0.0:0.0	.	386	Q6PML9	ZNT9_HUMAN	G	386;214	ENSP00000264451:R386G	ENSP00000264451:R386G	R	+	1	0	SLC30A9	41763870	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.977000	0.63792	2.941000	0.99782	0.655000	0.94253	CGT	SLC30A9	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000014824		0.348	SLC30A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A9	HGNC	protein_coding	OTTHUMT00000216842.3	425	0.23	1	C			42069113	42069113	+1	no_errors	ENST00000264451	ensembl	human	known	69_37n	missense	282	24.93	94	SNP	1.000	G
SPIN1	10927	genome.wustl.edu	37	9	91090014	91090014	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr9:91090014G>C	ENST00000375859.3	+	6	889	c.611G>C	c.(610-612)aGg>aCg	p.R204T	SPIN1_ENST00000469017.2_3'UTR|SPIN1_ENST00000541629.1_Missense_Mutation_p.R204T	NM_006717.2	NP_006708.2	Q9Y657	SPIN1_HUMAN	spindlin 1	204					chromatin modification (GO:0016568)|gamete generation (GO:0007276)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|positive regulation of Wnt signaling pathway (GO:0030177)|rRNA transcription (GO:0009303)|Wnt signaling pathway (GO:0016055)	nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle (GO:0005819)	methylated histone binding (GO:0035064)			endometrium(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4						CCAGCAGAAAGGGAACCAGGA	0.353																																						dbGAP											0													54.0	54.0	54.0					9																	91090014		2107	4263	6370	-	-	-	SO:0001583	missense	0			AF317228	CCDS43843.1	9q22.1	2008-02-05	2007-01-03	2007-01-03	ENSG00000106723	ENSG00000106723			11243	protein-coding gene	gene with protein product		609936	"""spindlin"""	SPIN		16098913	Standard	NM_006717		Approved		uc004apy.3	Q9Y657	OTTHUMG00000020168	ENST00000375859.3:c.611G>C	9.37:g.91090014G>C	ENSP00000365019:p.Arg204Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0X6|B3KRQ4|Q7KZJ8|Q9GZT2|Q9H0N7	Missense_Mutation	SNP	pfam_Spin_Ssty	p.R204T	ENST00000375859.3	37	c.611	CCDS43843.1	9	.	.	.	.	.	.	.	.	.	.	G	16.78	3.217795	0.58560	.	.	ENSG00000106723	ENST00000375859;ENST00000541629	T;T	0.45276	0.9;0.9	5.54	5.54	0.83059	.	0.047655	0.85682	D	0.000000	T	0.55800	0.1943	M	0.69823	2.125	0.80722	D	1	D	0.59767	0.986	P	0.53062	0.717	T	0.47182	-0.9137	10	0.18276	T	0.48	-14.5559	19.675	0.95928	0.0:0.0:1.0:0.0	.	204	Q9Y657	SPIN1_HUMAN	T	204	ENSP00000365019:R204T;ENSP00000441864:R204T	ENSP00000365019:R204T	R	+	2	0	SPIN1	90279834	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.114000	0.94329	2.885000	0.99019	0.655000	0.94253	AGG	SPIN1	-	NULL	ENSG00000106723		0.353	SPIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPIN1	HGNC	protein_coding	OTTHUMT00000052967.1	114	0.00	0	G	NM_006717		91090014	91090014	+1	no_errors	ENST00000375859	ensembl	human	known	69_37n	missense	45	33.82	23	SNP	1.000	C
ST6GALNAC4	27090	genome.wustl.edu	37	9	130670691	130670691	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr9:130670691G>T	ENST00000335791.5	-	6	1164	c.889C>A	c.(889-891)Ccg>Acg	p.P297T	ST6GALNAC4_ENST00000343609.2_Missense_Mutation_p.P213T|ST6GALNAC4_ENST00000495983.1_5'UTR	NM_175039.3	NP_778204.1	Q9H4F1	SIA7D_HUMAN	ST6 (alpha-N-acetyl-neuraminyl-2,3-beta-galactosyl-1,3)-N-acetylgalactosaminide alpha-2,6-sialyltransferase 4	297					cellular protein metabolic process (GO:0044267)|glycolipid metabolic process (GO:0006664)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	(alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl-galactosaminide 6-alpha-sialyltransferase activity (GO:0047290)|sialyltransferase activity (GO:0008373)			endometrium(1)|large_intestine(2)|lung(2)|prostate(2)	7						CTCCAGGACGGATGGGCGAAC	0.637																																						dbGAP											0													66.0	62.0	63.0					9																	130670691		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB035172	CCDS6883.1	9q34	2013-03-01	2005-02-07	2005-02-07	ENSG00000136840	ENSG00000136840	2.4.99.7	"""Sialyltransferases"""	17846	protein-coding gene	gene with protein product		606378	"""sialyltransferase 7D ((alpha-N-acetylneuraminyl-2,3-beta-galactosyl-1,3)-N-acetyl galactosaminide alpha-2,6-sialyltransferase)"""	SIAT7D		10207017, 11062056	Standard	XM_005251922		Approved	ST6GALNACIV, SIAT3C	uc004bss.3	Q9H4F1	OTTHUMG00000020724	ENST00000335791.5:c.889C>A	9.37:g.130670691G>T	ENSP00000336733:p.Pro297Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T9D0|Q9NWU6|Q9UKU1|Q9ULB9|Q9Y3G3|Q9Y3G4	Missense_Mutation	SNP	pfam_Glyco_trans_29	p.P297T	ENST00000335791.5	37	c.889	CCDS6883.1	9	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226989	0.79576	.	.	ENSG00000136840	ENST00000541933;ENST00000335791;ENST00000343609	T;T	0.62364	0.03;0.27	5.09	5.09	0.68999	.	0.000000	0.85682	D	0.000000	T	0.80253	0.4589	M	0.79926	2.475	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.83062	-0.0147	10	0.87932	D	0	-35.0913	16.3312	0.83015	0.0:0.0:1.0:0.0	.	297	Q9H4F1	SIA7D_HUMAN	T	213;297;213	ENSP00000336733:P297T;ENSP00000340382:P213T	ENSP00000336733:P297T	P	-	1	0	ST6GALNAC4	129710512	1.000000	0.71417	0.999000	0.59377	0.486000	0.33341	6.480000	0.73604	2.532000	0.85374	0.561000	0.74099	CCG	ST6GALNAC4	-	NULL	ENSG00000136840		0.637	ST6GALNAC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST6GALNAC4	HGNC	protein_coding	OTTHUMT00000054317.2	32	0.00	0	G	NM_175040		130670691	130670691	-1	no_errors	ENST00000335791	ensembl	human	known	69_37n	missense	16	27.27	6	SNP	1.000	T
TBL1XR1	79718	genome.wustl.edu	37	3	176769295	176769296	+	Frame_Shift_Ins	INS	-	-	TA	rs564623938		TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr3:176769295_176769296insTA	ENST00000430069.1	-	5	682_683	c.423_424insTA	c.(421-426)atagcafs	p.A142fs	TBL1XR1_ENST00000457928.2_Frame_Shift_Ins_p.A142fs			Q9BZK7	TBL1R_HUMAN	transducin (beta)-like 1 X-linked receptor 1	142					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein N-terminus binding (GO:0047485)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.I141fs*3(1)		breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31	all_cancers(143;1.44e-17)|Ovarian(172;0.00163)|Breast(254;0.214)	Acute lymphoblastic leukemia(1;0.00599)|all_hematologic(1;0.0632)|Prostate(884;0.215)	OV - Ovarian serous cystadenocarcinoma(80;9.83e-31)			AGCTCACTTGCTATAGTATGTG	0.391																																						dbGAP											1	Deletion - Frameshift(1)	breast(1)																																								-	-	-	SO:0001589	frameshift_variant	0			AK022956	CCDS46961.1	3q26.33	2013-01-10	2008-01-17		ENSG00000177565	ENSG00000177565		"""WD repeat domain containing"""	29529	protein-coding gene	gene with protein product		608628	"""transducin (beta)-like 1X-linked receptor 1"""			11063877, 11931768	Standard	NM_024665		Approved	IRA1, FLJ12894, TBLR1, C21, DC42	uc003fix.4	Q9BZK7	OTTHUMG00000157140	ENST00000430069.1:c.422_423dupTA	3.37:g.176769298_176769299dupTA	ENSP00000405574:p.Ala142fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNQ9|Q14DC3|Q9H2I1|Q9H9A1	Frame_Shift_Ins	INS	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A141fs	ENST00000430069.1	37	c.424_423	CCDS46961.1	3																																																																																			TBL1XR1	-	NULL	ENSG00000177565		0.391	TBL1XR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL1XR1	HGNC	protein_coding	OTTHUMT00000347587.3	325	0.00	0	-	NM_024665		176769295	176769296	-1	no_errors	ENST00000430069	ensembl	human	known	69_37n	frame_shift_ins	137	20.81	36	INS	1.000:1.000	TA
TOB1	10140	genome.wustl.edu	37	17	48941080	48941080	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr17:48941080G>T	ENST00000268957.3	-	3	727	c.299C>A	c.(298-300)tCt>tAt	p.S100Y	TOB1_ENST00000499247.2_Missense_Mutation_p.S100Y|TOB1_ENST00000509385.1_5'UTR|TOB1-AS1_ENST00000416263.3_RNA	NM_001243877.1	NP_001230806.1	P50616	TOB1_HUMAN	transducer of ERBB2, 1	100					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060212)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of translation (GO:0017148)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|positive regulation of nuclear-transcribed mRNA poly(A) tail shortening (GO:0060213)|positive regulation of signal transduction (GO:0009967)|SMAD protein import into nucleus (GO:0007184)	CCR4-NOT complex (GO:0030014)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	receptor tyrosine kinase binding (GO:0030971)|SH3/SH2 adaptor activity (GO:0005070)|transcription corepressor activity (GO:0003714)			breast(1)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	13			BRCA - Breast invasive adenocarcinoma(22;1.09e-08)			AATTTGGTAAGAAACCTCAAA	0.408											OREG0024576	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									NSCLC(144;643 1919 24513 29423 40686)	dbGAP											0													152.0	137.0	142.0					17																	48941080		2203	4300	6503	-	-	-	SO:0001583	missense	0			D38305	CCDS11576.1	17q21.33	2012-08-14			ENSG00000141232	ENSG00000141232			11979	protein-coding gene	gene with protein product		605523		TROB1		8632892, 17785442	Standard	NM_005749		Approved	TOB, TROB	uc002isw.3	P50616	OTTHUMG00000162277	ENST00000268957.3:c.299C>A	17.37:g.48941080G>T	ENSP00000268957:p.Ser100Tyr	Somatic	958	WXS	Illumina GAIIx	Phase_IV	B2R9T0|D3DTY3|Q4KMQ0	Missense_Mutation	SNP	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	p.S100Y	ENST00000268957.3	37	c.299	CCDS11576.1	17	.	.	.	.	.	.	.	.	.	.	G	17.33	3.362034	0.61403	.	.	ENSG00000141232	ENST00000499247;ENST00000268957	T;T	0.56776	0.44;0.44	5.69	5.69	0.88448	Anti-proliferative protein (4);	0.000000	0.85682	D	0.000000	T	0.79499	0.4456	M	0.91196	3.185	0.80722	D	1	D	0.76494	0.999	D	0.69824	0.966	D	0.83633	0.0146	10	0.87932	D	0	.	19.8045	0.96525	0.0:0.0:1.0:0.0	.	100	P50616	TOB1_HUMAN	Y	100	ENSP00000427695:S100Y;ENSP00000268957:S100Y	ENSP00000268957:S100Y	S	-	2	0	TOB1	46296079	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.476000	0.97823	2.676000	0.91093	0.655000	0.94253	TCT	TOB1	-	pfam_Anti_prolifrtn,smart_Anti_prolifrtn,prints_Anti_prolifrtn	ENSG00000141232		0.408	TOB1-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	TOB1	HGNC	protein_coding	OTTHUMT00000368364.1	301	0.00	0	G			48941080	48941080	-1	no_errors	ENST00000268957	ensembl	human	known	69_37n	missense	410	12.90	61	SNP	1.000	T
USPL1	10208	genome.wustl.edu	37	13	31205227	31205227	+	Missense_Mutation	SNP	C	C	A	rs113846082		TCGA-BH-A18R-01A-11D-A12B-09	TCGA-BH-A18R-11A-42D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	42facac2-81d9-4a9f-b4f6-1de89a7662fc	fd500edc-7b86-44fc-91b1-9d87683a3e79	g.chr13:31205227C>A	ENST00000255304.4	+	4	826	c.484C>A	c.(484-486)Cca>Aca	p.P162T	USPL1_ENST00000465952.1_3'UTR	NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	162					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TCAACAGAATCCAATTAGGAC	0.408																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													78.0	78.0	78.0					13																	31205227		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.484C>A	13.37:g.31205227C>A	ENSP00000255304:p.Pro162Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.P162T	ENST00000255304.4	37	c.484	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	C	12.38	1.919703	0.33908	.	.	ENSG00000132952	ENST00000255304	T	0.09723	2.95	6.07	2.08	0.27032	.	0.649587	0.16516	N	0.211034	T	0.20577	0.0495	M	0.72118	2.19	0.09310	N	1	D	0.58620	0.983	P	0.54544	0.755	T	0.08269	-1.0730	10	0.87932	D	0	-2.5355	6.0403	0.19730	0.0:0.5733:0.1222:0.3045	.	162	Q5W0Q7	USPL1_HUMAN	T	162	ENSP00000255304:P162T	ENSP00000255304:P162T	P	+	1	0	USPL1	30103227	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	0.286000	0.18902	0.057000	0.16193	0.655000	0.94253	CCA	USPL1	-	NULL	ENSG00000132952		0.408	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	201	0.00	0	C	NM_005800		31205227	31205227	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	79	24.76	26	SNP	0.003	A
