#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA12	26154	genome.wustl.edu	37	2	215815716	215815716	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:215815716C>G	ENST00000272895.7	-	45	6958	c.6739G>C	c.(6739-6741)Ggt>Cgt	p.G2247R	ABCA12_ENST00000389661.4_Missense_Mutation_p.G1929R|AC072062.1_ENST00000607412.1_RNA	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	2247					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		TCAGCTGCACCACTCTCAACT	0.378																																					Ovarian(66;664 1488 5121 34295)	dbGAP											0													224.0	220.0	222.0					2																	215815716		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.6739G>C	2.37:g.215815716C>G	ENSP00000272895:p.Gly2247Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G2247R	ENST00000272895.7	37	c.6739	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	C	18.01	3.527519	0.64860	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.89746	-2.56;-2.53	5.61	5.61	0.85477	.	0.374382	0.25768	N	0.028440	D	0.94364	0.8188	M	0.73319	2.225	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.99;0.999	D	0.94487	0.7698	10	0.87932	D	0	.	19.6562	0.95842	0.0:1.0:0.0:0.0	.	2247;1929	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	R	2247;1929	ENSP00000272895:G2247R;ENSP00000374312:G1929R	ENSP00000272895:G2247R	G	-	1	0	ABCA12	215523961	1.000000	0.71417	0.909000	0.35828	0.181000	0.23173	7.031000	0.76491	2.639000	0.89480	0.555000	0.69702	GGT	ABCA12	-	NULL	ENSG00000144452		0.378	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	910	0.11	1	C	NM_173076		215815716	215815716	-1	no_errors	ENST00000272895	ensembl	human	known	69_37n	missense	597	34.75	319	SNP	1.000	G
ACAP3	116983	genome.wustl.edu	37	1	1229567	1229567	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:1229567C>T	ENST00000354700.5	-	22	2354	c.2152G>A	c.(2152-2154)Gtc>Atc	p.V718I	ACAP3_ENST00000353662.3_Missense_Mutation_p.V643I|ACAP3_ENST00000379037.2_5'Flank	NM_030649.2	NP_085152.2	Q96P50	ACAP3_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 3	718					regulation of ARF GTPase activity (GO:0032312)		ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			endometrium(3)|lung(9)|skin(1)|upper_aerodigestive_tract(1)	14						AACTCACAGACGATCAAGGAG	0.721																																						dbGAP											0													19.0	22.0	21.0					1																	1229567		2173	4266	6439	-	-	-	SO:0001583	missense	0			AF411981	CCDS19.2	1p36	2013-01-10	2008-09-22	2008-09-22	ENSG00000131584	ENSG00000131584		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16754	protein-coding gene	gene with protein product			"""centaurin, beta 5"""	CENTB5			Standard	NM_030649		Approved	KIAA1716	uc001aeb.2	Q96P50	OTTHUMG00000002235	ENST00000354700.5:c.2152G>A	1.37:g.1229567C>T	ENSP00000346733:p.Val718Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF5|Q5TA42|Q5TA43|Q86UT3|Q9BSR9|Q9C0E7	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,prints_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP	p.V643I	ENST00000354700.5	37	c.1927	CCDS19.2	1	.	.	.	.	.	.	.	.	.	.	C	9.853	1.194075	0.22037	.	.	ENSG00000131584	ENST00000354700;ENST00000353662	T;T	0.62498	0.02;0.02	4.71	-0.342	0.12635	Ankyrin repeat-containing domain (4);	0.312020	0.29609	N	0.011666	T	0.43389	0.1245	L	0.31752	0.955	0.25505	N	0.987515	B;B	0.14805	0.011;0.001	B;B	0.12156	0.007;0.003	T	0.25433	-1.0132	10	0.21014	T	0.42	.	9.9862	0.41843	0.0:0.6074:0.0:0.3926	.	718;643	Q96P50;Q96P50-1	ACAP3_HUMAN;.	I	718;643	ENSP00000346733:V718I;ENSP00000321139:V643I	ENSP00000321139:V643I	V	-	1	0	ACAP3	1219430	0.017000	0.18338	0.136000	0.22124	0.001000	0.01503	0.241000	0.18065	0.065000	0.16485	-0.311000	0.09066	GTC	ACAP3	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000131584		0.721	ACAP3-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ACAP3	HGNC	protein_coding	OTTHUMT00000006366.2	33	0.00	0	C	NM_030649		1229567	1229567	-1	no_errors	ENST00000353662	ensembl	human	known	69_37n	missense	15	55.88	19	SNP	0.713	T
ACOX1	51	genome.wustl.edu	37	17	73949695	73949695	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:73949695G>C	ENST00000301608.4	-	7	841	c.781C>G	c.(781-783)Cct>Gct	p.P261A	ACOX1_ENST00000591857.1_5'Flank|ACOX1_ENST00000293217.5_Missense_Mutation_p.P261A|ACOX1_ENST00000537812.1_Missense_Mutation_p.P223A	NM_007292.5	NP_009223.2	Q15067	ACOX1_HUMAN	acyl-CoA oxidase 1, palmitoyl	261					alpha-linolenic acid metabolic process (GO:0036109)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid oxidation (GO:0019395)|generation of precursor metabolites and energy (GO:0006091)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|peroxisome fission (GO:0016559)|positive regulation of cholesterol homeostasis (GO:2000189)|prostaglandin metabolic process (GO:0006693)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid metabolic process (GO:0000038)	membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	acyl-CoA dehydrogenase activity (GO:0003995)|acyl-CoA oxidase activity (GO:0003997)|FAD binding (GO:0071949)|fatty acid binding (GO:0005504)|flavin adenine dinucleotide binding (GO:0050660)|palmitoyl-CoA oxidase activity (GO:0016401)|PDZ domain binding (GO:0030165)|protein N-terminus binding (GO:0047485)|receptor binding (GO:0005102)			large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(1)	14					Flavin adenine dinucleotide(DB03147)	GTGCCATCAGGCTTCACCTGG	0.507																																						dbGAP											0													137.0	108.0	118.0					17																	73949695		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03254	CCDS11734.1, CCDS11735.1	17q25.1	2012-10-04	2010-04-30		ENSG00000161533	ENSG00000161533	1.3.3.6		119	protein-coding gene	gene with protein product		609751	"""acyl-Coenzyme A oxidase 1, palmitoyl"""			8159712	Standard	NM_007292		Approved	PALMCOX	uc002jqe.3	Q15067	OTTHUMG00000180027	ENST00000301608.4:c.781C>G	17.37:g.73949695G>C	ENSP00000301608:p.Pro261Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X8|A8KAA0|B4DK61|F5GYQ8|Q12863|Q15068|Q15101|Q16131|Q7Z3W5|Q9UD31	Missense_Mutation	SNP	pfam_Acyl-CoA_oxidase_C,pfam_Acyl-CoA_Oxase/DH_cen-dom,superfamily_AcylCo_DH/oxidase_C,superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	p.P261A	ENST00000301608.4	37	c.781	CCDS11735.1	17	.	.	.	.	.	.	.	.	.	.	G	17.13	3.312037	0.60414	.	.	ENSG00000161533	ENST00000301608;ENST00000293217;ENST00000537812;ENST00000539791;ENST00000538781	D;D;D	0.90788	-2.73;-2.73;-2.73	6.17	6.17	0.99709	Acyl-CoA dehydrogenase/oxidase (1);Acyl-CoA oxidase/dehydrogenase, central domain (1);	0.047657	0.85682	D	0.000000	D	0.88028	0.6327	L	0.37800	1.135	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.0;0.0	T	0.81097	-0.1087	10	0.49607	T	0.09	-21.2575	20.8794	0.99867	0.0:0.0:1.0:0.0	.	193;223;261;261	F5H0M0;F5GYQ8;Q15067;Q15067-2	.;.;ACOX1_HUMAN;.	A	261;261;223;261;193	ENSP00000301608:P261A;ENSP00000293217:P261A;ENSP00000441257:P223A	ENSP00000293217:P261A	P	-	1	0	ACOX1	71461290	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.590000	0.82653	2.941000	0.99782	0.655000	0.94253	CCT	ACOX1	-	superfamily_AcylCoA_DH/oxidase,pirsf_Acyl-CoA_oxidase	ENSG00000161533		0.507	ACOX1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACOX1	HGNC	protein_coding	OTTHUMT00000439503.1	257	0.00	0	G			73949695	73949695	-1	no_errors	ENST00000293217	ensembl	human	known	69_37n	missense	74	54.27	89	SNP	1.000	C
ACTN4	81	genome.wustl.edu	37	19	39219701	39219701	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:39219701delC	ENST00000252699.2	+	20	2560	c.2484delC	c.(2482-2484)ttcfs	p.F828fs	ACTN4_ENST00000424234.2_Frame_Shift_Del_p.F438fs|ACTN4_ENST00000497637.1_3'UTR|ACTN4_ENST00000390009.3_Frame_Shift_Del_p.F609fs	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	828	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Mediates interaction with MICALL2. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			TTGTGACCTTCCAAGCCTTCA	0.612																																					Colon(168;199 1940 10254 46213 46384)	dbGAP											0													130.0	102.0	112.0					19																	39219701		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.2484delC	19.37:g.39219701delC	ENSP00000252699:p.Phe828fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4K467|D6PXK4|O76048	Frame_Shift_Del	DEL	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.Q829fs	ENST00000252699.2	37	c.2484	CCDS12518.1	19																																																																																			ACTN4	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000130402		0.612	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	96	0.00	0	C			39219701	39219701	+1	no_errors	ENST00000252699	ensembl	human	known	69_37n	frame_shift_del	36	28.85	15	DEL	1.000	-
ADCY2	108	genome.wustl.edu	37	5	7820754	7820754	+	Silent	SNP	C	C	G	rs527806846		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:7820754C>G	ENST00000338316.4	+	24	3164	c.3075C>G	c.(3073-3075)gtC>gtG	p.V1025V	ADCY2_ENST00000537121.1_Silent_p.V845V	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	1025					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						GCAACACTGTCAATGTGGCCA	0.493																																						dbGAP											0													137.0	121.0	126.0					5																	7820754		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.3075C>G	5.37:g.7820754C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Silent	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.V1025	ENST00000338316.4	37	c.3075	CCDS3872.2	5																																																																																			ADCY2	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	ENSG00000078295		0.493	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	346	0.00	0	C	NM_020546		7820754	7820754	+1	no_errors	ENST00000338316	ensembl	human	known	69_37n	silent	374	22.84	111	SNP	0.913	G
ADAMTS19	171019	genome.wustl.edu	37	5	128797410	128797410	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:128797410C>A	ENST00000274487.4	+	2	834	c.689C>A	c.(688-690)cCt>cAt	p.P230H	ADAMTS19-AS1_ENST00000502827.1_RNA	NM_133638.3	NP_598377.3	Q8TE59	ATS19_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 19	230						proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(10)|kidney(9)|large_intestine(14)|lung(34)|ovary(6)|pancreas(1)|prostate(6)|skin(6)	91		all_cancers(142;0.0148)|Prostate(80;0.0494)|Breast(839;0.238)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	OV - Ovarian serous cystadenocarcinoma(64;0.222)		CTGCGGCACCCTGGCTCGCTG	0.662																																						dbGAP											0													53.0	56.0	55.0					5																	128797410		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ311904	CCDS4146.1	5q23.3	2009-04-27	2005-08-19		ENSG00000145808	ENSG00000145808		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17111	protein-coding gene	gene with protein product		607513	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 19"""			11867212	Standard	NM_133638		Approved		uc003kvb.1	Q8TE59	OTTHUMG00000128990	ENST00000274487.4:c.689C>A	5.37:g.128797410C>A	ENSP00000274487:p.Pro230His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_PLAC,pfam_Pept_M10_metallopeptidase,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.P230H	ENST00000274487.4	37	c.689	CCDS4146.1	5	.	.	.	.	.	.	.	.	.	.	C	20.5	4.008365	0.75046	.	.	ENSG00000145808	ENST00000274487	T	0.09630	2.96	3.47	3.47	0.39725	Peptidase M12B, propeptide (1);	0.101666	0.38778	N	0.001578	T	0.33498	0.0865	M	0.80422	2.495	0.47009	D	0.999286	D	0.76494	0.999	D	0.70935	0.971	T	0.25257	-1.0137	9	.	.	.	.	15.8366	0.78801	0.0:1.0:0.0:0.0	.	230	Q8TE59	ATS19_HUMAN	H	230	ENSP00000274487:P230H	.	P	+	2	0	ADAMTS19	128825309	0.992000	0.36948	0.933000	0.37362	0.988000	0.76386	3.364000	0.52328	2.248000	0.74166	0.591000	0.81541	CCT	ADAMTS19	-	pfam_Peptidase_M12B_N	ENSG00000145808		0.662	ADAMTS19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS19	HGNC	protein_coding	OTTHUMT00000250979.2	49	0.00	0	C	NM_133638		128797410	128797410	+1	no_errors	ENST00000274487	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	0.993	A
ADORA1	134	genome.wustl.edu	37	1	203134380	203134380	+	Intron	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:203134380C>T	ENST00000367236.4	+	3	1262				ADORA1_ENST00000337894.4_Intron|ADORA1_ENST00000472535.1_Intron|ADORA1_ENST00000367235.1_3'UTR|ADORA1_ENST00000309502.3_Intron	NM_001048230.1	NP_001041695.1	P30542	AA1R_HUMAN	adenosine A1 receptor						activation of MAPKK activity (GO:0000186)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic signaling pathway (GO:0097190)|cell-cell signaling (GO:0007267)|cognition (GO:0050890)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|inflammatory response (GO:0006954)|lipid catabolic process (GO:0016042)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of blood pressure (GO:0045776)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of cell proliferation (GO:0008285)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of glutamate secretion (GO:0014050)|negative regulation of heart contraction (GO:0045822)|negative regulation of hormone secretion (GO:0046888)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of mucus secretion (GO:0070256)|negative regulation of neurotrophin production (GO:0032900)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of synaptic transmission, GABAergic (GO:0032229)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|negative regulation of vasodilation (GO:0045908)|nervous system development (GO:0007399)|phagocytosis (GO:0006909)|positive regulation of blood pressure (GO:0045777)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of nucleoside transport (GO:0032244)|positive regulation of peptide secretion (GO:0002793)|positive regulation of potassium ion transport (GO:0043268)|positive regulation of protein dephosphorylation (GO:0035307)|protein targeting to membrane (GO:0006612)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of glomerular filtration (GO:0003093)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|relaxation of vascular smooth muscle (GO:0060087)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|temperature homeostasis (GO:0001659)	asymmetric synapse (GO:0032279)|axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	G-protein coupled adenosine receptor activity (GO:0001609)|phospholipase C activity (GO:0004629)|purine nucleoside binding (GO:0001883)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(9)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	25					Adenosine(DB00640)|Aminophylline(DB01223)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Gabapentin(DB00996)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Theobromine(DB01412)|Theophylline(DB00277)	CTGCCCTCCTCTCCCCCAGGT	0.652																																						dbGAP											0													29.0	35.0	33.0					1																	203134380		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC026340	CCDS1434.1	1q32.1	2012-08-08			ENSG00000163485	ENSG00000163485		"""GPCR / Class A : Adenosine receptors"""	262	protein-coding gene	gene with protein product		102775				1662665, 2541503	Standard	NM_001048230		Approved	RDC7	uc001gzf.1	P30542	OTTHUMG00000042125	ENST00000367236.4:c.342-9C>T	1.37:g.203134380C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFY5|A6NGP4|A8K1L3|B3KXQ4|D2CGD0|Q6FHK3|Q8TAM8	RNA	SNP	-	NULL	ENST00000367236.4	37	NULL	CCDS1434.1	1																																																																																			ADORA1	-	-	ENSG00000163485		0.652	ADORA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA1	HGNC	protein_coding	OTTHUMT00000100273.1	115	0.00	0	C	NM_000674		203134380	203134380	+1	no_errors	ENST00000464019	ensembl	human	known	69_37n	rna	68	16.05	13	SNP	0.000	T
AEBP1	165	genome.wustl.edu	37	7	44153560	44153560	+	Silent	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:44153560C>G	ENST00000223357.3	+	21	3482	c.3177C>G	c.(3175-3177)acC>acG	p.T1059T	AEBP1_ENST00000450684.2_Silent_p.T634T	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	1059	Interaction with MAPK1 and MAPK3. {ECO:0000250}.|Required for transcriptional repression. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CCCCTGCCACCACCCTGAGCA	0.677																																						dbGAP											0													44.0	43.0	43.0					7																	44153560		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.3177C>G	7.37:g.44153560C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Silent	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.T1059	ENST00000223357.3	37	c.3177	CCDS5476.1	7																																																																																			AEBP1	-	NULL	ENSG00000106624		0.677	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	206	0.00	0	C	NM_001129		44153560	44153560	+1	no_errors	ENST00000223357	ensembl	human	known	69_37n	silent	194	21.37	53	SNP	0.000	G
AKAP9	10142	genome.wustl.edu	37	7	91718833	91718833	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:91718833A>C	ENST00000359028.2	+	38	9585	c.9360A>C	c.(9358-9360)aaA>aaC	p.K3120N	AKAP9_ENST00000356239.3_Missense_Mutation_p.K3116N|AKAP9_ENST00000358100.2_Missense_Mutation_p.K3066N			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	3120					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)			NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGAGTGAGAAACCAAGCCAAG	0.333			T	BRAF	papillary thyroid																																	dbGAP		Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	0													75.0	71.0	72.0					7																	91718833		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.9360A>C	7.37:g.91718833A>C	ENSP00000351922:p.Lys3120Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	Missense_Mutation	SNP	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.K3120N	ENST00000359028.2	37	c.9360		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.719|9.719	1.159260|1.159260	0.21454|0.21454	.|.	.|.	ENSG00000127914|ENSG00000127914	ENST00000356239;ENST00000359028;ENST00000358100;ENST00000413120;ENST00000394534|ENST00000435423	T;T;T;T|.	0.03524|.	3.99;3.99;3.99;3.9|.	4.58|4.58	2.26|2.26	0.28386|0.28386	.|.	0.179614|.	0.27080|.	N|.	0.021036|.	T|T	0.32763|0.32763	0.0840|0.0840	L|L	0.36672|0.36672	1.1|1.1	0.22199|0.22199	N|N	0.9993|0.9993	B;B;B;B;B|.	0.29037|.	0.231;0.144;0.089;0.144;0.144|.	B;B;B;B;B|.	0.30782|.	0.12;0.055;0.025;0.055;0.055|.	T|T	0.20405|0.20405	-1.0276|-1.0276	10|5	0.40728|.	T|.	0.16|.	.|.	5.5471|5.5471	0.17069|0.17069	0.6873:0.1477:0.165:0.0|0.6873:0.1477:0.165:0.0	.|.	3120;3120;3120;3116;3108|.	F5H3X5;Q99996-6;Q99996;Q99996-2;Q99996-3|.	.;.;AKAP9_HUMAN;.;.|.	N|T	3116;3120;3066;3120;962|261	ENSP00000348573:K3116N;ENSP00000351922:K3120N;ENSP00000350813:K3066N;ENSP00000378042:K962N|.	ENSP00000348573:K3116N|.	K|N	+|+	3|2	2|0	AKAP9|AKAP9	91556769|91556769	0.899000|0.899000	0.30636|0.30636	0.916000|0.916000	0.36221|0.36221	0.914000|0.914000	0.54420|0.54420	0.788000|0.788000	0.26872|0.26872	0.905000|0.905000	0.36596|0.36596	0.482000|0.482000	0.46254|0.46254	AAA|AAC	AKAP9	-	NULL	ENSG00000127914		0.333	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		338	0.29	1	A	NM_005751		91718833	91718833	+1	no_errors	ENST00000359028	ensembl	human	known	69_37n	missense	349	31.64	162	SNP	0.719	C
ALCAM	214	genome.wustl.edu	37	3	105260577	105260577	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:105260577G>C	ENST00000306107.5	+	8	1459	c.959G>C	c.(958-960)aGc>aCc	p.S320T	ALCAM_ENST00000389927.4_Intron|ALCAM_ENST00000486979.2_Missense_Mutation_p.S269T|ALCAM_ENST00000481337.1_3'UTR|ALCAM_ENST00000472644.2_Missense_Mutation_p.S320T	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	320	Ig-like C2-type 1.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GACAAAAAAAGCATGATTGCT	0.428																																						dbGAP											0													155.0	127.0	136.0					3																	105260577		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.959G>C	3.37:g.105260577G>C	ENSP00000305988:p.Ser320Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.S320T	ENST00000306107.5	37	c.959	CCDS33810.1	3	.	.	.	.	.	.	.	.	.	.	G	2.839	-0.240843	0.05944	.	.	ENSG00000170017	ENST00000306107;ENST00000472644;ENST00000486979	T;T;T	0.11385	2.78;2.78;2.78	6.17	2.4	0.29515	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.463544	0.30547	N	0.009393	T	0.03651	0.0104	N	0.03029	-0.43	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.09377	0.004;0.004	T	0.45396	-0.9264	10	0.20519	T	0.43	-5.5596	5.8367	0.18611	0.2728:0.1281:0.5991:0.0	.	320;320	B4DTU0;Q13740	.;CD166_HUMAN	T	320;320;269	ENSP00000305988:S320T;ENSP00000419236:S320T;ENSP00000418213:S269T	ENSP00000305988:S320T	S	+	2	0	ALCAM	106743267	0.998000	0.40836	0.953000	0.39169	0.999000	0.98932	1.055000	0.30467	0.169000	0.19679	0.655000	0.94253	AGC	ALCAM	-	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000170017		0.428	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALCAM	HGNC	protein_coding	OTTHUMT00000353764.1	285	0.00	0	G	NM_001627		105260577	105260577	+1	no_errors	ENST00000306107	ensembl	human	known	69_37n	missense	118	59.73	175	SNP	0.998	C
ALPK3	57538	genome.wustl.edu	37	15	85405916	85405916	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:85405916G>T	ENST00000258888.5	+	10	4953	c.4786G>T	c.(4786-4788)Gac>Tac	p.D1596Y		NM_020778.4	NP_065829.3	Q96L96	ALPK3_HUMAN	alpha-kinase 3	1596	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.				heart development (GO:0007507)	nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(3)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(4)|large_intestine(9)|lung(27)|ovary(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	81			BRCA - Breast invasive adenocarcinoma(143;0.0587)			GGGTCTGGCTGACTCTGGCTG	0.582																																						dbGAP											0													61.0	61.0	61.0					15																	85405916		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY044449	CCDS10333.1	15q25.2	2013-01-29			ENSG00000136383	ENSG00000136383		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17574	protein-coding gene	gene with protein product	"""myocyte induction differentiation originator"", ""muscle alpha-kinase"""					10021370	Standard	NM_020778		Approved	MAK, KIAA1330, Midori	uc002ble.3	Q96L96	OTTHUMG00000148667	ENST00000258888.5:c.4786G>T	15.37:g.85405916G>T	ENSP00000258888:p.Asp1596Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2L6	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.D1596Y	ENST00000258888.5	37	c.4786	CCDS10333.1	15	.	.	.	.	.	.	.	.	.	.	G	23.9	4.468804	0.84533	.	.	ENSG00000136383	ENST00000258888	T	0.06528	3.29	4.97	4.97	0.65823	MHCK/EF2 kinase (1);Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.21103	0.0508	L	0.55481	1.735	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.00097	-1.2071	10	0.72032	D	0.01	-30.0019	15.7728	0.78184	0.0:0.0:1.0:0.0	.	1596	Q96L96	ALPK3_HUMAN	Y	1596	ENSP00000258888:D1596Y	ENSP00000258888:D1596Y	D	+	1	0	ALPK3	83206920	1.000000	0.71417	0.998000	0.56505	0.997000	0.91878	9.074000	0.93998	2.578000	0.87016	0.655000	0.94253	GAC	ALPK3	-	superfamily_Kinase-like_dom,pfscan_MHCK_EF2_kinase	ENSG00000136383		0.582	ALPK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK3	HGNC	protein_coding	OTTHUMT00000308997.1	173	0.57	1	G	NM_020778		85405916	85405916	+1	no_errors	ENST00000258888	ensembl	human	known	69_37n	missense	146	28.64	59	SNP	1.000	T
ANKRD30A	91074	genome.wustl.edu	37	10	37508523	37508523	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:37508523A>G	ENST00000602533.1	+	34	3814	c.3715A>G	c.(3715-3717)Atg>Gtg	p.M1239V	ANKRD30A_ENST00000374660.1_Missense_Mutation_p.M1358V|ANKRD30A_ENST00000361713.1_Missense_Mutation_p.M1239V			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1295					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.M1239V(1)		NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						ACAGTGTCAAATGAAGGAAGC	0.358																																						dbGAP											1	Substitution - Missense(1)	lung(1)											73.0	63.0	66.0					10																	37508523		1923	4125	6048	-	-	-	SO:0001583	missense	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3715A>G	10.37:g.37508523A>G	ENSP00000473551:p.Met1239Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M1239V	ENST00000602533.1	37	c.3715		10	.	.	.	.	.	.	.	.	.	.	a	0.017	-1.498893	0.01001	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.13420	2.59;2.59	2.95	-3.64	0.04515	.	.	.	.	.	T	0.09423	0.0232	L	0.46157	1.445	0.09310	N	1	B	0.22983	0.078	B	0.13407	0.009	T	0.33752	-0.9856	9	0.36615	T	0.2	.	3.6291	0.08124	0.396:0.0:0.1224:0.4815	.	1295	Q9BXX3	AN30A_HUMAN	V	1239;1358	ENSP00000354432:M1239V;ENSP00000363792:M1358V	ENSP00000354432:M1239V	M	+	1	0	ANKRD30A	37548529	0.970000	0.33590	0.000000	0.03702	0.001000	0.01503	0.341000	0.19909	-0.667000	0.05303	-0.837000	0.03062	ATG	ANKRD30A	-	NULL	ENSG00000148513		0.358	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	269	0.00	0	A	NM_052997		37508523	37508523	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	missense	209	30.10	90	SNP	0.001	G
APLP1	333	genome.wustl.edu	37	19	36370329	36370329	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:36370329G>C	ENST00000221891.4	+	17	2134	c.1942G>C	c.(1942-1944)Gag>Cag	p.E648Q	RN7SL402P_ENST00000465059.1_RNA|APLP1_ENST00000586861.1_Missense_Mutation_p.E641Q|APLP1_ENST00000537454.2_Missense_Mutation_p.E608Q	NM_001024807.1|NM_005166.3	NP_001019978.1|NP_005157.1	P51693	APLP1_HUMAN	amyloid beta (A4) precursor-like protein 1	647	Interaction with DAB1. {ECO:0000250}.|Interaction with DAB2. {ECO:0000250}.				adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular response to norepinephrine stimulus (GO:0071874)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|mRNA polyadenylation (GO:0006378)|negative regulation of cAMP biosynthetic process (GO:0030818)|nervous system development (GO:0007399)|organ morphogenesis (GO:0009887)|regulation of translation (GO:0006417)	basement membrane (GO:0005604)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	alpha-2A adrenergic receptor binding (GO:0031694)|alpha-2B adrenergic receptor binding (GO:0031695)|alpha-2C adrenergic receptor binding (GO:0031696)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|transition metal ion binding (GO:0046914)			breast(4)|endometrium(2)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	33	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCGCTTCCTGGAGGAACGACC	0.667																																						dbGAP											0													74.0	75.0	75.0					19																	36370329		2203	4300	6503	-	-	-	SO:0001583	missense	0			U48437	CCDS32997.1	19q	2008-07-15							597	protein-coding gene	gene with protein product	"""amyloid-like protein 1"", ""amyloid precursor-like protein 1"""	104775				8432545	Standard	NM_001024807		Approved	APLP	uc002ocf.3	P51693		ENST00000221891.4:c.1942G>C	19.37:g.36370329G>C	ENSP00000221891:p.Glu648Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O00113|Q96A92	Missense_Mutation	SNP	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,smart_Amyloid_glyco_extra,prints_Amyloid_glyco	p.E648Q	ENST00000221891.4	37	c.1942	CCDS32997.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.140419	0.94560	.	.	ENSG00000105290	ENST00000537454;ENST00000221891	D;D	0.97731	-4.51;-4.51	5.89	5.89	0.94794	Beta-amyloid precursor protein C-terminal (1);	0.125034	0.36338	N	0.002649	D	0.98582	0.9526	M	0.79258	2.445	0.58432	D	0.999998	D;D;D;D	0.89917	0.998;1.0;1.0;1.0	D;D;D;D	0.97110	0.963;1.0;0.999;0.999	D	0.99274	1.0894	10	0.87932	D	0	-23.1168	15.7619	0.78091	0.0:0.0:1.0:0.0	.	641;608;648;647	B7Z4G8;F5GZ08;P51693-2;P51693	.;.;.;APLP1_HUMAN	Q	608;648	ENSP00000441501:E608Q;ENSP00000221891:E648Q	ENSP00000221891:E648Q	E	+	1	0	APLP1	41062169	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.917000	0.87498	2.793000	0.96121	0.655000	0.94253	GAG	APLP1	-	pfam_APP_amyloid_C,prints_Amyloid_glyco	ENSG00000105290		0.667	APLP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	APLP1	HGNC	protein_coding	OTTHUMT00000452564.1	114	0.00	0	G	NM_001024807		36370329	36370329	+1	no_errors	ENST00000221891	ensembl	human	known	69_37n	missense	74	33.93	38	SNP	1.000	C
APOB	338	genome.wustl.edu	37	2	21233256	21233256	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:21233256C>A	ENST00000233242.1	-	26	6611	c.6484G>T	c.(6484-6486)Gat>Tat	p.D2162Y		NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	2162	Heparin-binding.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					ATTTTGGCATCATCTAATGCA	0.294																																						dbGAP											0													58.0	57.0	57.0					2																	21233256		2203	4300	6503	-	-	-	SO:0001583	missense	0			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.6484G>T	2.37:g.21233256C>A	ENSP00000233242:p.Asp2162Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Missense_Mutation	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.D2162Y	ENST00000233242.1	37	c.6484	CCDS1703.1	2	.	.	.	.	.	.	.	.	.	.	C	12.33	1.905961	0.33628	.	.	ENSG00000084674	ENST00000233242;ENST00000535079	T	0.00711	5.8	5.65	1.97	0.26223	.	0.571782	0.17732	N	0.163869	T	0.00552	0.0018	N	0.22421	0.69	0.58432	D	0.999998	P	0.42337	0.776	B	0.32289	0.143	T	0.76323	-0.3001	10	0.72032	D	0.01	.	5.2297	0.15414	0.0:0.227:0.1376:0.6354	.	2162	P04114	APOB_HUMAN	Y	2162	ENSP00000233242:D2162Y	ENSP00000233242:D2162Y	D	-	1	0	APOB	21086761	0.980000	0.34600	0.973000	0.42090	0.930000	0.56654	1.168000	0.31859	0.085000	0.17107	-0.367000	0.07326	GAT	APOB	-	NULL	ENSG00000084674		0.294	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	297	0.34	1	C			21233256	21233256	-1	no_errors	ENST00000233242	ensembl	human	known	69_37n	missense	312	34.04	161	SNP	0.883	A
ARHGAP11A	9824	genome.wustl.edu	37	15	32929259	32929259	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:32929259C>G	ENST00000361627.3	+	12	3007	c.2285C>G	c.(2284-2286)tCt>tGt	p.S762C	ARHGAP11A_ENST00000565905.1_Missense_Mutation_p.S573C|ARHGAP11A_ENST00000543522.1_Missense_Mutation_p.S573C	NM_014783.3	NP_055598.1	Q6P4F7	RHGBA_HUMAN	Rho GTPase activating protein 11A	762					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			breast(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	31		all_lung(180;1.3e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)		GCTAGATCCTCTTTCTCACAG	0.378																																					Colon(45;757 1134 30003 36652)	dbGAP											0													88.0	82.0	84.0					15																	32929259		2201	4300	6501	-	-	-	SO:0001583	missense	0			D87717	CCDS10028.1, CCDS58349.1, CCDS66730.1	15q13.3	2006-09-19			ENSG00000198826	ENSG00000198826		"""Rho GTPase activating proteins"""	15783	protein-coding gene	gene with protein product	"""GAP (1-12)"""	610589				11829490	Standard	NM_199357		Approved	KIAA0013	uc001zgy.1	Q6P4F7	OTTHUMG00000129289	ENST00000361627.3:c.2285C>G	15.37:g.32929259C>G	ENSP00000355090:p.Ser762Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZN9|Q6PI96|Q9Y3S6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S762C	ENST00000361627.3	37	c.2285	CCDS10028.1	15	.	.	.	.	.	.	.	.	.	.	.	0.539	-0.854574	0.02630	.	.	ENSG00000198826	ENST00000361627;ENST00000543522	T	0.12147	2.71	4.21	2.29	0.28610	.	0.541778	0.16778	N	0.199934	T	0.09379	0.0231	L	0.29908	0.895	0.09310	N	1	B	0.15141	0.012	B	0.14578	0.011	T	0.25117	-1.0141	10	0.54805	T	0.06	.	5.7843	0.18324	0.0:0.6638:0.1606:0.1757	.	762	Q6P4F7	RHGBA_HUMAN	C	762;573	ENSP00000355090:S762C	ENSP00000355090:S762C	S	+	2	0	ARHGAP11A	30716551	0.000000	0.05858	0.049000	0.19019	0.019000	0.09904	0.110000	0.15437	0.527000	0.28560	-0.145000	0.13849	TCT	ARHGAP11A	-	NULL	ENSG00000198826		0.378	ARHGAP11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP11A	HGNC	protein_coding	OTTHUMT00000251417.1	103	0.00	0	C	NM_014783		32929259	32929259	+1	no_errors	ENST00000361627	ensembl	human	known	69_37n	missense	93	31.11	42	SNP	0.006	G
ARHGEF1	9138	genome.wustl.edu	37	19	42410647	42410647	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:42410647G>T	ENST00000354532.3	+	27	2678	c.2530G>T	c.(2530-2532)Gac>Tac	p.D844Y	ARHGEF1_ENST00000337665.4_Missense_Mutation_p.D859Y|ARHGEF1_ENST00000599846.1_Missense_Mutation_p.D900Y|CTD-2575K13.6_ENST00000597630.1_RNA|ARHGEF1_ENST00000347545.4_Missense_Mutation_p.D811Y|ARHGEF1_ENST00000378152.4_Intron	NM_004706.3	NP_004697.2	Q92888	ARHG1_HUMAN	Rho guanine nucleotide exchange factor (GEF) 1	844					cell proliferation (GO:0008283)|negative regulation of axonogenesis (GO:0050771)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of axonogenesis (GO:0050770)|Rho protein signal transduction (GO:0007266)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|poly(A) RNA binding (GO:0044822)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|large_intestine(6)|lung(9)|ovary(3)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	37		Renal(1328;0.000518)|Hepatocellular(1079;0.0046)|Medulloblastoma(540;0.0425)		Epithelial(262;5.89e-46)|GBM - Glioblastoma multiforme(1328;2.49e-12)|STAD - Stomach adenocarcinoma(1328;0.00644)		GGCGGAGGAAGACAATGGGGC	0.667																																						dbGAP											0													28.0	33.0	31.0					19																	42410647		2200	4296	6496	-	-	-	SO:0001583	missense	0			U64105	CCDS12590.1, CCDS12591.1, CCDS12592.1	19q13.13	2014-06-19			ENSG00000076928	ENSG00000076928		"""Rho guanine nucleotide exchange factors"""	681	protein-coding gene	gene with protein product		601855				8810315, 9135076	Standard	NM_004706		Approved	P115-RHOGEF, SUB1.5, LBCL2	uc002osa.3	Q92888	OTTHUMG00000182679	ENST00000354532.3:c.2530G>T	19.37:g.42410647G>T	ENSP00000346532:p.Asp844Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00513|Q8N4J4|Q96BF4|Q96F17|Q9BSB1	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D859Y	ENST00000354532.3	37	c.2575	CCDS12591.1	19	.	.	.	.	.	.	.	.	.	.	G	16.96	3.265925	0.59540	.	.	ENSG00000076928	ENST00000354532;ENST00000347545;ENST00000337665	T;T;T	0.70164	-0.45;-0.4;-0.46	3.69	3.69	0.42338	.	.	.	.	.	T	0.70298	0.3208	N	0.24115	0.695	0.32307	N	0.564239	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.73380	0.98;0.98;0.956	T	0.75958	-0.3134	9	0.72032	D	0.01	.	13.7583	0.62950	0.0:0.0:1.0:0.0	.	859;811;844	Q92888-3;Q92888-2;Q92888	.;.;ARHG1_HUMAN	Y	844;811;859	ENSP00000346532:D844Y;ENSP00000344429:D811Y;ENSP00000337261:D859Y	ENSP00000337261:D859Y	D	+	1	0	ARHGEF1	47102487	1.000000	0.71417	0.999000	0.59377	0.521000	0.34408	3.897000	0.56273	1.997000	0.58415	0.485000	0.47835	GAC	ARHGEF1	-	NULL	ENSG00000076928		0.667	ARHGEF1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF1	HGNC	protein_coding	OTTHUMT00000463360.1	68	0.00	0	G	NM_199002		42410647	42410647	+1	no_errors	ENST00000337665	ensembl	human	known	69_37n	missense	35	33.96	18	SNP	1.000	T
ARID3B	10620	genome.wustl.edu	37	15	74836815	74836815	+	Missense_Mutation	SNP	G	G	A	rs554192034		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:74836815G>A	ENST00000346246.5	+	2	769	c.538G>A	c.(538-540)Gag>Aag	p.E180K		NM_006465.2	NP_006456.1	Q8IVW6	ARI3B_HUMAN	AT rich interactive domain 3B (BRIGHT-like)	180						nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)			NS(1)|breast(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(2)	14						GAATCTGGATGAGCAGCTCAA	0.532																																						dbGAP											0													64.0	52.0	56.0					15																	74836815		2197	4296	6493	-	-	-	SO:0001583	missense	0				CCDS10264.1	15q24	2013-02-07	2006-11-08		ENSG00000179361	ENSG00000179361		"""-"""	14350	protein-coding gene	gene with protein product		612457	"""AT rich interactive domain 3B (BRIGHT- like)"""				Standard	NM_006465		Approved	BDP, DRIL2	uc002ayd.3	Q8IVW6	OTTHUMG00000141321	ENST00000346246.5:c.538G>A	15.37:g.74836815G>A	ENSP00000343126:p.Glu180Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95443|Q59HC9|Q6P9C9	Missense_Mutation	SNP	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E180K	ENST00000346246.5	37	c.538	CCDS10264.1	15	.	.	.	.	.	.	.	.	.	.	G	28.9	4.960913	0.92791	.	.	ENSG00000179361	ENST00000382537;ENST00000346246;ENST00000395077	T	0.50548	0.74	5.5	5.5	0.81552	.	0.255490	0.39759	N	0.001276	T	0.47135	0.1429	L	0.29908	0.895	0.80722	D	1	D;D;D	0.56521	0.976;0.975;0.976	P;P;P	0.53861	0.696;0.736;0.696	T	0.22521	-1.0214	10	0.08381	T	0.77	-13.7017	17.6041	0.88033	0.0:0.0:1.0:0.0	.	180;180;180	Q8IVW6;Q8IVW6-4;B4DQB0	ARI3B_HUMAN;.;.	K	180	ENSP00000343126:E180K	ENSP00000343126:E180K	E	+	1	0	ARID3B	72623868	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.619000	0.67729	2.583000	0.87209	0.650000	0.86243	GAG	ARID3B	-	NULL	ENSG00000179361		0.532	ARID3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID3B	HGNC	protein_coding	OTTHUMT00000280688.2	71	0.00	0	G	NM_006465		74836815	74836815	+1	no_errors	ENST00000346246	ensembl	human	known	69_37n	missense	47	41.25	33	SNP	1.000	A
ARID5B	84159	genome.wustl.edu	37	10	63661995	63661998	+	Frame_Shift_Del	DEL	AAGA	AAGA	-	rs180942152	byFrequency	TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	AAGA	AAGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:63661995_63661998delAAGA	ENST00000279873.7	+	2	509_512	c.99_102delAAGA	c.(97-102)ccaagafs	p.PR33fs		NM_032199.2	NP_115575.1	Q14865	ARI5B_HUMAN	AT rich interactive domain 5B (MRF1-like)	33					adipose tissue development (GO:0060612)|adrenal gland development (GO:0030325)|cell development (GO:0048468)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|fat pad development (GO:0060613)|female gonad development (GO:0008585)|fibroblast migration (GO:0010761)|kidney development (GO:0001822)|liver development (GO:0001889)|male gonad development (GO:0008584)|multicellular organism growth (GO:0035264)|muscle organ morphogenesis (GO:0048644)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|post-embryonic development (GO:0009791)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(2)|endometrium(13)|kidney(3)|large_intestine(7)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	44	Prostate(12;0.016)|all_hematologic(501;0.215)					AAGGCAAACCAAGAATTTTGTCCC	0.51																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			M73837	CCDS31208.1, CCDS58082.1	10q11.22	2013-02-07			ENSG00000150347	ENSG00000150347		"""-"""	17362	protein-coding gene	gene with protein product		608538				11483573, 11478881	Standard	NM_032199		Approved	FLJ21150, MRF2	uc001jlt.2	Q14865	OTTHUMG00000018298	ENST00000279873.7:c.99_102delAAGA	10.37:g.63661995_63661998delAAGA	ENSP00000279873:p.Pro33fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLB3|Q05DG6|Q32Q59|Q5VST4|Q6NZ42|Q7Z3M4|Q8N421|Q9H786	Frame_Shift_Del	DEL	pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.R34fs	ENST00000279873.7	37	c.99_102	CCDS31208.1	10																																																																																			ARID5B	-	NULL	ENSG00000150347		0.510	ARID5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID5B	HGNC	protein_coding	OTTHUMT00000048233.1	249	0.40	1	AAGA	XM_084482		63661995	63661998	+1	no_errors	ENST00000279873	ensembl	human	known	69_37n	frame_shift_del	160	35.34	88	DEL	1.000:1.000:1.000:1.000	-
ATP2B2	491	genome.wustl.edu	37	3	10430045	10430045	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:10430045C>T	ENST00000352432.4	-	5	892	c.823G>A	c.(823-825)Gct>Act	p.A275T	ATP2B2_ENST00000397077.1_Missense_Mutation_p.A275T|ATP2B2_ENST00000383800.4_Missense_Mutation_p.A275T|ATP2B2_ENST00000360273.2_Missense_Mutation_p.A275T|ATP2B2_ENST00000343816.4_Missense_Mutation_p.A275T			Q01814	AT2B2_HUMAN	ATPase, Ca++ transporting, plasma membrane 2	275					auditory receptor cell stereocilium organization (GO:0060088)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cerebellar granule cell differentiation (GO:0021707)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|cochlea development (GO:0090102)|cytosolic calcium ion homeostasis (GO:0051480)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|locomotion (GO:0040011)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|organelle organization (GO:0006996)|otolith mineralization (GO:0045299)|positive regulation of calcium ion transport (GO:0051928)|regulation of cell size (GO:0008361)|regulation of synaptic plasticity (GO:0048167)|sensory perception of sound (GO:0007605)|serotonin metabolic process (GO:0042428)|synapse organization (GO:0050808)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|cilium (GO:0005929)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calcium-dependent ATPase activity (GO:0030899)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|PDZ domain binding (GO:0030165)|protein C-terminus binding (GO:0008022)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(7)|large_intestine(19)|lung(29)|ovary(5)|prostate(2)|skin(4)|stomach(2)|urinary_tract(2)	74						ACACCCACAGCAGTCACCAAC	0.527																																					Ovarian(125;1619 1709 15675 19819 38835)	dbGAP											0													242.0	211.0	222.0					3																	10430045		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63575	CCDS2601.1, CCDS33701.1	3p25.3	2010-04-20	2001-12-04		ENSG00000157087	ENSG00000157087	3.6.3.8	"""ATPases / P-type"""	815	protein-coding gene	gene with protein product	"""plasma membrane Ca2+ pump 2"", ""plasma membrane calcium-transporting ATPase 2"""	108733				1313367	Standard	NM_001001331		Approved	PMCA2	uc003bvt.3	Q01814	OTTHUMG00000128679	ENST00000352432.4:c.823G>A	3.37:g.10430045C>T	ENSP00000324172:p.Ala275Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O00766|Q12994|Q16818	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.A275T	ENST00000352432.4	37	c.823	CCDS33701.1	3	.	.	.	.	.	.	.	.	.	.	C	36	5.728554	0.96856	.	.	ENSG00000157087	ENST00000352432;ENST00000383800;ENST00000397077;ENST00000360273;ENST00000343816;ENST00000535386;ENST00000452124;ENST00000342354	D;D;D;D;D;D	0.91792	-2.91;-2.91;-2.91;-2.91;-2.91;-2.91	5.65	5.65	0.86999	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.050186	0.85682	D	0.000000	D	0.96642	0.8904	M	0.84773	2.715	0.80722	D	1	D;D;D;D	0.89917	0.999;0.998;0.999;1.0	D;D;D;D	0.87578	0.998;0.991;0.98;0.991	D	0.96817	0.9601	10	0.87932	D	0	-18.4929	19.7221	0.96147	0.0:1.0:0.0:0.0	.	275;241;287;275	Q01814-7;F5H7F7;Q4LE63;Q01814	.;.;.;AT2B2_HUMAN	T	275;275;275;275;275;241;162;275	ENSP00000324172:A275T;ENSP00000373311:A275T;ENSP00000380267:A275T;ENSP00000353414:A275T;ENSP00000344677:A275T;ENSP00000414854:A162T	ENSP00000342954:A275T	A	-	1	0	ATP2B2	10405045	1.000000	0.71417	0.342000	0.25602	0.990000	0.78478	7.779000	0.85648	2.679000	0.91253	0.655000	0.94253	GCT	ATP2B2	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000157087		0.527	ATP2B2-001	KNOWN	basic|CCDS	protein_coding	ATP2B2	HGNC	protein_coding	OTTHUMT00000250576.2	482	0.00	0	C	NM_001683		10430045	10430045	-1	no_errors	ENST00000352432	ensembl	human	known	69_37n	missense	120	70.15	282	SNP	1.000	T
ATP2C2	9914	genome.wustl.edu	37	16	84473108	84473108	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:84473108C>T	ENST00000262429.4	+	13	1276	c.1187C>T	c.(1186-1188)aCg>aTg	p.T396M	ATP2C2_ENST00000416219.2_Missense_Mutation_p.T396M|ATP2C2_ENST00000420010.2_3'UTR	NM_014861.2	NP_055676.2	O75185	AT2C2_HUMAN	ATPase, Ca++ transporting, type 2C, member 2	396					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(3)|skin(5)|urinary_tract(1)	33						CAGCTTGTAACGTCAGATGGG	0.488																																						dbGAP											0													204.0	210.0	208.0					16																	84473108		2123	4244	6367	-	-	-	SO:0001583	missense	0			AK091051	CCDS42207.1, CCDS67088.1	16q24.1	2010-04-20			ENSG00000064270	ENSG00000064270	3.6.3.8	"""ATPases / P-type"""	29103	protein-coding gene	gene with protein product	"""secretory pathway calcium ATPase 2"""	613082				9734811	Standard	XM_006721355		Approved	KIAA0703, SPCA2	uc002fhx.3	O75185		ENST00000262429.4:c.1187C>T	16.37:g.84473108C>T	ENSP00000262429:p.Thr396Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU76|E7ES94|Q5HYC3|Q5S053|Q68CQ2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,prints_ATPase_P-typ_H-transp,prints_ATPase_P-typ_cation-exchng_asu,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_ATPase_P-typ_ion-transptr	p.T396M	ENST00000262429.4	37	c.1187	CCDS42207.1	16	.	.	.	.	.	.	.	.	.	.	C	14.77	2.633845	0.47049	.	.	ENSG00000064270	ENST00000416219;ENST00000262429;ENST00000420010	T;T	0.71341	-0.56;-0.56	4.91	4.91	0.64330	ATPase, cation-transporting, domain N (1);Haloacid dehalogenase-like hydrolase (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.081401	0.51477	D	0.000100	D	0.84424	0.5469	M	0.79693	2.465	0.54753	D	0.999989	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	D;D;D;D	0.71414	0.967;0.939;0.944;0.973	D	0.86970	0.2097	10	0.72032	D	0.01	.	17.0508	0.86518	0.0:1.0:0.0:0.0	.	396;245;413;396	E7ES94;F8WAA5;O75185-2;O75185	.;.;.;AT2C2_HUMAN	M	396;396;245	ENSP00000397925:T396M;ENSP00000262429:T396M	ENSP00000262429:T396M	T	+	2	0	ATP2C2	83030609	1.000000	0.71417	0.027000	0.17364	0.013000	0.08279	7.029000	0.76477	2.255000	0.74692	0.561000	0.74099	ACG	ATP2C2	-	pfam_Dehalogen-like_hydro,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Ca-transp_PMR1,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000064270		0.488	ATP2C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2C2	HGNC	protein_coding	OTTHUMT00000433404.1	383	0.00	0	C	NM_014861		84473108	84473108	+1	no_errors	ENST00000262429	ensembl	human	known	69_37n	missense	266	32.23	127	SNP	0.947	T
B3GALNT1	8706	genome.wustl.edu	37	3	160804030	160804030	+	Silent	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:160804030G>T	ENST00000392781.2	-	8	1260	c.513C>A	c.(511-513)ccC>ccA	p.P171P	B3GALNT1_ENST00000320474.4_Silent_p.P171P|B3GALNT1_ENST00000392780.1_Silent_p.P171P|B3GALNT1_ENST00000417187.1_Intron|B3GALNT1_ENST00000392779.2_Silent_p.P171P|B3GALNT1_ENST00000473285.1_Silent_p.P171P|B3GALNT1_ENST00000488170.1_Silent_p.P171P	NM_001038628.1	NP_001033717.1	O75752	B3GL1_HUMAN	beta-1,3-N-acetylgalactosaminyltransferase 1 (globoside blood group)	171					oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	galactosylgalactosylglucosylceramide beta-D-acetylgalactosaminyltransferase activity (GO:0047273)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13			LUSC - Lung squamous cell carcinoma(72;4.41e-05)|Lung(72;4.61e-05)			ACTTGGCATTGGGGCAAAACT	0.358																																						dbGAP											0													59.0	58.0	58.0					3																	160804030		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y15062	CCDS3193.1	3q25	2014-07-18	2006-06-14	2006-05-09	ENSG00000169255	ENSG00000169255	2.4.1.79	"""Blood group antigens"", ""Beta 3-glycosyltransferases"""	918	protein-coding gene	gene with protein product	"""globoside synthase"", ""P antigen synthase"""	603094	"""UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 3 (Globoside blood group)"", ""UDP-GalNAc:betaGlcNAc beta 1,3-galactosaminyltransferase, polypeptide 1 (Globoside blood group)"""	B3GALT3		9582303, 10993897	Standard	XM_005247861		Approved	beta3Gal-T3, galT3, P1, GLOB	uc003fdv.3	O75752	OTTHUMG00000159064	ENST00000392781.2:c.513C>A	3.37:g.160804030G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNM4|Q3Y531|Q6IAI5|Q8NFM8|Q8NFM9|Q9HA06	Silent	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.P171	ENST00000392781.2	37	c.513	CCDS3193.1	3																																																																																			B3GALNT1	-	pfam_Glyco_trans_31,pfam_Fringe-like	ENSG00000169255		0.358	B3GALNT1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	B3GALNT1	HGNC	protein_coding	OTTHUMT00000353125.1	147	0.00	0	G	NM_033167		160804030	160804030	-1	no_errors	ENST00000320474	ensembl	human	known	69_37n	silent	184	30.57	81	SNP	0.168	T
BAI1	575	genome.wustl.edu	37	8	143618431	143618431	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:143618431C>A	ENST00000517894.1	+	26	4548	c.3654C>A	c.(3652-3654)caC>caA	p.H1218Q	BAI1_ENST00000323289.5_Missense_Mutation_p.H1218Q			O14514	BAI1_HUMAN	brain-specific angiogenesis inhibitor 1	1218					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)|signal transduction (GO:0007165)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(28)|ovary(4)|pancreas(1)|prostate(7)	57	all_cancers(97;2.84e-12)|all_epithelial(106;5.91e-09)|Lung NSC(106;0.000322)|all_lung(105;0.000616)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					AGAACGGCCACGCCCAGCTCA	0.687																																						dbGAP											0													25.0	33.0	31.0					8																	143618431		2083	4202	6285	-	-	-	SO:0001583	missense	0			AB005297	CCDS64985.1	8q24.3	2014-08-08			ENSG00000181790	ENSG00000181790		"""-"", ""GPCR / Class B : Orphans"""	943	protein-coding gene	gene with protein product		602682				9533023	Standard	NM_001702		Approved		uc003ywm.3	O14514	OTTHUMG00000164732	ENST00000517894.1:c.3654C>A	8.37:g.143618431C>A	ENSP00000430945:p.His1218Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Thrombospondin_1_rpt,pfam_DUF3497,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like	p.H1218Q	ENST00000517894.1	37	c.3654		8	.	.	.	.	.	.	.	.	.	.	c	0.968	-0.700941	0.03255	.	.	ENSG00000181790	ENST00000517894;ENST00000323289	T;T	0.27104	1.69;1.69	3.63	-4.3	0.03710	.	0.071377	0.56097	U	0.000040	T	0.10937	0.0267	L	0.31294	0.92	0.36137	D	0.846525	B	0.30914	0.3	B	0.19946	0.027	T	0.44128	-0.9348	10	0.06365	T	0.9	.	10.8516	0.46773	0.0:0.4518:0.0:0.5482	.	1218	E9PBK0	.	Q	1218	ENSP00000430945:H1218Q;ENSP00000313046:H1218Q	ENSP00000313046:H1218Q	H	+	3	2	BAI1	143615433	0.023000	0.18921	0.979000	0.43373	0.222000	0.24845	-0.955000	0.03869	-0.997000	0.03450	0.306000	0.20318	CAC	BAI1	-	NULL	ENSG00000181790		0.687	BAI1-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	BAI1	HGNC	protein_coding	OTTHUMT00000379963.3	47	0.00	0	C	NM_001702		143618431	143618431	+1	no_errors	ENST00000323289	ensembl	human	known	69_37n	missense	21	30.00	9	SNP	0.704	A
BANK1	55024	genome.wustl.edu	37	4	102946423	102946423	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:102946423G>A	ENST00000322953.4	+	9	1625	c.1351G>A	c.(1351-1353)Gag>Aag	p.E451K	BANK1_ENST00000510950.1_3'UTR|BANK1_ENST00000504592.1_Missense_Mutation_p.E436K|RP11-498M5.2_ENST00000505091.1_RNA|BANK1_ENST00000444316.2_Missense_Mutation_p.E421K|BANK1_ENST00000508653.1_Missense_Mutation_p.E318K|BANK1_ENST00000428908.1_Missense_Mutation_p.E318K	NM_017935.4	NP_060405	Q8NDB2	BANK1_HUMAN	B-cell scaffold protein with ankyrin repeats 1	451					B cell activation (GO:0042113)					NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|liver(2)|lung(16)|ovary(2)|skin(2)|urinary_tract(1)	44		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.7e-07)		AGATGGAGCTGAGGCAAATGA	0.453																																						dbGAP											0													216.0	204.0	208.0					4																	102946423		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB063170	CCDS34038.1, CCDS47115.1, CCDS47116.1	4q23	2013-01-11						"""Ankyrin repeat domain containing"""	18233	protein-coding gene	gene with protein product		610292				11782428, 21208380, 21480188	Standard	NM_017935		Approved	BANK, FLJ20706	uc003hvy.4	Q8NDB2		ENST00000322953.4:c.1351G>A	4.37:g.102946423G>A	ENSP00000320509:p.Glu451Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7W8|B0F3S2|Q8N5K8|Q8NB56|Q8WYN5|Q9NWP2	Missense_Mutation	SNP	superfamily_Ankyrin_rpt-contain_dom	p.E451K	ENST00000322953.4	37	c.1351	CCDS34038.1	4	.	.	.	.	.	.	.	.	.	.	G	16.26	3.073547	0.55646	.	.	ENSG00000153064	ENST00000504592;ENST00000322953;ENST00000428908;ENST00000508653;ENST00000444316	T;T;T;T;T	0.18502	2.89;2.88;2.21;2.21;2.89	5.05	-0.59	0.11679	.	1.827190	0.03156	N	0.168649	T	0.16128	0.0388	L	0.46157	1.445	0.09310	N	1	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.13407	0.009;0.009;0.009	T	0.26815	-1.0092	10	0.29301	T	0.29	.	6.1995	0.20567	0.248:0.2509:0.5011:0.0	.	318;451;436	Q8NDB2-4;Q8NDB2;Q8NDB2-2	.;BANK1_HUMAN;.	K	436;451;318;318;421	ENSP00000421443:E436K;ENSP00000320509:E451K;ENSP00000412748:E318K;ENSP00000422314:E318K;ENSP00000388817:E421K	ENSP00000320509:E451K	E	+	1	0	BANK1	103165446	0.378000	0.25114	0.000000	0.03702	0.004000	0.04260	1.494000	0.35616	-0.069000	0.12931	-0.229000	0.12294	GAG	BANK1	-	NULL	ENSG00000153064		0.453	BANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BANK1	HGNC	protein_coding	OTTHUMT00000363161.1	529	0.00	0	G	NM_017935		102946423	102946423	+1	no_errors	ENST00000322953	ensembl	human	known	69_37n	missense	370	39.84	245	SNP	0.000	A
BARX2	8538	genome.wustl.edu	37	11	129306882	129306882	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:129306882G>T	ENST00000281437.4	+	2	520	c.424G>T	c.(424-426)Gag>Tag	p.E142*	BARX2_ENST00000526127.1_5'UTR	NM_003658.4	NP_003649.2	Q9UMQ3	BARX2_HUMAN	BARX homeobox 2	142					cartilage condensation (GO:0001502)|catagen (GO:0042637)|myotube differentiation (GO:0014902)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	20	all_hematologic(175;0.0749)	Lung NSC(97;0.000383)|all_lung(97;0.000824)|Breast(109;0.000962)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.00929)|Lung(977;0.0245)|LUSC - Lung squamous cell carcinoma(976;0.0253)		CATCTTCACCGAGCTGCAGCT	0.622																																						dbGAP											0													34.0	39.0	37.0					11																	129306882		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			AF031924	CCDS8481.1	11q24.3	2011-06-20	2007-07-09		ENSG00000043039	ENSG00000043039		"""Homeoboxes / ANTP class : NKL subclass"""	956	protein-coding gene	gene with protein product		604823	"""BarH-like homeobox 2"""			10644443	Standard	NM_003658		Approved		uc001qfc.4	Q9UMQ3	OTTHUMG00000165776	ENST00000281437.4:c.424G>T	11.37:g.129306882G>T	ENSP00000281437:p.Glu142*	Somatic		WXS	Illumina GAIIx	Phase_IV	O43518|Q6NT51	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.E142*	ENST00000281437.4	37	c.424	CCDS8481.1	11	.	.	.	.	.	.	.	.	.	.	G	39	7.548181	0.98352	.	.	ENSG00000043039	ENST00000281437	.	.	.	5.76	5.76	0.90799	.	0.100686	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	.	18.5398	0.91023	0.0:0.0:1.0:0.0	.	.	.	.	X	142	.	ENSP00000281437:E142X	E	+	1	0	BARX2	128812092	1.000000	0.71417	0.981000	0.43875	0.988000	0.76386	9.368000	0.97152	2.713000	0.92767	0.655000	0.94253	GAG	BARX2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000043039		0.622	BARX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BARX2	HGNC	protein_coding	OTTHUMT00000386153.1	96	0.00	0	G	NM_003658		129306882	129306882	+1	no_errors	ENST00000281437	ensembl	human	known	69_37n	nonsense	32	11.11	4	SNP	1.000	T
BCL2L12	83596	genome.wustl.edu	37	19	50173639	50173639	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:50173639C>G	ENST00000246785.3	+	6	1106	c.848C>G	c.(847-849)gCc>gGc	p.A283G	BCL2L12_ENST00000441864.2_Missense_Mutation_p.A282G|BCL2L12_ENST00000246784.3_3'UTR	NM_001040668.1|NM_138639.1	NP_001035758.1|NP_619580.1	Q9HB09	B2L12_HUMAN	BCL2-like 12 (proline rich)	283					inhibition of cysteine-type endopeptidase activity involved in apoptotic process (GO:1990001)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)	8		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.000681)|GBM - Glioblastoma multiforme(134;0.0214)		CTGGCCCTAGCCATGGAGCTG	0.736																																						dbGAP											0													6.0	6.0	6.0					19																	50173639		2121	4069	6190	-	-	-	SO:0001583	missense	0			AF289220	CCDS12776.1, CCDS46144.1, CCDS74424.1, CCDS74423.1	19q13.3	2014-03-07				ENSG00000126453			13787	protein-coding gene	gene with protein product		610837					Standard	NM_001040668		Approved		uc002ppa.3	Q9HB09		ENST00000246785.3:c.848C>G	19.37:g.50173639C>G	ENSP00000246785:p.Ala283Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY11|Q3SY13|Q96I96|Q9HB08	Missense_Mutation	SNP	NULL	p.A283G	ENST00000246785.3	37	c.848	CCDS12776.1	19	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130087	0.77549	.	.	ENSG00000126453	ENST00000246785;ENST00000441864	T;T	0.59083	0.29;0.29	4.09	4.09	0.47781	.	0.000000	0.44097	D	0.000492	T	0.63896	0.2550	L	0.32530	0.975	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.79108	0.992;0.992	T	0.64466	-0.6401	10	0.54805	T	0.06	-15.3741	12.1798	0.54206	0.0:1.0:0.0:0.0	.	282;283	Q3SY13;Q9HB09	.;B2L12_HUMAN	G	283;282	ENSP00000246785:A283G;ENSP00000393803:A282G	ENSP00000246785:A283G	A	+	2	0	BCL2L12	54865451	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	3.517000	0.53443	2.607000	0.88179	0.306000	0.20318	GCC	BCL2L12	-	NULL	ENSG00000126453		0.736	BCL2L12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L12	HGNC	protein_coding	OTTHUMT00000465770.1	13	0.00	0	C	NM_052842		50173639	50173639	+1	no_errors	ENST00000246785	ensembl	human	known	69_37n	missense	1	80.00	4	SNP	1.000	G
BMP5	653	genome.wustl.edu	37	6	55739309	55739309	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:55739309A>G	ENST00000370830.3	-	1	1053	c.355T>C	c.(355-357)Tct>Cct	p.S119P	BMP5_ENST00000446683.2_Missense_Mutation_p.S119P	NM_021073.2	NP_066551.1	P22003	BMP5_HUMAN	bone morphogenetic protein 5	119					cartilage development (GO:0051216)|growth (GO:0040007)|male genitalia development (GO:0030539)|negative regulation of aldosterone biosynthetic process (GO:0032348)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cortisol biosynthetic process (GO:2000065)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of steroid biosynthetic process (GO:0010894)|ossification (GO:0001503)|pattern specification process (GO:0007389)|positive regulation of dendrite development (GO:1900006)|positive regulation of DNA-dependent DNA replication (GO:2000105)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system development (GO:0001501)|type B pancreatic cell development (GO:0003323)	extracellular space (GO:0005615)|membrane-bounded vesicle (GO:0031988)	BMP receptor binding (GO:0070700)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(2)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)	45	Lung NSC(77;0.0462)		LUSC - Lung squamous cell carcinoma(124;0.181)			CCATTGGGAGAGGCTGGGTAT	0.517																																						dbGAP											0													136.0	118.0	124.0					6																	55739309		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4958.1	6p12.1	2014-01-30			ENSG00000112175	ENSG00000112175		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	1072	protein-coding gene	gene with protein product		112265				1427904, 11580864	Standard	NM_021073		Approved		uc003pcq.3	P22003	OTTHUMG00000014903	ENST00000370830.3:c.355T>C	6.37:g.55739309A>G	ENSP00000359866:p.Ser119Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0Y4|Q9H547|Q9NTM5	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C	p.S119P	ENST00000370830.3	37	c.355	CCDS4958.1	6	.	.	.	.	.	.	.	.	.	.	A	10.19	1.283025	0.23392	.	.	ENSG00000112175	ENST00000370830;ENST00000446683	T;T	0.72615	-0.67;-0.29	5.96	5.96	0.96718	Transforming growth factor-beta, N-terminal (1);	0.340491	0.32357	N	0.006216	T	0.22589	0.0545	N	0.00621	-1.32	0.47737	D	0.999506	B;B	0.09022	0.002;0.001	B;B	0.12837	0.004;0.008	T	0.24154	-1.0168	10	0.27785	T	0.31	.	12.3118	0.54933	0.859:0.141:0.0:0.0	.	119;119	B4E0Y4;P22003	.;BMP5_HUMAN	P	119	ENSP00000359866:S119P;ENSP00000391818:S119P	ENSP00000359866:S119P	S	-	1	0	BMP5	55847268	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.372000	0.44257	2.284000	0.76573	0.528000	0.53228	TCT	BMP5	-	pfam_TGF-b_N	ENSG00000112175		0.517	BMP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP5	HGNC	protein_coding	OTTHUMT00000041000.1	290	0.00	0	A			55739309	55739309	-1	no_errors	ENST00000370830	ensembl	human	known	69_37n	missense	222	34.41	117	SNP	1.000	G
BRD9	65980	genome.wustl.edu	37	5	870670	870670	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:870670G>A	ENST00000467963.1	-	14	1609	c.1443C>T	c.(1441-1443)gaC>gaT	p.D481D	BRD9_ENST00000388890.4_Silent_p.D365D|BRD9_ENST00000483173.1_Silent_p.D428D|BRD9_ENST00000323510.4_Silent_p.D385D	NM_023924.4	NP_076413.3	Q9H8M2	BRD9_HUMAN	bromodomain containing 9	481					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		lysine-acetylated histone binding (GO:0070577)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(11)|ovary(2)|pancreas(1)|prostate(3)	29			Epithelial(17;0.00202)|OV - Ovarian serous cystadenocarcinoma(19;0.00353)|all cancers(22;0.00815)|Lung(60;0.185)			AGCTGCTGCTGTCTCCTAGGG	0.468																																						dbGAP											0													124.0	109.0	114.0					5																	870670		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023503	CCDS34127.1, CCDS34128.1, CCDS34127.2, CCDS34128.2	5p15.33	2008-02-05			ENSG00000028310	ENSG00000028310			25818	protein-coding gene	gene with protein product						12477932	Standard	NM_023924		Approved	FLJ13441	uc003jbq.3	Q9H8M2	OTTHUMG00000159258	ENST00000467963.1:c.1443C>T	5.37:g.870670G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFY8|B4DMQ2|B4DR93|Q2XUS1|Q6UWU9|Q8IUS4|Q9H5Q5|Q9H7R9	Nonsense_Mutation	SNP	pfam_DUF3512	p.Q55*	ENST00000467963.1	37	c.163	CCDS34127.2	5																																																																																			BRD9	-	pfam_DUF3512	ENSG00000028310		0.468	BRD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRD9	HGNC	protein_coding	OTTHUMT00000354113.1	218	0.00	0	G	NM_023924		870670	870670	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000523139	ensembl	human	known	69_37n	nonsense	229	13.58	36	SNP	0.000	A
C2orf81	388963	genome.wustl.edu	37	2	74643227	74643227	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:74643227C>A	ENST00000290390.5	-	2	477	c.169G>T	c.(169-171)Gag>Tag	p.E57*	C2orf81_ENST00000517883.1_5'UTR	NM_001145054.1	NP_001138526.1	A6NN90	CB081_HUMAN	chromosome 2 open reading frame 81	50										endometrium(3)|kidney(1)	4						TCGCCCTCCTCGAGGGCTGTA	0.627																																						dbGAP											0													31.0	39.0	37.0					2																	74643227		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AC005041, CH471053		2p13.1	2012-08-07			ENSG00000159239	ENSG00000159239			34350	protein-coding gene	gene with protein product						15815621	Standard	NM_001145054		Approved	LOC388963, hCG40743	uc010yrq.1	A6NN90	OTTHUMG00000164184	ENST00000290390.5:c.169G>T	2.37:g.74643227C>A	ENSP00000290390:p.Glu57*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.E57*	ENST00000290390.5	37	c.169		2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.962516	0.74016	.	.	ENSG00000159239	ENST00000290390;ENST00000517896;ENST00000518401	.	.	.	4.99	4.11	0.48088	.	0.153266	0.30068	N	0.010492	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-27.5485	14.7792	0.69754	0.0:0.8544:0.1456:0.0	.	.	.	.	X	57;57;82	.	ENSP00000290390:E57X	E	-	1	0	C2orf81	74496735	0.957000	0.32711	0.885000	0.34714	0.878000	0.50629	2.054000	0.41335	1.457000	0.47850	0.467000	0.42956	GAG	C2orf81	-	NULL	ENSG00000159239		0.627	C2orf81-201	KNOWN	basic|appris_candidate_longest	protein_coding	C2orf81	HGNC	protein_coding		37	0.00	0	C	NM_001145054		74643227	74643227	-1	no_errors	ENST00000290390	ensembl	human	known	69_37n	nonsense	23	37.84	14	SNP	0.993	A
C8orf44	56260	genome.wustl.edu	37	8	67589946	67589946	+	Start_Codon_SNP	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:67589946G>A	ENST00000519561.1	+	2	154	c.3G>A	c.(1-3)atG>atA	p.M1I	C8orf44_ENST00000390159.3_Start_Codon_SNP_p.M1I|C8orf44_ENST00000521889.1_Start_Codon_SNP_p.M1I|C8orf44-SGK3_ENST00000520044.1_Intron|C8orf44-SGK3_ENST00000519289.1_Intron	NM_019607.2	NP_062553.1	Q96CB5	CH044_HUMAN	chromosome 8 open reading frame 44	1						nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(2)	4	Breast(64;0.186)		Epithelial(68;0.000959)|OV - Ovarian serous cystadenocarcinoma(28;0.00318)|all cancers(69;0.00363)|BRCA - Breast invasive adenocarcinoma(89;0.149)			TAGTTGAAATGAGGAAGAATG	0.433																																						dbGAP											0													103.0	100.0	101.0					8																	67589946		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AK002129	CCDS6193.1	8q13.1	2012-05-16		2005-08-09	ENSG00000213865	ENSG00000213865			25646	protein-coding gene	gene with protein product						12477932	Standard	NM_019607		Approved	FLJ11267	uc003xwo.2	Q96CB5	OTTHUMG00000164562	ENST00000519561.1:c.3G>A	8.37:g.67589946G>A	ENSP00000428002:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NUM6	Missense_Mutation	SNP	NULL	p.M1I	ENST00000519561.1	37	c.3	CCDS6193.1	8	.	.	.	.	.	.	.	.	.	.	G	8.841	0.942147	0.18281	.	.	ENSG00000213865	ENST00000519561;ENST00000521889;ENST00000390159	T;T	0.33654	1.4;1.4	3.08	-0.294	0.12831	.	.	.	.	.	T	0.25158	0.0611	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.04013	0.001	T	0.07195	-1.0785	8	0.87932	D	0	.	5.4769	0.16700	0.5165:0.0:0.4835:0.0	.	1	Q96CB5	CH044_HUMAN	I	1	ENSP00000428002:M1I;ENSP00000375087:M1I	ENSP00000375087:M1I	M	+	3	0	C8orf44	67752500	0.008000	0.16893	0.000000	0.03702	0.001000	0.01503	0.625000	0.24477	-0.069000	0.12931	-0.157000	0.13467	ATG	C8orf44	-	NULL	ENSG00000213865		0.433	C8orf44-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C8orf44	HGNC	protein_coding	OTTHUMT00000379242.2	287	0.00	0	G	NM_019607	Missense_Mutation	67589946	67589946	+1	no_errors	ENST00000390159	ensembl	human	known	69_37n	missense	279	25.40	95	SNP	0.000	A
C9orf3	84909	genome.wustl.edu	37	9	97522822	97522822	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:97522822G>A	ENST00000375315.2	+	1	757	c.757G>A	c.(757-759)Gaa>Aaa	p.E253K	C9orf3_ENST00000297979.5_Missense_Mutation_p.E253K|C9orf3_ENST00000277198.2_Missense_Mutation_p.E253K	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	253					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		AACTAAACCTGAAGGGCGATC	0.498																																						dbGAP											0													57.0	53.0	54.0					9																	97522822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.757G>A	9.37:g.97522822G>A	ENSP00000364464:p.Glu253Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Missense_Mutation	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.E253K	ENST00000375315.2	37	c.757	CCDS55328.1	9	.	.	.	.	.	.	.	.	.	.	G	13.63	2.294782	0.40594	.	.	ENSG00000148120	ENST00000277198;ENST00000297979;ENST00000375315;ENST00000427193;ENST00000424143;ENST00000428313	T;T;T;T;T;T	0.04119	3.7;3.7;3.7;3.7;3.7;3.7	4.79	1.8	0.24995	.	0.669254	0.15062	N	0.282720	T	0.04724	0.0128	L	0.53249	1.67	0.09310	N	0.99999	B;B;B;B	0.22414	0.069;0.045;0.001;0.056	B;B;B;B	0.23716	0.048;0.031;0.002;0.029	T	0.46555	-0.9183	10	0.10636	T	0.68	-1.2193	5.5386	0.17026	0.2655:0.2109:0.5236:0.0	.	253;253;253;253	Q8N6M6;Q8N6M6-4;Q8N6M6-2;Q8N6M6-3	AMPO_HUMAN;.;.;.	K	253;253;253;127;76;35	ENSP00000277198:E253K;ENSP00000297979:E253K;ENSP00000364464:E253K;ENSP00000387736:E127K;ENSP00000402171:E76K;ENSP00000401854:E35K	ENSP00000277198:E253K	E	+	1	0	C9orf3	96562643	0.763000	0.28462	0.873000	0.34254	0.887000	0.51463	1.105000	0.31086	0.277000	0.22141	0.467000	0.42956	GAA	C9orf3	-	NULL	ENSG00000148120		0.498	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		124	0.80	1	G	NM_032823		97522822	97522822	+1	no_errors	ENST00000375315	ensembl	human	known	69_37n	missense	30	76.38	97	SNP	0.043	A
CANX	821	genome.wustl.edu	37	5	179134161	179134161	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:179134161G>C	ENST00000247461.4	+	4	474	c.274G>C	c.(274-276)Gat>Cat	p.D92H	CANX_ENST00000504734.1_Missense_Mutation_p.D92H|CANX_ENST00000415618.2_Missense_Mutation_p.D127H|CANX_ENST00000503126.1_3'UTR|CANX_ENST00000452673.2_Missense_Mutation_p.D92H|CANX_ENST00000512607.2_Intron	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	92					aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	CAAGAAAGACGATACCGATGA	0.353																																						dbGAP											0													149.0	148.0	149.0					5																	179134161		2203	4300	6503	-	-	-	SO:0001583	missense	0			L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.274G>C	5.37:g.179134161G>C	ENSP00000247461:p.Asp92His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl,superfamily_Calreticulin/calnexin_P,prints_Calret/calnex	p.D127H	ENST00000247461.4	37	c.379	CCDS4447.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.136385	0.94517	.	.	ENSG00000127022	ENST00000514383;ENST00000502296;ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000502498;ENST00000513246;ENST00000354394	T;T;T;T;T;T;T;T	0.54071	0.59;0.59;0.59;0.59;0.59;0.59;0.59;0.61	5.62	5.62	0.85841	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.047111	0.85682	D	0.000000	T	0.75568	0.3867	M	0.81179	2.53	0.80722	D	1	D;D	0.89917	0.98;1.0	P;D	0.79784	0.807;0.993	T	0.77253	-0.2656	10	0.59425	D	0.04	-29.082	19.665	0.95890	0.0:0.0:1.0:0.0	.	127;92	B4DGP8;P27824	.;CALX_HUMAN	H	92;92;92;127;92;92;92;92;84	ENSP00000424341:D92H;ENSP00000424745:D92H;ENSP00000424063:D92H;ENSP00000394817:D127H;ENSP00000391646:D92H;ENSP00000247461:D92H;ENSP00000425246:D92H;ENSP00000421813:D92H	ENSP00000247461:D92H	D	+	1	0	CANX	179066767	1.000000	0.71417	0.999000	0.59377	0.934000	0.57294	9.843000	0.99491	2.654000	0.90174	0.655000	0.94253	GAT	CANX	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl	ENSG00000127022		0.353	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CANX	HGNC	protein_coding	OTTHUMT00000253500.2	607	0.16	1	G	NM_001024649		179134161	179134161	+1	no_errors	ENST00000415618	ensembl	human	known	69_37n	missense	524	52.75	585	SNP	1.000	C
CARNS1	57571	genome.wustl.edu	37	11	67191270	67191270	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:67191270G>T	ENST00000307823.3	+	9	2134	c.1682G>T	c.(1681-1683)gGt>gTt	p.G561V	CARNS1_ENST00000423745.2_Missense_Mutation_p.G561V|CARNS1_ENST00000524740.1_3'UTR|CARNS1_ENST00000445895.2_Missense_Mutation_p.G684V|CARNS1_ENST00000531040.1_Missense_Mutation_p.G658V	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	561	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						GGTGCAGTGGGTGTCCGGCTG	0.647																																						dbGAP											0													28.0	31.0	30.0					11																	67191270		2166	4262	6428	-	-	-	SO:0001583	missense	0				CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.1682G>T	11.37:g.67191270G>T	ENSP00000308268:p.Gly561Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	superfamily_PreATP-grasp_fold,superfamily_TIL_dom,pfscan_ATP-grasp	p.G684V	ENST00000307823.3	37	c.2051	CCDS44658.1	11	.	.	.	.	.	.	.	.	.	.	G	15.43	2.830876	0.50845	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000423745;ENST00000445895	D;D;D;D	0.99143	-5.48;-5.48;-5.48;-5.48	5.12	5.12	0.69794	ATP-grasp fold (1);ATP-grasp fold, DUF201-type (1);	0.000000	0.52532	D	0.000062	D	0.99321	0.9762	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.99153	1.0859	10	0.87932	D	0	-20.7956	17.3234	0.87241	0.0:0.0:1.0:0.0	.	561;700	A5YM72;A5YM72-3	CRNS1_HUMAN;.	V	658;561;658;561;684	ENSP00000431670:G658V;ENSP00000308268:G561V;ENSP00000401519:G561V;ENSP00000389009:G684V	ENSP00000308268:G561V	G	+	2	0	CARNS1	66947846	1.000000	0.71417	0.996000	0.52242	0.357000	0.29423	5.399000	0.66314	2.398000	0.81561	0.549000	0.68633	GGT	CARNS1	-	pfscan_ATP-grasp	ENSG00000172508		0.647	CARNS1-001	KNOWN	basic|CCDS	protein_coding	CARNS1	HGNC	protein_coding	OTTHUMT00000395501.1	112	0.00	0	G	NM_020811		67191270	67191270	+1	no_errors	ENST00000445895	ensembl	human	known	69_37n	missense	37	39.34	24	SNP	0.999	T
CBLB	868	genome.wustl.edu	37	3	105397410	105397410	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:105397410C>G	ENST00000264122.4	-	17	2755	c.2434G>C	c.(2434-2436)Gat>Cat	p.D812H	CBLB_ENST00000407712.1_Missense_Mutation_p.D27H|CBLB_ENST00000394027.3_Missense_Mutation_p.D790H	NM_170662.3	NP_733762.2	Q13191	CBLB_HUMAN	Cbl proto-oncogene B, E3 ubiquitin protein ligase	812	Pro-rich.				cell surface receptor signaling pathway (GO:0007166)|immune response (GO:0006955)|intracellular signal transduction (GO:0035556)|negative regulation of alpha-beta T cell proliferation (GO:0046642)|negative regulation of T cell receptor signaling pathway (GO:0050860)|NLS-bearing protein import into nucleus (GO:0006607)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of T cell anergy (GO:0002669)|signal transduction (GO:0007165)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(8)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(3)|stomach(2)|urinary_tract(2)	49						TCAAAAGCATCTTCACCTGCA	0.448			Mis S		AML																																GBM(93;588 1337 9788 29341 43499)	dbGAP		Rec	yes		3	3q13.11	868	Cas-Br-M (murine) ecotropic retroviral transforming sequence b		L	0													57.0	51.0	53.0					3																	105397410		2203	4300	6503	-	-	-	SO:0001583	missense	0			U26710	CCDS2948.1	3q	2013-07-09	2013-07-09		ENSG00000114423	ENSG00000114423		"""RING-type (C3HC4) zinc fingers"""	1542	protein-coding gene	gene with protein product		604491	"""Cas-Br-M (murine) ectropic retroviral transforming sequence b"", ""Cas-Br-M (murine) ecotropic retroviral transforming sequence b"""			7784085	Standard	XM_005247853		Approved	RNF56, Cbl-b	uc003dwc.3	Q13191	OTTHUMG00000150654	ENST00000264122.4:c.2434G>C	3.37:g.105397410C>G	ENSP00000264122:p.Asp812His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S7|B7WNM4|Q13192|Q13193|Q3LIC0|Q63Z43|Q8IVC5	Missense_Mutation	SNP	pfam_Adaptor_Cbl_N_hlx,pfam_Adaptor_Cbl_SH2-like,pfam_Adaptor_Cbl_EF_hand-like,pfam_Znf_C3HC4_RING-type,pfam_UBA/transl_elong_EF1B_N,superfamily_Adaptor_Cbl_N_hlx,superfamily_UBA-like,smart_Znf_RING,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RING	p.D812H	ENST00000264122.4	37	c.2434	CCDS2948.1	3	.	.	.	.	.	.	.	.	.	.	C	20.3	3.973640	0.74246	.	.	ENSG00000114423	ENST00000394030;ENST00000264122;ENST00000407712;ENST00000394027	T;D;D;D	0.86366	-1.4;-2.05;-1.52;-2.11	5.84	5.84	0.93424	.	0.294864	0.41001	D	0.000972	D	0.86997	0.6068	L	0.43152	1.355	0.80722	D	1	P;P;P	0.46706	0.61;0.808;0.883	B;P;P	0.48952	0.219;0.596;0.596	D	0.87953	0.2725	10	0.87932	D	0	-10.4092	14.3083	0.66397	0.0:0.9294:0.0:0.0706	.	790;812;790	E7ENW2;Q13191;B4DYP3	.;CBLB_HUMAN;.	H	151;812;27;790	ENSP00000377598:D151H;ENSP00000264122:D812H;ENSP00000384170:D27H;ENSP00000377595:D790H	ENSP00000264122:D812H	D	-	1	0	CBLB	106880100	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.792000	0.55476	2.763000	0.94921	0.650000	0.86243	GAT	CBLB	-	NULL	ENSG00000114423		0.448	CBLB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBLB	HGNC	protein_coding	OTTHUMT00000319417.2	321	0.00	0	C	NM_170662		105397410	105397410	-1	no_errors	ENST00000264122	ensembl	human	known	69_37n	missense	104	66.01	202	SNP	1.000	G
CCNB3	85417	genome.wustl.edu	37	X	50053928	50053928	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:50053928C>A	ENST00000376042.1	+	6	3057	c.2759C>A	c.(2758-2760)aCc>aAc	p.T920N	CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.T920N|CCNB3_ENST00000376038.1_Intron			Q8WWL7	CCNB3_HUMAN	cyclin B3	920					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					AAGATGTCTACCATCAATGAG	0.463																																						dbGAP											0													82.0	74.0	77.0					X																	50053928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2759C>A	X.37:g.50053928C>A	ENSP00000365210:p.Thr920Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.T920N	ENST00000376042.1	37	c.2759	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	C	11.86	1.764686	0.31228	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.17528	2.27;2.27	3.42	1.58	0.23477	.	966.672000	0.00357	N	0.000020	T	0.14485	0.0350	N	0.22421	0.69	0.09310	N	1	D	0.54772	0.968	P	0.44518	0.452	T	0.13737	-1.0498	9	.	.	.	.	5.2539	0.15537	0.0:0.7132:0.0:0.2868	.	920	Q8WWL7	CCNB3_HUMAN	N	920	ENSP00000365210:T920N;ENSP00000276014:T920N	.	T	+	2	0	CCNB3	50070668	0.000000	0.05858	0.000000	0.03702	0.070000	0.16714	-0.621000	0.05559	0.288000	0.22398	0.422000	0.28245	ACC	CCNB3	-	NULL	ENSG00000147082		0.463	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	247	0.00	0	C			50053928	50053928	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	87	57.14	116	SNP	0.000	A
CDH12	1010	genome.wustl.edu	37	5	21975200	21975200	+	Splice_Site	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:21975200C>T	ENST00000382254.1	-	6	1612	c.526G>A	c.(526-528)Ggt>Agt	p.G176S	CDH12_ENST00000522262.1_Splice_Site_p.G176S|CDH12_ENST00000504376.2_Splice_Site_p.G176S	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	176	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						GCCTACTCACCCACAGGAGAC	0.353										HNSCC(59;0.17)																												dbGAP											0													75.0	77.0	77.0					5																	21975200		2042	3889	5931	-	-	-	SO:0001630	splice_region_variant	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.526+1G>A	5.37:g.21975200C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.G176S	ENST00000382254.1	37	c.526	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	28.1	4.894816	0.91962	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;D	0.91407	-0.3;-0.3;-2.84	5.16	5.16	0.70880	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.96087	0.8725	M	0.92122	3.275	0.39461	D	0.967561	D;B	0.65815	0.995;0.269	P;B	0.61003	0.882;0.098	D	0.97445	1.0024	9	.	.	.	.	18.6264	0.91340	0.0:1.0:0.0:0.0	.	176;176	B7Z2U6;P55289	.;CAD12_HUMAN	S	176	ENSP00000423577:G176S;ENSP00000371689:G176S;ENSP00000428786:G176S	.	G	-	1	0	CDH12	22010957	1.000000	0.71417	1.000000	0.80357	0.711000	0.40976	7.397000	0.79903	2.414000	0.81942	0.484000	0.47621	GGT	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,prints_Cadherin,pfscan_Cadherin	ENSG00000154162		0.353	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	277	0.00	0	C	NM_004061	Missense_Mutation	21975200	21975200	-1	no_errors	ENST00000382254	ensembl	human	known	69_37n	missense	410	10.48	48	SNP	1.000	T
CDC20B	166979	genome.wustl.edu	37	5	54429340	54429340	+	Silent	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:54429340G>C	ENST00000381375.2	-	6	742	c.597C>G	c.(595-597)gtC>gtG	p.V199V	CDC20B_ENST00000296733.1_Silent_p.V199V|CDC20B_ENST00000334206.5_Silent_p.V199V|CDC20B_ENST00000322374.6_Silent_p.V199V			Q86Y33	CD20B_HUMAN	cell division cycle 20B	199										kidney(1)|large_intestine(5)|lung(7)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	19		Lung NSC(810;0.000744)|Breast(144;0.159)|Prostate(74;0.194)	LUSC - Lung squamous cell carcinoma(15;0.225)			ATTCATCTCTGACTCCATCTT	0.343																																						dbGAP											0													108.0	116.0	113.0					5																	54429340		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB086378	CCDS3966.1, CCDS47207.1, CCDS54852.1	5q11.2	2013-01-17	2013-01-17		ENSG00000164287	ENSG00000164287		"""WD repeat domain containing"""	24222	protein-coding gene	gene with protein product			"""CDC20 cell division cycle 20 homolog B (S. cerevisiae)"", ""cell division cycle 20 homolog B (S. cerevisiae)"""				Standard	NM_152623		Approved	FLJ37927	uc003jpo.2	Q86Y33	OTTHUMG00000131185	ENST00000381375.2:c.597C>G	5.37:g.54429340G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNV8|B9EGL8|C9J6X8|C9JHE9|C9JKL5|Q86Y31|Q86Y32|Q8IUZ8|Q8N1S1|Q8NG56	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V199	ENST00000381375.2	37	c.597	CCDS54852.1	5																																																																																			CDC20B	-	NULL	ENSG00000164287		0.343	CDC20B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CDC20B	HGNC	protein_coding	OTTHUMT00000369715.1	258	0.00	0	G	NM_152623		54429340	54429340	-1	no_errors	ENST00000296733	ensembl	human	known	69_37n	silent	105	52.27	115	SNP	0.221	C
CDK16	5127	genome.wustl.edu	37	X	47086816	47086816	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:47086816G>T	ENST00000357227.4	+	14	1747	c.1323G>T	c.(1321-1323)atG>atT	p.M441I	CDK16_ENST00000518022.1_Missense_Mutation_p.M441I|CDK16_ENST00000457458.2_Missense_Mutation_p.M447I|CDK16_ENST00000276052.6_Missense_Mutation_p.M515I	NM_006201.4	NP_006192.1	Q00536	CDK16_HUMAN	cyclin-dependent kinase 16	441	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				exocytosis (GO:0006887)|growth hormone secretion (GO:0030252)|neuron projection development (GO:0031175)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|spermatogenesis (GO:0007283)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|microtubule cytoskeleton (GO:0015630)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|large_intestine(4)|lung(3)	11						AGGATGCCATGAAACATCCAT	0.557																																						dbGAP											0													50.0	40.0	43.0					X																	47086816		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14276.1, CCDS48101.1, CCDS55408.1	Xp11	2011-11-08	2009-12-16	2009-12-16	ENSG00000102225	ENSG00000102225		"""Cyclin-dependent kinases"""	8749	protein-coding gene	gene with protein product	"""serine/threonine-protein kinase"""	311550	"""PCTAIRE protein kinase 1"""	PCTK1		1437147, 19884882	Standard	NM_033018		Approved	PCTAIRE, PCTAIRE1, PCTGAIRE, FLJ16665	uc011mll.2	Q00536	OTTHUMG00000021438	ENST00000357227.4:c.1323G>T	X.37:g.47086816G>T	ENSP00000349762:p.Met441Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K280|B7Z7C8|J3KN74|J3KQP7	Nonsense_Mutation	SNP	superfamily_Kinase-like_dom	p.E28*	ENST00000357227.4	37	c.82	CCDS14276.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.12|19.12	3.765962|3.765962	0.69878|0.69878	.|.	.|.	ENSG00000102225|ENSG00000102225	ENST00000520141;ENST00000462827|ENST00000457458;ENST00000357227;ENST00000540877;ENST00000540311;ENST00000518022;ENST00000276052;ENST00000523344	.|T;T;T;T;T	.|0.41758	.|0.99;0.99;0.99;0.99;0.99	5.73|5.73	5.73|5.73	0.89815|0.89815	.|Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.037448	.|0.85682	.|D	.|0.000000	.|T	.|0.41604	.|0.1166	N|N	0.12887|0.12887	0.27|0.27	0.58432|0.58432	D|D	0.999996|0.999996	.|P;P;P	.|0.43973	.|0.823;0.645;0.619	.|P;P;P	.|0.51615	.|0.675;0.542;0.543	.|T	.|0.47484	.|-0.9114	.|10	.|0.87932	.|D	.|0	-9.8629|-9.8629	17.7482|17.7482	0.88427|0.88427	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|515;546;441	.|B7Z7C8;B7Z8T0;Q00536	.|.;.;CDK16_HUMAN	X|I	28|447;441;546;393;441;515;205	.|ENSP00000405798:M447I;ENSP00000349762:M441I;ENSP00000429751:M441I;ENSP00000276052:M515I;ENSP00000428349:M205I	.|ENSP00000276052:M515I	E|M	+|+	1|3	0|0	CDK16|CDK16	46971760|46971760	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.268000|5.268000	0.65536|0.65536	2.551000|2.551000	0.86045|0.86045	0.600000|0.600000	0.82982|0.82982	GAA|ATG	CDK16	-	superfamily_Kinase-like_dom	ENSG00000102225		0.557	CDK16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK16	HGNC	protein_coding	OTTHUMT00000056406.2	197	0.00	0	G	NM_006201		47086816	47086816	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000520141	ensembl	human	putative	69_37n	nonsense	55	53.78	64	SNP	1.000	T
CLEC2D	29121	genome.wustl.edu	37	12	9833616	9833616	+	Silent	SNP	T	T	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:9833616T>G	ENST00000290855.6	+	2	181	c.159T>G	c.(157-159)gtT>gtG	p.V53V	CLEC2D_ENST00000543300.1_Silent_p.V53V|CLEC2D_ENST00000545918.1_Intron|CLEC2D_ENST00000487752.1_3'UTR|CLEC2D_ENST00000261339.6_Intron|CLEC2D_ENST00000261340.7_Silent_p.V53V	NM_013269.5	NP_037401.1	Q9UHP7	CLC2D_HUMAN	C-type lectin domain family 2, member D	53					cell surface receptor signaling pathway (GO:0007166)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|prostate(2)|stomach(1)	9						GTGGAATGGTTGCTGCTTTAA	0.318																																						dbGAP											0													128.0	125.0	126.0					12																	9833616		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF133299	CCDS8602.1, CCDS31741.1, CCDS55800.1, CCDS55801.1, CCDS55802.1	12p13.31	2011-05-24	2005-09-29		ENSG00000069493	ENSG00000069493		"""C-type lectin domain containing"""	14351	protein-coding gene	gene with protein product	"""C-type lectin related f"", ""lectin-like transcript 1"""	605659	"""C-type lectin superfamily 2, member D"""				Standard	NM_013269		Approved	LLT1, CLAX, OCIL	uc001qwf.3	Q9UHP7	OTTHUMG00000168369	ENST00000290855.6:c.159T>G	12.37:g.9833616T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D6CI39|D6CI40|D6CI41|Q6YID5|Q8WUP7|Q9HD37|Q9HD38	Silent	SNP	pfam_C-type_lectin,pfam_Herpes_UL45-like,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.V53	ENST00000290855.6	37	c.159	CCDS8602.1	12																																																																																			CLEC2D	-	pfam_Herpes_UL45-like	ENSG00000069493		0.318	CLEC2D-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC2D	HGNC	protein_coding	OTTHUMT00000335424.2	627	0.00	0	T	NM_013269		9833616	9833616	+1	no_errors	ENST00000261340	ensembl	human	known	69_37n	silent	956	12.45	136	SNP	0.000	G
CLEC9A	283420	genome.wustl.edu	37	12	10205227	10205227	+	Splice_Site	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:10205227A>T	ENST00000355819.1	+	4	555		c.e4-1		CLEC9A_ENST00000544751.1_3'UTR	NM_207345.2	NP_997228.1	Q6UXN8	CLC9A_HUMAN	C-type lectin domain family 9, member A						positive regulation of cytokine secretion (GO:0050715)|receptor-mediated endocytosis (GO:0006898)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	22						CCAAACCACAAGAGGAGTTAC	0.423																																						dbGAP											0																																										-	-	-	SO:0001630	splice_region_variant	0				CCDS8611.1	12p13.31	2010-04-27				ENSG00000197992		"""C-type lectin domain containing"""	26705	protein-coding gene	gene with protein product		612252					Standard	NM_207345		Approved	UNQ9341, HEEE9341	uc001qxa.3	Q6UXN8		ENST00000355819.1:c.-58-1A>T	12.37:g.10205227A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B0ZBM2	Splice_Site	SNP	-	e1-2	ENST00000355819.1	37	c.1-2	CCDS8611.1	12																																																																																			CLEC9A	-	-	ENSG00000197992		0.423	CLEC9A-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	CLEC9A	HGNC	protein_coding	OTTHUMT00000399564.1	151	0.00	0	A	NM_207345	Intron	10205227	10205227	+1	no_errors	ENST00000355819	ensembl	human	putative	69_37n	splice_site	209	23.44	64	SNP	0.001	T
CLMN	79789	genome.wustl.edu	37	14	95669354	95669354	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:95669354G>A	ENST00000298912.4	-	9	2445	c.2332C>T	c.(2332-2334)Cag>Tag	p.Q778*		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	778					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GAGCTGCTCTGAGAGCCATCG	0.587																																						dbGAP											0													38.0	38.0	38.0					14																	95669354		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.2332C>T	14.37:g.95669354G>A	ENSP00000298912:p.Gln778*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Nonsense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.Q778*	ENST00000298912.4	37	c.2332	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	G	37	6.474185	0.97594	.	.	ENSG00000165959	ENST00000298912	.	.	.	4.55	-2.36	0.06663	.	2.025030	0.02502	N	0.090570	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	1.5305	0.02534	0.3247:0.1313:0.4095:0.1345	.	.	.	.	X	778	.	ENSP00000298912:Q778X	Q	-	1	0	CLMN	94739107	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.118000	0.10692	-0.320000	0.08640	-0.266000	0.10368	CAG	CLMN	-	NULL	ENSG00000165959		0.587	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2	96	0.00	0	G			95669354	95669354	-1	no_errors	ENST00000298912	ensembl	human	known	69_37n	nonsense	50	35.06	27	SNP	0.000	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43849775	43849775	+	Silent	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:43849775C>T	ENST00000377564.3	+	11	2073	c.1680C>T	c.(1678-1680)ggC>ggT	p.G560G		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	560	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						AGCATGGGGGCGAGTGTTCCC	0.493																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.1680C>T	9.37:g.43849775C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.A609V	ENST00000377564.3	37	c.1826	CCDS55312.1	9	.	.	.	.	.	.	.	.	.	.	C	3.172	-0.169831	0.06461	.	.	ENSG00000154529	ENST00000377561	.	.	.	3.14	-2.98	0.05513	.	.	.	.	.	T	0.51550	0.1681	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46373	-0.9196	4	.	.	.	.	8.2373	0.31634	0.0:0.3999:0.0:0.6001	.	.	.	.	V	609	.	.	A	+	2	0	CNTNAP3B	43789771	0.043000	0.20138	0.164000	0.22755	0.512000	0.34134	-0.474000	0.06607	-0.691000	0.05135	-0.506000	0.04501	GCG	CNTNAP3B	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000154529		0.493	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	23	0.00	0	C			43849775	43849775	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000377561	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	0.868	T
CNTNAP5	129684	genome.wustl.edu	37	2	125204421	125204421	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:125204421G>A	ENST00000431078.1	+	6	1189	c.825G>A	c.(823-825)gaG>gaA	p.E275E		NM_130773.2	NP_570129.1	Q8WYK1	CNTP5_HUMAN	contactin associated protein-like 5	275	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(24)|lung(100)|ovary(10)|prostate(12)|skin(4)|upper_aerodigestive_tract(3)	176				BRCA - Breast invasive adenocarcinoma(221;0.248)		TCCTCATTGAGCGGGTGGGCA	0.592																																						dbGAP											0													88.0	92.0	90.0					2																	125204421		2168	4284	6452	-	-	-	SO:0001819	synonymous_variant	0			AB077881	CCDS46401.1	2q14.1	2008-02-05			ENSG00000155052	ENSG00000155052			18748	protein-coding gene	gene with protein product		610519					Standard	NM_130773		Approved	caspr5, FLJ31966	uc002tno.3	Q8WYK1	OTTHUMG00000153356	ENST00000431078.1:c.825G>A	2.37:g.125204421G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZFW2|Q4ZG21|Q53R09|Q53RX1|Q53SG3|Q584P3|Q96MS7	Silent	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.E275	ENST00000431078.1	37	c.825	CCDS46401.1	2																																																																																			CNTNAP5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000155052		0.592	CNTNAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP5	HGNC	protein_coding	OTTHUMT00000330864.3	137	0.00	0	G			125204421	125204421	+1	no_errors	ENST00000431078	ensembl	human	known	69_37n	silent	81	20.59	21	SNP	1.000	A
COL16A1	1307	genome.wustl.edu	37	1	32131199	32131199	+	Silent	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:32131199G>T	ENST00000373672.3	-	55	3993	c.3477C>A	c.(3475-3477)ggC>ggA	p.G1159G	COL16A1_ENST00000271069.6_Silent_p.G1159G	NM_001856.3	NP_001847.3	Q07092	COGA1_HUMAN	collagen, type XVI, alpha 1	1159	Triple-helical region 2 (COL2) with 2 imperfections.				cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|female pregnancy (GO:0007565)|integrin-mediated signaling pathway (GO:0007229)	collagen type XVI trimer (GO:0005597)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	integrin binding (GO:0005178)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(15)|ovary(8)|prostate(4)	48		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0423)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.059)		GGCCCGGAAAGCCTGGCTGGC	0.632																																					Colon(143;498 1786 21362 25193 36625)	dbGAP											0													80.0	86.0	84.0					1																	32131199		1973	4150	6123	-	-	-	SO:0001819	synonymous_variant	0			M92642	CCDS41297.1	1p35-p34	2013-01-16			ENSG00000084636	ENSG00000084636		"""Collagens"""	2193	protein-coding gene	gene with protein product		120326				1631157	Standard	NM_001856		Approved		uc001btk.1	Q07092	OTTHUMG00000003883	ENST00000373672.3:c.3477C>A	1.37:g.32131199G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16593|Q59F89|Q71RG9	Silent	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.G1159	ENST00000373672.3	37	c.3477	CCDS41297.1	1																																																																																			COL16A1	-	pfam_Collagen	ENSG00000084636		0.632	COL16A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL16A1	HGNC	protein_coding	OTTHUMT00000011057.2	143	0.00	0	G	NM_001856		32131199	32131199	-1	no_errors	ENST00000271069	ensembl	human	known	69_37n	silent	58	42.57	43	SNP	0.998	T
COPS3	8533	genome.wustl.edu	37	17	17171253	17171253	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:17171253G>T	ENST00000268717.5	-	5	493	c.387C>A	c.(385-387)gaC>gaA	p.D129E	COPS3_ENST00000439936.2_Missense_Mutation_p.D109E|COPS3_ENST00000539941.2_Missense_Mutation_p.D109E	NM_003653.3	NP_003644.2	Q9UNS2	CSN3_HUMAN	COP9 signalosome subunit 3	129					cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				NS(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TCTGCATCTTGTCTATGGCTT	0.448																																						dbGAP											0													285.0	208.0	234.0					17																	17171253		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031647	CCDS11183.1, CCDS56022.1	17p11.2	2013-03-14	2013-03-14		ENSG00000141030	ENSG00000141030			2239	protein-coding gene	gene with protein product		604665	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 3"", ""COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)"""			9535219, 10191102	Standard	NM_003653		Approved	SGN3, CSN3	uc002grd.3	Q9UNS2	OTTHUMG00000059281	ENST00000268717.5:c.387C>A	17.37:g.17171253G>T	ENSP00000268717:p.Asp129Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.D129E	ENST00000268717.5	37	c.387	CCDS11183.1	17	.	.	.	.	.	.	.	.	.	.	G	10.68	1.418064	0.25552	.	.	ENSG00000141030	ENST00000268717;ENST00000539941;ENST00000417352;ENST00000439936	T;T;T	0.60797	0.16;0.16;0.16	5.48	5.48	0.80851	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	N	0.11201	0.11	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.34527	-0.9825	10	0.02654	T	1	-26.7709	18.3459	0.90322	0.0:0.0:1.0:0.0	.	129	Q9UNS2	CSN3_HUMAN	E	129;109;129;153	ENSP00000268717:D129E;ENSP00000437606:D109E;ENSP00000409028:D129E	ENSP00000268717:D129E	D	-	3	2	COPS3	17111978	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.496000	0.73670	2.572000	0.86782	0.650000	0.86243	GAC	COPS3	-	NULL	ENSG00000141030		0.448	COPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS3	HGNC	protein_coding	OTTHUMT00000131603.2	575	0.00	0	G			17171253	17171253	-1	no_errors	ENST00000268717	ensembl	human	known	69_37n	missense	180	57.91	249	SNP	1.000	T
CPT2	1376	genome.wustl.edu	37	1	53675880	53675880	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:53675880G>C	ENST00000371486.3	+	4	1049	c.534G>C	c.(532-534)ttG>ttC	p.L178F	RP5-1024G6.2_ENST00000452466.1_RNA	NM_000098.2	NP_000089.1	P23786	CPT2_HUMAN	carnitine palmitoyltransferase 2	178					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	carnitine O-palmitoyltransferase activity (GO:0004095)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	15					L-Carnitine(DB00583)|Perhexiline(DB01074)	TGTTCCACTTGAACCCTGCAA	0.527																																						dbGAP											0													76.0	75.0	75.0					1																	53675880		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002445	CCDS575.1	1p32.3	2014-01-09	2009-03-04		ENSG00000157184	ENSG00000157184	2.3.1.21		2330	protein-coding gene	gene with protein product		600650	"""carnitine palmitoyltransferase II"""	CPT1		1339389	Standard	NM_000098		Approved	CPTASE	uc001cvb.4	P23786	OTTHUMG00000008942	ENST00000371486.3:c.534G>C	1.37:g.53675880G>C	ENSP00000360541:p.Leu178Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6S0|Q5SW68|Q9BQ26	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.L178F	ENST00000371486.3	37	c.534	CCDS575.1	1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004197	0.35320	.	.	ENSG00000157184	ENST00000371486	D	0.88896	-2.44	5.6	2.45	0.29901	.	0.000000	0.85682	D	0.000000	D	0.88153	0.6360	M	0.84219	2.685	0.54753	D	0.999986	P	0.39376	0.67	B	0.38954	0.286	D	0.88128	0.2836	10	0.66056	D	0.02	.	8.9647	0.35869	0.1547:0.1989:0.6463:0.0	.	178	P23786	CPT2_HUMAN	F	178	ENSP00000360541:L178F	ENSP00000360541:L178F	L	+	3	2	CPT2	53448468	1.000000	0.71417	1.000000	0.80357	0.890000	0.51754	1.339000	0.33885	1.369000	0.46134	0.585000	0.79938	TTG	CPT2	-	pfam_Carn_acyl_trans	ENSG00000157184		0.527	CPT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT2	HGNC	protein_coding	OTTHUMT00000024757.1	219	0.00	0	G	NM_000098		53675880	53675880	+1	no_errors	ENST00000371486	ensembl	human	known	69_37n	missense	149	16.76	30	SNP	0.998	C
CPXM1	56265	genome.wustl.edu	37	20	2776651	2776651	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr20:2776651A>G	ENST00000380605.2	-	10	1463	c.1399T>C	c.(1399-1401)Tac>Cac	p.Y467H		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	467					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						AGGGTGTAGTAAGTGGGCAAT	0.582																																						dbGAP											0													150.0	138.0	142.0					20																	2776651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.1399T>C	20.37:g.2776651A>G	ENSP00000369979:p.Tyr467His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.Y467H	ENST00000380605.2	37	c.1399	CCDS13033.1	20	.	.	.	.	.	.	.	.	.	.	A	13.11	2.139050	0.37728	.	.	ENSG00000088882	ENST00000380605;ENST00000421947	T	0.03358	3.96	5.18	5.18	0.71444	Peptidase M14, carboxypeptidase A (2);	0.248451	0.42294	D	0.000726	T	0.07728	0.0194	L	0.35542	1.07	0.33080	D	0.53649	D	0.67145	0.996	P	0.59288	0.855	T	0.36212	-0.9757	10	0.19147	T	0.46	-23.9261	13.0269	0.58821	1.0:0.0:0.0:0.0	.	467	Q96SM3	CPXM1_HUMAN	H	467;163	ENSP00000369979:Y467H	ENSP00000369979:Y467H	Y	-	1	0	CPXM1	2724651	0.984000	0.35163	0.945000	0.38365	0.638000	0.38207	2.888000	0.48594	2.168000	0.68352	0.460000	0.39030	TAC	CPXM1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000088882		0.582	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	353	0.00	0	A	NM_019609		2776651	2776651	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	missense	90	54.55	108	SNP	0.987	G
CSRNP2	81566	genome.wustl.edu	37	12	51457830	51457830	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:51457830G>C	ENST00000228515.1	-	5	1628	c.1331C>G	c.(1330-1332)cCa>cGa	p.P444R		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	444					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						CTTCTCCTTTGGGAAAGAGGC	0.527																																						dbGAP											0													69.0	74.0	73.0					12																	51457830		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1331C>G	12.37:g.51457830G>C	ENSP00000228515:p.Pro444Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.P444R	ENST00000228515.1	37	c.1331	CCDS8807.1	12	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745353	0.49151	.	.	ENSG00000110925	ENST00000228515	T	0.47869	0.83	4.38	4.38	0.52667	.	0.081250	0.48767	D	0.000164	T	0.29355	0.0731	N	0.14661	0.345	0.37325	D	0.909733	P	0.36837	0.571	B	0.30179	0.112	T	0.41360	-0.9513	10	0.54805	T	0.06	-13.2515	14.8682	0.70434	0.0:0.0:1.0:0.0	.	444	Q9H175	CSRN2_HUMAN	R	444	ENSP00000228515:P444R	ENSP00000228515:P444R	P	-	2	0	CSRNP2	49744097	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	4.553000	0.60753	2.728000	0.93425	0.555000	0.69702	CCA	CSRNP2	-	NULL	ENSG00000110925		0.527	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP2	HGNC	protein_coding	OTTHUMT00000404893.1	174	0.00	0	G			51457830	51457830	-1	no_errors	ENST00000228515	ensembl	human	known	69_37n	missense	97	12.50	14	SNP	1.000	C
CT45A5	441521	genome.wustl.edu	37	X	134947485	134947485	+	Silent	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:134947485A>T	ENST00000463085.2	-	4	551	c.462T>A	c.(460-462)ccT>ccA	p.P154P	CT45A4_ENST00000420087.2_Intron|CT45A5_ENST00000491480.1_Silent_p.P154P|CT45A5_ENST00000370724.3_Silent_p.P154P			Q6NSH3	CT455_HUMAN	cancer/testis antigen family 45, member A5	154										endometrium(1)|large_intestine(2)|lung(6)	9						TGACTGCAGTAGGTCCTTGCA	0.353																																						dbGAP											0													1.0	1.0	1.0					X																	134947485		536	757	1293	-	-	-	SO:0001819	synonymous_variant	0			AY743713	CCDS35406.1	Xq26.3	2009-03-12				ENSG00000269586			33270	protein-coding gene	gene with protein product	"""cancer/testis antigen CT45-5"""	300796				15905330	Standard	XM_006724759		Approved	CT45-5, CT45.5	uc022ces.1	Q6NSH3		ENST00000463085.2:c.462T>A	X.37:g.134947485A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K842|B7ZMC5	Silent	SNP	superfamily_RmlC_Cupin	p.P154	ENST00000463085.2	37	c.462	CCDS35406.1	X																																																																																			CT45A5	-	NULL	ENSG00000242284		0.353	CT45A5-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CT45A5	HGNC	protein_coding	OTTHUMT00000472589.1	90	0.00	0	A	NM_001007551		134947485	134947485	-1	no_errors	ENST00000370724	ensembl	human	known	69_37n	silent	21	68.18	45	SNP	0.006	T
CUBN	8029	genome.wustl.edu	37	10	16893355	16893355	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:16893355T>C	ENST00000377833.4	-	60	9607	c.9542A>G	c.(9541-9543)aAg>aGg	p.K3181R		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	3181	CUB 24. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GTTTAAATTCTTGTCATACAT	0.408																																						dbGAP											0													124.0	113.0	116.0					10																	16893355		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.9542A>G	10.37:g.16893355T>C	ENSP00000367064:p.Lys3181Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.K3181R	ENST00000377833.4	37	c.9542	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	T	7.009	0.556352	0.13436	.	.	ENSG00000107611	ENST00000377833;ENST00000545090	T	0.51071	0.72	5.26	1.35	0.21983	CUB (5);	0.000000	0.41194	D	0.000928	T	0.25419	0.0618	N	0.16016	0.355	0.35808	D	0.823653	B	0.14012	0.009	B	0.14578	0.011	T	0.17048	-1.0382	10	0.15066	T	0.55	.	9.4689	0.38831	0.0:0.3932:0.0:0.6068	.	3181	O60494	CUBN_HUMAN	R	3181;22	ENSP00000367064:K3181R	ENSP00000367064:K3181R	K	-	2	0	CUBN	16933361	0.131000	0.22433	0.454000	0.27019	0.642000	0.38348	0.326000	0.19646	0.241000	0.21283	0.260000	0.18958	AAG	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000107611		0.408	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	251	0.00	0	T	NM_001081		16893355	16893355	-1	no_errors	ENST00000377833	ensembl	human	known	69_37n	missense	183	35.56	101	SNP	0.135	C
CYP2C8	1558	genome.wustl.edu	37	10	96829054	96829054	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:96829054G>A	ENST00000371270.3	-	1	200	c.106C>T	c.(106-108)Ctt>Ttt	p.L36F	CYP2C8_ENST00000539050.1_5'UTR|CYP2C8_ENST00000535898.1_5'UTR	NM_000770.3|NM_001198853.1|NM_001198855.1	NP_000761.3|NP_001185782.1|NP_001185784.1	P10632	CP2C8_HUMAN	cytochrome P450, family 2, subfamily C, polypeptide 8	36					arachidonic acid metabolic process (GO:0019369)|drug metabolic process (GO:0017144)|epoxygenase P450 pathway (GO:0019373)|exogenous drug catabolic process (GO:0042738)|omega-hydroxylase P450 pathway (GO:0097267)|organic acid metabolic process (GO:0006082)|oxidation-reduction process (GO:0055114)|oxidative demethylation (GO:0070989)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|caffeine oxidase activity (GO:0034875)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)			breast(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(6)|skin(3)	21		Colorectal(252;0.0397)		all cancers(201;6.21e-05)	Abiraterone(DB05812)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Almotriptan(DB00918)|Aminophenazone(DB01424)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amodiaquine(DB00613)|Amprenavir(DB00701)|Antipyrine(DB01435)|Apixaban(DB06605)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzyl alcohol(DB06770)|Bezafibrate(DB01393)|Bortezomib(DB00188)|Brompheniramine(DB00835)|Buprenorphine(DB00921)|Bupropion(DB01156)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Candesartan(DB00796)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Chloramphenicol(DB00446)|Chloroquine(DB00608)|Cholecalciferol(DB00169)|Cimetidine(DB00501)|Cisapride(DB00604)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Cocaine(DB00907)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabrafenib(DB08912)|Dapsone(DB00250)|Delavirdine(DB00705)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Dextropropoxyphene(DB00647)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Diltiazem(DB00343)|Domperidone(DB01184)|Eltrombopag(DB06210)|Enzalutamide(DB08899)|Erlotinib(DB00530)|Estradiol(DB00783)|Eszopiclone(DB00402)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Felodipine(DB01023)|Fenofibrate(DB01039)|Fluorouracil(DB00544)|Fluvastatin(DB01095)|Fosphenytoin(DB01320)|Gemfibrozil(DB01241)|Halofantrine(DB01218)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Ifosfamide(DB01181)|Irbesartan(DB01029)|Isoniazid(DB00951)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Ketoprofen(DB01009)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Liotrix(DB01583)|Loperamide(DB00836)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Medroxyprogesterone Acetate(DB00603)|Mefenamic acid(DB00784)|Meloxicam(DB00814)|Methadone(DB00333)|Metronidazole(DB00916)|Mirtazapine(DB00370)|Mometasone(DB00764)|Montelukast(DB00471)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Naloxone(DB01183)|Naproxen(DB00788)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nilutamide(DB00665)|Nilvadipine(DB06712)|Omeprazole(DB00338)|Oxybutynin(DB01062)|Paclitaxel(DB01229)|Paramethadione(DB00617)|Paroxetine(DB00715)|Pazopanib(DB06589)|Pentamidine(DB00738)|Perphenazine(DB00850)|Phenelzine(DB00780)|Phenobarbital(DB01174)|Phenprocoumon(DB00946)|Phenytoin(DB00252)|Pioglitazone(DB01132)|Piroxicam(DB00554)|Pitavastatin(DB08860)|Ponatinib(DB08901)|Pravastatin(DB00175)|Primidone(DB00794)|Probenecid(DB01032)|Progesterone(DB00396)|Propafenone(DB01182)|Propofol(DB00818)|Pyrimethamine(DB00205)|Quinidine(DB00908)|Quinine(DB00468)|Raloxifene(DB00481)|Regorafenib(DB08896)|Repaglinide(DB00912)|Rifampicin(DB01045)|Rifapentine(DB01201)|Ritonavir(DB00503)|Rosiglitazone(DB00412)|Salmeterol(DB00938)|Saquinavir(DB01232)|Secobarbital(DB00418)|Selegiline(DB01037)|Simvastatin(DB00641)|Sitagliptin(DB01261)|Sorafenib(DB00398)|Spironolactone(DB00421)|Sulfadiazine(DB00359)|Sulfamethoxazole(DB01015)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Tazarotene(DB00799)|Temazepam(DB00231)|Terbinafine(DB00857)|Testosterone(DB00624)|Theophylline(DB00277)|Thioridazine(DB00679)|Ticlopidine(DB00208)|Tioconazole(DB01007)|Tolbutamide(DB01124)|Torasemide(DB00214)|Trametinib(DB08911)|Tretinoin(DB00755)|Triazolam(DB00897)|Trimethadione(DB00347)|Trimethoprim(DB00440)|Troleandomycin(DB01361)|Valproic Acid(DB00313)|Verapamil(DB00661)|Vismodegib(DB08828)|Warfarin(DB00682)|Zafirlukast(DB00549)|Zidovudine(DB00495)|Zopiclone(DB01198)	ATAATAGGAAGAGGAGTGGGG	0.453																																						dbGAP											0													75.0	75.0	75.0					10																	96829054		2203	4300	6503	-	-	-	SO:0001583	missense	0			M17397	CCDS7438.1, CCDS55721.1, CCDS73166.1	10q24.1	2007-12-14	2003-01-14		ENSG00000138115	ENSG00000138115		"""Cytochrome P450s"""	2622	protein-coding gene	gene with protein product		601129	"""cytochrome P450, subfamily IIC (mephenytoin 4-hydroxylase), polypeptide 8"""			7841444	Standard	NM_001198853		Approved	CPC8	uc001kkb.3	P10632	OTTHUMG00000018804	ENST00000371270.3:c.106C>T	10.37:g.96829054G>A	ENSP00000360317:p.Leu36Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9N8|B0AZN2|B7Z1F6|Q5VX93|Q8WWB1|Q9UCZ9	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.L36F	ENST00000371270.3	37	c.106	CCDS7438.1	10	.	.	.	.	.	.	.	.	.	.	G	11.73	1.727069	0.30593	.	.	ENSG00000138115	ENST00000371270	T	0.71103	-0.54	4.63	1.55	0.23275	.	0.199130	0.32518	U	0.005984	T	0.64897	0.2640	M	0.77712	2.385	0.80722	D	1	B	0.12013	0.005	B	0.20577	0.03	T	0.59606	-0.7423	10	0.49607	T	0.09	.	3.7084	0.08410	0.3062:0.0:0.5232:0.1705	.	36	P10632	CP2C8_HUMAN	F	36	ENSP00000360317:L36F	ENSP00000360317:L36F	L	-	1	0	CYP2C8	96819044	0.654000	0.27367	0.999000	0.59377	0.725000	0.41563	0.328000	0.19681	0.431000	0.26258	0.555000	0.69702	CTT	CYP2C8	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000138115		0.453	CYP2C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2C8	HGNC	protein_coding	OTTHUMT00000049499.2	206	0.00	0	G	NM_000770		96829054	96829054	-1	no_errors	ENST00000371270	ensembl	human	known	69_37n	missense	124	44.64	100	SNP	0.995	A
DCHS2	54798	genome.wustl.edu	37	4	155156862	155156862	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:155156862G>C	ENST00000357232.4	-	25	7576	c.7577C>G	c.(7576-7578)tCc>tGc	p.S2526C		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	2526	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TCCTTCAGAGGAGAAAGACAC	0.413																																						dbGAP											0													72.0	74.0	73.0					4																	155156862		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.7577C>G	4.37:g.155156862G>C	ENSP00000349768:p.Ser2526Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S2526C	ENST00000357232.4	37	c.7577	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	14.50	2.552603	0.45487	.	.	ENSG00000197410	ENST00000357232	T	0.61392	0.11	5.53	1.4	0.22301	Cadherin (2);	0.998180	0.08112	N	0.996110	T	0.62011	0.2393	L	0.50333	1.59	0.20403	N	0.999904	D	0.63880	0.993	P	0.53185	0.72	T	0.51764	-0.8664	10	0.56958	D	0.05	.	9.5649	0.39391	0.3199:0.0:0.6801:0.0	.	2526	Q6V1P9	PCD23_HUMAN	C	2526	ENSP00000349768:S2526C	ENSP00000349768:S2526C	S	-	2	0	DCHS2	155376312	0.960000	0.32886	0.001000	0.08648	0.763000	0.43281	2.273000	0.43381	0.167000	0.19631	0.467000	0.42956	TCC	DCHS2	-	smart_Cadherin,pfscan_Cadherin	ENSG00000197410		0.413	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	136	0.00	0	G	NM_001142552		155156862	155156862	-1	no_errors	ENST00000357232	ensembl	human	known	69_37n	missense	77	59.26	112	SNP	0.003	C
DLX5	1749	genome.wustl.edu	37	7	96650328	96650328	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:96650328T>G	ENST00000222598.4	-	3	1063	c.590A>C	c.(589-591)aAa>aCa	p.K197T	DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	197					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CTCCCCGTTTTTCATGATCTT	0.577																																						dbGAP											0													72.0	76.0	75.0					7																	96650328		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.590A>C	7.37:g.96650328T>G	ENSP00000222598:p.Lys197Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.K197T	ENST00000222598.4	37	c.590	CCDS5647.1	7	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243044	0.79912	.	.	ENSG00000105880	ENST00000222598	D	0.96104	-3.91	5.08	5.08	0.68730	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.046779	0.85682	D	0.000000	D	0.97717	0.9251	M	0.84511	2.7	0.80722	D	1	D	0.76494	0.999	D	0.76071	0.987	D	0.98604	1.0660	10	0.87932	D	0	-6.1152	15.0262	0.71671	0.0:0.0:0.0:1.0	.	197	P56178	DLX5_HUMAN	T	197	ENSP00000222598:K197T	ENSP00000222598:K197T	K	-	2	0	DLX5	96488264	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.819000	0.86621	2.134000	0.65973	0.533000	0.62120	AAA	DLX5	-	superfamily_Homeodomain-like,smart_Homeodomain	ENSG00000105880		0.577	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2	250	0.00	0	T			96650328	96650328	-1	no_errors	ENST00000222598	ensembl	human	known	69_37n	missense	133	34.16	69	SNP	1.000	G
DLX5	1749	genome.wustl.edu	37	7	96651583	96651583	+	Silent	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:96651583A>G	ENST00000222598.4	-	2	927	c.454T>C	c.(454-456)Tta>Cta	p.L152L	DLX5_ENST00000486603.2_Silent_p.L152L|DLX5_ENST00000493764.1_5'UTR	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	152					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					CTTCTCTGTAATGCGGCCAGC	0.522																																						dbGAP											0													117.0	116.0	116.0					7																	96651583		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.454T>C	7.37:g.96651583A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P3|Q9UPL1	Silent	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.L152	ENST00000222598.4	37	c.454	CCDS5647.1	7																																																																																			DLX5	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000105880		0.522	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2	250	0.00	0	A			96651583	96651583	-1	no_errors	ENST00000222598	ensembl	human	known	69_37n	silent	170	32.27	81	SNP	1.000	G
DNAH7	56171	genome.wustl.edu	37	2	196740462	196740462	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:196740462G>C	ENST00000312428.6	-	38	6323	c.6223C>G	c.(6223-6225)Cta>Gta	p.L2075V		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	2075	AAA 3. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CAATCTTTTAGATCATACCAG	0.408																																						dbGAP											0													90.0	85.0	86.0					2																	196740462		1882	4110	5992	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.6223C>G	2.37:g.196740462G>C	ENSP00000311273:p.Leu2075Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.L2075V	ENST00000312428.6	37	c.6223	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	G	16.37	3.105160	0.56291	.	.	ENSG00000118997	ENST00000312428	T	0.35421	1.31	4.88	4.88	0.63580	ATPase, AAA+ type, core (1);	0.068891	0.56097	D	0.000031	T	0.60222	0.2252	M	0.85710	2.77	0.80722	D	1	P	0.45902	0.868	P	0.56648	0.803	T	0.61481	-0.7054	10	0.35671	T	0.21	.	17.8218	0.88652	0.0:0.0:1.0:0.0	.	2075	Q8WXX0	DYH7_HUMAN	V	2075	ENSP00000311273:L2075V	ENSP00000311273:L2075V	L	-	1	2	DNAH7	196448707	1.000000	0.71417	1.000000	0.80357	0.829000	0.46940	2.661000	0.46758	2.550000	0.86006	0.655000	0.94253	CTA	DNAH7	-	smart_AAA+_ATPase	ENSG00000118997		0.408	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	178	0.00	0	G	NM_018897		196740462	196740462	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	148	36.75	86	SNP	1.000	C
DNAJC13	23317	genome.wustl.edu	37	3	132247140	132247140	+	Silent	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:132247140C>G	ENST00000260818.6	+	54	6737	c.6489C>G	c.(6487-6489)ctC>ctG	p.L2163L		NM_015268.3	NP_056083.3	O75165	DJC13_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 13	2163					osteoblast differentiation (GO:0001649)	extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)				breast(4)|endometrium(2)|kidney(2)|large_intestine(5)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|urinary_tract(1)	34						TTAAAGCTCTCAAGGCAATGA	0.453																																						dbGAP											0													87.0	90.0	89.0					3																	132247140		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014578	CCDS33857.1	3q22.1	2011-09-02			ENSG00000138246	ENSG00000138246		"""Heat shock proteins / DNAJ (HSP40)"""	30343	protein-coding gene	gene with protein product		614334				12438707	Standard	NM_015268		Approved	RME8, KIAA0678	uc003eor.3	O75165	OTTHUMG00000159674	ENST00000260818.6:c.6489C>G	3.37:g.132247140C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3L0T1|Q6PI82|Q6UJ77|Q6ZSW1|Q6ZUT5|Q86XG3|Q96DC1|Q9BWK9	Nonsense_Mutation	SNP	NULL	p.S32*	ENST00000260818.6	37	c.95	CCDS33857.1	3																																																																																			DNAJC13	-	NULL	ENSG00000138246		0.453	DNAJC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC13	HGNC	protein_coding	OTTHUMT00000356807.2	239	0.00	0	C	NM_015268		132247140	132247140	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000509279	ensembl	human	known	69_37n	nonsense	153	50.96	159	SNP	0.999	G
ECE2	9718	genome.wustl.edu	37	3	184008058	184008058	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:184008058G>T	ENST00000402825.3	+	14	1921	c.1921G>T	c.(1921-1923)Gat>Tat	p.D641Y	ECE2_ENST00000359140.4_Missense_Mutation_p.D494Y|ECE2_ENST00000357474.5_Missense_Mutation_p.D569Y|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000404464.3_Missense_Mutation_p.D523Y	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	641	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			AATTTCTGAAGATTCTTTCTT	0.448																																						dbGAP											0													55.0	52.0	53.0					3																	184008058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1921G>T	3.37:g.184008058G>T	ENSP00000384223:p.Asp641Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.D641Y	ENST00000402825.3	37	c.1921	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	G	17.20	3.328943	0.60743	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	5.04	5.04	0.67666	.	0.113770	0.56097	D	0.000023	D	0.91620	0.7352	M	0.72479	2.2	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.985;1.0;1.0;0.992	D;D;D;P;D;D;P	0.77004	0.976;0.976;0.943;0.745;0.958;0.989;0.86	D	0.92227	0.5789	10	0.59425	D	0.04	-9.8591	16.9745	0.86309	0.0:0.0:1.0:0.0	.	243;494;512;523;569;494;641	B4DHU4;B4DKF3;B4DF19;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;.;ECE2_HUMAN	Y	641;494;523;569;515	ENSP00000384223:D641Y;ENSP00000352052:D494Y;ENSP00000385846:D523Y;ENSP00000350066:D569Y;ENSP00000398444:D515Y	ENSP00000350066:D569Y	D	+	1	0	ECE2	185490752	1.000000	0.71417	1.000000	0.80357	0.681000	0.39784	7.638000	0.83328	2.347000	0.79759	0.448000	0.29417	GAT	ECE2	-	NULL	ENSG00000145194		0.448	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	275	0.36	1	G	NM_014693		184008058	184008058	+1	no_errors	ENST00000402825	ensembl	human	known	69_37n	missense	286	32.39	137	SNP	1.000	T
EML6	400954	genome.wustl.edu	37	2	55093957	55093957	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:55093957G>A	ENST00000356458.6	+	13	2507	c.1987G>A	c.(1987-1989)Gca>Aca	p.A663T		NM_001039753.2	NP_001034842.2	Q6ZMW3	EMAL6_HUMAN	echinoderm microtubule associated protein like 6	663						cytoplasm (GO:0005737)|microtubule (GO:0005874)				breast(1)|endometrium(6)	7						GAAAAACCACGCAGTGCCCTT	0.473																																						dbGAP											0													75.0	76.0	76.0					2																	55093957		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46286.1	2p16.1	2013-01-10			ENSG00000214595	ENSG00000214595		"""WD repeat domain containing"""	35412	protein-coding gene	gene with protein product							Standard	NM_001039753		Approved	FLJ42562	uc002ryb.4	Q6ZMW3	OTTHUMG00000152035	ENST00000356458.6:c.1987G>A	2.37:g.55093957G>A	ENSP00000348842:p.Ala663Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUB5|B6ZDG7	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A663T	ENST00000356458.6	37	c.1987	CCDS46286.1	2	.	.	.	.	.	.	.	.	.	.	G	10.72	1.430300	0.25726	.	.	ENSG00000214595	ENST00000356458	T	0.34859	1.34	5.77	3.86	0.44501	.	404.118000	0.04012	U	0.298275	T	0.25827	0.0629	N	0.14661	0.345	0.20703	N	0.999869	B	0.10296	0.003	B	0.04013	0.001	T	0.10245	-1.0638	10	0.09084	T	0.74	.	13.9295	0.63986	0.0:0.0:0.5769:0.423	.	663	Q6ZMW3	EMAL6_HUMAN	T	663	ENSP00000348842:A663T	ENSP00000348842:A663T	A	+	1	0	EML6	54947461	0.326000	0.24669	0.989000	0.46669	0.897000	0.52465	1.859000	0.39418	1.557000	0.49525	-0.182000	0.12963	GCA	EML6	-	NULL	ENSG00000214595		0.473	EML6-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	EML6	HGNC	protein_coding	OTTHUMT00000324997.3	139	0.71	1	G	XM_001725002		55093957	55093957	+1	no_errors	ENST00000356458	ensembl	human	novel	69_37n	missense	101	36.88	59	SNP	0.988	A
ENTPD2	954	genome.wustl.edu	37	9	139946068	139946068	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:139946068G>C	ENST00000355097.2	-	3	327	c.280C>G	c.(280-282)Cag>Gag	p.Q94E	RP11-229P13.15_ENST00000439076.1_RNA|ENTPD2_ENST00000460614.1_5'Flank|ENTPD2_ENST00000312665.5_Missense_Mutation_p.Q94E	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	94					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		ACAAGACTCTGGCTGGCCCCA	0.632																																						dbGAP											0													44.0	45.0	45.0					9																	139946068		2199	4299	6498	-	-	-	SO:0001583	missense	0			U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.280C>G	9.37:g.139946068G>C	ENSP00000347213:p.Gln94Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	O15464|Q5SPY6|Q5SPY7	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.Q94E	ENST00000355097.2	37	c.280	CCDS7026.1	9	.	.	.	.	.	.	.	.	.	.	G	1.033	-0.681310	0.03353	.	.	ENSG00000054179	ENST00000355097;ENST00000312665	T;T	0.10005	2.92;2.92	4.26	4.26	0.50523	.	0.341047	0.28583	N	0.014834	T	0.05227	0.0139	N	0.16037	0.36	0.27433	N	0.953938	B;B	0.17268	0.021;0.006	B;B	0.16722	0.016;0.007	T	0.37126	-0.9719	10	0.02654	T	1	-17.3432	9.7566	0.40506	0.0:0.0:0.6704:0.3295	.	94;94	Q9Y5L3-2;Q9Y5L3	.;ENTP2_HUMAN	E	94	ENSP00000347213:Q94E;ENSP00000312494:Q94E	ENSP00000312494:Q94E	Q	-	1	0	ENTPD2	139065889	0.091000	0.21658	0.998000	0.56505	0.779000	0.44077	1.488000	0.35551	2.203000	0.70933	0.561000	0.74099	CAG	ENTPD2	-	pfam_GDA1_CD39_NTPase	ENSG00000054179		0.632	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD2	HGNC	protein_coding	OTTHUMT00000055169.1	100	0.00	0	G	NM_203468		139946068	139946068	-1	no_errors	ENST00000355097	ensembl	human	known	69_37n	missense	53	28.38	21	SNP	0.999	C
ETNK1	55500	genome.wustl.edu	37	12	22796922	22796922	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:22796922G>A	ENST00000266517.4	+	2	738	c.649G>A	c.(649-651)Gat>Aat	p.D217N	ETNK1_ENST00000335148.3_Missense_Mutation_p.D217N	NM_018638.4	NP_061108.2	Q9HBU6	EKI1_HUMAN	ethanolamine kinase 1	217					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|ethanolamine kinase activity (GO:0004305)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16						AGAAGCACTGGATCCAAAGCA	0.378																																					Esophageal Squamous(42;87 913 3224 6226 43339)	dbGAP											0													106.0	92.0	96.0					12																	22796922		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC006111	CCDS8698.1, CCDS41760.1	12p12.2	2004-07-09			ENSG00000139163	ENSG00000139163			24649	protein-coding gene	gene with protein product		609858				11912161, 11044454	Standard	XM_005253420		Approved	EKI1, EKI	uc001rft.3	Q9HBU6	OTTHUMG00000169008	ENST00000266517.4:c.649G>A	12.37:g.22796922G>A	ENSP00000266517:p.Asp217Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	G5E969	Nonsense_Mutation	SNP	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.W207*	ENST00000266517.4	37	c.621	CCDS8698.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.88|16.88	3.245588|3.245588	0.59103|0.59103	.|.	.|.	ENSG00000139163|ENSG00000139163	ENST00000266517;ENST00000381409;ENST00000335148|ENST00000538218;ENST00000541247	T;T|.	0.58652|.	0.32;0.32|.	5.36|5.36	4.47|4.47	0.54385|0.54385	Protein kinase-like domain (1);Choline/ethanolamine kinase (1);|.	0.056273|.	0.64402|.	D|.	0.000001|.	T|.	0.59321|.	0.2185|.	L|L	0.43923|0.43923	1.385|1.385	0.44500|0.44500	D|D	0.99744|0.99744	B;B;P|.	0.37276|.	0.392;0.425;0.589|.	B;B;B|.	0.44044|.	0.241;0.223;0.439|.	T|.	0.56481|.	-0.7972|.	10|.	0.23891|.	T|.	0.37|.	-13.5448|-13.5448	13.9098|13.9098	0.63860|0.63860	0.0731:0.0:0.9269:0.0|0.0731:0.0:0.9269:0.0	.|.	217;217;217|.	E9PD44;Q9HBU6;G5E969|.	.;EKI1_HUMAN;.|.	N|X	217|207;96	ENSP00000266517:D217N;ENSP00000334041:D217N|.	ENSP00000266517:D217N|.	D|W	+|+	1|3	0|0	ETNK1|ETNK1	22688189|22688189	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.972000|0.972000	0.66771|0.66771	8.946000|8.946000	0.92992|0.92992	1.399000|1.399000	0.46721|0.46721	0.557000|0.557000	0.71058|0.71058	GAT|TGG	ETNK1	-	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,superfamily_Kinase-like_dom	ENSG00000139163		0.378	ETNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETNK1	HGNC	protein_coding	OTTHUMT00000401926.2	143	0.00	0	G	NM_018638		22796922	22796922	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538218	ensembl	human	putative	69_37n	nonsense	345	16.67	69	SNP	1.000	A
EP400NL	347918	genome.wustl.edu	37	12	132589226	132589226	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:132589226G>A	ENST00000376625.4	+	1	687	c.661G>A	c.(661-663)Ggc>Agc	p.G221S	EP400NL_ENST00000392352.1_Missense_Mutation_p.G89S|EP400NL_ENST00000389560.2_Missense_Mutation_p.G152S|EP400NL_ENST00000443539.2_Missense_Mutation_p.G89S|EP400NL_ENST00000361109.5_Missense_Mutation_p.G89S			Q6ZTU2	E400N_HUMAN	EP400 N-terminal like	221										endometrium(1)|lung(1)|prostate(2)|urinary_tract(1)	5						ACAGTCAGGGGGCACCATCCA	0.701																																						dbGAP											0													2.0	3.0	3.0					12																	132589226		467	1333	1800	-	-	-	SO:0001583	missense	0			AK091234		12q24.33	2013-02-15			ENSG00000185684	ENSG00000185684			26602	protein-coding gene	gene with protein product						12477932	Standard	NR_003290		Approved	FLJ33915	uc009zyq.3	Q6ZTU2	OTTHUMG00000168251	ENST00000376625.4:c.661G>A	12.37:g.132589226G>A	ENSP00000365812:p.Gly221Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLB7|A8K0Z5|B3KQY2|Q6NXP1|Q8N253|Q8N7S7|Q9UFJ3	Missense_Mutation	SNP	NULL	p.G221S	ENST00000376625.4	37	c.661		12	.	.	.	.	.	.	.	.	.	.	G	17.37	3.373250	0.61624	.	.	ENSG00000185684	ENST00000454179;ENST00000389560;ENST00000443539;ENST00000392352;ENST00000407361;ENST00000539205;ENST00000361109;ENST00000376625	.	.	.	2.98	2.98	0.34508	.	0.000000	0.33419	U	0.004922	T	0.73916	0.3648	.	.	.	0.32543	N	0.5334	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.81448	-0.0928	8	0.59425	D	0.04	.	14.2175	0.65802	0.0:0.0:1.0:0.0	.	221;89;221	Q6ZTU2-6;Q6ZTU2-5;Q6ZTU2	.;.;E400N_HUMAN	S	152;152;89;89;89;152;89;221	.	ENSP00000328997:G153S	G	+	1	0	EP400NL	131155179	1.000000	0.71417	0.993000	0.49108	0.656000	0.38851	7.376000	0.79658	1.356000	0.45884	0.305000	0.20034	GGC	EP400NL	-	NULL	ENSG00000185684		0.701	EP400NL-202	KNOWN	basic|appris_candidate_longest	protein_coding	EP400NL	HGNC	protein_coding		19	0.00	0	G	NM_182613		132589226	132589226	+1	no_errors	ENST00000376625	ensembl	human	known	69_37n	missense	4	33.33	2	SNP	0.998	A
F5	2153	genome.wustl.edu	37	1	169509636	169509636	+	Silent	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:169509636A>G	ENST00000367797.3	-	13	4893	c.4692T>C	c.(4690-4692)ccT>ccC	p.P1564P	F5_ENST00000367796.3_Silent_p.P1569P	NM_000130.4	NP_000121	P12259	FA5_HUMAN	coagulation factor V (proaccelerin, labile factor)	1564	B.				blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	copper ion binding (GO:0005507)			NS(1)|breast(4)|central_nervous_system(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(55)|ovary(3)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(1)	128	all_hematologic(923;0.208)				ART-123(DB05777)|Drotrecogin alfa(DB00055)	CAATGTTGTCAGGATCTCTGG	0.408																																						dbGAP											0													116.0	111.0	113.0					1																	169509636		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14335	CCDS1281.1	1q23	2012-10-02			ENSG00000198734	ENSG00000198734			3542	protein-coding gene	gene with protein product		612309					Standard	NM_000130		Approved		uc001ggg.1	P12259	OTTHUMG00000034595	ENST00000367797.3:c.4692T>C	1.37:g.169509636A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E8|Q14285|Q2EHR5|Q5R346|Q5R347|Q6UPU6|Q8WWQ6	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.P1569	ENST00000367797.3	37	c.4707	CCDS1281.1	1																																																																																			F5	-	NULL	ENSG00000198734		0.408	F5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	F5	HGNC	protein_coding	OTTHUMT00000083712.1	430	0.46	2	A	NM_000130		169509636	169509636	-1	no_errors	ENST00000367796	ensembl	human	known	69_37n	silent	569	14.18	94	SNP	0.896	G
FAM161A	84140	genome.wustl.edu	37	2	62067332	62067332	+	Silent	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:62067332G>C	ENST00000405894.3	-	3	908	c.807C>G	c.(805-807)ctC>ctG	p.L269L	FAM161A_ENST00000404929.1_Silent_p.L269L	NM_032180.2	NP_115556.2	Q3B820	F161A_HUMAN	family with sequence similarity 161, member A	269					cilium assembly (GO:0042384)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|photoreceptor connecting cilium (GO:0032391)				breast(1)|endometrium(5)|large_intestine(8)|lung(4)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25						CTTGTTTTTTGAGCGCTTTAT	0.378																																						dbGAP											0													192.0	170.0	177.0					2																	62067332		1826	4084	5910	-	-	-	SO:0001819	synonymous_variant	0				CCDS42687.2, CCDS56120.1	2p15	2011-03-15			ENSG00000170264	ENSG00000170264			25808	protein-coding gene	gene with protein product		613596	"""retinitis pigmentosa 28 (autosomal recessive)"""	RP28		10507729, 20705278, 20705279	Standard	NM_032180		Approved	FLJ13305	uc002sbm.4	Q3B820	OTTHUMG00000152165	ENST00000405894.3:c.807C>G	2.37:g.62067332G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJV7|Q9H8R2	Nonsense_Mutation	SNP	pfam_UPF0564	p.S265*	ENST00000405894.3	37	c.794	CCDS42687.2	2																																																																																			FAM161A	-	pfam_UPF0564	ENSG00000170264		0.378	FAM161A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM161A	HGNC	protein_coding	OTTHUMT00000325537.2	598	0.00	0	G	NM_032180		62067332	62067332	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000418113	ensembl	human	known	69_37n	nonsense	474	39.22	320	SNP	0.859	C
FAM86C1	55199	genome.wustl.edu	37	11	71507236	71507236	+	Intron	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:71507236C>T	ENST00000359244.4	+	4	434				FAM86C1_ENST00000346333.6_Intron|FAM86C1_ENST00000426628.2_Intron	NM_018172.2	NP_060642.2	Q9NVL1	FA86C_HUMAN	family with sequence similarity 86, member C1											lung(1)	1						CCCACCCGGGCCTGCATGGTC	0.622																																						dbGAP											0													79.0	91.0	87.0					11																	71507236		2200	4293	6493	-	-	-	SO:0001627	intron_variant	0			AK130709	CCDS8202.1, CCDS41686.1, CCDS44664.1	11q13.4	2011-07-07	2011-07-07	2011-07-07	ENSG00000158483	ENSG00000158483			25561	protein-coding gene	gene with protein product			"""family with sequence similarity 86, member C"""	FAM86C		12477932	Standard	NM_152563		Approved	FLJ10661, FLJ27199	uc001oqv.4	Q9NVL1	OTTHUMG00000160552	ENST00000359244.4:c.411+24C>T	11.37:g.71507236C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5D3	Silent	SNP	NULL	p.G111	ENST00000359244.4	37	c.333	CCDS41686.1	11																																																																																			FAM86C1	-	NULL	ENSG00000158483		0.622	FAM86C1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM86C1	HGNC	protein_coding	OTTHUMT00000361120.1	158	0.00	0	C	NM_152563		71507236	71507236	+1	no_errors	ENST00000528685	ensembl	human	putative	69_37n	silent	61	34.41	32	SNP	0.002	T
FBN1	2200	genome.wustl.edu	37	15	48717990	48717990	+	Missense_Mutation	SNP	G	G	T	rs372369490		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:48717990G>T	ENST00000316623.5	-	59	7731	c.7276C>A	c.(7276-7278)Cat>Aat	p.H2426N		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2426	EGF-like 41; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		CAAATGCAATGATATGATCCT	0.353																																						dbGAP											0													136.0	116.0	123.0					15																	48717990		2198	4296	6494	-	-	-	SO:0001583	missense	0			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.7276C>A	15.37:g.48717990G>T	ENSP00000325527:p.His2426Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_EGF-like_Ca-bd,pirsf_Fibrillin,pfscan_EG-like_dom	p.H2426N	ENST00000316623.5	37	c.7276	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617561	0.66787	.	.	ENSG00000166147	ENST00000316623	D	0.91521	-2.86	6.17	6.17	0.99709	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.299915	0.38111	N	0.001818	D	0.83986	0.5373	N	0.11698	0.16	0.80722	D	1	B	0.27791	0.189	B	0.22386	0.039	T	0.79398	-0.1820	10	0.46703	T	0.11	.	20.4745	0.99168	0.0:0.0:1.0:0.0	.	2426	P35555	FBN1_HUMAN	N	2426	ENSP00000325527:H2426N	ENSP00000325527:H2426N	H	-	1	0	FBN1	46505282	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	5.801000	0.69115	2.941000	0.99782	0.655000	0.94253	CAT	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Fibrillin,pfscan_EG-like_dom	ENSG00000166147		0.353	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	445	0.22	1	G			48717990	48717990	-1	no_errors	ENST00000316623	ensembl	human	known	69_37n	missense	305	34.82	164	SNP	1.000	T
FCER1A	2205	genome.wustl.edu	37	1	159273955	159273955	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:159273955A>T	ENST00000368115.1	+	4	413	c.314A>T	c.(313-315)tAc>tTc	p.Y105F	FCER1A_ENST00000368114.1_Missense_Mutation_p.Y72F	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide	105	Ig-like 1.				activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	GAACCTGTGTACCTGGAAGTC	0.398																																						dbGAP											0													73.0	73.0	73.0					1																	159273955		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.314A>T	1.37:g.159273955A>T	ENSP00000357097:p.Tyr105Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Y105F	ENST00000368115.1	37	c.314	CCDS1184.1	1	.	.	.	.	.	.	.	.	.	.	A	4.576	0.106971	0.08780	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	T;T	0.07800	3.16;3.16	4.7	0.82	0.18793	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.358570	0.04679	N	0.411951	T	0.05044	0.0135	M	0.63428	1.95	0.09310	N	1	B	0.28233	0.204	B	0.38327	0.271	T	0.47699	-0.9097	10	0.51188	T	0.08	.	5.2334	0.15434	0.5538:0.3499:0.0963:0.0	.	105	P12319	FCERA_HUMAN	F	105;72	ENSP00000357097:Y105F;ENSP00000357096:Y72F	ENSP00000357096:Y72F	Y	+	2	0	FCER1A	157540579	0.000000	0.05858	0.004000	0.12327	0.416000	0.31233	-0.058000	0.11750	0.262000	0.21774	0.460000	0.39030	TAC	FCER1A	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000179639		0.398	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCER1A	HGNC	protein_coding	OTTHUMT00000090328.2	148	0.00	0	A	NM_002001		159273955	159273955	+1	no_errors	ENST00000368115	ensembl	human	known	69_37n	missense	150	54.55	180	SNP	0.001	T
FGA	2243	genome.wustl.edu	37	4	155510695	155510695	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:155510695C>A	ENST00000302053.3	-	2	152	c.74G>T	c.(73-75)gGt>gTt	p.G25V	FGA_ENST00000403106.3_Missense_Mutation_p.G25V	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	25					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	TAGAAAGTCACCTTCACCACT	0.478																																					NSCLC(143;340 1922 20892 22370 48145)	dbGAP											0													138.0	129.0	132.0					4																	155510695		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.74G>T	4.37:g.155510695C>A	ENSP00000306361:p.Gly25Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.G25V	ENST00000302053.3	37	c.74	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	C	18.14	3.556855	0.65425	.	.	ENSG00000171560	ENST00000302053;ENST00000403106;ENST00000457487	T;T	0.59502	0.26;2.72	5.23	5.23	0.72850	.	1.270450	0.04834	N	0.439200	T	0.78375	0.4273	M	0.62723	1.935	0.28892	N	0.893768	D;D;D	0.89917	0.964;1.0;0.993	P;D;P	0.71656	0.784;0.974;0.861	T	0.69397	-0.5156	10	0.72032	D	0.01	.	18.4192	0.90584	0.0:1.0:0.0:0.0	.	25;25;25	A8K3E4;P02671-2;P02671	.;.;FIBA_HUMAN	V	25	ENSP00000306361:G25V;ENSP00000385981:G25V	ENSP00000306361:G25V	G	-	2	0	FGA	155730145	0.000000	0.05858	0.425000	0.26659	0.136000	0.21042	0.162000	0.16501	2.439000	0.82584	0.557000	0.71058	GGT	FGA	-	NULL	ENSG00000171560		0.478	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1	266	0.00	0	C	NM_000508		155510695	155510695	-1	no_errors	ENST00000302053	ensembl	human	known	69_37n	missense	188	53.10	214	SNP	0.081	A
FGF7	2252	genome.wustl.edu	37	15	49716609	49716609	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:49716609C>T	ENST00000267843.4	+	2	726	c.115C>T	c.(115-117)Caa>Taa	p.Q39*	FAM227B_ENST00000561064.1_Intron|FAM227B_ENST00000299338.6_Intron|FGF7_ENST00000560270.1_Nonsense_Mutation_p.Q39*	NM_002009.3	NP_002000.1	P21781	FGF7_HUMAN	fibroblast growth factor 7	39					actin cytoskeleton reorganization (GO:0031532)|branching involved in salivary gland morphogenesis (GO:0060445)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis development (GO:0008544)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|hair follicle morphogenesis (GO:0031069)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mesenchymal cell proliferation (GO:0010463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of keratinocyte migration (GO:0051549)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein localization to cell surface (GO:0034394)|regulation of branching involved in salivary gland morphogenesis by mesenchymal-epithelial signaling (GO:0060665)|response to wounding (GO:0009611)|secretion by lung epithelial cell involved in lung growth (GO:0061033)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	chemoattractant activity (GO:0042056)|growth factor activity (GO:0008083)|heparin binding (GO:0008201)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5		all_lung(180;0.00391)		all cancers(107;3.61e-08)|GBM - Glioblastoma multiforme(94;4.06e-05)		GACTCCAGAGCAAATGGCTAC	0.433																																						dbGAP											0													159.0	141.0	147.0					15																	49716609		2196	4295	6491	-	-	-	SO:0001587	stop_gained	0			M60828	CCDS10131.1	15q21.2	2014-01-30	2010-08-18		ENSG00000140285	ENSG00000140285		"""Endogenous ligands"""	3685	protein-coding gene	gene with protein product	"""keratinocyte growth factor"""	148180	"""fibroblast growth factor 7 (keratinocyte growth factor)"""			7749227, 1409637	Standard	NM_002009		Approved	KGF	uc001zxn.3	P21781	OTTHUMG00000131517	ENST00000267843.4:c.115C>T	15.37:g.49716609C>T	ENSP00000267843:p.Gln39*	Somatic		WXS	Illumina GAIIx	Phase_IV	H0YNY5|Q6FGV5|Q96FG5	Nonsense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.Q39*	ENST00000267843.4	37	c.115	CCDS10131.1	15	.	.	.	.	.	.	.	.	.	.	C	38	7.251510	0.98164	.	.	ENSG00000140285	ENST00000267843	.	.	.	5.7	5.7	0.88788	.	0.154112	0.43416	D	0.000568	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06625	T	0.88	.	19.8389	0.96675	0.0:1.0:0.0:0.0	.	.	.	.	X	39	.	ENSP00000267843:Q39X	Q	+	1	0	FGF7	47503901	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.519000	0.67074	2.703000	0.92315	0.655000	0.94253	CAA	FGF7	-	NULL	ENSG00000140285		0.433	FGF7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF7	HGNC	protein_coding	OTTHUMT00000254374.3	282	0.00	0	C	NM_002009		49716609	49716609	+1	no_errors	ENST00000267843	ensembl	human	known	69_37n	nonsense	227	37.57	139	SNP	1.000	T
FIGF	2277	genome.wustl.edu	37	X	15381257	15381257	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:15381257G>C	ENST00000297904.3	-	2	704	c.275C>G	c.(274-276)aCt>aGt	p.T92S		NM_004469.4	NP_004460.1	O43915	VEGFD_HUMAN	c-fos induced growth factor (vascular endothelial growth factor D)	92					angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|induction of positive chemotaxis (GO:0050930)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive chemotaxis (GO:0050918)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of mast cell chemotaxis (GO:0060754)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)|platelet alpha granule lumen (GO:0031093)	chemoattractant activity (GO:0042056)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor binding (GO:0005172)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	17	Hepatocellular(33;0.183)					GTCATAGAAAGTTGCCGCAAA	0.438																																						dbGAP											0													94.0	77.0	83.0					X																	15381257		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000185	CCDS14166.1	Xp22.31	2008-02-05			ENSG00000165197	ENSG00000165197			3708	protein-coding gene	gene with protein product		300091		VEGFD		9479493	Standard	NM_004469		Approved	VEGF-D	uc004cwt.2	O43915	OTTHUMG00000021175	ENST00000297904.3:c.275C>G	X.37:g.15381257G>C	ENSP00000297904:p.Thr92Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7Z3	Missense_Mutation	SNP	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor	p.T92S	ENST00000297904.3	37	c.275	CCDS14166.1	X	.	.	.	.	.	.	.	.	.	.	G	15.23	2.772768	0.49680	.	.	ENSG00000165197	ENST00000297904	.	.	.	5.76	5.76	0.90799	.	0.114699	0.64402	D	0.000020	T	0.49372	0.1553	L	0.47716	1.5	0.29791	N	0.833171	B	0.17465	0.022	B	0.16289	0.015	T	0.47045	-0.9147	9	0.39692	T	0.17	-34.061	17.8265	0.88667	0.0:0.0:1.0:0.0	.	92	O43915	VEGFD_HUMAN	S	92	.	ENSP00000297904:T92S	T	-	2	0	FIGF	15291178	1.000000	0.71417	0.997000	0.53966	0.992000	0.81027	3.830000	0.55768	2.428000	0.82296	0.594000	0.82650	ACT	FIGF	-	NULL	ENSG00000165197		0.438	FIGF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIGF	HGNC	protein_coding	OTTHUMT00000055859.1	188	0.00	0	G	NM_004469		15381257	15381257	-1	no_errors	ENST00000297904	ensembl	human	known	69_37n	missense	48	60.00	72	SNP	0.997	C
FLG	2312	genome.wustl.edu	37	1	152279371	152279371	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:152279371C>T	ENST00000368799.1	-	3	8026	c.7991G>A	c.(7990-7992)aGc>aAc	p.S2664N	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2664	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTGTCTGGAGCTGTCTGCTGA	0.547									Ichthyosis																													dbGAP											0													4.0	5.0	5.0					1																	152279371		1172	2523	3695	-	-	-	SO:0001583	missense	0	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.7991G>A	1.37:g.152279371C>T	ENSP00000357789:p.Ser2664Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S2664N	ENST00000368799.1	37	c.7991	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	C	10.81	1.456463	0.26161	.	.	ENSG00000143631	ENST00000368799	T	0.06142	3.34	4.13	1.09	0.20402	.	.	.	.	.	T	0.06371	0.0164	M	0.66939	2.045	0.09310	N	1	D	0.67145	0.996	D	0.64687	0.928	T	0.20907	-1.0261	9	0.33940	T	0.23	.	3.128	0.06413	0.1784:0.5488:0.173:0.0998	.	2664	P20930	FILA_HUMAN	N	2664	ENSP00000357789:S2664N	ENSP00000357789:S2664N	S	-	2	0	FLG	150545995	0.000000	0.05858	0.042000	0.18584	0.020000	0.10135	-0.506000	0.06359	0.129000	0.18514	0.306000	0.20318	AGC	FLG	-	pfam_Filaggrin	ENSG00000143631		0.547	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	23	0.00	0	C	NM_002016		152279371	152279371	-1	no_errors	ENST00000368799	ensembl	human	known	69_37n	missense	13	71.11	32	SNP	0.111	T
FLI1	2313	genome.wustl.edu	37	11	128638063	128638063	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:128638063G>A	ENST00000527786.2	+	3	770	c.281G>A	c.(280-282)gGa>gAa	p.G94E	FLI1_ENST00000344954.6_Missense_Mutation_p.G61E|FLI1_ENST00000534087.2_Missense_Mutation_p.G61E|FLI1_ENST00000281428.8_Missense_Mutation_p.G28E|FLI1_ENST00000525560.1_Intron	NM_001271010.1|NM_002017.4	NP_001257939.1|NP_002008.2	Q01543	FLI1_HUMAN	Fli-1 proto-oncogene, ETS transcription factor	94					blood circulation (GO:0008015)|cell differentiation (GO:0030154)|hemostasis (GO:0007599)|megakaryocyte development (GO:0035855)|organ morphogenesis (GO:0009887)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G94E(1)	EWSR1/FLI1(2569)	NS(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(14)|ovary(3)|prostate(2)	31	all_hematologic(175;0.0641)	Lung NSC(97;0.00588)|all_lung(97;0.00764)|Breast(109;0.0115)|Medulloblastoma(222;0.0523)|all_neural(223;0.0862)|all_hematologic(192;0.182)		OV - Ovarian serous cystadenocarcinoma(99;0.01)|LUSC - Lung squamous cell carcinoma(976;0.0324)|Lung(977;0.0327)		CTGGTGGGCGGAGGCGAGTCC	0.577			T	EWSR1	Ewing sarcoma																																	dbGAP		Dom	yes		11	11q24	2313	Friend leukemia virus integration 1		M	1	Substitution - Missense(1)	central_nervous_system(1)											91.0	95.0	93.0					11																	128638063		2080	4206	6286	-	-	-	SO:0001583	missense	0			M98833	CCDS44768.1, CCDS53725.1, CCDS59230.1, CCDS59231.1	11q24.1-q24.3	2014-09-17	2013-08-07		ENSG00000151702	ENSG00000151702			3749	protein-coding gene	gene with protein product		193067	"""Friend leukemia virus integration 1"""			1765382	Standard	NM_001167681		Approved	SIC-1, EWSR2	uc010sbu.2	Q01543	OTTHUMG00000165792	ENST00000527786.2:c.281G>A	11.37:g.128638063G>A	ENSP00000433488:p.Gly94Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8H2|B4DFV4|B4DTC6|G3V183|Q14319|Q92480|Q9UE07	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.G94E	ENST00000527786.2	37	c.281	CCDS44768.1	11	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196781	0.58126	.	.	ENSG00000151702	ENST00000344954;ENST00000429175;ENST00000534087;ENST00000281428	T;T;T;T	0.13657	2.64;2.57;2.64;2.64	5.19	4.25	0.50352	Sterile alpha motif/pointed domain (1);	0.178113	0.50627	D	0.000119	T	0.27169	0.0666	L	0.53249	1.67	0.50632	D	0.999881	P;B;D	0.58620	0.77;0.138;0.983	B;B;P	0.56343	0.282;0.105;0.796	T	0.01711	-1.1290	10	0.62326	D	0.03	.	14.8219	0.70080	0.0:0.3436:0.6564:0.0	.	94;28;61	Q01543;Q01543-2;B4DTC6	FLI1_HUMAN;.;.	E	61;94;61;28	ENSP00000339627:G61E;ENSP00000399985:G94E;ENSP00000432950:G61E;ENSP00000281428:G28E	ENSP00000281428:G28E	G	+	2	0	FLI1	128143273	1.000000	0.71417	0.956000	0.39512	0.696000	0.40369	3.015000	0.49599	1.139000	0.42245	0.655000	0.94253	GGA	FLI1	-	superfamily_SAM/pointed	ENSG00000151702		0.577	FLI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLI1	HGNC	protein_coding	OTTHUMT00000386226.2	351	0.00	0	G	NM_002017		128638063	128638063	+1	no_errors	ENST00000429175	ensembl	human	known	69_37n	missense	62	62.28	104	SNP	0.995	A
FNDC5	252995	genome.wustl.edu	37	1	33333876	33333876	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:33333876G>A	ENST00000373471.3	-	3	390	c.324C>T	c.(322-324)atC>atT	p.I108I	FNDC5_ENST00000496770.1_Silent_p.I33I|FNDC5_ENST00000609187.1_Silent_p.I33I	NM_001171940.1|NM_153756.2	NP_001165411.2|NP_715637.2	Q8NAU1	FNDC5_HUMAN	fibronectin type III domain containing 5	108	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				positive regulation of brown fat cell differentiation (GO:0090336)|response to muscle activity (GO:0014850)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(2)|ovary(1)	5		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				CCTGAATGGAGATGGCCTGCA	0.617																																						dbGAP											0													109.0	105.0	107.0					1																	33333876		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK092102	CCDS369.1, CCDS369.2, CCDS65483.1	1p34.3	2013-10-16			ENSG00000160097	ENSG00000160097		"""Fibronectin type III domain containing"""	20240	protein-coding gene	gene with protein product	"""irisin"""	611906				12384288, 22237023, 24120943	Standard	NM_153756		Approved	FRCP2	uc001bwg.3	Q8NAU1	OTTHUMG00000004015	ENST00000373471.3:c.324C>T	1.37:g.33333876G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMC9|D3DPQ6|Q6P6D9|Q7Z676	Silent	SNP	superfamily_Fibronectin_type3	p.I33	ENST00000373471.3	37	c.99		1																																																																																			FNDC5	-	superfamily_Fibronectin_type3	ENSG00000160097		0.617	FNDC5-001	KNOWN	non_ATG_start|basic	protein_coding	FNDC5	HGNC	protein_coding	OTTHUMT00000011467.3	152	0.00	0	G	NM_153756		33333876	33333876	-1	no_errors	ENST00000373471	ensembl	human	known	69_37n	silent	56	48.15	52	SNP	1.000	A
FRAS1	80144	genome.wustl.edu	37	4	79188077	79188077	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:79188077G>A	ENST00000325942.6	+	8	1217	c.777G>A	c.(775-777)ctG>ctA	p.L259L	FRAS1_ENST00000264895.6_Silent_p.L259L|FRAS1_ENST00000264899.6_Silent_p.L259L	NM_001166133.1	NP_001159605.1	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	259	VWFC 4. {ECO:0000255|PROSITE- ProRule:PRU00220}.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)	p.L259L(2)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GCCTGCCCCTGAGATGCGGAA	0.507																																						dbGAP											2	Substitution - coding silent(2)	large_intestine(2)											53.0	50.0	51.0					4																	79188077		2010	4173	6183	-	-	-	SO:0001819	synonymous_variant	0			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000325942.6:c.777G>A	4.37:g.79188077G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_VWF_C,superfamily_Growth_fac_rcpt,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,pfscan_VWF_C	p.E102K	ENST00000325942.6	37	c.304	CCDS54772.1	4	.	.	.	.	.	.	.	.	.	.	G	0.183	-1.060565	0.01950	.	.	ENSG00000138759	ENST00000508900	.	.	.	5.34	-1.94	0.07571	.	.	.	.	.	T	0.43366	0.1244	.	.	.	0.54753	D	0.999983	.	.	.	.	.	.	T	0.32771	-0.9894	4	.	.	.	.	4.3138	0.10982	0.3021:0.1244:0.4798:0.0936	.	.	.	.	K	102	.	.	E	+	1	0	FRAS1	79407101	0.018000	0.18449	0.568000	0.28447	0.015000	0.08874	-0.296000	0.08287	-0.150000	0.11195	0.655000	0.94253	GAG	FRAS1	-	pfam_VWF_C,smart_VWC_out,smart_VWF_C,pfscan_VWF_C	ENSG00000138759		0.507	FRAS1-001	NOVEL	basic|CCDS	protein_coding	FRAS1	HGNC	protein_coding	OTTHUMT00000362706.2	238	0.42	1	G			79188077	79188077	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000508900	ensembl	human	putative	69_37n	missense	70	51.39	74	SNP	0.491	A
GCLC	2729	genome.wustl.edu	37	6	53372344	53372344	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:53372344C>G	ENST00000229416.6	-	9	1501	c.1018G>C	c.(1018-1020)Ggt>Cgt	p.G340R	RP1-27K12.4_ENST00000508884.1_RNA	NM_001197115.1|NM_001498.3	NP_001184044.1|NP_001489.1	P48506	GSH1_HUMAN	glutamate-cysteine ligase, catalytic subunit	340					apoptotic mitochondrial changes (GO:0008637)|cell redox homeostasis (GO:0045454)|cellular nitrogen compound metabolic process (GO:0034641)|cysteine metabolic process (GO:0006534)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione derivative biosynthetic process (GO:1901687)|L-ascorbic acid metabolic process (GO:0019852)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|regulation of blood vessel size (GO:0050880)|regulation of mitochondrial depolarization (GO:0051900)|response to arsenic-containing substance (GO:0046685)|response to heat (GO:0009408)|response to hormone (GO:0009725)|response to nitrosative stress (GO:0051409)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|glutamate-cysteine ligase complex (GO:0017109)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|coenzyme binding (GO:0050662)|glutamate binding (GO:0016595)|glutamate-cysteine ligase activity (GO:0004357)|magnesium ion binding (GO:0000287)			breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22	Lung NSC(77;0.0137)				L-Cysteine(DB00151)|Vitamin E(DB00163)	TATTTCTCACCACACTTAGAT	0.343																																						dbGAP											0													154.0	140.0	145.0					6																	53372344		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90656	CCDS4952.1, CCDS75471.1	6p12	2008-02-05				ENSG00000001084	6.3.2.2		4311	protein-coding gene	gene with protein product		606857		GLCLC, GLCL		1350904	Standard	NM_001498		Approved	GCS	uc003pbw.2	P48506		ENST00000229416.6:c.1018G>C	6.37:g.53372344C>G	ENSP00000229416:p.Gly340Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14399	Missense_Mutation	SNP	pfam_GCS	p.G340R	ENST00000229416.6	37	c.1018	CCDS4952.1	6	.	.	.	.	.	.	.	.	.	.	C	10.77	1.444928	0.25987	.	.	ENSG00000001084	ENST00000229416	T	0.72835	-0.69	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.67211	0.2869	N	0.25890	0.77	0.80722	D	1	D	0.69078	0.997	D	0.68621	0.959	T	0.60444	-0.7262	10	0.11485	T	0.65	.	20.2227	0.98327	0.0:1.0:0.0:0.0	.	340	P48506	GSH1_HUMAN	R	340	ENSP00000229416:G340R	ENSP00000229416:G340R	G	-	1	0	GCLC	53480303	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.092000	0.71414	2.778000	0.95560	0.650000	0.86243	GGT	GCLC	-	pfam_GCS	ENSG00000001084		0.343	GCLC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCLC	HGNC	protein_coding	OTTHUMT00000359710.2	519	0.00	0	C			53372344	53372344	-1	no_errors	ENST00000229416	ensembl	human	known	69_37n	missense	774	13.62	122	SNP	1.000	G
GIPR	2696	genome.wustl.edu	37	19	46178065	46178065	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:46178065C>G	ENST00000590918.1	+	7	713	c.614C>G	c.(613-615)gCc>gGc	p.A205G	GIPR_ENST00000263281.3_Missense_Mutation_p.A205G|GIPR_ENST00000304207.8_Missense_Mutation_p.A169G|MIR642A_ENST00000385039.1_RNA	NM_000164.2	NP_000155.1	P48546	GIPR_HUMAN	gastric inhibitory polypeptide receptor	205					activation of adenylate cyclase activity (GO:0007190)|cell surface receptor signaling pathway (GO:0007166)|desensitization of G-protein coupled receptor protein signaling pathway (GO:0002029)|endocrine pancreas development (GO:0031018)|generation of precursor metabolites and energy (GO:0006091)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of insulin secretion (GO:0032024)|response to axon injury (GO:0048678)|response to calcium ion (GO:0051592)|response to fatty acid (GO:0070542)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gastric inhibitory peptide receptor activity (GO:0016519)|peptide hormone binding (GO:0017046)|transmembrane signaling receptor activity (GO:0004888)			endometrium(1)|kidney(2)|lung(5)|prostate(1)|skin(2)|urinary_tract(1)	12		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0056)|GBM - Glioblastoma multiforme(486;0.0832)|Epithelial(262;0.199)		GGGGACCAGGCCCTTGCGCTG	0.572																																						dbGAP											0													69.0	59.0	62.0					19																	46178065		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12671.1	19q13.2-q13.3	2012-08-10				ENSG00000010310		"""GPCR / Class B : Glucagon receptors"""	4271	protein-coding gene	gene with protein product		137241				7490109	Standard	NM_000164		Approved		uc002pcu.1	P48546		ENST00000590918.1:c.614C>G	19.37:g.46178065C>G	ENSP00000467494:p.Ala205Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WP14|B7ZKQ0|Q14401|Q16400|Q52M04|Q9UPI1	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_GIP_rcpt,prints_GPCR_2_secretin-like	p.A205G	ENST00000590918.1	37	c.614	CCDS12671.1	19	.	.	.	.	.	.	.	.	.	.	C	8.222	0.802621	0.16397	.	.	ENSG00000010310	ENST00000263281;ENST00000304207	T;T	0.58060	0.36;1.18	4.53	1.08	0.20341	GPCR, family 2-like (1);	1.086660	0.07104	N	0.841004	T	0.21387	0.0515	N	0.00841	-1.15	0.09310	N	0.999995	B;B;B	0.09022	0.001;0.002;0.0	B;B;B	0.12156	0.002;0.007;0.005	T	0.18999	-1.0319	10	0.27082	T	0.32	.	6.6891	0.23161	0.0:0.5572:0.3463:0.0965	.	169;205;205	B7WP14;P48546;P48546-2	.;GIPR_HUMAN;.	G	205;169	ENSP00000263281:A205G;ENSP00000305321:A169G	ENSP00000263281:A205G	A	+	2	0	GIPR	50869905	0.000000	0.05858	0.088000	0.20740	0.103000	0.19146	0.236000	0.17967	0.226000	0.20979	0.561000	0.74099	GCC	GIPR	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_GIP_rcpt	ENSG00000010310		0.572	GIPR-001	KNOWN	basic|CCDS	protein_coding	GIPR	HGNC	protein_coding	OTTHUMT00000459640.1	108	0.92	1	C			46178065	46178065	+1	no_errors	ENST00000590918	ensembl	human	known	69_37n	missense	63	33.68	32	SNP	0.288	G
GPR153	387509	genome.wustl.edu	37	1	6311508	6311508	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:6311508G>C	ENST00000377893.2	-	4	1128	c.869C>G	c.(868-870)gCc>gGc	p.A290G		NM_207370.2	NP_997253.2	Q6NV75	GP153_HUMAN	G protein-coupled receptor 153	290						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|liver(1)|lung(7)|skin(1)	14	Ovarian(185;0.0634)	all_cancers(23;8.07e-33)|all_epithelial(116;4.45e-18)|all_lung(118;1.09e-06)|all_neural(13;3.68e-06)|Lung NSC(185;1.52e-05)|all_hematologic(16;2.39e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00475)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;1.91e-37)|GBM - Glioblastoma multiforme(13;4.87e-29)|OV - Ovarian serous cystadenocarcinoma(86;3.03e-19)|Colorectal(212;1.33e-07)|COAD - Colon adenocarcinoma(227;1.36e-05)|Kidney(185;4.89e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|BRCA - Breast invasive adenocarcinoma(365;0.00109)|STAD - Stomach adenocarcinoma(132;0.00313)|READ - Rectum adenocarcinoma(331;0.0642)|Lung(427;0.246)		CAGCAGCAGGGCCTGGGCCAC	0.682																																						dbGAP											0													51.0	50.0	50.0					1																	6311508		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY255529	CCDS64.1	1p36.31	2012-08-21			ENSG00000158292	ENSG00000158292		"""GPCR / Class A : Orphans"""	23618	protein-coding gene	gene with protein product		614269				12679517	Standard	NM_207370		Approved	PGR1	uc001amp.2	Q6NV75	OTTHUMG00000001272	ENST00000377893.2:c.869C>G	1.37:g.6311508G>C	ENSP00000367125:p.Ala290Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGR5|Q6AHW8|Q86SP8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_GPCR_153,prints_GPCR_153/162	p.A290G	ENST00000377893.2	37	c.869	CCDS64.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.372637	0.95923	.	.	ENSG00000158292	ENST00000377893	T	0.72835	-0.69	5.45	5.45	0.79879	.	0.174926	0.52532	D	0.000076	T	0.63674	0.2531	N	0.14661	0.345	0.53005	D	0.999967	P	0.49783	0.928	P	0.47573	0.55	T	0.70494	-0.4856	10	0.72032	D	0.01	-39.7692	17.854	0.88756	0.0:0.0:1.0:0.0	.	290	Q6NV75	GP153_HUMAN	G	290	ENSP00000367125:A290G	ENSP00000367125:A290G	A	-	2	0	GPR153	6234095	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.859000	0.99545	2.561000	0.86390	0.643000	0.83706	GCC	GPR153	-	pfam_7TM_GPCR_Rhodpsn,prints_GPCR_153/162	ENSG00000158292		0.682	GPR153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR153	HGNC	protein_coding	OTTHUMT00000003717.2	32	0.00	0	G			6311508	6311508	-1	no_errors	ENST00000377893	ensembl	human	known	69_37n	missense	4	77.78	14	SNP	1.000	C
GPA33	10223	genome.wustl.edu	37	1	167038307	167038307	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:167038307G>A	ENST00000367868.3	-	3	610	c.267C>T	c.(265-267)gtC>gtT	p.V89V	GPA33_ENST00000527955.1_5'UTR	NM_005814.1	NP_005805.1	Q99795	GPA33_HUMAN	glycoprotein A33 (transmembrane)	89	Ig-like V-type.					extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(4)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15						TGGATATGCTGACGCGATTCT	0.488																																						dbGAP											0													169.0	147.0	155.0					1																	167038307		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U79725	CCDS1258.1	1q24.1	2013-01-29			ENSG00000143167	ENSG00000143167		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	4445	protein-coding gene	gene with protein product		602171				9012807, 9245713	Standard	NM_005814		Approved	A33	uc001gea.1	Q99795	OTTHUMG00000034435	ENST00000367868.3:c.267C>T	1.37:g.167038307G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZP6	Silent	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.V89	ENST00000367868.3	37	c.267	CCDS1258.1	1																																																																																			GPA33	-	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143167		0.488	GPA33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPA33	HGNC	protein_coding	OTTHUMT00000083245.1	400	0.00	0	G	NM_005814		167038307	167038307	-1	no_errors	ENST00000367868	ensembl	human	known	69_37n	silent	407	12.79	60	SNP	0.009	A
GPR160	26996	genome.wustl.edu	37	3	169802102	169802102	+	Silent	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:169802102G>C	ENST00000355897.5	+	4	950	c.342G>C	c.(340-342)ctG>ctC	p.L114L		NM_014373.2	NP_055188.1	Q9UJ42	GP160_HUMAN	G protein-coupled receptor 160	114						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			breast(1)|cervix(1)|kidney(1)|large_intestine(3)|lung(2)	8	all_cancers(22;3.26e-22)|all_epithelial(15;5.71e-27)|all_lung(20;8.41e-17)|Lung NSC(18;3.49e-16)|Ovarian(172;0.000337)|Breast(254;0.169)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.0655)			CAGTTTTCCTGACAGCTTGTA	0.279																																						dbGAP											0													48.0	52.0	51.0					3																	169802102		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB083583	CCDS3211.1	3q26.2-q27	2012-08-21			ENSG00000173890	ENSG00000173890		"""GPCR / Class A : Orphans"""	23693	protein-coding gene	gene with protein product						12044878	Standard	NM_014373		Approved	GPCR150, GPCR1	uc003fgi.3	Q9UJ42	OTTHUMG00000158776	ENST00000355897.5:c.342G>C	3.37:g.169802102G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNQ2	Silent	SNP	pfscan_GPCR_Rhodpsn_supfam	p.L114	ENST00000355897.5	37	c.342	CCDS3211.1	3																																																																																			GPR160	-	pfscan_GPCR_Rhodpsn_supfam	ENSG00000173890		0.279	GPR160-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR160	HGNC	protein_coding	OTTHUMT00000352167.1	231	0.43	1	G	NM_014373		169802102	169802102	+1	no_errors	ENST00000355897	ensembl	human	known	69_37n	silent	359	22.63	105	SNP	0.002	C
GPR180	160897	genome.wustl.edu	37	13	95273462	95273462	+	Silent	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:95273462C>T	ENST00000376958.4	+	6	892	c.867C>T	c.(865-867)ggC>ggT	p.G289G		NM_180989.5	NP_851320.1	Q86V85	GP180_HUMAN	G protein-coupled receptor 180	289					G-protein coupled receptor signaling pathway (GO:0007186)|response to pheromone (GO:0019236)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	10	all_neural(89;0.0684)|Medulloblastoma(90;0.163)					CATCCACTGGCATTGCAGTAT	0.418																																						dbGAP											0													150.0	134.0	139.0					13																	95273462		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF339823	CCDS9472.1	13q32.1	2006-04-05			ENSG00000152749	ENSG00000152749			28899	protein-coding gene	gene with protein product	"""intimal thickness related receptor"""	607787				12538434	Standard	NM_180989		Approved	ITR	uc001vly.3	Q86V85	OTTHUMG00000017207	ENST00000376958.4:c.867C>T	13.37:g.95273462C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1D5	Silent	SNP	pfam_Rhodopsin-like_GPCR_TM_domain,pfam_TM_rcpt_euk	p.G289	ENST00000376958.4	37	c.867	CCDS9472.1	13																																																																																			GPR180	-	pfam_Rhodopsin-like_GPCR_TM_domain,pfam_TM_rcpt_euk	ENSG00000152749		0.418	GPR180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR180	HGNC	protein_coding	OTTHUMT00000045465.3	277	0.36	1	C	NM_180989		95273462	95273462	+1	no_errors	ENST00000376958	ensembl	human	known	69_37n	silent	396	21.12	106	SNP	0.974	T
GRB7	2886	genome.wustl.edu	37	17	37899236	37899236	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:37899236T>A	ENST00000309156.4	+	4	649	c.392T>A	c.(391-393)cTg>cAg	p.L131Q	GRB7_ENST00000394209.2_Missense_Mutation_p.L131Q|GRB7_ENST00000394211.3_Missense_Mutation_p.L131Q|GRB7_ENST00000445327.2_Missense_Mutation_p.L154Q|GRB7_ENST00000394204.1_Missense_Mutation_p.L131Q|GRB7_ENST00000578702.1_Intron|GRB7_ENST00000309185.3_Missense_Mutation_p.L131Q	NM_005310.3	NP_005301.2	Q14451	GRB7_HUMAN	growth factor receptor-bound protein 7	131	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|epidermal growth factor receptor signaling pathway (GO:0007173)|leukocyte migration (GO:0050900)|negative regulation of translation (GO:0017148)|positive regulation of cell migration (GO:0030335)|positive regulation of signal transduction (GO:0009967)|stress granule assembly (GO:0034063)	cell projection (GO:0042995)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)|protein kinase binding (GO:0019901)|RNA binding (GO:0003723)|SH3/SH2 adaptor activity (GO:0005070)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)		UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;6.86e-60)|all cancers(3;1.65e-53)|BRCA - Breast invasive adenocarcinoma(8;2.03e-43)|STAD - Stomach adenocarcinoma(3;1.43e-12)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|LUSC - Lung squamous cell carcinoma(15;0.171)			TGTGAAATGCTGGTGCAGCGA	0.622																																						dbGAP											0													62.0	61.0	61.0					17																	37899236		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43772	CCDS11345.1, CCDS56028.1	17q12	2013-02-14			ENSG00000141738	ENSG00000141738		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4567	protein-coding gene	gene with protein product		601522					Standard	NM_005310		Approved		uc021twu.1	Q14451	OTTHUMG00000133253	ENST00000309156.4:c.392T>A	17.37:g.37899236T>A	ENSP00000310771:p.Leu131Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAV1|B3KNL0|B3KWP9|B7WP75|J3KQM4|Q53YD3|Q92568|Q96DF9|Q9Y220	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.L154Q	ENST00000309156.4	37	c.461	CCDS11345.1	17	.	.	.	.	.	.	.	.	.	.	T	23.7	4.444581	0.83993	.	.	ENSG00000141738	ENST00000309185;ENST00000309156;ENST00000394211;ENST00000394209;ENST00000445327;ENST00000394204	D;D;D;D;D;D	0.81659	-1.52;-1.52;-1.52;-1.52;-1.52;-1.52	4.77	4.77	0.60923	Ras-association (3);	0.078709	0.53938	D	0.000053	D	0.89979	0.6872	M	0.85373	2.75	0.80722	D	1	D;D	0.89917	0.998;1.0	D;D	0.85130	0.961;0.997	D	0.91577	0.5276	10	0.87932	D	0	-14.9937	13.6917	0.62550	0.0:0.0:0.0:1.0	.	131;131	Q14451-2;Q14451	.;GRB7_HUMAN	Q	131;131;131;131;154;131	ENSP00000311752:L131Q;ENSP00000310771:L131Q;ENSP00000377761:L131Q;ENSP00000377759:L131Q;ENSP00000403459:L154Q;ENSP00000377754:L131Q	ENSP00000310771:L131Q	L	+	2	0	GRB7	35152762	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	7.612000	0.82975	2.143000	0.66587	0.459000	0.35465	CTG	GRB7	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000141738		0.622	GRB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB7	HGNC	protein_coding	OTTHUMT00000257024.2	93	0.00	0	T	NM_005310		37899236	37899236	+1	no_errors	ENST00000445327	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	1.000	A
GRIK2	2898	genome.wustl.edu	37	6	102483412	102483412	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:102483412C>G	ENST00000421544.1	+	14	2772	c.2282C>G	c.(2281-2283)tCt>tGt	p.S761C	GRIK2_ENST00000369134.4_Missense_Mutation_p.S712C|GRIK2_ENST00000369137.3_Missense_Mutation_p.S685C|GRIK2_ENST00000318991.6_Missense_Mutation_p.S761C|GRIK2_ENST00000413795.1_Missense_Mutation_p.S761C|GRIK2_ENST00000369138.1_Missense_Mutation_p.S761C	NM_021956.4	NP_068775.1	Q13002	GRIK2_HUMAN	glutamate receptor, ionotropic, kainate 2	761					behavioral fear response (GO:0001662)|cellular calcium ion homeostasis (GO:0006874)|glutamate receptor signaling pathway (GO:0007215)|intracellular protein transport (GO:0006886)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuronal action potential (GO:0019228)|positive regulation of synaptic transmission (GO:0050806)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission (GO:0050804)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(37)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	83		all_cancers(76;1.19e-07)|Acute lymphoblastic leukemia(125;6.17e-11)|all_hematologic(75;6.01e-08)|all_epithelial(87;0.0121)|Colorectal(196;0.14)		all cancers(137;0.112)|BRCA - Breast invasive adenocarcinoma(108;0.124)|GBM - Glioblastoma multiforme(226;0.206)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	CTTATAGACTCTAAAGGTTAT	0.443																																						dbGAP											0													125.0	127.0	126.0					6																	102483412		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS5048.1, CCDS5049.1, CCDS55045.1	6q16.3	2012-08-29			ENSG00000164418	ENSG00000164418		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4580	protein-coding gene	gene with protein product		138244		GLUR6		8034316	Standard	NM_021956		Approved	GluK2, MRT6	uc003pqp.4	Q13002	OTTHUMG00000016328	ENST00000421544.1:c.2282C>G	6.37:g.102483412C>G	ENSP00000397026:p.Ser761Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY9|B5MCV0|D7RWZ3|D7RWZ4|D7RWZ5|D7RWZ6|D7RWZ7|Q8WWS1|Q96KS6|Q96KS7|Q96KS8	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.S761C	ENST00000421544.1	37	c.2282	CCDS5048.1	6	.	.	.	.	.	.	.	.	.	.	C	29.1	4.981220	0.93044	.	.	ENSG00000164418	ENST00000421544;ENST00000413795;ENST00000369138;ENST00000369137;ENST00000318991;ENST00000369134;ENST00000540076	T;T;T;T;T;T	0.12361	2.69;2.69;2.69;2.69;2.69;2.69	5.46	5.46	0.80206	Ionotropic glutamate receptor (2);	0.000000	0.85682	D	0.000000	T	0.40932	0.1137	M	0.90198	3.095	0.54753	D	0.999987	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77004	0.981;0.989;0.981	T	0.52019	-0.8631	10	0.87932	D	0	.	19.301	0.94144	0.0:1.0:0.0:0.0	.	761;761;761	Q13002-5;Q13002;Q13002-2	.;GRIK2_HUMAN;.	C	761;761;761;685;761;712;536	ENSP00000397026:S761C;ENSP00000405596:S761C;ENSP00000358134:S761C;ENSP00000358133:S685C;ENSP00000313276:S761C;ENSP00000358130:S712C	ENSP00000313276:S761C	S	+	2	0	GRIK2	102590105	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.920000	0.70017	2.555000	0.86185	0.655000	0.94253	TCT	GRIK2	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt	ENSG00000164418		0.443	GRIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK2	HGNC	protein_coding	OTTHUMT00000043718.1	83	0.00	0	C			102483412	102483412	+1	no_errors	ENST00000421544	ensembl	human	known	69_37n	missense	28	69.23	63	SNP	1.000	G
GRM8	2918	genome.wustl.edu	37	7	126173298	126173298	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:126173298C>T	ENST00000339582.2	-	9	2946	c.2138G>A	c.(2137-2139)tGg>tAg	p.W713*	GRM8_ENST00000358373.3_Nonsense_Mutation_p.W713*|GRM8_ENST00000480995.1_5'UTR|GRM8_ENST00000444921.2_Nonsense_Mutation_p.W713*			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	713					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CACAACAAACCAGACAAACAC	0.517										HNSCC(24;0.065)																												dbGAP											0													80.0	63.0	69.0					7																	126173298		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.2138G>A	7.37:g.126173298C>T	ENSP00000344173:p.Trp713*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.W713*	ENST00000339582.2	37	c.2138	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	C	43	9.894956	0.99290	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373	.	.	.	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.6261	0.91340	0.0:1.0:0.0:0.0	.	.	.	.	X	713	.	ENSP00000344173:W713X	W	-	2	0	GRM8	125960534	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.657000	0.90304	0.655000	0.94253	TGG	GRM8	-	pfam_GPCR_3_C,pfscan_GPCR_3_C,prints_GPCR_3	ENSG00000179603		0.517	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	167	0.00	0	C			126173298	126173298	-1	no_errors	ENST00000339582	ensembl	human	known	69_37n	nonsense	124	37.81	76	SNP	1.000	T
HIF3A	64344	genome.wustl.edu	37	19	46828875	46828875	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:46828875G>T	ENST00000377670.4	+	11	1450	c.1419G>T	c.(1417-1419)gaG>gaT	p.E473D	HIF3A_ENST00000300862.3_Missense_Mutation_p.E471D|HIF3A_ENST00000600383.1_Missense_Mutation_p.E404D|HIF3A_ENST00000472815.1_Missense_Mutation_p.E404D|AC007193.10_ENST00000596807.1_RNA|HIF3A_ENST00000339613.2_Missense_Mutation_p.E417D|HIF3A_ENST00000420102.2_Missense_Mutation_p.E422D|HIF3A_ENST00000244303.6_Missense_Mutation_p.E404D	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	473	NTAD.|ODD.				cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		AGGCAGTGGAGACAGATTTAG	0.512																																						dbGAP											0													121.0	121.0	121.0					19																	46828875		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.1419G>T	19.37:g.46828875G>T	ENSP00000366898:p.Glu473Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HIF_alpha_subunit,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.E473D	ENST00000377670.4	37	c.1419	CCDS12681.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	8.689|8.689	0.906923|0.906923	0.17833|0.17833	.|.	.|.	ENSG00000124440|ENSG00000124440	ENST00000472815|ENST00000244302;ENST00000377670;ENST00000244303;ENST00000339613;ENST00000291300;ENST00000300862;ENST00000420102	.|T;T;T;T;T	.|0.65178	.|0.6;-0.14;0.48;0.6;-0.14	4.47|4.47	3.4|3.4	0.38934|0.38934	.|.	.|0.185017	.|0.26518	.|N	.|0.023924	T|T	0.44095|0.44095	0.1277|0.1277	L|L	0.27053|0.27053	0.805|0.805	0.25919|0.25919	N|N	0.983138|0.983138	.|B;B;B;B;B;B;B	.|0.11235	.|0.004;0.003;0.001;0.003;0.001;0.001;0.003	.|B;B;B;B;B;B;B	.|0.11329	.|0.006;0.002;0.003;0.002;0.002;0.002;0.003	T|T	0.19712|0.19712	-1.0297|-1.0297	5|10	.|0.11182	.|T	.|0.66	.|.	10.8556|10.8556	0.46798|0.46798	0.0:0.1926:0.8074:0.0|0.0:0.1926:0.8074:0.0	.|.	.|422;404;471;422;417;473;473	.|F5H884;B4DNA2;Q9Y2N7-2;B4DSD9;A8MPQ1;Q9Y2N7;B0M185	.|.;.;.;.;.;HIF3A_HUMAN;.	Y|D	446|473;473;404;417;417;471;422	.|ENSP00000366898:E473D;ENSP00000244303:E404D;ENSP00000341877:E417D;ENSP00000300862:E471D;ENSP00000407771:E422D	.|ENSP00000244302:E473D	D|E	+|+	1|3	0|2	HIF3A|HIF3A	51520715|51520715	1.000000|1.000000	0.71417|0.71417	0.805000|0.805000	0.32314|0.32314	0.211000|0.211000	0.24417|0.24417	2.019000|2.019000	0.41001|0.41001	1.147000|1.147000	0.42369|0.42369	0.650000|0.650000	0.86243|0.86243	GAC|GAG	HIF3A	-	NULL	ENSG00000124440		0.512	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	203	0.00	0	G			46828875	46828875	+1	no_errors	ENST00000377670	ensembl	human	known	69_37n	missense	150	32.43	72	SNP	0.979	T
HIST1H2BH	8345	genome.wustl.edu	37	6	26251947	26251947	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:26251947G>A	ENST00000356350.2	+	1	69	c.69G>A	c.(67-69)caG>caA	p.Q23Q	HIST1H3F_ENST00000446824.2_5'Flank	NM_003524.2	NP_003515.1	Q93079	H2B1H_HUMAN	histone cluster 1, H2bh	23					chromatin organization (GO:0006325)|nucleosome assembly (GO:0006334)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.Q23H(1)|p.Q23Q(1)		NS(3)|breast(2)|large_intestine(1)|lung(3)|ovary(3)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	17						CCAAGGCGCAGAAGAAGGATG	0.552																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	NS(1)|breast(1)											125.0	113.0	117.0					6																	26251947		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z80781	CCDS4601.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000197459	ENSG00000275713		"""Histones / Replication-dependent"""	4755	protein-coding gene	gene with protein product		602806	"""H2B histone family, member J"", ""histone 1, H2bh"""	H2BFJ		9119399, 12408966	Standard	NM_003524		Approved	H2B/j	uc003nhh.3	Q93079	OTTHUMG00000014447	ENST00000356350.2:c.69G>A	6.37:g.26251947G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R541|Q4VB74	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.Q23	ENST00000356350.2	37	c.69	CCDS4601.1	6																																																																																			HIST1H2BH	-	superfamily_Histone-fold	ENSG00000197459		0.552	HIST1H2BH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BH	HGNC	protein_coding	OTTHUMT00000040110.1	472	0.21	1	G	NM_003524		26251947	26251947	+1	no_errors	ENST00000356350	ensembl	human	known	69_37n	silent	338	26.04	119	SNP	0.998	A
HTR2A	3356	genome.wustl.edu	37	13	47409443	47409443	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:47409443G>A	ENST00000378688.4	-	3	1076	c.945C>T	c.(943-945)atC>atT	p.I315I	HTR2A_ENST00000542664.1_Silent_p.I315I|HTR2A_ENST00000543956.1_Silent_p.I231I			P28223	5HT2A_HUMAN	5-hydroxytryptamine (serotonin) receptor 2A, G protein-coupled	315					activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|behavioral response to cocaine (GO:0048148)|cell death (GO:0008219)|cellular calcium ion homeostasis (GO:0006874)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|memory (GO:0007613)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phospholipase C-activating serotonin receptor signaling pathway (GO:0007208)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|positive regulation of vasoconstriction (GO:0045907)|protein localization to cytoskeleton (GO:0044380)|regulation of behavior (GO:0050795)|regulation of dopamine secretion (GO:0014059)|regulation of hormone secretion (GO:0046883)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|sleep (GO:0030431)|synaptic transmission (GO:0007268)|temperature homeostasis (GO:0001659)|urinary bladder smooth muscle contraction (GO:0014832)	cell body fiber (GO:0070852)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	1-(4-iodo-2,5-dimethoxyphenyl)propan-2-amine binding (GO:0071886)|drug binding (GO:0008144)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|liver(1)|lung(10)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	36		all_lung(13;7.2e-10)|Lung NSC(96;3.77e-07)|Breast(56;2.06e-05)|Prostate(109;0.00116)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|Myeloproliferative disorder(33;0.0333)		GBM - Glioblastoma multiforme(144;4.67e-05)|COAD - Colon adenocarcinoma(199;0.224)	Acepromazine(DB01614)|Amisulpride(DB06288)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Cinitapride(DB08810)|Cisapride(DB00604)|Clomipramine(DB01242)|Clozapine(DB00363)|Cyclobenzaprine(DB00924)|Cyproheptadine(DB00434)|Desipramine(DB01151)|Donepezil(DB00843)|Doxepin(DB01142)|Epinastine(DB00751)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Flupentixol(DB00875)|Fluspirilene(DB04842)|Haloperidol(DB00502)|Iloperidone(DB04946)|Imipramine(DB00458)|Ketamine(DB01221)|Lisuride(DB00589)|Loxapine(DB00408)|Lurasidone(DB08815)|Maprotiline(DB00934)|Mesoridazine(DB00933)|Methotrimeprazine(DB01403)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Molindone(DB01618)|Nefazodone(DB01149)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Paliperidone(DB01267)|Paroxetine(DB00715)|Pergolide(DB01186)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Sertindole(DB06144)|Thioproperazine(DB01622)|Thioridazine(DB00679)|Thiothixene(DB01623)|Trazodone(DB00656)|Trimipramine(DB00726)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GCTCATTGCTGATGGACTGCA	0.517																																						dbGAP											0													151.0	118.0	130.0					13																	47409443		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X57830	CCDS9405.1, CCDS53867.1	13q14-q21	2012-08-08	2012-02-03		ENSG00000102468	ENSG00000102468		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5293	protein-coding gene	gene with protein product		182135	"""5-hydroxytryptamine (serotonin) receptor 2A"""	HTR2		8035173	Standard	NM_000621		Approved	5-HT2A	uc010acr.4	P28223	OTTHUMG00000016881	ENST00000378688.4:c.945C>T	13.37:g.47409443G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAC5|B4DZ79|F5GWE8|Q5T8C0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.I315	ENST00000378688.4	37	c.945	CCDS9405.1	13																																																																																			HTR2A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000102468		0.517	HTR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2A	HGNC	protein_coding	OTTHUMT00000044835.3	151	0.65	1	G	NM_000621		47409443	47409443	-1	no_errors	ENST00000378688	ensembl	human	known	69_37n	silent	97	38.61	61	SNP	1.000	A
HTR2B	3357	genome.wustl.edu	37	2	231988413	231988413	+	Silent	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:231988413G>C	ENST00000258400.3	-	2	578	c.66C>G	c.(64-66)acC>acG	p.T22T	PSMD1_ENST00000373635.4_Intron|PSMD1_ENST00000409643.1_Intron|PSMD1_ENST00000308696.6_Intron	NM_000867.4	NP_000858.3	P41595	5HT2B_HUMAN	5-hydroxytryptamine (serotonin) receptor 2B, G protein-coupled	22					activation of phospholipase C activity (GO:0007202)|behavior (GO:0007610)|calcium-mediated signaling (GO:0019722)|cardiac muscle hypertrophy (GO:0003300)|cellular calcium ion homeostasis (GO:0006874)|cellular response to temperature stimulus (GO:0071502)|cGMP biosynthetic process (GO:0006182)|embryonic morphogenesis (GO:0048598)|ERK1 and ERK2 cascade (GO:0070371)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|heart morphogenesis (GO:0003007)|intestine smooth muscle contraction (GO:0014827)|negative regulation of apoptotic process (GO:0043066)|negative regulation of autophagy (GO:0010507)|negative regulation of cell death (GO:0060548)|neural crest cell differentiation (GO:0014033)|neural crest cell migration (GO:0001755)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphorylation (GO:0016310)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of cytokine secretion (GO:0050715)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of phosphatidylinositol biosynthetic process (GO:0010513)|protein kinase C signaling (GO:0070528)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of behavior (GO:0050795)|release of sequestered calcium ion into cytosol (GO:0051209)|response to drug (GO:0042493)|serotonin receptor signaling pathway (GO:0007210)|vasoconstriction (GO:0042310)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)	drug binding (GO:0008144)|G-protein alpha-subunit binding (GO:0001965)|Ras GTPase activator activity (GO:0005099)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|urinary_tract(1)	11		Renal(207;0.025)|all_hematologic(139;0.094)|Acute lymphoblastic leukemia(138;0.164)|Medulloblastoma(418;0.232)		Epithelial(121;4.48e-11)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.0141)	Amoxapine(DB00543)|Apomorphine(DB00714)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clomipramine(DB01242)|Dihydroergotamine(DB00320)|Doxepin(DB01142)|Eletriptan(DB00216)|Ergoloid mesylate(DB01049)|Ketamine(DB01221)|Lisuride(DB00589)|Methysergide(DB00247)|Mianserin(DB06148)|Minaprine(DB00805)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Ropinirole(DB00268)|Triflupromazine(DB00508)|Yohimbine(DB01392)	CGTGAACAAAGGTGCTCTGCA	0.413																																					Ovarian(155;1331 1891 12853 14038 34991)	dbGAP											0													161.0	153.0	156.0					2																	231988413		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2483.1	2q36.3-q37.1	2012-08-08	2012-02-03		ENSG00000135914	ENSG00000135914		"""5-HT (serotonin) receptors"", ""GPCR / Class A : 5-HT (serotonin) receptors, GPCR only"""	5294	protein-coding gene	gene with protein product		601122	"""5-hydroxytryptamine (serotonin) receptor 2B"""			8143856	Standard	NM_000867		Approved	5-HT(2B), 5-HT2B	uc002vro.3	P41595	OTTHUMG00000133222	ENST00000258400.3:c.66C>G	2.37:g.231988413G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9D5|Q53TI1|Q62221|Q6P523	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_5HT2B_rcpt,prints_7TM_GPCR_Rhodpsn,prints_5HT_rcpt	p.T22	ENST00000258400.3	37	c.66	CCDS2483.1	2																																																																																			HTR2B	-	NULL	ENSG00000135914		0.413	HTR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTR2B	HGNC	protein_coding	OTTHUMT00000256957.2	355	0.28	1	G	NM_000867		231988413	231988413	-1	no_errors	ENST00000258400	ensembl	human	known	69_37n	silent	362	38.01	222	SNP	0.028	C
IFI35	3430	genome.wustl.edu	37	17	41165360	41165360	+	Silent	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:41165360C>G	ENST00000415816.2	+	4	568	c.345C>G	c.(343-345)ccC>ccG	p.P115P	IFI35_ENST00000438323.2_Silent_p.P115P	NM_005533.4	NP_005524.2	P80217	IN35_HUMAN	interferon-induced protein 35	115					cytokine-mediated signaling pathway (GO:0019221)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)|ovary(1)	8		Breast(137;0.00499)		BRCA - Breast invasive adenocarcinoma(366;0.157)		AGGTCCAGCCCTTGGAGCTGC	0.597																																						dbGAP											0													53.0	56.0	55.0					17																	41165360		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC001356	CCDS11450.1	17q21	2006-04-05			ENSG00000068079	ENSG00000068079			5399	protein-coding gene	gene with protein product		600735					Standard	NM_005533		Approved	IFP35	uc021txx.1	P80217	OTTHUMG00000167720	ENST00000415816.2:c.345C>G	17.37:g.41165360C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JGX1|Q92984|Q99537|Q9BV98	Silent	SNP	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.P115	ENST00000415816.2	37	c.345		17																																																																																			IFI35	-	pfam_Nmi/IFP35	ENSG00000068079		0.597	IFI35-002	KNOWN	basic|appris_candidate	protein_coding	IFI35	HGNC	protein_coding	OTTHUMT00000395851.1	107	0.00	0	C	NM_005533		41165360	41165360	+1	no_errors	ENST00000438323	ensembl	human	known	69_37n	silent	60	22.08	17	SNP	0.681	G
IL21R	50615	genome.wustl.edu	37	16	27448978	27448978	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:27448978G>C	ENST00000337929.3	+	4	795	c.322G>C	c.(322-324)Gag>Cag	p.E108Q	IL21R_ENST00000395755.1_Missense_Mutation_p.E108Q|IL21R_ENST00000395754.4_Missense_Mutation_p.E108Q|IL21R_ENST00000564089.1_Missense_Mutation_p.E108Q	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor	108	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						CTACTCCCAGGAGTGTGGCAG	0.557			T	BCL6	NHL																																	dbGAP		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0													125.0	95.0	106.0					16																	27448978		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.322G>C	16.37:g.27448978G>C	ENSP00000338010:p.Glu108Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.E108Q	ENST00000337929.3	37	c.322	CCDS10630.1	16	.	.	.	.	.	.	.	.	.	.	G	12.82	2.051127	0.36181	.	.	ENSG00000103522	ENST00000337929;ENST00000395755;ENST00000395754	T;T;T	0.57107	0.42;0.42;0.42	4.79	3.57	0.40892	Fibronectin, type III (1);	0.792676	0.11748	N	0.533360	T	0.56217	0.1970	M	0.67953	2.075	0.32214	N	0.576095	D	0.59357	0.985	P	0.52217	0.693	T	0.59343	-0.7472	10	0.28530	T	0.3	-19.1889	5.9573	0.19281	0.1742:0.0:0.8258:0.0	.	108	Q9HBE5	IL21R_HUMAN	Q	108	ENSP00000338010:E108Q;ENSP00000379104:E108Q;ENSP00000379103:E108Q	ENSP00000338010:E108Q	E	+	1	0	IL21R	27356479	0.992000	0.36948	1.000000	0.80357	0.171000	0.22731	1.518000	0.35877	2.343000	0.79666	0.555000	0.69702	GAG	IL21R	-	superfamily_Fibronectin_type3	ENSG00000103522		0.557	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R	HGNC	protein_coding	OTTHUMT00000254578.2	199	0.00	0	G	NM_181078		27448978	27448978	+1	no_errors	ENST00000337929	ensembl	human	known	69_37n	missense	117	37.10	69	SNP	0.985	C
IMPDH1	3614	genome.wustl.edu	37	7	128038635	128038635	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr7:128038635G>C	ENST00000480861.1	-	7	714	c.637C>G	c.(637-639)Ctg>Gtg	p.L213V	IMPDH1_ENST00000343214.4_Missense_Mutation_p.L193V|IMPDH1_ENST00000338791.6_Missense_Mutation_p.L303V|IMPDH1_ENST00000496200.1_Missense_Mutation_p.L193V|IMPDH1_ENST00000470772.1_Missense_Mutation_p.L217V|IMPDH1_ENST00000378717.4_Missense_Mutation_p.L234V|IMPDH1_ENST00000348127.6_Missense_Mutation_p.L267V|IMPDH1_ENST00000419067.2_Missense_Mutation_p.L270V|IMPDH1_ENST00000354269.5_Missense_Mutation_p.L293V	NM_001142574.1	NP_001136046.1			IMP (inosine 5'-monophosphate) dehydrogenase 1											breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|skin(3)	22						ATGGCCACCAGCTCATCGCAA	0.567											OREG0018292	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													77.0	80.0	79.0					7																	128038635		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34748.1, CCDS34749.1, CCDS43643.1, CCDS47699.1, CCDS47700.1, CCDS55161.1	7q31.3-q32	2013-01-08	2010-04-29		ENSG00000106348	ENSG00000106348	1.1.1.205		6052	protein-coding gene	gene with protein product		146690	"""retinitis pigmentosa 10 (autosomal dominant)"", ""IMP (inosine monophosphate) dehydrogenase 1"""	RP10		1969416, 11875049, 11875050	Standard	NM_000883		Approved	sWSS2608, LCA11	uc003vmu.2	P20839	OTTHUMG00000157713	ENST00000480861.1:c.637C>G	7.37:g.128038635G>C	ENSP00000420185:p.Leu213Val	Somatic	1561	WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_IMP_DH_GMPRt,pfam_Cysta_beta_synth_core,pfam_2Npropane_dOase,pfam_FMN-dep_DH,smart_Cysta_beta_synth_core,tigrfam_IMP_DH	p.L303V	ENST00000480861.1	37	c.907	CCDS55161.1	7	.	.	.	.	.	.	.	.	.	.	G	13.22	2.172769	0.38413	.	.	ENSG00000106348	ENST00000419067;ENST00000338791;ENST00000496200;ENST00000354269;ENST00000378717;ENST00000348127;ENST00000343214;ENST00000470772;ENST00000480861;ENST00000497868	D;D;D;D;D;D;D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63;-3.63;-3.63;-3.63;-3.63;-3.63;-3.63	5.29	1.84	0.25277	Aldolase-type TIM barrel (1);Cystathionine beta-synthase, core (3);IMP dehydrogenase/GMP reductase (1);	0.000000	0.85682	D	0.000000	D	0.96445	0.8840	M	0.81179	2.53	0.48975	D	0.999737	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;0.987;0.99;1.0	D;D;D;D;D;P;P;D	0.97110	0.999;1.0;1.0;1.0;1.0;0.664;0.773;1.0	D	0.95474	0.8554	10	0.87932	D	0	-17.5924	9.5818	0.39493	0.2965:0.0:0.7035:0.0	.	270;213;218;234;293;267;303;193	C9JV30;B4DE09;P20839;E7EQS0;Q5H9Q6;P20839-3;A4D0Z6;P20839-2	.;.;IMDH1_HUMAN;.;.;.;.;.	V	270;303;193;293;234;267;193;217;213;234	ENSP00000399400:L270V;ENSP00000345096:L303V;ENSP00000420803:L193V;ENSP00000346219:L293V;ENSP00000367989:L234V;ENSP00000265385:L267V;ENSP00000342438:L193V;ENSP00000417296:L217V;ENSP00000420185:L213V;ENSP00000419609:L234V	ENSP00000345096:L303V	L	-	1	2	IMPDH1	127825871	1.000000	0.71417	0.139000	0.22197	0.199000	0.23934	3.519000	0.53458	0.547000	0.28938	0.655000	0.94253	CTG	IMPDH1	-	pfam_IMP_DH_GMPRt,pfam_Cysta_beta_synth_core,smart_Cysta_beta_synth_core,tigrfam_IMP_DH	ENSG00000106348		0.567	IMPDH1-009	PUTATIVE	basic|appris_candidate|CCDS	protein_coding	IMPDH1	HGNC	protein_coding	OTTHUMT00000349462.1	82	0.00	0	G	NM_000883		128038635	128038635	-1	no_errors	ENST00000338791	ensembl	human	known	69_37n	missense	40	54.02	47	SNP	1.000	C
KLHL41	10324	genome.wustl.edu	37	2	170366886	170366886	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:170366886G>C	ENST00000284669.1	+	1	675	c.598G>C	c.(598-600)Gtg>Ctg	p.V200L	BBS5_ENST00000554017.1_Intron|RP11-724O16.1_ENST00000513963.1_Intron	NM_006063.2	NP_006054.2	O60662	KLH41_HUMAN	kelch-like family member 41	200	BACK.				myofibril assembly (GO:0030239)|protein ubiquitination (GO:0016567)|regulation of lateral pseudopodium assembly (GO:0031275)|regulation of myoblast differentiation (GO:0045661)|regulation of myoblast proliferation (GO:2000291)|regulation of skeletal muscle cell differentiation (GO:2001014)|skeletal muscle cell differentiation (GO:0035914)|striated muscle contraction (GO:0006941)	Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|M band (GO:0031430)|pseudopodium (GO:0031143)											ATTTGAGGCAGTGATGAAATG	0.373																																						dbGAP											0													119.0	127.0	124.0					2																	170366886		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056929	CCDS2234.1	2q31.1	2013-02-22	2013-02-22	2013-01-08	ENSG00000239474	ENSG00000239474		"""Kelch-like"", ""BTB/POZ domain containing"""	16905	protein-coding gene	gene with protein product	"""sarcomeric muscle protein"""	607701	"""kelch repeat and BTB (POZ) domain containing 10"", ""kelch-like 41 (Drosophila)"""	KBTBD10		9655184	Standard	NM_006063		Approved	SARCOSIN, Krp1	uc002ueu.1	O60662	OTTHUMG00000132205	ENST00000284669.1:c.598G>C	2.37:g.170366886G>C	ENSP00000284669:p.Val200Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R42	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.V200L	ENST00000284669.1	37	c.598	CCDS2234.1	2	.	.	.	.	.	.	.	.	.	.	G	2.673	-0.277135	0.05679	.	.	ENSG00000239474	ENST00000284669	T	0.70986	-0.53	4.88	4.0	0.46444	BTB/Kelch-associated (2);	0.184924	0.47852	D	0.000219	T	0.55097	0.1899	N	0.25992	0.78	0.43564	D	0.995887	B	0.16603	0.018	B	0.21360	0.034	T	0.48456	-0.9034	10	0.27785	T	0.31	.	9.706	0.40216	0.1599:0.0:0.8401:0.0	.	200	O60662	KBTBA_HUMAN	L	200	ENSP00000284669:V200L	ENSP00000284669:V200L	V	+	1	0	KBTBD10	170075132	1.000000	0.71417	0.989000	0.46669	0.344000	0.29017	5.647000	0.67923	1.188000	0.43014	-0.218000	0.12543	GTG	KBTBD10	-	pfam_BACK,smart_BACK,pirsf_Kelch-like_gigaxonin	ENSG00000239474		0.373	KLHL41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD10	HGNC	protein_coding	OTTHUMT00000255263.1	414	0.00	0	G	NM_006063		170366886	170366886	+1	no_errors	ENST00000284669	ensembl	human	known	69_37n	missense	520	25.07	174	SNP	0.982	C
KCNA4	3739	genome.wustl.edu	37	11	30034200	30034200	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:30034200T>C	ENST00000328224.6	-	2	1259	c.26A>G	c.(25-27)gAg>gGg	p.E9G	KCNA4_ENST00000526518.1_5'Flank	NM_002233.3	NP_002224.1	P22459	KCNA4_HUMAN	potassium voltage-gated channel, shaker-related subfamily, member 4	9					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	potassium ion binding (GO:0030955)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(17)|lung(39)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	78					Dalfampridine(DB06637)	CCCTGAGCTCTCCGCACTCAC	0.552																																						dbGAP											0													67.0	68.0	68.0					11																	30034200		1962	4143	6105	-	-	-	SO:0001583	missense	0			M55514	CCDS41629.1	11p14	2012-07-05	2002-07-10			ENSG00000182255		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6222	protein-coding gene	gene with protein product		176266	"""potassium voltage-gated channel, shaker-related subfamily, member 4-like"""	KCNA4L		2263489, 16382104	Standard	NM_002233		Approved	Kv1.4, HK1, HPCN2	uc001msk.3	P22459		ENST00000328224.6:c.26A>G	11.37:g.30034200T>C	ENSP00000328511:p.Glu9Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv1.4_TID,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv1.4,prints_K_chnl_volt-dep_Kv1,prints_K_chnl_volt-dep_Kv	p.E9G	ENST00000328224.6	37	c.26	CCDS41629.1	11	.	.	.	.	.	.	.	.	.	.	T	14.65	2.598887	0.46318	.	.	ENSG00000182255	ENST00000328224	D	0.97279	-4.32	5.18	4.05	0.47172	Potassium channel, voltage dependent, Kv1.4, tandem inactivation (2);	1846.230000	0.01045	N	0.004362	D	0.92974	0.7764	N	0.08118	0	0.40027	D	0.975489	P	0.42078	0.77	B	0.37346	0.247	T	0.81720	-0.0804	10	0.72032	D	0.01	.	10.8142	0.46564	0.0:0.0743:0.0:0.9257	.	9	P22459	KCNA4_HUMAN	G	9	ENSP00000328511:E9G	ENSP00000328511:E9G	E	-	2	0	KCNA4	29990776	1.000000	0.71417	0.964000	0.40570	0.140000	0.21249	7.513000	0.81739	0.822000	0.34565	0.533000	0.62120	GAG	KCNA4	-	pfam_K_chnl_volt-dep_Kv1.4_TID,prints_K_chnl_volt-dep_Kv1.4	ENSG00000182255		0.552	KCNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNA4	HGNC	protein_coding	OTTHUMT00000388074.2	49	0.00	0	T	NM_002233		30034200	30034200	-1	no_errors	ENST00000328224	ensembl	human	known	69_37n	missense	7	58.82	10	SNP	1.000	C
KIAA0226	9711	genome.wustl.edu	37	3	197402332	197402332	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:197402332T>C	ENST00000296343.5	-	19	2700	c.2701A>G	c.(2701-2703)Atc>Gtc	p.I901V	MIR922_ENST00000401223.1_RNA|KIAA0226_ENST00000273582.5_Missense_Mutation_p.I856V	NM_014687.1	NP_055502.1	Q92622	RUBIC_HUMAN	KIAA0226	901	Cys-rich.				autophagy (GO:0006914)|cell death (GO:0008219)|endocytosis (GO:0006897)|negative regulation of autophagy (GO:0010507)|negative regulation of endocytosis (GO:0045806)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)				NS(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_cancers(143;8.26e-10)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;2.19e-23)|all cancers(36;1.39e-21)|OV - Ovarian serous cystadenocarcinoma(49;1.21e-18)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(93;0.0446)		AAGGGAAAGATGATGTCATCC	0.537																																					Esophageal Squamous(3;167 355 3763 15924)	dbGAP											0													173.0	171.0	172.0					3																	197402332		2049	4201	6250	-	-	-	SO:0001583	missense	0			D86979	CCDS43195.1, CCDS46987.1	3q29	2011-08-09			ENSG00000145016	ENSG00000145016			28991	protein-coding gene	gene with protein product	"""RUN domain and cysteine-rich domain containing, Beclin 1-interacting protein"""	613516				9039502, 19270693, 20826435	Standard	XM_005269374		Approved	rubicon, rundataxin	uc003fyc.2	Q92622	OTTHUMG00000155452	ENST00000296343.5:c.2701A>G	3.37:g.197402332T>C	ENSP00000296343:p.Ile901Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96CK5	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.I901V	ENST00000296343.5	37	c.2701	CCDS43195.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	17.88|17.88	3.496618|3.496618	0.64186|0.64186	.|.	.|.	ENSG00000145016|ENSG00000145016	ENST00000413360|ENST00000273582;ENST00000296343	.|.	.|.	.|.	5.51|5.51	5.51|5.51	0.81932|0.81932	.|.	.|0.061993	.|0.64402	.|D	.|0.000005	T|T	0.73249|0.73249	0.3563|0.3563	M|M	0.86651|0.86651	2.83|2.83	0.80722|0.80722	D|D	1|1	.|P;P	.|0.41978	.|0.485;0.767	.|B;P	.|0.45610	.|0.395;0.487	T|T	0.78038|0.78038	-0.2360|-0.2360	5|9	.|0.54805	.|T	.|0.06	.|.	15.6179|15.6179	0.76780|0.76780	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|856;901	.|Q92622-2;Q92622	.|.;RUBIC_HUMAN	R|V	862|856;901	.|.	.|ENSP00000273582:I856V	H|I	-|-	2|1	0|0	KIAA0226|KIAA0226	198886729|198886729	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	5.008000|5.008000	0.63991|0.63991	2.094000|2.094000	0.63399|0.63399	0.482000|0.482000	0.46254|0.46254	CAT|ATC	KIAA0226	-	NULL	ENSG00000145016		0.537	KIAA0226-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0226	HGNC	protein_coding	OTTHUMT00000340184.1	194	0.00	0	T	XM_032901		197402332	197402332	-1	no_errors	ENST00000296343	ensembl	human	known	69_37n	missense	186	22.18	53	SNP	1.000	C
KIAA0430	9665	genome.wustl.edu	37	16	15702342	15702342	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:15702342G>C	ENST00000396368.3	-	21	4194	c.3988C>G	c.(3988-3990)Ctg>Gtg	p.L1330V	KIAA0430_ENST00000540441.2_Missense_Mutation_p.L1165V|KIAA0430_ENST00000548025.1_Missense_Mutation_p.L1327V|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000344181.3_Missense_Mutation_p.L932V|KIAA0430_ENST00000551742.1_Missense_Mutation_p.L1330V|KIAA0430_ENST00000602337.1_Missense_Mutation_p.L1327V|KIAA0430_ENST00000547936.1_5'Flank	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1330	HTH OST-type 5. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						ACCTCTGTCAGAGTAAGGATC	0.428																																						dbGAP											0													61.0	59.0	60.0					16																	15702342		1839	4087	5926	-	-	-	SO:0001583	missense	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.3988C>G	16.37:g.15702342G>C	ENSP00000379654:p.Leu1330Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.L1330V	ENST00000396368.3	37	c.3988	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	G	16.55	3.155453	0.57259	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	.	.	.	5.97	3.75	0.43078	.	0.000000	0.64402	D	0.000001	T	0.70657	0.3249	M	0.76838	2.35	0.52501	D	0.999952	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.87578	0.994;0.998;0.998;0.996	T	0.68318	-0.5440	9	0.54805	T	0.06	.	4.5084	0.11899	0.6266:0.0:0.2377:0.1357	.	1329;1327;1326;1329	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	V	1330;1165;1270;932;1327;1330;1110	.	ENSP00000315718:L1270V	L	-	1	2	KIAA0430	15609843	0.850000	0.29656	0.935000	0.37517	0.895000	0.52256	1.439000	0.35013	0.521000	0.28445	-0.302000	0.09304	CTG	KIAA0430	-	NULL	ENSG00000166783		0.428	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	225	0.00	0	G	NM_014647		15702342	15702342	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	missense	193	33.22	96	SNP	0.817	C
CCDC183	84960	genome.wustl.edu	37	9	139701383	139701383	+	Intron	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:139701383C>T	ENST00000338005.6	+	13	1424				RABL6_ENST00000371671.4_5'Flank|RABL6_ENST00000371663.4_5'Flank|RP11-216L13.18_ENST00000471502.1_RNA|RABL6_ENST00000311502.7_5'Flank|RP11-216L13.19_ENST00000415992.1_RNA|RABL6_ENST00000357466.2_5'Flank|KIAA1984-AS1_ENST00000414656.1_RNA	NM_001039374.4	NP_001034463.4	Q5T5S1	CC183_HUMAN												biliary_tract(1)|breast(1)|endometrium(1)|kidney(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(1)	13	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;9.33e-06)|Epithelial(140;0.000124)		GGCTCCCGTTCAGAGTGTCTG	0.622																																						dbGAP											0													35.0	40.0	38.0					9																	139701383		2073	4207	6280	-	-	-	SO:0001627	intron_variant	0																														ENST00000338005.6:c.1390-39C>T	9.37:g.139701383C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP89|C9JD38|Q6P2D9|Q8NAI4|Q8TF18	RNA	SNP	-	NULL	ENST00000338005.6	37	NULL	CCDS43906.1	9																																																																																			KIAA1984-AS1	-	-	ENSG00000228544		0.622	KIAA1984-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1984-AS1	HGNC	protein_coding	OTTHUMT00000354899.1	38	0.00	0	C			139701383	139701383	-1	no_errors	ENST00000414656	ensembl	human	known	69_37n	rna	20	35.48	11	SNP	0.003	T
KLHL1	57626	genome.wustl.edu	37	13	70456605	70456605	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:70456605C>T	ENST00000377844.4	-	5	1796	c.1037G>A	c.(1036-1038)aGa>aAa	p.R346K	KLHL1_ENST00000545028.1_Missense_Mutation_p.R153K	NM_020866.2	NP_065917.1	Q9NR64	KLHL1_HUMAN	kelch-like family member 1	346					actin cytoskeleton organization (GO:0030036)|adult walking behavior (GO:0007628)|cerebellar Purkinje cell layer development (GO:0021680)|dendrite development (GO:0016358)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	actin binding (GO:0003779)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(56)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	84		Breast(118;0.000162)		COAD - Colon adenocarcinoma(199;0.000193)|GBM - Glioblastoma multiforme(99;0.000211)		CTCTTGATTTCTGATAACTTC	0.368																																						dbGAP											0													95.0	87.0	90.0					13																	70456605		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040923	CCDS9445.1, CCDS73582.1	13q21	2013-01-30	2013-01-30		ENSG00000150361	ENSG00000150361		"""Kelch-like"", ""BTB/POZ domain containing"""	6352	protein-coding gene	gene with protein product	"""Kelch-like protein 1"", ""Mayven-related protein 2"""	605332	"""kelch (Drosophila)-like 1"", ""kelch-like 1 (Drosophila)"""			10888605	Standard	NM_020866		Approved	KIAA1490, MRP2, FLJ30047	uc001vip.3	Q9NR64	OTTHUMG00000017056	ENST00000377844.4:c.1037G>A	13.37:g.70456605C>T	ENSP00000367075:p.Arg346Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5X0|Q5VZ64|Q9H4X4|Q9NR65|Q9P238	Missense_Mutation	SNP	pfam_Kelch_1,pfam_Kelch_2,pfam_BACK,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.R346K	ENST00000377844.4	37	c.1037	CCDS9445.1	13	.	.	.	.	.	.	.	.	.	.	c	4.552	0.102503	0.08731	.	.	ENSG00000150361	ENST00000377844;ENST00000545028	T;T	0.65916	-0.18;-0.18	5.08	4.25	0.50352	BTB/Kelch-associated (2);	0.156049	0.45867	N	0.000327	T	0.32376	0.0827	N	0.02213	-0.635	0.24359	N	0.994885	B;B	0.02656	0.0;0.0	B;B	0.09377	0.004;0.002	T	0.11155	-1.0599	10	0.05721	T	0.95	.	14.0822	0.64932	0.0:0.9266:0.0:0.0734	.	346;346	Q8TBJ7;Q9NR64	.;KLHL1_HUMAN	K	346;153	ENSP00000367075:R346K;ENSP00000439602:R153K	ENSP00000367075:R346K	R	-	2	0	KLHL1	69354606	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	2.607000	0.46300	1.285000	0.44548	-0.185000	0.12909	AGA	KLHL1	-	pfam_BACK,smart_BACK	ENSG00000150361		0.368	KLHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL1	HGNC	protein_coding	OTTHUMT00000045231.3	290	0.00	0	C	NM_020866		70456605	70456605	-1	no_errors	ENST00000377844	ensembl	human	known	69_37n	missense	309	21.57	85	SNP	1.000	T
KRT86	3892	genome.wustl.edu	37	12	52649868	52649868	+	Intron	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:52649868G>A	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GTTGAGCTCTGAGGCCAGCCT	0.537																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+6656G>A	12.37:g.52649868G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P78387	RNA	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			KRT121P	-	-	ENSG00000135477		0.537	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		207	0.00	0	G	NM_002284		52649868	52649868	-1	no_errors	ENST00000529785	ensembl	human	known	69_37n	rna	56	59.42	82	SNP	0.002	A
LINGO2	158038	genome.wustl.edu	37	9	27950483	27950483	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:27950483C>G	ENST00000379992.2	-	6	636	c.187G>C	c.(187-189)Gac>Cac	p.D63H	LINGO2_ENST00000308675.3_Missense_Mutation_p.D63H	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	63						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TTACTGAGGTCCAAGATTTTG	0.463																																						dbGAP											0													191.0	195.0	193.0					9																	27950483		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.187G>C	9.37:g.27950483C>G	ENSP00000369328:p.Asp63His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D63H	ENST00000379992.2	37	c.187	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	C	27.8	4.862621	0.91511	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.42131	0.98;0.98	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	L	0.55017	1.72	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.55661	-0.8106	9	.	.	.	.	20.2825	0.98528	0.0:1.0:0.0:0.0	.	63	Q7L985	LIGO2_HUMAN	H	63	ENSP00000369328:D63H;ENSP00000310126:D63H	.	D	-	1	0	LINGO2	27940483	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.009000	0.70745	2.873000	0.98535	0.561000	0.74099	GAC	LINGO2	-	NULL	ENSG00000174482		0.463	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	314	0.00	0	C	NM_152570		27950483	27950483	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	missense	246	32.60	119	SNP	1.000	G
LMNB2	84823	genome.wustl.edu	37	19	2431811	2431811	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:2431811G>A	ENST00000582871.1	-	10	1706	c.1620C>T	c.(1618-1620)ttC>ttT	p.F540F	LMNB2_ENST00000475819.1_5'UTR|LMNB2_ENST00000325327.3_Silent_p.F560F	NM_032737.3	NP_116126.3	Q03252	LMNB2_HUMAN	lamin B2	540	LTD.|Tail.					lamin filament (GO:0005638)|nuclear inner membrane (GO:0005637)	structural molecule activity (GO:0005198)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GGACGGTGCGGAAGCTCTCGC	0.721																																						dbGAP											0													64.0	55.0	58.0					19																	2431811		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			M94362	CCDS12090.1, CCDS12090.2	19p13.3	2013-01-16			ENSG00000176619	ENSG00000176619		"""Intermediate filaments type V, lamins"""	6638	protein-coding gene	gene with protein product		150341		LMN2		1630457	Standard	NM_032737		Approved		uc002lvy.4	Q03252	OTTHUMG00000150626	ENST00000582871.1:c.1620C>T	19.37:g.2431811G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75292|Q14734|Q96DF6	Silent	SNP	pfam_F,pfam_Lamin_tail_dom,superfamily_Prefoldin	p.F560	ENST00000582871.1	37	c.1680		19																																																																																			LMNB2	-	pfam_Lamin_tail_dom	ENSG00000176619		0.721	LMNB2-201	KNOWN	basic|appris_principal	protein_coding	LMNB2	HGNC	protein_coding		54	0.00	0	G	NM_032737		2431811	2431811	-1	no_errors	ENST00000325327	ensembl	human	known	69_37n	silent	13	56.67	17	SNP	0.999	A
LPPR1	54886	genome.wustl.edu	37	9	104032342	104032342	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:104032342A>C	ENST00000374874.3	+	3	683	c.244A>C	c.(244-246)Act>Cct	p.T82P	LPPR1_ENST00000395056.2_Missense_Mutation_p.T82P	NM_207299.1	NP_997182.1	Q8TBJ4	LPPR1_HUMAN		82					nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	catalytic activity (GO:0003824)										TGCCACCCCAACTGCTATTGT	0.448																																						dbGAP											0													80.0	79.0	79.0					9																	104032342		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000374874.3:c.244A>C	9.37:g.104032342A>C	ENSP00000364008:p.Thr82Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VX23|Q9NXE2	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.T82P	ENST00000374874.3	37	c.244	CCDS6751.1	9	.	.	.	.	.	.	.	.	.	.	A	15.31	2.796047	0.50208	.	.	ENSG00000148123	ENST00000374874;ENST00000456287;ENST00000374871;ENST00000395056	T;T	0.32753	1.44;1.44	5.85	5.85	0.93711	.	0.141537	0.64402	D	0.000005	T	0.29716	0.0742	L	0.52206	1.635	0.58432	D	0.999995	B;P	0.50617	0.232;0.937	B;B	0.39706	0.104;0.307	T	0.05338	-1.0891	10	0.38643	T	0.18	-14.5155	15.4255	0.75048	1.0:0.0:0.0:0.0	.	66;82	B7Z8P4;Q8TBJ4	.;LPPR1_HUMAN	P	82	ENSP00000364008:T82P;ENSP00000378496:T82P	ENSP00000364005:T82P	T	+	1	0	RP11-35N6.1	103072163	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.085000	0.64468	2.233000	0.73108	0.455000	0.32223	ACT	RP11-35N6.1	-	NULL	ENSG00000148123		0.448	LPPR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LPPR1	Clone_based_vega_gene	protein_coding	OTTHUMT00000053425.1	133	0.00	0	A			104032342	104032342	+1	no_errors	ENST00000374871	ensembl	human	known	69_37n	missense	35	72.00	90	SNP	1.000	C
LRP2	4036	genome.wustl.edu	37	2	170027091	170027091	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:170027091A>G	ENST00000263816.3	-	59	11635	c.11350T>C	c.(11350-11352)Tgt>Cgt	p.C3784R		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	3784	LDL-receptor class A 32. {ECO:0000255|PROSITE-ProRule:PRU00124}.			C -> LW (in Ref. 3; AAB02882). {ECO:0000305}.	cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTGTCCCCACAGTCGTTGTAA	0.483																																						dbGAP											0													181.0	153.0	163.0					2																	170027091		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.11350T>C	2.37:g.170027091A>G	ENSP00000263816:p.Cys3784Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.C3784R	ENST00000263816.3	37	c.11350	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	A	26.2	4.719624	0.89205	.	.	ENSG00000081479	ENST00000263816;ENST00000536293	D	0.99919	-8.0	5.86	5.86	0.93980	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.99959	0.9983	H	0.99906	4.925	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96141	0.9100	10	0.87932	D	0	.	16.2668	0.82588	1.0:0.0:0.0:0.0	.	3784	P98164	LRP2_HUMAN	R	3784;479	ENSP00000263816:C3784R	ENSP00000263816:C3784R	C	-	1	0	LRP2	169735337	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.339000	0.96797	2.240000	0.73641	0.533000	0.62120	TGT	LRP2	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000081479		0.483	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	226	0.00	0	A	NM_004525		170027091	170027091	-1	no_errors	ENST00000263816	ensembl	human	known	69_37n	missense	172	30.08	74	SNP	1.000	G
LRRC31	79782	genome.wustl.edu	37	3	169565908	169565908	+	Splice_Site	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:169565908C>A	ENST00000316428.5	-	8	1384	c.1327G>T	c.(1327-1329)Gca>Tca	p.A443S	LRRC31_ENST00000523069.1_Splice_Site_p.E443*|LRRC31_ENST00000264676.5_Splice_Site_p.A387S	NM_001277127.1|NM_024727.2	NP_001264056.1|NP_079003.2	Q6UY01	LRC31_HUMAN	leucine rich repeat containing 31	443								p.A443S(1)		cervix(3)|endometrium(3)|large_intestine(8)|lung(9)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	31	all_cancers(22;2.76e-22)|all_epithelial(15;4.73e-27)|all_lung(20;9.24e-17)|Lung NSC(18;3.85e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00943)			AGATACACACCCAGGAGAGCC	0.562																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											65.0	68.0	67.0					3																	169565908		2051	4191	6242	-	-	-	SO:0001630	splice_region_variant	0			AK026912	CCDS43167.1, CCDS63832.1, CCDS63833.1	3q26.2	2005-01-24			ENSG00000114248	ENSG00000114248			26261	protein-coding gene	gene with protein product						12975309	Standard	NM_001277127		Approved	FLJ23259	uc003fgc.2	Q6UY01	OTTHUMG00000164421	ENST00000316428.5:c.1327+1G>T	3.37:g.169565908C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL44|E5RJA9|Q17RA3|Q8N848|Q9H5N5|V9HW14	Nonsense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.E443*	ENST00000316428.5	37	c.1327	CCDS43167.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.55|15.55	2.866897|2.866897	0.51588|0.51588	.|.	.|.	ENSG00000114248|ENSG00000114248	ENST00000316428;ENST00000264676|ENST00000523069	T;T|.	0.54479|.	0.57;0.57|.	4.61|4.61	3.74|3.74	0.42951|0.42951	.|.	0.230621|.	0.42294|.	D|.	0.000725|.	T|.	0.48874|.	0.1524|.	M|M	0.71206|0.71206	2.165|2.165	0.19945|0.19945	N|N	0.999947|0.999947	D;D|.	0.61697|.	0.99;0.983|.	P;P|.	0.57152|.	0.814;0.656|.	T|.	0.39057|.	-0.9632|.	9|.	.|.	.|.	.|.	-6.7318|-6.7318	7.9173|7.9173	0.29825|0.29825	0.0:0.7558:0.0:0.2442|0.0:0.7558:0.0:0.2442	.|.	387;443|.	Q6UY01-2;Q6UY01|.	.;LRC31_HUMAN|.	S|X	443;387|443	ENSP00000325978:A443S;ENSP00000264676:A387S|.	.|.	A|E	-|-	1|1	0|0	LRRC31|LRRC31	171048602|171048602	1.000000|1.000000	0.71417|0.71417	0.981000|0.981000	0.43875|0.43875	0.013000|0.013000	0.08279|0.08279	1.792000|1.792000	0.38754|0.38754	0.931000|0.931000	0.37242|0.37242	-0.136000|-0.136000	0.14681|0.14681	GCA|GAG	LRRC31	-	NULL	ENSG00000114248		0.562	LRRC31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC31	HGNC	protein_coding	OTTHUMT00000378699.1	88	0.00	0	C	NM_024727	Missense_Mutation	169565908	169565908	-1	no_errors	ENST00000523069	ensembl	human	putative	69_37n	nonsense	87	26.89	32	SNP	0.992	A
LTK	4058	genome.wustl.edu	37	15	41800394	41800394	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:41800394C>A	ENST00000263800.6	-	9	1218	c.1122G>T	c.(1120-1122)gaG>gaT	p.E374D	LTK_ENST00000453182.2_Missense_Mutation_p.E313D|LTK_ENST00000355166.5_Missense_Mutation_p.E313D|LTK_ENST00000561619.1_Missense_Mutation_p.E56D	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	374					cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		GCCTTCGGATCTCTACCTCTC	0.527										TSP Lung(18;0.14)																												dbGAP											0													167.0	145.0	152.0					15																	41800394		2203	4300	6503	-	-	-	SO:0001583	missense	0			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1122G>T	15.37:g.41800394C>A	ENSP00000263800:p.Glu374Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E374D	ENST00000263800.6	37	c.1122	CCDS10077.1	15	.	.	.	.	.	.	.	.	.	.	C	6.358	0.434188	0.12045	.	.	ENSG00000062524	ENST00000360087;ENST00000355166;ENST00000263800;ENST00000453182	T;T;T	0.76316	-1.0;-0.76;-1.01	4.67	0.0808	0.14422	.	0.224693	0.22469	U	0.059650	T	0.55497	0.1924	N	0.25890	0.77	0.21290	N	0.999734	P;B;B;B	0.34546	0.456;0.028;0.038;0.02	B;B;B;B	0.24541	0.046;0.012;0.054;0.029	T	0.43426	-0.9392	10	0.35671	T	0.21	.	6.0759	0.19915	0.2379:0.529:0.0:0.2331	.	313;313;313;374	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	D	374;313;374;313	ENSP00000347293:E313D;ENSP00000263800:E374D;ENSP00000392196:E313D	ENSP00000263800:E374D	E	-	3	2	LTK	39587686	0.996000	0.38824	0.554000	0.28268	0.679000	0.39708	0.369000	0.20416	-0.033000	0.13736	-1.134000	0.01955	GAG	LTK	-	NULL	ENSG00000062524		0.527	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2	229	0.00	0	C			41800394	41800394	-1	no_errors	ENST00000263800	ensembl	human	known	69_37n	missense	149	36.32	85	SNP	0.961	A
LZTS2	84445	genome.wustl.edu	37	10	102762473	102762473	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:102762473G>A	ENST00000370220.1	+	1	3241	c.178G>A	c.(178-180)Gat>Aat	p.D60N	LZTS2_ENST00000370223.3_Missense_Mutation_p.D60N					leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		CCGCCAGCAGGATGGCCTGCT	0.667																																					Esophageal Squamous(8;38 437 13604 19902 37640)	dbGAP											0													31.0	36.0	34.0					10																	102762473		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914	ENST00000370220.1:c.178G>A	10.37:g.102762473G>A	ENSP00000359240:p.Asp60Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fez1	p.D60N	ENST00000370220.1	37	c.178	CCDS7507.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.900490	0.97081	.	.	ENSG00000107816	ENST00000426584;ENST00000370223;ENST00000429732;ENST00000315797;ENST00000370220;ENST00000454422	T;T	0.48201	0.82;0.82	4.97	4.97	0.65823	.	0.305222	0.33438	N	0.004905	T	0.42131	0.1189	L	0.49778	1.585	0.50171	D	0.999851	P	0.47762	0.9	B	0.36534	0.227	T	0.50074	-0.8870	10	0.52906	T	0.07	-14.6959	16.988	0.86346	0.0:0.0:1.0:0.0	.	60	Q9BRK4	LZTS2_HUMAN	N	60	ENSP00000359243:D60N;ENSP00000359240:D60N	ENSP00000314437:D60N	D	+	1	0	LZTS2	102752463	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	6.947000	0.75959	2.277000	0.76020	0.561000	0.74099	GAT	LZTS2	-	NULL	ENSG00000107816		0.667	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LZTS2	HGNC	protein_coding	OTTHUMT00000049872.1	29	0.00	0	G	XM_046743		102762473	102762473	+1	no_errors	ENST00000370220	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
MAB21L1	4081	genome.wustl.edu	37	13	36049917	36049917	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:36049917G>C	ENST00000379919.4	-	1	915	c.359C>G	c.(358-360)tCc>tGc	p.S120C	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	120					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GAGGTAGCCGGAGGCGGTAAT	0.592																																						dbGAP											0													45.0	46.0	46.0					13																	36049917		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.359C>G	13.37:g.36049917G>C	ENSP00000369251:p.Ser120Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6I9T5	Missense_Mutation	SNP	pfam_Mab-21_dom	p.S120C	ENST00000379919.4	37	c.359	CCDS9353.1	13	.	.	.	.	.	.	.	.	.	.	G	21.0	4.077203	0.76415	.	.	ENSG00000180660	ENST00000379919	T	0.09073	3.02	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.35307	0.0927	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08046	-1.0741	10	0.66056	D	0.02	-15.5188	19.7375	0.96212	0.0:0.0:1.0:0.0	.	120	Q13394	MB211_HUMAN	C	120	ENSP00000369251:S120C	ENSP00000369251:S120C	S	-	2	0	MAB21L1	34947917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.680000	0.91292	0.655000	0.94253	TCC	MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.592	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	85	0.00	0	G	NM_005584		36049917	36049917	-1	no_errors	ENST00000379919	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	C
MAP2	4133	genome.wustl.edu	37	2	210574870	210574870	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:210574870G>A	ENST00000360351.4	+	12	5471	c.4965G>A	c.(4963-4965)gcG>gcA	p.A1655A	MAP2_ENST00000475600.1_3'UTR|MAP2_ENST00000199940.6_Silent_p.A356A|MAP2_ENST00000447185.1_Silent_p.A1651A|MAP2_ENST00000361559.4_Silent_p.A299A|MAP2_ENST00000392194.1_Silent_p.A299A	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	1655				A -> GL (in Ref. 2; AAB48098/AAB48097). {ECO:0000305}.	axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AATCTCCTGCGACTCCCAAGC	0.502																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													90.0	76.0	81.0					2																	210574870		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.4965G>A	2.37:g.210574870G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.A1655	ENST00000360351.4	37	c.4965	CCDS2384.1	2																																																																																			MAP2	-	NULL	ENSG00000078018		0.502	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	342	0.29	1	G	NM_001039538		210574870	210574870	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	silent	180	37.93	110	SNP	0.085	A
MB21D2	151963	genome.wustl.edu	37	3	192516720	192516720	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:192516720G>C	ENST00000392452.2	-	2	1251	c.931C>G	c.(931-933)Cag>Gag	p.Q311E		NM_178496.3	NP_848591.2	Q8IYB1	M21D2_HUMAN	Mab-21 domain containing 2	311							protein complex binding (GO:0032403)	p.Q309E(2)		endometrium(3)|kidney(1)|large_intestine(4)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(1)	31						TTGCAGGCCTGATAGGCCTGC	0.557																																						dbGAP											2	Substitution - Missense(2)	lung(2)											34.0	35.0	34.0					3																	192516720		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056276	CCDS3302.2	3q28-q29	2011-02-23	2011-02-23	2011-02-23	ENSG00000180611	ENSG00000180611			30438	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 59"""	C3orf59		12477932	Standard	NM_178496		Approved		uc011bsp.2	Q8IYB1	OTTHUMG00000155768	ENST00000392452.2:c.931C>G	3.37:g.192516720G>C	ENSP00000376246:p.Gln311Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86VD8	Missense_Mutation	SNP	pfam_Mab-21_dom	p.Q311E	ENST00000392452.2	37	c.931	CCDS3302.2	3	.	.	.	.	.	.	.	.	.	.	G	14.16	2.453077	0.43531	.	.	ENSG00000180611	ENST00000392452	T	0.07800	3.16	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.10252	0.0251	L	0.51422	1.61	0.80722	D	1	P	0.46784	0.884	B	0.42959	0.403	T	0.07102	-1.0790	10	0.05351	T	0.99	.	18.2403	0.89966	0.0:0.0:1.0:0.0	.	311	Q8IYB1	M21D2_HUMAN	E	311	ENSP00000376246:Q311E	ENSP00000376246:Q311E	Q	-	1	0	MB21D2	193999414	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.869000	0.99810	2.542000	0.85734	0.655000	0.94253	CAG	MB21D2	-	pfam_Mab-21_dom	ENSG00000180611		0.557	MB21D2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MB21D2	HGNC	protein_coding	OTTHUMT00000341543.1	49	0.00	0	G	NM_178496		192516720	192516720	-1	no_errors	ENST00000392452	ensembl	human	known	69_37n	missense	34	31.37	16	SNP	1.000	C
MCM10	55388	genome.wustl.edu	37	10	13251286	13251286	+	Silent	SNP	T	T	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:13251286T>A	ENST00000484800.2	+	20	2707	c.2604T>A	c.(2602-2604)gcT>gcA	p.A868A	MCM10_ENST00000378694.1_3'UTR|MCM10_ENST00000378714.3_Silent_p.A867A			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	868					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						AAGAACATGCTAAATTTCTGA	0.403																																						dbGAP											0													98.0	94.0	96.0					10																	13251286		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.2604T>A	10.37:g.13251286T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Silent	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.A868	ENST00000484800.2	37	c.2604	CCDS7096.1	10																																																																																			MCM10	-	pfam_Rep_factor_Mcm10	ENSG00000065328		0.403	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	411	0.00	0	T	NM_182751		13251286	13251286	+1	no_errors	ENST00000361282	ensembl	human	known	69_37n	silent	582	11.82	78	SNP	0.983	A
METAP1D	254042	genome.wustl.edu	37	2	172944897	172944897	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:172944897G>C	ENST00000315796.4	+	9	1279	c.892G>C	c.(892-894)Gag>Cag	p.E298Q	METAP1D_ENST00000488581.1_3'UTR	NM_199227.1	NP_954697.1	Q6UB28	MAP12_HUMAN	methionyl aminopeptidase type 1D (mitochondrial)	298					N-terminal protein amino acid modification (GO:0031365)|peptidyl-methionine modification (GO:0018206)|protein initiator methionine removal (GO:0070084)	mitochondrion (GO:0005739)	aminopeptidase activity (GO:0004177)|metal ion binding (GO:0046872)|metalloaminopeptidase activity (GO:0070006)|metalloexopeptidase activity (GO:0008235)			NS(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(1)	8						taaagtcctggaggatgcatg	0.433																																						dbGAP											0													165.0	161.0	162.0					2																	172944897		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY374142, BC029123	CCDS2246.1	2q31.1	2010-09-21			ENSG00000172878	ENSG00000172878			32583	protein-coding gene	gene with protein product	"""methionine aminopeptidase 1D"""	610267				14532271, 16568094	Standard	NM_199227		Approved	MAP1D, Metap1l	uc002uhk.3	Q6UB28	OTTHUMG00000132283	ENST00000315796.4:c.892G>C	2.37:g.172944897G>C	ENSP00000315152:p.Glu298Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q1WNX3	Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,prints_Pept_M24_MAP,tigrfam_Pept_M24A_MAP1	p.E298Q	ENST00000315796.4	37	c.892	CCDS2246.1	2	.	.	.	.	.	.	.	.	.	.	G	13.18	2.160842	0.38119	.	.	ENSG00000172878	ENST00000315796	T	0.46451	0.87	5.95	5.95	0.96441	Peptidase M24, structural domain (3);	0.290214	0.42821	D	0.000643	T	0.37517	0.1006	L	0.47716	1.5	0.37222	D	0.905293	B	0.16802	0.019	B	0.20955	0.032	T	0.35475	-0.9787	10	0.62326	D	0.03	-7.6083	10.7916	0.46436	0.1433:0.0:0.8567:0.0	.	298	Q6UB28	AMP1D_HUMAN	Q	298	ENSP00000315152:E298Q	ENSP00000315152:E298Q	E	+	1	0	METAP1D	172653143	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.463000	0.45058	2.824000	0.97209	0.655000	0.94253	GAG	METAP1D	-	pfam_Pept_M24_structural-domain,superfamily_Pept_M24_structural-domain,tigrfam_Pept_M24A_MAP1	ENSG00000172878		0.433	METAP1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METAP1D	HGNC	protein_coding	OTTHUMT00000255378.2	571	0.17	1	G	NM_199227		172944897	172944897	+1	no_errors	ENST00000315796	ensembl	human	known	69_37n	missense	405	32.16	192	SNP	1.000	C
MFGE8	4240	genome.wustl.edu	37	15	89450546	89450546	+	Silent	SNP	C	C	G	rs1878327	byFrequency	TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:89450546C>G	ENST00000566497.1	-	3	328	c.267G>C	c.(265-267)tcG>tcC	p.S89S	MFGE8_ENST00000542878.1_Silent_p.S45S|MFGE8_ENST00000268151.7_Silent_p.S89S|MFGE8_ENST00000559997.1_5'UTR|MFGE8_ENST00000539437.1_Silent_p.S81S|MFGE8_ENST00000268150.8_Silent_p.S89S			Q08431	MFGM_HUMAN	milk fat globule-EGF factor 8 protein	89	F5/8 type C 1. {ECO:0000255|PROSITE- ProRule:PRU00081}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|phagocytosis, engulfment (GO:0006911)|phagocytosis, recognition (GO:0006910)|positive regulation of apoptotic cell clearance (GO:2000427)|single fertilization (GO:0007338)|viral process (GO:0016032)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of plasma membrane (GO:0019897)|membrane (GO:0016020)|vesicle (GO:0031982)	phosphatidylethanolamine binding (GO:0008429)|phosphatidylserine binding (GO:0001786)	p.S89S(1)		breast(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	22	Lung NSC(78;0.0392)|all_lung(78;0.077)					CACGCACAGACGAGGCGGCGA	0.617																																						dbGAP											1	Substitution - coding silent(1)	stomach(1)											131.0	91.0	105.0					15																	89450546		2200	4299	6499	-	-	-	SO:0001819	synonymous_variant	0			U58516	CCDS10347.1, CCDS45345.1	15q25	2009-03-25			ENSG00000140545	ENSG00000140545			7036	protein-coding gene	gene with protein product	"""sperm surface protein hP47"""	602281	"""sperm associated antigen 10"""	SPAG10		9027496, 19204935	Standard	NM_005928		Approved	SED1, EDIL1, BA46, OAcGD3S, HsT19888, MFG-E8, hP47	uc002bng.4	Q08431	OTTHUMG00000148682	ENST00000566497.1:c.267G>C	15.37:g.89450546C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6M7|Q53FU9|Q7Z3D2|Q9BTL9	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_EGF-like_dom,superfamily_Galactose-bd-like,smart_EGF-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.S89	ENST00000566497.1	37	c.267	CCDS10347.1	15																																																																																			MFGE8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000140545		0.617	MFGE8-015	NOVEL	alternative_3_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	MFGE8	HGNC	protein_coding	OTTHUMT00000432804.1	56	0.00	0	C	NM_005928		89450546	89450546	-1	no_errors	ENST00000268150	ensembl	human	known	69_37n	silent	54	31.07	32	SNP	0.000	G
MIS18BP1	55320	genome.wustl.edu	37	14	45716464	45716464	+	Nonsense_Mutation	SNP	G	G	C	rs139783125		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:45716464G>C	ENST00000310806.4	-	2	484	c.26C>G	c.(25-27)tCa>tGa	p.S9*		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	9					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						GTAAATTCTTGAATGTTTCAA	0.378																																						dbGAP											0													52.0	51.0	51.0					14																	45716464		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.26C>G	14.37:g.45716464G>C	ENSP00000309790:p.Ser9*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Nonsense_Mutation	SNP	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S9*	ENST00000310806.4	37	c.26	CCDS9684.1	14	.	.	.	.	.	.	.	.	.	.	G	20.0	3.931156	0.73327	.	.	ENSG00000129534	ENST00000310806;ENST00000451174	.	.	.	5.28	3.34	0.38264	.	0.400383	0.21486	N	0.073746	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-0.8422	5.9361	0.19167	0.0974:0.0:0.7123:0.1903	.	.	.	.	X	9	.	ENSP00000309790:S9X	S	-	2	0	MIS18BP1	44786214	0.980000	0.34600	0.996000	0.52242	0.458000	0.32498	1.635000	0.37134	2.466000	0.83321	0.585000	0.79938	TCA	MIS18BP1	-	NULL	ENSG00000129534		0.378	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	134	0.00	0	G			45716464	45716464	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	nonsense	57	54.40	68	SNP	0.985	C
MKL2	57496	genome.wustl.edu	37	16	14334339	14334339	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr16:14334339C>G	ENST00000341243.5	+	8	1044	c.1044C>G	c.(1042-1044)ttC>ttG	p.F348L	MKL2_ENST00000572567.1_Missense_Mutation_p.F348L|MKL2_ENST00000573051.1_Missense_Mutation_p.F308L|MKL2_ENST00000571589.1_Missense_Mutation_p.F359L|MKL2_ENST00000574045.1_Missense_Mutation_p.F359L|MKL2_ENST00000318282.5_Missense_Mutation_p.F359L			Q9ULH7	MKL2_HUMAN	MKL/myocardin-like 2	348					blood vessel morphogenesis (GO:0048514)|cardiac muscle tissue development (GO:0048738)|embryonic organ development (GO:0048568)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|muscle organ development (GO:0007517)|positive regulation of striated muscle tissue development (GO:0045844)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(6)|liver(2)|lung(7)|ovary(4)|pancreas(1)|prostate(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTGCACCATTCAAGTACGGCG	0.502																																						dbGAP											0													99.0	92.0	95.0					16																	14334339		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB033069	CCDS32391.1	16p13.12	2012-11-29			ENSG00000186260	ENSG00000186260			29819	protein-coding gene	gene with protein product		609463				10574462	Standard	NM_014048		Approved	MRTF-B, FLJ31823	uc002dcg.3	Q9ULH7	OTTHUMG00000177379	ENST00000341243.5:c.1044C>G	16.37:g.14334339C>G	ENSP00000345841:p.Phe348Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND53|B4DGT8|Q68CT1|Q6UB16|Q86WW2|Q8N226	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.F348L	ENST00000341243.5	37	c.1044		16	.	.	.	.	.	.	.	.	.	.	C	5.072	0.198891	0.09652	.	.	ENSG00000186260	ENST00000318282;ENST00000389126;ENST00000341243	.	.	.	5.78	4.83	0.62350	.	0.309791	0.35585	N	0.003103	T	0.12518	0.0304	N	0.00595	-1.35	0.80722	D	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.01281	0.0;0.0;0.0;0.0	T	0.14868	-1.0457	9	0.06494	T	0.89	-7.3212	5.2775	0.15657	0.1384:0.6324:0.1509:0.0783	.	308;359;348;359	Q9ULH7-2;B4DGT8;Q9ULH7;Q9ULH7-4	.;.;MKL2_HUMAN;.	L	359;348;348	.	ENSP00000339086:F359L	F	+	3	2	MKL2	14241840	1.000000	0.71417	0.977000	0.42913	0.921000	0.55340	1.831000	0.39141	1.448000	0.47680	0.655000	0.94253	TTC	MKL2	-	NULL	ENSG00000186260		0.502	MKL2-202	KNOWN	basic	protein_coding	MKL2	HGNC	protein_coding		164	0.00	0	C	NM_014048		14334339	14334339	+1	no_errors	ENST00000341243	ensembl	human	known	69_37n	missense	104	35.58	58	SNP	1.000	G
MRPS22	56945	genome.wustl.edu	37	3	139074558	139074558	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:139074558C>G	ENST00000495075.1	+	9	1345	c.913C>G	c.(913-915)Cac>Gac	p.H305D	MRPS22_ENST00000465056.1_Missense_Mutation_p.H304D|MRPS22_ENST00000478464.1_Missense_Mutation_p.H264D|MRPS22_ENST00000310776.4_Missense_Mutation_p.H305D			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	305						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						CCAGCTGTATCACGTGCTCCA	0.413																																						dbGAP											0													78.0	75.0	76.0					3																	139074558		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.913C>G	3.37:g.139074558C>G	ENSP00000418008:p.His305Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3I1	Missense_Mutation	SNP	pfam_Ribosomal_S22_mit	p.H305D	ENST00000495075.1	37	c.913	CCDS3107.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.4|20.4	3.987710|3.987710	0.74589|0.74589	.|.	.|.	ENSG00000175110|ENSG00000184432	ENST00000495075;ENST00000310776;ENST00000465056;ENST00000478464|ENST00000503326	D;D;D;D|.	0.82344|.	-1.6;-1.6;-1.6;-1.6|.	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	0.045811|.	0.85682|.	D|.	0.000000|.	T|.	0.78874|.	0.4352|.	M|M	0.78049|0.78049	2.395|2.395	0.80722|0.80722	D|D	1|1	P;D;D|.	0.67145|.	0.922;0.994;0.996|.	P;P;P|.	0.62014|.	0.689;0.835;0.897|.	T|.	0.77715|.	-0.2484|.	10|.	0.07644|.	T|.	0.81|.	-14.5597|-14.5597	19.9533|19.9533	0.97211|0.97211	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	264;304;305|.	G5E9W7;G5E9V5;P82650|.	.;.;RT22_HUMAN|.	D|S	305;305;304;264|106	ENSP00000418008:H305D;ENSP00000310785:H305D;ENSP00000418233:H304D;ENSP00000419303:H264D|.	ENSP00000310785:H305D|.	H|X	+|-	1|2	0|2	MRPS22|COPB2	140557248|140557248	1.000000|1.000000	0.71417|0.71417	0.984000|0.984000	0.44739|0.44739	0.309000|0.309000	0.27889|0.27889	3.720000|3.720000	0.54933|0.54933	2.723000|2.723000	0.93209|0.93209	0.655000|0.655000	0.94253|0.94253	CAC|TGA	MRPS22	-	pfam_Ribosomal_S22_mit	ENSG00000175110		0.413	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	HGNC	protein_coding	OTTHUMT00000358120.1	268	0.00	0	C	NM_020191		139074558	139074558	+1	no_errors	ENST00000310776	ensembl	human	known	69_37n	missense	241	37.56	145	SNP	1.000	G
MSH3	4437	genome.wustl.edu	37	5	80071554	80071554	+	Silent	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:80071554A>T	ENST00000265081.6	+	16	2375	c.2295A>T	c.(2293-2295)ccA>ccT	p.P765P		NM_002439.4	NP_002430.3	P20585	MSH3_HUMAN	mutS homolog 3	765					ATP catabolic process (GO:0006200)|DNA repair (GO:0006281)|maintenance of DNA repeat elements (GO:0043570)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|somatic recombination of immunoglobulin gene segments (GO:0016447)	membrane (GO:0016020)|MutSbeta complex (GO:0032302)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)	ATP binding (GO:0005524)|centromeric DNA binding (GO:0019237)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|double-strand/single-strand DNA junction binding (GO:0000406)|enzyme binding (GO:0019899)|heteroduplex DNA loop binding (GO:0000404)|Y-form DNA binding (GO:0000403)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29		Lung NSC(167;0.00479)|all_lung(232;0.00507)|Ovarian(174;0.0261)|Breast(144;0.244)		OV - Ovarian serous cystadenocarcinoma(54;2.38e-45)|Epithelial(54;1.58e-38)|all cancers(79;4.93e-33)		CTTGTATACCAACTGATTGGG	0.289								Mismatch excision repair (MMR)																													Melanoma(88;1010 1399 13793 26548 36275)	dbGAP											0													64.0	66.0	65.0					5																	80071554		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			U61981	CCDS34195.1	5q11-q12	2013-09-12	2013-09-12		ENSG00000113318	ENSG00000113318			7326	protein-coding gene	gene with protein product	"""Divergent upstream protein"", ""Mismatch repair protein 1"""	600887	"""mutS (E. coli) homolog 3"", ""mutS homolog 3 (E. coli)"""				Standard	NM_002439		Approved	DUP, MRP1	uc003kgz.4	P20585	OTTHUMG00000162540	ENST00000265081.6:c.2295A>T	5.37:g.80071554A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L480|A1L482|A6NMM6|Q6PJT5|Q86UQ6|Q92867	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.P765	ENST00000265081.6	37	c.2295	CCDS34195.1	5																																																																																			MSH3	-	pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core	ENSG00000113318		0.289	MSH3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	MSH3	HGNC	protein_coding	OTTHUMT00000369471.1	388	0.26	1	A	NM_002439		80071554	80071554	+1	no_errors	ENST00000265081	ensembl	human	known	69_37n	silent	176	50.42	180	SNP	0.994	T
MTUS2	23281	genome.wustl.edu	37	13	29600959	29600959	+	Silent	SNP	C	C	G	rs371479373		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:29600959C>G	ENST00000431530.3	+	1	2212	c.2154C>G	c.(2152-2154)gtC>gtG	p.V718V		NM_001033602.2	NP_001028774.2	Q5JR59	MTUS2_HUMAN	microtubule associated tumor suppressor candidate 2	708	Mediates interaction with MAPRE1.					cytoplasm (GO:0005737)|microtubule (GO:0005874)	microtubule binding (GO:0008017)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(3)|prostate(1)|skin(1)	20						AGCCAAGGGTCTTCAGTTCCG	0.498																																						dbGAP											0													64.0	66.0	65.0					13																	29600959		1895	4107	6002	-	-	-	SO:0001819	synonymous_variant	0			AB018317	CCDS41874.1, CCDS45022.1	13q12.3	2013-01-17	2009-10-20	2009-10-20	ENSG00000132938	ENSG00000132938			20595	protein-coding gene	gene with protein product	"""+TIP of 150 kDa"", ""cardiac zipper protein"""		"""KIAA0774"""	KIAA0774		19543227	Standard	NM_001033602		Approved	TIP150, CAZIP, ICIS	uc001usl.4	Q5JR59	OTTHUMG00000016657	ENST00000431530.3:c.2154C>G	13.37:g.29600959C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E292|B4DF81|O94872|Q08E97|Q5JQR3|Q8N5E2	Silent	SNP	NULL	p.V718	ENST00000431530.3	37	c.2154	CCDS45022.1	13																																																																																			MTUS2	-	NULL	ENSG00000132938		0.498	MTUS2-002	KNOWN	basic|CCDS	protein_coding	MTUS2	HGNC	protein_coding	OTTHUMT00000044336.3	174	0.00	0	C	XM_166270		29600959	29600959	+1	no_errors	ENST00000431530	ensembl	human	known	69_37n	silent	168	19.43	41	SNP	1.000	G
MTRF1	9617	genome.wustl.edu	37	13	41834948	41834948	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:41834948C>G	ENST00000379480.4	-	2	196	c.96G>C	c.(94-96)caG>caC	p.Q32H	MTRF1_ENST00000430347.2_Missense_Mutation_p.Q45H|MTRF1_ENST00000239852.6_5'UTR|MTRF1_ENST00000379477.1_Missense_Mutation_p.Q32H	NM_004294.2	NP_004285.2	O75570	RF1M_HUMAN	mitochondrial translational release factor 1	32					regulation of translational termination (GO:0006449)	mitochondrion (GO:0005739)	translation release factor activity (GO:0003747)|translation release factor activity, codon specific (GO:0016149)			breast(1)|endometrium(4)|large_intestine(3)|lung(6)	14		Lung NSC(96;4.52e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)|Ovarian(182;0.125)		OV - Ovarian serous cystadenocarcinoma(117;4.24e-10)|all cancers(112;2.05e-09)|Epithelial(112;2.48e-09)|GBM - Glioblastoma multiforme(144;0.00115)|BRCA - Breast invasive adenocarcinoma(63;0.0721)|KIRC - Kidney renal clear cell carcinoma(186;0.248)		CAAGATGTATCTGTCTAAATT	0.393																																						dbGAP											0													106.0	98.0	101.0					13																	41834948		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072934	CCDS9378.1	13q14.1-q14.3	2008-07-18			ENSG00000120662	ENSG00000120662			7469	protein-coding gene	gene with protein product	"""mitochontrial peptide chain release factor 1"""	604601				9838146, 10773675	Standard	NM_004294		Approved	RF1, MTTRF1, MGC47721	uc001uxy.3	O75570	OTTHUMG00000016790	ENST00000379480.4:c.96G>C	13.37:g.41834948C>G	ENSP00000368793:p.Gln32His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG01|Q5T6Y5|Q8IUQ6	Missense_Mutation	SNP	pfam_Pep_chain_release_fac_I_II,pfam_PCRF,smart_PCRF	p.Q45H	ENST00000379480.4	37	c.135	CCDS9378.1	13	.	.	.	.	.	.	.	.	.	.	C	6.441	0.449459	0.12223	.	.	ENSG00000120662	ENST00000379480;ENST00000379477;ENST00000430347;ENST00000239852;ENST00000452359	T;T;T;T	0.25085	2.89;2.89;2.84;1.82	4.82	3.04	0.35103	.	0.810284	0.10916	N	0.620094	T	0.18045	0.0433	L	0.27053	0.805	0.09310	N	1	B;B	0.09022	0.002;0.001	B;B	0.10450	0.005;0.003	T	0.24225	-1.0166	10	0.72032	D	0.01	-0.663	6.4019	0.21642	0.0:0.5559:0.2948:0.1493	.	45;32	B4DG01;O75570	.;RF1M_HUMAN	H	32;32;45;32;32	ENSP00000368793:Q32H;ENSP00000368790:Q32H;ENSP00000400031:Q45H;ENSP00000399279:Q32H	ENSP00000239852:Q32H	Q	-	3	2	MTRF1	40732948	0.004000	0.15560	0.265000	0.24526	0.394000	0.30568	-0.123000	0.10611	0.584000	0.29591	0.462000	0.41574	CAG	MTRF1	-	NULL	ENSG00000120662		0.393	MTRF1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MTRF1	HGNC	protein_coding	OTTHUMT00000044666.3	225	0.00	0	C	NM_004294		41834948	41834948	-1	no_errors	ENST00000430347	ensembl	human	known	69_37n	missense	170	38.63	107	SNP	0.074	G
MUC13	56667	genome.wustl.edu	37	3	124632415	124632415	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:124632415A>C	ENST00000311075.3	-	7	1113	c.1075T>G	c.(1075-1077)Tgc>Ggc	p.C359G		NM_033049.3	NP_149038	Q9H3R2	MUC13_HUMAN	mucin 13, cell surface associated	360	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(5)|prostate(1)|skin(1)|stomach(1)	18						TTACCAACGCAGAAAGGGCTC	0.413																																						dbGAP											0													117.0	107.0	110.0					3																	124632415		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF286113		3q21.2	2007-01-17	2006-03-14		ENSG00000173702	ENSG00000173702		"""Mucins"""	7511	protein-coding gene	gene with protein product		612181	"""down-regulated in colon cancer 1"", ""mucin 13, epithelial transmembrane"""	DRCC1		11278439	Standard	NM_033049		Approved		uc003ehq.2	Q9H3R2	OTTHUMG00000159484	ENST00000311075.3:c.1075T>G	3.37:g.124632415A>C	ENSP00000312235:p.Cys359Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWD9|Q9NXT5	Missense_Mutation	SNP	pfam_SEA,superfamily_Growth_fac_rcpt,smart_EGF-like,pfscan_EG-like_dom	p.C359G	ENST00000311075.3	37	c.1075		3	.	.	.	.	.	.	.	.	.	.	A	14.57	2.574178	0.45902	.	.	ENSG00000173702	ENST00000311075	D	0.91351	-2.83	4.18	4.18	0.49190	.	0.000000	0.56097	D	0.000034	D	0.93612	0.7960	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	D	0.92583	0.6076	10	0.41790	T	0.15	-20.6955	9.9106	0.41403	1.0:0.0:0.0:0.0	.	359	Q9H3R2	MUC13_HUMAN	G	359	ENSP00000312235:C359G	ENSP00000312235:C359G	C	-	1	0	MUC13	126115105	0.918000	0.31147	0.112000	0.21494	0.029000	0.11900	3.579000	0.53900	2.120000	0.65058	0.374000	0.22700	TGC	MUC13	-	superfamily_Growth_fac_rcpt,smart_EGF-like	ENSG00000173702		0.413	MUC13-001	KNOWN	basic|appris_principal	protein_coding	MUC13	HGNC	protein_coding	OTTHUMT00000355714.1	155	0.00	0	A	NM_033049		124632415	124632415	-1	no_errors	ENST00000311075	ensembl	human	known	69_37n	missense	120	34.78	64	SNP	0.129	C
MYO1A	4640	genome.wustl.edu	37	12	57423998	57423998	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:57423998G>C	ENST00000442789.2	-	25	2874	c.2587C>G	c.(2587-2589)Cag>Gag	p.Q863E	MYO1A_ENST00000300119.3_Missense_Mutation_p.Q863E|TAC3_ENST00000415231.1_5'Flank|MYO1A_ENST00000544473.1_Missense_Mutation_p.Q701E	NM_001256041.1	NP_001242970.1	Q9UBC5	MYO1A_HUMAN	myosin IA	863	Myosin tail. {ECO:0000255}.				microvillus assembly (GO:0030033)|sensory perception of sound (GO:0007605)|vesicle localization (GO:0051648)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|basolateral plasma membrane (GO:0016323)|brush border (GO:0005903)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(7)|urinary_tract(3)	50						CCTCACCTCTGGGGATATGAA	0.562																																						dbGAP											0													102.0	81.0	88.0					12																	57423998		2203	4300	6503	-	-	-	SO:0001583	missense	0			L29137	CCDS8929.1	12q13-q15	2011-09-27			ENSG00000166866	ENSG00000166866		"""Myosins / Myosin superfamily : Class I"""	7595	protein-coding gene	gene with protein product		601478		MYHL, DFNA48		8884266, 12736868	Standard	NM_001256041		Approved		uc009zpd.3	Q9UBC5	OTTHUMG00000149899	ENST00000442789.2:c.2587C>G	12.37:g.57423998G>C	ENSP00000393392:p.Gln863Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQD7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q863E	ENST00000442789.2	37	c.2587	CCDS8929.1	12	.	.	.	.	.	.	.	.	.	.	G	11.00	1.511097	0.27036	.	.	ENSG00000166866	ENST00000300119;ENST00000442789;ENST00000544473	T;T;T	0.36878	1.23;1.23;1.23	4.94	2.94	0.34122	Myosin tail 2 (1);	0.465980	0.24933	N	0.034442	T	0.28863	0.0716	L	0.43701	1.375	0.28909	N	0.892832	B	0.09022	0.002	B	0.16722	0.016	T	0.17107	-1.0380	10	0.23891	T	0.37	.	11.3334	0.49490	0.0:0.3527:0.6473:0.0	.	863	Q9UBC5	MYO1A_HUMAN	E	863;863;701	ENSP00000300119:Q863E;ENSP00000393392:Q863E;ENSP00000440514:Q701E	ENSP00000300119:Q863E	Q	-	1	0	MYO1A	55710265	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	1.319000	0.33655	1.010000	0.39314	0.544000	0.68410	CAG	MYO1A	-	pfam_Myosin_tail_2	ENSG00000166866		0.562	MYO1A-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MYO1A	HGNC	protein_coding	OTTHUMT00000313833.2	191	0.00	0	G	NM_005379		57423998	57423998	-1	no_errors	ENST00000300119	ensembl	human	known	69_37n	missense	50	50.50	51	SNP	0.999	C
NALCN	259232	genome.wustl.edu	37	13	101748002	101748002	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:101748002A>T	ENST00000251127.6	-	28	3273	c.3192T>A	c.(3190-3192)aaT>aaA	p.N1064K		NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	1064					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					ACACACTGACATTAATTCTGA	0.353																																						dbGAP											0													67.0	72.0	70.0					13																	101748002		2203	4299	6502	-	-	-	SO:0001583	missense	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.3192T>A	13.37:g.101748002A>T	ENSP00000251127:p.Asn1064Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.N1064K	ENST00000251127.6	37	c.3192	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	A	5.629	0.300759	0.10678	.	.	ENSG00000102452	ENST00000251127	D	0.97811	-4.55	5.01	3.84	0.44239	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.87180	0.6113	N	0.00621	-1.32	0.80722	D	1	B	0.13594	0.008	B	0.17098	0.017	T	0.82335	-0.0508	10	0.02654	T	1	.	10.4911	0.44752	0.9232:0.0:0.0768:0.0	.	1064	Q8IZF0	NALCN_HUMAN	K	1064	ENSP00000251127:N1064K	ENSP00000251127:N1064K	N	-	3	2	NALCN	100546003	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.296000	0.43584	0.768000	0.33290	0.459000	0.35465	AAT	NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.353	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	295	0.00	0	A	NM_052867		101748002	101748002	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	missense	225	52.53	249	SNP	1.000	T
NDUFB9	4715	genome.wustl.edu	37	8	125551447	125551447	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:125551447G>T	ENST00000276689.3	+	1	104	c.20G>T	c.(19-21)gGa>gTa	p.G7V	TATDN1_ENST00000521546.1_5'Flank|TATDN1_ENST00000519548.1_5'Flank|NDUFB9_ENST00000517367.1_Missense_Mutation_p.G7V|TATDN1_ENST00000276692.6_5'Flank|NDUFB9_ENST00000522532.1_Missense_Mutation_p.G7V|TATDN1_ENST00000517678.1_5'Flank|TATDN1_ENST00000605953.1_5'Flank|NDUFB9_ENST00000518008.1_Missense_Mutation_p.G7V	NM_001278646.1|NM_005005.2	NP_001265575.1|NP_004996.1	Q9Y6M9	NDUB9_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9, 22kDa	7					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	8	Ovarian(258;0.00438)|all_neural(195;0.0779)|Hepatocellular(40;0.108)		STAD - Stomach adenocarcinoma(47;0.00288)			TTGGCGTCGGGACCCTACCTG	0.662																																						dbGAP											0													64.0	66.0	66.0					8																	125551447		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044956	CCDS6352.1	8q24.13	2011-07-04	2002-08-29		ENSG00000147684	ENSG00000147684		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7704	protein-coding gene	gene with protein product	"""complex I B22 subunit"""	601445	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 9 (22kD, B22)"""			8661098	Standard	NM_005005		Approved	B22, UQOR22, LYRM3	uc003yrg.4	Q9Y6M9	OTTHUMG00000165054	ENST00000276689.3:c.20G>T	8.37:g.125551447G>T	ENSP00000276689:p.Gly7Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8M6|Q9UQE8	Missense_Mutation	SNP	pfam_Complex1_LYR	p.G7V	ENST00000276689.3	37	c.20	CCDS6352.1	8	.	.	.	.	.	.	.	.	.	.	G	13.89	2.373499	0.42105	.	.	ENSG00000147684	ENST00000276689;ENST00000518008;ENST00000522532;ENST00000517367	T;D;D;T	0.83506	-0.64;-1.73;-1.71;-0.65	5.18	-10.2	0.00374	.	1.570180	0.03625	N	0.237050	T	0.71273	0.3320	N	0.22421	0.69	0.09310	N	0.999999	B;B	0.18863	0.031;0.0	B;B	0.08055	0.003;0.0	T	0.56475	-0.7973	10	0.17369	T	0.5	0.3299	19.891	0.96930	0.0:0.1156:0.7987:0.0856	.	7;7	E9PF49;Q9Y6M9	.;NDUB9_HUMAN	V	7	ENSP00000276689:G7V;ENSP00000428282:G7V;ENSP00000431115:G7V;ENSP00000430322:G7V	ENSP00000276689:G7V	G	+	2	0	NDUFB9	125620628	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.521000	0.06245	-1.618000	0.01568	-0.704000	0.03662	GGA	NDUFB9	-	NULL	ENSG00000147684		0.662	NDUFB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB9	HGNC	protein_coding	OTTHUMT00000381606.1	32	0.00	0	G	NM_005005		125551447	125551447	+1	no_errors	ENST00000276689	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	0.000	T
NEO1	4756	genome.wustl.edu	37	15	73593721	73593721	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:73593721C>T	ENST00000339362.5	+	29	4672	c.4225C>T	c.(4225-4227)Cgg>Tgg	p.R1409W	NEO1_ENST00000560262.1_Missense_Mutation_p.R1356W|NEO1_ENST00000558964.1_Missense_Mutation_p.R1398W|NEO1_ENST00000261908.6_Missense_Mutation_p.R1409W			Q92859	NEO1_HUMAN	neogenin 1	1409					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|iron ion homeostasis (GO:0055072)|muscle cell differentiation (GO:0042692)|myoblast fusion (GO:0007520)|positive regulation of muscle cell differentiation (GO:0051149)|regulation of transcription, DNA-templated (GO:0006355)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(9)|lung(26)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(2)	57						AGGAAGGAGCCGGCCTCCTAT	0.562																																						dbGAP											0													102.0	87.0	92.0					15																	73593721		2198	4297	6495	-	-	-	SO:0001583	missense	0			U61262	CCDS10247.1, CCDS53957.1, CCDS58378.1	15q22.3-q23	2014-06-20	2010-06-24		ENSG00000067141	ENSG00000067141		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7754	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 2"""	601907	"""neogenin (chicken) homolog 1"""			9121761	Standard	NM_002499		Approved	NGN, HsT17534, IGDCC2, NTN1R2	uc002avm.4	Q92859	OTTHUMG00000133509	ENST00000339362.5:c.4225C>T	15.37:g.73593721C>T	ENSP00000341198:p.Arg1409Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKM9|B7ZKN0|O00340|Q17RX1	Missense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R1409W	ENST00000339362.5	37	c.4225	CCDS10247.1	15	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425851	0.83667	.	.	ENSG00000067141	ENST00000339362;ENST00000379842;ENST00000261908	T	0.55052	0.54	5.31	4.38	0.52667	Neogenin, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.72104	0.3419	M	0.74258	2.255	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.76547	-0.2919	10	0.87932	D	0	-10.6357	15.2655	0.73657	0.1415:0.8585:0.0:0.0	.	1356;1398;1120;1409	B7ZKM9;B7ZKN0;E7EUX3;Q92859	.;.;.;NEO1_HUMAN	W	1356;1120;1409	ENSP00000261908:R1409W	ENSP00000261908:R1409W	R	+	1	2	NEO1	71380774	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	4.271000	0.58902	1.211000	0.43351	0.655000	0.94253	CGG	NEO1	-	pfam_Neogenin_C	ENSG00000067141		0.562	NEO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEO1	HGNC	protein_coding	OTTHUMT00000257472.2	213	0.00	0	C	NM_002499		73593721	73593721	+1	no_errors	ENST00000261908	ensembl	human	known	69_37n	missense	102	34.19	53	SNP	1.000	T
NOTCH1	4851	genome.wustl.edu	37	9	139390731	139390731	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:139390731T>A	ENST00000277541.6	-	34	7535	c.7460A>T	c.(7459-7461)cAg>cTg	p.Q2487L		NM_017617.3	NP_060087.3	P46531	NOTC1_HUMAN	notch 1	2487					anagen (GO:0042640)|aortic valve morphogenesis (GO:0003180)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|arterial endothelial cell differentiation (GO:0060842)|atrioventricular node development (GO:0003162)|atrioventricular valve morphogenesis (GO:0003181)|auditory receptor cell fate commitment (GO:0009912)|axonogenesis (GO:0007409)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac atrium morphogenesis (GO:0003209)|cardiac chamber formation (GO:0003207)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac left ventricle morphogenesis (GO:0003214)|cardiac muscle cell proliferation (GO:0060038)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac right atrium morphogenesis (GO:0003213)|cardiac right ventricle formation (GO:0003219)|cardiac septum morphogenesis (GO:0060411)|cardiac vascular smooth muscle cell development (GO:0060948)|cardiac ventricle morphogenesis (GO:0003208)|cell fate specification (GO:0001708)|cell migration involved in endocardial cushion formation (GO:0003273)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|cilium morphogenesis (GO:0060271)|collecting duct development (GO:0072044)|compartment pattern specification (GO:0007386)|coronary artery morphogenesis (GO:0060982)|coronary vein morphogenesis (GO:0003169)|determination of left/right symmetry (GO:0007368)|distal tubule development (GO:0072017)|embryonic hindlimb morphogenesis (GO:0035116)|endocardial cell differentiation (GO:0060956)|endocardial cushion morphogenesis (GO:0003203)|endocardium development (GO:0003157)|endocardium morphogenesis (GO:0003160)|endoderm development (GO:0007492)|epithelial to mesenchymal transition (GO:0001837)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|forebrain development (GO:0030900)|foregut morphogenesis (GO:0007440)|gene expression (GO:0010467)|glial cell differentiation (GO:0010001)|glomerular mesangial cell development (GO:0072144)|growth involved in heart morphogenesis (GO:0003241)|hair follicle morphogenesis (GO:0031069)|heart development (GO:0007507)|heart looping (GO:0001947)|heart trabecula morphogenesis (GO:0061384)|humoral immune response (GO:0006959)|immune response (GO:0006955)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|keratinocyte differentiation (GO:0030216)|left/right axis specification (GO:0070986)|liver development (GO:0001889)|lung development (GO:0030324)|mesenchymal cell development (GO:0014031)|mitral valve formation (GO:0003192)|negative regulation of anoikis (GO:2000811)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell migration involved in sprouting angiogenesis (GO:0090051)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of endothelial cell chemotaxis (GO:2001027)|negative regulation of glial cell proliferation (GO:0060253)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of neurogenesis (GO:0050768)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of ossification (GO:0030279)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of photoreceptor cell differentiation (GO:0046533)|negative regulation of pro-B cell differentiation (GO:2000974)|negative regulation of stem cell differentiation (GO:2000737)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural tube development (GO:0021915)|neuronal stem cell maintenance (GO:0097150)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|Notch signaling pathway involved in regulation of secondary heart field cardioblast proliferation (GO:0003270)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland epithelium morphogenesis (GO:0060740)|pulmonary valve morphogenesis (GO:0003184)|regulation of epithelial cell proliferation involved in prostate gland development (GO:0060768)|regulation of extracellular matrix assembly (GO:1901201)|regulation of somitogenesis (GO:0014807)|regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003256)|regulation of transcription, DNA-templated (GO:0006355)|response to muramyl dipeptide (GO:0032495)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)|skeletal muscle cell differentiation (GO:0035914)|somatic stem cell division (GO:0048103)|sprouting angiogenesis (GO:0002040)|transcription initiation from RNA polymerase II promoter (GO:0006367)|tube formation (GO:0035148)|vasculogenesis involved in coronary vascular morphogenesis (GO:0060979)|venous endothelial cell differentiation (GO:0060843)|ventricular septum morphogenesis (GO:0060412)|ventricular trabecula myocardium morphogenesis (GO:0003222)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|MAML1-RBP-Jkappa- ICN1 complex (GO:0002193)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|receptor activity (GO:0004872)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(16)|central_nervous_system(17)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1183)|kidney(4)|large_intestine(1)|lung(57)|oesophagus(2)|ovary(3)|pancreas(1)|prostate(3)|skin(21)|upper_aerodigestive_tract(39)|urinary_tract(3)	1359	all_cancers(76;0.223)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.34e-06)|Epithelial(140;7.77e-06)		GTAGCTGTGCTGCGAGGGGGG	0.682			"""T, Mis, O"""	TRB@	T-ALL					HNSCC(8;0.001)																												dbGAP		Dom	yes		9	9q34.3	4851	"""Notch homolog 1, translocation-associated (Drosophila) (TAN1)"""		L	0													17.0	22.0	20.0					9																	139390731		2133	4221	6354	-	-	-	SO:0001583	missense	0			AF308602	CCDS43905.1	9q34.3	2013-01-10	2010-06-24		ENSG00000148400	ENSG00000148400		"""Ankyrin repeat domain containing"""	7881	protein-coding gene	gene with protein product		190198	"""Notch (Drosophila) homolog 1 (translocation-associated)"", ""Notch homolog 1, translocation-associated (Drosophila)"""	TAN1		1831692	Standard	NM_017617		Approved		uc004chz.3	P46531	OTTHUMG00000020935	ENST00000277541.6:c.7460A>T	9.37:g.139390731T>A	ENSP00000277541:p.Gln2487Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59ED8|Q5SXM3	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_EGF_extracell,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_1,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.Q2487L	ENST00000277541.6	37	c.7460	CCDS43905.1	9	.	.	.	.	.	.	.	.	.	.	T	22.6	4.309362	0.81247	.	.	ENSG00000148400	ENST00000277541	T	0.79749	-1.3	5.1	5.1	0.69264	Domain of unknown function DUF3454, notch (1);	0.000000	0.85682	D	0.000000	D	0.88562	0.6470	M	0.70595	2.14	0.80722	D	1	D	0.71674	0.998	D	0.83275	0.996	D	0.89892	0.4038	10	0.87932	D	0	.	14.3352	0.66584	0.0:0.0:0.0:1.0	.	2487	P46531	NOTC1_HUMAN	L	2487	ENSP00000277541:Q2487L	ENSP00000277541:Q2487L	Q	-	2	0	NOTCH1	138510552	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	7.881000	0.87252	2.049000	0.60858	0.379000	0.24179	CAG	NOTCH1	-	pirsf_Notch,pfam_DUF3454_notch	ENSG00000148400		0.682	NOTCH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH1	HGNC	protein_coding	OTTHUMT00000055087.1	86	0.00	0	T	NM_017617		139390731	139390731	-1	no_errors	ENST00000277541	ensembl	human	known	69_37n	missense	7	86.27	44	SNP	1.000	A
NOTCH2	4853	genome.wustl.edu	37	1	120465372	120465372	+	Missense_Mutation	SNP	C	C	T	rs147812271		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:120465372C>T	ENST00000256646.2	-	27	5108	c.4889G>A	c.(4888-4890)cGc>cAc	p.R1630H	NOTCH2_ENST00000493703.1_5'UTR	NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	1630	Negative regulatory region (NRR).				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)	p.R1630L(1)		breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		AACACACTGGCGGTTGTCAAT	0.537			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	1	Substitution - Missense(1)	lung(1)											153.0	158.0	157.0					1																	120465372		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.4889G>A	1.37:g.120465372C>T	ENSP00000256646:p.Arg1630His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.R1630H	ENST00000256646.2	37	c.4889	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.356354	0.95854	.	.	ENSG00000134250	ENST00000256646	T	0.39056	1.1	5.78	5.78	0.91487	Notch, NODP domain (1);	0.000000	0.36703	U	0.002453	T	0.61085	0.2319	M	0.87971	2.92	0.80722	D	1	D	0.89917	1.0	D	0.70227	0.968	T	0.67662	-0.5613	10	0.87932	D	0	.	12.3325	0.55048	0.0:0.9234:0.0:0.0766	.	1630	Q04721	NOTC2_HUMAN	H	1630	ENSP00000256646:R1630H	ENSP00000256646:R1630H	R	-	2	0	NOTCH2	120266895	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.091000	0.71406	2.744000	0.94065	0.563000	0.77884	CGC	NOTCH2	-	pirsf_Notch,pfam_Notch_NODP_dom	ENSG00000134250		0.537	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	283	0.00	0	C	NM_024408		120465372	120465372	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	156	34.58	83	SNP	1.000	T
NPY2R	4887	genome.wustl.edu	37	4	156135095	156135095	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:156135095G>C	ENST00000329476.3	+	2	493	c.4G>C	c.(4-6)Ggt>Cgt	p.G2R	NPY2R_ENST00000506608.1_Missense_Mutation_p.G2R	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	2					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	ACTGAAAATGGGTCCAATAGG	0.428																																						dbGAP											0													100.0	98.0	99.0					4																	156135095		2203	4300	6503	-	-	-	SO:0001583	missense	0			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.4G>C	4.37:g.156135095G>C	ENSP00000332591:p.Gly2Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,prints_NPY2_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.G2R	ENST00000329476.3	37	c.4	CCDS3791.1	4	.	.	.	.	.	.	.	.	.	.	G	16.76	3.211773	0.58452	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.72942	-0.7;-0.7	5.4	5.4	0.78164	.	0.232248	0.38111	N	0.001807	T	0.80742	0.4681	L	0.47716	1.5	0.47308	D	0.999382	D	0.89917	1.0	D	0.74023	0.982	T	0.82000	-0.0674	10	0.87932	D	0	.	18.5259	0.90973	0.0:0.0:1.0:0.0	.	2	P49146	NPY2R_HUMAN	R	2	ENSP00000332591:G2R;ENSP00000426366:G2R	ENSP00000332591:G2R	G	+	1	0	NPY2R	156354545	1.000000	0.71417	1.000000	0.80357	0.710000	0.40934	5.207000	0.65197	2.680000	0.91292	0.637000	0.83480	GGT	NPY2R	-	prints_NPY2_rcpt	ENSG00000185149		0.428	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	HGNC	protein_coding	OTTHUMT00000365128.1	317	0.00	0	G	NM_000910		156135095	156135095	+1	no_errors	ENST00000329476	ensembl	human	known	69_37n	missense	222	49.43	217	SNP	1.000	C
NSD1	64324	genome.wustl.edu	37	5	176721686	176721686	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:176721686G>A	ENST00000439151.2	+	23	7362	c.7317G>A	c.(7315-7317)ctG>ctA	p.L2439L	NSD1_ENST00000354179.4_Silent_p.L2170L|NSD1_ENST00000347982.4_Silent_p.L2170L|NSD1_ENST00000361032.4_Silent_p.L2336L	NM_022455.4	NP_071900.2	Q96L73	NSD1_HUMAN	nuclear receptor binding SET domain protein 1	2439					gastrulation with mouth forming second (GO:0001702)|histone H3-K36 methylation (GO:0010452)|histone H4-K20 methylation (GO:0034770)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|estrogen receptor binding (GO:0030331)|histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H4-K20 specific) (GO:0042799)|retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription cofactor activity (GO:0003712)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(18)|lung(24)|ovary(2)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(3)	96	all_cancers(89;1.57e-05)|Renal(175;0.000269)|Lung NSC(126;0.00111)|all_lung(126;0.002)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.198)	Kidney(146;0.235)		AAAAAGCACTGAGGCCTGTGG	0.502			T	NUP98	AML		Sotos Syndrome		Weaver syndrome;Sotos syndrome;Beckwith-Wiedemann syndrome	HNSCC(47;0.14)																												dbGAP		Dom	yes		5	5q35	64324	nuclear receptor binding SET domain protein 1	yes	L	0													51.0	57.0	55.0					5																	176721686		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Weaver-Smith syndrome;Cerebral Gigantism;BWS, Exomphalos-Macroglossia-Gigantism (EMG) syndrome, Wiedemann-Beckwith syndrome, WBS	AK026066	CCDS4412.1, CCDS4413.1	5q35	2014-09-17	2003-03-12		ENSG00000165671	ENSG00000165671		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	14234	protein-coding gene	gene with protein product		606681	"""Sotos syndrome"""	STO		9628876, 11896389	Standard	NM_022455		Approved	ARA267, FLJ22263, KMT3B	uc003mfr.4	Q96L73	OTTHUMG00000130846	ENST00000439151.2:c.7317G>A	5.37:g.176721686G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PD8|Q96RN7	Silent	SNP	pfam_PWWP,pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_PWWP,smart_Znf_PHD,smart_AWS,smart_SET_dom,smart_Post-SET_dom,pfscan_AWS,pfscan_PWWP,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger	p.L2439	ENST00000439151.2	37	c.7317	CCDS4412.1	5																																																																																			NSD1	-	NULL	ENSG00000165671		0.502	NSD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSD1	HGNC	protein_coding	OTTHUMT00000253412.2	93	0.00	0	G	NM_172349		176721686	176721686	+1	no_errors	ENST00000439151	ensembl	human	known	69_37n	silent	42	49.40	41	SNP	1.000	A
NT5DC2	64943	genome.wustl.edu	37	3	52563265	52563265	+	Silent	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:52563265G>T	ENST00000307076.4	-	2	607	c.207C>A	c.(205-207)gtC>gtA	p.V69V	NT5DC2_ENST00000490681.1_5'UTR|NT5DC2_ENST00000422318.2_Silent_p.V106V|NT5DC2_ENST00000307092.4_Silent_p.V35V|NT5DC2_ENST00000459839.1_Silent_p.V106V	NM_022908.2	NP_075059.1	Q9H857	NT5D2_HUMAN	5'-nucleotidase domain containing 2	69							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)			endometrium(1)|lung(3)|prostate(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;1.7e-05)|Kidney(197;0.00177)|KIRC - Kidney renal clear cell carcinoma(197;0.002)|OV - Ovarian serous cystadenocarcinoma(275;0.0476)		CAAAGCCGTAGACCTCAACGT	0.582																																						dbGAP											0													261.0	207.0	225.0					3																	52563265		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF131781	CCDS2858.1, CCDS46843.1	3p21.1	2006-02-03			ENSG00000168268	ENSG00000168268			25717	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_022908		Approved	FLJ12442	uc003den.3	Q9H857	OTTHUMG00000158626	ENST00000307076.4:c.207C>A	3.37:g.52563265G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JTZ6|E9PAL9|O95888|Q96C80|Q9H9Z8	Missense_Mutation	SNP	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom	p.L38I	ENST00000307076.4	37	c.112	CCDS2858.1	3	.	.	.	.	.	.	.	.	.	.	G	6.450	0.451167	0.12223	.	.	ENSG00000168268	ENST00000489316	.	.	.	5.56	1.57	0.23409	.	.	.	.	.	T	0.60805	0.2297	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.54497	-0.8285	4	.	.	.	-52.3125	11.4849	0.50348	0.0:0.3293:0.4439:0.2268	.	.	.	.	I	38	.	.	L	-	1	2	NT5DC2	52538305	1.000000	0.71417	0.947000	0.38551	0.591000	0.36615	1.017000	0.29989	0.002000	0.14630	0.555000	0.69702	CTA	NT5DC2	-	pfam_HAD-SF_hydro_IG_5-nucl,superfamily_HAD-like_dom	ENSG00000168268		0.582	NT5DC2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NT5DC2	HGNC	protein_coding	OTTHUMT00000351509.1	548	0.00	0	G	NM_022908		52563265	52563265	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000489316	ensembl	human	novel	69_37n	missense	303	11.85	41	SNP	1.000	T
NYNRIN	57523	genome.wustl.edu	37	14	24880591	24880591	+	Silent	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:24880591C>G	ENST00000382554.3	+	6	2895	c.2577C>G	c.(2575-2577)ctC>ctG	p.L859L		NM_025081.2	NP_079357.2	Q9P2P1	NYNRI_HUMAN	NYN domain and retroviral integrase containing	859					DNA integration (GO:0015074)	integral component of membrane (GO:0016021)	nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(8)|lung(21)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	56						TACACTCGCTCAAGATGCTTT	0.552											OREG0022626	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													202.0	199.0	200.0					14																	24880591		1999	4173	6172	-	-	-	SO:0001819	synonymous_variant	0			AB037726	CCDS45090.1	14q11.2	2009-10-14	2009-10-14	2009-10-14		ENSG00000205978			20165	protein-coding gene	gene with protein product	"""Cousin of GIN1"""		"""KIAA1305"""	KIAA1305		19561090, 17114934	Standard	NM_025081		Approved	FLJ11811, CGIN1	uc001wpf.4	Q9P2P1		ENST00000382554.3:c.2577C>G	14.37:g.24880591C>G		Somatic	774	WXS	Illumina GAIIx	Phase_IV	Q6P153|Q86TR3|Q9HAC4	Silent	SNP	pfam_RNase_Zc3h12,superfamily_RNaseH-like_dom,pfscan_Integrase_cat-core	p.L859	ENST00000382554.3	37	c.2577	CCDS45090.1	14																																																																																			NYNRIN	-	pfam_RNase_Zc3h12	ENSG00000205978		0.552	NYNRIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYNRIN	HGNC	protein_coding	OTTHUMT00000412939.1	376	0.00	0	C			24880591	24880591	+1	no_errors	ENST00000382554	ensembl	human	known	69_37n	silent	86	58.17	121	SNP	1.000	G
OR13C4	138804	genome.wustl.edu	37	9	107288610	107288610	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:107288610A>T	ENST00000277216.3	-	1	880	c.881T>A	c.(880-882)aTa>aAa	p.I294K		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	294						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						GCTATAGATTATGGGGTTTAA	0.403																																						dbGAP											0													51.0	54.0	53.0					9																	107288610		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.881T>A	9.37:g.107288610A>T	ENSP00000277216:p.Ile294Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF51|Q96R41	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.I294K	ENST00000277216.3	37	c.881	CCDS35088.1	9	.	.	.	.	.	.	.	.	.	.	A	20.4	3.984932	0.74474	.	.	ENSG00000148136	ENST00000277216;ENST00000545903	T	0.48201	0.82	3.75	3.75	0.43078	GPCR, rhodopsin-like superfamily (1);	0.000000	0.46145	U	0.000320	T	0.72203	0.3431	H	0.95539	3.685	0.51767	D	0.999936	D	0.56035	0.974	P	0.59643	0.861	T	0.79860	-0.1625	10	0.87932	D	0	.	10.7146	0.46005	1.0:0.0:0.0:0.0	.	294	Q8NGS5	O13C4_HUMAN	K	294;323	ENSP00000277216:I294K	ENSP00000277216:I294K	I	-	2	0	OR13C4	106328431	0.873000	0.30073	0.996000	0.52242	0.965000	0.64279	7.083000	0.76859	1.672000	0.50884	0.383000	0.25322	ATA	OR13C4	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000148136		0.403	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C4	HGNC	protein_coding	OTTHUMT00000053478.1	131	0.00	0	A			107288610	107288610	-1	no_errors	ENST00000277216	ensembl	human	known	69_37n	missense	101	38.41	63	SNP	1.000	T
PARP3	10039	genome.wustl.edu	37	3	51978147	51978147	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:51978147G>C	ENST00000417220.2	+	4	714	c.226G>C	c.(226-228)Gag>Cag	p.E76Q	PARP3_ENST00000431474.1_Missense_Mutation_p.E76Q|PARP3_ENST00000398755.3_Missense_Mutation_p.E83Q|RRP9_ENST00000232888.6_5'Flank			Q9Y6F1	PARP3_HUMAN	poly (ADP-ribose) polymerase family, member 3	76					DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|positive regulation of DNA ligation (GO:0051106)|protein ADP-ribosylation (GO:0006471)|protein localization to site of double-strand break (GO:1990166)|regulation of mitotic spindle organization (GO:0060236)|telomere maintenance (GO:0000723)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)|site of double-strand break (GO:0035861)	catalytic activity (GO:0003824)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			ovary(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		GACCAACATCGAGAACAACAA	0.602																																						dbGAP											0													184.0	199.0	194.0					3																	51978147		2092	4223	6315	-	-	-	SO:0001583	missense	0			AF083068	CCDS43097.1, CCDS46839.1	3p22.2-p21.1	2010-07-14	2004-08-20	2004-08-26	ENSG00000041880	ENSG00000041880	2.4.2.30	"""Poly (ADP-ribose) polymerases"""	273	protein-coding gene	gene with protein product	"""poly(ADP-ribose) synthetase-3"", ""NAD+ ADP-ribosyltransferase 3"", ""poly(ADP-ribose) polymerase 3"""	607726	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 3"""	ADPRTL3		10329013	Standard	NM_001003931		Approved	ADPRT3, IRT1, hPARP-3, pADPRT-3	uc003dbz.3	Q9Y6F1	OTTHUMG00000156931	ENST00000417220.2:c.226G>C	3.37:g.51978147G>C	ENSP00000395951:p.Glu76Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NER9|Q96CG2|Q9UG81	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Poly(ADP-ribose)pol_reg_dom,pfam_WGR_domain,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_WGR_domain,smart_WGR_domain,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.E83Q	ENST00000417220.2	37	c.247	CCDS43097.1	3	.	.	.	.	.	.	.	.	.	.	G	11.31	1.600807	0.28534	.	.	ENSG00000041880	ENST00000417220;ENST00000431474;ENST00000398755;ENST00000498510	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	4.87	3.99	0.46301	WGR domain (4);	0.286349	0.39083	N	0.001464	T	0.06325	0.0163	N	0.02674	-0.535	0.09310	N	0.999996	B;B	0.12013	0.004;0.005	B;B	0.08055	0.002;0.003	T	0.37197	-0.9716	10	0.15952	T	0.53	-14.0912	10.3054	0.43678	0.166:0.0:0.834:0.0	.	83;76	Q9Y6F1-2;Q9Y6F1	.;PARP3_HUMAN	Q	76;76;83;76	ENSP00000395951:E76Q;ENSP00000401511:E76Q;ENSP00000381740:E83Q;ENSP00000417625:E76Q	ENSP00000381740:E83Q	E	+	1	0	PARP3	51953187	0.319000	0.24607	0.078000	0.20375	0.188000	0.23474	2.769000	0.47654	1.033000	0.39918	0.655000	0.94253	GAG	PARP3	-	pfam_WGR_domain,superfamily_WGR_domain,smart_WGR_domain	ENSG00000041880		0.602	PARP3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PARP3	HGNC	protein_coding	OTTHUMT00000348612.2	180	0.55	1	G	NM_005485.4		51978147	51978147	+1	no_errors	ENST00000398755	ensembl	human	known	69_37n	missense	36	68.38	80	SNP	0.528	C
PARP8	79668	genome.wustl.edu	37	5	50128622	50128622	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:50128622C>G	ENST00000281631.5	+	23	2399	c.2241C>G	c.(2239-2241)aaC>aaG	p.N747K	PARP8_ENST00000503750.2_Missense_Mutation_p.N705K|PARP8_ENST00000511363.2_3'UTR|PARP8_ENST00000514067.2_Missense_Mutation_p.N705K|PARP8_ENST00000505554.1_Missense_Mutation_p.N726K|PARP8_ENST00000514342.2_Missense_Mutation_p.N458K|PARP8_ENST00000505697.2_Missense_Mutation_p.N747K	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	747	PARP catalytic. {ECO:0000255|PROSITE- ProRule:PRU00397}.					intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				CAGGGATGAACAAGAAACAGA	0.413																																						dbGAP											0													144.0	124.0	131.0					5																	50128622		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.2241C>G	5.37:g.50128622C>G	ENSP00000281631:p.Asn747Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.N747K	ENST00000281631.5	37	c.2241	CCDS3954.1	5	.	.	.	.	.	.	.	.	.	.	C	19.32	3.805298	0.70682	.	.	ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000514342;ENST00000281631;ENST00000514067;ENST00000505554;ENST00000503561;ENST00000423185	T;T;T;T;T;T	0.13196	2.61;2.61;2.61;2.61;2.61;2.61	5.7	2.98	0.34508	Poly(ADP-ribose) polymerase, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.21550	0.0519	L	0.34521	1.04	0.51012	D	0.9999	D;D;D	0.69078	0.997;0.989;0.997	D;D;D	0.79108	0.992;0.969;0.992	T	0.01222	-1.1414	9	.	.	.	-20.8677	8.5282	0.33317	0.0:0.7105:0.0:0.2895	.	639;705;747	B4DQ81;Q8N3A8-2;Q8N3A8	.;.;PARP8_HUMAN	K	747;705;458;747;705;726;458;458	ENSP00000422217:N747K;ENSP00000440851:N705K;ENSP00000439022:N458K;ENSP00000281631:N747K;ENSP00000424814:N705K;ENSP00000423946:N726K	.	N	+	3	2	PARP8	50164379	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.580000	0.23803	0.781000	0.33589	0.650000	0.86243	AAC	PARP8	-	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	ENSG00000151883		0.413	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	319	0.00	0	C	NM_024615		50128622	50128622	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	missense	174	42.02	129	SNP	1.000	G
PDE3A	5139	genome.wustl.edu	37	12	20799535	20799535	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:20799535C>T	ENST00000359062.3	+	11	2403	c.2363C>T	c.(2362-2364)tCa>tTa	p.S788L	PDE3A_ENST00000544307.1_3'UTR	NM_000921.4|NM_001244683.1	NP_000912.3|NP_001231612.1	Q14432	PDE3A_HUMAN	phosphodiesterase 3A, cGMP-inhibited	788	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP-mediated signaling (GO:0019934)|diterpenoid metabolic process (GO:0016101)|lipid metabolic process (GO:0006629)|negative regulation of apoptotic process (GO:0043066)|negative regulation of vascular permeability (GO:0043116)|oocyte maturation (GO:0001556)|positive regulation of oocyte development (GO:0060282)|positive regulation of vascular permeability (GO:0043117)|regulation of meiosis (GO:0040020)|response to cAMP (GO:0051591)|response to drug (GO:0042493)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|cAMP binding (GO:0030552)|cGMP-inhibited cyclic-nucleotide phosphodiesterase activity (GO:0004119)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(7)|lung(29)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	58	Esophageal squamous(101;0.125)	Breast(259;0.134)			Aminophylline(DB01223)|Amrinone(DB01427)|Anagrelide(DB00261)|Caffeine(DB00201)|Cilostazol(DB01166)|Enoximone(DB04880)|Ibudilast(DB05266)|Levosimendan(DB00922)|Milrinone(DB00235)|Oxtriphylline(DB01303)|Theophylline(DB00277)|Tofisopam(DB08811)	ACCAGTGATTCAGGTATGTAC	0.373																																						dbGAP											0													134.0	114.0	121.0					12																	20799535		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31754.1	12p12.2	2011-04-15			ENSG00000172572	ENSG00000172572	3.1.4.17	"""Phosphodiesterases"""	8778	protein-coding gene	gene with protein product		123805				1315035, 10679291	Standard	NM_000921		Approved	CGI-PDE	uc001reh.2	Q14432	OTTHUMG00000168962	ENST00000359062.3:c.2363C>T	12.37:g.20799535C>T	ENSP00000351957:p.Ser788Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60865|Q13348|Q17RD1	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom	p.S788L	ENST00000359062.3	37	c.2363	CCDS31754.1	12	.	.	.	.	.	.	.	.	.	.	C	17.74	3.463178	0.63513	.	.	ENSG00000172572	ENST00000359062	T	0.75821	-0.97	5.64	5.64	0.86602	Metal-dependent phosphohydrolase, HD domain (1);	0.299670	0.32884	N	0.005526	T	0.67192	0.2867	L	0.33485	1.01	0.54753	D	0.999988	B	0.27882	0.192	B	0.26310	0.068	T	0.61515	-0.7047	10	0.30854	T	0.27	.	19.6599	0.95861	0.0:1.0:0.0:0.0	.	788	Q14432	PDE3A_HUMAN	L	788	ENSP00000351957:S788L	ENSP00000351957:S788L	S	+	2	0	PDE3A	20690802	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	4.320000	0.59203	2.818000	0.97014	0.637000	0.83480	TCA	PDE3A	-	smart_HD/PDEase_dom	ENSG00000172572		0.373	PDE3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE3A	HGNC	protein_coding	OTTHUMT00000401756.2	320	0.00	0	C			20799535	20799535	+1	no_errors	ENST00000359062	ensembl	human	known	69_37n	missense	471	27.43	178	SNP	1.000	T
PHF12	57649	genome.wustl.edu	37	17	27240940	27240940	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:27240940A>G	ENST00000332830.4	-	8	2060	c.1250T>C	c.(1249-1251)cTt>cCt	p.L417P	PHF12_ENST00000577226.1_Missense_Mutation_p.L417P|PHF12_ENST00000582655.1_5'UTR|PHF12_ENST00000268756.3_Missense_Mutation_p.L417P	NM_001033561.1	NP_001028733.1			PHD finger protein 12											breast(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	30	all_cancers(5;1.95e-14)|all_epithelial(6;5e-18)|Lung NSC(42;0.01)		Epithelial(11;1.64e-05)|all cancers(11;7.47e-05)|BRCA - Breast invasive adenocarcinoma(11;9.79e-05)			AGAGTTCAAAAGGTGCATCTG	0.552																																						dbGAP											0													124.0	103.0	110.0					17																	27240940		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040956	CCDS11247.1, CCDS32598.1	17q11.2	2013-01-28			ENSG00000109118	ENSG00000109118		"""Zinc fingers, PHD-type"""	20816	protein-coding gene	gene with protein product						11390640	Standard	XM_005258015		Approved	PF1, KIAA1523	uc002hdg.1	Q96QT6	OTTHUMG00000132676	ENST00000332830.4:c.1250T>C	17.37:g.27240940A>G	ENSP00000329933:p.Leu417Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_SMAD_FHA_domain,smart_Znf_PHD,pfscan_FHA_dom,pfscan_Znf_PHD-finger	p.L417P	ENST00000332830.4	37	c.1250	CCDS32598.1	17	.	.	.	.	.	.	.	.	.	.	A	16.49	3.136743	0.56936	.	.	ENSG00000109118	ENST00000332830;ENST00000378879;ENST00000268756	D;D;D	0.95272	-3.57;-3.66;-3.66	5.99	5.99	0.97316	.	0.000000	0.64402	D	0.000002	D	0.94466	0.8219	L	0.40543	1.245	0.80722	D	1	D;D;D;D;D	0.71674	0.971;0.983;0.971;0.998;0.971	P;P;P;P;P	0.58077	0.641;0.804;0.641;0.832;0.641	D	0.93202	0.6592	10	0.27785	T	0.31	-19.9847	15.3183	0.74099	1.0:0.0:0.0:0.0	.	399;417;417;417;417	B4DFE2;Q96QT6-2;Q2TAK2;C9J9G2;Q96QT6	.;.;.;.;PHF12_HUMAN	P	417	ENSP00000329933:L417P;ENSP00000368157:L417P;ENSP00000268756:L417P	ENSP00000268756:L417P	L	-	2	0	PHF12	24265066	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.945000	0.63568	2.291000	0.77112	0.533000	0.62120	CTT	PHF12	-	NULL	ENSG00000109118		0.552	PHF12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF12	HGNC	protein_coding	OTTHUMT00000255941.1	285	0.70	2	A	NM_020889		27240940	27240940	-1	no_errors	ENST00000332830	ensembl	human	known	69_37n	missense	60	66.67	120	SNP	1.000	G
PHKA2	5256	genome.wustl.edu	37	X	18918818	18918818	+	Splice_Site	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:18918818C>G	ENST00000379942.4	-	28	3693		c.e28-1			NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)						carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					GCCTAGTCATCTGAAAGCAAA	0.463																																						dbGAP											0													159.0	116.0	131.0					X																	18918818		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.3028-1G>C	X.37:g.18918818C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Splice_Site	SNP	-	e28-1	ENST00000379942.4	37	c.3028-1	CCDS14190.1	X	.	.	.	.	.	.	.	.	.	.	C	18.35	3.605342	0.66445	.	.	ENSG00000044446	ENST00000379942	.	.	.	5.63	5.63	0.86233	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1286	0.81410	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	PHKA2	18828739	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	2.616000	0.46376	2.499000	0.84300	0.513000	0.50165	.	PHKA2	-	-	ENSG00000044446		0.463	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	568	0.00	0	C	NM_000292	Intron	18918818	18918818	-1	no_errors	ENST00000379942	ensembl	human	known	69_37n	splice_site	293	17.00	60	SNP	1.000	G
PLA2R1	22925	genome.wustl.edu	37	2	160840563	160840563	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:160840563G>C	ENST00000283243.7	-	13	2265	c.2059C>G	c.(2059-2061)Ctg>Gtg	p.L687V	PLA2R1_ENST00000392771.1_Missense_Mutation_p.L687V	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	687	C-type lectin 4. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						CTTTTCATCAGAACTTTTTCA	0.323																																						dbGAP											0													53.0	56.0	55.0					2																	160840563		2202	4298	6500	-	-	-	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.2059C>G	2.37:g.160840563G>C	ENSP00000283243:p.Leu687Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.L687V	ENST00000283243.7	37	c.2059	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	G	12.92	2.083885	0.36758	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.06687	3.31;3.27	5.59	-0.973	0.10297	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (2);	0.000000	0.64402	D	0.000002	T	0.07954	0.0199	N	0.04162	-0.26	0.43122	D	0.994843	B;D;D	0.89917	0.243;1.0;1.0	B;D;D	0.91635	0.341;0.999;0.996	T	0.23476	-1.0187	10	0.10377	T	0.69	.	11.2081	0.48782	0.5204:0.0:0.4796:0.0	.	687;687;687	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	V	687	ENSP00000283243:L687V;ENSP00000376524:L687V	ENSP00000283243:L687V	L	-	1	2	PLA2R1	160548809	0.705000	0.27846	0.275000	0.24674	0.819000	0.46315	0.846000	0.27682	-0.151000	0.11176	-0.237000	0.12165	CTG	PLA2R1	-	superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000153246		0.323	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	116	0.00	0	G			160840563	160840563	-1	no_errors	ENST00000283243	ensembl	human	known	69_37n	missense	82	43.45	63	SNP	0.518	C
PLEKHA5	54477	genome.wustl.edu	37	12	19500091	19500091	+	Intron	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:19500091G>C	ENST00000299275.6	+	19	2406				PLEKHA5_ENST00000424268.1_Missense_Mutation_p.G781A|PLEKHA5_ENST00000539256.1_Intron|PLEKHA5_ENST00000543806.1_Missense_Mutation_p.G774A|PLEKHA5_ENST00000317589.4_Missense_Mutation_p.G855A|PLEKHA5_ENST00000355397.3_Intron|PLEKHA5_ENST00000429027.2_Missense_Mutation_p.G958A|PLEKHA5_ENST00000538714.1_Intron|PLEKHA5_ENST00000359180.3_Intron	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5						reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CAAGTTCAAGGATATCCAAGA	0.418																																					Pancreas(196;329 2193 11246 14234 19524)	dbGAP											0													81.0	72.0	75.0					12																	19500091		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.2401-1242G>C	12.37:g.19500091G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_Rsp5_WWP	p.G855A	ENST00000299275.6	37	c.2564	CCDS8682.1	12	.	.	.	.	.	.	.	.	.	.	G	14.18	2.458143	0.43634	.	.	ENSG00000052126	ENST00000317589;ENST00000542828;ENST00000429027;ENST00000424268;ENST00000543806;ENST00000536974	T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0	5.66	5.66	0.87406	.	0.869422	0.10224	N	0.700534	T	0.16257	0.0391	.	.	.	0.80722	D	1	P;P;P;P;P	0.46784	0.748;0.884;0.816;0.816;0.603	B;P;B;B;B	0.45610	0.391;0.487;0.293;0.293;0.293	T	0.03335	-1.1047	9	0.35671	T	0.21	-23.9543	15.2525	0.73559	0.0:0.1398:0.8602:0.0	.	855;774;781;953;958	Q9HAU0-4;F5H0I0;E7EME8;B4DHK5;E9PHQ3	.;.;.;.;.	A	855;954;958;781;774;747	ENSP00000325155:G855A;ENSP00000404296:G958A;ENSP00000400411:G781A;ENSP00000439837:G774A;ENSP00000440371:G747A	ENSP00000325155:G855A	G	+	2	0	PLEKHA5	19391358	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.815000	0.62634	2.645000	0.89757	0.650000	0.86243	GGA	PLEKHA5	-	NULL	ENSG00000052126		0.418	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	HGNC	protein_coding	OTTHUMT00000397013.1	273	0.00	0	G	NM_019012		19500091	19500091	+1	no_errors	ENST00000317589	ensembl	human	known	69_37n	missense	252	26.74	92	SNP	1.000	C
PPP1R36	145376	genome.wustl.edu	37	14	65053580	65053580	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:65053580G>C	ENST00000298705.1	+	9	790	c.694G>C	c.(694-696)Gac>Cac	p.D232H	RP11-973N13.3_ENST00000554454.1_RNA|RP11-973N13.3_ENST00000556634.1_RNA	NM_172365.1	NP_758953.1	Q96LQ0	PPR36_HUMAN	protein phosphatase 1, regulatory subunit 36	232					negative regulation of phosphatase activity (GO:0010923)		phosphatase binding (GO:0019902)|protein phosphatase inhibitor activity (GO:0004864)										TACACAGAAAGACTGGAAGTT	0.358																																						dbGAP											0													134.0	126.0	129.0					14																	65053580		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9767.1	14q23.2	2012-04-17	2011-10-11	2011-10-11	ENSG00000165807	ENSG00000165807		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	20097	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 50"""	C14orf50			Standard	NM_172365		Approved		uc001xhl.1	Q96LQ0	OTTHUMG00000141316	ENST00000298705.1:c.694G>C	14.37:g.65053580G>C	ENSP00000298705:p.Asp232His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTH6	Missense_Mutation	SNP	NULL	p.D232H	ENST00000298705.1	37	c.694	CCDS9767.1	14	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876247	0.72180	.	.	ENSG00000165807	ENST00000298705	T	0.52295	0.67	5.91	5.91	0.95273	.	0.000000	0.64402	D	0.000001	T	0.72961	0.3526	M	0.87547	2.89	0.43835	D	0.996413	D	0.89917	1.0	D	0.78314	0.991	T	0.76992	-0.2753	10	0.87932	D	0	-32.1229	15.8012	0.78454	0.0:0.0:1.0:0.0	.	232	Q96LQ0	PPR36_HUMAN	H	232	ENSP00000298705:D232H	ENSP00000298705:D232H	D	+	1	0	C14orf50	64123333	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.068000	0.64364	2.809000	0.96659	0.555000	0.69702	GAC	PPP1R36	-	NULL	ENSG00000165807		0.358	PPP1R36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R36	HGNC	protein_coding	OTTHUMT00000280667.1	537	0.00	0	G	NM_172365		65053580	65053580	+1	no_errors	ENST00000298705	ensembl	human	known	69_37n	missense	220	54.88	270	SNP	1.000	C
PPP2R5B	5526	genome.wustl.edu	37	11	64699231	64699232	+	Missense_Mutation	DNP	TG	TG	CT			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:64699231_64699232TG>CT	ENST00000164133.2	+	11	1629_1630	c.1007_1008TG>CT	c.(1006-1008)cTG>cCT	p.L336P		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	336					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						GTGATGTTTCTGGGGGAGATGG	0.569																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	Exception_encountered	11.37:g.64699231_64699232delinsCT	ENSP00000164133:p.Leu336Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13853	Missense_Mutation|Silent	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.L336P|p.L336	ENST00000164133.2	37	c.1007|c.1008	CCDS8085.1	11																																																																																			PPP2R5B	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	ENSG00000068971		0.569	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1	178|180	0.00	0	T|G	NM_006244		64699231|64699232	64699231|64699232	+1	no_errors	ENST00000164133	ensembl	human	known	69_37n	missense|silent	128|127	35.35	70	SNP	1.000	C|T
PPP4R2	151987	genome.wustl.edu	37	3	73114577	73114577	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:73114577C>G	ENST00000356692.5	+	9	1211	c.958C>G	c.(958-960)Cca>Gca	p.P320A	PPP4R2_ENST00000394284.3_Missense_Mutation_p.P263A|PPP4R2_ENST00000295862.9_Missense_Mutation_p.P264A			Q9NY27	PP4R2_HUMAN	protein phosphatase 4, regulatory subunit 2	320	Glu-rich.				cellular protein modification process (GO:0006464)|hematopoietic progenitor cell differentiation (GO:0002244)|mRNA processing (GO:0006397)|regulation of catalytic activity (GO:0050790)|regulation of double-strand break repair via homologous recombination (GO:0010569)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|protein phosphatase 4 complex (GO:0030289)	protein binding, bridging (GO:0030674)|protein phosphatase type 4 regulator activity (GO:0030362)			breast(2)|endometrium(1)|large_intestine(1)|lung(3)|skin(2)|stomach(1)|urinary_tract(2)	12		Prostate(10;0.0187)|Lung SC(41;0.236)		Epithelial(33;1.76e-07)|BRCA - Breast invasive adenocarcinoma(55;9.42e-05)|LUSC - Lung squamous cell carcinoma(21;0.00211)|Lung(16;0.00643)|KIRC - Kidney renal clear cell carcinoma(39;0.0164)|Kidney(39;0.0193)|OV - Ovarian serous cystadenocarcinoma(275;0.031)		AGAAATGATCCCAGAAAGAAA	0.308																																						dbGAP											0													38.0	44.0	42.0					3																	73114577		2184	4288	6472	-	-	-	SO:0001583	missense	0			AJ271448	CCDS2917.1	3q29	2010-06-18			ENSG00000163605	ENSG00000163605		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	18296	protein-coding gene	gene with protein product		613822				10769191	Standard	NM_174907		Approved		uc003dph.1	Q9NY27	OTTHUMG00000158816	ENST00000356692.5:c.958C>G	3.37:g.73114577C>G	ENSP00000349124:p.Pro320Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1I6|Q2TAJ9|Q498B8|Q8WXX6	Missense_Mutation	SNP	pfam_PPP4R2	p.P320A	ENST00000356692.5	37	c.958	CCDS2917.1	3	.	.	.	.	.	.	.	.	.	.	C	9.516	1.107020	0.20714	.	.	ENSG00000163605	ENST00000356692;ENST00000394284;ENST00000295862	T;T;T	0.32272	1.47;1.46;1.48	4.96	3.1	0.35709	.	0.501173	0.23517	N	0.047334	T	0.27278	0.0669	L	0.48362	1.52	0.45515	D	0.998471	B;B	0.17038	0.02;0.001	B;B	0.16722	0.016;0.002	T	0.05115	-1.0905	10	0.16896	T	0.51	.	15.2064	0.73183	0.0:0.7325:0.2675:0.0	.	263;320	Q9NY27-2;Q9NY27	.;PP4R2_HUMAN	A	320;263;264	ENSP00000349124:P320A;ENSP00000377825:P263A;ENSP00000295862:P264A	ENSP00000295862:P264A	P	+	1	0	PPP4R2	73197267	0.649000	0.27322	0.989000	0.46669	0.997000	0.91878	0.900000	0.28431	0.569000	0.29329	0.650000	0.86243	CCA	PPP4R2	-	NULL	ENSG00000163605		0.308	PPP4R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP4R2	HGNC	protein_coding	OTTHUMT00000352321.1	36	0.00	0	C	NM_174907		73114577	73114577	+1	no_errors	ENST00000356692	ensembl	human	known	69_37n	missense	9	78.72	37	SNP	0.967	G
PRKAA1	5562	genome.wustl.edu	37	5	40767578	40767578	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:40767578T>G	ENST00000397128.2	-	6	819	c.811A>C	c.(811-813)Aaa>Caa	p.K271Q	PRKAA1_ENST00000354209.3_Missense_Mutation_p.K286Q	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	271	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	CTGATATCTTTGATTGTGGCC	0.353																																						dbGAP											0													78.0	74.0	75.0					5																	40767578		1819	4076	5895	-	-	-	SO:0001583	missense	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.811A>C	5.37:g.40767578T>G	ENSP00000380317:p.Lys271Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K286Q	ENST00000397128.2	37	c.856	CCDS3932.2	5	.	.	.	.	.	.	.	.	.	.	T	14.81	2.647921	0.47258	.	.	ENSG00000132356	ENST00000397128;ENST00000354209	T;T	0.66460	-0.21;-0.21	5.72	5.72	0.89469	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.189216	0.56097	D	0.000034	T	0.45438	0.1342	N	0.02334	-0.595	0.80722	D	1	B;B	0.33238	0.366;0.403	B;B	0.39094	0.062;0.29	T	0.52147	-0.8614	10	0.29301	T	0.29	-15.432	13.0677	0.59043	0.0:0.0:0.1336:0.8664	.	271;286	Q13131;Q13131-2	AAPK1_HUMAN;.	Q	271;286	ENSP00000380317:K271Q;ENSP00000346148:K286Q	ENSP00000346148:K286Q	K	-	1	0	AC008810.1	40803335	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.977000	0.70492	2.180000	0.69256	0.459000	0.35465	AAA	PRKAA1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000132356		0.353	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2	263	0.00	0	T	NM_006251		40767578	40767578	-1	no_errors	ENST00000354209	ensembl	human	known	69_37n	missense	165	43.30	126	SNP	1.000	G
PTPRF	5792	genome.wustl.edu	37	1	44084968	44084968	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:44084968G>A	ENST00000359947.4	+	28	4996	c.4656G>A	c.(4654-4656)gtG>gtA	p.V1552V	PTPRF_ENST00000372413.3_Silent_p.V1543V|PTPRF_ENST00000372414.3_Silent_p.V1552V|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000438120.1_Silent_p.V1543V|PTPRF_ENST00000422171.2_Silent_p.V911V	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	1552	Substrate binding. {ECO:0000250}.|Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				GCGCGGGCGTGGGCCGCACCG	0.647																																						dbGAP											0													30.0	31.0	31.0					1																	44084968		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.4656G>A	1.37:g.44084968G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.W1198*	ENST00000359947.4	37	c.3593	CCDS489.2	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	7.700|7.700	0.692878|0.692878	0.15039|0.15039	.|.	.|.	ENSG00000142949|ENSG00000142949	ENST00000412568;ENST00000414879|ENST00000429895	.|.	.|.	.|.	5.02|5.02	5.02|5.02	0.67125|0.67125	.|.	.|.	.|.	.|.	.|.	T|.	0.74884|.	0.3775|.	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.73335|.	-0.4015|.	4|.	.|.	.|.	.|.	.|.	19.2372|19.2372	0.93866|0.93866	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	R|X	936;977|1198	.|.	.|.	G|W	+|+	1|2	0|0	PTPRF|PTPRF	43857555|43857555	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.923000|0.923000	0.55619|0.55619	3.195000|3.195000	0.51013|0.51013	2.714000|2.714000	0.92807|0.92807	0.561000|0.561000	0.74099|0.74099	GGG|TGG	PTPRF	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000142949		0.647	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	26	0.00	0	G			44084968	44084968	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000429895	ensembl	human	novel	69_37n	nonsense	8	52.94	9	SNP	1.000	A
R3HCC1L	27291	genome.wustl.edu	37	10	99994243	99994243	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:99994243G>A	ENST00000298999.3	+	7	2305	c.2002G>A	c.(2002-2004)Gcc>Acc	p.A668T	R3HCC1L_ENST00000370584.3_Missense_Mutation_p.A668T|R3HCC1L_ENST00000314594.5_Missense_Mutation_p.A84T|R3HCC1L_ENST00000370586.2_Missense_Mutation_p.A74T	NM_014472.4	NP_055287	Q7Z5L2	R3HCL_HUMAN	R3H domain and coiled-coil containing 1-like	682							nucleotide binding (GO:0000166)										TGATACACATGCCCTAGGAGT	0.323																																						dbGAP											0													143.0	145.0	145.0					10																	99994243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF525304	CCDS31267.1, CCDS58093.1, CCDS73178.1	10q24.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000166024	ENSG00000166024			23512	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 28"""	C10orf28			Standard	NM_014472		Approved	GIDRP86, PSORT	uc001kox.4	Q7Z5L2	OTTHUMG00000018873	ENST00000298999.3:c.2002G>A	10.37:g.99994243G>A	ENSP00000298999:p.Ala668Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60598|Q5W0B4|Q5W0B5|Q86VT9|Q8N9H0	Missense_Mutation	SNP	NULL	p.A668T	ENST00000298999.3	37	c.2002	CCDS31267.1	10	.	.	.	.	.	.	.	.	.	.	G	33	5.268579	0.95429	.	.	ENSG00000166024	ENST00000370584;ENST00000298999;ENST00000370586;ENST00000314594;ENST00000544834	T;T;T;T	0.62498	0.02;0.02;0.02;0.02	5.93	5.93	0.95920	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	D	0.83266	0.5217	M	0.88570	2.965	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.999	D	0.84676	0.0714	9	.	.	.	-7.4939	19.1039	0.93285	0.0:0.0:1.0:0.0	.	74;682;668	Q7Z5L2-3;Q7Z5L2;Q7Z5L2-2	.;GIDRP_HUMAN;.	T	668;668;74;84;75	ENSP00000359616:A668T;ENSP00000298999:A668T;ENSP00000359618:A74T;ENSP00000314018:A84T	.	A	+	1	0	C10orf28	99984233	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.792000	0.85828	2.799000	0.96334	0.650000	0.86243	GCC	R3HCC1L	-	NULL	ENSG00000166024		0.323	R3HCC1L-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	R3HCC1L	HGNC	protein_coding	OTTHUMT00000049764.1	511	0.00	0	G	NM_014472		99994243	99994243	+1	no_errors	ENST00000298999	ensembl	human	known	69_37n	missense	417	19.77	103	SNP	1.000	A
RECQL	5965	genome.wustl.edu	37	12	21624426	21624426	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:21624426G>A	ENST00000444129.2	-	13	2071	c.1603C>T	c.(1603-1605)Ccc>Tcc	p.P535S	RECQL_ENST00000421138.2_Missense_Mutation_p.P535S	NM_002907.3|NM_032941.2	NP_002898.2|NP_116559.1	P46063	RECQ1_HUMAN	RecQ helicase-like	535					DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand renaturation (GO:0000733)	membrane (GO:0016020)|nucleus (GO:0005634)	annealing helicase activity (GO:0036310)|ATP binding (GO:0005524)|ATP-dependent 3'-5' DNA helicase activity (GO:0043140)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	17						GGAAGTGTGGGAGCCACAACA	0.413								Other identified genes with known or suspected DNA repair function																														dbGAP											0													131.0	118.0	122.0					12																	21624426		2203	4300	6503	-	-	-	SO:0001583	missense	0			D37984	CCDS31756.1	12p12.1	2014-03-07	2014-03-07	2014-03-07	ENSG00000004700	ENSG00000004700			9948	protein-coding gene	gene with protein product	"""DNA helicase Q1-like"""	600537	"""RecQ protein-like (DNA helicase Q1-like)"""			7527136, 7961977	Standard	NM_002907		Approved	RecQ1, RecQL1	uc001rex.3	P46063	OTTHUMG00000169131	ENST00000444129.2:c.1603C>T	12.37:g.21624426G>A	ENSP00000416739:p.Pro535Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6G2	Missense_Mutation	SNP	pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_RQC_domain,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,tigrfam_DNA_helicase_ATP-dep_RecQ	p.P535S	ENST00000444129.2	37	c.1603	CCDS31756.1	12	.	.	.	.	.	.	.	.	.	.	G	18.66	3.671803	0.67928	.	.	ENSG00000004700	ENST00000444129;ENST00000421138	T;T	0.39229	1.09;1.09	5.52	5.52	0.82312	RQC domain (1);	0.153499	0.64402	D	0.000015	T	0.47563	0.1452	M	0.67397	2.05	0.48511	D	0.999661	P	0.35493	0.505	B	0.40636	0.335	T	0.35450	-0.9788	10	0.33141	T	0.24	-6.8119	15.2699	0.73693	0.0:0.0:0.8594:0.1406	.	535	P46063	RECQ1_HUMAN	S	535	ENSP00000416739:P535S;ENSP00000395449:P535S	ENSP00000395449:P535S	P	-	1	0	RECQL	21515693	1.000000	0.71417	0.568000	0.28447	0.827000	0.46813	3.886000	0.56190	2.878000	0.98634	0.650000	0.86243	CCC	RECQL	-	pfam_RQC_domain,tigrfam_DNA_helicase_ATP-dep_RecQ	ENSG00000004700		0.413	RECQL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL	HGNC	protein_coding	OTTHUMT00000402371.1	240	0.41	1	G	NM_002907		21624426	21624426	-1	no_errors	ENST00000421138	ensembl	human	known	69_37n	missense	289	29.10	119	SNP	0.999	A
RGS3	5998	genome.wustl.edu	37	9	116241773	116241773	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:116241773C>T	ENST00000374140.2	+	5	627	c.418C>T	c.(418-420)Cag>Tag	p.Q140*	RGS3_ENST00000350696.5_Nonsense_Mutation_p.Q140*|RGS3_ENST00000317613.6_Nonsense_Mutation_p.Q28*	NM_001282923.1|NM_144488.4	NP_001269852.1|NP_652759.3	P49796	RGS3_HUMAN	regulator of G-protein signaling 3	140	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				inactivation of MAPK activity (GO:0000188)|positive regulation of GTPase activity (GO:0043547)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			cervix(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(22)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	48						TTCCTTAGGTCAGCTGAGGCT	0.532																																						dbGAP											0													233.0	202.0	212.0					9																	116241773		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF006610	CCDS6797.1, CCDS6798.1, CCDS35113.1, CCDS35114.1, CCDS43869.1, CCDS65111.1	9q32	2008-02-05	2007-08-14		ENSG00000138835	ENSG00000138835		"""Regulators of G-protein signaling"""	9999	protein-coding gene	gene with protein product		602189	"""regulator of G-protein signalling 3"""			8602223, 11034339	Standard	NM_001276260		Approved	C2PA, FLJ20370, PDZ-RGS3	uc004bhq.4	P49796	OTTHUMG00000021048	ENST00000374140.2:c.418C>T	9.37:g.116241773C>T	ENSP00000363255:p.Gln140*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA0|A8K0V1|B3KUB2|Q5VXB8|Q5VXC1|Q5VZ05|Q5VZ06|Q6ZRM5|Q8IUQ1|Q8NC47|Q8NFN4|Q8NFN5|Q8NFN6|Q8TD59|Q8TD68|Q8WV02|Q8WXA0	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_C2_Ca-dep,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,smart_C2_Ca-dep,smart_PDZ,smart_Regulat_G_prot_signal,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.Q140*	ENST00000374140.2	37	c.418	CCDS43869.1	9	.	.	.	.	.	.	.	.	.	.	C	26.5	4.746087	0.89663	.	.	ENSG00000138835	ENST00000374140;ENST00000350696;ENST00000317613	.	.	.	4.22	4.22	0.49857	.	0.097223	0.40385	N	0.001105	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	11.9802	0.53115	0.0:1.0:0.0:0.0	.	.	.	.	X	140;140;28	.	ENSP00000312844:Q28X	Q	+	1	0	RGS3	115281594	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	3.927000	0.56499	2.171000	0.68590	0.555000	0.69702	CAG	RGS3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000138835		0.532	RGS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS3	HGNC	protein_coding	OTTHUMT00000055561.3	595	0.00	0	C	NM_017790		116241773	116241773	+1	no_errors	ENST00000350696	ensembl	human	known	69_37n	nonsense	327	36.38	187	SNP	1.000	T
RPL35	11224	genome.wustl.edu	37	9	127620332	127620332	+	Missense_Mutation	SNP	C	C	G	rs148490706		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:127620332C>G	ENST00000348462.3	-	4	285	c.237G>C	c.(235-237)aaG>aaC	p.K79N	RPL35_ENST00000373570.4_3'UTR	NM_007209.3	NP_009140.1	P42766	RL35_HUMAN	ribosomal protein L35	79					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|nucleolus (GO:0005730)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(1)|lung(1)|ovary(1)	4				GBM - Glioblastoma multiforme(294;0.182)		GGTCCAGGGGCTTGTACTTCT	0.632																																						dbGAP											0													23.0	22.0	22.0					9																	127620332		2203	4300	6503	-	-	-	SO:0001583	missense	0			U12465	CCDS6858.1	9q34.1	2011-04-06			ENSG00000136942	ENSG00000136942		"""L ribosomal proteins"""	10344	protein-coding gene	gene with protein product	"""60S ribosomal protein L35"""					11401437	Standard	NM_007209		Approved	L35	uc004boy.1	P42766	OTTHUMG00000020659	ENST00000348462.3:c.237G>C	9.37:g.127620332C>G	ENSP00000259469:p.Lys79Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4V7|Q4VBY5|Q5JTN5|Q6IBC7|Q96QJ7|Q9BYF4	Missense_Mutation	SNP	pfam_Ribosomal_L29,superfamily_Ribosomal_L29,tigrfam_Ribosomal_L29	p.K79N	ENST00000348462.3	37	c.237	CCDS6858.1	9	.	.	.	.	.	.	.	.	.	.	C	20.1	3.940028	0.73557	.	.	ENSG00000136942	ENST00000348462	.	.	.	5.6	4.71	0.59529	.	0.000000	0.85682	D	0.000000	T	0.78097	0.4230	M	0.89715	3.055	0.80722	D	1	D	0.58970	0.984	P	0.57548	0.823	T	0.79729	-0.1681	9	0.27785	T	0.31	.	13.9816	0.64308	0.0:0.9271:0.0:0.0729	.	79	P42766	RL35_HUMAN	N	79	.	ENSP00000259469:K79N	K	-	3	2	RPL35	126660153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.891000	0.28309	1.520000	0.48965	0.655000	0.94253	AAG	RPL35	-	NULL	ENSG00000136942		0.632	RPL35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL35	HGNC	protein_coding	OTTHUMT00000054035.1	72	0.00	0	C	NM_007209		127620332	127620332	-1	no_errors	ENST00000348462	ensembl	human	known	69_37n	missense	13	72.92	35	SNP	1.000	G
SAMD4B	55095	genome.wustl.edu	37	19	39847654	39847654	+	Silent	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr19:39847654C>T	ENST00000314471.6	+	5	1156	c.121C>T	c.(121-123)Ctg>Ttg	p.L41L	SAMD4B_ENST00000594204.1_3'UTR|SAMD4B_ENST00000598913.1_Silent_p.L41L|SAMD4B_ENST00000596368.1_Silent_p.L41L	NM_018028.2	NP_060498.2	Q5PRF9	SMAG2_HUMAN	sterile alpha motif domain containing 4B	41					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			autonomic_ganglia(1)|breast(1)|endometrium(5)|large_intestine(1)|lung(4)|skin(1)|urinary_tract(2)	15	all_cancers(60;2.5e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;9.6e-28)|all cancers(26;9.14e-25)|Lung(45;0.000168)|LUSC - Lung squamous cell carcinoma(53;0.000199)			GGCCCGCTTCCTGCAGCTCTG	0.602																																						dbGAP											0													57.0	45.0	49.0					19																	39847654		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33020.1	19q13.2	2013-01-10				ENSG00000179134		"""Sterile alpha motif (SAM) domain containing"""	25492	protein-coding gene	gene with protein product	"""smaug homolog B (Drosophila)"""					16221671	Standard	XM_005259029		Approved	FLJ10211, MGC99832, SMGB, hSmaug2	uc002olb.3	Q5PRF9		ENST00000314471.6:c.121C>T	19.37:g.39847654C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5Z0M6|Q6P194	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM	p.L41	ENST00000314471.6	37	c.121	CCDS33020.1	19																																																																																			SAMD4B	-	NULL	ENSG00000179134		0.602	SAMD4B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SAMD4B	HGNC	protein_coding	OTTHUMT00000464467.1	101	0.00	0	C	NM_018028		39847654	39847654	+1	no_errors	ENST00000314471	ensembl	human	known	69_37n	silent	43	36.76	25	SNP	1.000	T
SCCPDH	51097	genome.wustl.edu	37	1	246890259	246890259	+	Missense_Mutation	SNP	G	G	C	rs374026669		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:246890259G>C	ENST00000366510.3	+	2	632	c.256G>C	c.(256-258)Gat>Cat	p.D86H		NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)	86						lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		AGCCTCGCTTGATGAAATGGC	0.388																																						dbGAP											0													138.0	119.0	125.0					1																	246890259		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.256G>C	1.37:g.246890259G>C	ENSP00000355467:p.Asp86His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAR0|Q9Y363	Missense_Mutation	SNP	pfam_Saccharopine_DH/HSpermid_syn	p.D86H	ENST00000366510.3	37	c.256	CCDS31084.1	1	.	.	.	.	.	.	.	.	.	.	G	19.47	3.834089	0.71373	.	.	ENSG00000143653	ENST00000366510	T	0.47177	0.85	6.17	6.17	0.99709	.	0.090003	0.85682	D	0.000000	T	0.48714	0.1515	L	0.48218	1.51	0.51012	D	0.999904	B	0.33044	0.395	B	0.35899	0.213	T	0.36383	-0.9750	10	0.44086	T	0.13	-16.0112	20.4745	0.99168	0.0:0.0:1.0:0.0	.	86	Q8NBX0	SCPDL_HUMAN	H	86	ENSP00000355467:D86H	ENSP00000355467:D86H	D	+	1	0	SCCPDH	244956882	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.654000	0.91092	2.941000	0.99782	0.655000	0.94253	GAT	SCCPDH	-	pfam_Saccharopine_DH/HSpermid_syn	ENSG00000143653		0.388	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCCPDH	HGNC	protein_coding	OTTHUMT00000096902.2	512	0.00	0	G	NM_016002		246890259	246890259	+1	no_errors	ENST00000366510	ensembl	human	known	69_37n	missense	509	17.07	105	SNP	1.000	C
SCN4A	6329	genome.wustl.edu	37	17	62026013	62026013	+	Silent	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:62026013C>T	ENST00000435607.1	-	16	3178	c.3102G>A	c.(3100-3102)gaG>gaA	p.E1034E	SCN4A_ENST00000578147.1_Silent_p.E1034E	NM_000334.4	NP_000325.4	P35499	SCN4A_HUMAN	sodium channel, voltage-gated, type IV, alpha subunit	1034					membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			breast(4)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(40)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	101					Diclofenac(DB00586)|Flecainide(DB01195)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CAATGAAGGTCTCGAACCAGT	0.627																																						dbGAP											0													50.0	52.0	51.0					17																	62026013		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			U24693		17q23.3	2012-02-26	2007-01-23					"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10591	protein-coding gene	gene with protein product		603967		HYKPP		1654742, 1659948, 16382098	Standard	XM_005257566		Approved	Nav1.4, HYPP, SkM1	uc002jds.1	P35499		ENST00000435607.1:c.3102G>A	17.37:g.62026013C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15478|Q16447|Q7Z6B1	Silent	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a4su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.E1034	ENST00000435607.1	37	c.3102	CCDS45761.1	17																																																																																			SCN4A	-	pfam_Na_trans_assoc	ENSG00000007314		0.627	SCN4A-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN4A	HGNC	protein_coding		101	0.98	1	C	NM_000334		62026013	62026013	-1	no_errors	ENST00000435607	ensembl	human	known	69_37n	silent	26	59.38	38	SNP	1.000	T
SCUBE1	80274	genome.wustl.edu	37	22	43634854	43634854	+	Silent	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr22:43634854C>T	ENST00000360835.4	-	7	960	c.834G>A	c.(832-834)aaG>aaA	p.K278K	Z82214.2_ENST00000419643.1_RNA|SCUBE1_ENST00000290460.7_Silent_p.K308K	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	278	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				CTTTGCATGTCTTCCCGTCCG	0.642																																						dbGAP											0													72.0	60.0	64.0					22																	43634854		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.834G>A	22.37:g.43634854C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R336	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd	p.D132N	ENST00000360835.4	37	c.394	CCDS14048.1	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.39|12.39	1.922707|1.922707	0.33908|0.33908	.|.	.|.	ENSG00000159307|ENSG00000159307	ENST00000449304|ENST00000381243	.|.	.|.	.|.	5.57|5.57	2.32|2.32	0.28847|0.28847	.|.	.|.	.|.	.|.	.|.	T|T	0.56108|0.56108	0.1963|0.1963	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49844|0.49844	-0.8896|-0.8896	4|4	.|.	.|.	.|.	.|.	8.1084|8.1084	0.30900|0.30900	0.0:0.5779:0.0:0.4221|0.0:0.5779:0.0:0.4221	.|.	.|.	.|.	.|.	N|K	132|71	.|.	.|.	D|R	-|-	1|2	0|0	SCUBE1|SCUBE1	41964798|41964798	0.995000|0.995000	0.38212|0.38212	1.000000|1.000000	0.80357|0.80357	0.503000|0.503000	0.33858|0.33858	0.331000|0.331000	0.19733|0.19733	0.727000|0.727000	0.32360|0.32360	0.655000|0.655000	0.94253|0.94253	GAC|AGA	SCUBE1	-	smart_EGF-like,smart_EGF-like_Ca-bd	ENSG00000159307		0.642	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	61	0.00	0	C	NM_173050		43634854	43634854	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000449304	ensembl	human	known	69_37n	missense	29	40.82	20	SNP	1.000	T
SEC62	7095	genome.wustl.edu	37	3	169684617	169684617	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:169684617G>A	ENST00000337002.4	+	1	65	c.7G>A	c.(7-9)Gaa>Aaa	p.E3K	RP11-379K17.4_ENST00000487580.1_RNA|RP11-379K17.4_ENST00000469301.1_RNA|SEC62_ENST00000480708.1_Missense_Mutation_p.E3K|RP11-379K17.4_ENST00000600502.1_RNA|RP11-379K17.4_ENST00000483289.2_RNA	NM_003262.3	NP_003253.1	Q99442	SEC62_HUMAN	SEC62 homolog (S. cerevisiae)	3					cotranslational protein targeting to membrane (GO:0006613)|posttranslational protein targeting to membrane (GO:0006620)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)	protein transporter activity (GO:0008565)|receptor activity (GO:0004872)			NS(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)	9						CAACATGGCGGAACGCAGGAG	0.667																																						dbGAP											0													27.0	23.0	25.0					3																	169684617		2137	4181	6318	-	-	-	SO:0001583	missense	0			D87127	CCDS3210.1	3q26.2	2008-04-22	2008-04-22	2008-04-22	ENSG00000008952	ENSG00000008952			11846	protein-coding gene	gene with protein product		602173	"""translocation protein 1"""	TLOC1		9020021, 10799540	Standard	NM_003262		Approved	Dtrp1, HTP1	uc003fgh.3	Q99442	OTTHUMG00000158753	ENST00000337002.4:c.7G>A	3.37:g.169684617G>A	ENSP00000337688:p.Glu3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNQ0|O00682|O00729	Missense_Mutation	SNP	pfam_Sec62,superfamily_ABC_transptrTM_dom_typ1	p.E3K	ENST00000337002.4	37	c.7	CCDS3210.1	3	.	.	.	.	.	.	.	.	.	.	G	21.4	4.138021	0.77775	.	.	ENSG00000008952	ENST00000337002;ENST00000537426;ENST00000544081;ENST00000480708	.	.	.	4.92	4.03	0.46877	.	0.248381	0.39083	N	0.001478	T	0.52725	0.1752	L	0.43152	1.355	0.58432	D	0.999993	B	0.02656	0.0	B	0.04013	0.001	T	0.55698	-0.8100	9	0.66056	D	0.02	-16.3686	11.3676	0.49681	0.0908:0.0:0.9092:0.0	.	3	Q99442	SEC62_HUMAN	K	3	.	ENSP00000337688:E3K	E	+	1	0	SEC62	171167311	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	5.320000	0.65841	2.537000	0.85549	0.563000	0.77884	GAA	SEC62	-	NULL	ENSG00000008952		0.667	SEC62-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC62	HGNC	protein_coding	OTTHUMT00000352043.1	56	0.00	0	G			169684617	169684617	+1	no_errors	ENST00000337002	ensembl	human	known	69_37n	missense	35	25.53	12	SNP	1.000	A
SEL1L2	80343	genome.wustl.edu	37	20	13894543	13894543	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr20:13894543G>T	ENST00000284951.5	-	5	508	c.434C>A	c.(433-435)gCt>gAt	p.A145D	SEL1L2_ENST00000486903.1_5'UTR|SEL1L2_ENST00000378072.5_Missense_Mutation_p.A145D			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	145						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						TTTCTCCATAGCTTTCAAGTT	0.358																																						dbGAP											0													75.0	69.0	71.0					20																	13894543		1811	4082	5893	-	-	-	SO:0001583	missense	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.434C>A	20.37:g.13894543G>T	ENSP00000284951:p.Ala145Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXX5	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.A145D	ENST00000284951.5	37	c.434		20	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570417	0.86542	.	.	ENSG00000101251	ENST00000378072;ENST00000284951;ENST00000473203	T;T;T	0.62941	0.09;0.09;-0.01	5.87	5.87	0.94306	Tetratricopeptide-like helical (1);	0.000000	0.51477	D	0.000084	T	0.75064	0.3799	L	0.49778	1.585	0.52501	D	0.999955	D;D	0.89917	1.0;0.999	D;D	0.83275	0.995;0.996	T	0.75569	-0.3272	10	0.87932	D	0	-7.6679	16.0731	0.80948	0.0:0.0:1.0:0.0	.	145;145	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	D	145;145;33	ENSP00000367312:A145D;ENSP00000284951:A145D;ENSP00000420372:A33D	ENSP00000284951:A145D	A	-	2	0	SEL1L2	13842543	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.118000	0.64673	2.941000	0.99782	0.655000	0.94253	GCT	SEL1L2	-	pfam_Sel1-like,smart_Sel1-like	ENSG00000101251		0.358	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	256	0.78	2	G	NM_025229		13894543	13894543	-1	no_errors	ENST00000284951	ensembl	human	known	69_37n	missense	108	54.24	128	SNP	1.000	T
SGMS1	259230	genome.wustl.edu	37	10	52103557	52103557	+	Silent	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:52103557C>A	ENST00000361781.2	-	7	1277	c.318G>T	c.(316-318)ggG>ggT	p.G106G	SGMS1_ENST00000361543.2_Silent_p.G106G|SGMS1_ENST00000429490.1_Intron|SGMS1_ENST00000492601.2_5'Flank	NM_147156.3	NP_671512.1	Q86VZ5	SMS1_HUMAN	sphingomyelin synthase 1	112					apoptotic process (GO:0006915)|cell growth (GO:0016049)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)	endoplasmic reticulum (GO:0005783)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ceramide cholinephosphotransferase activity (GO:0047493)|kinase activity (GO:0016301)|sphingomyelin synthase activity (GO:0033188)			endometrium(1)|kidney(1)|large_intestine(5)|liver(1)|lung(4)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	16						CATTTGGCATCCCGTTGGGTT	0.532																																						dbGAP											0													103.0	103.0	103.0					10																	52103557		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY280959	CCDS7240.1	10q11.2	2013-01-10	2007-03-16	2007-03-16	ENSG00000198964	ENSG00000198964	2.7.8.27	"""Sterile alpha motif (SAM) domain containing"""	29799	protein-coding gene	gene with protein product		611573	"""transmembrane protein 23"""	TMEM23		11841947, 14976195	Standard	NM_147156		Approved	MOB, MGC17342, SMS1	uc001jje.3	Q86VZ5	OTTHUMG00000018231	ENST00000361781.2:c.318G>T	10.37:g.52103557C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q68U43|Q6EKK0|Q75SP1	Silent	SNP	pfam_P_Acid_Pase_2/haloperoxidase,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_P_Acid_Pase_2/haloperoxidase,pfscan_SAM	p.G106	ENST00000361781.2	37	c.318	CCDS7240.1	10																																																																																			SGMS1	-	NULL	ENSG00000198964		0.532	SGMS1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SGMS1	HGNC	protein_coding	OTTHUMT00000048074.2	305	0.00	0	C	NM_147156		52103557	52103557	-1	no_errors	ENST00000361781	ensembl	human	known	69_37n	silent	268	17.03	55	SNP	0.992	A
SKIV2L2	23517	genome.wustl.edu	37	5	54696232	54696232	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:54696232T>C	ENST00000230640.5	+	21	2718	c.2464T>C	c.(2464-2466)Tgt>Cgt	p.C822R	SKIV2L2_ENST00000545714.1_Missense_Mutation_p.C721R	NM_015360.4	NP_056175.3	P42285	SK2L2_HUMAN	superkiller viralicidic activity 2-like 2 (S. cerevisiae)	822					maturation of 5.8S rRNA (GO:0000460)|mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			NS(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(5)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	41		Lung NSC(810;0.000744)|Breast(144;0.181)|Prostate(74;0.194)				GTATACGCTTTGTGAAAAAAA	0.328																																					Melanoma(2;92 134 23744 29976 33782)	dbGAP											0													46.0	45.0	46.0					5																	54696232		2203	4299	6502	-	-	-	SO:0001583	missense	0			D29641	CCDS3967.1	5q11.2	2008-11-25	2005-02-18	2005-02-18	ENSG00000039123	ENSG00000039123			18734	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 118"""		"""KIAA0052"""	KIAA0052			Standard	NM_015360		Approved	Mtr4, Dob1, fSAP118	uc003jpy.4	P42285	OTTHUMG00000097019	ENST00000230640.5:c.2464T>C	5.37:g.54696232T>C	ENSP00000230640:p.Cys822Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M386|Q6MZZ8|Q6P170|Q8N5R0|Q8TAG2	Missense_Mutation	SNP	pfam_DSH_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pirsf_RNA_helicase_ATP-dep_SK12/DOB1,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.C822R	ENST00000230640.5	37	c.2464	CCDS3967.1	5	.	.	.	.	.	.	.	.	.	.	T	15.63	2.889138	0.52014	.	.	ENSG00000039123	ENST00000230640;ENST00000545714	T;T	0.30448	1.53;1.54	5.3	5.3	0.74995	.	0.000000	0.85682	D	0.000000	T	0.42086	0.1187	M	0.75447	2.3	0.80722	D	1	P;P	0.43519	0.809;0.614	B;P	0.44422	0.358;0.449	T	0.47623	-0.9103	10	0.72032	D	0.01	-12.3374	15.2404	0.73465	0.0:0.0:0.0:1.0	.	721;822	F5H7E2;P42285	.;SK2L2_HUMAN	R	822;721	ENSP00000230640:C822R;ENSP00000442583:C721R	ENSP00000230640:C822R	C	+	1	0	SKIV2L2	54731989	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.529000	0.81952	2.004000	0.58718	0.482000	0.46254	TGT	SKIV2L2	-	pirsf_RNA_helicase_ATP-dep_SK12/DOB1	ENSG00000039123		0.328	SKIV2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKIV2L2	HGNC	protein_coding	OTTHUMT00000214108.1	132	0.00	0	T			54696232	54696232	+1	no_errors	ENST00000230640	ensembl	human	known	69_37n	missense	46	63.78	81	SNP	1.000	C
SLAMF6	114836	genome.wustl.edu	37	1	160461134	160461134	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:160461134G>C	ENST00000368057.3	-	3	487	c.427C>G	c.(427-429)Cag>Gag	p.Q143E	SLAMF6_ENST00000368059.3_Missense_Mutation_p.Q143E|SLAMF6_ENST00000368055.1_Missense_Mutation_p.Q32E			Q96DU3	SLAF6_HUMAN	SLAM family member 6	143	Ig-like C2-type.					extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|skin(4)	22	all_cancers(52;1.05e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0923)			GTCATATTCTGAAATAGCTGA	0.433																																						dbGAP											0													114.0	108.0	110.0					1																	160461134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832854	CCDS1205.1, CCDS53393.1, CCDS53394.1	1q23.1	2013-01-29			ENSG00000162739	ENSG00000162739		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	21392	protein-coding gene	gene with protein product		606446				11489943	Standard	NM_052931		Approved	KALI, NTBA, KALIb, Ly108, SF2000, NTB-A, CD352	uc001fwe.2	Q96DU3	OTTHUMG00000022729	ENST00000368057.3:c.427C>G	1.37:g.160461134G>C	ENSP00000357036:p.Gln143Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMW2|B2R8X8|Q14CF0|Q5TAS4|Q5TAS6|Q5TAT3|Q96DV0	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.Q143E	ENST00000368057.3	37	c.427	CCDS53394.1	1	.	.	.	.	.	.	.	.	.	.	G	0.009	-1.808883	0.00606	.	.	ENSG00000162739	ENST00000368059;ENST00000368057;ENST00000368055	T;T;T	0.14516	4.14;4.14;2.5	4.37	0.335	0.15953	Immunoglobulin-like fold (1);	1.713730	0.02800	N	0.123065	T	0.00754	0.0025	N	0.00611	-1.325	0.09310	N	1	B;B;B;B;B;B	0.21821	0.032;0.011;0.049;0.049;0.061;0.061	B;B;B;B;B;B	0.13407	0.008;0.008;0.005;0.005;0.009;0.009	T	0.39418	-0.9615	10	0.02654	T	1	0.0442	4.0213	0.09667	0.0:0.4998:0.1888:0.3113	.	32;32;94;143;143;143	B7Z6A7;Q5TAS6;B4E1U5;Q96DU3-2;Q96DU3;B2R8X8	.;.;.;.;SLAF6_HUMAN;.	E	143;143;32	ENSP00000357038:Q143E;ENSP00000357036:Q143E;ENSP00000357034:Q32E	ENSP00000357034:Q32E	Q	-	1	0	SLAMF6	158727758	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.254000	0.08781	0.210000	0.20664	-0.165000	0.13383	CAG	SLAMF6	-	NULL	ENSG00000162739		0.433	SLAMF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLAMF6	HGNC	protein_coding	OTTHUMT00000059010.1	218	0.00	0	G	NM_052931		160461134	160461134	-1	no_errors	ENST00000368057	ensembl	human	known	69_37n	missense	509	11.01	63	SNP	0.000	C
SLC15A1	6564	genome.wustl.edu	37	13	99376256	99376256	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr13:99376256G>C	ENST00000376503.5	-	5	330	c.275C>G	c.(274-276)aCa>aGa	p.T92R		NM_005073.3	NP_005064.1	P46059	S15A1_HUMAN	solute carrier family 15 (oligopeptide transporter), member 1	92					digestion (GO:0007586)|ion transport (GO:0006811)|protein transport (GO:0015031)|proton transport (GO:0015992)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	peptide:proton symporter activity (GO:0015333)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	30	all_neural(89;0.101)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Aminolevulinic acid(DB00855)|Amoxicillin(DB01060)|Ampicillin(DB00415)|Azidocillin(DB08795)|Benazepril(DB00542)|Benzylpenicillin(DB01053)|Captopril(DB01197)|Cefaclor(DB00833)|Cefadroxil(DB01140)|Cefalotin(DB00456)|Cefdinir(DB00535)|Cefepime(DB01413)|Cefixime(DB00671)|Cefmetazole(DB00274)|Cefotaxime(DB00493)|Cefradine(DB01333)|Ceftazidime(DB00438)|Ceftibuten(DB01415)|Ceftizoxime(DB01332)|Ceftriaxone(DB01212)|Cefuroxime(DB01112)|Cephalexin(DB00567)|Chlorpropamide(DB00672)|Cilazapril(DB01340)|Cloxacillin(DB01147)|Cyclacillin(DB01000)|Dicloxacillin(DB00485)|Enalapril(DB00584)|Fluvastatin(DB01095)|Fosinopril(DB00492)|Glyburide(DB01016)|L-DOPA(DB01235)|Lisinopril(DB00722)|Methyldopa(DB00968)|Midodrine(DB00211)|Moexipril(DB00691)|Nateglinide(DB00731)|Oseltamivir(DB00198)|Oxacillin(DB00713)|Perindopril(DB00790)|Quinapril(DB00881)|Ramipril(DB00178)|Spirapril(DB01348)|Tolbutamide(DB01124)|Trandolapril(DB00519)|Valaciclovir(DB00577)|Valganciclovir(DB01610)	TTGTCCAATTGTGTAGACAAT	0.473																																						dbGAP											0													299.0	233.0	255.0					13																	99376256		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13173	CCDS9489.1	13q32.3	2013-05-22			ENSG00000088386	ENSG00000088386		"""Solute carriers"""	10920	protein-coding gene	gene with protein product	"""peptide transporter HPEPT1"", ""bA551M18.1.1 (solute carrier family 15 (oligopeptide transporter) member 1)"", ""solute carrier family 15 oligopeptide transporter member 1"""	600544				7896779	Standard	NM_005073		Approved	PEPT1, HPECT1, HPEPT1	uc001vno.3	P46059	OTTHUMG00000017255	ENST00000376503.5:c.275C>G	13.37:g.99376256G>C	ENSP00000365686:p.Thr92Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VW82	Missense_Mutation	SNP	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	p.T92R	ENST00000376503.5	37	c.275	CCDS9489.1	13	.	.	.	.	.	.	.	.	.	.	G	21.4	4.144563	0.77888	.	.	ENSG00000088386	ENST00000376503;ENST00000376494;ENST00000313260	T	0.04758	3.56	5.65	5.65	0.86999	Major facilitator superfamily domain, general substrate transporter (1);PTR2 family proton/oligopeptide symporter, conserved site (1);	0.049879	0.85682	D	0.000000	T	0.29028	0.0721	M	0.88570	2.965	0.58432	D	0.999999	D;D	0.71674	0.998;0.996	P;D	0.75020	0.884;0.985	T	0.02676	-1.1125	10	0.59425	D	0.04	-26.6694	20.0965	0.97849	0.0:0.0:1.0:0.0	.	60;92	Q9BZ22;P46059	.;S15A1_HUMAN	R	92;60;102	ENSP00000365686:T92R	ENSP00000318937:T102R	T	-	2	0	SLC15A1	98174257	1.000000	0.71417	0.971000	0.41717	0.327000	0.28475	7.612000	0.82975	2.824000	0.97209	0.655000	0.94253	ACA	SLC15A1	-	pfam_Oligopeptide_transporter,superfamily_MFS_dom_general_subst_transpt,tigrfam_Pep_H_symport	ENSG00000088386		0.473	SLC15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC15A1	HGNC	protein_coding	OTTHUMT00000045560.3	536	0.37	2	G	NM_005073		99376256	99376256	-1	no_errors	ENST00000376503	ensembl	human	known	69_37n	missense	426	28.52	170	SNP	1.000	C
SLC9A2	6549	genome.wustl.edu	37	2	103274408	103274408	+	Silent	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:103274408C>G	ENST00000233969.2	+	2	817	c.675C>G	c.(673-675)gtC>gtG	p.V225V		NM_003048.3	NP_003039.2	Q9UBY0	SL9A2_HUMAN	solute carrier family 9, subfamily A (NHE2, cation proton antiporter 2), member 2	225					ion transport (GO:0006811)|protein localization (GO:0008104)|regulation of pH (GO:0006885)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:proton antiporter activity (GO:0015385)			breast(5)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(3)|lung(17)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42						TGCTTGCTGTCTTTGAGAACA	0.502																																						dbGAP											0													224.0	200.0	208.0					2																	103274408		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2062.1	2q11.2	2013-05-22	2012-03-22		ENSG00000115616	ENSG00000115616		"""Solute carriers"""	11072	protein-coding gene	gene with protein product		600530	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 2"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 2"""	NHE2			Standard	NM_003048		Approved		uc002tca.3	Q9UBY0	OTTHUMG00000130778	ENST00000233969.2:c.675C>G	2.37:g.103274408C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMS2	Silent	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_2,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.V225	ENST00000233969.2	37	c.675	CCDS2062.1	2																																																																																			SLC9A2	-	pfam_Cation/H_exchanger,tigrfam_NaH_exchanger	ENSG00000115616		0.502	SLC9A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A2	HGNC	protein_coding	OTTHUMT00000253292.2	310	0.00	0	C			103274408	103274408	+1	no_errors	ENST00000233969	ensembl	human	known	69_37n	silent	207	36.70	120	SNP	1.000	G
SON	6651	genome.wustl.edu	37	21	34927217	34927217	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr21:34927217T>C	ENST00000356577.4	+	3	6155	c.5680T>C	c.(5680-5682)Tct>Cct	p.S1894P	SON_ENST00000381679.4_Missense_Mutation_p.S1894P|SON_ENST00000290239.6_Missense_Mutation_p.S1894P|SON_ENST00000300278.4_Missense_Mutation_p.S1894P|SON_ENST00000381692.2_Intron	NM_138927.1	NP_620305	P18583	SON_HUMAN	SON DNA binding protein	1894					cytokinesis (GO:0000910)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|regulation of cell cycle (GO:0051726)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)|nucleus (GO:0005634)	DNA binding (GO:0003677)|nucleic acid binding (GO:0003676)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(3)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|lung(25)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	72						GCGCAAAAGATCTCCAAAGCA	0.458																																						dbGAP											0													49.0	48.0	48.0					21																	34927217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380181	CCDS13629.1, CCDS13631.1, CCDS74784.1	21q22.1-q22.2	2013-01-28			ENSG00000159140	ENSG00000159140		"""G patch domain containing"""	11183	protein-coding gene	gene with protein product	"""NRE-binding protein"", ""negative regulatory element-binding protein"", ""Bax antagonist selected in Saccharomyces 1"""	182465		C21orf50		8318737, 21551269	Standard	NM_032195		Approved	DBP-5, NREBP, KIAA1019, BASS1, FLJ21099, FLJ33914	uc002yse.1	P18583	OTTHUMG00000065806	ENST00000356577.4:c.5680T>C	21.37:g.34927217T>C	ENSP00000348984:p.Ser1894Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSF5|D3DSF6|E7ETE8|E7EU67|E7EVW3|E9PFQ2|O14487|O95981|Q14120|Q6PKE0|Q9H7B1|Q9P070|Q9P072|Q9UKP9|Q9UPY0	Missense_Mutation	SNP	pfam_G_patch_dom,superfamily_WD40_repeat_dom,smart_G_patch_dom,pfscan_G_patch_dom,pfscan_Ds-RNA-bd	p.S1894P	ENST00000356577.4	37	c.5680	CCDS13629.1	21	.	.	.	.	.	.	.	.	.	.	T	14.77	2.634313	0.47049	.	.	ENSG00000159140	ENST00000356577;ENST00000290239;ENST00000300278;ENST00000381679	T;T;T;T	0.69306	-0.39;-0.39;-0.39;2.11	5.53	5.53	0.82687	.	0.000000	0.49916	D	0.000136	T	0.67163	0.2864	N	0.08118	0	0.46167	D	0.998902	D;D;D;D;D	0.89917	1.0;0.999;1.0;1.0;1.0	D;D;D;D;D	0.87578	0.998;0.994;0.997;0.997;0.997	T	0.74548	-0.3629	10	0.56958	D	0.05	.	15.6678	0.77247	0.0:0.0:0.0:1.0	.	1894;1894;1575;1894;1894	P18583-10;P18583;P18583-2;P18583-3;P18583-6	.;SON_HUMAN;.;.;.	P	1894	ENSP00000348984:S1894P;ENSP00000290239:S1894P;ENSP00000300278:S1894P;ENSP00000371095:S1894P	ENSP00000290239:S1894P	S	+	1	0	SON	33849087	0.997000	0.39634	0.990000	0.47175	0.996000	0.88848	4.144000	0.58057	2.108000	0.64289	0.533000	0.62120	TCT	SON	-	NULL	ENSG00000159140		0.458	SON-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SON	HGNC	protein_coding	OTTHUMT00000140978.2	113	0.00	0	T	NM_138927		34927217	34927217	+1	no_errors	ENST00000356577	ensembl	human	known	69_37n	missense	77	31.25	35	SNP	0.994	C
SSX2IP	117178	genome.wustl.edu	37	1	85130215	85130215	+	Silent	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:85130215G>A	ENST00000342203.3	-	6	821	c.558C>T	c.(556-558)atC>atT	p.I186I	SSX2IP_ENST00000437941.2_Silent_p.I159I|SSX2IP_ENST00000370612.4_Silent_p.I186I|SSX2IP_ENST00000605755.1_Silent_p.I159I|SSX2IP_ENST00000603677.1_Intron	NM_001166293.1|NM_001166294.1|NM_014021.3	NP_001159765.1|NP_001159766.1|NP_054740.3	Q9Y2D8	ADIP_HUMAN	synovial sarcoma, X breakpoint 2 interacting protein	186					cell adhesion (GO:0007155)|centrosome organization (GO:0051297)|regulation of cell motility (GO:2000145)|regulation of Rac protein signal transduction (GO:0035020)	cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|centriolar satellite (GO:0034451)|nucleus (GO:0005634)|protein complex (GO:0043234)				endometrium(5)|kidney(1)|large_intestine(4)|lung(6)|ovary(2)|urinary_tract(1)	19				all cancers(265;0.0053)|Epithelial(280;0.0214)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GACTTGCAATGATATTTTGTA	0.328																																						dbGAP											0													105.0	103.0	104.0					1																	85130215		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS699.1, CCDS53337.1	1p22.3	2008-02-05			ENSG00000117155	ENSG00000117155			16509	protein-coding gene	gene with protein product		608690					Standard	NM_014021		Approved		uc001dkj.3	Q9Y2D8	OTTHUMG00000009926	ENST00000342203.3:c.558C>T	1.37:g.85130215G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8W0|B4DFE3|D3DT13|J3KR02|Q6P2P8|Q6ULS1|Q7L168|Q9UIX0	Silent	SNP	pfam_Afadin/alpha-actinin-bd	p.I186	ENST00000342203.3	37	c.558	CCDS699.1	1																																																																																			SSX2IP	-	pfam_Afadin/alpha-actinin-bd	ENSG00000117155		0.328	SSX2IP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX2IP	HGNC	protein_coding	OTTHUMT00000027469.1	502	0.59	3	G	NM_014021		85130215	85130215	-1	no_errors	ENST00000342203	ensembl	human	known	69_37n	silent	205	50.12	206	SNP	0.982	A
SSX4	6759	genome.wustl.edu	37	X	48244061	48244061	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:48244061C>G	ENST00000376886.2	+	3	291	c.128C>G	c.(127-129)tCg>tGg	p.S43W	SSX4_ENST00000375517.3_Missense_Mutation_p.S43W	NM_005636.3	NP_005627.1	O60224	SSX4_HUMAN	synovial sarcoma, X breakpoint 4	43	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)		SS18/SSX4(12)	lung(1)	1						ATGAAATCCTCGGAGAAAATC	0.388			T	SS18	synovial sarcoma																																	dbGAP		Dom	yes		X	Xp11.23	6759	"""synovial sarcoma, X breakpoint 4"""		M	0													7.0	4.0	5.0					X																	48244061		1854	3377	5231	-	-	-	SO:0001583	missense	0				CCDS35240.1, CCDS43934.1	Xp11.23	2009-06-17			ENSG00000204645	ENSG00000268009			11338	protein-coding gene	gene with protein product		300326					Standard	NM_005636		Approved	CT5.4		O60224	OTTHUMG00000022698	ENST00000376886.2:c.128C>G	X.37:g.48244061C>G	ENSP00000366083:p.Ser43Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYD4|B2RPE3|Q3SYD4|Q5JQZ0|Q9UJU9	Missense_Mutation	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S43W	ENST00000376886.2	37	c.128	CCDS35240.1	X	.	.	.	.	.	.	.	.	.	.	c	2.531	-0.308422	0.05458	.	.	ENSG00000204645	ENST00000376886;ENST00000375517	T;T	0.00902	5.56;5.56	1.71	-0.44	0.12261	Krueppel-associated box (2);Krueppel-associated box-related (1);	0.967092	0.08463	N	0.942104	T	0.00608	0.0020	.	.	.	0.09310	N	1	B;B	0.31968	0.349;0.072	B;B	0.30782	0.12;0.077	T	0.45175	-0.9279	9	0.15499	T	0.54	.	2.7364	0.05241	0.0:0.483:0.3014:0.2156	.	43;43	A8MYD4;O60224	.;SSX4_HUMAN	W	43	ENSP00000366083:S43W;ENSP00000364667:S43W	ENSP00000364667:S43W	S	+	2	0	SSX4	48129005	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.629000	0.05508	-0.212000	0.10109	-1.268000	0.01426	TCG	SSX4	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	ENSG00000204645		0.388	SSX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX4	HGNC	protein_coding	OTTHUMT00000058902.2	83	0.00	0	C			48244061	48244061	+1	no_errors	ENST00000376886	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.000	G
SSX4B	548313	genome.wustl.edu	37	X	48270249	48270249	+	Missense_Mutation	SNP	G	G	C	rs377690870		TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:48270249G>C	ENST00000376884.2	-	3	185	c.128C>G	c.(127-129)tCg>tGg	p.S43W	SSX4B_ENST00000396928.1_Missense_Mutation_p.S43W	NM_001034832.3	NP_001030004.1	O60224	SSX4_HUMAN	synovial sarcoma, X breakpoint 4B	43	KRAB-related. {ECO:0000255|PROSITE- ProRule:PRU00120}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			lung(1)	1						GATTTTCTCCGAGGATTTCAT	0.388																																						dbGAP											0													27.0	32.0	30.0					X																	48270249		2180	4258	6438	-	-	-	SO:0001583	missense	0				CCDS35241.1, CCDS43935.1	Xp11.23	2008-02-05			ENSG00000198946	ENSG00000269791			16880	protein-coding gene	gene with protein product							Standard	NM_001034832		Approved	OTTHUMT00000056510	uc004djf.2	O60224	OTTHUMG00000021497	ENST00000376884.2:c.128C>G	X.37:g.48270249G>C	ENSP00000366081:p.Ser43Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYD4|B2RPE3|Q3SYD4|Q5JQZ0|Q9UJU9	Missense_Mutation	SNP	pfam_SSXRD_motif,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S43W	ENST00000376884.2	37	c.128	CCDS35241.1	X	.	.	.	.	.	.	.	.	.	.	N	0.124	-1.122239	0.01785	.	.	ENSG00000198946	ENST00000376884;ENST00000396928	T;T	0.00902	5.56;5.56	1.64	0.617	0.17619	.	0.967092	0.08463	N	0.942104	T	0.01254	0.0041	M	0.62723	1.935	0.09310	N	1	.	.	.	.	.	.	T	0.48281	-0.9049	8	0.06365	T	0.9	.	5.1923	0.15216	0.0:0.3688:0.6312:0.0	.	.	.	.	W	43	ENSP00000366081:S43W;ENSP00000380134:S43W	ENSP00000366081:S43W	S	-	2	0	SSX4B	48155193	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	0.081000	0.14823	0.140000	0.18849	0.110000	0.15639	TCG	SSX4B	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	ENSG00000198946		0.388	SSX4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSX4B	HGNC	protein_coding	OTTHUMT00000056510.2	686	0.29	2	G			48270249	48270249	-1	no_errors	ENST00000376884	ensembl	human	known	69_37n	missense	383	25.63	132	SNP	0.001	C
STAMBPL1	57559	genome.wustl.edu	37	10	90661472	90661472	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr10:90661472C>A	ENST00000371926.3	+	2	965	c.7C>A	c.(7-9)Cag>Aag	p.Q3K	STAMBPL1_ENST00000371927.3_Missense_Mutation_p.Q3K|STAMBPL1_ENST00000371924.1_Missense_Mutation_p.Q3K	NM_020799.3	NP_065850.1	Q96FJ0	STALP_HUMAN	STAM binding protein-like 1	3						membrane (GO:0016020)	metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(2)|endometrium(1)|large_intestine(2)|liver(2)|lung(2)|ovary(1)|skin(1)	11		Colorectal(252;0.0381)		Colorectal(12;6.38e-05)|COAD - Colon adenocarcinoma(12;7.75e-05)		CAACATGGATCAGCCTTTTAC	0.353																																						dbGAP											0													206.0	188.0	194.0					10																	90661472		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037794	CCDS7391.1	10q23.32	2006-11-08			ENSG00000138134	ENSG00000138134			24105	protein-coding gene	gene with protein product	"""associated molecule with the SH3 domain of STAM (AMSH) like protein"", ""associated molecule with the SH3 domain of STAM (AMSH) - Family Protein"""	612352				12810066, 12943674	Standard	NM_020799		Approved	AMSH-LP, KIAA1373, AMSH-FP, FLJ31524, ALMalpha, bA399O19.2	uc001kfk.4	Q96FJ0	OTTHUMG00000018702	ENST00000371926.3:c.7C>A	10.37:g.90661472C>A	ENSP00000360994:p.Gln3Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPA7|Q5T9N4|Q5T9N9|Q7Z420|Q9P2H4	Missense_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.Q3K	ENST00000371926.3	37	c.7	CCDS7391.1	10	.	.	.	.	.	.	.	.	.	.	C	10.57	1.387109	0.25031	.	.	ENSG00000138134	ENST00000371926;ENST00000371927;ENST00000371924	T;T;T	0.23552	1.95;1.9;1.95	6.07	5.17	0.71159	.	1.446330	0.04159	N	0.322723	T	0.31857	0.0810	L	0.47716	1.5	0.80722	D	1	B;B	0.23249	0.082;0.03	B;B	0.25140	0.058;0.03	T	0.04005	-1.0985	10	0.72032	D	0.01	-3.7432	12.4305	0.55571	0.0:0.9222:0.0:0.0778	.	3;3	Q96FJ0-2;Q96FJ0	.;STALP_HUMAN	K	3	ENSP00000360994:Q3K;ENSP00000360995:Q3K;ENSP00000360992:Q3K	ENSP00000360992:Q3K	Q	+	1	0	STAMBPL1	90651452	0.995000	0.38212	0.971000	0.41717	0.042000	0.13812	3.447000	0.52936	1.578000	0.49821	0.650000	0.86243	CAG	STAMBPL1	-	NULL	ENSG00000138134		0.353	STAMBPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049283.1	481	0.41	2	C	NM_020799		90661472	90661472	+1	no_errors	ENST00000371927	ensembl	human	known	69_37n	missense	242	42.92	182	SNP	0.986	A
STK10	6793	genome.wustl.edu	37	5	171533651	171533651	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr5:171533651G>A	ENST00000176763.5	-	6	1104	c.761C>T	c.(760-762)cCt>cTt	p.P254L		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	254	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CAGCGTGGGAGGGTCCGACTT	0.657											OREG0017039	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													98.0	90.0	93.0					5																	171533651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.761C>T	5.37:g.171533651G>A	ENSP00000176763:p.Pro254Leu	Somatic	1893	WXS	Illumina GAIIx	Phase_IV	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P254L	ENST00000176763.5	37	c.761	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	G	18.04	3.534948	0.64972	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.25579	1.79	4.86	4.86	0.63082	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.40815	0.1132	L	0.35487	1.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.28713	-1.0035	10	0.87932	D	0	.	15.5673	0.76303	0.0:0.0:1.0:0.0	.	254	O94804	STK10_HUMAN	L	254	ENSP00000176763:P254L	ENSP00000176763:P254L	P	-	2	0	STK10	171466256	1.000000	0.71417	0.122000	0.21767	0.023000	0.10783	9.648000	0.98483	2.537000	0.85549	0.655000	0.94253	CCT	STK10	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000072786		0.657	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	219	0.00	0	G	NM_005990		171533651	171533651	-1	no_errors	ENST00000176763	ensembl	human	known	69_37n	missense	42	55.32	52	SNP	0.995	A
STMN4	81551	genome.wustl.edu	37	8	27099197	27099197	+	Intron	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:27099197G>A	ENST00000265770.7	-	4	246				STMN4_ENST00000523048.1_Nonsense_Mutation_p.Q63*|STMN4_ENST00000519614.1_Intron|STMN4_ENST00000522908.1_Nonsense_Mutation_p.Q63*|STMN4_ENST00000350889.4_Nonsense_Mutation_p.Q63*|STMN4_ENST00000519997.1_Intron			Q9H169	STMN4_HUMAN	stathmin-like 4						regulation of microtubule polymerization or depolymerization (GO:0031110)	cell projection (GO:0042995)|Golgi apparatus (GO:0005794)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)	11		Ovarian(32;0.00167)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0214)|Epithelial(17;9.82e-10)|Colorectal(74;0.142)	Lomustine(DB01206)	CTCCTACCCTGAGCTCTTCTT	0.607																																						dbGAP											0													122.0	98.0	106.0					8																	27099197		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS6055.1, CCDS64851.1, CCDS64852.1, CCDS64854.1	8p21.2	2006-12-09			ENSG00000015592	ENSG00000015592			16078	protein-coding gene	gene with protein product						11230166	Standard	NM_001283054		Approved	RB3	uc003xfj.3	Q9H169	OTTHUMG00000099461	ENST00000265770.7:c.110-418C>T	8.37:g.27099197G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2Z7|B7Z4I9|D3DSS8|D3DSS9|G5EA16|Q2TAB9	Nonsense_Mutation	SNP	pfam_Stathmin,superfamily_Stathmin,pirsf_Stathmin,prints_Stathmin	p.Q63*	ENST00000265770.7	37	c.187		8	.	.	.	.	.	.	.	.	.	.	G	15.74	2.922227	0.52653	.	.	ENSG00000015592	ENST00000350889;ENST00000523048;ENST00000522908	.	.	.	4.8	1.95	0.26073	.	0.384916	0.20562	N	0.089884	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	4.2294	0.10596	0.2049:0.1936:0.6015:0.0	.	.	.	.	X	63	.	ENSP00000342538:Q63X	Q	-	1	0	STMN4	27155114	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	1.209000	0.32357	0.672000	0.31204	0.462000	0.41574	CAG	STMN4	-	pirsf_Stathmin	ENSG00000015592		0.607	STMN4-006	KNOWN	basic|appris_principal	protein_coding	STMN4	HGNC	protein_coding	OTTHUMT00000375941.1	236	0.00	0	G	NM_030795		27099197	27099197	-1	no_errors	ENST00000350889	ensembl	human	known	69_37n	nonsense	54	49.53	53	SNP	0.994	A
STON2	85439	genome.wustl.edu	37	14	81862331	81862331	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:81862331C>G	ENST00000267540.2	-	2	480	c.280G>C	c.(280-282)Gac>Cac	p.D94H	STON2_ENST00000555447.1_Missense_Mutation_p.D94H	NM_033104.3	NP_149095.2	Q8WXE9	STON2_HUMAN	stonin 2	94					hematopoietic progenitor cell differentiation (GO:0002244)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)|synaptic vesicle endocytosis (GO:0048488)	cell junction (GO:0030054)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|cytoplasm (GO:0005737)|neuron projection (GO:0043005)|nucleolus (GO:0005730)|synaptic vesicle (GO:0008021)				breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(13)|pancreas(2)|prostate(1)|skin(5)	34				BRCA - Breast invasive adenocarcinoma(234;0.0348)		GAGGCCAGGTCAGGTGGGGGC	0.577																																						dbGAP											0													87.0	90.0	89.0					14																	81862331		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB208948	CCDS9875.1, CCDS58332.1	14q31.1	2007-08-01				ENSG00000140022			30652	protein-coding gene	gene with protein product	"""stoned B homolog 2 (Drosophila)"""	608467				11381094, 11454741	Standard	NM_033104		Approved	STNB2, STN2	uc001xvk.2	Q8WXE9		ENST00000267540.2:c.280G>C	14.37:g.81862331C>G	ENSP00000267540:p.Asp94His	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V2T7|Q17R24|Q59H11|Q6NT47|Q96RI7|Q96RU6	Missense_Mutation	SNP	pfam_Stonin2_N,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,pirsf_Stonin,pfscan_Clathrin_mu_C,pfscan_SHD	p.D94H	ENST00000267540.2	37	c.280	CCDS9875.1	14	.	.	.	.	.	.	.	.	.	.	C	15.66	2.899339	0.52227	.	.	ENSG00000140022	ENST00000555447;ENST00000546306;ENST00000267540	T;T	0.57907	0.37;0.37	5.82	4.93	0.64822	Stonin-2, N-terminal (1);	0.198331	0.44483	D	0.000457	T	0.48277	0.1491	L	0.50333	1.59	0.32433	N	0.547721	B;B;B	0.21071	0.036;0.036;0.051	B;B;B	0.23419	0.046;0.031;0.027	T	0.58781	-0.7576	10	0.59425	D	0.04	-19.5213	12.1247	0.53910	0.0:0.9196:0.0:0.0804	.	94;94;94	Q8WXE9;Q17R23;G3V2T7	STON2_HUMAN;.;.	H	94;106;94	ENSP00000450857:D94H;ENSP00000267540:D94H	ENSP00000267540:D94H	D	-	1	0	STON2	80932084	1.000000	0.71417	0.936000	0.37596	0.969000	0.65631	4.253000	0.58791	1.459000	0.47892	0.655000	0.94253	GAC	STON2	-	pfam_Stonin2_N,pirsf_Stonin	ENSG00000140022		0.577	STON2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STON2	HGNC	protein_coding	OTTHUMT00000413317.1	144	0.00	0	C	NM_033104		81862331	81862331	-1	no_errors	ENST00000267540	ensembl	human	known	69_37n	missense	31	68.69	68	SNP	1.000	G
STRAP	11171	genome.wustl.edu	37	12	16055855	16055855	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:16055855A>T	ENST00000419869.2	+	10	1309	c.996A>T	c.(994-996)gaA>gaT	p.E332D	STRAP_ENST00000025399.6_Missense_Mutation_p.E345D|STRAP_ENST00000538352.1_Missense_Mutation_p.E238D	NM_007178.3	NP_009109.3	Q9Y3F4	STRAP_HUMAN	serine/threonine kinase receptor associated protein	332				E -> A (in Ref. 6; AAV38848). {ECO:0000305}.	maintenance of gastrointestinal epithelium (GO:0030277)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of pathway-restricted SMAD protein phosphorylation (GO:0060394)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|spliceosomal snRNP assembly (GO:0000387)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(6)|skin(1)	15		Hepatocellular(102;0.121)				TTATAGAAGAAATTGCTTCAG	0.308																																						dbGAP											0													45.0	43.0	44.0					12																	16055855		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024327	CCDS8676.1	12p13.1	2013-01-10			ENSG00000023734	ENSG00000023734		"""WD repeat domain containing"""	30796	protein-coding gene	gene with protein product	"""Unr-interacting protein"""	605986					Standard	NM_007178		Approved	UNRIP, pt-wd, MAWD	uc001rdc.4	Q9Y3F4	OTTHUMG00000168791	ENST00000419869.2:c.996A>T	12.37:g.16055855A>T	ENSP00000392270:p.Glu332Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5S5|B4DNJ6|Q5TZT4|Q9NTK0|Q9UQC8	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E345D	ENST00000419869.2	37	c.1035	CCDS8676.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	12.28|12.28	1.890133|1.890133	0.33348|0.33348	.|.	.|.	ENSG00000023734|ENSG00000023734	ENST00000538352;ENST00000025399;ENST00000419869|ENST00000538718	T;T;T|.	0.61742|.	0.17;0.13;0.08|.	4.8|4.8	2.18|2.18	0.27775|0.27775	.|.	0.144737|.	0.44902|.	D|.	0.000414|.	T|T	0.18257|0.18257	0.0438|0.0438	N|N	0.08118|0.08118	0|0	0.33214|0.33214	D|D	0.553767|0.553767	B;B|.	0.06786|.	0.001;0.0|.	B;B|.	0.09377|.	0.004;0.0|.	T|T	0.20009|0.20009	-1.0288|-1.0288	10|5	0.27082|.	T|.	0.32|.	-21.247|-21.247	1.8369|1.8369	0.03141|0.03141	0.5643:0.1291:0.1677:0.1389|0.5643:0.1291:0.1677:0.1389	.|.	345;332|.	B4DNJ6;Q9Y3F4|.	.;STRAP_HUMAN|.	D|Y	238;345;332|77	ENSP00000439761:E238D;ENSP00000025399:E345D;ENSP00000392270:E332D|.	ENSP00000025399:E345D|.	E|N	+|+	3|1	2|0	STRAP|STRAP	15947122|15947122	0.998000|0.998000	0.40836|0.40836	1.000000|1.000000	0.80357|0.80357	0.963000|0.963000	0.63663|0.63663	0.397000|0.397000	0.20883|0.20883	0.822000|0.822000	0.34565|0.34565	0.533000|0.533000	0.62120|0.62120	GAA|AAT	STRAP	-	NULL	ENSG00000023734		0.308	STRAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRAP	HGNC	protein_coding	OTTHUMT00000401114.1	97	0.00	0	A	NM_007178		16055855	16055855	+1	no_errors	ENST00000025399	ensembl	human	known	69_37n	missense	135	25.41	46	SNP	0.992	T
SURF6	6838	genome.wustl.edu	37	9	136200568	136200568	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:136200568C>G	ENST00000372022.4	-	3	644	c.379G>C	c.(379-381)Gag>Cag	p.E127Q	SURF6_ENST00000468290.1_5'Flank	NM_006753.4	NP_006744.2	O75683	SURF6_HUMAN	surfeit 6	127					ribosome biogenesis (GO:0042254)	granular component (GO:0001652)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(1)|large_intestine(5)|lung(5)|ovary(1)	12				OV - Ovarian serous cystadenocarcinoma(145;1.16e-06)|Epithelial(140;8.34e-06)|all cancers(34;7.08e-05)		CCCCGGGCCTCCTGGATCTTC	0.632																																						dbGAP											0													47.0	44.0	45.0					9																	136200568		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF186772	CCDS6962.1	9q33-q34	2010-07-06			ENSG00000148296	ENSG00000148296			11478	protein-coding gene	gene with protein product	"""surfeit locus protein 6"""	185642				9740673, 15629442	Standard	NM_006753		Approved	FLJ30322, RRP14	uc004cdb.4	O75683	OTTHUMG00000020871	ENST00000372022.4:c.379G>C	9.37:g.136200568C>G	ENSP00000361092:p.Glu127Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T8U1|Q9BRK9|Q9BTZ5|Q9UK24	Missense_Mutation	SNP	pfam_Surf6	p.E127Q	ENST00000372022.4	37	c.379	CCDS6962.1	9	.	.	.	.	.	.	.	.	.	.	C	17.61	3.432044	0.62844	.	.	ENSG00000148296	ENST00000372022	T	0.17370	2.28	4.62	2.74	0.32292	.	0.168672	0.50627	D	0.000112	T	0.19927	0.0479	M	0.68593	2.085	0.48830	D	0.999713	P	0.52316	0.952	P	0.46585	0.521	T	0.04268	-1.0964	10	0.25106	T	0.35	-18.5525	7.0752	0.25201	0.0:0.6913:0.1433:0.1654	.	127	O75683	SURF6_HUMAN	Q	127	ENSP00000361092:E127Q	ENSP00000361092:E127Q	E	-	1	0	SURF6	135190389	1.000000	0.71417	0.996000	0.52242	0.994000	0.84299	1.434000	0.34958	0.363000	0.24346	0.655000	0.94253	GAG	SURF6	-	NULL	ENSG00000148296		0.632	SURF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF6	HGNC	protein_coding	OTTHUMT00000054905.1	47	0.00	0	C	NM_006753		136200568	136200568	-1	no_errors	ENST00000372022	ensembl	human	known	69_37n	missense	17	39.29	11	SNP	1.000	G
TFCP2L1	29842	genome.wustl.edu	37	2	121981961	121981961	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:121981961C>G	ENST00000263707.5	-	15	1493	c.1396G>C	c.(1396-1398)Gag>Cag	p.E466Q		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	466					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.E466Q(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					TCATTGCTCTCAGCTGCAAGA	0.517																																						dbGAP											1	Substitution - Missense(1)	lung(1)											91.0	76.0	81.0					2																	121981961		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.1396G>C	2.37:g.121981961C>G	ENSP00000263707:p.Glu466Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4ZG43	Missense_Mutation	SNP	pfam_CP2,superfamily_SAM/pointed	p.E466Q	ENST00000263707.5	37	c.1396	CCDS2134.1	2	.	.	.	.	.	.	.	.	.	.	C	14.44	2.535491	0.45176	.	.	ENSG00000115112	ENST00000263707;ENST00000537910	T	0.20738	2.05	5.12	4.24	0.50183	.	0.359565	0.30911	N	0.008630	T	0.20700	0.0498	L	0.45581	1.43	0.58432	D	0.999998	B	0.17852	0.024	B	0.19148	0.024	T	0.02661	-1.1127	10	0.34782	T	0.22	.	14.0933	0.65004	0.0:0.9267:0.0:0.0733	.	466	Q9NZI6	TF2L1_HUMAN	Q	466;19	ENSP00000263707:E466Q	ENSP00000263707:E466Q	E	-	1	0	TFCP2L1	121698431	1.000000	0.71417	0.824000	0.32777	0.880000	0.50808	6.189000	0.72051	1.279000	0.44446	0.557000	0.71058	GAG	TFCP2L1	-	NULL	ENSG00000115112		0.517	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2L1	HGNC	protein_coding	OTTHUMT00000338539.1	177	0.00	0	C	NM_014553		121981961	121981961	-1	no_errors	ENST00000263707	ensembl	human	known	69_37n	missense	139	16.17	27	SNP	0.998	G
TIPRL	261726	genome.wustl.edu	37	1	168160639	168160639	+	Silent	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr1:168160639A>G	ENST00000367833.2	+	4	562	c.417A>G	c.(415-417)gaA>gaG	p.E139E	TIPRL_ENST00000367830.3_Silent_p.E139E	NM_152902.3	NP_690866.1	O75663	TIPRL_HUMAN	TOR signaling pathway regulator	139					DNA damage checkpoint (GO:0000077)|negative regulation of protein phosphatase type 2A activity (GO:0034048)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|kidney(1)|large_intestine(1)|ovary(2)|skin(1)	6	all_hematologic(923;0.215)					TAGATACAGAAAAATTGAAAG	0.343																																						dbGAP											0													57.0	65.0	62.0					1																	168160639		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB097034	CCDS1270.1, CCDS30935.1	1q23.2	2014-03-07	2014-03-07		ENSG00000143155	ENSG00000143155			30231	protein-coding gene	gene with protein product		611807	"""TIP41, TOR signaling pathway regulator-like (S. cerevisiae)"""			12761501	Standard	NM_001031800		Approved	MGC3794, dJ69E11.3, TIP41	uc001gfg.3	O75663	OTTHUMG00000034646	ENST00000367833.2:c.417A>G	1.37:g.168160639A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8V3|Q5HYB2|Q8IZ86	Silent	SNP	pfam_TIP41-like	p.E139	ENST00000367833.2	37	c.417	CCDS1270.1	1																																																																																			TIPRL	-	pfam_TIP41-like	ENSG00000143155		0.343	TIPRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIPRL	HGNC	protein_coding	OTTHUMT00000083822.1	90	0.00	0	A	NM_152902		168160639	168160639	+1	no_errors	ENST00000367833	ensembl	human	known	69_37n	silent	176	14.56	30	SNP	1.000	G
TMEM245	23731	genome.wustl.edu	37	9	111853251	111853251	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:111853251C>G	ENST00000374586.3	-	5	1132	c.1101G>C	c.(1099-1101)caG>caC	p.Q367H		NM_032012.3	NP_114401.2	Q9H330	TM245_HUMAN	transmembrane protein 245	367						integral component of membrane (GO:0016021)											TCAACCAGATCTGCATGACGA	0.443																																						dbGAP											0													97.0	102.0	100.0					9																	111853251		2040	4186	6226	-	-	-	SO:0001583	missense	0			AF153415	CCDS43858.1	9q31	2012-03-06	2012-03-06	2012-03-06	ENSG00000106771	ENSG00000106771			1363	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 5"""	C9orf5		10564813	Standard	NM_032012		Approved	CG-2	uc004bdt.4	Q9H330	OTTHUMG00000020469	ENST00000374586.3:c.1101G>C	9.37:g.111853251C>G	ENSP00000363714:p.Gln367His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSW7|Q5JTQ5|Q5SS43|Q6ZME3|Q8NDJ5|Q96CG6	Missense_Mutation	SNP	pfam_UPF0118	p.Q367H	ENST00000374586.3	37	c.1101	CCDS43858.1	9	.	.	.	.	.	.	.	.	.	.	C	16.86	3.239316	0.58995	.	.	ENSG00000106771	ENST00000374587;ENST00000374586;ENST00000223608	T	0.25414	1.8	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.47655	0.1457	M	0.62723	1.935	0.39778	D	0.972259	D;D	0.71674	0.998;0.998	D;D	0.80764	0.994;0.993	T	0.43925	-0.9361	10	0.59425	D	0.04	-15.2835	13.4664	0.61256	0.0:0.9288:0.0:0.0712	.	367;367	Q9H330-2;Q9H330	.;CI005_HUMAN	H	367	ENSP00000363714:Q367H	ENSP00000223608:Q367H	Q	-	3	2	C9orf5	110893072	1.000000	0.71417	0.995000	0.50966	0.469000	0.32828	2.817000	0.48034	2.793000	0.96121	0.563000	0.77884	CAG	TMEM245	-	NULL	ENSG00000106771		0.443	TMEM245-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM245	HGNC	protein_coding	OTTHUMT00000053587.2	328	0.00	0	C	NM_032012		111853251	111853251	-1	no_errors	ENST00000374586	ensembl	human	known	69_37n	missense	228	37.09	135	SNP	1.000	G
TNXB	7148	genome.wustl.edu	37	6	32023670	32023670	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr6:32023670C>T	ENST00000375244.3	-	24	8626	c.8425G>A	c.(8425-8427)Gag>Aag	p.E2809K	TNXB_ENST00000375247.2_Missense_Mutation_p.E2809K			P22105	TENX_HUMAN	tenascin XB	2867	Fibronectin type-III 20. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)	p.E2896*(1)|p.E2809*(1)		endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CGCCGCCCCTCGTGGAGGCCG	0.637																																						dbGAP											2	Substitution - Nonsense(2)	lung(2)											61.0	69.0	66.0					6																	32023670		1238	2542	3780	-	-	-	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8425G>A	6.37:g.32023670C>T	ENSP00000364393:p.Glu2809Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.E2809K	ENST00000375244.3	37	c.8425		6	.	.	.	.	.	.	.	.	.	.	C	11.57	1.679191	0.29783	.	.	ENSG00000168477	ENST00000375244;ENST00000375247	T;T	0.56776	0.44;0.44	5.04	-0.513	0.11962	.	.	.	.	.	T	0.12689	0.0308	L	0.34521	1.04	0.09310	N	1	B	0.34200	0.441	B	0.33042	0.157	T	0.33599	-0.9862	9	0.06757	T	0.87	.	7.0086	0.24849	0.0:0.4675:0.3848:0.1478	.	2809	P22105-3	.	K	2809	ENSP00000364393:E2809K;ENSP00000364396:E2809K	ENSP00000364393:E2809K	E	-	1	0	TNXB	32131648	0.000000	0.05858	0.022000	0.16811	0.894000	0.52154	0.371000	0.20450	-0.480000	0.06803	0.462000	0.41574	GAG	TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.637	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	33	0.00	0	C	NM_019105		32023670	32023670	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	missense	13	59.38	19	SNP	0.000	T
TP53	7157	genome.wustl.edu	37	17	7579521	7579521	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:7579521C>A	ENST00000269305.4	-	4	355	c.166G>T	c.(166-168)Gaa>Taa	p.E56*	TP53_ENST00000420246.2_Nonsense_Mutation_p.E56*|TP53_ENST00000359597.4_Nonsense_Mutation_p.E56*|TP53_ENST00000455263.2_Nonsense_Mutation_p.E56*|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000413465.2_Nonsense_Mutation_p.E56*|TP53_ENST00000445888.2_Nonsense_Mutation_p.E56*	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	56	Interaction with HRMT1L2.		E -> K (in sporadic cancers; somatic mutation).|E -> V (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.E56*(7)|p.E56K(3)|p.E56fs*73(3)|p.E51fs*59(1)|p.Q52fs*67(1)|p.D48fs*55(1)|p.E56fs*67(1)|p.P13fs*18(1)|p.S33fs*23(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CCTGGGTCTTCAGTGAACCAT	0.597		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	27	Whole gene deletion(8)|Substitution - Nonsense(7)|Deletion - Frameshift(6)|Insertion - Frameshift(3)|Substitution - Missense(3)	upper_aerodigestive_tract(4)|bone(4)|liver(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|urinary_tract(2)|breast(2)|pancreas(2)|large_intestine(1)|stomach(1)|endometrium(1)|lung(1)|skin(1)|prostate(1)											158.0	159.0	159.0					17																	7579521		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.166G>T	17.37:g.7579521C>A	ENSP00000269305:p.Glu56*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Nonsense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.E56*	ENST00000269305.4	37	c.166	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.63	2.594134	0.46214	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000508793;ENST00000503591	.	.	.	3.33	0.2	0.15181	.	1.101100	0.06919	N	0.809088	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-0.0048	3.4906	0.07636	0.0:0.5368:0.2153:0.2479	.	.	.	.	X	56	.	ENSP00000269305:E56X	E	-	1	0	TP53	7520246	0.064000	0.20934	0.001000	0.08648	0.010000	0.07245	0.714000	0.25808	0.099000	0.17552	-0.264000	0.10439	GAA	TP53	-	NULL	ENSG00000141510		0.597	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	145	0.00	0	C	NM_000546		7579521	7579521	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	nonsense	29	61.84	47	SNP	0.074	A
TRIM49B	283116	genome.wustl.edu	37	11	49059214	49059214	+	Silent	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr11:49059214G>T	ENST00000332682.7	+	7	1072	c.1044G>T	c.(1042-1044)ggG>ggT	p.G348G		NM_001206626.1	NP_001193555.1	A6NDI0	TR49B_HUMAN	tripartite motif containing 49B	348	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			lung(8)	8						TCCATGTAGGGGACTCCTGGA	0.438																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0				CCDS55762.1	11p11.12	2014-02-17			ENSG00000182053	ENSG00000182053		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	42955	protein-coding gene	gene with protein product							Standard	NM_001206626		Approved		uc021qix.1	A6NDI0		ENST00000332682.7:c.1044G>T	11.37:g.49059214G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.G348	ENST00000332682.7	37	c.1044	CCDS55762.1	11																																																																																			TRIM49B	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000182053		0.438	TRIM49B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49B	HGNC	protein_coding		213	0.00	0	G			49059214	49059214	+1	no_errors	ENST00000332682	ensembl	human	known	69_37n	silent	231	36.36	132	SNP	0.020	T
TRIP4	9325	genome.wustl.edu	37	15	64687614	64687614	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:64687614A>G	ENST00000261884.3	+	3	349	c.289A>G	c.(289-291)Aaa>Gaa	p.K97E	TRIP4_ENST00000559565.1_3'UTR	NM_016213.4	NP_057297.2	Q15650	TRIP4_HUMAN	thyroid hormone receptor interactor 4	97					positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21						AGATGGGCAGAAATCAGGCGA	0.383																																						dbGAP											0													54.0	53.0	53.0					15																	64687614		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40371	CCDS10194.1	15q22.1	2014-02-17			ENSG00000103671	ENSG00000103671		"""-"""	12310	protein-coding gene	gene with protein product	"""zinc finger, C2HC5-type"""	604501				7776974	Standard	NM_016213		Approved	HsT17391, ZC2HC5	uc002anm.3	Q15650	OTTHUMG00000133033	ENST00000261884.3:c.289A>G	15.37:g.64687614A>G	ENSP00000261884:p.Lys97Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAS0|Q96ED7|Q9UKH0	Missense_Mutation	SNP	pfam_ASCH_domain,pfam_Znf_C2HC5,superfamily_PUA-like_domain	p.K97E	ENST00000261884.3	37	c.289	CCDS10194.1	15	.	.	.	.	.	.	.	.	.	.	A	7.541	0.660636	0.14645	.	.	ENSG00000103671	ENST00000261884	.	.	.	5.46	4.32	0.51571	.	0.577288	0.21172	N	0.078966	T	0.20659	0.0497	N	0.08118	0	0.09310	N	1	B	0.15719	0.014	B	0.15484	0.013	T	0.16837	-1.0389	9	0.06365	T	0.9	-6.2211	12.4471	0.55657	0.6699:0.3301:0.0:0.0	.	97	Q15650	TRIP4_HUMAN	E	97	.	ENSP00000261884:K97E	K	+	1	0	TRIP4	62474667	0.284000	0.24287	0.469000	0.27204	0.936000	0.57629	1.532000	0.36029	0.995000	0.38917	0.528000	0.53228	AAA	TRIP4	-	NULL	ENSG00000103671		0.383	TRIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP4	HGNC	protein_coding	OTTHUMT00000256635.2	128	0.78	1	A	NM_016213		64687614	64687614	+1	no_errors	ENST00000261884	ensembl	human	known	69_37n	missense	113	42.35	83	SNP	0.026	G
TSHR	7253	genome.wustl.edu	37	14	81606112	81606112	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr14:81606112A>T	ENST00000541158.2	+	10	1104	c.782A>T	c.(781-783)aAg>aTg	p.K261M	TSHR_ENST00000298171.2_Missense_Mutation_p.K261M|RP11-114N19.3_ENST00000557775.1_RNA			P16473	TSHR_HUMAN	thyroid stimulating hormone receptor	261					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adult locomotory behavior (GO:0008344)|B cell differentiation (GO:0030183)|cell-cell signaling (GO:0007267)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|positive regulation of cell proliferation (GO:0008284)|positive regulation of multicellular organism growth (GO:0040018)|regulation of locomotion (GO:0040012)|thyroid-stimulating hormone signaling pathway (GO:0038194)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	thyroid-stimulating hormone receptor activity (GO:0004996)			breast(2)|endometrium(2)|kidney(1)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(2)|stomach(1)|thyroid(291)|upper_aerodigestive_tract(1)	337				BRCA - Breast invasive adenocarcinoma(234;0.0402)	Thyrotropin Alfa(DB00024)	TGGACTCTTAAGAAACTTCCA	0.498			Mis		toxic thyroid adenoma	thyroid  adenoma	Hereditary nonautoimmune hyperthyroidism; subclinical hypothyroidism																															dbGAP	yes	Dom	yes		14	14q31	7253	thyroid stimulating hormone receptor	yes	E	0													110.0	87.0	95.0					14																	81606112		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY429111	CCDS9872.1, CCDS32131.1, CCDS55935.1	14q24-q31	2014-09-17			ENSG00000165409	ENSG00000165409		"""GPCR / Class A : Gonadotropin and TSH receptors"""	12373	protein-coding gene	gene with protein product		603372				2558651, 2610690	Standard	NM_001018036		Approved	LGR3	uc001xvd.1	P16473		ENST00000541158.2:c.782A>T	14.37:g.81606112A>T	ENSP00000441235:p.Lys261Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJU7|F5GYU5|G3V2A9|Q16503|Q8TB90|Q96GT6|Q9P1V4|Q9ULA3|Q9UPH3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_TSH_rcpt,prints_Gphrmn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_FSH_rcpt,prints_LSH_rcpt	p.K261M	ENST00000541158.2	37	c.782	CCDS9872.1	14	.	.	.	.	.	.	.	.	.	.	A	21.6	4.180545	0.78677	.	.	ENSG00000165409	ENST00000541158;ENST00000298171	T;T	0.79033	-1.23;-1.23	5.46	4.32	0.51571	.	0.044719	0.85682	D	0.000000	D	0.88317	0.6404	M	0.89658	3.05	0.80722	D	1	D	0.67145	0.996	D	0.65010	0.931	D	0.89290	0.3618	10	0.87932	D	0	.	11.245	0.48991	0.9286:0.0:0.0714:0.0	.	261	F5GYU5	.	M	261	ENSP00000441235:K261M;ENSP00000298171:K261M	ENSP00000298171:K261M	K	+	2	0	TSHR	80675865	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.478000	0.81082	0.918000	0.36919	0.533000	0.62120	AAG	TSHR	-	NULL	ENSG00000165409		0.498	TSHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHR	HGNC	protein_coding	OTTHUMT00000413364.1	248	0.00	0	A	NM_000369		81606112	81606112	+1	no_errors	ENST00000298171	ensembl	human	known	69_37n	missense	127	43.81	99	SNP	1.000	T
UBXN8	7993	genome.wustl.edu	37	8	30614364	30614364	+	RNA	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:30614364C>G	ENST00000519246.1	+	0	687							O00124	UBXN8_HUMAN	UBX domain protein 8						ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|single fertilization (GO:0007338)	integral component of endoplasmic reticulum membrane (GO:0030176)				central_nervous_system(1)|lung(2)	3						AAACCTTTAACTGAATTTCCG	0.433																																					Colon(169;855 1943 17895 39459 47884)	dbGAP											0													109.0	101.0	104.0					8																	30614364		1949	4145	6094	-	-	-			0			D83767	CCDS75723.1, CCDS75724.1, CCDS75725.1	8p12-p11.2	2012-07-06	2008-07-25	2008-07-25		ENSG00000104691		"""UBX domain containing"""	30307	protein-coding gene	gene with protein product		602155	"""UBX domain containing 6"""	UBXD6		9027507, 21949850	Standard	NM_005671		Approved	D8S2298E, REP8	uc003xii.3	O00124			8.37:g.30614364C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z6F2	RNA	SNP	-	NULL	ENST00000519246.1	37	NULL		8																																																																																			UBXN8	-	-	ENSG00000104691		0.433	UBXN8-001	KNOWN	basic	processed_transcript	UBXN8	HGNC	processed_transcript	OTTHUMT00000375957.1	278	0.00	0	C	NM_005671		30614364	30614364	+1	no_errors	ENST00000265616	ensembl	human	known	69_37n	rna	110	50.00	111	SNP	0.000	G
UGT2B10	7365	genome.wustl.edu	37	4	69682121	69682121	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:69682121T>A	ENST00000265403.7	+	1	411	c.384T>A	c.(382-384)gaT>gaA	p.D128E	UGT2B10_ENST00000458688.2_Missense_Mutation_p.D128E	NM_001075.4	NP_001066.1	P36537	UDB10_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B10	128					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			endometrium(3)|kidney(4)|large_intestine(1)|lung(13)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	29						TCTGTAAAGATGTAGTTTCAA	0.338																																					Melanoma(133;755 1763 25578 26334 46021)	dbGAP											0													52.0	56.0	54.0					4																	69682121		2159	4279	6438	-	-	-	SO:0001583	missense	0			X63359	CCDS75135.1, CCDS75136.1	4q13.3	2008-02-05	2005-07-20			ENSG00000109181		"""UDP glucuronosyltransferases"""	12544	protein-coding gene	gene with protein product		600070	"""UDP glycosyltransferase 2 family, polypeptide B10"""			8333863	Standard	NM_001075		Approved		uc003hee.3	P36537		ENST00000265403.7:c.384T>A	4.37:g.69682121T>A	ENSP00000265403:p.Asp128Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9M3|B4DPP1|Q14CR8	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.D128E	ENST00000265403.7	37	c.384		4	.	.	.	.	.	.	.	.	.	.	t	2.562	-0.301551	0.05495	.	.	ENSG00000109181	ENST00000265403;ENST00000458688	T;T	0.58210	0.35;3.3	2.63	-3.41	0.04839	.	0.387293	0.21804	N	0.068871	T	0.23133	0.0559	N	0.05608	-0.01	0.09310	N	1	B;B	0.19073	0.033;0.003	B;B	0.28465	0.09;0.02	T	0.13602	-1.0503	10	0.21540	T	0.41	.	3.0845	0.06273	0.46:0.1333:0.0:0.4067	.	128;128	B4DPP1;P36537	.;UDB10_HUMAN	E	128	ENSP00000265403:D128E;ENSP00000413420:D128E	ENSP00000265403:D128E	D	+	3	2	UGT2B10	69716710	0.000000	0.05858	0.000000	0.03702	0.027000	0.11550	-1.825000	0.01707	-1.013000	0.03383	0.155000	0.16302	GAT	UGT2B10	-	pfam_UDP_glucos_trans	ENSG00000109181		0.338	UGT2B10-001	KNOWN	non_canonical_polymorphism|basic|appris_principal	protein_coding	UGT2B10	HGNC	protein_coding	OTTHUMT00000365169.1	287	0.00	0	T	NM_001075		69682121	69682121	+1	no_errors	ENST00000265403	ensembl	human	known	69_37n	missense	125	58.75	178	SNP	0.002	A
UMPS	7372	genome.wustl.edu	37	3	124456915	124456915	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr3:124456915G>C	ENST00000232607.2	+	3	917	c.811G>C	c.(811-813)Gat>Cat	p.D271H	UMPS_ENST00000498715.1_3'UTR|UMPS_ENST00000538242.1_Missense_Mutation_p.D93H|UMPS_ENST00000536109.1_Missense_Mutation_p.D179H|UMPS_ENST00000413078.2_Missense_Mutation_p.D93H	NM_000373.3	NP_000364.1	P11172	UMPS_HUMAN	uridine monophosphate synthetase	271	OMPdecase.				'de novo' pyrimidine nucleobase biosynthetic process (GO:0006207)|'de novo' UMP biosynthetic process (GO:0044205)|cellular response to drug (GO:0035690)|female pregnancy (GO:0007565)|lactation (GO:0007595)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside biosynthetic process (GO:0046134)|small molecule metabolic process (GO:0044281)|UMP biosynthetic process (GO:0006222)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	orotate phosphoribosyltransferase activity (GO:0004588)|orotidine-5'-phosphate decarboxylase activity (GO:0004590)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16				GBM - Glioblastoma multiforme(114;0.146)	Fluorouracil(DB00544)	GCAGCTAGCAGATGCTTTAGG	0.433																																						dbGAP											0													140.0	128.0	132.0					3																	124456915		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3029.1	3q13	2008-02-04	2008-02-04		ENSG00000114491	ENSG00000114491	2.4.2.10, 4.1.1.23		12563	protein-coding gene	gene with protein product	"""orotate phosphoribosyl transferase and orotidine-5'-decarboxylase"""	613891				2767686	Standard	NM_000373		Approved		uc003ehl.4	P11172	OTTHUMG00000159431	ENST00000232607.2:c.811G>C	3.37:g.124456915G>C	ENSP00000232607:p.Asp271His	Somatic		WXS	Illumina GAIIx	Phase_IV	B5LY68|B5LY72|O00758|O00759|O00760|Q16862|Q9H3Q2|Q9UG49	Missense_Mutation	SNP	pfam_OMPdeCOase_dom,pfam_PRibTrfase,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase,tigrfam_Or_phspho_trans_clade-1	p.D271H	ENST00000232607.2	37	c.811	CCDS3029.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.064058	0.76187	.	.	ENSG00000114491	ENST00000232607;ENST00000536109;ENST00000538242;ENST00000413078	T;T;T;T	0.68624	-0.27;-0.27;-0.27;-0.34	5.33	4.42	0.53409	Orotidine 5&apos (2);Aldolase-type TIM barrel (1);-phosphate decarboxylase domain (2);Ribulose-phosphate binding barrel (1);	0.161712	0.56097	D	0.000038	D	0.82917	0.5141	M	0.90595	3.13	0.44825	D	0.997832	D;D;D	0.76494	0.999;0.986;0.965	D;P;P	0.65323	0.934;0.75;0.761	D	0.86136	0.1578	10	0.87932	D	0	-25.3978	13.9579	0.64162	0.0:0.0:0.8494:0.1506	.	93;93;271	B5LY72;B5LY70;P11172	.;.;UMPS_HUMAN	H	271;179;93;93	ENSP00000232607:D271H;ENSP00000443577:D179H;ENSP00000444988:D93H;ENSP00000397965:D93H	ENSP00000232607:D271H	D	+	1	0	UMPS	125939605	1.000000	0.71417	0.988000	0.46212	0.902000	0.53008	4.129000	0.57957	2.778000	0.95560	0.655000	0.94253	GAT	UMPS	-	pfam_OMPdeCOase_dom,superfamily_RibuloseP-bd_barrel,smart_OMPdeCOase_dom,tigrfam_OMPdecase	ENSG00000114491		0.433	UMPS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UMPS	HGNC	protein_coding	OTTHUMT00000355271.1	316	0.00	0	G	NM_000373		124456915	124456915	+1	no_errors	ENST00000232607	ensembl	human	known	69_37n	missense	272	28.98	111	SNP	0.768	C
UNC5C	8633	genome.wustl.edu	37	4	96222841	96222841	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr4:96222841C>G	ENST00000453304.1	-	3	754	c.406G>C	c.(406-408)Gga>Cga	p.G136R	UNC5C_ENST00000504962.1_Missense_Mutation_p.G136R|UNC5C_ENST00000506749.1_Missense_Mutation_p.G136R	NM_003728.3	NP_003719.3	O95185	UNC5C_HUMAN	unc-5 homolog C (C. elegans)	136	Ig-like.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|brain development (GO:0007420)|positive regulation of apoptotic process (GO:0043065)|regulation of cell migration (GO:0030334)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(14)|lung(25)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	55		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;8.72e-10)		TCTTCAGGTCCAAAGAGTTCT	0.488																																						dbGAP											0													85.0	70.0	75.0					4																	96222841		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055634	CCDS3643.1	4q21-q23	2013-01-11	2001-11-28		ENSG00000182168	ENSG00000182168		"""Immunoglobulin superfamily / I-set domain containing"""	12569	protein-coding gene	gene with protein product		603610	"""unc5 (C.elegans homolog) c"""			9126742, 9782087	Standard	NM_003728		Approved		uc003hto.3	O95185	OTTHUMG00000130989	ENST00000453304.1:c.406G>C	4.37:g.96222841C>G	ENSP00000406022:p.Gly136Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUT0	Missense_Mutation	SNP	pfam_ZU5,pfam_Death,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.G136R	ENST00000453304.1	37	c.406	CCDS3643.1	4	.	.	.	.	.	.	.	.	.	.	C	25.8	4.670575	0.88348	.	.	ENSG00000182168	ENST00000453304;ENST00000331502;ENST00000513796;ENST00000506749;ENST00000504962	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	5.57	5.57	0.84162	Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.60689	0.2288	M	0.89478	3.035	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.997	T	0.67753	-0.5589	10	0.87932	D	0	.	19.5525	0.95326	0.0:1.0:0.0:0.0	.	136;136;136	A8K385;E0CX15;O95185	.;.;UNC5C_HUMAN	R	136;95;136;136;136	ENSP00000406022:G136R;ENSP00000426924:G136R;ENSP00000426153:G136R;ENSP00000425117:G136R	ENSP00000328673:G95R	G	-	1	0	UNC5C	96441864	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.959000	0.70339	2.626000	0.88956	0.650000	0.86243	GGA	UNC5C	-	NULL	ENSG00000182168		0.488	UNC5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5C	HGNC	protein_coding	OTTHUMT00000253607.1	173	0.00	0	C	NM_003728		96222841	96222841	-1	no_errors	ENST00000453304	ensembl	human	known	69_37n	missense	112	45.37	93	SNP	1.000	G
USP11	8237	genome.wustl.edu	37	X	47101698	47101698	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chrX:47101698C>T	ENST00000218348.3	+	10	1526	c.1526C>T	c.(1525-1527)cCa>cTa	p.P509L	USP11_ENST00000377107.2_Missense_Mutation_p.P466L	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	509	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						CGCCGCAAGCCAGAGCAGGTG	0.547																																						dbGAP											0													34.0	31.0	32.0					X																	47101698		2203	4300	6503	-	-	-	SO:0001583	missense	0			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1526C>T	X.37:g.47101698C>T	ENSP00000218348:p.Pro509Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTX1|Q8IUG6|Q9BWE1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.P509L	ENST00000218348.3	37	c.1526	CCDS14277.1	X	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551653	0.86127	.	.	ENSG00000102226	ENST00000377107;ENST00000218348	T;T	0.28895	1.63;1.59	5.6	5.6	0.85130	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.57902	0.2085	M	0.74881	2.28	0.80722	D	1	D;D	0.89917	0.996;1.0	D;D	0.91635	0.968;0.999	T	0.61946	-0.6958	10	0.87932	D	0	-9.0112	17.2763	0.87116	0.0:1.0:0.0:0.0	.	236;509	B3KP28;P51784	.;UBP11_HUMAN	L	466;509	ENSP00000366311:P466L;ENSP00000218348:P509L	ENSP00000218348:P509L	P	+	2	0	USP11	46986642	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.422000	0.80217	2.346000	0.79739	0.600000	0.82982	CCA	USP11	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000102226		0.547	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		140	0.00	0	C	NM_004651		47101698	47101698	+1	no_errors	ENST00000218348	ensembl	human	known	69_37n	missense	34	60.00	51	SNP	1.000	T
UTP20	27340	genome.wustl.edu	37	12	101757468	101757468	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr12:101757468G>C	ENST00000261637.4	+	45	6079	c.5905G>C	c.(5905-5907)Ggc>Cgc	p.G1969R		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1969					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TGAAATCCTCGGCAAGTTTGT	0.403																																						dbGAP											0													107.0	95.0	99.0					12																	101757468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.5905G>C	12.37:g.101757468G>C	ENSP00000261637:p.Gly1969Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.G1969R	ENST00000261637.4	37	c.5905	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	32	5.128502	0.94473	.	.	ENSG00000120800	ENST00000261637	T	0.66460	-0.21	5.92	5.92	0.95590	Armadillo-type fold (1);	0.100760	0.64402	D	0.000002	T	0.78227	0.4250	L	0.58101	1.795	0.80722	D	1	D	0.62365	0.991	P	0.58391	0.838	T	0.78783	-0.2069	10	0.87932	D	0	-14.867	20.3248	0.98698	0.0:0.0:1.0:0.0	.	1969	O75691	UTP20_HUMAN	R	1969	ENSP00000261637:G1969R	ENSP00000261637:G1969R	G	+	1	0	UTP20	100281599	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.672000	0.98629	2.818000	0.97014	0.655000	0.94253	GGC	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.403	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	384	0.00	0	G	NM_014503		101757468	101757468	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	195	26.32	70	SNP	1.000	C
VPS13A	23230	genome.wustl.edu	37	9	79954717	79954717	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr9:79954717G>C	ENST00000360280.3	+	48	6924	c.6664G>C	c.(6664-6666)Ggc>Cgc	p.G2222R	VPS13A_ENST00000376634.4_Missense_Mutation_p.G2222R|VPS13A_ENST00000357409.5_Missense_Mutation_p.G2222R|VPS13A_ENST00000376636.3_Missense_Mutation_p.G2183R	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	2222					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						CAATAAAACTGGCCGCATGTT	0.363																																						dbGAP											0													130.0	128.0	129.0					9																	79954717		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.6664G>C	9.37:g.79954717G>C	ENSP00000353422:p.Gly2222Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.G2222R	ENST00000360280.3	37	c.6664	CCDS6655.1	9	.	.	.	.	.	.	.	.	.	.	G	18.71	3.681321	0.68042	.	.	ENSG00000197969	ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	T;T;T;T	0.36340	1.26;1.26;1.26;1.26	5.96	5.05	0.67936	Vacuolar protein sorting-associated protein (1);	0.240956	0.42682	D	0.000680	T	0.58680	0.2139	M	0.81802	2.56	0.80722	D	1	P;P;P;P	0.52463	0.915;0.848;0.953;0.889	P;P;P;P	0.59889	0.865;0.769;0.783;0.783	T	0.64918	-0.6294	10	0.72032	D	0.01	.	14.2695	0.66143	0.0721:0.0:0.9279:0.0	.	2183;2222;2222;2222	Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.;VP13A_HUMAN;.;.	R	2222;2183;2222;2222	ENSP00000365821:G2222R;ENSP00000365823:G2183R;ENSP00000353422:G2222R;ENSP00000349985:G2222R	ENSP00000349985:G2222R	G	+	1	0	VPS13A	79144537	1.000000	0.71417	0.993000	0.49108	0.901000	0.52897	3.094000	0.50227	1.503000	0.48686	0.585000	0.79938	GGC	VPS13A	-	pfam_VPSAP	ENSG00000197969		0.363	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	241	0.00	0	G	NM_015186		79954717	79954717	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	missense	96	54.07	113	SNP	1.000	C
VPS13B	157680	genome.wustl.edu	37	8	100830977	100830977	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr8:100830977C>G	ENST00000358544.2	+	47	8668	c.8557C>G	c.(8557-8559)Ctt>Gtt	p.L2853V	VPS13B_ENST00000357162.2_Missense_Mutation_p.L2828V|VPS13B_ENST00000395996.1_3'UTR	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	2853					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GAGGAGTCATCTTCCAGACCC	0.368																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													134.0	136.0	136.0					8																	100830977		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.8557C>G	8.37:g.100830977C>G	ENSP00000351346:p.Leu2853Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.L2853V	ENST00000358544.2	37	c.8557	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	C	20.5	3.996025	0.74703	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	D;D	0.85556	-1.98;-2.0	5.66	5.66	0.87406	.	0.000000	0.64402	D	0.000001	D	0.89305	0.6677	L	0.32530	0.975	0.80722	D	1	D;D	0.69078	0.988;0.997	P;D	0.78314	0.892;0.991	D	0.90156	0.4224	10	0.87932	D	0	.	19.7532	0.96277	0.0:1.0:0.0:0.0	.	2828;2853	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	V	2828;2853	ENSP00000349685:L2828V;ENSP00000351346:L2853V	ENSP00000349685:L2828V	L	+	1	0	VPS13B	100900153	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.607000	0.67648	2.682000	0.91365	0.650000	0.86243	CTT	VPS13B	-	NULL	ENSG00000132549		0.368	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	378	0.00	0	C	NM_184042		100830977	100830977	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	485	24.69	159	SNP	1.000	G
XIRP2	129446	genome.wustl.edu	37	2	168100303	168100303	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr2:168100303G>A	ENST00000409195.1	+	9	2490	c.2401G>A	c.(2401-2403)Gtc>Atc	p.V801I	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.V801I|XIRP2_ENST00000409273.1_Missense_Mutation_p.V579I|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	626					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						GGAAGAAAATGTCAAAGGTGG	0.378																																						dbGAP											0													79.0	77.0	77.0					2																	168100303		1851	4088	5939	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.2401G>A	2.37:g.168100303G>A	ENSP00000386840:p.Val801Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.V801I	ENST00000409195.1	37	c.2401	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	G	4.445	0.082312	0.08533	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273	T;T;T	0.02552	4.25;4.25;4.25	5.92	3.07	0.35406	.	0.438150	0.24502	N	0.037965	T	0.02571	0.0078	L	0.43152	1.355	0.09310	N	1	B;B;B	0.28512	0.214;0.01;0.01	B;B;B	0.20767	0.031;0.016;0.027	T	0.44236	-0.9341	10	0.30078	T	0.28	-4.9793	5.411	0.16349	0.2403:0.2731:0.4866:0.0	.	626;626;579	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	I	801;801;579	ENSP00000386840:V801I;ENSP00000295237:V801I;ENSP00000387255:V579I	ENSP00000295237:V801I	V	+	1	0	XIRP2	167808549	0.000000	0.05858	1.000000	0.80357	0.983000	0.72400	0.030000	0.13688	0.811000	0.34303	0.650000	0.86243	GTC	XIRP2	-	NULL	ENSG00000163092		0.378	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	165	0.00	0	G	NM_152381		168100303	168100303	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	137	30.10	59	SNP	0.005	A
ZC3H7B	23264	genome.wustl.edu	37	22	41752377	41752377	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr22:41752377G>C	ENST00000352645.4	+	21	2671	c.2414G>C	c.(2413-2415)tGg>tCg	p.W805S	ZC3H7B_ENST00000351589.4_Missense_Mutation_p.W805S	NM_017590.4	NP_060060.3	Q9UGR2	Z3H7B_HUMAN	zinc finger CCCH-type containing 7B	821					viral process (GO:0016032)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(11)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						TATGACATGTGGCTGAAAAAA	0.592																																						dbGAP											0													144.0	133.0	137.0					22																	41752377		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14013.1	22q13.2	2013-01-10		2005-08-09	ENSG00000100403	ENSG00000100403		"""Zinc fingers, CCCH-type domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30869	protein-coding gene	gene with protein product						10470851, 11230166	Standard	NM_017590		Approved	RoXaN, FLJ13787, DKFZp434K0920, KIAA1031	uc003azw.4	Q9UGR2	OTTHUMG00000150969	ENST00000352645.4:c.2414G>C	22.37:g.41752377G>C	ENSP00000345793:p.Trp805Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7YY88|B2RCA4|Q5TFX9|Q8TBT9|Q9H8B6|Q9UGQ9|Q9UGR0|Q9UGR1|Q9UK03|Q9UPW9	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_TPR-1,smart_TPR_repeat,smart_Znf_CCCH,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.W805S	ENST00000352645.4	37	c.2414	CCDS14013.1	22	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865199	0.91511	.	.	ENSG00000100403	ENST00000352645;ENST00000351589	T;T	0.12774	2.65;2.65	5.05	5.05	0.67936	.	0.060718	0.64402	D	0.000001	T	0.30885	0.0779	L	0.42245	1.32	0.80722	D	1	D	0.69078	0.997	D	0.69142	0.962	T	0.01269	-1.1400	10	0.54805	T	0.06	-8.2088	18.7991	0.92008	0.0:0.0:1.0:0.0	.	805	Q9UGR2-2	.	S	805	ENSP00000345793:W805S;ENSP00000263243:W805S	ENSP00000263243:W805S	W	+	2	0	ZC3H7B	40082323	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.761000	0.98940	2.529000	0.85273	0.655000	0.94253	TGG	ZC3H7B	-	NULL	ENSG00000100403		0.592	ZC3H7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H7B	HGNC	protein_coding	OTTHUMT00000320696.1	145	0.00	0	G	NM_017590		41752377	41752377	+1	no_errors	ENST00000351589	ensembl	human	known	69_37n	missense	105	11.67	14	SNP	1.000	C
ZNF592	9640	genome.wustl.edu	37	15	85327556	85327556	+	Silent	SNP	G	G	T			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr15:85327556G>T	ENST00000560079.2	+	4	1938	c.1650G>T	c.(1648-1650)ctG>ctT	p.L550L	ZNF592_ENST00000299927.3_Silent_p.L550L	NM_014630.2	NP_055445.2	Q92610	ZN592_HUMAN	zinc finger protein 592	550					cell death (GO:0008219)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(1)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	40			BRCA - Breast invasive adenocarcinoma(143;0.0587)			CTGCCCCACTGATTGTAGAGG	0.582																																						dbGAP											0													88.0	89.0	89.0					15																	85327556		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			D86966	CCDS32317.1	15q25.2	2011-03-15				ENSG00000166716		"""Zinc fingers, C2H2-type"""	28986	protein-coding gene	gene with protein product		613624	"""spinocerebellar ataxia, autosomal recessive 5"""	SCAR5		9039502, 12030328, 20531441	Standard	NM_014630		Approved	KIAA0211, CAMOS	uc002bld.3	Q92610		ENST00000560079.2:c.1650G>T	15.37:g.85327556G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1T2|Q504Y9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L550	ENST00000560079.2	37	c.1650	CCDS32317.1	15																																																																																			ZNF592	-	NULL	ENSG00000166716		0.582	ZNF592-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF592	HGNC	protein_coding	OTTHUMT00000418779.2	82	0.00	0	G	NM_014630		85327556	85327556	+1	no_errors	ENST00000299927	ensembl	human	known	69_37n	silent	50	33.33	25	SNP	0.067	T
ZNF594	84622	genome.wustl.edu	37	17	5087301	5087301	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A18V-01A-11D-A12B-09	TCGA-BH-A18V-11A-52D-A12B-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	6150dd25-a8f4-4d9f-9da0-f956855ab67d	e968461c-7bb9-4db0-87c6-5e7c77c5042c	g.chr17:5087301C>G	ENST00000399604.4	-	1	391	c.251G>C	c.(250-252)gGa>gCa	p.G84A	ZNF594_ENST00000575779.1_Missense_Mutation_p.G84A			Q96JF6	ZN594_HUMAN	zinc finger protein 594	84					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(3)|lung(10)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	33						TTCATTACATCCATGGCCAAT	0.428																																						dbGAP											0													118.0	109.0	111.0					17																	5087301		1848	4106	5954	-	-	-	SO:0001583	missense	0			AB058774	CCDS42241.1	17p13	2013-01-08			ENSG00000180626	ENSG00000180626		"""Zinc fingers, C2H2-type"""	29392	protein-coding gene	gene with protein product						11347906	Standard	NM_032530		Approved	KIAA1871	uc010cla.1	Q96JF6	OTTHUMG00000132059	ENST00000399604.4:c.251G>C	17.37:g.5087301C>G	ENSP00000382513:p.Gly84Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6RFS0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G84A	ENST00000399604.4	37	c.251	CCDS42241.1	17	.	.	.	.	.	.	.	.	.	.	C	1.977	-0.435070	0.04669	.	.	ENSG00000180626	ENST00000399604	T	0.08102	3.13	2.19	-0.886	0.10590	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.09310	N	1	P	0.42409	0.779	B	0.35607	0.206	T	0.41520	-0.9504	9	0.31617	T	0.26	.	4.6316	0.12504	0.0:0.4448:0.0:0.5552	.	84	Q96JF6	ZN594_HUMAN	A	84	ENSP00000382513:G84A	ENSP00000382513:G84A	G	-	2	0	ZNF594	5028025	0.000000	0.05858	0.024000	0.17045	0.303000	0.27691	-0.768000	0.04715	-0.090000	0.12462	0.455000	0.32223	GGA	ZNF594	-	NULL	ENSG00000180626		0.428	ZNF594-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF594	HGNC	protein_coding	OTTHUMT00000438996.1	278	0.00	0	C	XM_290737		5087301	5087301	-1	no_errors	ENST00000399604	ensembl	human	known	69_37n	missense	116	54.51	139	SNP	0.003	G
