#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AVPR2	554	genome.wustl.edu	37	X	153172076	153172076	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chrX:153172076G>A	ENST00000358927.2	+	4	1219	c.1010G>A	c.(1009-1011)cGa>cAa	p.R337Q	AVPR2_ENST00000370049.1_3'UTR|ARHGAP4_ENST00000467421.1_5'Flank|AVPR2_ENST00000337474.5_Missense_Mutation_p.R337Q			P30518	V2R_HUMAN	arginine vasopressin receptor 2	337					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|excretion (GO:0007588)|hemostasis (GO:0007599)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|interferon-gamma production (GO:0032609)|negative regulation of renal sodium excretion (GO:0035814)|negative regulation of urine volume (GO:0035811)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of systemic arterial blood pressure (GO:0003084)|response to cytokine (GO:0034097)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	vasopressin receptor activity (GO:0005000)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(1)|skin(1)	26	all_cancers(53;6.72e-15)|all_epithelial(53;3.19e-09)|all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)				Conivaptan(DB00872)|Desmopressin(DB00035)|Terlipressin(DB02638)|Tolvaptan(DB06212)|Vasopressin(DB00067)	TCAGAGCTGCGAAGCTTGCTC	0.627																																						dbGAP											0													102.0	88.0	93.0					X																	153172076		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z11687	CCDS14735.1, CCDS55539.1	Xq28	2014-09-17	2008-08-01		ENSG00000126895	ENSG00000126895		"""GPCR / Class A : Vasopressin and oxytocin receptors"""	897	protein-coding gene	gene with protein product	"""nephrogenic diabetes insipidus"""	300538		DIR3, DIR		1324225	Standard	NM_000054		Approved	V2R	uc004fjh.4	P30518	OTTHUMG00000024227	ENST00000358927.2:c.1010G>A	X.37:g.153172076G>A	ENSP00000351805:p.Arg337Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C5HF20|O43192|Q3MJD3|Q9UCV9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Vprsn_rcpt_V2,prints_Vasoprsn_rcpt,prints_7TM_GPCR_Rhodpsn	p.R337Q	ENST00000358927.2	37	c.1010	CCDS14735.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	0.023|0.023	-1.396295|-1.396295	0.01175|0.01175	.|.	.|.	ENSG00000126895|ENSG00000126895	ENST00000430697|ENST00000358927;ENST00000337474	T|T;T	0.74209|0.39406	-0.82|1.08;1.08	4.3|4.3	4.3|4.3	0.51218|0.51218	.|.	.|0.331999	.|0.27816	.|N	.|0.017738	T|T	0.26919|0.26919	0.0659|0.0659	L|L	0.50333|0.50333	1.59|1.59	0.09310|0.09310	N|N	0.999998|0.999998	.|P	.|0.41313	.|0.745	.|B	.|0.22753	.|0.041	T|T	0.21724|0.21724	-1.0237|-1.0237	7|10	0.46703|0.24483	T|T	0.11|0.36	.|.	9.1182|9.1182	0.36771|0.36771	0.1086:0.0:0.8914:0.0|0.1086:0.0:0.8914:0.0	.|.	.|337	.|P30518	.|V2R_HUMAN	K|Q	308|337	ENSP00000393513:E308K|ENSP00000351805:R337Q;ENSP00000338072:R337Q	ENSP00000393513:E308K|ENSP00000338072:R337Q	E|R	+|+	1|2	0|0	AVPR2|AVPR2	152825270|152825270	0.009000|0.009000	0.17119|0.17119	0.822000|0.822000	0.32727|0.32727	0.038000|0.038000	0.13279|0.13279	0.815000|0.815000	0.27253|0.27253	1.880000|1.880000	0.54463|0.54463	0.418000|0.418000	0.28097|0.28097	GAA|CGA	AVPR2	-	prints_Vprsn_rcpt_V2	ENSG00000126895		0.627	AVPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AVPR2	HGNC	protein_coding	OTTHUMT00000061127.2	45	0.00	0	G			153172076	153172076	+1	no_errors	ENST00000337474	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	0.183	A
BTBD3	22903	genome.wustl.edu	37	20	11904104	11904104	+	Silent	SNP	A	A	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr20:11904104A>G	ENST00000405977.1	+	5	1984	c.1359A>G	c.(1357-1359)gtA>gtG	p.V453V	BTBD3_ENST00000254977.3_Silent_p.V392V|BTBD3_ENST00000378226.2_Silent_p.V453V|BTBD3_ENST00000399006.2_Silent_p.V392V	NM_001282550.1|NM_001282552.1|NM_001282554.1	NP_001269479.1|NP_001269481.1|NP_001269483.1	Q9Y2F9	BTBD3_HUMAN	BTB (POZ) domain containing 3	453					cerebral cortex development (GO:0021987)|dendrite morphogenesis (GO:0048813)	cytosol (GO:0005829)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(18)|ovary(3)|skin(2)	34						CCTTTCCCGTATGGTTTGAAT	0.493																																						dbGAP											0													121.0	113.0	116.0					20																	11904104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023169	CCDS13113.1, CCDS13114.1	20p12.2	2013-01-08			ENSG00000132640	ENSG00000132640		"""BTB/POZ domain containing"""	15854	protein-coding gene	gene with protein product		615566					Standard	NM_001282551		Approved	KIAA0952, dJ742J24.1	uc002wnz.3	Q9Y2F9	OTTHUMG00000031889	ENST00000405977.1:c.1359A>G	20.37:g.11904104A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW19|Q5JY73	Silent	SNP	pfam_PHR,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.V453	ENST00000405977.1	37	c.1359	CCDS13113.1	20																																																																																			BTBD3	-	pfam_PHR	ENSG00000132640		0.493	BTBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD3	HGNC	protein_coding	OTTHUMT00000078021.3	81	0.00	0	A			11904104	11904104	+1	no_errors	ENST00000378226	ensembl	human	known	69_37n	silent	42	44.00	33	SNP	1.000	G
CHIA	27159	genome.wustl.edu	37	1	111857167	111857167	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr1:111857167G>A	ENST00000369740.1	+	5	366	c.263G>A	c.(262-264)aGc>aAc	p.S88N	CHIA_ENST00000343320.6_Missense_Mutation_p.S88N|CHIA_ENST00000483391.1_5'UTR|CHIA_ENST00000430615.1_5'UTR|CHIA_ENST00000451398.2_5'UTR|CHIA_ENST00000353665.6_5'UTR	NM_001258001.1|NM_201653.3	NP_001244930.1|NP_970615.2	Q9BZP6	CHIA_HUMAN	chitinase, acidic	88					apoptotic process (GO:0006915)|cell wall chitin metabolic process (GO:0006037)|chitin catabolic process (GO:0006032)|chitin metabolic process (GO:0006030)|digestion (GO:0007586)|immune response (GO:0006955)|polysaccharide catabolic process (GO:0000272)|positive regulation of chemokine secretion (GO:0090197)|production of molecular mediator involved in inflammatory response (GO:0002532)|response to fungus (GO:0009620)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|chitinase activity (GO:0004568)|kinase binding (GO:0019900)|lysozyme activity (GO:0003796)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		all_cancers(81;3.23e-05)|all_epithelial(167;1.2e-05)|all_lung(203;0.000154)|Lung NSC(277;0.000304)		Colorectal(144;0.0115)|Lung(183;0.0292)|COAD - Colon adenocarcinoma(174;0.0314)|all cancers(265;0.0477)|Epithelial(280;0.0918)|LUSC - Lung squamous cell carcinoma(189;0.154)		TACAGGAACAGCCAGCTGAAA	0.423																																						dbGAP											0													111.0	110.0	110.0					1																	111857167		1859	4098	5957	-	-	-	SO:0001583	missense	0			AF290004	CCDS832.1, CCDS41368.1, CCDS58017.1	1p13.2	2008-05-14			ENSG00000134216	ENSG00000134216			17432	protein-coding gene	gene with protein product		606080				11085997	Standard	NM_021797		Approved	AMCase, TSA1902, CHIT2	uc001eas.4	Q9BZP6	OTTHUMG00000011165	ENST00000369740.1:c.263G>A	1.37:g.111857167G>A	ENSP00000358755:p.Ser88Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32W79|Q32W80|Q3B866|Q5U5Z5|Q5VUV4|Q86UD8|Q9ULY3|Q9ULY4	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,pfam_Chitin-bd_dom,superfamily_Glycoside_hydrolase_SF,superfamily_Chitin-bd_dom,smart_Chitinase_II,smart_Chitin-bd_dom,pfscan_Chitin-bd_dom	p.S88N	ENST00000369740.1	37	c.263	CCDS41368.1	1	.	.	.	.	.	.	.	.	.	.	G	6.192	0.403583	0.11754	.	.	ENSG00000134216	ENST00000422815;ENST00000369740;ENST00000343320	T;T;T	0.05649	3.41;3.41;3.41	4.56	0.283	0.15696	Chitinase II (1);Glycoside hydrolase, family 18, catalytic domain (1);Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.415688	0.21392	U	0.075287	T	0.01905	0.0060	L	0.54323	1.7	0.23940	N	0.996403	B	0.02656	0.0	B	0.06405	0.002	T	0.41088	-0.9528	10	0.49607	T	0.09	-2.9566	4.5132	0.11921	0.2769:0.0:0.5613:0.1618	.	88	Q9BZP6	CHIA_HUMAN	N	32;88;88	ENSP00000387671:S32N;ENSP00000358755:S88N;ENSP00000341828:S88N	ENSP00000341828:S88N	S	+	2	0	CHIA	111658690	0.000000	0.05858	0.247000	0.24249	0.321000	0.28281	0.334000	0.19787	0.084000	0.17077	0.462000	0.41574	AGC	CHIA	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000134216		0.423	CHIA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIA	HGNC	protein_coding	OTTHUMT00000030710.1	86	0.00	0	G			111857167	111857167	+1	no_errors	ENST00000343320	ensembl	human	known	69_37n	missense	31	43.64	24	SNP	0.019	A
CPSF3	51692	genome.wustl.edu	37	2	9597078	9597078	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr2:9597078A>C	ENST00000238112.3	+	14	1826	c.1620A>C	c.(1618-1620)ttA>ttC	p.L540F	CPSF3_ENST00000460593.1_Missense_Mutation_p.L503F	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	540					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		TGGAAGAATTAGAAATTCAAG	0.318																																					Colon(194;1259 2048 3845 5218 19985)	dbGAP											0													46.0	51.0	49.0					2																	9597078		2203	4291	6494	-	-	-	SO:0001583	missense	0			AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.1620A>C	2.37:g.9597078A>C	ENSP00000238112:p.Leu540Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	pfam_CPSF73-100_C,pfam_Beta_Casp,pfam_Beta-lactamas-like,pfam_RMMBL,smart_Beta-lactamas-like	p.L540F	ENST00000238112.3	37	c.1620	CCDS1664.1	2	.	.	.	.	.	.	.	.	.	.	A	11.54	1.668161	0.29604	.	.	ENSG00000119203	ENST00000238112;ENST00000540142;ENST00000427001;ENST00000460593	T;T	0.51325	0.71;0.71	5.77	3.28	0.37604	-end-processing endonuclease polyadenylation factor C-term (1);Pre-mRNA 3&apos (1);	0.365309	0.26086	N	0.026425	T	0.32615	0.0835	L	0.40543	1.245	0.47009	D	0.999285	B;B	0.06786	0.0;0.001	B;B	0.15484	0.003;0.013	T	0.08371	-1.0725	10	0.13108	T	0.6	-22.0748	7.9298	0.29895	0.6604:0.1177:0.0:0.2219	.	491;540	E7ER23;Q9UKF6	.;CPSF3_HUMAN	F	540;262;491;503	ENSP00000238112:L540F;ENSP00000418957:L503F	ENSP00000238112:L540F	L	+	3	2	CPSF3	9514529	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.715000	0.37971	2.207000	0.71202	0.528000	0.53228	TTA	CPSF3	-	pfam_CPSF73-100_C	ENSG00000119203		0.318	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3	HGNC	protein_coding	OTTHUMT00000206843.1	25	0.00	0	A	NM_016207		9597078	9597078	+1	no_errors	ENST00000238112	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	1.000	C
CYTIP	9595	genome.wustl.edu	37	2	158300389	158300389	+	Silent	SNP	C	C	T	rs112794298		TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr2:158300389C>T	ENST00000264192.3	-	1	265	c.144G>A	c.(142-144)acG>acA	p.T48T	AC019201.1_ENST00000401235.1_RNA|CYTIP_ENST00000540637.1_Intron|CYTIP_ENST00000497432.1_Intron	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	48					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						GAGTAGCCACCGTGTCTGCTA	0.498																																						dbGAP											0													168.0	143.0	152.0					2																	158300389		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.144G>A	2.37:g.158300389C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWH9|Q15630|Q8NE32	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T48	ENST00000264192.3	37	c.144	CCDS2204.1	2																																																																																			CYTIP	-	superfamily_PDZ	ENSG00000115165		0.498	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTIP	HGNC	protein_coding	OTTHUMT00000254926.1	120	0.83	1	C	NM_004288		158300389	158300389	-1	no_errors	ENST00000264192	ensembl	human	known	69_37n	silent	64	18.99	15	SNP	0.011	T
EML5	161436	genome.wustl.edu	37	14	89205341	89205341	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr14:89205341C>T	ENST00000380664.5	-	6	728	c.729G>A	c.(727-729)atG>atA	p.M243I	EML5_ENST00000554922.1_Missense_Mutation_p.M243I|EML5_ENST00000352093.5_Missense_Mutation_p.M243I			Q05BV3	EMAL5_HUMAN	echinoderm microtubule associated protein like 5	243						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	catalytic activity (GO:0003824)			breast(1)|endometrium(3)|kidney(4)|large_intestine(17)|lung(14)|ovary(3)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	50						CACAAGCATTCATGCTAAAAA	0.333																																						dbGAP											0													56.0	49.0	51.0					14																	89205341		1850	4085	5935	-	-	-	SO:0001583	missense	0			AY357725	CCDS45148.1	14q31.3	2013-01-10				ENSG00000165521		"""WD repeat domain containing"""	18197	protein-coding gene	gene with protein product							Standard	NM_183387		Approved	HuEMAP-2, EMAP-2	uc021ryf.1	Q05BV3		ENST00000380664.5:c.729G>A	14.37:g.89205341C>T	ENSP00000370039:p.Met243Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EK59|Q5H9N6|Q6UYC9|Q6ZRP3|Q6ZT03	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_HELP,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M243I	ENST00000380664.5	37	c.729	CCDS45148.1	14	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433683	0.43224	.	.	ENSG00000165521	ENST00000554922;ENST00000352093;ENST00000380664	T;T;T	0.01139	5.28;5.28;5.28	5.23	5.23	0.72850	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.01558	0.0050	N	0.11651	0.15	0.53688	D	0.999977	P	0.36837	0.571	P	0.46208	0.507	T	0.79075	-0.1952	10	0.15952	T	0.53	-18.6145	18.8023	0.92023	0.0:1.0:0.0:0.0	.	243	Q05BV3	EMAL5_HUMAN	I	243	ENSP00000451998:M243I;ENSP00000298315:M243I;ENSP00000370039:M243I	ENSP00000298315:M243I	M	-	3	0	EML5	88275094	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.487000	0.81328	2.437000	0.82529	0.555000	0.69702	ATG	EML5	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000165521		0.333	EML5-010	KNOWN	basic|CCDS	protein_coding	EML5	HGNC	protein_coding	OTTHUMT00000410491.1	22	0.00	0	C			89205341	89205341	-1	no_errors	ENST00000554922	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	1.000	T
EXPH5	23086	genome.wustl.edu	37	11	108380596	108380596	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr11:108380596T>C	ENST00000265843.4	-	6	5748	c.5638A>G	c.(5638-5640)Ata>Gta	p.I1880V	EXPH5_ENST00000428840.1_Missense_Mutation_p.I1804V|EXPH5_ENST00000525344.1_Missense_Mutation_p.I1873V|EXPH5_ENST00000443411.1_Missense_Mutation_p.I1692V	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	1880					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		GGTCTGTATATAGATATTGCA	0.413																																						dbGAP											0													64.0	67.0	66.0					11																	108380596		2201	4298	6499	-	-	-	SO:0001583	missense	0				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.5638A>G	11.37:g.108380596T>C	ENSP00000265843:p.Ile1880Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.I1880V	ENST00000265843.4	37	c.5638	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	T	12.15	1.851600	0.32699	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956	T;T;T;T	0.04194	3.91;3.83;3.68;3.91	6.17	5.05	0.67936	.	0.165270	0.41938	N	0.000789	T	0.17023	0.0409	M	0.71581	2.175	0.22171	N	0.999313	D	0.64830	0.994	D	0.79108	0.992	T	0.06991	-1.0796	10	0.44086	T	0.13	-17.3113	8.5064	0.33190	0.0:0.1846:0.0:0.8154	.	1880	Q8NEV8	EXPH5_HUMAN	V	1880;1804;1692;1873;710	ENSP00000265843:I1880V;ENSP00000391966:I1804V;ENSP00000411390:I1692V;ENSP00000432546:I1873V	ENSP00000265843:I1880V	I	-	1	0	EXPH5	107885806	1.000000	0.71417	0.388000	0.26195	0.016000	0.09150	3.940000	0.56599	1.153000	0.42468	-0.264000	0.10439	ATA	EXPH5	-	NULL	ENSG00000110723		0.413	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1	30	0.00	0	T	NM_015065		108380596	108380596	-1	no_errors	ENST00000265843	ensembl	human	known	69_37n	missense	13	48.00	12	SNP	0.614	C
FAM208A	23272	genome.wustl.edu	37	3	56667431	56667431	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr3:56667431T>G	ENST00000493960.2	-	18	3398	c.3388A>C	c.(3388-3390)Aat>Cat	p.N1130H	FAM208A_ENST00000355628.5_Missense_Mutation_p.N1069H|FAM208A_ENST00000431842.2_Missense_Mutation_p.N693H	NM_001112736.1	NP_001106207.1	Q9UK61	F208A_HUMAN	family with sequence similarity 208, member A	1130							poly(A) RNA binding (GO:0044822)			NS(1)|breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(11)|prostate(3)|skin(1)	32						AGATGTTTATTGTTGAAGTCA	0.433																																						dbGAP											0													139.0	133.0	135.0					3																	56667431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF180425	CCDS2877.1, CCDS46853.1	3p14.3	2011-09-14	2011-09-14	2011-09-14	ENSG00000163946	ENSG00000163946			30314	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 63"""	C3orf63		10470851, 11149944	Standard	NM_015224		Approved	se89-1, RAP140, KIAA1105	uc003die.4	Q9UK61	OTTHUMG00000158827	ENST00000493960.2:c.3388A>C	3.37:g.56667431T>G	ENSP00000417509:p.Asn1130His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A4|B5ME28|Q9H2F7|Q9UPP7	Missense_Mutation	SNP	pfam_DUF3715	p.N1069H	ENST00000493960.2	37	c.3205	CCDS46853.1	3	.	.	.	.	.	.	.	.	.	.	T	2.012	-0.426784	0.04701	.	.	ENSG00000163946	ENST00000431842;ENST00000493960;ENST00000355628	T;T;T	0.11712	2.75;2.94;2.94	5.57	4.37	0.52481	.	1.043360	0.07461	N	0.900731	T	0.09158	0.0226	L	0.34521	1.04	0.09310	N	1	P;P;P;P	0.44309	0.526;0.643;0.654;0.832	B;B;B;B	0.40101	0.319;0.179;0.296;0.17	T	0.17107	-1.0380	10	0.13108	T	0.6	-0.2561	7.9471	0.29993	0.0:0.0701:0.1363:0.7935	.	1130;1069;693;1130	Q9UK61-3;Q9UK61-4;Q9UK61-2;Q9UK61	.;.;.;F208A_HUMAN	H	693;1130;1069	ENSP00000399410:N693H;ENSP00000417509:N1130H;ENSP00000347845:N1069H	ENSP00000347845:N1069H	N	-	1	0	C3orf63	56642471	0.157000	0.22836	0.094000	0.20943	0.466000	0.32739	0.668000	0.25127	0.998000	0.38996	0.528000	0.53228	AAT	FAM208A	-	NULL	ENSG00000163946		0.433	FAM208A-004	PUTATIVE	basic|appris_principal|CCDS	protein_coding	FAM208A	HGNC	protein_coding	OTTHUMT00000352352.2	32	0.00	0	T	NM_015224		56667431	56667431	-1	no_errors	ENST00000355628	ensembl	human	known	69_37n	missense	42	31.15	19	SNP	0.210	G
FAM57A	79850	genome.wustl.edu	37	17	644619	644619	+	Missense_Mutation	SNP	C	C	T	rs375216921		TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr17:644619C>T	ENST00000308278.8	+	5	819	c.583C>T	c.(583-585)Ctc>Ttc	p.L195F	FAM57A_ENST00000301324.8_Missense_Mutation_p.L163F	NM_024792.1	NP_079068.1	Q8TBR7	FA57A_HUMAN	family with sequence similarity 57, member A	195	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|urinary_tract(2)	10				UCEC - Uterine corpus endometrioid carcinoma (25;0.0217)		CCGGATCCTTCTCTTCCCCTT	0.532																																						dbGAP											0													154.0	130.0	138.0					17																	644619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK025935	CCDS10996.1	17p13.3	2014-08-14				ENSG00000167695			29646	protein-coding gene	gene with protein product		611627				12270127	Standard	NM_024792		Approved	FLJ22282, CT120	uc002frp.3	Q8TBR7		ENST00000308278.8:c.583C>T	17.37:g.644619C>T	ENSP00000312017:p.Leu195Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7Q0|Q7Z464|Q96D97|Q9H6H3	Missense_Mutation	SNP	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	p.L195F	ENST00000308278.8	37	c.583	CCDS10996.1	17	.	.	.	.	.	.	.	.	.	.	C	16.36	3.102630	0.56183	.	.	ENSG00000167695	ENST00000308278;ENST00000301324;ENST00000451373	D;D	0.87256	-2.23;-2.23	5.96	3.92	0.45320	TRAM/LAG1/CLN8 homology domain (3);	0.056975	0.64402	D	0.000001	D	0.88220	0.6378	M	0.86651	2.83	0.43977	D	0.996667	B;B	0.27140	0.169;0.12	B;B	0.29663	0.064;0.105	D	0.88049	0.2786	10	0.72032	D	0.01	-16.5001	11.4015	0.49873	0.0:0.8063:0.1255:0.0682	.	163;195	Q8TBR7-1;Q8TBR7	.;FA57A_HUMAN	F	195;163;268	ENSP00000312017:L195F;ENSP00000301324:L163F	ENSP00000301324:L163F	L	+	1	0	FAM57A	591369	0.646000	0.27295	0.748000	0.31131	0.637000	0.38172	1.190000	0.32126	1.535000	0.49220	-0.150000	0.13652	CTC	FAM57A	-	pfam_TLC-dom,smart_TLC-dom,pfscan_TLC-dom	ENSG00000167695		0.532	FAM57A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM57A	HGNC	protein_coding	OTTHUMT00000437155.2	121	0.00	0	C	NM_024792		644619	644619	+1	no_errors	ENST00000308278	ensembl	human	known	69_37n	missense	47	22.95	14	SNP	0.678	T
FBXL18	80028	genome.wustl.edu	37	7	5541277	5541277	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr7:5541277C>T	ENST00000382368.3	-	3	746	c.623G>A	c.(622-624)cGc>cAc	p.R208H	FBXL18_ENST00000453700.3_Missense_Mutation_p.R208H	NM_024963.4	NP_079239.3	Q96ME1	FXL18_HUMAN	F-box and leucine-rich repeat protein 18	208									FBXL18/RNF216(2)	central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)	21		Ovarian(82;0.0607)		UCEC - Uterine corpus endometrioid carcinoma (126;0.181)|OV - Ovarian serous cystadenocarcinoma(56;3.64e-13)		GGCGCCCTCGCGCGTGCGGTC	0.647																																						dbGAP											0													24.0	29.0	27.0					7																	5541277		2051	4206	6257	-	-	-	SO:0001583	missense	0			AK057042	CCDS43546.1	7p22.2	2011-06-09			ENSG00000155034	ENSG00000155034		"""F-boxes / Leucine-rich repeats"""	21874	protein-coding gene	gene with protein product		609084					Standard	NM_024963		Approved	FLJ11467, Fbl18	uc003son.4	Q96ME1	OTTHUMG00000151832	ENST00000382368.3:c.623G>A	7.37:g.5541277C>T	ENSP00000371805:p.Arg208His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BR90|Q9BTC7|Q9HAK7	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.R208H	ENST00000382368.3	37	c.623	CCDS43546.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.71|18.71	3.682105|3.682105	0.68042|0.68042	.|.	.|.	ENSG00000155034|ENSG00000155034	ENST00000458142|ENST00000382368;ENST00000312577;ENST00000453700	.|T;T	.|0.56275	.|0.51;0.47	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.050391	.|0.85682	.|D	.|0.000000	T|T	0.59555|0.59555	0.2202|0.2202	N|N	0.24115|0.24115	0.695|0.695	0.53688|0.53688	D|D	0.999976|0.999976	.|D;D	.|0.89917	.|1.0;1.0	.|D;D	.|0.69824	.|0.966;0.966	T|T	0.57004|0.57004	-0.7885|-0.7885	5|10	.|0.30854	.|T	.|0.27	.|.	18.1629|18.1629	0.89716|0.89716	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|208;208	.|F5H4Z4;Q96ME1-4	.|.;.	T|H	92|208	.|ENSP00000371805:R208H;ENSP00000444797:R208H	.|ENSP00000311990:R208H	A|R	-|-	1|2	0|0	FBXL18|FBXL18	5507803|5507803	0.998000|0.998000	0.40836|0.40836	0.109000|0.109000	0.21407|0.21407	0.852000|0.852000	0.48524|0.48524	4.034000|4.034000	0.57289|0.57289	2.528000|2.528000	0.85240|0.85240	0.655000|0.655000	0.94253|0.94253	GCG|CGC	FBXL18	-	NULL	ENSG00000155034		0.647	FBXL18-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL18	HGNC	protein_coding	OTTHUMT00000324093.1	12	0.00	0	C	NM_024963		5541277	5541277	-1	no_errors	ENST00000453700	ensembl	human	known	69_37n	missense	15	44.44	12	SNP	0.938	T
FBXL7	23194	genome.wustl.edu	37	5	15936967	15936967	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr5:15936967C>T	ENST00000504595.1	+	4	1629	c.1148C>T	c.(1147-1149)gCg>gTg	p.A383V	MIR887_ENST00000401258.1_RNA|FBXL7_ENST00000510662.1_Missense_Mutation_p.A336V|FBXL7_ENST00000329673.7_Missense_Mutation_p.A371V	NM_001278317.1|NM_012304.3	NP_001265246.1|NP_036436.1	Q9UJT9	FBXL7_HUMAN	F-box and leucine-rich repeat protein 7	383					cell proliferation (GO:0008283)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|ubiquitin-dependent protein catabolic process (GO:0006511)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(13)|lung(33)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	60						TACCTCAACGCGAGGGGCTGC	0.622																																						dbGAP											0													65.0	72.0	70.0					5																	15936967		2178	4267	6445	-	-	-	SO:0001583	missense	0			AB020647	CCDS54833.1, CCDS64129.1	5p15.1	2011-06-09				ENSG00000183580		"""F-boxes / Leucine-rich repeats"""	13604	protein-coding gene	gene with protein product		605656				10048485, 10531035	Standard	NM_012304		Approved	KIAA0840, FBL7, FBL6	uc003jfn.1	Q9UJT9		ENST00000504595.1:c.1148C>T	5.37:g.15936967C>T	ENSP00000423630:p.Ala383Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGF1|D6RDY7|O94926	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.A383V	ENST00000504595.1	37	c.1148	CCDS54833.1	5	.	.	.	.	.	.	.	.	.	.	C	17.20	3.328079	0.60743	.	.	ENSG00000183580	ENST00000504595;ENST00000510662;ENST00000329673	T;T;T	0.50548	0.74;0.74;0.74	5.37	5.37	0.77165	.	0.000000	0.85682	D	0.000000	T	0.24005	0.0581	N	0.03209	-0.39	0.80722	D	1	P	0.49696	0.927	B	0.35039	0.194	T	0.14448	-1.0472	10	0.26408	T	0.33	.	19.109	0.93309	0.0:1.0:0.0:0.0	.	383	Q9UJT9	FBXL7_HUMAN	V	383;336;371	ENSP00000423630:A383V;ENSP00000425184:A336V;ENSP00000329632:A371V	ENSP00000329632:A371V	A	+	2	0	FBXL7	15989967	1.000000	0.71417	0.992000	0.48379	0.868000	0.49771	7.625000	0.83145	2.525000	0.85131	0.655000	0.94253	GCG	FBXL7	-	smart_Leu-rich_rpt_Cys-con_subtyp	ENSG00000183580		0.622	FBXL7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL7	HGNC	protein_coding	OTTHUMT00000366117.1	27	0.00	0	C	NM_012304		15936967	15936967	+1	no_errors	ENST00000504595	ensembl	human	known	69_37n	missense	26	23.53	8	SNP	1.000	T
GGT3P	2679	genome.wustl.edu	37	22	18769678	18769678	+	RNA	SNP	G	G	A	rs3894040	byFrequency	TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr22:18769678G>A	ENST00000412448.1	-	0	1000							A6NGU5	GGT3_HUMAN	gamma-glutamyltransferase 3 pseudogene						glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)										GCTCGATGACGGTCCGCTTGT	0.672																																						dbGAP											0																																										-	-	-			0					22q11.21	2008-08-05	2008-03-10	2008-03-10	ENSG00000197421	ENSG00000197421		"""Gamma-glutamyltransferases"""	4252	pseudogene	pseudogene			"""gamma-glutamyltransferase 3"""	GGT3		8104871, 18357469	Standard	NR_003267		Approved		uc002zob.1	A6NGU5	OTTHUMG00000150161		22.37:g.18769678G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000412448.1	37	NULL		22																																																																																			GGT3P	-	-	ENSG00000197421		0.672	GGT3P-002	KNOWN	basic	processed_transcript	GGT3P	HGNC	pseudogene	OTTHUMT00000341281.1	41	0.00	0	G	NR_003267		18769678	18769678	-1	no_errors	ENST00000412448	ensembl	human	known	69_37n	rna	35	12.50	5	SNP	0.000	A
GRIN2B	2904	genome.wustl.edu	37	12	13716419	13716419	+	Silent	SNP	C	C	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr12:13716419C>G	ENST00000609686.1	-	13	3962	c.3753G>C	c.(3751-3753)ctG>ctC	p.L1251L		NM_000834.3	NP_000825.2	Q13224	NMDE2_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2B	1251					behavioral fear response (GO:0001662)|behavioral response to pain (GO:0048266)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|glutamate receptor signaling pathway (GO:0007215)|in utero embryonic development (GO:0001701)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning (GO:0007612)|learning or memory (GO:0007611)|memory (GO:0007613)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic plasticity (GO:0048167)|response to ethanol (GO:0045471)|sensory organ development (GO:0007423)|startle response (GO:0001964)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(5)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(12)|liver(1)|lung(70)|ovary(4)|prostate(6)|skin(10)|upper_aerodigestive_tract(5)|urinary_tract(1)	143					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Haloperidol(DB00502)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TGATGTCATACAGGTTGCCTG	0.607																																						dbGAP											0													85.0	87.0	86.0					12																	13716419		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS8662.1	12p13.1	2014-07-16			ENSG00000273079			"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4586	protein-coding gene	gene with protein product		138252		NMDAR2B		1350383	Standard	NM_000834		Approved	GluN2B	uc001rbt.2	Q13224	OTTHUMG00000137373	ENST00000609686.1:c.3753G>C	12.37:g.13716419C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q12919|Q13220|Q13225|Q14CU4|Q9UM56	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L1251	ENST00000609686.1	37	c.3753	CCDS8662.1	12																																																																																			GRIN2B	-	pfam_NMDAR2_C	ENSG00000150086		0.607	GRIN2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2B	HGNC	protein_coding	OTTHUMT00000268014.2	113	0.00	0	C			13716419	13716419	-1	no_errors	ENST00000279593	ensembl	human	known	69_37n	silent	63	24.10	20	SNP	1.000	G
HAUS7	55559	genome.wustl.edu	37	X	152728092	152728092	+	Silent	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chrX:152728092C>T	ENST00000370211.4	-	4	403	c.360G>A	c.(358-360)gcG>gcA	p.A120A	TREX2_ENST00000370232.1_5'UTR|HAUS7_ENST00000421080.2_5'UTR|HAUS7_ENST00000370210.1_Silent_p.A110A|TREX2_ENST00000338525.2_5'UTR|TREX2_ENST00000330912.2_5'UTR|HAUS7_ENST00000370212.3_Silent_p.A120A|TREX2_ENST00000334497.2_5'UTR	NM_017518.7	NP_059988.3	Q99871	HAUS7_HUMAN	HAUS augmin-like complex, subunit 7	120					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|HAUS complex (GO:0070652)|microtubule (GO:0005874)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	thioesterase binding (GO:0031996)			endometrium(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|skin(3)	19						GGTCATCTGGCGCACACAGCA	0.597																																						dbGAP											0													92.0	67.0	76.0					X																	152728092		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF267739	CCDS35438.1	Xq28	2011-10-24	2009-04-20	2009-04-20		ENSG00000213397		"""HAUS augmin-like complex subunits"""	32979	protein-coding gene	gene with protein product	"""UCH37 interacting protein 1"", ""26S proteasome-associated UCH interacting protein 1"""	300540	"""UCHL5 interacting protein"""	UCHL5IP		11163772, 16395595, 19427217	Standard	NM_017518		Approved	UIP1	uc004fho.2	Q99871		ENST00000370211.4:c.360G>A	X.37:g.152728092C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUH6|D3DWT9|Q96HS8|Q9NP54|Q9UFH9	Silent	SNP	NULL	p.A120	ENST00000370211.4	37	c.360	CCDS35438.1	X																																																																																			HAUS7	-	NULL	ENSG00000213397		0.597	HAUS7-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	HAUS7	HGNC	protein_coding	OTTHUMT00000060963.2	68	0.00	0	C	NM_017518		152728092	152728092	-1	no_errors	ENST00000370212	ensembl	human	known	69_37n	silent	47	24.19	15	SNP	0.004	T
ICA1L	130026	genome.wustl.edu	37	2	203653623	203653623	+	Silent	SNP	G	G	A	rs180939445		TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr2:203653623G>A	ENST00000392237.2	-	12	1330	c.1173C>T	c.(1171-1173)ctC>ctT	p.L391L	ICA1L_ENST00000358299.2_Silent_p.L391L	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	391										breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						AAGAATGAGCGAGGGGCTCAG	0.493													G|||	1	0.000199681	0.0	0.0	5008	,	,		18546	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													74.0	74.0	74.0					2																	203653623		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.1173C>T	2.37:g.203653623G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Silent	SNP	pfam_Islet_autoAg_Ica1_C,pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	p.L391	ENST00000392237.2	37	c.1173	CCDS2354.1	2																																																																																			ICA1L	-	pfam_Islet_autoAg_Ica1_C	ENSG00000163596		0.493	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICA1L	HGNC	protein_coding	OTTHUMT00000256330.1	32	0.00	0	G	NM_138468		203653623	203653623	-1	no_errors	ENST00000358299	ensembl	human	known	69_37n	silent	22	51.11	23	SNP	0.870	A
KIF5A	3798	genome.wustl.edu	37	12	57966441	57966441	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr12:57966441G>T	ENST00000455537.2	+	15	1922	c.1648G>T	c.(1648-1650)Gtg>Ttg	p.V550L	KIF5A_ENST00000286452.5_Missense_Mutation_p.V461L	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	550					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						AATTGCTGAGGTGCTGAACGG	0.572																																						dbGAP											0													194.0	159.0	171.0					12																	57966441		2203	4300	6503	-	-	-	SO:0001583	missense	0			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.1648G>T	12.37:g.57966441G>T	ENSP00000408979:p.Val550Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8M5|Q4LE26	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.V550L	ENST00000455537.2	37	c.1648	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	G	10.98	1.504008	0.26949	.	.	ENSG00000155980	ENST00000455537;ENST00000286452	T;T	0.77358	-1.09;-1.09	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.68146	0.2969	L	0.31207	0.915	0.58432	D	0.999996	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.002	T	0.61691	-0.7011	10	0.16420	T	0.52	.	18.4695	0.90767	0.0:0.0:1.0:0.0	.	461;550	B7Z2M7;Q12840	.;KIF5A_HUMAN	L	550;461	ENSP00000408979:V550L;ENSP00000286452:V461L	ENSP00000286452:V461L	V	+	1	0	KIF5A	56252708	1.000000	0.71417	1.000000	0.80357	0.103000	0.19146	1.199000	0.32235	2.746000	0.94184	0.655000	0.94253	GTG	KIF5A	-	NULL	ENSG00000155980		0.572	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	HGNC	protein_coding	OTTHUMT00000407634.1	194	0.00	0	G	NM_004984		57966441	57966441	+1	no_errors	ENST00000455537	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	T
LINGO2	158038	genome.wustl.edu	37	9	27949804	27949804	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr9:27949804T>G	ENST00000379992.2	-	6	1315	c.866A>C	c.(865-867)gAa>gCa	p.E289A	LINGO2_ENST00000308675.3_Missense_Mutation_p.E289A	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	289						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		CATGCCTGCTTCAATAGTGCT	0.517																																						dbGAP											0													179.0	169.0	173.0					9																	27949804		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.866A>C	9.37:g.27949804T>G	ENSP00000369328:p.Glu289Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E289A	ENST00000379992.2	37	c.866	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	T	11.00	1.509358	0.27036	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.79653	-1.29;-1.29	6.17	5.04	0.67666	.	0.050110	0.85682	D	0.000000	T	0.66790	0.2825	N	0.16903	0.455	0.80722	D	1	B	0.14438	0.01	B	0.21708	0.036	T	0.58923	-0.7550	9	.	.	.	.	12.34	0.55089	0.0:0.0653:0.0:0.9347	.	289	Q7L985	LIGO2_HUMAN	A	289	ENSP00000369328:E289A;ENSP00000310126:E289A	.	E	-	2	0	LINGO2	27939804	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.287000	0.72671	1.156000	0.42514	-0.256000	0.11100	GAA	LINGO2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000174482		0.517	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	99	1.00	1	T	NM_152570		27949804	27949804	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	missense	60	25.00	20	SNP	1.000	G
MBD5	55777	genome.wustl.edu	37	2	149227717	149227717	+	Silent	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr2:149227717C>T	ENST00000407073.1	+	9	3202	c.2205C>T	c.(2203-2205)aaC>aaT	p.N735N	MBD5_ENST00000404807.1_Silent_p.N735N	NM_018328.4	NP_060798.2	Q9P267	MBD5_HUMAN	methyl-CpG binding domain protein 5	735					glucose homeostasis (GO:0042593)|nervous system development (GO:0007399)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|regulation of multicellular organism growth (GO:0040014)|single-organism behavior (GO:0044708)	chromocenter (GO:0010369)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(1)|large_intestine(16)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	62				BRCA - Breast invasive adenocarcinoma(221;0.0569)		GCTCTGCTAACCAGCTGCATT	0.458																																						dbGAP											0													98.0	96.0	97.0					2																	149227717		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040894	CCDS33302.1	2q23.2	2009-04-17			ENSG00000204406	ENSG00000204406			20444	protein-coding gene	gene with protein product		611472				12529184	Standard	NM_018328		Approved	FLJ11113, KIAA1461	uc002twm.4	Q9P267	OTTHUMG00000150440	ENST00000407073.1:c.2205C>T	2.37:g.149227717C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5HMQ4|A7E2B1|Q53SR1|Q9NUV6	Missense_Mutation	SNP	NULL	p.T475I	ENST00000407073.1	37	c.1424	CCDS33302.1	2	.	.	.	.	.	.	.	.	.	.	C	1.955	-0.440277	0.04636	.	.	ENSG00000204406	ENST00000416015	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	T	0.72293	0.3442	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70450	-0.4868	4	.	.	.	-5.9945	16.9333	0.86196	0.0:1.0:0.0:0.0	.	.	.	.	I	475	.	.	T	+	2	0	MBD5	148944187	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	1.885000	0.39678	2.746000	0.94184	0.655000	0.94253	ACC	MBD5	-	NULL	ENSG00000204406		0.458	MBD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD5	HGNC	protein_coding	OTTHUMT00000318111.2	35	0.00	0	C			149227717	149227717	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416015	ensembl	human	novel	69_37n	missense	44	40.54	30	SNP	1.000	T
MIA3	375056	genome.wustl.edu	37	1	222828136	222828136	+	Splice_Site	SNP	G	G	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr1:222828136G>C	ENST00000344922.5	+	18	4632		c.e18+1		MIA3_ENST00000344507.1_Intron|MIA3_ENST00000344441.6_Splice_Site|MIA3_ENST00000340535.7_Splice_Site	NM_198551.2	NP_940953.2	Q5JRA6	MIA3_HUMAN	melanoma inhibitory activity family, member 3						chondrocyte development (GO:0002063)|collagen fibril organization (GO:0030199)|exocytosis (GO:0006887)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|positive regulation of bone mineralization (GO:0030501)|positive regulation of leukocyte migration (GO:0002687)|protein transport (GO:0015031)|wound healing (GO:0042060)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(5)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(15)|lung(37)|ovary(5)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|urinary_tract(1)	80				GBM - Glioblastoma multiforme(131;0.0199)		CTTTGCAAAAGTAAGATTATC	0.358																																						dbGAP											0													91.0	85.0	87.0					1																	222828136		1912	4133	6045	-	-	-	SO:0001630	splice_region_variant	0				CCDS41470.1, CCDS73035.1	1p36.33	2012-12-13		2006-07-25	ENSG00000154305	ENSG00000154305			24008	protein-coding gene	gene with protein product	"""C219 reactive peptide"", ""transport and golgi organization"""	613455				15183315	Standard	XM_005273121		Approved	UNQ6077, FLJ39207, KIAA0268, TANGO	uc001hnl.3	Q5JRA6	OTTHUMG00000037543	ENST00000344922.5:c.4607+1G>C	1.37:g.222828136G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2S0|A8MT05|A8MT13|B7Z430|Q14083|Q3S4X3|Q5JRA5|Q5JRB0|Q5JRB1|Q5JRB2|Q6UVY8|Q86Y60|Q8N8M5|Q92580	Splice_Site	SNP	-	e18+1	ENST00000344922.5	37	c.4607+1	CCDS41470.1	1	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779515	0.70107	.	.	ENSG00000154305	ENST00000344922;ENST00000344441;ENST00000320831;ENST00000340535;ENST00000284471	.	.	.	5.28	5.28	0.74379	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.2681	0.93997	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MIA3	220894759	1.000000	0.71417	0.995000	0.50966	0.805000	0.45488	7.791000	0.85805	2.622000	0.88805	0.655000	0.94253	.	MIA3	-	-	ENSG00000154305		0.358	MIA3-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MIA3	HGNC	protein_coding	OTTHUMT00000091489.4	54	0.00	0	G	NM_198551	Intron	222828136	222828136	+1	no_errors	ENST00000344441	ensembl	human	known	69_37n	splice_site	28	23.68	9	SNP	1.000	C
KMT2E	55904	genome.wustl.edu	37	7	104752417	104752417	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr7:104752417C>T	ENST00000311117.3	+	27	4759	c.4214C>T	c.(4213-4215)tCa>tTa	p.S1405L	KMT2E_ENST00000257745.4_Missense_Mutation_p.S1405L|KMT2E_ENST00000334914.7_Missense_Mutation_p.S460L|KMT2E_ENST00000334877.4_Missense_Mutation_p.S1363L|SRPK2_ENST00000493638.1_Intron	NM_182931.2	NP_891847.1	Q8IZD2	KMT2E_HUMAN	lysine (K)-specific methyltransferase 2E	1405					cell cycle arrest (GO:0007050)|cellular response to retinoic acid (GO:0071300)|DNA methylation (GO:0006306)|erythrocyte differentiation (GO:0030218)|histone H3-K4 methylation (GO:0051568)|neutrophil activation (GO:0042119)|neutrophil mediated immunity (GO:0002446)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription, DNA-templated (GO:0045893)|retinoic acid receptor signaling pathway (GO:0048384)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|MLL5-L complex (GO:0070688)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)										AAACAGCTATCAAATAACAAC	0.418																																						dbGAP											0													125.0	113.0	117.0					7																	104752417		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF067804	CCDS34723.1	7q22.1	2013-05-09	2013-05-09	2013-05-09	ENSG00000005483	ENSG00000005483		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	18541	protein-coding gene	gene with protein product		608444	"""myeloid/lymphoid or mixed-lineage leukemia 5 (trithorax homolog, Drosophila)"""	MLL5		9218106, 7672722	Standard	XM_005250493		Approved	HDCMC04P		Q8IZD2	OTTHUMG00000157403	ENST00000311117.3:c.4214C>T	7.37:g.104752417C>T	ENSP00000312379:p.Ser1405Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B6ZDE4|B6ZDM3|M4K8J3|Q6P5Y2|Q6PKG4|Q6T316|Q86TI3|Q86W12|Q86WG0|Q86WL2|Q8IV78|Q8IWR5|Q8NFF8|Q9NWE7	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_PHD-finger	p.S1405L	ENST00000311117.3	37	c.4214	CCDS34723.1	7	.	.	.	.	.	.	.	.	.	.	C	13.67	2.307719	0.40795	.	.	ENSG00000005483	ENST00000311117;ENST00000393656;ENST00000334877;ENST00000351043;ENST00000257745;ENST00000334914	D;D;D;T	0.91464	-2.85;-2.6;-2.85;0.87	5.22	3.28	0.37604	.	0.667219	0.13031	N	0.419353	D	0.82513	0.5053	N	0.19112	0.55	0.09310	N	0.999993	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.0	T	0.66626	-0.5876	10	0.25751	T	0.34	.	11.0102	0.47659	0.0:0.889:0.0:0.111	.	1325;1405	F8W6H1;Q8IZD2	.;MLL5_HUMAN	L	1405;1405;1363;1325;1405;460	ENSP00000312379:S1405L;ENSP00000335599:S1363L;ENSP00000257745:S1405L;ENSP00000333986:S460L	ENSP00000257745:S1405L	S	+	2	0	MLL5	104539653	0.887000	0.30362	0.001000	0.08648	0.958000	0.62258	1.980000	0.40618	0.472000	0.27344	0.650000	0.86243	TCA	MLL5	-	NULL	ENSG00000005483		0.418	KMT2E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL5	HGNC	protein_coding	OTTHUMT00000348697.1	51	0.00	0	C			104752417	104752417	+1	no_errors	ENST00000257745	ensembl	human	known	69_37n	missense	63	18.18	14	SNP	0.002	T
MYH8	4626	genome.wustl.edu	37	17	10312698	10312698	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr17:10312698T>C	ENST00000403437.2	-	16	1889	c.1795A>G	c.(1795-1797)Aaa>Gaa	p.K599E	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	599	Myosin motor.				ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						TCCTTATTTTTGTCCAGCCAG	0.502									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																													dbGAP											0													97.0	97.0	97.0					17																	10312698		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.1795A>G	17.37:g.10312698T>C	ENSP00000384330:p.Lys599Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K599E	ENST00000403437.2	37	c.1795	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	T	22.0	4.232195	0.79688	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	T	0.79454	-1.27	5.23	5.23	0.72850	Myosin head, motor domain (2);	0.000000	0.43747	U	0.000537	D	0.92971	0.7763	H	0.99391	4.545	0.58432	D	0.999995	D	0.63046	0.992	D	0.64877	0.93	D	0.95889	0.8905	10	0.87932	D	0	.	15.2836	0.73810	0.0:0.0:0.0:1.0	.	599	P13535	MYH8_HUMAN	E	599	ENSP00000384330:K599E	ENSP00000252173:K599E	K	-	1	0	MYH8	10253423	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	7.788000	0.85771	2.209000	0.71365	0.533000	0.62120	AAA	MYH8	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000133020		0.502	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	129	0.00	0	T	NM_002472		10312698	10312698	-1	no_errors	ENST00000403437	ensembl	human	known	69_37n	missense	75	17.58	16	SNP	1.000	C
MYO16	23026	genome.wustl.edu	37	13	109779790	109779790	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr13:109779790C>T	ENST00000357550.2	+	30	3918	c.3877C>T	c.(3877-3879)Cgg>Tgg	p.R1293W	MYO16_ENST00000356711.2_Missense_Mutation_p.R1293W|MYO16_ENST00000457511.2_Missense_Mutation_p.R805W	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			CCCGTCTCCACGGAAACAGCC	0.662																																						dbGAP											0													37.0	37.0	37.0					13																	109779790		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3877C>T	13.37:g.109779790C>T	ENSP00000350160:p.Arg1293Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1293W	ENST00000357550.2	37	c.3877	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	C	17.05	3.291070	0.59976	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	T;T;T	0.52057	0.68;0.68;0.68	5.5	2.73	0.32206	.	0.000000	0.37178	U	0.002219	T	0.67739	0.2925	M	0.79258	2.445	0.48087	D	0.999586	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68387	-0.5422	9	.	.	.	.	14.5596	0.68126	0.4782:0.5218:0.0:0.0	.	805;1293	F8W883;Q9Y6X6	.;MYO16_HUMAN	W	1293;1293;805	ENSP00000349145:R1293W;ENSP00000350160:R1293W;ENSP00000401633:R805W	.	R	+	1	2	MYO16	108577791	1.000000	0.71417	0.965000	0.40720	0.835000	0.47333	1.116000	0.31221	0.245000	0.21373	0.563000	0.77884	CGG	MYO16	-	NULL	ENSG00000041515		0.662	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	16	0.00	0	C	NM_015011		109779790	109779790	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	missense	14	33.33	7	SNP	0.997	T
MYO5A	4644	genome.wustl.edu	37	15	52667640	52667640	+	Missense_Mutation	SNP	C	C	T	rs561485938		TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr15:52667640C>T	ENST00000399231.3	-	20	2681	c.2438G>A	c.(2437-2439)cGc>cAc	p.R813H	MYO5A_ENST00000358212.6_Missense_Mutation_p.R813H|MYO5A_ENST00000553916.1_Missense_Mutation_p.R813H|MYO5A_ENST00000356338.6_Missense_Mutation_p.R813H|MYO5A_ENST00000399233.2_Missense_Mutation_p.R813H	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	813	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		CTTGGTTCTGCGCAGAAACTT	0.413													C|||	1	0.000199681	0.0	0.0	5008	,	,		16937	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													85.0	80.0	81.0					15																	52667640		1914	4122	6036	-	-	-	SO:0001583	missense	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.2438G>A	15.37:g.52667640C>T	ENSP00000382177:p.Arg813His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R813H	ENST00000399231.3	37	c.2438	CCDS42037.1	15	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407693	0.83340	.	.	ENSG00000197535	ENST00000399231;ENST00000399229;ENST00000399233;ENST00000356338;ENST00000358212;ENST00000546028;ENST00000553916	D;D;D;D;D	0.95853	-3.83;-3.83;-3.83;-3.83;-3.83	5.34	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.97420	0.9156	M	0.85197	2.74	0.58432	D	0.999999	D;D	0.76494	0.964;0.999	P;D	0.63113	0.815;0.911	D	0.97871	1.0286	10	0.87932	D	0	.	14.2355	0.65925	0.0:0.9276:0.0:0.0724	.	813;813	Q9Y4I1;Q9Y4I1-2	MYO5A_HUMAN;.	H	813;347;813;813;813;443;813	ENSP00000382177:R813H;ENSP00000382179:R813H;ENSP00000348693:R813H;ENSP00000350945:R813H;ENSP00000451109:R813H	ENSP00000348693:R813H	R	-	2	0	MYO5A	50454932	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.477000	0.60223	1.254000	0.44035	0.545000	0.68477	CGC	MYO5A	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	ENSG00000197535		0.413	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	51	0.00	0	C	NM_000259		52667640	52667640	-1	no_errors	ENST00000358212	ensembl	human	known	69_37n	missense	45	25.00	15	SNP	1.000	T
NOA1	84273	genome.wustl.edu	37	4	57842776	57842776	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr4:57842776C>T	ENST00000264230.4	-	1	2213	c.976G>A	c.(976-978)Gag>Aag	p.E326K	POLR2B_ENST00000381227.1_5'Flank|POLR2B_ENST00000441246.2_5'Flank|POLR2B_ENST00000431623.2_5'Flank|POLR2B_ENST00000314595.5_5'Flank	NM_032313.2	NP_115689.1	Q8NC60	NOA1_HUMAN	nitric oxide associated 1	326	CP-type G. {ECO:0000255|PROSITE- ProRule:PRU01058}.				apoptotic process (GO:0006915)|GTP catabolic process (GO:0006184)|mitochondrial translation (GO:0032543)|regulation of cell death (GO:0010941)|regulation of cellular respiration (GO:0043457)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)										GAGATCAACTCTTCCACTCCA	0.617																																						dbGAP											0													77.0	71.0	73.0					4																	57842776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098215	CCDS3510.1	4q12	2013-05-24	2011-10-19	2011-10-19	ENSG00000084092	ENSG00000084092			28473	protein-coding gene	gene with protein product	"""nitric oxide synthase, mitochondrial (putative)"", ""mitochondrial GTPase 3 homolog (S. cerevisiae)"""	614919	"""chromosome 4 open reading frame 14"""	C4orf14		16380119, 2118999, 21771794, 22447445	Standard	NM_032313		Approved	MGC3232, hAtNOS1, hNOA1, MTG3	uc003hck.3	Q8NC60	OTTHUMG00000128773	ENST00000264230.4:c.976G>A	4.37:g.57842776C>T	ENSP00000264230:p.Glu326Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7L6|Q9BSQ9	Missense_Mutation	SNP	NULL	p.E326K	ENST00000264230.4	37	c.976	CCDS3510.1	4	.	.	.	.	.	.	.	.	.	.	C	28.2	4.899160	0.91962	.	.	ENSG00000084092	ENST00000264230	T	0.13901	2.55	5.89	5.89	0.94794	.	0.393126	0.28442	N	0.015322	T	0.18045	0.0433	L	0.42632	1.34	0.47476	D	0.999439	P	0.46142	0.873	P	0.45037	0.467	T	0.00175	-1.1954	10	0.56958	D	0.05	.	15.391	0.74744	0.0:0.9318:0.0:0.0682	.	326	Q8NC60	CD014_HUMAN	K	326	ENSP00000264230:E326K	ENSP00000264230:E326K	E	-	1	0	C4orf14	57537533	1.000000	0.71417	0.996000	0.52242	0.893000	0.52053	2.585000	0.46111	2.781000	0.95711	0.555000	0.69702	GAG	NOA1	-	NULL	ENSG00000084092		0.617	NOA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOA1	HGNC	protein_coding	OTTHUMT00000250694.2	20	0.00	0	C	NM_032313		57842776	57842776	-1	no_errors	ENST00000264230	ensembl	human	known	69_37n	missense	20	25.93	7	SNP	1.000	T
ORM2	5005	genome.wustl.edu	37	9	117092260	117092260	+	Silent	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr9:117092260C>T	ENST00000431067.2	+	1	112	c.76C>T	c.(76-78)Cta>Tta	p.L26L	ORM2_ENST00000412657.1_Silent_p.L26L	NM_000608.2	NP_000599.1	P19652	A1AG2_HUMAN	orosomucoid 2	26					acute-phase response (GO:0006953)|regulation of immune system process (GO:0002682)|transport (GO:0006810)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(2)|urinary_tract(1)	7		Myeloproliferative disorder(63;0.163)			Chlorpromazine(DB00477)|Oxycodone(DB00497)|Thalidomide(DB01041)	GTGTGCCAACCTAGTACCGGT	0.622																																					NSCLC(65;867 1308 1814 2391 12508)	dbGAP											0													15.0	19.0	18.0					9																	117092260		2185	4273	6458	-	-	-	SO:0001819	synonymous_variant	0				CCDS6804.1	9q32	2013-09-19			ENSG00000228278	ENSG00000228278		"""Lipocalins"""	8499	protein-coding gene	gene with protein product	"""alpha-1-acid glycoprotein, type 2"""	138610				4711474, 2970990	Standard	NM_000608		Approved	AGP-B, AGP-B', AGP2		P19652	OTTHUMG00000021014	ENST00000431067.2:c.76C>T	9.37:g.117092260C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5L2|Q16571|Q5T538|Q6IB74	Silent	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,pfam_ApoM,superfamily_Calycin-like,pirsf_A1A_glycop,prints_A1A_glycop	p.L26	ENST00000431067.2	37	c.76	CCDS6804.1	9																																																																																			ORM2	-	pfam_ApoM,pirsf_A1A_glycop	ENSG00000228278		0.622	ORM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORM2	HGNC	protein_coding	OTTHUMT00000055432.1	44	0.00	0	C	NM_000608		117092260	117092260	+1	no_errors	ENST00000431067	ensembl	human	known	69_37n	silent	9	25.00	3	SNP	0.000	T
OBP2B	29989	genome.wustl.edu	37	9	136083528	136083528	+	Missense_Mutation	SNP	T	T	A	rs3192921	byFrequency	TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr9:136083528T>A	ENST00000372034.3	-	3	310	c.269A>T	c.(268-270)tAc>tTc	p.Y90F	OBP2B_ENST00000372032.2_Silent_p.I45I|OBP2B_ENST00000461961.1_5'UTR	NM_014581.2	NP_055396.1	Q9NPH6	OBP2B_HUMAN	odorant binding protein 2B	90					chemosensory behavior (GO:0007635)|sensory perception of smell (GO:0007608)|transport (GO:0006810)	extracellular region (GO:0005576)	odorant binding (GO:0005549)			central_nervous_system(2)|large_intestine(1)|lung(3)|skin(1)	7				OV - Ovarian serous cystadenocarcinoma(145;3.41e-06)|Epithelial(140;1.88e-05)		ACAGGCGCTGTATTTGCCAGG	0.642																																						dbGAP											0													60.0	58.0	59.0					9																	136083528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ251026	CCDS6961.1	9q34	2014-01-22			ENSG00000171102	ENSG00000171102		"""Lipocalins"""	23381	protein-coding gene	gene with protein product		604606					Standard	NM_001288987		Approved	hOBPIIb, LCN14	uc004ccz.3	Q9NPH6	OTTHUMG00000020860	ENST00000372034.3:c.269A>T	9.37:g.136083528T>A	ENSP00000361104:p.Tyr90Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSP6|Q9NY51|Q9NY52	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_von_Ebner_gland,prints_PstgldnD_synth	p.Y90F	ENST00000372034.3	37	c.269	CCDS6961.1	9	.	.	.	.	.	.	.	.	.	.	A	0.025	-1.376984	0.01214	.	.	ENSG00000171102	ENST00000372034	T	0.06849	3.25	1.91	0.679	0.17975	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);	0.188123	0.26062	N	0.026576	T	0.04543	0.0124	N	0.24115	0.695	0.19945	N	0.999945	B	0.33000	0.393	B	0.37731	0.257	T	0.39881	-0.9592	10	0.02654	T	1	-47.8449	5.6514	0.17618	0.2549:0.0:0.0:0.7451	rs3192921;rs17417803	90	Q9NPH6	OBP2B_HUMAN	F	90	ENSP00000361104:Y90F	ENSP00000361104:Y90F	Y	-	2	0	OBP2B	135073349	0.001000	0.12720	0.123000	0.21794	0.003000	0.03518	-0.353000	0.07691	-0.219000	0.10003	-1.992000	0.00449	TAC	OBP2B	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_von_Ebner_gland	ENSG00000171102		0.642	OBP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OBP2B	HGNC	protein_coding	OTTHUMT00000054851.1	22	0.00	0	T	NM_014581		136083528	136083528	-1	no_errors	ENST00000372034	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	0.224	A
PARP8	79668	genome.wustl.edu	37	5	50046013	50046013	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr5:50046013G>C	ENST00000281631.5	+	3	333	c.175G>C	c.(175-177)Gat>Cat	p.D59H	PARP8_ENST00000505697.2_Missense_Mutation_p.D59H|PARP8_ENST00000514067.2_Missense_Mutation_p.D59H|PARP8_ENST00000503750.2_Missense_Mutation_p.D59H|PARP8_ENST00000514342.2_5'UTR|PARP8_ENST00000505554.1_Missense_Mutation_p.D38H|PARP8_ENST00000511363.2_3'UTR	NM_001178056.1|NM_024615.3	NP_001171527.1|NP_078891.2	Q8N3A8	PARP8_HUMAN	poly (ADP-ribose) polymerase family, member 8	59						intracellular (GO:0005622)	NAD+ ADP-ribosyltransferase activity (GO:0003950)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Lung NSC(810;0.0305)|Breast(144;0.222)				TGTATCTGAAGATTACCCAGG	0.303																																						dbGAP											0													143.0	138.0	140.0					5																	50046013		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL834477	CCDS3954.1, CCDS54849.1	5q11.2	2010-02-16			ENSG00000151883	ENSG00000151883		"""Poly (ADP-ribose) polymerases"""	26124	protein-coding gene	gene with protein product						15273990	Standard	NM_001178055		Approved	FLJ21308, pART16	uc003joo.3	Q8N3A8	OTTHUMG00000096969	ENST00000281631.5:c.175G>C	5.37:g.50046013G>C	ENSP00000281631:p.Asp59His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KRB7|Q6DHZ1|Q9H754	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.D59H	ENST00000281631.5	37	c.175	CCDS3954.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.99|12.99	2.104019|2.104019	0.37145|0.37145	.|.	.|.	ENSG00000151883|ENSG00000151883	ENST00000505697;ENST00000503750;ENST00000502524;ENST00000281631;ENST00000514067;ENST00000503046;ENST00000505554|ENST00000503888;ENST00000503193	.|.	.|.	.|.	5.41|5.41	5.41|5.41	0.78517|0.78517	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.43500|0.43500	0.1250|0.1250	N|N	0.22421|0.22421	0.69|0.69	0.80722|0.80722	D|D	1|1	D;D|B	0.89917|0.15473	1.0;0.999|0.013	D;D|B	0.83275|0.15870	0.996;0.99|0.014	T|T	0.25502|0.25502	-1.0130|-1.0130	8|7	.|.	.|.	.|.	-8.8202|-8.8202	15.0506|15.0506	0.71865|0.71865	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	59;59|4	Q8N3A8-2;Q8N3A8|B4DQ81	.;PARP8_HUMAN|.	H|N	59;59;59;59;59;59;38|40	.|.	.|.	D|K	+|+	1|3	0|2	PARP8|PARP8	50081770|50081770	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	6.242000|6.242000	0.72376|0.72376	2.699000|2.699000	0.92147|0.92147	0.555000|0.555000	0.69702|0.69702	GAT|AAG	PARP8	-	NULL	ENSG00000151883		0.303	PARP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP8	HGNC	protein_coding	OTTHUMT00000214035.3	116	0.00	0	G	NM_024615		50046013	50046013	+1	no_errors	ENST00000281631	ensembl	human	known	69_37n	missense	141	18.97	33	SNP	1.000	C
PRDX4	10549	genome.wustl.edu	37	X	23697375	23697375	+	Silent	SNP	A	A	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chrX:23697375A>G	ENST00000379341.4	+	4	695	c.570A>G	c.(568-570)gtA>gtG	p.V190V		NM_006406.1	NP_006397.1	Q13162	PRDX4_HUMAN	peroxiredoxin 4	190	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				4-hydroxyproline metabolic process (GO:0019471)|cell redox homeostasis (GO:0045454)|extracellular matrix organization (GO:0030198)|I-kappaB phosphorylation (GO:0007252)|male gonad development (GO:0008584)|negative regulation of male germ cell proliferation (GO:2000255)|protein maturation by protein folding (GO:0022417)|reactive oxygen species metabolic process (GO:0072593)|spermatogenesis (GO:0007283)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	thioredoxin peroxidase activity (GO:0008379)			lung(6)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	9						ACTATGGTGTATACCTAGAGG	0.403																																						dbGAP											0													186.0	168.0	174.0					X																	23697375		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U25182	CCDS14206.1	Xp22.11	2012-09-20			ENSG00000123131	ENSG00000123131			17169	protein-coding gene	gene with protein product		300927				9388242	Standard	XM_005274438		Approved	AOE37-2	uc004dam.3	Q13162	OTTHUMG00000021253	ENST00000379341.4:c.570A>G	X.37:g.23697375A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHT3	Missense_Mutation	SNP	pfam_AhpC/TSA,pfam_Peroxiredoxin_C,pfam_Redoxin,superfamily_Thioredoxin-like_fold	p.I68V	ENST00000379341.4	37	c.202	CCDS14206.1	X	.	.	.	.	.	.	.	.	.	.	A	8.990	0.977547	0.18812	.	.	ENSG00000123131	ENST00000439422	.	.	.	5.19	-8.01	0.01122	.	.	.	.	.	T	0.32224	0.0822	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.40590	-0.9555	4	.	.	.	-9.5654	0.4251	0.00462	0.2955:0.2388:0.1397:0.326	.	.	.	.	V	68	.	.	I	+	1	0	PRDX4	23607296	0.425000	0.25498	0.312000	0.25196	0.967000	0.64934	-0.238000	0.08977	-1.475000	0.01876	0.345000	0.21793	ATA	PRDX4	-	pfam_AhpC/TSA,pfam_Redoxin,superfamily_Thioredoxin-like_fold	ENSG00000123131		0.403	PRDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX4	HGNC	protein_coding	OTTHUMT00000056049.1	96	0.00	0	A	NM_006406		23697375	23697375	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000439422	ensembl	human	known	69_37n	missense	52	21.21	14	SNP	0.249	G
PLXNB3	5365	genome.wustl.edu	37	X	153032507	153032507	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chrX:153032507C>G	ENST00000361971.5	+	3	339	c.225C>G	c.(223-225)ttC>ttG	p.F75L	PLXNB3_ENST00000538543.1_Intron|U52111.14_ENST00000416854.1_RNA|U52111.14_ENST00000434284.1_RNA|PLXNB3_ENST00000538282.1_Intron|PLXNB3_ENST00000538966.1_Missense_Mutation_p.F98L|PLXNB3_ENST00000538776.1_Intron	NM_005393.2	NP_005384.2	Q9ULL4	PLXB3_HUMAN	plexin B3	75	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|cell chemotaxis (GO:0060326)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell migration (GO:0030336)|negative regulation of GTPase activity (GO:0034260)|negative regulation of lamellipodium assembly (GO:0010593)|positive chemotaxis (GO:0050918)|positive regulation of endothelial cell proliferation (GO:0001938)|semaphorin-plexin signaling pathway (GO:0071526)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	protein domain specific binding (GO:0019904)|semaphorin receptor activity (GO:0017154)			central_nervous_system(1)|endometrium(7)|large_intestine(2)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	32	all_hematologic(71;4.25e-06)|all_lung(58;3.83e-05)|Lung NSC(58;5.54e-05)|Acute lymphoblastic leukemia(192;6.56e-05)					ACCGCCTCTTCCAGCTCAGCC	0.647																																						dbGAP											0													37.0	33.0	34.0					X																	153032507		2201	4300	6501	-	-	-	SO:0001583	missense	0			AF149019	CCDS14729.1, CCDS55536.1	Xq28	2008-02-05			ENSG00000198753	ENSG00000198753		"""Plexins"""	9105	protein-coding gene	gene with protein product		300214		PLXN6		10520995	Standard	NM_005393		Approved	PLEXR, PLEXB3	uc010nuk.2	Q9ULL4	OTTHUMG00000024217	ENST00000361971.5:c.225C>G	X.37:g.153032507C>G	ENSP00000355378:p.Phe75Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3E6|F5H773|Q9HDA4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.F98L	ENST00000361971.5	37	c.294	CCDS14729.1	X	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372219	0.61624	.	.	ENSG00000198753	ENST00000538966;ENST00000361971	T;T	0.11712	2.75;2.75	4.92	3.12	0.35913	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.153985	0.44097	D	0.000485	T	0.20251	0.0487	L	0.58669	1.825	0.38166	D	0.93917	P;P	0.48230	0.907;0.868	P;P	0.54544	0.702;0.755	T	0.01266	-1.1401	10	0.46703	T	0.11	.	10.0528	0.42225	0.0:0.8243:0.0:0.1757	.	98;75	F5H773;Q9ULL4	.;PLXB3_HUMAN	L	98;75	ENSP00000442736:F98L;ENSP00000355378:F75L	ENSP00000355378:F75L	F	+	3	2	PLXNB3	152685701	0.991000	0.36638	1.000000	0.80357	0.465000	0.32709	0.659000	0.24994	0.317000	0.23160	-0.296000	0.09543	TTC	PLXNB3	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000198753		0.647	PLXNB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLXNB3	HGNC	protein_coding	OTTHUMT00000061063.1	14	0.00	0	C			153032507	153032507	+1	no_errors	ENST00000538966	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	G
REG3G	130120	genome.wustl.edu	37	2	79253873	79253873	+	Silent	SNP	G	G	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr2:79253873G>T	ENST00000272324.5	+	3	295	c.111G>T	c.(109-111)cgG>cgT	p.R37R	REG3G_ENST00000409471.1_Silent_p.R37R|REG3G_ENST00000393897.2_Silent_p.R37R	NM_001008387.2	NP_001008388.1	Q6UW15	REG3G_HUMAN	regenerating islet-derived 3 gamma	37					acute-phase response (GO:0006953)|defense response to Gram-positive bacterium (GO:0050830)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|negative regulation of keratinocyte differentiation (GO:0045617)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of wound healing (GO:0090303)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(27)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38						CCTCTCCACGGATCAGCTGTC	0.527																																						dbGAP											0													84.0	81.0	82.0					2																	79253873		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY359047	CCDS1962.1, CCDS58714.1	2p12	2005-02-11			ENSG00000143954	ENSG00000143954			29595	protein-coding gene	gene with protein product		609933				12975309	Standard	NM_001008387		Approved	UNQ429, LPPM429, PAP1B	uc002snx.4	Q6UW15	OTTHUMG00000130018	ENST00000272324.5:c.111G>T	2.37:g.79253873G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K980|D6W5J6|Q3SYE4|Q3SYE6|Q6FH18	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Pancreatis_ac	p.R37	ENST00000272324.5	37	c.111	CCDS1962.1	2																																																																																			REG3G	-	prints_Pancreatis_ac	ENSG00000143954		0.527	REG3G-002	KNOWN	basic|appris_principal|CCDS	protein_coding	REG3G	HGNC	protein_coding	OTTHUMT00000328247.1	84	0.00	0	G	NM_198448		79253873	79253873	+1	no_errors	ENST00000272324	ensembl	human	known	69_37n	silent	105	16.00	20	SNP	0.000	T
RORA	6095	genome.wustl.edu	37	15	60789700	60789700	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr15:60789700T>G	ENST00000335670.6	-	11	1626	c.1526A>C	c.(1525-1527)gAg>gCg	p.E509A	RP11-219B17.1_ENST00000559824.1_RNA|RORA_ENST00000261523.5_Missense_Mutation_p.E542A|RORA_ENST00000309157.4_Missense_Mutation_p.E534A|RP11-219B17.1_ENST00000501579.2_RNA|RP11-219B17.1_ENST00000558235.1_RNA|RP11-219B17.1_ENST00000558140.1_RNA|RORA_ENST00000449337.2_Missense_Mutation_p.E454A	NM_134261.2	NP_599023.1	P35398	RORA_HUMAN	RAR-related orphan receptor A	509	Ligand-binding.				angiogenesis (GO:0001525)|cellular response to hypoxia (GO:0071456)|cellular response to sterol (GO:0036315)|cerebellar granule cell precursor proliferation (GO:0021930)|cerebellar Purkinje cell differentiation (GO:0021702)|cGMP metabolic process (GO:0046068)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|muscle cell differentiation (GO:0042692)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of inflammatory response (GO:0050728)|nitric oxide biosynthetic process (GO:0006809)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of cholesterol homeostasis (GO:2000188)|regulation of glucose metabolic process (GO:0010906)|regulation of macrophage activation (GO:0043030)|regulation of smoothened signaling pathway (GO:0008589)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|regulation of transcription, DNA-templated (GO:0006355)|T-helper 17 cell differentiation (GO:0072539)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription coactivator binding (GO:0001223)|transcription corepressor binding (GO:0001222)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|large_intestine(3)|liver(1)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	21						AGTGAACAACTCCTTGTATAA	0.368																																						dbGAP											0													119.0	104.0	109.0					15																	60789700		2203	4300	6503	-	-	-	SO:0001583	missense	0			U04897	CCDS10177.1, CCDS10178.1, CCDS10179.1, CCDS45271.1	15q21-q22	2013-01-16			ENSG00000069667	ENSG00000069667		"""Nuclear hormone receptors"""	10258	protein-coding gene	gene with protein product		600825				7926749	Standard	NM_134261		Approved	RZRA, ROR1, ROR2, ROR3, NR1F1	uc002agv.3	P35398	OTTHUMG00000132769	ENST00000335670.6:c.1526A>C	15.37:g.60789700T>G	ENSP00000335087:p.Glu509Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	P35397|P35399|P45445|Q495X4|Q96H83	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.E542A	ENST00000335670.6	37	c.1625	CCDS10177.1	15	.	.	.	.	.	.	.	.	.	.	T	21.5	4.158084	0.78114	.	.	ENSG00000069667	ENST00000335670;ENST00000449337;ENST00000309157;ENST00000261523	D;D;D;D	0.97906	-4.6;-4.6;-4.6;-4.6	6.07	6.07	0.98685	Nuclear hormone receptor, ligand-binding (2);	0.000000	0.85682	D	0.000000	D	0.98741	0.9577	M	0.83774	2.66	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;0.998;1.0	D	0.99816	1.1044	10	0.87932	D	0	.	16.6407	0.85098	0.0:0.0:0.0:1.0	.	509;534;542;454	P35398-2;P35398-3;P35398;P35398-4	.;.;RORA_HUMAN;.	A	509;454;534;542	ENSP00000335087:E509A;ENSP00000402971:E454A;ENSP00000309753:E534A;ENSP00000261523:E542A	ENSP00000261523:E542A	E	-	2	0	RORA	58576992	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.040000	0.89188	2.326000	0.78906	0.533000	0.62120	GAG	RORA	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000069667		0.368	RORA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RORA	HGNC	protein_coding	OTTHUMT00000256142.2	89	0.00	0	T			60789700	60789700	-1	no_errors	ENST00000261523	ensembl	human	known	69_37n	missense	42	27.59	16	SNP	1.000	G
SEL1L2	80343	genome.wustl.edu	37	20	13894469	13894469	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr20:13894469A>C	ENST00000284951.5	-	5	582	c.508T>G	c.(508-510)Tat>Gat	p.Y170D	SEL1L2_ENST00000486903.1_5'UTR|SEL1L2_ENST00000378072.5_Missense_Mutation_p.Y170D			Q5TEA6	SE1L2_HUMAN	sel-1 suppressor of lin-12-like 2 (C. elegans)	170						integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|lung(25)|ovary(2)|skin(3)|urinary_tract(1)	51						AAGGACTCATATAATTGGATA	0.383																																						dbGAP											0													108.0	97.0	100.0					20																	13894469		1823	4089	5912	-	-	-	SO:0001583	missense	0			AL137678	CCDS59443.1	20p12.1	2011-03-31	2006-11-24	2006-11-24	ENSG00000101251	ENSG00000101251			15897	protein-coding gene	gene with protein product		614289	"""chromosome 20 open reading frame 50"""	C20orf50			Standard	NM_001271539		Approved	DKFZp434C1826	uc010zrl.3	Q5TEA6	OTTHUMG00000031910	ENST00000284951.5:c.508T>G	20.37:g.13894469A>C	ENSP00000284951:p.Tyr170Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXX5	Missense_Mutation	SNP	pfam_Sel1-like,smart_Sel1-like	p.Y170D	ENST00000284951.5	37	c.508		20	.	.	.	.	.	.	.	.	.	.	A	22.8	4.339525	0.81911	.	.	ENSG00000101251	ENST00000378072;ENST00000284951	T;T	0.59906	0.23;0.23	5.87	5.87	0.94306	Tetratricopeptide-like helical (1);	0.145155	0.32147	N	0.006501	T	0.52629	0.1746	N	0.08118	0	0.39361	D	0.965914	D;D	0.64830	0.994;0.994	P;P	0.58077	0.795;0.832	T	0.63554	-0.6611	10	0.87932	D	0	-5.9945	12.9575	0.58438	1.0:0.0:0.0:0.0	.	170;170	B4DXX5;Q5TEA6	.;SE1L2_HUMAN	D	170	ENSP00000367312:Y170D;ENSP00000284951:Y170D	ENSP00000284951:Y170D	Y	-	1	0	SEL1L2	13842469	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.844000	0.62846	2.371000	0.80710	0.533000	0.62120	TAT	SEL1L2	-	pfam_Sel1-like,smart_Sel1-like	ENSG00000101251		0.383	SEL1L2-002	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	SEL1L2	HGNC	protein_coding	OTTHUMT00000078067.3	106	0.00	0	A	NM_025229		13894469	13894469	-1	no_errors	ENST00000284951	ensembl	human	known	69_37n	missense	80	22.33	23	SNP	1.000	C
SLC5A7	60482	genome.wustl.edu	37	2	108614411	108614411	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr2:108614411T>A	ENST00000264047.2	+	5	842	c.566T>A	c.(565-567)gTc>gAc	p.V189D	SLC5A7_ENST00000540517.1_Missense_Mutation_p.V84D|SLC5A7_ENST00000409059.1_Missense_Mutation_p.V189D	NM_021815.2	NP_068587.1	Q9GZV3	SC5A7_HUMAN	solute carrier family 5 (sodium/choline cotransporter), member 7	189					acetylcholine biosynthetic process (GO:0008292)|cell death (GO:0008219)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	choline binding (GO:0033265)|choline transmembrane transporter activity (GO:0015220)|choline:sodium symporter activity (GO:0005307)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(23)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	49					Choline(DB00122)	TACACTGATGTCGTTCAGCTC	0.428																																						dbGAP											0													228.0	202.0	211.0					2																	108614411		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF276871	CCDS2074.1	2q12	2013-07-19	2013-07-19		ENSG00000115665	ENSG00000115665		"""Solute carriers"""	14025	protein-coding gene	gene with protein product		608761	"""solute carrier family 5 (choline transporter), member 7"""			11027560	Standard	NM_021815		Approved	hCHT, CHT1	uc002tdv.3	Q9GZV3	OTTHUMG00000130959	ENST00000264047.2:c.566T>A	2.37:g.108614411T>A	ENSP00000264047:p.Val189Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TF2	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter	p.V189D	ENST00000264047.2	37	c.566	CCDS2074.1	2	.	.	.	.	.	.	.	.	.	.	T	23.2	4.384362	0.82792	.	.	ENSG00000115665	ENST00000409059;ENST00000540517;ENST00000264047	D;D;D	0.88741	-2.42;-2.42;-2.42	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.95787	0.8629	M	0.93197	3.39	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.96900	0.9659	10	0.87932	D	0	-11.8625	14.9248	0.70868	0.0:0.0:0.0:1.0	.	189	Q9GZV3	SC5A7_HUMAN	D	189;84;189	ENSP00000387346:V189D;ENSP00000445351:V84D;ENSP00000264047:V189D	ENSP00000264047:V189D	V	+	2	0	SLC5A7	107980843	1.000000	0.71417	0.719000	0.30619	0.822000	0.46500	8.040000	0.89188	1.937000	0.56155	0.533000	0.62120	GTC	SLC5A7	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter	ENSG00000115665		0.428	SLC5A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A7	HGNC	protein_coding	OTTHUMT00000253562.1	108	0.00	0	T			108614411	108614411	+1	no_errors	ENST00000264047	ensembl	human	known	69_37n	missense	105	17.97	23	SNP	0.998	A
SNRK	54861	genome.wustl.edu	37	3	43389849	43389849	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr3:43389849G>C	ENST00000296088.7	+	7	2402	c.2098G>C	c.(2098-2100)Gca>Cca	p.A700P	SNRK_ENST00000437827.1_Missense_Mutation_p.A494P|SNRK_ENST00000454177.1_Missense_Mutation_p.A700P|RP11-188P20.3_ENST00000607513.1_RNA|SNRK-AS1_ENST00000422681.1_RNA|SNRK_ENST00000429705.2_Missense_Mutation_p.A700P	NM_017719.4	NP_060189.3			SNF related kinase											breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(5)|prostate(1)|skin(2)|stomach(1)	27				KIRC - Kidney renal clear cell carcinoma(284;0.0636)|Kidney(284;0.0792)		GCAGGTCCCTGCAGTGGGCGG	0.468																																						dbGAP											0													101.0	101.0	101.0					3																	43389849		1923	4113	6036	-	-	-	SO:0001583	missense	0			D43636	CCDS43075.1	3p22.1	2005-08-09			ENSG00000163788	ENSG00000163788			30598	protein-coding gene	gene with protein product		612760				8654423, 7788527	Standard	NM_017719		Approved	FLJ20224, HSNFRK, KIAA0096	uc003cmt.4	Q9NRH2	OTTHUMG00000156491	ENST00000296088.7:c.2098G>C	3.37:g.43389849G>C	ENSP00000296088:p.Ala700Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.A700P	ENST00000296088.7	37	c.2098	CCDS43075.1	3	.	.	.	.	.	.	.	.	.	.	G	7.667	0.686109	0.14973	.	.	ENSG00000163788	ENST00000454177;ENST00000429705;ENST00000296088;ENST00000437827	T;T;T;T	0.66280	-0.2;-0.2;-0.2;2.71	5.39	3.57	0.40892	.	0.378221	0.27531	N	0.018956	T	0.28896	0.0717	N	0.02011	-0.69	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.06917	-1.0800	10	0.39692	T	0.17	.	3.0761	0.06247	0.1599:0.1166:0.551:0.1724	.	700	Q9NRH2	SNRK_HUMAN	P	700;700;700;494	ENSP00000401246:A700P;ENSP00000411375:A700P;ENSP00000296088:A700P;ENSP00000409516:A494P	ENSP00000296088:A700P	A	+	1	0	SNRK	43364853	0.029000	0.19370	0.034000	0.17996	0.810000	0.45777	0.533000	0.23082	1.427000	0.47276	0.655000	0.94253	GCA	SNRK	-	NULL	ENSG00000163788		0.468	SNRK-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SNRK	HGNC	protein_coding	OTTHUMT00000344325.1	42	0.00	0	G	NM_017719		43389849	43389849	+1	no_errors	ENST00000296088	ensembl	human	known	69_37n	missense	29	23.68	9	SNP	0.376	C
STK11	6794	genome.wustl.edu	37	19	1207090	1207091	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr19:1207090_1207091insA	ENST00000326873.7	+	1	1351_1352	c.178_179insA	c.(178-180)tacfs	p.Y60fs	STK11_ENST00000585748.1_Intron	NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	60	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.|Sufficient for interaction with SIRT1.				activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.?(3)|p.G56fs*4(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		GGAAGGCTCTTACGGCAAGGTG	0.629		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																												dbGAP	yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	24	Whole gene deletion(20)|Deletion - Frameshift(2)|Unknown(2)	cervix(15)|lung(4)|skin(1)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	GRCh37	CI055775	STK11	I																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.179dupA	19.37:g.1207091_1207091dupA	ENSP00000324856:p.Tyr60fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBX7|E7EW76	Frame_Shift_Ins	INS	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y60fs	ENST00000326873.7	37	c.178_179	CCDS45896.1	19																																																																																			STK11	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000118046		0.629	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	STK11	HGNC	protein_coding	OTTHUMT00000449839.3	12	0.00	0	-	NM_000455		1207090	1207091	+1	no_errors	ENST00000326873	ensembl	human	known	69_37n	frame_shift_ins	18	40.00	12	INS	1.000:1.000	A
SYTL4	94121	genome.wustl.edu	37	X	99956630	99956630	+	Silent	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chrX:99956630C>T	ENST00000372989.1	-	5	481	c.150G>A	c.(148-150)ggG>ggA	p.G50G	SYTL4_ENST00000372981.1_Silent_p.G50G|SYTL4_ENST00000276141.6_Silent_p.G50G|SYTL4_ENST00000455616.1_Silent_p.G50G|SYTL4_ENST00000454200.2_Silent_p.G50G|SYTL4_ENST00000263033.5_Silent_p.G50G	NM_080737.2	NP_542775.2	Q96C24	SYTL4_HUMAN	synaptotagmin-like 4	50	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)|multivesicular body sorting pathway (GO:0071985)|negative regulation of insulin secretion (GO:0046676)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extrinsic component of membrane (GO:0019898)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|synaptic vesicle (GO:0008021)	neurexin family protein binding (GO:0042043)|phospholipid binding (GO:0005543)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(2)|prostate(1)|skin(2)	27					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCCTCTTGGCCCCTTTCCTTT	0.512																																						dbGAP											0													66.0	63.0	64.0					X																	99956630		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14472.1	Xq21.33	2008-07-31	2008-07-31		ENSG00000102362	ENSG00000102362			15588	protein-coding gene	gene with protein product	"""granuphilin-a"", ""exophilin-2"""	300723					Standard	NM_080737		Approved		uc010nnc.3	Q96C24	OTTHUMG00000022004	ENST00000372989.1:c.150G>A	X.37:g.99956630C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9J3|Q5JPG8|Q8N9P4|Q9H4R0|Q9H4R1	Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,prints_Synaptotagmin	p.G50	ENST00000372989.1	37	c.150	CCDS14472.1	X																																																																																			SYTL4	-	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	ENSG00000102362		0.512	SYTL4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SYTL4	HGNC	protein_coding	OTTHUMT00000057488.1	101	0.00	0	C	NM_080737		99956630	99956630	-1	no_errors	ENST00000454200	ensembl	human	known	69_37n	silent	44	16.98	9	SNP	0.998	T
GNB1L	54584	genome.wustl.edu	37	22	19770438	19770438	+	IGR	SNP	C	C	A			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr22:19770438C>A	ENST00000329517.6	-	0	6706				TBX1_ENST00000359500.3_Missense_Mutation_p.L338M	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					gactccagggctggtcacaga	0.532																																						dbGAP											0													122.0	114.0	117.0					22																	19770438		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279		22.37:g.19770438C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H2S2|Q9H4M4	Missense_Mutation	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.L338M	ENST00000329517.6	37	c.1012	CCDS13768.1	22	.	.	.	.	.	.	.	.	.	.	C	6.401	0.442106	0.12164	.	.	ENSG00000184058	ENST00000359500	D	0.86694	-2.16	1.57	-0.751	0.11076	.	.	.	.	.	T	0.66177	0.2763	N	0.14661	0.345	0.09310	N	1	P	0.39831	0.69	B	0.23574	0.047	T	0.59445	-0.7453	9	0.41790	T	0.15	.	2.7171	0.05190	0.0:0.4784:0.3111:0.2105	.	338	Q152R5	.	M	338	ENSP00000352483:L338M	ENSP00000352483:L338M	L	+	1	2	TBX1	18150438	0.000000	0.05858	0.002000	0.10522	0.289000	0.27227	0.006000	0.13152	-0.142000	0.11354	0.563000	0.77884	CTG	TBX1	-	NULL	ENSG00000184058		0.532	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX1	HGNC	protein_coding	OTTHUMT00000075202.1	28	0.00	0	C			19770438	19770438	+1	no_errors	ENST00000359500	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	0.002	A
TCF12	6938	genome.wustl.edu	37	15	57458613	57458613	+	Missense_Mutation	SNP	G	G	T	rs180768505	byFrequency	TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr15:57458613G>T	ENST00000267811.5	+	6	643	c.339G>T	c.(337-339)gaG>gaT	p.E113D	TCF12_ENST00000333725.5_Missense_Mutation_p.E113D|TCF12_ENST00000557843.1_Missense_Mutation_p.E113D|TCF12_ENST00000438423.2_Missense_Mutation_p.E113D|TCF12_ENST00000452095.2_Missense_Mutation_p.E109D	NM_003205.3|NM_207038.1	NP_003196.1|NP_996921.1	Q99081	HTF4_HUMAN	transcription factor 12	113					immune response (GO:0006955)|muscle organ development (GO:0007517)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	bHLH transcription factor binding (GO:0043425)|E-box binding (GO:0070888)|enhancer binding (GO:0035326)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)		TCF12/NR4A3(2)	breast(2)|central_nervous_system(5)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	36		Colorectal(260;0.0907)		all cancers(107;0.000313)|GBM - Glioblastoma multiforme(80;0.00878)|STAD - Stomach adenocarcinoma(283;0.239)		AAACATCAGAGAGAGGCTCAT	0.303			T	TEC	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		15	15q21	6938	"""transcription factor 12 (HTF4, helix-loop-helix transcription factors 4)"""		M	0													86.0	98.0	94.0					15																	57458613		2192	4286	6478	-	-	-	SO:0001583	missense	0			BC050556	CCDS10159.1, CCDS10160.1, CCDS42042.1	15q21	2013-05-21	2008-07-31		ENSG00000140262	ENSG00000140262		"""Basic helix-loop-helix proteins"""	11623	protein-coding gene	gene with protein product	"""helix-loop-helix transcription factor 4"""	600480				1886779	Standard	NM_003205		Approved	HEB, HTF4, HsT17266, bHLHb20	uc002aeb.3	Q99081	OTTHUMG00000132047	ENST00000267811.5:c.339G>T	15.37:g.57458613G>T	ENSP00000267811:p.Glu113Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3D9|Q86TC1|Q86VM2	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.E113D	ENST00000267811.5	37	c.339	CCDS10159.1	15	.	.	.	.	.	.	.	.	.	.	G	11.38	1.621104	0.28889	.	.	ENSG00000140262	ENST00000543236;ENST00000267811;ENST00000438423;ENST00000452095;ENST00000333725	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.14	3.25	0.37280	.	0.159222	0.56097	N	0.000037	T	0.45696	0.1355	N	0.25060	0.705	0.35491	D	0.798974	B;B;B;B	0.11235	0.0;0.004;0.001;0.001	B;B;B;B	0.11329	0.001;0.006;0.002;0.004	T	0.37572	-0.9700	10	0.22109	T	0.4	-4.516	5.2098	0.15310	0.0784:0.3848:0.4024:0.1343	.	109;165;113;113	E9PGY0;F5H6Z6;Q99081;Q99081-3	.;.;HTF4_HUMAN;.	D	165;113;113;109;113	ENSP00000267811:E113D;ENSP00000388940:E113D;ENSP00000396881:E109D;ENSP00000331057:E113D	ENSP00000267811:E113D	E	+	3	2	TCF12	55245905	0.997000	0.39634	1.000000	0.80357	0.997000	0.91878	0.169000	0.16641	0.559000	0.29153	0.555000	0.69702	GAG	TCF12	-	NULL	ENSG00000140262		0.303	TCF12-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TCF12	HGNC	protein_coding	OTTHUMT00000255069.3	42	0.00	0	G	NM_003205		57458613	57458613	+1	no_errors	ENST00000438423	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	T
TNXB	7148	genome.wustl.edu	37	6	32021331	32021331	+	Silent	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr6:32021331C>T	ENST00000375244.3	-	25	8826	c.8625G>A	c.(8623-8625)ctG>ctA	p.L2875L	TNXB_ENST00000375247.2_Silent_p.L2873L			P22105	TENX_HUMAN	tenascin XB	2922	Fibronectin type-III 20. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						TGTACTGGACCAGGAAGTGGT	0.647																																						dbGAP											0													58.0	63.0	62.0					6																	32021331		1288	2556	3844	-	-	-	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8625G>A	6.37:g.32021331C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L2873	ENST00000375244.3	37	c.8619		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.647	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	19	0.00	0	C	NM_019105		32021331	32021331	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	silent	13	35.00	7	SNP	0.101	T
TPST2	8459	genome.wustl.edu	37	22	26936814	26936814	+	Silent	SNP	G	G	A			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr22:26936814G>A	ENST00000338754.4	-	3	1053	c.783C>T	c.(781-783)agC>agT	p.S261S	TPST2_ENST00000398110.2_Silent_p.S261S|TPST2_ENST00000403880.1_Silent_p.S261S	NM_003595.3	NP_003586.3	O60704	TPST2_HUMAN	tyrosylprotein sulfotransferase 2	261					fusion of sperm to egg plasma membrane (GO:0007342)|peptidyl-tyrosine sulfation (GO:0006478)|prevention of polyspermy (GO:0060468)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			central_nervous_system(1)|large_intestine(1)|lung(5)	7						GGACAGCGTCGCTCCAGGCGA	0.607																																						dbGAP											0													68.0	60.0	62.0					22																	26936814		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF049891	CCDS13839.1	22q12.1	2012-12-13			ENSG00000128294	ENSG00000128294	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12021	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog B (Drosophila)"""	603126				9736702, 9733778	Standard	NM_003595		Approved	TANGO13B	uc003acx.3	O60704	OTTHUMG00000150987	ENST00000338754.4:c.783C>T	22.37:g.26936814G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQA7|Q6FI98|Q9H0V4	Silent	SNP	pfam_Sulfotransferase_dom	p.S261	ENST00000338754.4	37	c.783	CCDS13839.1	22																																																																																			TPST2	-	pfam_Sulfotransferase_dom	ENSG00000128294		0.607	TPST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST2	HGNC	protein_coding	OTTHUMT00000320820.3	49	0.00	0	G	NM_003595		26936814	26936814	-1	no_errors	ENST00000338754	ensembl	human	known	69_37n	silent	13	35.00	7	SNP	1.000	A
SLC38A6	145389	genome.wustl.edu	37	14	61446282	61446282	+	5'Flank	SNP	A	A	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr14:61446282A>G	ENST00000267488.4	+	0	0				RP11-193F5.1_ENST00000553946.1_RNA|SLC38A6_ENST00000456840.2_5'Flank|TRMT5_ENST00000261249.6_Missense_Mutation_p.S112P|SLC38A6_ENST00000354886.2_5'Flank	NM_153811.2	NP_722518.2	Q8IZM9	S38A6_HUMAN	solute carrier family 38, member 6						amino acid transport (GO:0006865)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(3)|stomach(1)|urinary_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.0981)		CTTTTTAGGGATCGCATCAAT	0.398																																						dbGAP											0													185.0	188.0	187.0					14																	61446282		2203	4300	6503	-	-	-	SO:0001631	upstream_gene_variant	0			AF070578	CCDS9751.1, CCDS53900.1	14q23.1	2013-05-22			ENSG00000139974	ENSG00000139974		"""Solute carriers"""	19863	protein-coding gene	gene with protein product							Standard	NM_153811		Approved	NAT-1	uc001xfh.2	Q8IZM9	OTTHUMG00000140335		14.37:g.61446282A>G	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JWA6|Q86SY5	Missense_Mutation	SNP	pfam_tRNA_Trfase_Trm5/Tyw2	p.S112P	ENST00000267488.4	37	c.334	CCDS9751.1	14	.	.	.	.	.	.	.	.	.	.	A	12.12	1.843269	0.32606	.	.	ENSG00000126814	ENST00000261249;ENST00000553903;ENST00000555420	T	0.24538	1.85	4.44	0.396	0.16309	.	0.283721	0.40469	N	0.001094	T	0.21674	0.0522	L	0.51422	1.61	0.35564	D	0.804911	B	0.12630	0.006	B	0.13407	0.009	T	0.19418	-1.0306	10	0.28530	T	0.3	-8.3925	12.2403	0.54538	0.5737:0.4263:0.0:0.0	.	112	Q32P41	TRM5_HUMAN	P	112;140;139	ENSP00000261249:S112P	ENSP00000261249:S112P	S	-	1	0	TRMT5	60516035	0.987000	0.35691	0.955000	0.39395	0.757000	0.42996	1.418000	0.34782	-0.024000	0.13941	0.533000	0.62120	TCC	TRMT5	-	NULL	ENSG00000126814		0.398	SLC38A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT5	HGNC	protein_coding	OTTHUMT00000276957.1	55	0.00	0	A			61446282	61446282	-1	no_errors	ENST00000261249	ensembl	human	known	69_37n	missense	39	24.53	13	SNP	1.000	G
TRPM6	140803	genome.wustl.edu	37	9	77377167	77377167	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr9:77377167delT	ENST00000360774.1	-	26	4657	c.4420delA	c.(4420-4422)accfs	p.T1474fs	TRPM6_ENST00000376872.3_Intron|TRPM6_ENST00000376864.4_Frame_Shift_Del_p.T1474fs|TRPM6_ENST00000376871.3_Intron|TRPM6_ENST00000449912.2_Frame_Shift_Del_p.T1469fs|TRPM6_ENST00000361255.3_Frame_Shift_Del_p.T1469fs|TRPM6_ENST00000451710.3_Frame_Shift_Del_p.T1474fs	NM_017662.4	NP_060132.3	Q9BX84	TRPM6_HUMAN	transient receptor potential cation channel, subfamily M, member 6	1474					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(22)|liver(1)|lung(53)|ovary(1)|prostate(7)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	126						GGCAAGCAGGTTTGCCACTTT	0.483																																						dbGAP											0													131.0	124.0	127.0					9																	77377167		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK026281	CCDS6647.1, CCDS55318.1, CCDS55319.1	9q21.13	2011-12-14	2003-12-02		ENSG00000119121	ENSG00000119121		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17995	protein-coding gene	gene with protein product		607009	"""hypomagnesemia, secondary hypocalcemia"""	HOMG, HSH		10021370, 12032570, 16382100	Standard	NM_017662		Approved	CHAK2, FLJ22628	uc004ajk.1	Q9BX84	OTTHUMG00000020027	ENST00000360774.1:c.4420delA	9.37:g.77377167delT	ENSP00000354006:p.Thr1474fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6VPR8|Q6VPR9|Q6VPS0|Q6VPS1|Q6VPS2	Frame_Shift_Del	DEL	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.T1474fs	ENST00000360774.1	37	c.4420	CCDS6647.1	9																																																																																			TRPM6	-	NULL	ENSG00000119121		0.483	TRPM6-001	KNOWN	basic|CCDS	protein_coding	TRPM6	HGNC	protein_coding	OTTHUMT00000052693.1	81	0.00	0	T	NM_017662		77377167	77377167	-1	no_errors	ENST00000451710	ensembl	human	known	69_37n	frame_shift_del	16	50.00	19	DEL	0.002	-
TSHZ2	128553	genome.wustl.edu	37	20	51871632	51871632	+	Silent	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr20:51871632C>T	ENST00000371497.5	+	2	2522	c.1635C>T	c.(1633-1635)caC>caT	p.H545H	RP4-678D15.1_ENST00000606932.1_RNA|TSHZ2_ENST00000603338.2_Silent_p.H542H|TSHZ2_ENST00000329613.6_Silent_p.H542H	NM_001193421.1|NM_173485.5	NP_001180350.1|NP_775756.3	Q9NRE2	TSH2_HUMAN	teashirt zinc finger homeobox 2	545					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(16)|lung(38)|ovary(5)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	84			STAD - Stomach adenocarcinoma(23;0.1)			CCAGCATCCACGCAGCCTACC	0.562																																						dbGAP											0													58.0	57.0	57.0					20																	51871632		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF230201	CCDS33490.1, CCDS54474.1	20q13.2	2013-11-20	2007-07-16	2006-03-14	ENSG00000182463	ENSG00000182463		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	13010	protein-coding gene	gene with protein product		614118	"""chromosome 20 open reading frame 17"", ""zinc finger protein 218"", ""teashirt family zinc finger 2"""	C20orf17, ZNF218		9671742	Standard	NM_173485		Approved	ZABC2, OVC10-2, TSH2	uc021wex.1	Q9NRE2	OTTHUMG00000033058	ENST00000371497.5:c.1635C>T	20.37:g.51871632C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7W1|J3KNQ0|Q4VXM4|Q6N003|Q8N260	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Znf_C2H2	p.H545	ENST00000371497.5	37	c.1635	CCDS33490.1	20																																																																																			TSHZ2	-	NULL	ENSG00000182463		0.562	TSHZ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ2	HGNC	protein_coding	OTTHUMT00000080398.6	25	0.00	0	C	NM_173485		51871632	51871632	+1	no_errors	ENST00000371497	ensembl	human	known	69_37n	silent	10	52.38	11	SNP	1.000	T
WDR46	9277	genome.wustl.edu	37	6	33247311	33247311	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr6:33247311A>G	ENST00000374617.4	-	14	2053	c.1697T>C	c.(1696-1698)gTg>gCg	p.V566A	B3GALT4_ENST00000606990.1_Intron	NM_001164267.1|NM_005452.5	NP_001157739.1|NP_005443.3	O15213	WDR46_HUMAN	WD repeat domain 46	566							poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	20						CTTCCTCTTCACCAGGCTTGC	0.602																																						dbGAP											0													201.0	198.0	199.0					6																	33247311		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z97184	CCDS4772.1	6p21.3	2013-01-09	2005-05-31	2005-05-31	ENSG00000227057	ENSG00000227057		"""WD repeat domain containing"""	13923	protein-coding gene	gene with protein product		611440	"""chromosome 6 open reading frame 11"""	C6orf11		9545376, 9521053	Standard	NM_005452		Approved	BING4, UTP7	uc003ods.3	O15213	OTTHUMG00000031192	ENST00000374617.4:c.1697T>C	6.37:g.33247311A>G	ENSP00000363746:p.Val566Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDP5|Q5HYZ0|Q5STK5|Q5STR3	Missense_Mutation	SNP	pfam_BING4_C_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V566A	ENST00000374617.4	37	c.1697	CCDS4772.1	6	.	.	.	.	.	.	.	.	.	.	A	13.48	2.250064	0.39797	.	.	ENSG00000227057	ENST00000374617	T	0.18810	2.19	6.02	6.02	0.97574	.	0.237913	0.42053	D	0.000768	T	0.07052	0.0179	L	0.29908	0.895	0.35000	D	0.755879	B;B	0.28820	0.224;0.224	B;B	0.27500	0.08;0.05	T	0.19844	-1.0293	10	0.15066	T	0.55	-11.1584	14.4947	0.67678	1.0:0.0:0.0:0.0	.	512;566	B4DP15;O15213	.;WDR46_HUMAN	A	566	ENSP00000363746:V566A	ENSP00000363746:V566A	V	-	2	0	WDR46	33355289	0.993000	0.37304	0.995000	0.50966	0.990000	0.78478	3.586000	0.53950	2.309000	0.77851	0.448000	0.29417	GTG	WDR46	-	NULL	ENSG00000227057		0.602	WDR46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR46	HGNC	protein_coding	OTTHUMT00000076382.2	123	0.00	0	A	NM_005452		33247311	33247311	-1	no_errors	ENST00000374617	ensembl	human	known	69_37n	missense	66	37.74	40	SNP	1.000	G
YEATS4	8089	genome.wustl.edu	37	12	69764730	69764730	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr12:69764730A>C	ENST00000247843.2	+	6	759	c.489A>C	c.(487-489)ttA>ttC	p.L163F	YEATS4_ENST00000548020.1_Missense_Mutation_p.L109F	NM_006530.2	NP_006521.1	O95619	YETS4_HUMAN	YEATS domain containing 4	163	Interaction with MLLT10.				chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic nuclear division (GO:0007067)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear matrix (GO:0016363)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|protein C-terminus binding (GO:0008022)|sequence-specific DNA binding transcription factor activity (GO:0003700)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(1)	5	all_epithelial(5;9.25e-35)|Breast(13;9.83e-07)|Esophageal squamous(21;0.187)		Epithelial(6;6.89e-18)|BRCA - Breast invasive adenocarcinoma(5;3.14e-09)|Lung(24;9.68e-05)|LUAD - Lung adenocarcinoma(15;0.00107)|OV - Ovarian serous cystadenocarcinoma(12;0.00691)|STAD - Stomach adenocarcinoma(21;0.0151)|LUSC - Lung squamous cell carcinoma(43;0.24)|Kidney(9;0.241)			AGCTAACATTAGGAGCCTATA	0.343																																						dbGAP											0													102.0	98.0	100.0					12																	69764730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ245746	CCDS8990.1, CCDS73495.1	12q13-q15	2008-02-05				ENSG00000127337			24859	protein-coding gene	gene with protein product		602116				9302258, 11903063	Standard	XM_005269163		Approved	NuBI-1, GAS41, YAF9	uc001sux.3	O95619	OTTHUMG00000169358	ENST00000247843.2:c.489A>C	12.37:g.69764730A>C	ENSP00000247843:p.Leu163Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NQD0	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.L163F	ENST00000247843.2	37	c.489	CCDS8990.1	12	.	.	.	.	.	.	.	.	.	.	A	8.761	0.923575	0.18056	.	.	ENSG00000127337	ENST00000247843;ENST00000548020;ENST00000549685;ENST00000552955	.	.	.	6.13	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.73217	2.22	0.54753	D	0.999987	B	0.16166	0.016	B	0.14023	0.01	T	0.51252	-0.8729	8	.	.	.	-11.3485	4.4857	0.11788	0.598:0.0:0.1491:0.2529	.	163	O95619	YETS4_HUMAN	F	163;109;105;204	.	.	L	+	3	2	YEATS4	68050997	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.869000	0.27996	1.162000	0.42619	0.524000	0.50904	TTA	YEATS4	-	NULL	ENSG00000127337		0.343	YEATS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS4	HGNC	protein_coding	OTTHUMT00000403663.1	57	0.00	0	A	NM_006530		69764730	69764730	+1	no_errors	ENST00000247843	ensembl	human	known	69_37n	missense	24	56.36	31	SNP	0.998	C
ZP4	57829	genome.wustl.edu	37	1	238049097	238049097	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr1:238049097G>C	ENST00000366570.4	-	7	1087	c.929C>G	c.(928-930)aCc>aGc	p.T310S	RP11-193H5.1_ENST00000450451.1_RNA	NM_021186.3	NP_067009.1	Q12836	ZP4_HUMAN	zona pellucida glycoprotein 4	310	ZP. {ECO:0000255|PROSITE- ProRule:PRU00375}.				acrosomal vesicle exocytosis (GO:0060478)|binding of sperm to zona pellucida (GO:0007339)|intracellular signal transduction (GO:0035556)|multicellular organism reproduction (GO:0032504)|negative regulation of binding of sperm to zona pellucida (GO:2000360)|positive regulation of acrosome reaction (GO:2000344)|positive regulation of humoral immune response (GO:0002922)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of T cell proliferation (GO:0042102)|protein kinase A signaling (GO:0010737)|protein kinase C signaling (GO:0070528)|single fertilization (GO:0007338)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	acrosin binding (GO:0032190)|signal transducer activity (GO:0004871)			breast(6)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(8)|lung(42)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	73	Ovarian(103;0.103)	all_cancers(173;0.00175)|all_epithelial(177;0.162)|all_neural(198;0.164)|Melanoma(53;0.211)|Prostate(94;0.214)	OV - Ovarian serous cystadenocarcinoma(106;0.00989)			TCCAGGCTGGGTCTCAGGAAA	0.517																																					NSCLC(166;160 2029 11600 18754 19936)	dbGAP											0													136.0	133.0	134.0					1																	238049097		2203	4300	6503	-	-	-	SO:0001583	missense	0			U05781	CCDS1615.1	1q43	2013-01-17			ENSG00000116996	ENSG00000116996		"""Zona pellucida glycoproteins"""	15770	protein-coding gene	gene with protein product		613514				7841460	Standard	NM_021186		Approved	ZPB	uc001hym.3	Q12836	OTTHUMG00000039586	ENST00000366570.4:c.929C>G	1.37:g.238049097G>C	ENSP00000355529:p.Thr310Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAE1	Missense_Mutation	SNP	pfam_Zona_pellucida_Endoglin/CD105,pfam_P_trefoil,superfamily_P_trefoil,smart_P_trefoil,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105,prints_Endoglin/CD105_subgr	p.T310S	ENST00000366570.4	37	c.929	CCDS1615.1	1	.	.	.	.	.	.	.	.	.	.	G	3.182	-0.167612	0.06461	.	.	ENSG00000116996	ENST00000366570	D	0.81499	-1.5	4.55	1.46	0.22682	Zona pellucida sperm-binding protein (3);	0.271698	0.36409	N	0.002602	T	0.71879	0.3392	L	0.49778	1.585	0.09310	N	1	P	0.37370	0.592	B	0.40329	0.326	T	0.58457	-0.7633	10	0.13853	T	0.58	-5.6662	7.9941	0.30258	0.2926:0.0:0.7074:0.0	.	310	Q12836	ZP4_HUMAN	S	310	ENSP00000355529:T310S	ENSP00000355529:T310S	T	-	2	0	ZP4	236115720	0.211000	0.23529	0.455000	0.27031	0.353000	0.29299	1.780000	0.38634	0.082000	0.17018	-0.355000	0.07637	ACC	ZP4	-	pfam_Zona_pellucida_Endoglin/CD105,smart_Zona_pellucida_Endoglin/CD105,pfscan_Zona_pellucida_Endoglin/CD105	ENSG00000116996		0.517	ZP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZP4	HGNC	protein_coding	OTTHUMT00000095476.1	86	0.00	0	G			238049097	238049097	-1	no_errors	ENST00000366570	ensembl	human	known	69_37n	missense	134	17.79	29	SNP	0.016	C
ZNF669	79862	genome.wustl.edu	37	1	247265394	247265394	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EN-01A-11D-A17G-09	TCGA-BH-A1EN-11A-23W-A14R-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ca100ef0-be45-415f-909d-7172261d0084	ac317f91-d40e-4c6c-bca4-9220150a5af9	g.chr1:247265394C>T	ENST00000343381.6	-	2	455	c.283G>A	c.(283-285)Gtg>Atg	p.V95M	ZNF669_ENST00000358785.4_Missense_Mutation_p.V95M|ZNF669_ENST00000448299.2_Missense_Mutation_p.V9M|ZNF669_ENST00000366500.1_Missense_Mutation_p.V9M|ZNF669_ENST00000366501.1_Missense_Mutation_p.V9M	NM_024804.2	NP_079080.2	Q96BR6	ZN669_HUMAN	zinc finger protein 669	95	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(4)|large_intestine(2)|lung(6)	17	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			TTCACAGCCACATCCTCAAAA	0.468																																						dbGAP											0													69.0	69.0	69.0					1																	247265394		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31088.1, CCDS44345.1	1q44	2013-01-08			ENSG00000188295	ENSG00000188295		"""Zinc fingers, C2H2-type"", ""-"""	25736	protein-coding gene	gene with protein product						12477932	Standard	NM_024804		Approved	FLJ12606	uc001ice.2	Q96BR6	OTTHUMG00000040869	ENST00000343381.6:c.283G>A	1.37:g.247265394C>T	ENSP00000342818:p.Val95Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP94|Q5VT39|Q9H9Q6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V95M	ENST00000343381.6	37	c.283	CCDS31088.1	1	.	.	.	.	.	.	.	.	.	.	C	12.71	2.018263	0.35606	.	.	ENSG00000188295	ENST00000535105;ENST00000448299;ENST00000358785;ENST00000343381;ENST00000366501;ENST00000366500;ENST00000476158	T;T;T;T;T;T	0.10382	2.88;2.88;2.88;2.88;2.88;2.88	1.08	1.08	0.20341	Krueppel-associated box (4);	.	.	.	.	T	0.36303	0.0962	M	0.93420	3.415	0.28160	N	0.929015	D;D	0.67145	0.996;0.996	D;D	0.79108	0.992;0.992	T	0.11012	-1.0605	9	0.59425	D	0.04	.	5.4633	0.16630	0.0:1.0:0.0:0.0	.	9;95	B3KP94;Q96BR6	.;ZN669_HUMAN	M	9;9;95;95;9;9;95	ENSP00000404370:V9M;ENSP00000351636:V95M;ENSP00000342818:V95M;ENSP00000355457:V9M;ENSP00000355456:V9M;ENSP00000429550:V95M	ENSP00000342818:V95M	V	-	1	0	ZNF669	245332017	0.015000	0.18098	0.893000	0.35052	0.668000	0.39293	0.433000	0.21477	0.543000	0.28864	0.289000	0.19496	GTG	ZNF669	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000188295		0.468	ZNF669-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF669	HGNC	protein_coding	OTTHUMT00000098394.4	20	0.00	0	C	NM_024804		247265394	247265394	-1	no_errors	ENST00000343381	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	0.998	T
