#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACSF2	80221	genome.wustl.edu	37	17	48551936	48551936	+	3'UTR	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr17:48551936G>A	ENST00000300441.4	+	0	1975				ACSF2_ENST00000502667.1_3'UTR|ACSF2_ENST00000506085.1_3'UTR|ACSF2_ENST00000504392.1_3'UTR|ACSF2_ENST00000541920.1_3'UTR|ACSF2_ENST00000427954.2_3'UTR	NM_025149.4	NP_079425.3	Q96CM8	ACSF2_HUMAN	acyl-CoA synthetase family member 2						fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ligase activity (GO:0016874)			endometrium(7)|kidney(3)|large_intestine(1)|lung(1)|stomach(1)	13	Breast(11;1.93e-18)		BRCA - Breast invasive adenocarcinoma(22;1.55e-09)			GCCTGTCCTGGCCGGTTGGCT	0.483																																						dbGAP											0													69.0	73.0	72.0					17																	48551936		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK024573, BC012053	CCDS11567.1, CCDS74103.1, CCDS74104.1, CCDS74105.1	17q21.33	2007-10-17			ENSG00000167107	ENSG00000167107		"""Acyl-CoA synthetase family"""	26101	protein-coding gene	gene with protein product		610465				17762044	Standard	NM_001288968		Approved	FLJ20920, ACSMW	uc002iqu.2	Q96CM8	OTTHUMG00000162128	ENST00000300441.4:c.*23G>A	17.37:g.48551936G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFQ6|B4DHT5|B4DUF5|Q9H7G2	RNA	SNP	-	NULL	ENST00000300441.4	37	NULL	CCDS11567.1	17																																																																																			ACSF2	-	-	ENSG00000167107		0.483	ACSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSF2	HGNC	protein_coding	OTTHUMT00000367423.3	146	0.00	0	G	NM_025149		48551936	48551936	+1	no_errors	ENST00000506085	ensembl	human	known	69_37n	rna	28	36.36	16	SNP	0.012	A
AKAP12	9590	genome.wustl.edu	37	6	151674316	151674316	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr6:151674316delA	ENST00000253332.1	+	3	4979	c.4790delA	c.(4789-4791)gaafs	p.E1597fs	AKAP12_ENST00000354675.6_Frame_Shift_Del_p.E1499fs|AKAP12_ENST00000402676.2_Frame_Shift_Del_p.E1597fs|AKAP12_ENST00000359755.5_Frame_Shift_Del_p.E1492fs			Q02952	AKA12_HUMAN	A kinase (PRKA) anchor protein 12	1597					G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of protein kinase A signaling (GO:0010739)|protein targeting (GO:0006605)|regulation of protein kinase C signaling (GO:0090036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)	adenylate cyclase binding (GO:0008179)|protein kinase A binding (GO:0051018)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(22)|ovary(2)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	68		Ovarian(120;0.125)	BRCA - Breast invasive adenocarcinoma(37;0.175)	OV - Ovarian serous cystadenocarcinoma(155;2.98e-11)		ACGGAGAAAGAAGGAGAGGAA	0.488																																					Melanoma(141;1616 1805 10049 24534 51979)	dbGAP											0													72.0	72.0	72.0					6																	151674316		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			U81607	CCDS5229.1, CCDS5230.1	6q24-q25	2011-07-01	2008-08-29		ENSG00000131016	ENSG00000131016		"""A-kinase anchor proteins"""	370	protein-coding gene	gene with protein product	"""gravin"", ""Src-Suppressed C Kinase Substrate"""	604698	"""A kinase (PRKA) anchor protein (gravin) 12"""			9000000	Standard	NM_144497		Approved	AKAP250, SSeCKS	uc011eep.2	Q02952	OTTHUMG00000015833	ENST00000253332.1:c.4790delA	6.37:g.151674316delA	ENSP00000253332:p.Glu1597fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O00310|O00498|Q4LE68|Q5SZ80|Q5TGN1|Q68D82|Q99970	Frame_Shift_Del	DEL	pfam_Pkinase-A_anch_WSK-motif,pfam_RII_binding_1	p.G1598fs	ENST00000253332.1	37	c.4790	CCDS5229.1	6																																																																																			AKAP12	-	NULL	ENSG00000131016		0.488	AKAP12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AKAP12	HGNC	protein_coding	OTTHUMT00000042712.1	133	0.00	0	A			151674316	151674316	+1	no_errors	ENST00000253332	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	0.001	-
AMOTL1	154810	genome.wustl.edu	37	11	94532696	94532696	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr11:94532696G>A	ENST00000433060.2	+	3	481	c.340G>A	c.(340-342)Gag>Aag	p.E114K	AMOTL1_ENST00000317837.9_Missense_Mutation_p.E114K|AMOTL1_ENST00000317829.8_Missense_Mutation_p.E64K	NM_130847.2	NP_570899.1	Q8IY63	AMOL1_HUMAN	angiomotin like 1	114					establishment of cell polarity involved in ameboidal cell migration (GO:0003365)|hippo signaling (GO:0035329)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|Wnt signaling pathway (GO:0016055)	apical plasma membrane (GO:0016324)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|tight junction (GO:0005923)	identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(2)	36		Acute lymphoblastic leukemia(157;2.38e-05)|all_hematologic(158;0.00824)				CACCCCAACCGAGAACATGAA	0.542																																						dbGAP											0													53.0	56.0	55.0					11																	94532696		2046	4191	6237	-	-	-	SO:0001583	missense	0			AF453742	CCDS44712.1, CCDS73368.1	11q21	2008-07-18				ENSG00000166025			17811	protein-coding gene	gene with protein product	"""junction-enriched and associated protein"""	614657				11733531	Standard	XM_005273798		Approved	JEAP	uc001pfb.3	Q8IY63		ENST00000433060.2:c.340G>A	11.37:g.94532696G>A	ENSP00000387739:p.Glu114Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q63HK7|Q8NDN0|Q8TEN8|Q8WXD1|Q96CM5	Missense_Mutation	SNP	pfam_Angiomotin_C,prints_Angiomotin	p.E114K	ENST00000433060.2	37	c.340	CCDS44712.1	11	.	.	.	.	.	.	.	.	.	.	G	16.44	3.124248	0.56613	.	.	ENSG00000166025	ENST00000299004;ENST00000317829;ENST00000542840;ENST00000317837;ENST00000433060	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.04	5.04	0.67666	.	0.000000	0.64402	D	0.000002	T	0.64571	0.2610	M	0.72118	2.19	0.46927	D	0.999257	D;D	0.89917	0.994;1.0	P;D	0.71870	0.734;0.975	T	0.68720	-0.5334	10	0.72032	D	0.01	-30.6512	17.9573	0.89073	0.0:0.0:1.0:0.0	.	64;114	Q8IY63-2;Q8IY63	.;AMOL1_HUMAN	K	143;64;120;114;114	ENSP00000299004:E143K;ENSP00000320968:E64K;ENSP00000323474:E114K;ENSP00000387739:E114K	ENSP00000299004:E143K	E	+	1	0	AMOTL1	94172344	1.000000	0.71417	0.985000	0.45067	0.938000	0.57974	6.147000	0.71783	2.339000	0.79563	0.555000	0.69702	GAG	AMOTL1	-	NULL	ENSG00000166025		0.542	AMOTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMOTL1	HGNC	protein_coding	OTTHUMT00000396474.3	97	0.00	0	G	NM_130847		94532696	94532696	+1	no_errors	ENST00000433060	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.999	A
ANKRD20A5P	440482	genome.wustl.edu	37	18	14179217	14179217	+	RNA	DEL	A	A	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr18:14179217delA	ENST00000581935.1	+	0	122							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGGATTAGATAATAGATttgg	0.602																																						dbGAP											0																																										-	-	-			0			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179217delA		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1B6	RNA	DEL	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-	ENSG00000186481		0.602	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1	19	0.00	0	A			14179217	14179217	+1	no_errors	ENST00000581181	ensembl	human	known	69_37n	rna	0	40.00	2	DEL	0.001	-
ARHGEF19	128272	genome.wustl.edu	37	1	16532853	16532853	+	Intron	SNP	C	C	T			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr1:16532853C>T	ENST00000270747.3	-	7	1274				ARHGEF19_ENST00000478117.1_Intron	NM_153213.3	NP_694945.2	Q8IW93	ARHGJ_HUMAN	Rho guanine nucleotide exchange factor (GEF) 19						regulation of actin cytoskeleton organization (GO:0032956)|wound healing (GO:0042060)		GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			cervix(1)|endometrium(1)|lung(3)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	12		Colorectal(325;0.000147)|Renal(390;0.00145)|Breast(348;0.00224)|Lung NSC(340;0.00566)|all_lung(284;0.00831)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|Colorectal(212;3.48e-07)|COAD - Colon adenocarcinoma(227;2.19e-05)|BRCA - Breast invasive adenocarcinoma(304;9.46e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(313;0.0117)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGCACACACGGGGTCGAAA	0.652																																						dbGAP											0													29.0	26.0	27.0					1																	16532853		2197	4283	6480	-	-	-	SO:0001627	intron_variant	0			BC012982	CCDS170.1	1p36.13	2011-11-16			ENSG00000142632	ENSG00000142632		"""Rho guanine nucleotide exchange factors"""	26604	protein-coding gene	gene with protein product		612496				12477932	Standard	NM_153213		Approved	FLJ33962, WGEF	uc001ayc.1	Q8IW93	OTTHUMG00000002219	ENST00000270747.3:c.1138-18G>A	1.37:g.16532853C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ04|Q5TEV2|Q6PJQ4|Q8N244	Missense_Mutation	SNP	pfam_DH-domain,superfamily_DH-domain,pfscan_DH-domain	p.V57M	ENST00000270747.3	37	c.169	CCDS170.1	1	.	.	.	.	.	.	.	.	.	.	C	12.44	1.939925	0.34283	.	.	ENSG00000142632	ENST00000441785	T	0.45276	0.9	4.7	-0.125	0.13519	.	.	.	.	.	T	0.25865	0.0630	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.23440	-1.0188	5	.	.	.	.	3.1575	0.06509	0.2785:0.471:0.1546:0.0959	.	.	.	.	M	57	ENSP00000414370:V57M	.	V	-	1	0	ARHGEF19	16405440	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.442000	0.21628	0.079000	0.16929	0.555000	0.69702	GTG	ARHGEF19	-	superfamily_DH-domain	ENSG00000142632		0.652	ARHGEF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF19	HGNC	protein_coding	OTTHUMT00000006289.1	52	0.00	0	C	NM_153213		16532853	16532853	-1	no_start_codon	ENST00000441785	ensembl	human	known	69_37n	missense	45	24.59	15	SNP	0.000	T
C17orf49	124944	genome.wustl.edu	37	17	6920583	6920583	+	Silent	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr17:6920583G>A	ENST00000439424.2	+	6	594	c.518G>A	c.(517-519)tGa>tAa	p.*173*	C17orf49_ENST00000552402.1_Silent_p.*139*|C17orf49_ENST00000552775.1_Silent_p.L148L|RNASEK-C17orf49_ENST00000547302.2_Silent_p.*215*|AC040977.1_ENST00000593646.1_5'Flank|MIR497HG_ENST00000385056.1_RNA|MIR497HG_ENST00000385194.1_RNA|C17orf49_ENST00000547709.1_3'UTR|MIR497HG_ENST00000572453.1_RNA|RP11-589P10.7_ENST00000572547.1_RNA|C17orf49_ENST00000546495.1_Silent_p.L174L|MIR497HG_ENST00000443997.1_RNA|C17orf49_ENST00000546760.1_Silent_p.L139L	NM_001142798.2|NM_174893.3	NP_001136270.1|NP_777553.1	Q8IXM2	BAP18_HUMAN	chromosome 17 open reading frame 49	0					chromatin modification (GO:0016568)	MLL1 complex (GO:0071339)|NURF complex (GO:0016589)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			kidney(1)|large_intestine(2)|ovary(1)	4						CAGACAGCCTGACCCTGGATT	0.582																																						dbGAP											0													209.0	179.0	189.0					17																	6920583		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK055800	CCDS32542.1, CCDS45595.1, CCDS45596.1	17p13.1	2013-02-11			ENSG00000258315	ENSG00000258315			28737	protein-coding gene	gene with protein product	"""BPTF associated protein of 18 kDa"", ""human embryo lung cellular protein interacting with SARS-CoV nsp-10"""						Standard	NM_174893		Approved	MGC49942, BAP18, HEPIS		Q8IXM2	OTTHUMG00000170147	ENST00000439424.2:c.518G>A	17.37:g.6920583G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIV3|C9J4G0|E9PB29	Silent	SNP	superfamily_Homeodomain-like	p.L174	ENST00000439424.2	37	c.522	CCDS32542.1	17																																																																																			C17orf49	-	NULL	ENSG00000258315		0.582	C17orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf49	Clone_based_vega_gene	protein_coding	OTTHUMT00000407666.1	385	0.00	0	G	NM_174893		6920583	6920583	+1	no_errors	ENST00000546495	ensembl	human	known	69_37n	silent	19	13.64	3	SNP	1.000	A
SMIM7	79086	genome.wustl.edu	37	19	16770904	16770904	+	Silent	SNP	C	C	T			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr19:16770904C>T	ENST00000487416.2	-	1	64	c.18G>A	c.(16-18)ctG>ctA	p.L6L	TMEM38A_ENST00000187762.2_5'Flank|CTC-429P9.4_ENST00000600705.1_Silent_p.L6L|CTC-429P9.4_ENST00000593962.1_5'UTR|SMIM7_ENST00000397349.2_5'Flank|SMIM7_ENST00000597711.1_Silent_p.L6L|SMIM7_ENST00000358726.6_Silent_p.L6L	NM_024104.3	NP_077009.2	Q9BQ49	SMIM7_HUMAN	small integral membrane protein 7	6						integral component of membrane (GO:0016021)											ACCCGAACAGCAGGATGTCTC	0.612																																						dbGAP											0													40.0	42.0	41.0					19																	16770904		1976	4153	6129	-	-	-	SO:0001819	synonymous_variant	0			AK025602	CCDS12348.2, CCDS74307.1	19p13.11	2012-10-26	2012-10-26	2012-10-26	ENSG00000214046	ENSG00000214046			28419	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 42"""	C19orf42		12477932	Standard	NM_024104		Approved	MGC2747	uc002ner.3	Q9BQ49	OTTHUMG00000149895	ENST00000487416.2:c.18G>A	19.37:g.16770904C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX44	Silent	SNP	NULL	p.L6	ENST00000487416.2	37	c.18	CCDS12348.2	19																																																																																			C19orf42	-	NULL	ENSG00000214046		0.612	SMIM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf42	HGNC	protein_coding	OTTHUMT00000313801.2	43	0.00	0	C	NM_024104		16770904	16770904	-1	no_errors	ENST00000487803	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	1.000	T
C1orf54	79630	genome.wustl.edu	37	1	150248171	150248171	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr1:150248171C>T	ENST00000369102.1	+	5	922	c.152C>T	c.(151-153)aCc>aTc	p.T51I	C1orf54_ENST00000369098.3_Missense_Mutation_p.T51I|C1orf54_ENST00000369099.3_Missense_Mutation_p.T51I			Q8WWF1	CA054_HUMAN	chromosome 1 open reading frame 54	51						extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|urinary_tract(1)	7	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			GCAGATTTCACCATTGATTAC	0.363																																						dbGAP											0													87.0	83.0	84.0					1																	150248171		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC017761	CCDS948.1, CCDS72905.1	1q21.2	2012-06-25			ENSG00000118292	ENSG00000118292			26258	protein-coding gene	gene with protein product						12477932	Standard	NM_024579		Approved	FLJ23221	uc001eud.3	Q8WWF1	OTTHUMG00000012546	ENST00000369102.1:c.152C>T	1.37:g.150248171C>T	ENSP00000358098:p.Thr51Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H5P3	Missense_Mutation	SNP	NULL	p.T51I	ENST00000369102.1	37	c.152	CCDS948.1	1	.	.	.	.	.	.	.	.	.	.	c	13.73	2.324624	0.41197	.	.	ENSG00000118292	ENST00000369102;ENST00000369099;ENST00000369098	.	.	.	3.82	3.82	0.43975	.	0.000000	0.50627	D	0.000117	T	0.52256	0.1723	L	0.58101	1.795	0.29531	N	0.852775	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.43507	-0.9387	9	0.72032	D	0.01	-12.2284	11.529	0.50597	0.0:1.0:0.0:0.0	.	51;51	Q5TB16;Q8WWF1	.;CA054_HUMAN	I	51	.	ENSP00000358094:T51I	T	+	2	0	C1orf54	148514795	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.275000	0.51639	2.429000	0.82318	0.604000	0.83254	ACC	C1orf54	-	NULL	ENSG00000118292		0.363	C1orf54-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf54	HGNC	protein_coding	OTTHUMT00000035055.1	376	0.00	0	C	NM_024579		150248171	150248171	+1	no_errors	ENST00000369099	ensembl	human	known	69_37n	missense	85	11.46	11	SNP	1.000	T
CDS1	1040	genome.wustl.edu	37	4	85530598	85530598	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr4:85530598A>G	ENST00000295887.5	+	3	685	c.262A>G	c.(262-264)Ata>Gta	p.I88V		NM_001263.3	NP_001254.2	O96017	CHK2_HUMAN	CDP-diacylglycerol synthase (phosphatidate cytidylyltransferase) 1	412					cellular protein catabolic process (GO:0044257)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage checkpoint (GO:0000077)|DNA damage induced protein phosphorylation (GO:0006975)|double-strand break repair (GO:0006302)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|positive regulation of transcription, DNA-templated (GO:0045893)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of protein catabolic process (GO:0042176)|regulation of transcription, DNA-templated (GO:0006355)|replicative senescence (GO:0090399)|response to gamma radiation (GO:0010332)|signal transduction in response to DNA damage (GO:0042770)|signal transduction involved in intra-S DNA damage checkpoint (GO:0072428)|spindle assembly involved in mitosis (GO:0090307)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|liver(2)|lung(5)|ovary(1)	20		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.00101)		AAACTGGTGGATACGTGGAAT	0.348																																						dbGAP											0													261.0	243.0	249.0					4																	85530598		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65887	CCDS3608.1	4q21	2008-02-05			ENSG00000163624	ENSG00000163624	2.7.7.41		1800	protein-coding gene	gene with protein product		603548				9806839, 9115637	Standard	NM_001263		Approved		uc011ccv.2	Q92903	OTTHUMG00000130428	ENST00000295887.5:c.262A>G	4.37:g.85530598A>G	ENSP00000295887:p.Ile88Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3Y9|B7ZBF3|B7ZBF4|B7ZBF5|Q6QA03|Q6QA04|Q6QA05|Q6QA06|Q6QA07|Q6QA08|Q6QA10|Q6QA11|Q6QA12|Q6QA13|Q9HBS5|Q9HCQ8|Q9UGF0|Q9UGF1	Missense_Mutation	SNP	pfam_PC_trans,pirsf_PC_Trfase_euk	p.I88V	ENST00000295887.5	37	c.262	CCDS3608.1	4	.	.	.	.	.	.	.	.	.	.	A	8.313	0.822479	0.16678	.	.	ENSG00000163624	ENST00000295887	T	0.40756	1.02	5.57	5.57	0.84162	.	0.046280	0.85682	D	0.000000	T	0.24005	0.0581	N	0.05351	-0.065	0.48452	D	0.999651	B	0.15141	0.012	B	0.27076	0.076	T	0.10894	-1.0610	10	0.02654	T	1	-9.7953	15.7746	0.78204	1.0:0.0:0.0:0.0	.	88	Q92903	CDS1_HUMAN	V	88	ENSP00000295887:I88V	ENSP00000295887:I88V	I	+	1	0	CDS1	85749622	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.540000	0.53611	2.125000	0.65367	0.454000	0.30748	ATA	CDS1	-	pfam_PC_trans,pirsf_PC_Trfase_euk	ENSG00000163624		0.348	CDS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDS1	HGNC	protein_coding	OTTHUMT00000252817.2	619	0.00	0	A			85530598	85530598	+1	no_errors	ENST00000295887	ensembl	human	known	69_37n	missense	45	26.23	16	SNP	1.000	G
CHST3	9469	genome.wustl.edu	37	10	73767932	73767932	+	Silent	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr10:73767932G>A	ENST00000373115.4	+	3	1580	c.1143G>A	c.(1141-1143)aaG>aaA	p.K381K		NM_004273.4	NP_004264.2	Q7LGC8	CHST3_HUMAN	carbohydrate (chondroitin 6) sulfotransferase 3	381					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)|T cell homeostasis (GO:0043029)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin 6-sulfotransferase activity (GO:0008459)|proteoglycan sulfotransferase activity (GO:0050698)|sulfotransferase activity (GO:0008146)			endometrium(1)|lung(5)	6						CGCTGCAGAAGGCCCGCGAGA	0.711																																						dbGAP											0													8.0	9.0	9.0					10																	73767932		2020	3926	5946	-	-	-	SO:0001819	synonymous_variant	0			AB017915	CCDS7312.1	10q22.1	2007-03-14			ENSG00000122863	ENSG00000122863		"""Sulfotransferases, membrane-bound"""	1971	protein-coding gene	gene with protein product		603799				9883891, 9714738	Standard	NM_004273		Approved	C6ST, C6ST1	uc001jsn.3	Q7LGC8	OTTHUMG00000018431	ENST00000373115.4:c.1143G>A	10.37:g.73767932G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75099|Q52M30	Silent	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.K381	ENST00000373115.4	37	c.1143	CCDS7312.1	10																																																																																			CHST3	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	ENSG00000122863		0.711	CHST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST3	HGNC	protein_coding	OTTHUMT00000048563.1	9	0.00	0	G	NM_004273		73767932	73767932	+1	no_errors	ENST00000373115	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	1.000	A
COTL1	23406	genome.wustl.edu	37	16	84600388	84600388	+	3'UTR	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr16:84600388G>A	ENST00000262428.4	-	0	654				COTL1_ENST00000567278.1_5'UTR|COTL1_ENST00000564057.1_3'UTR	NM_021149.2	NP_066972.1	Q14019	COTL1_HUMAN	coactosin-like F-actin binding protein 1						defense response to fungus (GO:0050832)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	actin binding (GO:0003779)|enzyme binding (GO:0019899)			endometrium(1)|large_intestine(1)|liver(1)|lung(2)|skin(1)	6						TGAGGCCGGCGGTCCTCTCCC	0.677																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			L54057	CCDS10947.1	16q24.1	2014-03-05	2014-03-05	2002-08-01	ENSG00000103187	ENSG00000103187			18304	protein-coding gene	gene with protein product		606748	"""coactosin-like 1 (Dictyostelium)"""			10051563, 9326934, 16924104	Standard	NM_021149		Approved	CLP	uc002fid.3	Q14019	OTTHUMG00000137634	ENST00000262428.4:c.*63C>T	16.37:g.84600388G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDU3|D3DUL9|Q86XM5	RNA	SNP	-	NULL	ENST00000262428.4	37	NULL	CCDS10947.1	16																																																																																			COTL1	-	-	ENSG00000103187		0.677	COTL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COTL1	HGNC	protein_coding	OTTHUMT00000269075.1	74	0.00	0	G	NM_021149		84600388	84600388	-1	no_errors	ENST00000567278	ensembl	human	known	69_37n	rna	47	24.19	15	SNP	0.001	A
CRIPAK	285464	genome.wustl.edu	37	4	1388635	1388635	+	Silent	SNP	T	T	C	rs74518227	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr4:1388635T>C	ENST00000324803.4	+	1	3296	c.336T>C	c.(334-336)tgT>tgC	p.C112C		NM_175918.3	NP_787114.2	Q8N1N5	CRPAK_HUMAN	cysteine-rich PAK1 inhibitor	112					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of protein kinase activity (GO:0006469)|regulation of cytoskeleton organization (GO:0051493)|response to estrogen (GO:0043627)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.C112C(1)		NS(3)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(11)|ovary(1)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(1)	35			OV - Ovarian serous cystadenocarcinoma(23;0.0106)			CGTGCCCATGTGGAGTGCCCG	0.672													N|||	258	0.0515176	0.0348	0.0548	5008	,	,		16946	0.0069		0.0507	False		,,,				2504	0.1186					dbGAP											1	Substitution - coding silent(1)	prostate(1)											189.0	145.0	160.0					4																	1388635		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK096209	CCDS3349.1	4p16.3	2011-02-10	2006-09-04		ENSG00000179979	ENSG00000179979			26619	protein-coding gene	gene with protein product		610203	"""cysteine-rich PAK1inhibitor"""			16278681	Standard	NM_175918		Approved	FLJ34443	uc003gdf.2	Q8N1N5	OTTHUMG00000121131	ENST00000324803.4:c.336T>C	4.37:g.1388635T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB03	Silent	SNP	smart_Post-SET_dom	p.C112	ENST00000324803.4	37	c.336	CCDS3349.1	4	.	.	.	.	.	.	.	.	.	.	-	5.811	0.333996	0.11013	.	.	ENSG00000179979	ENST00000382944	.	.	.	0.948	-1.08	0.09936	.	.	.	.	.	T	0.21427	0.0516	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.27123	-1.0083	5	0.25106	T	0.35	.	4.049	0.09786	0.3111:0.0:0.0:0.6889	.	.	.	.	R	96	.	ENSP00000372402:W96R	W	+	1	0	CRIPAK	1378635	0.000000	0.05858	0.002000	0.10522	0.008000	0.06430	-1.127000	0.03251	-0.202000	0.10268	0.102000	0.15555	TGG	CRIPAK	-	smart_Post-SET_dom	ENSG00000179979		0.672	CRIPAK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRIPAK	HGNC	protein_coding	OTTHUMT00000241607.2	99	1.00	1	T	NM_175918		1388635	1388635	+1	no_errors	ENST00000324803	ensembl	human	known	69_37n	silent	127	20.13	32	SNP	0.008	C
CTH	1491	genome.wustl.edu	37	1	70904845	70904845	+	3'UTR	DEL	G	G	-	rs374978160		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr1:70904845delG	ENST00000370938.3	+	0	1397				CTH_ENST00000346806.2_3'UTR|CTH_ENST00000411986.2_3'UTR	NM_001902.5	NP_001893.2	Q96IQ7	VSIG2_HUMAN	cystathionine gamma-lyase							integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	18						TGCTTCCTGTGAAGATCAAAT	0.363																																						dbGAP											0													86.0	91.0	89.0					1																	70904845		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			BC015807	CCDS650.1, CCDS651.1, CCDS53333.1	1p31.1	2014-06-24	2014-06-24		ENSG00000116761	ENSG00000116761	4.4.1.1		2501	protein-coding gene	gene with protein product		607657	"""cystathionase (cystathionine gamma-lyase)"""			1339280	Standard	NM_001902		Approved		uc001dfd.3	P32929	OTTHUMG00000009352	ENST00000370938.3:c.*35G>-	1.37:g.70904845delG		Somatic		WXS	Illumina GAIIx	Phase_IV	O95791|Q9NX42	RNA	DEL	-	NULL	ENST00000370938.3	37	NULL	CCDS650.1	1																																																																																			CTH	-	-	ENSG00000116761		0.363	CTH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTH	HGNC	protein_coding	OTTHUMT00000025918.1	213	0.00	0	G	NM_001902		70904845	70904845	+1	no_errors	ENST00000482383	ensembl	human	known	69_37n	rna	16	11.11	2	DEL	0.001	-
CYB5A	1528	genome.wustl.edu	37	18	71930670	71930670	+	Missense_Mutation	SNP	C	C	T	rs528890824	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr18:71930670C>T	ENST00000340533.4	-	2	312	c.172G>A	c.(172-174)Gac>Aac	p.D58N	CYB5A_ENST00000397914.4_Missense_Mutation_p.D58N|CYB5A_ENST00000494131.2_Missense_Mutation_p.D58N|CYB5A_ENST00000299438.9_5'UTR|CYB5A_ENST00000579064.1_5'Flank	NM_148923.3	NP_683725.1	P00167	CYB5_HUMAN	cytochrome b5 type A (microsomal)	58	Cytochrome b5 heme-binding. {ECO:0000255|PROSITE-ProRule:PRU00279}.				hydrogen ion transmembrane transport (GO:1902600)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)	aldo-keto reductase (NADP) activity (GO:0004033)|cytochrome-c oxidase activity (GO:0004129)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(1)|skin(1)	4		Esophageal squamous(42;0.0749)|Prostate(75;0.157)|Melanoma(33;0.211)				TCAGTAGCGTCACCTCCAGCT	0.418													C|||	2	0.000399361	0.0015	0.0	5008	,	,		15957	0.0		0.0	False		,,,				2504	0.0				NSCLC(176;1530 2076 2606 27426 50572)|Ovarian(151;328 1870 2837 37860 52175)	dbGAP											0													121.0	111.0	114.0					18																	71930670		2203	4300	6503	-	-	-	SO:0001583	missense	0			M22865	CCDS12004.1, CCDS12005.1, CCDS54188.1	18q23	2006-01-30	2006-01-30	2006-01-30	ENSG00000166347	ENSG00000166347		"""Cytochrome b genes"""	2570	protein-coding gene	gene with protein product		613218	"""cytochrome b-5"", ""cytochrome b5 (microsomal)"""	CYB5		1840560	Standard	NM_148923		Approved		uc002lli.3	P00167	OTTHUMG00000132843	ENST00000340533.4:c.172G>A	18.37:g.71930670C>T	ENSP00000341625:p.Asp58Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV91|F8WEU4|Q6IB14	Missense_Mutation	SNP	pfam_Cyt_B5,superfamily_Cyt_B5,prints_Cyt_B5,pfscan_Cyt_B5	p.D58N	ENST00000340533.4	37	c.172	CCDS12004.1	18	.	.	.	.	.	.	.	.	.	.	C	32	5.168753	0.94768	.	.	ENSG00000166347	ENST00000397914;ENST00000340533;ENST00000299438	D;D	0.94184	-3.37;-3.37	5.79	5.79	0.91817	Cytochrome b5 (5);	0.043065	0.85682	D	0.000000	D	0.95765	0.8622	M	0.89163	3.01	0.80722	D	1	P;B	0.40197	0.706;0.142	P;B	0.45829	0.494;0.081	D	0.96056	0.9035	10	0.72032	D	0.01	-1.542	18.8188	0.92088	0.0:1.0:0.0:0.0	.	58;58	P00167;P00167-2	CYB5_HUMAN;.	N	58	ENSP00000381011:D58N;ENSP00000341625:D58N	ENSP00000299438:D58N	D	-	1	0	CYB5A	70081650	0.996000	0.38824	0.994000	0.49952	0.853000	0.48598	3.460000	0.53028	2.722000	0.93159	0.655000	0.94253	GAC	CYB5A	-	pfam_Cyt_B5,superfamily_Cyt_B5,prints_Cyt_B5,pfscan_Cyt_B5	ENSG00000166347		0.418	CYB5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5A	HGNC	protein_coding	OTTHUMT00000256316.1	250	0.00	0	C	NM_001914, NM_148923		71930670	71930670	-1	no_errors	ENST00000340533	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	T
DMXL1	1657	genome.wustl.edu	37	5	118465089	118465089	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr5:118465089C>A	ENST00000311085.8	+	10	1366	c.1286C>A	c.(1285-1287)tCt>tAt	p.S429Y	DMXL1_ENST00000539542.1_Missense_Mutation_p.S429Y	NM_005509.4	NP_005500.4	Q9Y485	DMXL1_HUMAN	Dmx-like 1	429										breast(3)|central_nervous_system(1)|endometrium(14)|kidney(4)|large_intestine(20)|liver(6)|lung(28)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)	86		all_cancers(142;0.0314)|all_epithelial(76;0.00559)|Prostate(80;0.11)|Breast(839;0.231)		OV - Ovarian serous cystadenocarcinoma(64;0.000563)|Epithelial(69;0.00179)|all cancers(49;0.0243)		GTAGAAGATTCTAATCAGGCA	0.308																																						dbGAP											0													33.0	35.0	35.0					5																	118465089		2201	4299	6500	-	-	-	SO:0001583	missense	0			AJ005821	CCDS4125.1, CCDS75289.1	5q22	2013-01-10			ENSG00000172869	ENSG00000172869		"""WD repeat domain containing"""	2937	protein-coding gene	gene with protein product		605671				10708522	Standard	NM_005509		Approved		uc003ksd.2	Q9Y485	OTTHUMG00000128898	ENST00000311085.8:c.1286C>A	5.37:g.118465089C>A	ENSP00000309690:p.Ser429Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S429Y	ENST00000311085.8	37	c.1286	CCDS4125.1	5	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296648	0.40594	.	.	ENSG00000172869	ENST00000503802;ENST00000311085;ENST00000539542	T;T;T	0.48836	0.8;0.8;0.8	5.83	1.81	0.25067	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.678318	0.15568	N	0.255616	T	0.43831	0.1265	L	0.54323	1.7	0.27101	N	0.962618	B;B	0.09022	0.002;0.0	B;B	0.04013	0.001;0.001	T	0.40421	-0.9564	10	0.59425	D	0.04	-1.5499	13.3757	0.60736	0.1127:0.4968:0.3905:0.0	.	429;429	F5H269;Q9Y485	.;DMXL1_HUMAN	Y	429	ENSP00000427692:S429Y;ENSP00000309690:S429Y;ENSP00000439479:S429Y	ENSP00000309690:S429Y	S	+	2	0	DMXL1	118492988	0.165000	0.22948	0.841000	0.33234	0.975000	0.68041	0.488000	0.22371	0.023000	0.15187	0.585000	0.79938	TCT	DMXL1	-	superfamily_WD40_repeat_dom	ENSG00000172869		0.308	DMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMXL1	HGNC	protein_coding	OTTHUMT00000250862.1	124	0.00	0	C	NM_005509		118465089	118465089	+1	no_errors	ENST00000539542	ensembl	human	known	69_37n	missense	34	18.60	8	SNP	0.615	A
DYNC1H1	1778	genome.wustl.edu	37	14	102500367	102500367	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr14:102500367G>T	ENST00000360184.4	+	55	10632	c.10468G>T	c.(10468-10470)Gaa>Taa	p.E3490*	RP11-1017G21.4_ENST00000557551.1_RNA|DYNC1H1_ENST00000556791.1_3'UTR|RP11-1017G21.4_ENST00000553701.1_RNA|RP11-1017G21.4_ENST00000557242.1_RNA	NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	3490	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						TGAACGATGGGAAAAAACAAG	0.483																																						dbGAP											0													137.0	138.0	137.0					14																	102500367		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.10468G>T	14.37:g.102500367G>T	ENSP00000348965:p.Glu3490*	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Nonsense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.E3490*	ENST00000360184.4	37	c.10468	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	G	53	21.365860	0.99939	.	.	ENSG00000197102	ENST00000360184	.	.	.	5.72	4.83	0.62350	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	.	15.2431	0.73485	0.0677:0.0:0.9323:0.0	.	.	.	.	X	3490	.	ENSP00000348965:E3490X	E	+	1	0	DYNC1H1	101570120	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	9.755000	0.98912	1.561000	0.49584	0.655000	0.94253	GAA	DYNC1H1	-	NULL	ENSG00000197102		0.483	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	180	0.00	0	G	NM_001376		102500367	102500367	+1	no_errors	ENST00000360184	ensembl	human	known	69_37n	nonsense	30	11.76	4	SNP	1.000	T
EPHA6	285220	genome.wustl.edu	37	3	96706581	96706581	+	Silent	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr3:96706581G>A	ENST00000389672.5	+	3	896	c.858G>A	c.(856-858)ggG>ggA	p.G286G	EPHA6_ENST00000542517.1_Silent_p.G192G|EPHA6_ENST00000470610.2_Silent_p.G286G	NM_001080448.2	NP_001073917.2	Q9UF33	EPHA6_HUMAN	EPH receptor A6	192						integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(2)|lung(60)|ovary(3)|skin(11)|stomach(5)|upper_aerodigestive_tract(2)	101						AAGACATTGGGGCGTGCATTG	0.453																																						dbGAP											0													232.0	241.0	238.0					3																	96706581		1955	4185	6140	-	-	-	SO:0001819	synonymous_variant	0			AK092565	CCDS46876.1, CCDS54616.1, CCDS63697.1	3q12.1	2013-02-11	2004-10-28		ENSG00000080224	ENSG00000080224		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19296	protein-coding gene	gene with protein product		600066				12471243	Standard	NM_001080448		Approved	FLJ35246	uc010how.1	Q9UF33	OTTHUMG00000159208	ENST00000389672.5:c.858G>A	3.37:g.96706581G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D6RAL5	Missense_Mutation	SNP	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	p.G231S	ENST00000389672.5	37	c.691	CCDS46876.1	3	.	.	.	.	.	.	.	.	.	.	G	4.757	0.140838	0.09083	.	.	ENSG00000080224	ENST00000506569	T	0.52983	0.64	5.48	-0.466	0.12153	.	0.000000	0.64402	U	0.000002	T	0.48187	0.1486	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44143	-0.9347	7	0.87932	D	0	.	4.4288	0.11517	0.4626:0.0:0.3714:0.166	.	.	.	.	S	231	ENSP00000425132:G231S	ENSP00000425132:G231S	G	+	1	0	EPHA6	98189271	0.980000	0.34600	0.996000	0.52242	0.735000	0.41995	0.280000	0.18790	-0.012000	0.14223	-0.136000	0.14681	GGC	EPHA6	-	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom	ENSG00000080224		0.453	EPHA6-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	EPHA6	HGNC	protein_coding	OTTHUMT00000353845.3	204	0.00	0	G	NM_001080448		96706581	96706581	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000506569	ensembl	human	putative	69_37n	missense	17	34.62	9	SNP	0.977	A
FAM157B	100132403	genome.wustl.edu	37	9	141107536	141107537	+	lincRNA	INS	-	-	GCA	rs367832601|rs554298933|rs370981092		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr9:141107536_141107537insGCA	ENST00000446912.2	+	0	19_20							P0CG42	F157B_HUMAN	family with sequence similarity 157, member B																		CGgcagcggcggcagcagcagc	0.545																																						dbGAP											0																																										-	-	-			0					9q34	2013-01-24			ENSG00000233013	ENSG00000233013			34080	other	unknown							Standard	NM_001145249		Approved		uc011mfe.1	P0CG42	OTTHUMG00000021000		9.37:g.141107543_141107545dupGCA		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	INS	-	NULL	ENST00000446912.2	37	NULL		9																																																																																			FAM157B	-	-	ENSG00000233013		0.545	FAM157B-001	KNOWN	mRNA_end_NF|basic	lincRNA	FAM157B	HGNC	lincRNA	OTTHUMT00000055378.2	70	0.00	0	-	NM_001145249		141107536	141107537	+1	no_errors	ENST00000446912	ensembl	human	known	69_37n	rna	48	28.36	19	INS	0.033:0.036	GCA
LOC101929008	101929008	genome.wustl.edu	37	16	90168691	90168691	+	lincRNA	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr16:90168691G>A	ENST00000562203.1	-	0	832																											AAGAACTGgcggcggcagcag	0.577																																						dbGAP											0																																										-	-	-			0																															16.37:g.90168691G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000562203.1	37	NULL		16																																																																																			FAM157C	-	-	ENSG00000260528		0.577	RP11-356C4.3-001	KNOWN	basic	lincRNA	FAM157C	HGNC	lincRNA	OTTHUMT00000420874.1	72	0.00	0	G			90168691	90168691	+1	no_errors	ENST00000563357	ensembl	human	known	69_37n	rna	88	13.73	14	SNP	0.006	A
GALNT10	55568	genome.wustl.edu	37	5	153789185	153789185	+	Missense_Mutation	SNP	G	G	T	rs375000619		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr5:153789185G>T	ENST00000297107.6	+	9	1386	c.1249G>T	c.(1249-1251)Gct>Tct	p.A417S	SAP30L-AS1_ENST00000524264.1_RNA|GALNT10_ENST00000377657.3_Missense_Mutation_p.A90S|SAP30L-AS1_ENST00000519727.1_RNA|GALNT10_ENST00000377661.2_Missense_Mutation_p.A355S	NM_198321.3	NP_938080.1	Q86SR1	GLT10_HUMAN	polypeptide N-acetylgalactosaminyltransferase 10	417					cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(12)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	32	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)|all_hematologic(541;0.21)	Kidney(363;8.21e-05)|KIRC - Kidney renal clear cell carcinoma(527;0.000577)			ccacctctccgctggggatgt	0.537																																						dbGAP											0													101.0	109.0	107.0					5																	153789185		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023782	CCDS4325.1	5q34	2014-03-13	2014-03-13		ENSG00000164574	ENSG00000164574	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	19873	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 10"""	608043	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 10 (GalNAc-T10)"""			12417297	Standard	NM_198321		Approved	GalNAc-T10	uc003lvh.3	Q86SR1	OTTHUMG00000130145	ENST00000297107.6:c.1249G>T	5.37:g.153789185G>T	ENSP00000297107:p.Ala417Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXC9|Q6IN56|Q86VP8|Q8IXJ2|Q8TEJ2|Q96IV2|Q9H8E1|Q9Y4M4	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.A417S	ENST00000297107.6	37	c.1249	CCDS4325.1	5	.	.	.	.	.	.	.	.	.	.	G	18.65	3.669993	0.67814	.	.	ENSG00000164574	ENST00000297107;ENST00000377661;ENST00000377657	T;T;T	0.68624	-0.34;-0.34;-0.34	5.08	2.92	0.33932	.	0.158123	0.56097	D	0.000032	T	0.68787	0.3039	L	0.48260	1.515	0.40766	D	0.983044	P;B;B	0.49961	0.93;0.123;0.064	P;B;B	0.57152	0.814;0.124;0.139	T	0.65162	-0.6235	10	0.22109	T	0.4	.	11.9725	0.53071	0.1717:0.0:0.8283:0.0	.	355;88;417	Q86SR1-2;D6R8Y1;Q86SR1	.;.;GLT10_HUMAN	S	417;355;90	ENSP00000297107:A417S;ENSP00000366889:A355S;ENSP00000366885:A90S	ENSP00000297107:A417S	A	+	1	0	GALNT10	153769378	1.000000	0.71417	0.198000	0.23420	0.765000	0.43378	3.699000	0.54778	1.124000	0.41980	0.561000	0.74099	GCT	GALNT10	-	NULL	ENSG00000164574		0.537	GALNT10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT10	HGNC	protein_coding	OTTHUMT00000252453.1	135	0.00	0	G	NM_198321		153789185	153789185	+1	no_errors	ENST00000297107	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.672	T
GPR112	139378	genome.wustl.edu	37	X	135430311	135430311	+	Silent	SNP	C	C	A	rs188598421		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chrX:135430311C>A	ENST00000394143.1	+	6	4737	c.4446C>A	c.(4444-4446)tcC>tcA	p.S1482S	GPR112_ENST00000412101.1_Silent_p.S1277S|GPR112_ENST00000370652.1_Silent_p.S1482S|GPR112_ENST00000287534.4_Silent_p.S1419S|GPR112_ENST00000394141.1_Silent_p.S1277S	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	1482					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					CAGTTCTCTCCGACAGGATCA	0.438																																						dbGAP											0													100.0	99.0	99.0					X																	135430311		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.4446C>A	X.37:g.135430311C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.S1482	ENST00000394143.1	37	c.4446	CCDS35409.1	X																																																																																			GPR112	-	NULL	ENSG00000156920		0.438	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	58	0.00	0	C			135430311	135430311	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	silent	54	16.92	11	SNP	0.001	A
IL21R	50615	genome.wustl.edu	37	16	27457410	27457411	+	Splice_Site	DEL	GT	GT	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr16:27457410_27457411delGT	ENST00000337929.3	+	8	1340		c.e8+1		IL21R_ENST00000564583.1_Splice_Site|IL21R-AS1_ENST00000563191.1_RNA|IL21R_ENST00000395754.4_Splice_Site|IL21R_ENST00000564089.1_Splice_Site|IL21R_ENST00000395755.1_Splice_Site	NM_181078.2	NP_851564.1	Q9HBE5	IL21R_HUMAN	interleukin 21 receptor						interleukin-21-mediated signaling pathway (GO:0038114)|natural killer cell activation (GO:0030101)	integral component of membrane (GO:0016021)	interleukin-21 receptor activity (GO:0001532)			breast(2)|large_intestine(3)|lung(1)|ovary(2)	8						AGACTTCAAGGTGAGCTCCCGA	0.649			T	BCL6	NHL																																	dbGAP		Dom	yes		16	16p11	50615	interleukin 21 receptor		L	0																																										-	-	-	SO:0001630	splice_region_variant	0			AF254067	CCDS10630.1	16p11	2014-09-17			ENSG00000103522	ENSG00000103522		"""Interleukins and interleukin receptors"", ""CD molecules"""	6006	protein-coding gene	gene with protein product		605383				11081504	Standard	NM_181078		Approved	CD360	uc002dos.2	Q9HBE5	OTTHUMG00000131675	ENST00000337929.3:c.867+1GT>-	16.37:g.27457410_27457411delGT		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9E8|D3DWF7|Q96HZ1|Q9HB91	Splice_Site	DEL	-	e7+1	ENST00000337929.3	37	c.867+1_867+1	CCDS10630.1	16																																																																																			IL21R	-	-	ENSG00000103522		0.649	IL21R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL21R	HGNC	protein_coding	OTTHUMT00000254578.2	56	0.00	0	GT	NM_181078	Intron	27457410	27457411	+1	no_errors	ENST00000337929	ensembl	human	known	69_37n	splice_site_del	17	10.53	2	DEL	1.000:0.992	-
KRTAP5-2	440021	genome.wustl.edu	37	11	1619181	1619181	+	Silent	SNP	G	G	A	rs61869704|rs59506446		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr11:1619181G>A	ENST00000412090.1	-	1	343	c.300C>T	c.(298-300)tcC>tcT	p.S100S	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	100	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		AACCCCCACAGGAGCCACAGC	0.662																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.300C>T	11.37:g.1619181G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9JTZ1	Silent	SNP	NULL	p.S100	ENST00000412090.1	37	c.300	CCDS31331.1	11																																																																																			KRTAP5-2	-	NULL	ENSG00000205867		0.662	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-2	HGNC	protein_coding	OTTHUMT00000384775.1	102	0.00	0	G	NM_001004325		1619181	1619181	-1	no_errors	ENST00000412090	ensembl	human	known	69_37n	silent	66	10.81	8	SNP	0.053	A
KRTAP5-2	440021	genome.wustl.edu	37	11	1619184	1619184	+	Silent	SNP	G	G	A	rs36134435|rs59506446		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr11:1619184G>A	ENST00000412090.1	-	1	340	c.297C>T	c.(295-297)ggC>ggT	p.G99G	KRTAP5-AS1_ENST00000532922.1_RNA|KRTAP5-AS1_ENST00000524947.1_RNA|KRTAP5-AS1_ENST00000534077.1_RNA|KRTAP5-AS1_ENST00000424148.1_RNA	NM_001004325.1	NP_001004325.1	Q701N4	KRA52_HUMAN	keratin associated protein 5-2	99	6 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)				large_intestine(1)|lung(2)|skin(1)	4		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		CCCCACAGGAGCCACAGCCCC	0.652																																						dbGAP											0													55.0	76.0	69.0					11																	1619184		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			AB126071	CCDS31331.1	11p15.5	2008-02-05				ENSG00000205867		"""Keratin associated proteins"""	23597	protein-coding gene	gene with protein product						15144888	Standard	NM_001004325		Approved	KRTAP5.2, KRTAP5-8	uc001ltv.3	Q701N4		ENST00000412090.1:c.297C>T	11.37:g.1619184G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9JTZ1	Silent	SNP	NULL	p.G99	ENST00000412090.1	37	c.297	CCDS31331.1	11																																																																																			KRTAP5-2	-	NULL	ENSG00000205867		0.652	KRTAP5-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-2	HGNC	protein_coding	OTTHUMT00000384775.1	90	0.00	0	G	NM_001004325		1619184	1619184	-1	no_errors	ENST00000412090	ensembl	human	known	69_37n	silent	58	15.94	11	SNP	0.365	A
MUC3A	4584	genome.wustl.edu	37	7	100552549	100552549	+	Missense_Mutation	SNP	C	C	A	rs73163760		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr7:100552549C>A	ENST00000319509.7	+	1	1300	c.1300C>A	c.(1300-1302)Cta>Ata	p.L434I				Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated	2099	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						TGTGATCCCCCTACCTCTTCC	0.557																																						dbGAP											0													245.0	236.0	239.0					7																	100552549		876	1991	2867	-	-	-	SO:0001583	missense	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.1300C>A	7.37:g.100552549C>A	ENSP00000324834:p.Leu434Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	Missense_Mutation	SNP	pfam_SEA,smart_EGF-like,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.L434I	ENST00000319509.7	37	c.1300		7	.	.	.	.	.	.	.	.	.	.	C	7.456	0.643657	0.14451	.	.	ENSG00000169894	ENST00000319509	T	0.06528	3.29	1.79	0.871	0.19107	.	.	.	.	.	T	0.03136	0.0092	N	0.08118	0	0.30974	N	0.7227589999999999	B	0.06786	0.001	B	0.01281	0.0	T	0.34079	-0.9843	8	0.35671	T	0.21	0.0359	5.9851	0.19430	0.0:0.8151:0.0:0.1849	.	2099	Q02505	MUC3A_HUMAN	I	434	ENSP00000324834:L434I	ENSP00000324834:L434I	L	+	1	2	MUC3A	100390485	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.131000	0.10482	0.294000	0.22547	0.467000	0.42956	CTA	MUC3A	-	NULL	ENSG00000169894		0.557	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	MUC3A	HGNC	protein_coding	OTTHUMT00000347215.1	9	0.00	0	C	XM_001725354		100552549	100552549	+1	no_start_codon	ENST00000319509	ensembl	human	known	69_37n	missense	30	18.92	7	SNP	0.020	A
MGAM	8972	genome.wustl.edu	37	7	141794263	141794263	+	Intron	SNP	A	A	G	rs3087322	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr7:141794263A>G	ENST00000549489.2	+	39	4713				MGAM_ENST00000475668.2_Silent_p.T2424T	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)						carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)			cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GAGACAACACAGCCGCGTGGG	0.622													N|||	1149	0.229433	0.1687	0.3501	5008	,	,		16158	0.0833		0.2376	False		,,,				2504	0.3681					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.4619-157A>G	7.37:g.141794263A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Silent	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.T2425	ENST00000549489.2	37	c.7275	CCDS47727.1	7																																																																																			MGAM	-	pfam_Glyco_hydro_31,superfamily_Glycoside_hydrolase_SF	ENSG00000257335		0.622	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	57	0.00	0	A			141794263	141794263	+1	no_errors	ENST00000475668	ensembl	human	putative	69_37n	silent	35	12.50	5	SNP	0.003	G
NASP	4678	genome.wustl.edu	37	1	46073222	46073222	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr1:46073222delA	ENST00000350030.3	+	6	726	c.639delA	c.(637-639)gcafs	p.A213fs	NASP_ENST00000402363.3_Frame_Shift_Del_p.A215fs|NASP_ENST00000372052.4_Intron|NASP_ENST00000537798.1_Frame_Shift_Del_p.A149fs|NASP_ENST00000351223.3_Intron	NM_002482.3	NP_002473.2	P49321	NASP_HUMAN	nuclear autoantigenic sperm protein (histone-binding)	213	Glu-rich (acidic).|Histone-binding.				blastocyst development (GO:0001824)|cell cycle (GO:0007049)|cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|DNA replication-independent nucleosome assembly (GO:0006336)|histone exchange (GO:0043486)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)	Hsp90 protein binding (GO:0051879)			breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	17	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.211)					CTGAAGAGGCAAAAGGAGGAG	0.453																																						dbGAP											0													43.0	46.0	45.0					1																	46073222		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			M97856	CCDS524.1, CCDS525.1, CCDS55597.1	1p34.1	2013-01-10			ENSG00000132780	ENSG00000132780		"""Tetratricopeptide (TTC) repeat domain containing"""	7644	protein-coding gene	gene with protein product		603185				1426632	Standard	NM_002482		Approved	FLB7527, FLJ31599, FLJ35510, MGC19722, MGC20372, MGC2297, DKFZp547F162, PRO1999	uc001coi.2	P49321	OTTHUMG00000007826	ENST00000350030.3:c.639delA	1.37:g.46073222delA	ENSP00000255120:p.Ala213fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6H2|B4DQP3|D3DQ07|F5H3J2|Q53GW5|Q5T622|Q5T625|Q96A69|Q9BTW2	Frame_Shift_Del	DEL	pfam_Tetratricopeptide_SHNi-TPR_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.G217fs	ENST00000350030.3	37	c.645	CCDS524.1	1																																																																																			NASP	-	NULL	ENSG00000132780		0.453	NASP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NASP	HGNC	protein_coding	OTTHUMT00000021533.2	77	0.00	0	A	NM_002482		46073222	46073222	+1	no_errors	ENST00000402363	ensembl	human	known	69_37n	frame_shift_del	56	12.50	8	DEL	0.076	-
NLRP2	55655	genome.wustl.edu	37	19	55501622	55501622	+	Intron	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr19:55501622G>A	ENST00000543010.1	+	9	2680				NLRP2_ENST00000391721.4_Intron|NLRP2_ENST00000263437.6_Intron|NLRP2_ENST00000339757.7_Intron|NLRP2_ENST00000448584.2_Intron|NLRP2_ENST00000537859.1_Intron|NLRP2_ENST00000427260.2_Intron|NLRP2_ENST00000538819.1_Intron	NM_001174081.1	NP_001167552.1	Q9NX02	NALP2_HUMAN	NLR family, pyrin domain containing 2						positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|Pyrin domain binding (GO:0032090)			large_intestine(4)|liver(1)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)	11			BRCA - Breast invasive adenocarcinoma(297;0.163)	GBM - Glioblastoma multiforme(193;0.028)		GACGAGCAATGGTCATGCCTG	0.502																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK000517	CCDS12913.1, CCDS54318.1, CCDS54319.1	19q13.42	2008-02-05	2006-12-08	2006-12-08	ENSG00000022556	ENSG00000022556		"""Nucleotide-binding domain and leucine rich repeat containing"""	22948	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 2"""	609364	"""NACHT, leucine rich repeat and PYD containing 2"""	NALP2		12563287, 11270363	Standard	NM_001174081		Approved	FLJ20510, PYPAF2, NBS1, PAN1, CLR19.9	uc021vbq.1	Q9NX02	OTTHUMG00000167763	ENST00000543010.1:c.2537+62G>A	19.37:g.55501622G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZL7|I3L0G4|Q53FL5|Q59G09|Q8IXT0|Q9BVN5|Q9H6G6|Q9HAV9|Q9NWK3	Missense_Mutation	SNP	NULL	p.M75I	ENST00000543010.1	37	c.225	CCDS12913.1	19																																																																																			NLRP2	-	NULL	ENSG00000022556		0.502	NLRP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP2	HGNC	protein_coding	OTTHUMT00000396152.1	90	0.00	0	G	NM_017852		55501622	55501622	+1	no_start_codon	ENST00000543277	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.000	A
NPTX1	4884	genome.wustl.edu	37	17	78447237	78447237	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr17:78447237T>G	ENST00000306773.4	-	3	817	c.660A>C	c.(658-660)aaA>aaC	p.K220N	NPTX1_ENST00000575212.1_5'UTR	NM_002522.3	NP_002513.2	Q15818	NPTX1_HUMAN	neuronal pentraxin I	220					axonogenesis involved in innervation (GO:0060385)|cellular response to glucose stimulus (GO:0071333)|cellular response to potassium ion (GO:0035865)|central nervous system development (GO:0007417)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mitochondrial transport (GO:0006839)|synaptic transmission (GO:0007268)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)	11	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0232)|OV - Ovarian serous cystadenocarcinoma(97;0.0487)			GGCGGTTGTCTTTCTGACCTG	0.537																																						dbGAP											0													215.0	180.0	191.0					17																	78447237		2203	4300	6503	-	-	-	SO:0001583	missense	0			U61849	CCDS32762.1	17q25.3	2008-05-14				ENSG00000171246			7952	protein-coding gene	gene with protein product		602367				8884281	Standard	NM_002522		Approved		uc002jyp.1	Q15818		ENST00000306773.4:c.660A>C	17.37:g.78447237T>G	ENSP00000307549:p.Lys220Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXH3|Q5FWE6	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,prints_Pentaxin	p.K220N	ENST00000306773.4	37	c.660	CCDS32762.1	17	.	.	.	.	.	.	.	.	.	.	T	12.79	2.043004	0.36085	.	.	ENSG00000171246	ENST00000306773	T	0.10763	2.84	4.84	-2.22	0.06952	.	0.000000	0.85682	D	0.000000	T	0.06917	0.0176	L	0.34521	1.04	0.49213	D	0.999763	P	0.35433	0.501	B	0.32289	0.143	T	0.23762	-1.0179	10	0.40728	T	0.16	-16.1702	10.7022	0.45934	0.0:0.4115:0.0:0.5885	.	220	Q15818	NPTX1_HUMAN	N	220	ENSP00000307549:K220N	ENSP00000307549:K220N	K	-	3	2	NPTX1	76061832	0.971000	0.33674	0.996000	0.52242	0.965000	0.64279	0.230000	0.17852	-0.289000	0.09038	-0.558000	0.04189	AAA	NPTX1	-	NULL	ENSG00000171246		0.537	NPTX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPTX1	HGNC	protein_coding	OTTHUMT00000438051.1	166	0.00	0	T			78447237	78447237	-1	no_errors	ENST00000306773	ensembl	human	known	69_37n	missense	75	10.71	9	SNP	0.989	G
TENM1	10178	genome.wustl.edu	37	X	123554275	123554275	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chrX:123554275delC	ENST00000371130.3	-	24	4910	c.4847delG	c.(4846-4848)ggafs	p.G1616fs	STAG2_ENST00000469481.1_Intron|TENM1_ENST00000422452.2_Frame_Shift_Del_p.G1623fs	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	1616					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										TTTCAGGACTCCATTGCTGCT	0.498																																						dbGAP											0													89.0	71.0	77.0					X																	123554275		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.4847delG	X.37:g.123554275delC	ENSP00000360171:p.Gly1616fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Frame_Shift_Del	DEL	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.G1623fs	ENST00000371130.3	37	c.4868	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.498	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	95	0.00	0	C	NM_014253		123554275	123554275	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	frame_shift_del	38	11.63	5	DEL	0.993	-
OR4C13	283092	genome.wustl.edu	37	11	49974289	49974289	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr11:49974289C>A	ENST00000555099.1	+	1	347	c.315C>A	c.(313-315)ttC>ttA	p.F105L		NM_001001955.2	NP_001001955.2	Q8NGP0	OR4CD_HUMAN	olfactory receptor, family 4, subfamily C, member 13	105						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|ovary(2)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	43						AACATTTTTTCAGAGGTGTTG	0.423																																						dbGAP											0													110.0	109.0	109.0					11																	49974289		2201	4296	6497	-	-	-	SO:0001583	missense	0			AB065750	CCDS31495.1	11p11.12	2012-10-03			ENSG00000258817	ENSG00000258817		"""GPCR / Class A : Olfactory receptors"""	15169	protein-coding gene	gene with protein product							Standard	NM_001001955		Approved		uc010rhz.2	Q8NGP0	OTTHUMG00000166686	ENST00000555099.1:c.315C>A	11.37:g.49974289C>A	ENSP00000452277:p.Phe105Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJJ3|B9EH30|Q6IF48|Q96R68	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F105L	ENST00000555099.1	37	c.315	CCDS31495.1	11	.	.	.	.	.	.	.	.	.	.	.	0.889	-0.725986	0.03158	.	.	ENSG00000258817	ENST00000555099	T	0.00631	6.09	2.95	0.53	0.17102	GPCR, rhodopsin-like superfamily (1);	0.000000	0.47852	D	0.000203	T	0.00468	0.0015	N	0.20685	0.6	0.09310	N	1	B	0.16396	0.017	B	0.17979	0.02	T	0.47142	-0.9140	9	.	.	.	.	5.7739	0.18269	0.0:0.2625:0.0:0.7375	.	105	Q8NGP0	OR4CD_HUMAN	L	105	ENSP00000452277:F105L	.	F	+	3	2	OR4C13	49930865	0.000000	0.05858	0.113000	0.21522	0.068000	0.16541	-0.751000	0.04803	-0.011000	0.14247	0.195000	0.17529	TTC	OR4C13	-	pfam_7TM_GPCR_Rhodpsn,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000258817		0.423	OR4C13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C13	HGNC	protein_coding	OTTHUMT00000391103.1	271	0.37	1	C	NM_001001955		49974289	49974289	+1	no_errors	ENST00000555099	ensembl	human	known	69_37n	missense	79	21.78	22	SNP	0.006	A
PCDHB12	56124	genome.wustl.edu	37	5	140590635	140590635	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr5:140590635C>A	ENST00000239450.2	+	1	2345	c.2156C>A	c.(2155-2157)gCg>gAg	p.A719E	PCDHB13_ENST00000341948.4_5'Flank|PCDHB12_ENST00000541609.1_Missense_Mutation_p.A382E	NM_018932.3	NP_061755.1	Q9Y5F1	PCDBC_HUMAN	protocadherin beta 12	719					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(10)|large_intestine(17)|lung(38)|ovary(3)|pancreas(1)|prostate(2)|skin(7)|stomach(1)	83			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			AGGAGCAGGGCGGCCCCGGTC	0.657																																						dbGAP											0													69.0	78.0	75.0					5																	140590635		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF152491	CCDS4254.1	5q31	2010-01-26			ENSG00000120328	ENSG00000120328		"""Cadherins / Protocadherins : Clustered"""	8683	other	protocadherin		606338				10380929	Standard	NM_018932		Approved	PCDH-BETA12	uc003liz.3	Q9Y5F1	OTTHUMG00000129620	ENST00000239450.2:c.2156C>A	5.37:g.140590635C>A	ENSP00000239450:p.Ala719Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A719E	ENST00000239450.2	37	c.2156	CCDS4254.1	5	.	.	.	.	.	.	.	.	.	.	c	9.103	1.004709	0.19199	.	.	ENSG00000120328	ENST00000541609;ENST00000239450;ENST00000507840	T;T	0.17054	2.3;2.3	3.46	-5.1	0.02911	.	.	.	.	.	T	0.17534	0.0421	L	0.37697	1.125	0.09310	N	1	D	0.61697	0.99	P	0.59115	0.852	T	0.13176	-1.0519	9	0.31617	T	0.26	.	2.8984	0.05698	0.4325:0.2813:0.1979:0.0884	.	719	Q9Y5F1	PCDBC_HUMAN	E	382;719;339	ENSP00000440199:A382E;ENSP00000239450:A719E	ENSP00000239450:A719E	A	+	2	0	PCDHB12	140570819	0.002000	0.14202	0.001000	0.08648	0.208000	0.24298	-0.022000	0.12480	-0.592000	0.05851	-0.359000	0.07587	GCG	PCDHB12	-	NULL	ENSG00000120328		0.657	PCDHB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB12	HGNC	protein_coding	OTTHUMT00000251815.2	56	0.00	0	C	NM_018932		140590635	140590635	+1	no_errors	ENST00000239450	ensembl	human	known	69_37n	missense	111	18.38	25	SNP	0.002	A
PKN1	5585	genome.wustl.edu	37	19	14578443	14578443	+	Missense_Mutation	SNP	G	G	A	rs373897527	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr19:14578443G>A	ENST00000242783.6	+	13	1963	c.1798G>A	c.(1798-1800)Gcc>Acc	p.A600T	PKN1_ENST00000342216.4_Missense_Mutation_p.A606T	NM_002741.3	NP_002732.3	Q16512	PKN1_HUMAN	protein kinase N1	600					activation of JUN kinase activity (GO:0007257)|epithelial cell migration (GO:0010631)|histone H3-T11 phosphorylation (GO:0035407)|hyperosmotic response (GO:0006972)|protein phosphorylation (GO:0006468)|regulation of cell motility (GO:2000145)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|GTP-Rho binding (GO:0017049)|histone binding (GO:0042393)|histone deacetylase binding (GO:0042826)|histone kinase activity (H3-T11 specific) (GO:0035402)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|Rac GTPase binding (GO:0048365)			breast(3)|central_nervous_system(1)|cervix(1)|kidney(2)|large_intestine(6)|lung(11)|ovary(4)|skin(2)|upper_aerodigestive_tract(1)	31						CCCAGGCCCCGCCCTGTGCAG	0.662													G|||	11	0.00219649	0.0	0.0	5008	,	,		13874	0.0109		0.0	False		,,,				2504	0.0				NSCLC(185;2539 2965 10733 52867)	dbGAP											0													42.0	52.0	49.0					19																	14578443		2035	4173	6208	-	-	-	SO:0001583	missense	0			S75546	CCDS42513.1, CCDS42514.1	19p13.12	2008-05-14	2004-07-01	2004-07-01	ENSG00000123143	ENSG00000123143			9405	protein-coding gene	gene with protein product		601032	"""protein kinase C-like 1"""	PRKCL1		9570957	Standard	NM_002741		Approved	DBK, PRK1, PKN, MGC46204, PAK1	uc002myq.3	Q16512	OTTHUMG00000039611	ENST00000242783.6:c.1798G>A	19.37:g.14578443G>A	ENSP00000242783:p.Ala600Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7W5|B2R9R4|B3KVN3|Q15143|Q504U4|Q8IUV5|Q9UD44	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_HR1_rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_HR1_rho-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_HR1_rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.A606T	ENST00000242783.6	37	c.1816	CCDS42513.1	19	.	.	.	.	.	.	.	.	.	.	G	9.820	1.185405	0.21870	.	.	ENSG00000123143	ENST00000242783;ENST00000342216	T;T	0.66815	-0.23;-0.23	4.0	-4.99	0.03010	.	1.338590	0.05217	N	0.507872	T	0.51381	0.1671	L	0.42245	1.32	0.09310	N	0.999991	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.26677	-1.0096	10	0.20046	T	0.44	-34.662	6.0918	0.19999	0.5323:0.0:0.3377:0.1301	.	606;600	Q16512-2;Q16512	.;PKN1_HUMAN	T	600;606	ENSP00000242783:A600T;ENSP00000343325:A606T	ENSP00000242783:A600T	A	+	1	0	PKN1	14439443	0.000000	0.05858	0.238000	0.24106	0.981000	0.71138	-0.450000	0.06803	-0.753000	0.04721	0.462000	0.41574	GCC	PKN1	-	NULL	ENSG00000123143		0.662	PKN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKN1	HGNC	protein_coding	OTTHUMT00000095510.1	79	0.00	0	G	NM_002741, NM_213560		14578443	14578443	+1	no_errors	ENST00000342216	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	0.225	A
POU5F1	5460	genome.wustl.edu	37	6	31132414	31132414	+	Silent	SNP	G	G	A	rs1061118	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr6:31132414G>A	ENST00000259915.8	-	5	1119	c.1047C>T	c.(1045-1047)tcC>tcT	p.S349S	POU5F1_ENST00000513407.1_Silent_p.S153S|POU5F1_ENST00000471529.2_Silent_p.S153S|POU5F1_ENST00000512818.1_Silent_p.S153S|POU5F1_ENST00000606567.1_Silent_p.S179S|POU5F1_ENST00000441888.3_Silent_p.S153S	NM_002701.4	NP_002692.2	Q01860	PO5F1_HUMAN	POU class 5 homeobox 1	349					anatomical structure morphogenesis (GO:0009653)|blastocyst development (GO:0001824)|BMP signaling pathway involved in heart induction (GO:0003130)|cardiac cell fate determination (GO:0060913)|cell fate commitment involved in formation of primary germ layer (GO:0060795)|endodermal cell fate specification (GO:0001714)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of gene silencing by miRNA (GO:0060965)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of SMAD protein import into nucleus (GO:0060391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of asymmetric cell division (GO:0009786)|regulation of gene expression (GO:0010468)|regulation of heart induction by regulation of canonical Wnt signaling pathway (GO:0090081)|regulation of methylation-dependent chromatin silencing (GO:0090308)|regulation of transcription, DNA-templated (GO:0006355)|response to wounding (GO:0009611)|somatic stem cell maintenance (GO:0035019)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|miRNA binding (GO:0035198)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)		EWSR1/POU5F1(10)	breast(1)|large_intestine(2)|lung(3)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	13					Dopamine(DB00988)|Norepinephrine(DB00368)	GAGTGGTGACGGAGACAGGGG	0.597			T	EWSR1	sarcoma								G|||	3413	0.68151	0.8033	0.67	5008	,	,		17728	0.6419		0.668	False		,,,				2504	0.5798					dbGAP		Dom	yes		6	6p21.31	5460	"""POU domain, class 5, transcription factor 1"""		M	0													5.0	6.0	6.0					6																	31132414		1410	2617	4027	-	-	-	SO:0001819	synonymous_variant	0			Z11898	CCDS34391.1, CCDS47398.1, CCDS47398.2, CCDS75420.1	6p21.33	2011-06-20	2007-07-13		ENSG00000204531	ENSG00000204531		"""Homeoboxes / POU class"""	9221	protein-coding gene	gene with protein product		164177	"""POU domain class 5, transcription factor 1"""	OTF3		1408763	Standard	NM_002701		Approved	OCT3, Oct4, MGC22487	uc003nsv.3	Q01860	OTTHUMG00000031206	ENST00000259915.8:c.1047C>T	6.37:g.31132414G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCS1|A6NLL8|D2IYK4|P31359|Q15167|Q15168|Q16422|Q5STF3|Q5STF4	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.S349	ENST00000259915.8	37	c.1047	CCDS34391.1	6																																																																																			POU5F1	-	NULL	ENSG00000204531		0.597	POU5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F1	HGNC	protein_coding	OTTHUMT00000076413.4	75	0.00	0	G	NM_002701		31132414	31132414	-1	no_errors	ENST00000259915	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.565	A
PNLDC1	154197	genome.wustl.edu	37	6	160225641	160225641	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr6:160225641A>G	ENST00000610273.1	+	6	571	c.400A>G	c.(400-402)Atc>Gtc	p.I134V	PNLDC1_ENST00000609334.1_3'UTR|PNLDC1_ENST00000392167.3_Missense_Mutation_p.I145V	NM_001271862.1|NM_173516.1	NP_001258791.1|NP_775787.1	Q8NA58	PNDC1_HUMAN	poly(A)-specific ribonuclease (PARN)-like domain containing 1	134						integral component of membrane (GO:0016021)|nucleus (GO:0005634)	nucleic acid binding (GO:0003676)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(2)|large_intestine(11)|lung(9)|ovary(1)|prostate(2)|skin(1)|stomach(1)|urinary_tract(1)	31		Breast(66;0.00519)|Ovarian(120;0.123)		OV - Ovarian serous cystadenocarcinoma(65;1.55e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		TAGACACGATATCCTGACTGG	0.448																																						dbGAP											0													112.0	105.0	107.0					6																	160225641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097559	CCDS5271.1, CCDS5271.2, CCDS64561.1	6q25.3	2008-02-05			ENSG00000146453	ENSG00000146453			21185	protein-coding gene	gene with protein product							Standard	NM_001271862		Approved	FLJ40240, dJ195P10.2	uc003qsy.2	Q8NA58	OTTHUMG00000015941	ENST00000610273.1:c.400A>G	6.37:g.160225641A>G	ENSP00000476448:p.Ile134Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TAP7|Q8N7X5	Missense_Mutation	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.I134V	ENST00000610273.1	37	c.400	CCDS5271.1	6	.	.	.	.	.	.	.	.	.	.	A	3.134	-0.177747	0.06380	.	.	ENSG00000146453	ENST00000275275;ENST00000392167	.	.	.	5.28	4.17	0.49024	Ribonuclease H-like (1);	0.104324	0.42294	D	0.000728	T	0.14787	0.0357	N	0.21194	0.64	0.32980	D	0.523516	B;B	0.20988	0.05;0.036	B;B	0.26864	0.015;0.074	T	0.09640	-1.0665	9	0.15499	T	0.54	.	9.0295	0.36249	0.6898:0.3102:0.0:0.0	.	145;134	Q8NA58-2;Q8NA58	.;PNDC1_HUMAN	V	134;145	.	ENSP00000275275:I134V	I	+	1	0	PNLDC1	160145631	0.983000	0.35010	0.913000	0.36048	0.045000	0.14185	2.708000	0.47152	1.989000	0.58080	0.533000	0.62120	ATC	PNLDC1	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	ENSG00000146453		0.448	PNLDC1-201	KNOWN	basic|CCDS	protein_coding	PNLDC1	HGNC	protein_coding		303	0.00	0	A	NM_173516		160225641	160225641	+1	no_errors	ENST00000275275	ensembl	human	known	69_37n	missense	101	15.13	18	SNP	0.967	G
RASSF1	11186	genome.wustl.edu	37	3	50369009	50369009	+	Silent	SNP	G	G	A	rs201678786		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr3:50369009G>A	ENST00000357043.2	-	4	788	c.753C>T	c.(751-753)cgC>cgT	p.R251R	RASSF1_ENST00000359365.4_Silent_p.R247R|RASSF1_ENST00000327761.3_Silent_p.R177R|RASSF1_ENST00000395126.3_Silent_p.R96R					Ras association (RalGDS/AF-6) domain family member 1											lung(2)|ovary(1)|skin(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000278)|OV - Ovarian serous cystadenocarcinoma(275;0.0015)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		GACGCTCAGCGCGCTCAAAGA	0.602													G|||	1	0.000199681	0.0	0.0	5008	,	,		20362	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													68.0	77.0	74.0					3																	50369009		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132675	CCDS2820.1, CCDS2821.1, CCDS2822.1, CCDS43096.1	3p21.3	2008-02-22	2008-02-22		ENSG00000068028	ENSG00000068028			9882	protein-coding gene	gene with protein product		605082					Standard	NM_170713		Approved	NORE2A, REH3P21, RDA32, 123F2	uc003dad.1	Q9NS23	OTTHUMG00000149958	ENST00000357043.2:c.753C>T	3.37:g.50369009G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ras-assoc,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.R251	ENST00000357043.2	37	c.753	CCDS2820.1	3																																																																																			RASSF1	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	ENSG00000068028		0.602	RASSF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF1	HGNC	protein_coding	OTTHUMT00000314304.1	58	0.00	0	G			50369009	50369009	-1	no_errors	ENST00000357043	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	1.000	A
RBMX	27316	genome.wustl.edu	37	X	135956107	135956107	+	3'UTR	SNP	G	G	A	rs4020659		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chrX:135956107G>A	ENST00000320676.7	-	0	1524				RBMX_ENST00000431446.3_Intron|RBMX_ENST00000570135.1_3'UTR|RBMX_ENST00000496459.2_5'UTR	NM_002139.3	NP_002130.2	P38159	RBMX_HUMAN	RNA binding motif protein, X-linked						cellular response to interleukin-1 (GO:0071347)|gene expression (GO:0010467)|membrane protein ectodomain proteolysis (GO:0006509)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|osteoblast differentiation (GO:0001649)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homooligomerization (GO:0051260)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|supraspliceosomal complex (GO:0044530)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|urinary_tract(1)	33	Acute lymphoblastic leukemia(192;0.000127)					AAAGCAATGCGAAAGTCAAAT	0.308																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS14661.1, CCDS55510.1	Xq26	2013-05-23	2003-09-12		ENSG00000147274	ENSG00000147274		"""RNA binding motif (RRM) containing"""	9910	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein G"""	300199	"""RNA binding motif protein, X chromosome"""			10391206, 10391207	Standard	NM_002139		Approved	RNMX, hnRNP-G, HNRNPG	uc004fae.2	P38159	OTTHUMG00000022517	ENST00000320676.7:c.*194C>T	X.37:g.135956107G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3U4|D3DWH0|E9PG86|Q5JQ67|Q8N8Y7|Q969R3	RNA	SNP	-	NULL	ENST00000320676.7	37	NULL	CCDS14661.1	X																																																																																			RBMX	-	-	ENSG00000147274		0.308	RBMX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMX	HGNC	protein_coding	OTTHUMT00000058507.1	9	0.00	0	G	NM_002139		135956107	135956107	-1	no_errors	ENST00000496459	ensembl	human	known	69_37n	rna	33	36.54	19	SNP	0.702	A
RETSAT	54884	genome.wustl.edu	37	2	85573033	85573033	+	Intron	SNP	G	G	A	rs908302	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr2:85573033G>A	ENST00000295802.4	-	6	1230				RETSAT_ENST00000475624.2_Intron|RETSAT_ENST00000263854.6_Intron|RETSAT_ENST00000457495.2_Intron	NM_017750.3	NP_060220.3	Q6NUM9	RETST_HUMAN	retinol saturase (all-trans-retinol 13,14-reductase)						oxidation-reduction process (GO:0055114)|retinol metabolic process (GO:0042572)	endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nuclear membrane (GO:0031965)|nuclear outer membrane (GO:0005640)	all-trans-retinol 13,14-reductase activity (GO:0051786)|oxidoreductase activity (GO:0016491)			NS(2)|breast(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|prostate(2)|skin(2)|urinary_tract(1)	30					Vitamin A(DB00162)	ACACGGAGCAGGTTGGCTCCA	0.577													A|||	3515	0.701877	0.5113	0.7781	5008	,	,		19150	0.9573		0.6213	False		,,,				2504	0.7249					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK075261	CCDS1972.1	2p11.2	2008-02-05			ENSG00000042445	ENSG00000042445	1.3.99.23		25991	protein-coding gene	gene with protein product						12975309, 15358783	Standard	NM_017750		Approved	FLJ20296	uc002spd.3	Q6NUM9	OTTHUMG00000154611	ENST00000295802.4:c.1117+64C>T	2.37:g.85573033G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIK3|Q53R95|Q53SA9|Q6UX05|Q8N2H5|Q96FA4|Q9NXE5	Silent	SNP	NULL	p.L95	ENST00000295802.4	37	c.283	CCDS1972.1	2																																																																																			RETSAT	-	NULL	ENSG00000042445		0.577	RETSAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RETSAT	HGNC	protein_coding	OTTHUMT00000252489.1	56	0.00	0	G	NM_017750		85573033	85573033	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000438611	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.000	A
RFC1	5981	genome.wustl.edu	37	4	39297368	39297368	+	Silent	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr4:39297368G>A	ENST00000381897.1	-	22	2956	c.2823C>T	c.(2821-2823)gcC>gcT	p.A941A	RNU6-32P_ENST00000383948.1_RNA|RFC1_ENST00000349703.2_Silent_p.A940A	NM_001204747.1|NM_002913.4	NP_001191676.1|NP_002904.3	P35251	RFC1_HUMAN	replication factor C (activator 1) 1, 145kDa	941					DNA repair (GO:0006281)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA-dependent DNA replication (GO:0006261)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|positive regulation of catalytic activity (GO:0043085)|positive regulation of transcription, DNA-templated (GO:0045893)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|telomere maintenance via telomerase (GO:0007004)|transcription, DNA-templated (GO:0006351)|transcription-coupled nucleotide-excision repair (GO:0006283)	cell junction (GO:0030054)|DNA replication factor C complex (GO:0005663)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA clamp loader activity (GO:0003689)|double-stranded DNA binding (GO:0003690)|enzyme activator activity (GO:0008047)|sequence-specific DNA binding (GO:0043565)			haematopoietic_and_lymphoid_tissue(2)|large_intestine(9)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						GAAGAACACTGGCATAAATGG	0.453																																					Colon(109;59 1555 12203 17579 39824)|Esophageal Squamous(18;360 542 16186 28570 51157)	dbGAP											0													74.0	67.0	69.0					4																	39297368		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L23320	CCDS3450.1, CCDS56329.1	4p14-p13	2010-04-21	2002-08-29		ENSG00000035928	ENSG00000035928		"""ATPases / AAA-type"""	9969	protein-coding gene	gene with protein product		102579	"""replication factor C (activator 1) 1 (145kD)"""			8114700	Standard	NM_002913		Approved	A1, PO-GA, RFC140, MHCBFB	uc003gty.2	P35251	OTTHUMG00000099363	ENST00000381897.1:c.2823C>T	4.37:g.39297368G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E7|Q5XKF5|Q6PKU0|Q86V41|Q86V46	Silent	SNP	pfam_DNA_replication_fac_RFC1_C,pfam_BRCT_dom,pfam_ATPase_AAA_core,superfamily_DNA_pol3_clamp-load_cplx_C,superfamily_BRCT_dom,smart_BRCT_dom,smart_AAA+_ATPase,pirsf_DNA_replication_fac_C_lsu,pfscan_BRCT_dom	p.A941	ENST00000381897.1	37	c.2823	CCDS56329.1	4																																																																																			RFC1	-	pfam_DNA_replication_fac_RFC1_C,superfamily_DNA_pol3_clamp-load_cplx_C,pirsf_DNA_replication_fac_C_lsu	ENSG00000035928		0.453	RFC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RFC1	HGNC	protein_coding	OTTHUMT00000216808.1	133	0.00	0	G	NM_002913		39297368	39297368	-1	no_errors	ENST00000381897	ensembl	human	known	69_37n	silent	34	10.53	4	SNP	0.996	A
SH3KBP1	30011	genome.wustl.edu	37	X	19560045	19560045	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chrX:19560045C>A	ENST00000397821.3	-	16	2180	c.1890G>T	c.(1888-1890)caG>caT	p.Q630H	SH3KBP1_ENST00000379716.1_Missense_Mutation_p.Q392H|SH3KBP1_ENST00000541422.1_Missense_Mutation_p.Q369H|SH3KBP1_ENST00000379698.4_Missense_Mutation_p.Q593H	NM_031892.2	NP_114098.1	Q96B97	SH3K1_HUMAN	SH3-domain kinase binding protein 1	630					apoptotic process (GO:0006915)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|cytoskeleton organization (GO:0007010)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|regulation of cell shape (GO:0008360)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(8)|skin(4)	29						GCACTCACTTCTGCTGGTCCT	0.627																																						dbGAP											0													106.0	96.0	100.0					X																	19560045		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230904	CCDS14193.1, CCDS35213.1, CCDS55383.1	Xp22.1-p21.3	2008-02-05			ENSG00000147010	ENSG00000147010			13867	protein-coding gene	gene with protein product		300374				8889549, 7566098	Standard	NM_031892		Approved	CIN85	uc004czm.3	Q96B97	OTTHUMG00000021227	ENST00000397821.3:c.1890G>T	X.37:g.19560045C>A	ENSP00000380921:p.Gln630His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1D5|Q5JPT4|Q5JPT5|Q8IWX6|Q8IX98|Q96RN4|Q9NYR0	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_p67phox,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.Q630H	ENST00000397821.3	37	c.1890	CCDS14193.1	X	.	.	.	.	.	.	.	.	.	.	C	3.308	-0.141521	0.06669	.	.	ENSG00000147010	ENST00000379702;ENST00000397821;ENST00000379716;ENST00000379698;ENST00000541422;ENST00000379726	T;T;T;T;T	0.33654	1.4;1.4;1.4;1.4;1.4	5.39	4.41	0.53225	.	0.000000	0.64402	D	0.000010	T	0.30541	0.0768	N	0.12887	0.27	0.37413	D	0.9133	D;B;D	0.89917	1.0;0.156;0.997	D;B;D	0.85130	0.997;0.031;0.99	T	0.44050	-0.9353	10	0.02654	T	1	-14.024	6.2238	0.20695	0.0:0.7735:0.0:0.2265	.	392;630;593	Q5JPT4;Q96B97;Q5JPT5	.;SH3K1_HUMAN;.	H	615;630;392;593;369;610	ENSP00000380921:Q630H;ENSP00000369039:Q392H;ENSP00000369020:Q593H;ENSP00000442499:Q369H;ENSP00000369049:Q610H	ENSP00000369020:Q593H	Q	-	3	2	SH3KBP1	19469966	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	1.388000	0.34442	2.265000	0.75225	0.529000	0.55759	CAG	SH3KBP1	-	NULL	ENSG00000147010		0.627	SH3KBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3KBP1	HGNC	protein_coding	OTTHUMT00000055992.1	78	0.00	0	C	NM_031892		19560045	19560045	-1	no_errors	ENST00000397821	ensembl	human	known	69_37n	missense	75	24.24	24	SNP	1.000	A
SLC45A4	57210	genome.wustl.edu	37	8	142222352	142222352	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr8:142222352C>T	ENST00000024061.3	-	7	2399	c.2092G>A	c.(2092-2094)Gtg>Atg	p.V698M	SLC45A4_ENST00000517878.1_Missense_Mutation_p.V749M|SLC45A4_ENST00000433583.2_Missense_Mutation_p.V691M|SLC45A4_ENST00000519067.1_Missense_Mutation_p.V698M	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			AGCTTCAGCACGGTGGGCTTT	0.642																																						dbGAP											0													35.0	31.0	32.0					8																	142222352		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.2092G>A	8.37:g.142222352C>T	ENSP00000024061:p.Val698Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.V749M	ENST00000024061.3	37	c.2245	CCDS34948.1	8	.	.	.	.	.	.	.	.	.	.	C	11.47	1.649836	0.29336	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	T;T;T;T	0.19250	2.25;2.22;2.22;2.16	5.27	0.368	0.16146	.	0.408875	0.23838	N	0.044075	T	0.18467	0.0443	M	0.65975	2.015	0.09310	N	1	B;B;B	0.33694	0.185;0.421;0.18	B;B;B	0.21360	0.01;0.034;0.023	T	0.08371	-1.0725	10	0.56958	D	0.05	-15.9587	10.4496	0.44513	0.0:0.6834:0.0:0.3166	.	749;698;698	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	M	698;749;691;698	ENSP00000429059:V698M;ENSP00000428137:V749M;ENSP00000400799:V691M;ENSP00000024061:V698M	ENSP00000024061:V698M	V	-	1	0	SLC45A4	142291534	0.003000	0.15002	0.000000	0.03702	0.003000	0.03518	0.658000	0.24979	-0.237000	0.09739	-0.150000	0.13652	GTG	SLC45A4	-	NULL	ENSG00000022567		0.642	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A4	HGNC	protein_coding	OTTHUMT00000378571.3	25	0.00	0	C	XM_050325		142222352	142222352	-1	no_errors	ENST00000517878	ensembl	human	known	69_37n	missense	44	15.38	8	SNP	0.000	T
SRL	6345	genome.wustl.edu	37	16	4242562	4242562	+	Silent	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr16:4242562G>A	ENST00000399609.3	-	6	1026	c.1014C>T	c.(1012-1014)atC>atT	p.I338I	SRL_ENST00000537996.1_Silent_p.I296I	NM_001098814.1	NP_001092284.1	Q86TD4	SRCA_HUMAN	sarcalumenin	797	Acidic domain, probably binds calcium. {ECO:0000250}.					sarcoplasmic reticulum (GO:0016529)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(8)|ovary(3)|skin(3)	21						TGCGGACCCGGATGGCGTGCT	0.512																																						dbGAP											0													131.0	140.0	137.0					16																	4242562		2117	4235	6352	-	-	-	SO:0001819	synonymous_variant	0			AK056588	CCDS42113.1	16p13.3	2008-02-05				ENSG00000185739			11295	protein-coding gene	gene with protein product		604992				2762314	Standard	NM_001098814		Approved		uc002cvz.4	Q86TD4		ENST00000399609.3:c.1014C>T	16.37:g.4242562G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Dynamin_GTPase,pfam_GTP_binding_domain	p.I338	ENST00000399609.3	37	c.1014	CCDS42113.1	16																																																																																			SRL	-	NULL	ENSG00000185739		0.512	SRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRL	HGNC	protein_coding	OTTHUMT00000438087.1	190	0.52	1	G	XM_064152		4242562	4242562	-1	no_errors	ENST00000399609	ensembl	human	known	69_37n	silent	101	13.68	16	SNP	1.000	A
TBP	6908	genome.wustl.edu	37	6	170871004	170871004	+	Silent	SNP	G	G	A			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr6:170871004G>A	ENST00000392092.2	+	3	459	c.180G>A	c.(178-180)caG>caA	p.Q60Q	TBP_ENST00000540980.1_Silent_p.Q40Q|TBP_ENST00000230354.6_Silent_p.Q60Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	60	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		Ggcagcagcagcaacaacaac	0.542																																						dbGAP											0													43.0	45.0	44.0					6																	170871004		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.180G>A	6.37:g.170871004G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q60	ENST00000392092.2	37	c.180	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.542	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	44	0.00	0	G	NM_003194		170871004	170871004	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	41	12.77	6	SNP	0.991	A
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000540980.1_Silent_p.Q56Q|TBP_ENST00000230354.6_Silent_p.Q76Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																						dbGAP											4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	-	-	-	SO:0001819	synonymous_variant	0			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL	ENSG00000112592		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	27	0.00	0	G	NM_003194		170871052	170871052	+1	no_errors	ENST00000230354	ensembl	human	known	69_37n	silent	23	45.45	20	SNP	0.994	A
THOC5	8563	genome.wustl.edu	37	22	29907214	29907214	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr22:29907214delG	ENST00000490103.1	-	19	1991	c.1869delC	c.(1867-1869)accfs	p.T623fs	THOC5_ENST00000397873.2_Frame_Shift_Del_p.T623fs|CTA-256D12.11_ENST00000411969.1_RNA|THOC5_ENST00000397871.1_Frame_Shift_Del_p.T623fs|THOC5_ENST00000397872.1_Frame_Shift_Del_p.T623fs	NM_003678.4	NP_003669.4	Q13769	THOC5_HUMAN	THO complex 5	623					blastocyst development (GO:0001824)|cell morphogenesis (GO:0000902)|monocyte differentiation (GO:0030224)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of macrophage differentiation (GO:0045650)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|primitive hemopoiesis (GO:0060215)|regulation of mRNA export from nucleus (GO:0010793)|regulation of stem cell division (GO:2000035)|RNA splicing (GO:0008380)|stem cell division (GO:0017145)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	mRNA binding (GO:0003729)			NS(1)|breast(4)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GCAGCTGGTTGGTCAACAGCT	0.582																																						dbGAP											0													102.0	89.0	93.0					22																	29907214		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB023200	CCDS13859.1	22q12	2013-02-11			ENSG00000100296	ENSG00000100296		"""THO complex subunits"""	19074	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 79"""	612733	"""chromosome 22 open reading frame 19"""	C22orf19		11979277, 8242058, 10231032, 19015024, 18373705	Standard	NM_003678		Approved	PK1.3, KIAA0983, Fmip, fSAP79	uc003afs.3	Q13769	OTTHUMG00000151291	ENST00000490103.1:c.1869delC	22.37:g.29907214delG	ENSP00000420306:p.Thr623fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O60839|Q9UPZ5	Frame_Shift_Del	DEL	pfam_THO_Thoc5	p.N624fs	ENST00000490103.1	37	c.1869	CCDS13859.1	22																																																																																			THOC5	-	NULL	ENSG00000100296		0.582	THOC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC5	HGNC	protein_coding	OTTHUMT00000322097.1	73	0.00	0	G	NM_003678		29907214	29907214	-1	no_errors	ENST00000397871	ensembl	human	known	69_37n	frame_shift_del	13	13.33	2	DEL	1.000	-
TRIM60	166655	genome.wustl.edu	37	4	165962604	165962604	+	Silent	SNP	T	T	C			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr4:165962604T>C	ENST00000512596.1	+	3	1596	c.1380T>C	c.(1378-1380)ccT>ccC	p.P460P	TRIM60_ENST00000508504.1_Silent_p.P460P|TRIM60_ENST00000341062.5_Silent_p.P460P	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	460	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		ATTCCGAACCTCTTAAAATCT	0.338																																						dbGAP											0													41.0	45.0	44.0					4																	165962604		2195	4296	6491	-	-	-	SO:0001819	synonymous_variant	0			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.1380T>C	4.37:g.165962604T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA35	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.P460	ENST00000512596.1	37	c.1380	CCDS3808.1	4																																																																																			TRIM60	-	superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000176979		0.338	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	HGNC	protein_coding	OTTHUMT00000364325.1	169	0.00	0	T	NM_152620		165962604	165962604	+1	no_errors	ENST00000341062	ensembl	human	known	69_37n	silent	45	13.46	7	SNP	0.051	C
TULP3	7289	genome.wustl.edu	37	12	3040227	3040227	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr12:3040227A>C	ENST00000448120.2	+	6	568	c.517A>C	c.(517-519)Act>Cct	p.T173P	RNU7-166P_ENST00000459397.1_RNA|TULP3_ENST00000397132.2_Missense_Mutation_p.T173P	NM_003324.4	NP_003315.2	O75386	TULP3_HUMAN	tubby like protein 3	173				TSGSATAAQPADNL -> IPVLLLPPNQLITF (in Ref. 1; AAC95431). {ECO:0000305}.	anterior/posterior pattern specification (GO:0009952)|bone development (GO:0060348)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|central nervous system neuron differentiation (GO:0021953)|embryonic camera-type eye development (GO:0031076)|embryonic digit morphogenesis (GO:0042733)|embryonic neurocranium morphogenesis (GO:0048702)|G-protein coupled receptor signaling pathway (GO:0007186)|ganglion development (GO:0061548)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:1901621)|negative regulation of smoothened signaling pathway involved in ventral spinal cord patterning (GO:0021914)|neural tube closure (GO:0001843)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of transcription, DNA-templated (GO:0006355)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	axoneme (GO:0005930)|ciliary base (GO:0097546)|cilium (GO:0005929)|extracellular region (GO:0005576)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	enzyme binding (GO:0019899)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|protein complex binding (GO:0032403)			endometrium(1)|large_intestine(4)|lung(13)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22			OV - Ovarian serous cystadenocarcinoma(31;0.000818)			CGGTTCTGCTACTGCCGCCCA	0.493																																						dbGAP											0													125.0	121.0	122.0					12																	3040227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF045583	CCDS8519.1, CCDS53737.1	12p13	2014-02-21			ENSG00000078246	ENSG00000078246		"""Intraflagellar transport homologs"""	12425	protein-coding gene	gene with protein product		604730				9828123	Standard	NM_003324		Approved	TUBL3	uc001qlj.2	O75386	OTTHUMG00000168152	ENST00000448120.2:c.517A>C	12.37:g.3040227A>C	ENSP00000410051:p.Thr173Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNB7|B7Z6A2|D3DUQ4|F8WBZ9|Q8N5B0	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C,prints_Tubby_N	p.T173P	ENST00000448120.2	37	c.517	CCDS8519.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	9.878|9.878	1.200711|1.200711	0.22121|0.22121	.|.	.|.	ENSG00000078246|ENSG00000078246	ENST00000228245;ENST00000542730;ENST00000448120;ENST00000397132|ENST00000535226	D;D|.	0.92348|.	-3.0;-3.02|.	5.54|5.54	-1.33|-1.33	0.09172|0.09172	.|.	0.807910|.	0.12045|.	N|.	0.504628|.	T|T	0.22282|0.22282	0.0537|0.0537	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	P;P;P|.	0.48503|.	0.627;0.627;0.911|.	B;B;P|.	0.47981|.	0.133;0.184;0.563|.	T|T	0.29027|0.29027	-1.0025|-1.0025	10|6	0.18276|0.87932	T|D	0.48|0	-12.8706|-12.8706	3.6894|3.6894	0.08340|0.08340	0.4653:0.0:0.2806:0.2541|0.4653:0.0:0.2806:0.2541	.|.	30;173;173|.	B7Z1E7;O75386;F8WBZ9|.	.;TULP3_HUMAN;.|.	P|S	173;30;173;173|165	ENSP00000410051:T173P;ENSP00000380321:T173P|.	ENSP00000228245:T173P|ENSP00000443709:Y165S	T|Y	+|+	1|2	0|0	TULP3|TULP3	2910488|2910488	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.130000|0.130000	0.20726|0.20726	-0.345000|-0.345000	0.07770|0.07770	-0.222000|-0.222000	0.09958|0.09958	0.459000|0.459000	0.35465|0.35465	ACT|TAC	TULP3	-	NULL	ENSG00000078246		0.493	TULP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TULP3	HGNC	protein_coding	OTTHUMT00000398468.1	106	0.93	1	A	NM_003324		3040227	3040227	+1	no_errors	ENST00000228245	ensembl	human	known	69_37n	missense	52	15.87	10	SNP	0.000	C
ZC3H13	23091	genome.wustl.edu	37	13	46616352	46616352	+	Missense_Mutation	SNP	C	C	A	rs199682940		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr13:46616352C>A	ENST00000242848.4	-	4	634	c.286G>T	c.(286-288)Gtg>Ttg	p.V96L	ZC3H13_ENST00000282007.3_Missense_Mutation_p.V96L			Q5T200	ZC3HD_HUMAN	zinc finger CCCH-type containing 13	96							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|lung(25)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	79		Lung NSC(96;7.26e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;4.18e-05)		TCAGTGTCCACGTCTTGGCGC	0.413																																					Esophageal Squamous(187;747 2077 11056 31291 44172)	dbGAP											0													211.0	193.0	199.0					13																	46616352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020660	CCDS9400.1	13q14.11	2012-07-05	2006-05-15	2006-05-15	ENSG00000123200	ENSG00000123200		"""Zinc fingers, CCCH-type domain containing"""	20368	protein-coding gene	gene with protein product			"""KIAA0853"""	KIAA0853		10048485	Standard	XM_005266301		Approved	DKFZp434D1812	uc001vas.1	Q5T200	OTTHUMG00000016863	ENST00000242848.4:c.286G>T	13.37:g.46616352C>A	ENSP00000242848:p.Val96Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A323|O94936|Q5T1Z9|Q7Z7J3|Q8NDT6|Q9H0L6	Missense_Mutation	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.V96L	ENST00000242848.4	37	c.286		13	.	.	.	.	.	.	.	.	.	.	C	12.82	2.052734	0.36181	.	.	ENSG00000123200	ENST00000242848;ENST00000282007;ENST00000428921	T;T	0.36878	2.18;1.23	5.43	4.59	0.56863	.	0.000000	0.51477	D	0.000087	T	0.28797	0.0714	L	0.27053	0.805	0.80722	D	1	P;P	0.39809	0.562;0.689	B;B	0.42062	0.207;0.374	T	0.04454	-1.0950	10	0.39692	T	0.17	.	11.295	0.49274	0.0:0.8533:0.0:0.1467	.	96;96	Q5T200;Q5T200-2	ZC3HD_HUMAN;.	L	96	ENSP00000242848:V96L;ENSP00000282007:V96L	ENSP00000242848:V96L	V	-	1	0	ZC3H13	45514353	1.000000	0.71417	1.000000	0.80357	0.540000	0.34992	3.503000	0.53340	1.300000	0.44818	0.467000	0.42956	GTG	ZC3H13	-	NULL	ENSG00000123200		0.413	ZC3H13-001	KNOWN	basic|appris_candidate_longest	protein_coding	ZC3H13	HGNC	protein_coding	OTTHUMT00000044789.1	309	0.00	0	C	NM_015070		46616352	46616352	-1	no_errors	ENST00000242848	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	1.000	A
ZNF799	90576	genome.wustl.edu	37	19	12501969	12501970	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr19:12501969_12501970delGA	ENST00000430385.3	-	4	1442_1443	c.1242_1243delTC	c.(1240-1245)actcacfs	p.H415fs	ZNF799_ENST00000419318.1_Frame_Shift_Del_p.H383fs|CTD-3105H18.14_ENST00000435033.1_Intron	NM_001080821.2	NP_001074290.1	Q96GE5	ZN799_HUMAN	zinc finger protein 799	415					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|kidney(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(2)	19						TCTGCAGTGTGAGTCTTTTCAT	0.421																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC009517	CCDS45989.1	19p13.2	2013-01-08			ENSG00000196466	ENSG00000196466		"""Zinc fingers, C2H2-type"", ""-"""	28071	protein-coding gene	gene with protein product			"""zinc finger protein 842"""	ZNF842			Standard	NM_001080821		Approved	HIT-40, MGC71805	uc002mts.4	Q96GE5	OTTHUMG00000156408	ENST00000430385.3:c.1242_1243delTC	19.37:g.12501969_12501970delGA	ENSP00000411084:p.His415fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T416fs	ENST00000430385.3	37	c.1243_1242	CCDS45989.1	19																																																																																			ZNF799	-	pfscan_Znf_C2H2	ENSG00000196466		0.421	ZNF799-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF799	HGNC	protein_coding	OTTHUMT00000344099.2	233	0.00	0	GA	NM_001080821		12501969	12501970	-1	no_errors	ENST00000430385	ensembl	human	known	69_37n	frame_shift_del	64	11.11	8	DEL	0.990:0.062	-
ZNF208	7757	genome.wustl.edu	37	19	22156863	22156863	+	Missense_Mutation	SNP	C	C	A	rs202200782		TCGA-BH-A1ES-06A-12D-A243-09	TCGA-BH-A1ES-11A-33D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	e4c67368-9525-4d6f-8015-be7960045be1	b281f983-29fc-4389-bea2-cabf4c90b3df	g.chr19:22156863C>A	ENST00000397126.4	-	4	1121	c.973G>T	c.(973-975)Gtc>Ttc	p.V325F	ZNF208_ENST00000601773.1_Intron|ZNF208_ENST00000599916.1_Intron	NM_007153.3	NP_009084.2	O43345	ZN208_HUMAN	zinc finger protein 208	325					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.V325F(1)		breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|liver(1)|lung(71)|ovary(6)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	113		all_lung(12;0.0961)|Lung NSC(12;0.103)				AGGGTTGAGACCTTACTGAAG	0.403																																						dbGAP											1	Substitution - Missense(1)	NS(1)											66.0	68.0	67.0					19																	22156863		1946	3920	5866	-	-	-	SO:0001583	missense	0			BC038199	CCDS54240.1	19p12	2013-01-08				ENSG00000160321		"""Zinc fingers, C2H2-type"", ""-"""	12999	protein-coding gene	gene with protein product	"""zinc finger protein 95"""	603977				9724325	Standard	NM_007153		Approved	PMIDP, ZNF95	uc021urr.1	O43345		ENST00000397126.4:c.973G>T	19.37:g.22156863C>A	ENSP00000380315:p.Val325Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V325F	ENST00000397126.4	37	c.973	CCDS54240.1	19	.	.	.	.	.	.	.	.	.	.	C	0.040	-1.286883	0.01387	.	.	ENSG00000160321	ENST00000397126;ENST00000428290	T	0.38560	1.13	2.93	-5.86	0.02304	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.21962	0.0529	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.10428	-1.0630	8	0.39692	T	0.17	.	0.9385	0.01350	0.2555:0.1041:0.2969:0.3435	.	325	O43345	ZN208_HUMAN	F	325	ENSP00000380315:V325F	ENSP00000380315:V325F	V	-	1	0	ZNF208	21948703	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.688000	0.00392	-2.968000	0.00287	-2.283000	0.00269	GTC	ZNF208	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000160321		0.403	ZNF208-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ZNF208	HGNC	protein_coding	OTTHUMT00000464302.1	71	0.00	0	C	NM_007153		22156863	22156863	-1	no_errors	ENST00000397126	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.000	A
