#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ACTA1	58	genome.wustl.edu	37	1	229567787	229567787	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr1:229567787G>T	ENST00000366684.3	-	5	864	c.762C>A	c.(760-762)aaC>aaA	p.N254K	ACTA1_ENST00000366683.2_Missense_Mutation_p.N166K	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	254					cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				GGAAGCGCTCGTTGCCGATGG	0.716																																						dbGAP											0													27.0	26.0	26.0					1																	229567787		2203	4299	6502	-	-	-	SO:0001583	missense	0			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.762C>A	1.37:g.229567787G>T	ENSP00000355645:p.Asn254Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.N254K	ENST00000366684.3	37	c.762	CCDS1578.1	1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.032852	0.35893	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000366682	D;D	0.94457	-3.43;-3.43	4.28	-0.105	0.13601	.	0.057338	0.64402	D	0.000005	D	0.95076	0.8405	L	0.58969	1.84	0.47245	D	0.999366	D	0.71674	0.998	D	0.87578	0.998	D	0.92676	0.6154	10	0.87932	D	0	.	7.296	0.26393	0.714:0.0:0.286:0.0	.	254	P68133	ACTS_HUMAN	K	254;164;166;219	ENSP00000355645:N254K;ENSP00000355644:N166K	ENSP00000312351:N164K	N	-	3	2	ACTA1	227634410	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	0.900000	0.28431	0.097000	0.17492	-0.471000	0.05019	AAC	ACTA1	-	pfam_Actin-like,smart_Actin-like,prints_Actin-like	ENSG00000143632		0.716	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	HGNC	protein_coding	OTTHUMT00000092781.1	67	0.00	0	G	NM_001100		229567787	229567787	-1	no_errors	ENST00000366684	ensembl	human	known	69_37n	missense	34	37.04	20	SNP	1.000	T
DUSP6	1848	genome.wustl.edu	37	12	89744753	89744753	+	Silent	SNP	A	A	G			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr12:89744753A>G	ENST00000279488.7	-	2	1681	c.450T>C	c.(448-450)aaT>aaC	p.N150N	DUSP6_ENST00000547140.1_5'UTR|DUSP6_ENST00000547291.1_Silent_p.N25N|DUSP6_ENST00000308385.6_Intron	NM_001946.2	NP_001937.2	Q16828	DUS6_HUMAN	dual specificity phosphatase 6	150					cell differentiation (GO:0030154)|dorsal/ventral pattern formation (GO:0009953)|inactivation of MAPK activity (GO:0000188)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|regulation of endodermal cell fate specification (GO:0042663)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of heart growth (GO:0060420)|response to drug (GO:0042493)|response to nitrosative stress (GO:0051409)|response to organic cyclic compound (GO:0014070)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|protein tyrosine phosphatase activity (GO:0004725)			large_intestine(5)|lung(8)|skin(2)|urinary_tract(1)	16						AGCCGTCTAGATTGGTCTCGC	0.567																																					Colon(132;3456 5224)	dbGAP											0													19.0	19.0	19.0					12																	89744753		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC037236	CCDS9033.1, CCDS9034.1	12q22-q23	2011-06-09				ENSG00000139318		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3072	protein-coding gene	gene with protein product		602748				8626780, 9205128	Standard	NM_001946		Approved	MKP-3, PYST1	uc001tay.3	Q16828		ENST00000279488.7:c.450T>C	12.37:g.89744753A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O75109|Q53Y75|Q9BSH6	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,prints_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.N150	ENST00000279488.7	37	c.450	CCDS9033.1	12																																																																																			DUSP6	-	superfamily_Rhodanese-like_dom,pirsf_MKP	ENSG00000139318		0.567	DUSP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP6	HGNC	protein_coding	OTTHUMT00000406534.2	27	0.00	0	A	NM_001946, NM_022652		89744753	89744753	-1	no_errors	ENST00000279488	ensembl	human	known	69_37n	silent	16	40.74	11	SNP	1.000	G
ELMOD1	55531	genome.wustl.edu	37	11	107518302	107518302	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr11:107518302G>C	ENST00000265840.7	+	7	794	c.529G>C	c.(529-531)Gga>Cga	p.G177R	ELMOD1_ENST00000443271.2_Missense_Mutation_p.G177R|ELMOD1_ENST00000531234.1_Missense_Mutation_p.G171R	NM_018712.3	NP_061182.3	Q8N336	ELMD1_HUMAN	ELMO/CED-12 domain containing 1	177	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)|positive regulation of GTPase activity (GO:0043547)	cytoskeleton (GO:0005856)	GTPase activator activity (GO:0005096)			endometrium(2)|large_intestine(5)|liver(2)|lung(7)|pancreas(2)|prostate(1)	19		Melanoma(852;0.000288)|Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00301)|all_epithelial(67;0.00304)|Breast(348;0.104)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)|Epithelial(105;0.00027)|all cancers(92;0.00481)		TCGAGGAATGGGACTTCTGGG	0.413																																						dbGAP											0													112.0	110.0	110.0					11																	107518302		1872	4112	5984	-	-	-	SO:0001583	missense	0			AL359601	CCDS44723.1, CCDS44724.1	11q23.1	2012-10-15	2006-01-20		ENSG00000110675	ENSG00000110675			25334	protein-coding gene	gene with protein product		615456	"""ELMO domain containing 1"""			12477932	Standard	NM_018712		Approved	DKFZp547C176	uc010rvs.2	Q8N336	OTTHUMG00000166361	ENST00000265840.7:c.529G>C	11.37:g.107518302G>C	ENSP00000265840:p.Gly177Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E167|G5E9S5|Q9NPW3	Missense_Mutation	SNP	pfam_Engulfment_cell_motility_ELMO	p.G177R	ENST00000265840.7	37	c.529	CCDS44723.1	11	.	.	.	.	.	.	.	.	.	.	G	27.4	4.825115	0.90955	.	.	ENSG00000110675	ENST00000531234;ENST00000265840;ENST00000443271	T;T;T	0.68624	-0.34;-0.34;-0.34	5.12	5.12	0.69794	Engulfment/cell motility, ELMO (2);	0.000000	0.85682	D	0.000000	D	0.86112	0.5855	M	0.91510	3.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.89238	0.3582	10	0.87932	D	0	.	18.9154	0.92503	0.0:0.0:1.0:0.0	.	177;177	Q8N336;G5E9S5	ELMD1_HUMAN;.	R	171;177;177	ENSP00000433232:G171R;ENSP00000265840:G177R;ENSP00000412257:G177R	ENSP00000265840:G177R	G	+	1	0	ELMOD1	107023512	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.386000	0.97228	2.530000	0.85305	0.655000	0.94253	GGA	ELMOD1	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000110675		0.413	ELMOD1-001	KNOWN	basic|CCDS	protein_coding	ELMOD1	HGNC	protein_coding	OTTHUMT00000389406.1	483	0.00	0	G	NM_018712		107518302	107518302	+1	no_errors	ENST00000265840	ensembl	human	known	69_37n	missense	281	28.79	114	SNP	1.000	C
MYH2	4620	genome.wustl.edu	37	17	10436640	10436640	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr17:10436640G>T	ENST00000245503.5	-	21	2787	c.2403C>A	c.(2401-2403)ttC>ttA	p.F801L	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA|RP11-799N11.1_ENST00000399342.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.F801L|MYH2_ENST00000532183.2_Intron	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	801	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						CTCTTGCCAAGAACCCTCTGC	0.458																																						dbGAP											0													95.0	95.0	95.0					17																	10436640		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2403C>A	17.37:g.10436640G>T	ENSP00000245503:p.Phe801Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Splice_Site	SNP	-	NULL	ENST00000245503.5	37	c.NULL	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	G	17.64	3.440244	0.63067	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.71817	-0.6;-0.6	5.17	4.2	0.49525	.	0.186353	0.25388	U	0.031023	T	0.65554	0.2702	L	0.54908	1.71	0.34681	D	0.724737	B	0.10296	0.003	B	0.26614	0.071	T	0.68667	-0.5348	10	0.33940	T	0.23	.	10.8674	0.46864	0.1508:0.0:0.8492:0.0	.	801	Q9UKX2	MYH2_HUMAN	L	801	ENSP00000245503:F801L;ENSP00000380367:F801L	ENSP00000245503:F801L	F	-	3	2	MYH2	10377365	0.929000	0.31497	1.000000	0.80357	0.997000	0.91878	1.435000	0.34969	1.403000	0.46800	0.591000	0.81541	TTC	CTC-297N7.7	-	-	ENSG00000214970		0.458	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000214970	Clone_based_vega_gene	protein_coding	OTTHUMT00000252726.3	305	0.00	0	G	NM_017534		10436640	10436640	+1	no_errors	ENST00000399342	ensembl	human	known	69_37n	splice_site	179	24.79	59	SNP	1.000	T
FAM160A1	729830	genome.wustl.edu	37	4	152571037	152571037	+	Missense_Mutation	SNP	A	A	C	rs369699317	byFrequency	TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr4:152571037A>C	ENST00000505231.1	+	9	2003	c.1844A>C	c.(1843-1845)aAa>aCa	p.K615T	FAM160A1_ENST00000435205.1_Missense_Mutation_p.K615T			Q05DH4	F16A1_HUMAN	family with sequence similarity 160, member A1	615										endometrium(2)|kidney(1)	3						GATCCCCCCAAACACATCCAG	0.537																																						dbGAP											0													58.0	66.0	64.0					4																	152571037		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47146.1	4q31.3	2012-11-30			ENSG00000164142	ENSG00000164142			34237	protein-coding gene	gene with protein product							Standard	NM_001109977		Approved	FLJ43373	uc003imj.2	Q05DH4	OTTHUMG00000161675	ENST00000505231.1:c.1844A>C	4.37:g.152571037A>C	ENSP00000421580:p.Lys615Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZUS2	Missense_Mutation	SNP	pfam_RetinoicA-induced_16-like	p.K615T	ENST00000505231.1	37	c.1844	CCDS47146.1	4	.	.	.	.	.	.	.	.	.	.	A	16.89	3.247307	0.59103	.	.	ENSG00000164142	ENST00000435205;ENST00000505231	T;T	0.14391	2.51;2.51	5.37	-1.47	0.08772	.	.	.	.	.	T	0.15782	0.0380	M	0.66939	2.045	0.09310	N	1	B	0.32245	0.361	B	0.35470	0.203	T	0.23976	-1.0173	9	0.29301	T	0.29	.	10.385	0.44134	0.7025:0.0:0.2975:0.0	.	615	Q05DH4	F16A1_HUMAN	T	615	ENSP00000413196:K615T;ENSP00000421580:K615T	ENSP00000413196:K615T	K	+	2	0	FAM160A1	152790487	0.548000	0.26473	0.831000	0.32960	0.870000	0.49936	1.548000	0.36201	-0.465000	0.06953	0.477000	0.44152	AAA	FAM160A1	-	NULL	ENSG00000164142		0.537	FAM160A1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM160A1	HGNC	protein_coding	OTTHUMT00000365691.1	208	0.00	0	A	NM_001109977		152571037	152571037	+1	no_errors	ENST00000435205	ensembl	human	known	69_37n	missense	104	29.25	43	SNP	0.099	C
FER1L6	654463	genome.wustl.edu	37	8	125047696	125047696	+	Splice_Site	SNP	G	G	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr8:125047696G>A	ENST00000522917.1	+	19	2670		c.e19+1		FER1L6_ENST00000399018.1_Splice_Site|FER1L6-AS1_ENST00000518567.1_RNA|RP11-959I15.4_ENST00000522005.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6							integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CTCTACCAAGGTAGGGTCCCC	0.502																																						dbGAP											0													41.0	39.0	40.0					8																	125047696		1910	4117	6027	-	-	-	SO:0001630	splice_region_variant	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.2464+1G>A	8.37:g.125047696G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e18+1	ENST00000522917.1	37	c.2464+1	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	G	12.26	1.884640	0.33255	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	.	.	.	4.91	4.91	0.64330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.237	0.87001	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FER1L6	125116877	1.000000	0.71417	1.000000	0.80357	0.076000	0.17211	5.006000	0.63978	2.417000	0.82017	0.655000	0.94253	.	FER1L6	-	-	ENSG00000214814		0.502	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	106	0.00	0	G	NM_001039112	Intron	125047696	125047696	+1	no_errors	ENST00000399018	ensembl	human	known	69_37n	splice_site	48	36.00	27	SNP	1.000	A
FER1L6	654463	genome.wustl.edu	37	8	125076805	125076805	+	Silent	SNP	A	A	G			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr8:125076805A>G	ENST00000522917.1	+	26	3752	c.3546A>G	c.(3544-3546)ggA>ggG	p.G1182G	FER1L6_ENST00000399018.1_Silent_p.G1182G|FER1L6-AS2_ENST00000520031.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	1182						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CAAAAGATGGAAAACCTAAGG	0.517																																						dbGAP											0													56.0	58.0	57.0					8																	125076805		1913	4127	6040	-	-	-	SO:0001819	synonymous_variant	0			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.3546A>G	8.37:g.125076805A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.G1182	ENST00000522917.1	37	c.3546	CCDS43767.1	8																																																																																			FER1L6	-	NULL	ENSG00000214814		0.517	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	182	0.00	0	A	NM_001039112		125076805	125076805	+1	no_errors	ENST00000399018	ensembl	human	known	69_37n	silent	80	35.48	44	SNP	0.000	G
GPR63	81491	genome.wustl.edu	37	6	97247418	97247418	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr6:97247418T>C	ENST00000229955.3	-	2	535	c.190A>G	c.(190-192)Aca>Gca	p.T64A	GPR63_ENST00000417980.1_Missense_Mutation_p.T64A	NM_001143957.2|NM_030784.3	NP_001137429.1|NP_110411.1	Q9BZJ6	GPR63_HUMAN	G protein-coupled receptor 63	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			kidney(1)|large_intestine(5)|lung(13)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;6.89e-05)|Acute lymphoblastic leukemia(125;7.02e-10)|all_hematologic(75;1.23e-06)|all_epithelial(107;0.0618)|Colorectal(196;0.0721)		BRCA - Breast invasive adenocarcinoma(108;0.0912)		GGCACAGCTGTACTATTCACG	0.443																																						dbGAP											0													111.0	104.0	106.0					6																	97247418		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF317654	CCDS5036.1	6q16.1-q16.3	2012-08-21			ENSG00000112218	ENSG00000112218		"""GPCR / Class A : Orphans"""	13302	protein-coding gene	gene with protein product		606915					Standard	NM_030784		Approved	PSP24(beta), PSP24B	uc003pou.3	Q9BZJ6	OTTHUMG00000015245	ENST00000229955.3:c.190A>G	6.37:g.97247418T>C	ENSP00000229955:p.Thr64Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJH3	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.T64A	ENST00000229955.3	37	c.190	CCDS5036.1	6	.	.	.	.	.	.	.	.	.	.	T	10.78	1.446998	0.25987	.	.	ENSG00000112218	ENST00000536583;ENST00000417980;ENST00000229955;ENST00000369268	T;T;T	0.54279	0.58;0.58;0.58	5.15	5.15	0.70609	.	0.227450	0.34411	N	0.003987	T	0.21718	0.0523	N	0.24115	0.695	0.36528	D	0.870583	B	0.30406	0.278	B	0.24974	0.057	T	0.17077	-1.0381	10	0.51188	T	0.08	-4.1253	10.5007	0.44804	0.1448:0.0:0.0:0.8552	.	64	Q9BZJ6	GPR63_HUMAN	A	88;64;64;64	ENSP00000393170:T64A;ENSP00000229955:T64A;ENSP00000358273:T64A	ENSP00000229955:T64A	T	-	1	0	GPR63	97354139	1.000000	0.71417	0.999000	0.59377	0.755000	0.42902	2.973000	0.49264	2.077000	0.62373	0.528000	0.53228	ACA	GPR63	-	NULL	ENSG00000112218		0.443	GPR63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR63	HGNC	protein_coding	OTTHUMT00000041566.2	261	0.00	0	T			97247418	97247418	-1	no_errors	ENST00000229955	ensembl	human	known	69_37n	missense	121	40.20	82	SNP	1.000	C
HECTD4	283450	genome.wustl.edu	37	12	112687979	112687979	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr12:112687979G>A	ENST00000430131.2	-	24	3798	c.2653C>T	c.(2653-2655)Cgt>Tgt	p.R885C	HECTD4_ENST00000550722.1_Missense_Mutation_p.R1161C|HECTD4_ENST00000377560.5_Missense_Mutation_p.R1135C			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	885					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GGTCTAGCACGCCCAGAAATT	0.418																																						dbGAP											0													57.0	57.0	57.0					12																	112687979		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.2653C>T	12.37:g.112687979G>A	ENSP00000404379:p.Arg885Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.R1135C	ENST00000430131.2	37	c.3403		12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.356540	0.82243	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.65178	-0.14;-0.12;-0.13	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.69895	0.3162	N	0.24115	0.695	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.76575	0.988;0.973;0.988	T	0.74213	-0.3738	10	0.87932	D	0	.	19.2588	0.93959	0.0:0.0:1.0:0.0	.	885;885;875	Q9Y4D8-2;Q9Y4D8;Q9Y4D8-3	.;K0614_HUMAN;.	C	1135;885;1161	ENSP00000366783:R1135C;ENSP00000404379:R885C;ENSP00000449784:R1161C	ENSP00000366783:R1135C	R	-	1	0	C12orf51	111172362	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.049000	0.76613	2.637000	0.89404	0.555000	0.69702	CGT	HECTD4	-	NULL	ENSG00000173064		0.418	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		184	0.00	0	G	NM_173813		112687979	112687979	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	130	11.56	17	SNP	1.000	A
HIF3A	64344	genome.wustl.edu	37	19	46815779	46815779	+	Silent	SNP	G	G	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr19:46815779G>A	ENST00000377670.4	+	8	925	c.894G>A	c.(892-894)caG>caA	p.Q298Q	HIF3A_ENST00000600383.1_Silent_p.Q229Q|HIF3A_ENST00000300862.3_Silent_p.Q296Q|HIF3A_ENST00000472815.1_Silent_p.Q229Q|HIF3A_ENST00000339613.2_Silent_p.Q242Q|HIF3A_ENST00000244303.6_Silent_p.Q229Q|HIF3A_ENST00000420102.2_Silent_p.Q247Q	NM_152795.3	NP_690008.2	Q9Y2N7	HIF3A_HUMAN	hypoxia inducible factor 3, alpha subunit	298					cellular response to hypoxia (GO:0071456)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|transcription from RNA polymerase II promoter (GO:0006366)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(7)|lung(14)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	33		Ovarian(192;0.00965)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00204)|all cancers(93;0.0107)|GBM - Glioblastoma multiforme(486;0.0489)|Epithelial(262;0.136)		GCAAGGGCCAGGCAGTAACAG	0.652																																						dbGAP											0													66.0	63.0	64.0					19																	46815779		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK027725	CCDS12681.2, CCDS12682.1, CCDS42580.1, CCDS42580.2	19q13	2013-05-21			ENSG00000124440	ENSG00000124440		"""Basic helix-loop-helix proteins"""	15825	protein-coding gene	gene with protein product		609976				11573933, 11734856	Standard	NM_152794		Approved	IPAS, MOP7, PASD7, bHLHe17	uc002peh.3	Q9Y2N7	OTTHUMG00000141296	ENST00000377670.4:c.894G>A	19.37:g.46815779G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0M185|B4DNA2|Q58A43|Q66K72|Q8WXA1|Q96K34|Q9H7Z9|Q9HAI2	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,smart_PAC,pfscan_PAS,tigrfam_PAS	p.G271S	ENST00000377670.4	37	c.811	CCDS12681.2	19	.	.	.	.	.	.	.	.	.	.	G	9.351	1.065631	0.20067	.	.	ENSG00000124440	ENST00000472815	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	T	0.71126	0.3303	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.70517	-0.4850	4	.	.	.	.	15.6027	0.76636	0.0:0.0:1.0:0.0	.	.	.	.	S	271	.	.	G	+	1	0	HIF3A	51507619	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.265000	0.58865	2.370000	0.80446	0.591000	0.81541	GGC	HIF3A	-	pfam_PAS_fold_3,pfam_PAS_fold,tigrfam_PAS	ENSG00000124440		0.652	HIF3A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIF3A	HGNC	protein_coding	OTTHUMT00000280556.3	77	0.00	0	G			46815779	46815779	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000472815	ensembl	human	putative	69_37n	missense	48	30.43	21	SNP	1.000	A
INHBE	83729	genome.wustl.edu	37	12	57849486	57849486	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr12:57849486A>C	ENST00000266646.2	+	1	383	c.167A>C	c.(166-168)cAc>cCc	p.H56P	INHBE_ENST00000551553.1_Intron	NM_031479.3	NP_113667.1	P58166	INHBE_HUMAN	inhibin, beta E	56					growth (GO:0040007)	extracellular region (GO:0005576)				breast(2)|central_nervous_system(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	15						GATGGGTTGCACCTGACCAGT	0.617																																					GBM(191;1808 2166 15720 36624 50371)	dbGAP											0													79.0	72.0	74.0					12																	57849486		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8939.1	12q13.2	2008-02-05				ENSG00000139269			24029	protein-coding gene	gene with protein product		612031				12242034	Standard	NM_031479		Approved	activin, MGC4638	uc001snw.3	P58166		ENST00000266646.2:c.167A>C	12.37:g.57849486A>C	ENSP00000266646:p.His56Pro	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaC,prints_Inhibin_asu	p.H56P	ENST00000266646.2	37	c.167	CCDS8939.1	12	.	.	.	.	.	.	.	.	.	.	A	14.47	2.543913	0.45280	.	.	ENSG00000139269	ENST00000266646	T	0.64260	-0.09	4.8	3.65	0.41850	Transforming growth factor-beta, N-terminal (1);	0.216967	0.46758	D	0.000270	T	0.64886	0.2639	M	0.78456	2.415	0.52501	D	0.999954	P	0.42123	0.771	P	0.45577	0.486	T	0.64807	-0.6320	10	0.49607	T	0.09	-8.5577	7.4082	0.27004	0.9016:0.0:0.0984:0.0	.	56	P58166	INHBE_HUMAN	P	56	ENSP00000266646:H56P	ENSP00000266646:H56P	H	+	2	0	INHBE	56135753	1.000000	0.71417	0.998000	0.56505	0.597000	0.36814	4.650000	0.61440	0.973000	0.38340	-0.290000	0.09829	CAC	INHBE	-	pfam_TGF-b_N,prints_Inhibin_betaC	ENSG00000139269		0.617	INHBE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBE	HGNC	protein_coding	OTTHUMT00000406773.1	168	0.59	1	A	NM_031479		57849486	57849486	+1	no_errors	ENST00000266646	ensembl	human	known	69_37n	missense	64	26.97	24	SNP	0.997	C
ITLN1	55600	genome.wustl.edu	37	1	160850420	160850420	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr1:160850420C>T	ENST00000326245.3	-	6	758	c.643G>A	c.(643-645)Gac>Aac	p.D215N	ITLN1_ENST00000487531.1_5'UTR	NM_017625.2	NP_060095.2	Q8WWA0	ITLN1_HUMAN	intelectin 1 (galactofuranose binding)	215	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				positive regulation of glucose import (GO:0046326)|positive regulation of protein phosphorylation (GO:0001934)|response to nematode (GO:0009624)	anchored component of membrane (GO:0031225)|brush border membrane (GO:0031526)|extracellular vesicular exosome (GO:0070062)|membrane raft (GO:0045121)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	21	all_cancers(52;2.99e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TTCTGGGCGTCGCCAAAATCA	0.443																																						dbGAP											0													181.0	181.0	181.0					1																	160850420		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB036706	CCDS1211.1	1q21.3	2008-02-05			ENSG00000179914	ENSG00000179914			18259	protein-coding gene	gene with protein product		609873				11313366, 11181563	Standard	NM_017625		Approved	ITLN, FLJ20022, LFR, HL-1, hIntL	uc001fxc.3	Q8WWA0	OTTHUMG00000028604	ENST00000326245.3:c.643G>A	1.37:g.160850420C>T	ENSP00000323587:p.Asp215Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5IWS4|Q5VYI4|Q6YDJ3|Q9NP67	Missense_Mutation	SNP	superfamily_Fibrinogen_a/b/g_C	p.D215N	ENST00000326245.3	37	c.643	CCDS1211.1	1	.	.	.	.	.	.	.	.	.	.	C	5.427	0.263890	0.10294	.	.	ENSG00000179914	ENST00000326245	T	0.16196	2.36	4.17	3.26	0.37387	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.518571	0.17907	N	0.157988	T	0.04724	0.0128	L	0.49513	1.565	0.22961	N	0.998501	B	0.18013	0.025	B	0.17722	0.019	T	0.38243	-0.9670	10	0.18276	T	0.48	-10.3329	6.5624	0.22493	0.0:0.7843:0.0:0.2157	.	215	Q8WWA0	ITLN1_HUMAN	N	215	ENSP00000323587:D215N	ENSP00000323587:D215N	D	-	1	0	ITLN1	159117044	0.014000	0.17966	0.878000	0.34440	0.153000	0.21895	0.143000	0.16115	0.961000	0.38030	-0.119000	0.15052	GAC	ITLN1	-	superfamily_Fibrinogen_a/b/g_C	ENSG00000179914		0.443	ITLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITLN1	HGNC	protein_coding	OTTHUMT00000071462.1	237	0.00	0	C	NM_017625		160850420	160850420	-1	no_errors	ENST00000326245	ensembl	human	known	69_37n	missense	110	40.32	75	SNP	0.962	T
KDM2A	22992	genome.wustl.edu	37	11	67010479	67010479	+	Splice_Site	SNP	G	G	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr11:67010479G>T	ENST00000529006.2	+	13	1925		c.e13-1		KDM2A_ENST00000398645.2_Splice_Site|KDM2A_ENST00000308783.5_Splice_Site|KDM2A_ENST00000530342.1_Splice_Site|KDM2A_ENST00000526258.1_Splice_Site	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A						histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CCTACCCTTAGATTTTGCTGG	0.483																																						dbGAP											0													166.0	147.0	153.0					11																	67010479		1878	4114	5992	-	-	-	SO:0001630	splice_region_variant	0			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.1480-1G>T	11.37:g.67010479G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Splice_Site	SNP	-	e12-1	ENST00000529006.2	37	c.1480-1	CCDS44657.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.296513	0.95574	.	.	ENSG00000173120	ENST00000398645;ENST00000529006;ENST00000530342;ENST00000446134	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3668	0.98882	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KDM2A	66767055	1.000000	0.71417	0.792000	0.32020	0.695000	0.40330	9.121000	0.94375	2.894000	0.99253	0.655000	0.94253	.	KDM2A	-	-	ENSG00000173120		0.483	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	730	0.00	0	G	NM_012308	Intron	67010479	67010479	+1	no_errors	ENST00000529006	ensembl	human	known	69_37n	splice_site	416	27.90	161	SNP	0.999	T
LRIG1	26018	genome.wustl.edu	37	3	66431242	66431242	+	Silent	SNP	C	C	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr3:66431242C>T	ENST00000273261.3	-	18	3338	c.2814G>A	c.(2812-2814)gtG>gtA	p.V938V	LRIG1_ENST00000383703.3_Silent_p.V915V|SLC25A26_ENST00000536651.1_3'UTR|LRIG1_ENST00000496559.2_5'UTR	NM_015541.2	NP_056356.2	Q96JA1	LRIG1_HUMAN	leucine-rich repeats and immunoglobulin-like domains 1	938					innervation (GO:0060384)|otolith morphogenesis (GO:0032474)|sensory perception of sound (GO:0007605)	integral component of membrane (GO:0016021)				NS(2)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(12)|ovary(3)|prostate(1)|skin(4)|stomach(4)|urinary_tract(1)	42		Lung NSC(201;0.0101)		BRCA - Breast invasive adenocarcinoma(55;0.00047)		AGTAACAGTCCACTTCGGTGT	0.612																																						dbGAP											0													61.0	64.0	63.0					3																	66431242		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB050468	CCDS33783.1	3p14	2013-01-14			ENSG00000144749	ENSG00000144749		"""Immunoglobulin superfamily / I-set domain containing"""	17360	protein-coding gene	gene with protein product	"""ortholog of mouse integral membrane glycoprotein LIG-1"", ""leucine-rich repeat protein LRIG1"""	608868				11414704, 12234026	Standard	NM_015541		Approved	LIG-1, DKFZP586O1624, LIG1	uc003dmx.3	Q96JA1	OTTHUMG00000158727	ENST00000273261.3:c.2814G>A	3.37:g.66431242C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IQ51|Q96CF9|Q9BYB8|Q9UFI4	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Cys-rich_flank_reg_C,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V938	ENST00000273261.3	37	c.2814	CCDS33783.1	3																																																																																			LRIG1	-	NULL	ENSG00000144749		0.612	LRIG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG1	HGNC	protein_coding	OTTHUMT00000351930.1	46	0.00	0	C	NM_015541		66431242	66431242	-1	no_errors	ENST00000273261	ensembl	human	known	69_37n	silent	26	33.33	13	SNP	0.001	T
MTPAP	55149	genome.wustl.edu	37	10	30602780	30602780	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr10:30602780G>A	ENST00000263063.4	-	9	1550	c.1507C>T	c.(1507-1509)Cga>Tga	p.R503*	MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_Nonsense_Mutation_p.R633*	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase	503					cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GCACTTTCTCGGGCCAAATCT	0.428																																						dbGAP											0													94.0	94.0	94.0					10																	30602780		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.1507C>T	10.37:g.30602780G>A	ENSP00000263063:p.Arg503*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	Nonsense_Mutation	SNP	pfam_PAP_assoc	p.R633*	ENST00000263063.4	37	c.1897	CCDS7165.1	10	.	.	.	.	.	.	.	.	.	.	G	28.9	4.961149	0.92791	.	.	ENSG00000107951	ENST00000358107;ENST00000263063	.	.	.	5.76	2.04	0.26737	.	0.155507	0.56097	D	0.000028	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.4055	14.2258	0.65858	0.0:0.0:0.5318:0.4682	.	.	.	.	X	633;503	.	ENSP00000263063:R503X	R	-	1	2	MTPAP	30642786	1.000000	0.71417	0.996000	0.52242	0.605000	0.37080	0.702000	0.25631	0.093000	0.17368	-0.262000	0.10625	CGA	MTPAP	-	NULL	ENSG00000107951		0.428	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2	203	0.00	0	G	NM_018109		30602780	30602780	-1	no_errors	ENST00000358107	ensembl	human	known	69_37n	nonsense	136	22.73	40	SNP	0.999	A
NEDD9	4739	genome.wustl.edu	37	6	11191135	11191135	+	Missense_Mutation	SNP	C	C	T	rs200047696		TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr6:11191135C>T	ENST00000379446.5	-	5	1133	c.967G>A	c.(967-969)Gtt>Att	p.V323I	NEDD9_ENST00000504387.1_Missense_Mutation_p.V323I|RP3-510L9.1_ENST00000500636.2_RNA	NM_001271033.1|NM_006403.3	NP_001257962.1|NP_006394.1	Q14511	CASL_HUMAN	neural precursor cell expressed, developmentally down-regulated 9	323					actin filament bundle assembly (GO:0051017)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|integrin-mediated signaling pathway (GO:0007229)|mitotic nuclear division (GO:0007067)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle pole (GO:0000922)				endometrium(3)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	Breast(50;0.0768)|Ovarian(93;0.152)	all_hematologic(90;0.135)	Epithelial(50;0.0647)|all cancers(50;0.179)			AGAAACTGAACGCCTCGGGGG	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		18771	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													67.0	71.0	70.0					6																	11191135		2203	4300	6503	-	-	-	SO:0001583	missense	0			L43821	CCDS4520.1, CCDS34340.1, CCDS47373.1, CCDS75400.1	6p25-p24	2011-04-13			ENSG00000111859	ENSG00000111859		"""Cas scaffolding proteins"""	7733	protein-coding gene	gene with protein product	"""Cas scaffolding protein family member 2"", ""Cas-like"""	602265					Standard	NM_182966		Approved	HEF1, CAS-L, CASS2	uc003mzv.2	Q14511	OTTHUMG00000014255	ENST00000379446.5:c.967G>A	6.37:g.11191135C>T	ENSP00000368759:p.Val323Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9G7|A8MSJ9|G5E9Y9|Q5T9R4|Q5XKI0	Missense_Mutation	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	p.V323I	ENST00000379446.5	37	c.967	CCDS4520.1	6	1	4.578754578754579E-4	0	0.0	0	0.0	0	0.0	1	0.0013192612137203166	C	0.495	-0.873473	0.02570	.	.	ENSG00000111859	ENST00000379446;ENST00000504387	T;T	0.39406	1.08;1.19	5.94	3.26	0.37387	.	0.637453	0.17523	N	0.171167	T	0.09247	0.0228	N	0.13043	0.29	0.58432	D	0.999998	B;B;B	0.13145	0.006;0.007;0.006	B;B;B	0.09377	0.003;0.002;0.004	T	0.14980	-1.0453	10	0.14656	T	0.56	-7.0614	8.9568	0.35823	0.0:0.636:0.0:0.364	.	323;323;323	G5E9Y9;A8K9G7;Q14511	.;.;CASL_HUMAN	I	323	ENSP00000368759:V323I;ENSP00000422871:V323I	ENSP00000368759:V323I	V	-	1	0	NEDD9	11299121	0.078000	0.21339	0.668000	0.29813	0.011000	0.07611	0.263000	0.18478	0.437000	0.26423	-0.254000	0.11334	GTT	NEDD9	-	NULL	ENSG00000111859		0.567	NEDD9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEDD9	HGNC	protein_coding	OTTHUMT00000039853.2	78	0.00	0	C	NM_006403		11191135	11191135	-1	no_errors	ENST00000379446	ensembl	human	known	69_37n	missense	57	35.96	32	SNP	0.603	T
PCDHB6	56130	genome.wustl.edu	37	5	140532071	140532071	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr5:140532071C>A	ENST00000231136.1	+	1	2233	c.2233C>A	c.(2233-2235)Cag>Aag	p.Q745K	PCDHB6_ENST00000543635.1_Missense_Mutation_p.Q609K	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	745					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GACCCTATCCCAGAGCTACCA	0.602																																						dbGAP											0													122.0	133.0	129.0					5																	140532071		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.2233C>A	5.37:g.140532071C>A	ENSP00000231136:p.Gln745Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8R9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q745K	ENST00000231136.1	37	c.2233	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	C	13.48	2.250612	0.39797	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.53640	0.61;0.64	4.45	4.45	0.53987	.	.	.	.	.	T	0.52645	0.1747	M	0.82517	2.595	0.25965	N	0.982578	B	0.10296	0.003	B	0.12837	0.008	T	0.52578	-0.8557	9	0.87932	D	0	.	11.4387	0.50083	0.18:0.82:0.0:0.0	.	745	Q9Y5E3	PCDB6_HUMAN	K	609;745	ENSP00000438466:Q609K;ENSP00000231136:Q745K	ENSP00000231136:Q745K	Q	+	1	0	PCDHB6	140512255	0.000000	0.05858	0.998000	0.56505	0.779000	0.44077	0.991000	0.29654	2.187000	0.69744	0.556000	0.70494	CAG	PCDHB6	-	NULL	ENSG00000113211		0.602	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	219	0.45	1	C	NM_018939		140532071	140532071	+1	no_errors	ENST00000231136	ensembl	human	known	69_37n	missense	142	34.26	74	SNP	0.965	A
PIEZO2	63895	genome.wustl.edu	37	18	10855367	10855367	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr18:10855367T>C	ENST00000503781.3	-	7	900	c.901A>G	c.(901-903)Aat>Gat	p.N301D	PIEZO2_ENST00000580640.1_Missense_Mutation_p.N301D|PIEZO2_ENST00000302079.6_Missense_Mutation_p.N301D	NM_022068.2	NP_071351.2	Q9H5I5	PIEZ2_HUMAN	piezo-type mechanosensitive ion channel component 2	301					cation transport (GO:0006812)|detection of mechanical stimulus involved in sensory perception (GO:0050974)|regulation of membrane potential (GO:0042391)|response to mechanical stimulus (GO:0009612)	integral component of membrane (GO:0016021)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)										TAGTAGTCATTGGGTGGAACT	0.448																																						dbGAP											0													81.0	73.0	76.0					18																	10855367		692	1591	2283	-	-	-	SO:0001583	missense	0			AK027056		18p11.21	2012-11-19	2011-08-31	2011-08-31	ENSG00000154864	ENSG00000154864			26270	protein-coding gene	gene with protein product		613629	"""chromosome 18 open reading frame 30"", ""chromosome 18 open reading frame 58"", ""family with sequence similarity 38, member B"""	FAM38B2, C18orf30, C18orf58, FAM38B		20813920, 21056836, 21299953	Standard	NM_022068		Approved	FLJ23403, FLJ23144, HsT748, HsT771, FLJ34907	uc002kos.2	Q9H5I5	OTTHUMG00000178507	ENST00000503781.3:c.901A>G	18.37:g.10855367T>C	ENSP00000421377:p.Asn301Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z812|M4GPJ9|Q6ZS91|Q8N787|Q8NAR6|Q9H5R4	Missense_Mutation	SNP	NULL	p.N301D	ENST00000503781.3	37	c.901		18	.	.	.	.	.	.	.	.	.	.	T	9.272	1.045830	0.19748	.	.	ENSG00000154864	ENST00000302079	T	0.72282	-0.64	5.42	4.28	0.50868	.	0.709014	0.14799	N	0.297729	T	0.50411	0.1614	N	0.14661	0.345	0.20074	N	0.999936	.	.	.	.	.	.	T	0.36359	-0.9751	8	0.13853	T	0.58	-12.746	8.2512	0.31724	0.0:0.1649:0.0:0.8351	.	.	.	.	D	301	ENSP00000303316:N301D	ENSP00000303316:N301D	N	-	1	0	FAM38B	10845367	0.321000	0.24625	0.983000	0.44433	0.796000	0.44982	0.358000	0.20216	2.037000	0.60232	0.533000	0.62120	AAT	PIEZO2	-	NULL	ENSG00000154864		0.448	PIEZO2-003	NOVEL	basic|appris_principal	protein_coding	PIEZO2	HGNC	protein_coding	OTTHUMT00000442385.4	185	0.00	0	T	NM_022068		10855367	10855367	-1	no_errors	ENST00000582913	ensembl	human	known	69_37n	missense	137	20.81	36	SNP	0.206	C
PIK3CA	5290	genome.wustl.edu	37	3	178936082	178936082	+	Missense_Mutation	SNP	G	G	A	rs121913273		TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr3:178936082G>A	ENST00000263967.3	+	10	1781	c.1624G>A	c.(1624-1626)Gaa>Aaa	p.E542K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	542	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> K (in CLOVE, KERSEB, CRC and BC; also found in glioblastoma multiforme and endometrial carcinoma; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N- terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|E -> Q (found in an endometrial carcinoma sample; unknown pathological significance). {ECO:0000269|PubMed:16322209}.|E -> V (in BC; unknown pathological significance). {ECO:0000269|PubMed:16353168}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E542K(545)|p.E542Q(10)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TCCTCTCTCTGAAATCACTGA	0.333	E542K(BT483_BREAST)|E542K(CAL51_BREAST)|E542K(HGC27_STOMACH)|E542K(IM95_STOMACH)|E542K(JHUEM1_ENDOMETRIUM)|E542K(NCIH1341_LUNG)|E542K(SW948_LARGE_INTESTINE)|E542K(T84_LARGE_INTESTINE)|E542K(VMCUB1_URINARY_TRACT)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	555	Substitution - Missense(555)	breast(176)|large_intestine(166)|urinary_tract(45)|endometrium(37)|skin(19)|lung(18)|stomach(16)|ovary(16)|thyroid(14)|upper_aerodigestive_tract(9)|central_nervous_system(7)|cervix(6)|liver(6)|oesophagus(5)|penis(4)|kidney(3)|soft_tissue(2)|haematopoietic_and_lymphoid_tissue(2)|prostate(2)|biliary_tract(1)|pituitary(1)											56.0	56.0	56.0					3																	178936082		1809	4069	5878	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1624G>A	3.37:g.178936082G>A	ENSP00000263967:p.Glu542Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E542K	ENST00000263967.3	37	c.1624	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	34	5.360420	0.95877	.	.	ENSG00000121879	ENST00000263967	T	0.62105	0.05	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.69287	0.3094	L	0.41356	1.27	0.80722	D	1	D	0.65815	0.995	D	0.63192	0.912	T	0.60296	-0.7291	10	0.09843	T	0.71	-23.9623	20.0024	0.97423	0.0:0.0:1.0:0.0	.	542	P42336	PK3CA_HUMAN	K	542	ENSP00000263967:E542K	ENSP00000263967:E542K	E	+	1	0	PIK3CA	180418776	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.333	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	276	0.36	1	G			178936082	178936082	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	167	35.77	93	SNP	1.000	A
SLC35G5	83650	genome.wustl.edu	37	8	11188822	11188822	+	Silent	SNP	G	G	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr8:11188822G>A	ENST00000382435.4	+	1	426	c.207G>A	c.(205-207)tcG>tcA	p.S69S		NM_001282300.1|NM_054028.1	NP_001269229.1|NP_473369.1	Q96KT7	S35G5_HUMAN	solute carrier family 35, member G5	69	EamA 1.					integral component of membrane (GO:0016021)											ACCTGCCCTCGCTGGAGCTGC	0.632																																						dbGAP											0													160.0	157.0	158.0					8																	11188822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ291677	CCDS5980.1	8p23.1	2013-05-22	2011-08-03	2011-08-03	ENSG00000177710	ENSG00000177710		"""Solute carriers"""	15546	protein-coding gene	gene with protein product		615199	"""acyl-malonyl condensing enzyme 1-like 2"""	AMAC, AMAC1L2			Standard	NM_054028		Approved		uc003wtp.1	Q96KT7	OTTHUMG00000090653	ENST00000382435.4:c.207G>A	8.37:g.11188822G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRL6	Silent	SNP	pfam_DMT	p.S69	ENST00000382435.4	37	c.207	CCDS5980.1	8																																																																																			SLC35G5	-	pfam_DMT	ENSG00000177710		0.632	SLC35G5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35G5	HGNC	protein_coding	OTTHUMT00000207313.2	395	0.75	3	G	NM_054028		11188822	11188822	+1	no_errors	ENST00000382435	ensembl	human	known	69_37n	silent	190	35.76	108	SNP	1.000	A
PRKDC	5591	genome.wustl.edu	37	8	48743255	48743255	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr8:48743255C>T	ENST00000314191.2	-	62	8361	c.8305G>A	c.(8305-8307)Gtt>Att	p.V2769I	PRKDC_ENST00000523565.1_5'UTR|PRKDC_ENST00000338368.3_Missense_Mutation_p.V2769I	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	2770	KIP-binding.				B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CTGTACAGAACGACCTGGGCA	0.483								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)	dbGAP											0													96.0	102.0	100.0					8																	48743255		2012	4183	6195	-	-	-	SO:0001583	missense	0				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.8305G>A	8.37:g.48743255C>T	ENSP00000313420:p.Val2769Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Missense_Mutation	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.V2769I	ENST00000314191.2	37	c.8305		8	.	.	.	.	.	.	.	.	.	.	C	12.62	1.992484	0.35131	.	.	ENSG00000253729	ENST00000314191;ENST00000338368	T;T	0.02579	4.31;4.24	5.6	-0.705	0.11252	.	0.420678	0.22737	N	0.056259	T	0.02380	0.0073	L	0.34521	1.04	0.22866	N	0.998636	B;B	0.15930	0.015;0.015	B;B	0.11329	0.006;0.004	T	0.45891	-0.9230	10	0.22109	T	0.4	.	9.8076	0.40803	0.0:0.3593:0.0:0.6407	.	2769;2770	E7EUY0;P78527	.;PRKDC_HUMAN	I	2769	ENSP00000313420:V2769I;ENSP00000345182:V2769I	ENSP00000313420:V2769I	V	-	1	0	PRKDC	48905808	0.957000	0.32711	0.006000	0.13384	0.955000	0.61496	0.877000	0.28106	-0.372000	0.07992	-0.302000	0.09304	GTT	PRKDC	-	NULL	ENSG00000253729		0.483	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		145	0.00	0	C	NM_001081640		48743255	48743255	-1	no_errors	ENST00000314191	ensembl	human	known	69_37n	missense	74	35.09	40	SNP	0.995	T
SOX14	8403	genome.wustl.edu	37	3	137483952	137483952	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr3:137483952G>A	ENST00000306087.1	+	1	374	c.326G>A	c.(325-327)gGc>gAc	p.G109D		NM_004189.3	NP_004180.1	O95416	SOX14_HUMAN	SRY (sex determining region Y)-box 14	109					entrainment of circadian clock (GO:0009649)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|regulation of neuron migration (GO:2001222)|visual perception (GO:0007601)	nuclear transcription factor complex (GO:0044798)	chromatin binding (GO:0003682)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			large_intestine(2)|lung(12)	14						AAGGCGGCTGGCCTGCCCGTG	0.701																																						dbGAP											0													57.0	65.0	62.0					3																	137483952		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ006230	CCDS3094.1	3q22-q23	2008-07-18			ENSG00000168875	ENSG00000168875		"""SRY (sex determining region Y)-boxes"""	11193	protein-coding gene	gene with protein product	"""HMG box transcription factor SOX-14"", ""SRY-box 14"""	604747				9925951	Standard	NM_004189		Approved	SOX28	uc003erm.2	O95416	OTTHUMG00000159757	ENST00000306087.1:c.326G>A	3.37:g.137483952G>A	ENSP00000305343:p.Gly109Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAC0|Q3KPH7	Missense_Mutation	SNP	pfam_HMG_superfamily,pfam_TF_SOX,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.G109D	ENST00000306087.1	37	c.326	CCDS3094.1	3	.	.	.	.	.	.	.	.	.	.	G	20.9	4.070100	0.76301	.	.	ENSG00000168875	ENST00000306087	D	0.96716	-4.1	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.96361	0.8813	L	0.42245	1.32	0.80722	D	1	D	0.63046	0.992	D	0.63283	0.913	D	0.94436	0.7654	10	0.13470	T	0.59	.	17.8201	0.88648	0.0:0.0:1.0:0.0	.	109	O95416	SOX14_HUMAN	D	109	ENSP00000305343:G109D	ENSP00000305343:G109D	G	+	2	0	SOX14	138966642	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	7.578000	0.82498	2.449000	0.82847	0.511000	0.50034	GGC	SOX14	-	NULL	ENSG00000168875		0.701	SOX14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX14	HGNC	protein_coding	OTTHUMT00000357182.1	66	0.00	0	G	NM_004189		137483952	137483952	+1	no_errors	ENST00000306087	ensembl	human	known	69_37n	missense	31	36.00	18	SNP	1.000	A
UCP3	7352	genome.wustl.edu	37	11	73717218	73717218	+	Silent	SNP	C	C	T			TCGA-BH-A1ET-01A-11D-A135-09	TCGA-BH-A1ET-11B-23D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9bd66613-68ad-42c1-ab43-dac1386027f9	55ca01bf-18c0-48b3-b83f-4e13b5161bde	g.chr11:73717218C>T	ENST00000314032.4	-	3	885	c.333G>A	c.(331-333)gcG>gcA	p.A111A	UCP3_ENST00000426995.2_Silent_p.A111A|UCP3_ENST00000348534.4_Silent_p.A111A	NM_003356.3	NP_003347.1	P55916	UCP3_HUMAN	uncoupling protein 3 (mitochondrial, proton carrier)	111					aging (GO:0007568)|cellular metabolic process (GO:0044237)|cellular response to hormone stimulus (GO:0032870)|fatty acid metabolic process (GO:0006631)|lipid metabolic process (GO:0006629)|mitochondrial transport (GO:0006839)|proton transport (GO:0015992)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|response to activity (GO:0014823)|response to cold (GO:0009409)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)|response to nutrient (GO:0007584)|response to superoxide (GO:0000303)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	oxidative phosphorylation uncoupler activity (GO:0017077)|transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	12	Breast(11;2.08e-05)					ACTCACTGTCCGCGCCTTTGG	0.617																																						dbGAP											0													39.0	38.0	38.0					11																	73717218		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			AF001787	CCDS8229.1, CCDS44677.1	11q13.4	2013-05-22				ENSG00000175564		"""Solute carriers"""	12519	protein-coding gene	gene with protein product		602044				9480760, 9196039	Standard	NM_003356		Approved	SLC25A9	uc001our.3	P55916		ENST00000314032.4:c.333G>A	11.37:g.73717218C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60475|Q96HL3	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling,prints_Mit_carrier	p.A111	ENST00000314032.4	37	c.333	CCDS8229.1	11																																																																																			UCP3	-	superfamily_Mt_carrier_dom,prints_Mit_uncoupling	ENSG00000175564		0.617	UCP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UCP3	HGNC	protein_coding	OTTHUMT00000398200.1	42	0.00	0	C	NM_003356		73717218	73717218	-1	no_errors	ENST00000314032	ensembl	human	known	69_37n	silent	28	34.88	15	SNP	0.000	T
