#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAM17	6868	genome.wustl.edu	37	2	9633946	9633946	+	Silent	SNP	A	A	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:9633946A>G	ENST00000310823.3	-	16	2105	c.1923T>C	c.(1921-1923)tgT>tgC	p.C641C	IAH1_ENST00000545602.1_Intron	NM_003183.4	NP_003174.3	P78536	ADA17_HUMAN	ADAM metallopeptidase domain 17	641	Crambin-like.				apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell differentiation (GO:0030183)|cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell motility (GO:0048870)|collagen catabolic process (GO:0030574)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermal growth factor-activated receptor transactivation by G-protein coupled receptor signaling pathway (GO:0035625)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|germinal center formation (GO:0002467)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|negative regulation of interleukin-8 production (GO:0032717)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil mediated immunity (GO:0002446)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|PMA-inducible membrane protein ectodomain proteolysis (GO:0051088)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of chemokine production (GO:0032722)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|proteolysis (GO:0006508)|regulation of mast cell apoptotic process (GO:0033025)|response to drug (GO:0042493)|response to high density lipoprotein particle (GO:0055099)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|spleen development (GO:0048536)|T cell differentiation in thymus (GO:0033077)|wound healing, spreading of epidermal cells (GO:0035313)	actin cytoskeleton (GO:0015629)|apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|interleukin-6 receptor binding (GO:0005138)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|Notch binding (GO:0005112)|PDZ domain binding (GO:0030165)|zinc ion binding (GO:0008270)			breast(1)|cervix(4)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(1)	28	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.225)		CTCGTTTCTCACATTTGCCCT	0.363																																						dbGAP											0													139.0	126.0	130.0					2																	9633946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69611	CCDS1665.1	2p25	2010-08-05	2008-07-31		ENSG00000151694	ENSG00000151694		"""ADAM metallopeptidase domain containing"", ""CD molecules"""	195	protein-coding gene	gene with protein product		603639	"""tumor necrosis factor, alpha, converting enzyme"""	TACE		9034190, 9574564	Standard	NM_003183		Approved	cSVP, CD156B	uc002qzu.3	P78536	OTTHUMG00000090425	ENST00000310823.3:c.1923T>C	2.37:g.9633946A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O60226	Silent	SNP	pfam_Blood-coag_inhib_Disintegrin,pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.C641	ENST00000310823.3	37	c.1923	CCDS1665.1	2																																																																																			ADAM17	-	NULL	ENSG00000151694		0.363	ADAM17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM17	HGNC	protein_coding	OTTHUMT00000206857.1	457	0.22	1	A			9633946	9633946	-1	no_errors	ENST00000310823	ensembl	human	known	69_37n	silent	403	17.08	83	SNP	1.000	G
AEBP1	165	genome.wustl.edu	37	7	44147257	44147257	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr7:44147257C>G	ENST00000223357.3	+	4	1002	c.697C>G	c.(697-699)Ctg>Gtg	p.L233V		NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	233	Pro-rich.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						GCAACCCACACTGGACTACAA	0.632																																						dbGAP											0													128.0	135.0	133.0					7																	44147257		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.697C>G	7.37:g.44147257C>G	ENSP00000223357:p.Leu233Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.L233V	ENST00000223357.3	37	c.697	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	C	9.892	1.204434	0.22205	.	.	ENSG00000106624	ENST00000223357;ENST00000449162	T;T	0.52754	0.65;0.65	3.51	0.55	0.17219	.	10.464400	0.00166	N	0.000000	T	0.32823	0.0842	L	0.27053	0.805	0.39186	D	0.962877	P	0.42692	0.787	B	0.34779	0.189	T	0.23940	-1.0174	10	0.87932	D	0	-16.0683	4.5807	0.12257	0.1743:0.6289:0.0:0.1968	.	233	Q8IUX7	AEBP1_HUMAN	V	233;149	ENSP00000223357:L233V;ENSP00000401758:L149V	ENSP00000223357:L233V	L	+	1	2	AEBP1	44113782	0.097000	0.21791	0.135000	0.22099	0.210000	0.24377	0.298000	0.19120	0.107000	0.17824	-0.339000	0.08088	CTG	AEBP1	-	NULL	ENSG00000106624		0.632	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	194	0.00	0	C	NM_001129		44147257	44147257	+1	no_errors	ENST00000223357	ensembl	human	known	69_37n	missense	177	17.29	37	SNP	0.167	G
AGBL1	123624	genome.wustl.edu	37	15	86806012	86806012	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr15:86806012G>A	ENST00000441037.2	+	9	930	c.835G>A	c.(835-837)Gat>Aat	p.D279N	AGBL1_ENST00000389298.3_Missense_Mutation_p.D10N|AGBL1_ENST00000421325.2_Missense_Mutation_p.D279N	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	279	Asp-rich.				C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						ATTTTAGGATGATGACTTGGA	0.428																																						dbGAP											0													118.0	119.0	118.0					15																	86806012		1938	4133	6071	-	-	-	SO:0001583	missense	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.835G>A	15.37:g.86806012G>A	ENSP00000413001:p.Asp279Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Missense_Mutation	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.D279N	ENST00000441037.2	37	c.835	CCDS58398.1	15	.	.	.	.	.	.	.	.	.	.	G	21.7	4.191852	0.78902	.	.	ENSG00000166748	ENST00000441037;ENST00000421325;ENST00000389298	T;T	0.49720	0.77;2.64	5.5	4.56	0.56223	Armadillo-type fold (1);	0.379577	0.25948	N	0.027270	T	0.48677	0.1513	M	0.80982	2.52	0.25275	N	0.989482	B;B	0.32382	0.368;0.028	B;B	0.32677	0.15;0.014	T	0.52734	-0.8536	10	0.62326	D	0.03	-19.2999	8.3429	0.32254	0.0859:0.0:0.753:0.1611	.	10;279	Q96MI9-3;Q96MI9	.;CBPC4_HUMAN	N	308;279;10	ENSP00000397173:D279N;ENSP00000373949:D10N	ENSP00000373949:D10N	D	+	1	0	AGBL1	84607016	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	3.849000	0.55910	1.253000	0.44018	0.655000	0.94253	GAT	AGBL1	-	superfamily_ARM-type_fold	ENSG00000166748		0.428	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	357	0.28	1	G	NM_152336		86806012	86806012	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	missense	240	22.58	70	SNP	1.000	A
AKAP6	9472	genome.wustl.edu	37	14	33015522	33015522	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr14:33015522G>A	ENST00000280979.4	+	4	1833	c.1663G>A	c.(1663-1665)Gag>Aag	p.E555K	AKAP6_ENST00000557272.1_Missense_Mutation_p.E555K|AKAP6_ENST00000557354.1_Missense_Mutation_p.E555K	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	555					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ATCCTCACTTGAGCCTTGTAA	0.438																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0													87.0	91.0	90.0					14																	33015522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.1663G>A	14.37:g.33015522G>A	ENSP00000280979:p.Glu555Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.E555K	ENST00000280979.4	37	c.1663	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	G	10.33	1.320754	0.23994	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272;ENST00000553547	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	6.11	6.11	0.99139	.	0.420549	0.26773	N	0.022571	T	0.38719	0.1051	L	0.44542	1.39	0.26159	N	0.980026	B;B	0.31125	0.309;0.309	B;B	0.24541	0.054;0.054	T	0.35276	-0.9795	10	0.52906	T	0.07	-6.5792	18.9147	0.92501	0.0:0.0:1.0:0.0	.	555;555	A7E242;Q13023	.;AKAP6_HUMAN	K	555;555;555;313	ENSP00000280979:E555K;ENSP00000450531:E555K;ENSP00000451247:E555K;ENSP00000451239:E313K	ENSP00000280979:E555K	E	+	1	0	AKAP6	32085273	0.965000	0.33210	0.150000	0.22450	0.100000	0.18952	3.501000	0.53325	2.906000	0.99361	0.655000	0.94253	GAG	AKAP6	-	NULL	ENSG00000151320		0.438	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	164	0.00	0	G	NM_004274		33015522	33015522	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	156	18.75	36	SNP	0.665	A
ANK3	288	genome.wustl.edu	37	10	61829925	61829925	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr10:61829925C>G	ENST00000280772.2	-	37	10905	c.10714G>C	c.(10714-10716)Gaa>Caa	p.E3572Q	ANK3_ENST00000355288.2_Intron|ANK3_ENST00000373827.2_Intron|ANK3_ENST00000503366.1_Intron	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)	3572					axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						GAGCGGTCTTCTACCGCCAGC	0.483																																						dbGAP											0													114.0	108.0	110.0					10																	61829925		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.10714G>C	10.37:g.61829925C>G	ENSP00000280772:p.Glu3572Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.E3572Q	ENST00000280772.2	37	c.10714	CCDS7258.1	10	.	.	.	.	.	.	.	.	.	.	C	16.90	3.250681	0.59212	.	.	ENSG00000151150	ENST00000280772	T	0.16897	2.31	5.77	5.77	0.91146	.	0.159531	0.29266	N	0.012655	T	0.23289	0.0563	L	0.46157	1.445	0.80722	D	1	P	0.38250	0.624	B	0.39706	0.307	T	0.01004	-1.1484	10	0.72032	D	0.01	.	19.9837	0.97340	0.0:1.0:0.0:0.0	.	3572	Q12955	ANK3_HUMAN	Q	3572	ENSP00000280772:E3572Q	ENSP00000280772:E3572Q	E	-	1	0	ANK3	61499931	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	7.818000	0.86416	2.723000	0.93209	0.655000	0.94253	GAA	ANK3	-	NULL	ENSG00000151150		0.483	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	480	0.21	1	C	NM_020987		61829925	61829925	-1	no_errors	ENST00000280772	ensembl	human	known	69_37n	missense	396	20.24	101	SNP	1.000	G
ARGLU1	55082	genome.wustl.edu	37	13	107220001	107220001	+	Silent	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr13:107220001C>T	ENST00000400198.3	-	1	511	c.267G>A	c.(265-267)gtG>gtA	p.V89V		NM_018011.3	NP_060481.3	Q9NWB6	ARGL1_HUMAN	arginine and glutamate rich 1	89					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrion (GO:0005739)|nucleus (GO:0005634)				large_intestine(1)|lung(5)|pancreas(1)	7	Lung NSC(43;0.015)|all_neural(89;0.0741)|Lung SC(71;0.14)|Medulloblastoma(90;0.169)					TGCGCTTGCTCACCGTGCGCC	0.692																																						dbGAP											0													42.0	43.0	43.0					13																	107220001		1997	4181	6178	-	-	-	SO:0001819	synonymous_variant	0			BC071587	CCDS41906.1	13q33.3	2011-10-03	2007-11-28		ENSG00000134884	ENSG00000134884			25482	protein-coding gene	gene with protein product		614046				21454576	Standard	NM_018011		Approved	FLJ10154	uc001vqk.4	Q9NWB6	OTTHUMG00000017321	ENST00000400198.3:c.267G>A	13.37:g.107220001C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0Y3|Q5T257|Q6IQ34	Silent	SNP	NULL	p.V89	ENST00000400198.3	37	c.267	CCDS41906.1	13																																																																																			ARGLU1	-	NULL	ENSG00000134884		0.692	ARGLU1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARGLU1	HGNC	protein_coding	OTTHUMT00000045727.1	66	0.00	0	C	NM_018011		107220001	107220001	-1	no_errors	ENST00000400198	ensembl	human	known	69_37n	silent	24	30.56	11	SNP	1.000	T
ARID1B	57492	genome.wustl.edu	37	6	157527466	157527466	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:157527466G>C	ENST00000350026.5	+	19	5153	c.5152G>C	c.(5152-5154)Gag>Cag	p.E1718Q	ARID1B_ENST00000275248.4_Missense_Mutation_p.E1713Q|ARID1B_ENST00000346085.5_Missense_Mutation_p.E1731Q|ARID1B_ENST00000367148.1_Missense_Mutation_p.E1771Q	NM_017519.2	NP_059989.2	Q8NFD5	ARI1B_HUMAN	AT rich interactive domain 1B (SWI1-like)	1718					chromatin-mediated maintenance of transcription (GO:0048096)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			NS(2)|breast(5)|central_nervous_system(4)|endometrium(12)|kidney(4)|large_intestine(11)|lung(30)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(3)	81		Breast(66;0.000162)|Ovarian(120;0.0265)		OV - Ovarian serous cystadenocarcinoma(65;3.19e-17)|BRCA - Breast invasive adenocarcinoma(81;1.01e-05)		TTCTGGGAAAGAGGAGGAAGA	0.498																																						dbGAP											0													154.0	164.0	161.0					6																	157527466		2203	4296	6499	-	-	-	SO:0001583	missense	0			AF521671	CCDS5251.1, CCDS5251.2, CCDS55072.1	6q25.3	2014-09-17			ENSG00000049618	ENSG00000049618		"""-"""	18040	protein-coding gene	gene with protein product		614556					Standard	NM_017519		Approved	KIAA1235, ELD/OSA1, p250R, BAF250b, DAN15, 6A3-5	uc003qqo.3	Q8NFD5	OTTHUMG00000015890	ENST00000350026.5:c.5152G>C	6.37:g.157527466G>C	ENSP00000055163:p.Glu1718Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRD1|Q5VYC4|Q8IZY8|Q8TEV0|Q8TF02|Q99491|Q9ULI5	Missense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E1771Q	ENST00000350026.5	37	c.5311	CCDS5251.2	6	.	.	.	.	.	.	.	.	.	.	G	10.34	1.324131	0.24080	.	.	ENSG00000049618	ENST00000346085;ENST00000350026;ENST00000367148;ENST00000275248;ENST00000414678	T;T;T;T;T	0.02579	4.56;4.56;4.54;4.55;4.24	5.16	5.16	0.70880	Armadillo-like helical (1);	0.211894	0.47455	D	0.000229	T	0.03095	0.0091	M	0.64404	1.975	0.48975	D	0.999739	P;P;P	0.45827	0.791;0.867;0.779	B;B;B	0.41894	0.203;0.369;0.369	T	0.52646	-0.8548	10	0.46703	T	0.11	.	18.6564	0.91455	0.0:0.0:1.0:0.0	.	1718;1731;1713	Q8NFD5;Q8NFD5-2;G3XAA0	ARI1B_HUMAN;.;.	Q	1731;1718;1771;1713;1240	ENSP00000344546:E1731Q;ENSP00000055163:E1718Q;ENSP00000356116:E1771Q;ENSP00000275248:E1713Q;ENSP00000412835:E1240Q	ENSP00000275248:E1713Q	E	+	1	0	ARID1B	157569158	1.000000	0.71417	0.876000	0.34364	0.449000	0.32228	7.285000	0.78660	2.394000	0.81467	0.467000	0.42956	GAG	ARID1B	-	NULL	ENSG00000049618		0.498	ARID1B-009	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARID1B	HGNC	protein_coding	OTTHUMT00000372723.1	246	0.00	0	G	NM_020732		157527466	157527466	+1	no_errors	ENST00000367148	ensembl	human	known	69_37n	missense	177	31.01	80	SNP	0.994	C
ARPP21	10777	genome.wustl.edu	37	3	35785363	35785363	+	Nonsense_Mutation	SNP	C	C	A	rs199538011		TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:35785363C>A	ENST00000187397.4	+	18	2394	c.1938C>A	c.(1936-1938)taC>taA	p.Y646*	ARPP21_ENST00000417925.1_Nonsense_Mutation_p.Y647*|ARPP21_ENST00000444190.1_Nonsense_Mutation_p.Y627*|ARPP21_ENST00000458225.1_Nonsense_Mutation_p.Y647*|ARPP21_ENST00000337271.5_Nonsense_Mutation_p.Y627*|MIR128-2_ENST00000384893.1_RNA	NM_016300.4	NP_057384.2	Q9UBL0	ARP21_HUMAN	cAMP-regulated phosphoprotein, 21kDa	646	Gln-rich.				cellular response to heat (GO:0034605)	cytoplasm (GO:0005737)	nucleic acid binding (GO:0003676)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|lung(31)|ovary(3)|prostate(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	61						CTGGTCAGTACCCTACCTCAA	0.448																																						dbGAP											0																																										-	-	-	SO:0001587	stop_gained	0			AA733082	CCDS2661.1, CCDS43063.1, CCDS58823.1, CCDS58824.1	3p24.3	2010-08-12			ENSG00000172995	ENSG00000172995			16968	protein-coding gene	gene with protein product	"""R3H domain containing 3"""	605488				8120638	Standard	NM_198399		Approved	ARPP-21, TARPP, R3HDM3	uc011axy.2	Q9UBL0	OTTHUMG00000130795	ENST00000187397.4:c.1938C>A	3.37:g.35785363C>A	ENSP00000187397:p.Tyr646*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG96|Q49AK3|Q49AS6|Q4G0V4|Q6NYC3|Q86V31|Q9UF93	Nonsense_Mutation	SNP	pfam_R3H_ss-bd,smart_R3H_ss-bd,pfscan_R3H_ss-bd	p.Y647*	ENST00000187397.4	37	c.1941	CCDS2661.1	3	.	.	.	.	.	.	.	.	.	.	C	41	8.868494	0.98984	.	.	ENSG00000172995	ENST00000458225;ENST00000337271;ENST00000444190;ENST00000187397;ENST00000417925	.	.	.	5.82	5.82	0.92795	.	0.541641	0.18814	N	0.130429	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-12.2602	18.2794	0.90092	0.0:1.0:0.0:0.0	.	.	.	.	X	647;627;627;646;647	.	ENSP00000187397:Y646X	Y	+	3	2	ARPP21	35760367	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.614000	0.54160	2.740000	0.93945	0.655000	0.94253	TAC	ARPP21	-	NULL	ENSG00000172995		0.448	ARPP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPP21	HGNC	protein_coding	OTTHUMT00000253334.2	229	0.00	0	C	NM_198399		35785363	35785363	+1	no_errors	ENST00000417925	ensembl	human	known	69_37n	nonsense	217	13.55	34	SNP	1.000	A
C10orf2	56652	genome.wustl.edu	37	10	102749027	102749027	+	Missense_Mutation	SNP	C	C	T	rs533720034		TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr10:102749027C>T	ENST00000311916.2	+	1	1245	c.1060C>T	c.(1060-1062)Cgt>Tgt	p.R354C	MRPL43_ENST00000370241.3_5'Flank|MRPL43_ENST00000370242.4_5'Flank|MRPL43_ENST00000477279.1_5'Flank|MRPL43_ENST00000299179.5_5'Flank|C10orf2_ENST00000370228.1_Missense_Mutation_p.R354C|MRPL43_ENST00000493646.1_5'Flank|MRPL43_ENST00000370236.1_5'Flank|MRPL43_ENST00000318364.8_5'Flank|MRPL43_ENST00000342071.1_5'Flank|MRPL43_ENST00000370234.4_5'Flank|C10orf2_ENST00000473656.1_Intron|MRPL43_ENST00000318325.2_5'Flank	NM_001163813.1|NM_021830.4	NP_001157285.1|NP_068602.2	Q96RR1	PEO1_HUMAN	chromosome 10 open reading frame 2	354			R -> P (in PEOA3). {ECO:0000269|PubMed:11431692, ECO:0000269|PubMed:20479361}.		cell death (GO:0008219)|DNA unwinding involved in DNA replication (GO:0006268)|mitochondrial DNA replication (GO:0006264)|protein hexamerization (GO:0034214)|protein homooligomerization (GO:0051260)|transcription from mitochondrial promoter (GO:0006390)	mitochondrial nucleoid (GO:0042645)	5'-3' DNA helicase activity (GO:0043139)|ATP binding (GO:0005524)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)|stomach(1)	24		Colorectal(252;0.122)|all_hematologic(284;0.152)		Epithelial(162;7.18e-11)|all cancers(201;8.75e-09)|BRCA - Breast invasive adenocarcinoma(275;0.224)		CAATCTTTCTCGTATTCTTCG	0.562													c|||	1	0.000199681	0.0008	0.0	5008	,	,		18284	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													60.0	56.0	57.0					10																	102749027		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF292004	CCDS7506.1, CCDS53570.1	10q24	2013-05-13			ENSG00000107815	ENSG00000107815			1160	protein-coding gene	gene with protein product	"""twinkle"", ""T7 helicase-related protein with intramitochondrial nucleoid localization"""	606075	"""infantile onset spinocerebellar ataxia (autosomal recessive)"""	IOSCA		11431692, 10645945, 16135556	Standard	NM_021830		Approved	PEO, PEO1, TWINKLE, FLJ21832, TWINL	uc001ksf.2	Q96RR1	OTTHUMG00000018917	ENST00000311916.2:c.1060C>T	10.37:g.102749027C>T	ENSP00000309595:p.Arg354Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2CQL2|Q6MZX2|Q6PJP5|Q96RR0	Missense_Mutation	SNP	pfam_Circ_KaiC/RadA,pfam_DNA_helicase_DnaB-like_C,pfscan_DNA_helicase_DnaB-like_C	p.R354C	ENST00000311916.2	37	c.1060	CCDS7506.1	10	.	.	.	.	.	.	.	.	.	.	c	16.46	3.128310	0.56721	.	.	ENSG00000107815	ENST00000311916;ENST00000370228	D;D	0.95238	-3.32;-3.65	5.9	4.92	0.64577	.	0.268632	0.36854	N	0.002379	D	0.94958	0.8369	L	0.54323	1.7	0.23762	N	0.996919	D;D	0.76494	0.999;0.994	P;P	0.56700	0.804;0.613	D	0.89792	0.3969	10	0.66056	D	0.02	-14.1335	13.4045	0.60903	0.237:0.763:0.0:0.0	.	354;354	Q96RR1-2;Q96RR1	.;PEO1_HUMAN	C	354	ENSP00000309595:R354C;ENSP00000359248:R354C	ENSP00000309595:R354C	R	+	1	0	C10orf2	102739017	0.966000	0.33281	0.943000	0.38184	0.857000	0.48899	3.298000	0.51818	2.801000	0.96364	0.457000	0.33378	CGT	C10orf2	-	NULL	ENSG00000107815		0.562	C10orf2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf2	HGNC	protein_coding	OTTHUMT00000049886.1	75	0.00	0	C	NM_021830		102749027	102749027	+1	no_errors	ENST00000311916	ensembl	human	known	69_37n	missense	60	21.79	17	SNP	0.152	T
CCDC185	164127	genome.wustl.edu	37	1	223567997	223567997	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:223567997A>C	ENST00000366875.3	+	1	1283	c.1180A>C	c.(1180-1182)Agc>Cgc	p.S394R		NM_152610.2	NP_689823.2	Q8N715	CC185_HUMAN		394										breast(4)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|skin(3)	29				GBM - Glioblastoma multiforme(131;0.0704)		GGAGCAGCACAGCCTGCAGCT	0.652																																						dbGAP											0													27.0	27.0	27.0					1																	223567997		2199	4298	6497	-	-	-	SO:0001583	missense	0																														ENST00000366875.3:c.1180A>C	1.37:g.223567997A>C	ENSP00000355840:p.Ser394Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N746|Q8NA93	Missense_Mutation	SNP	NULL	p.S394R	ENST00000366875.3	37	c.1180	CCDS1537.1	1	.	.	.	.	.	.	.	.	.	.	A	1.157	-0.644932	0.03531	.	.	ENSG00000178395	ENST00000366875	T	0.22539	1.95	4.94	-0.92	0.10475	.	.	.	.	.	T	0.11495	0.0280	L	0.28274	0.84	0.09310	N	1	B	0.17268	0.021	B	0.18263	0.021	T	0.39881	-0.9592	9	0.15499	T	0.54	.	5.8312	0.18581	0.4064:0.1613:0.4323:0.0	.	394	Q8N715	CA065_HUMAN	R	394	ENSP00000355840:S394R	ENSP00000355840:S394R	S	+	1	0	C1orf65	221634620	0.000000	0.05858	0.001000	0.08648	0.102000	0.19082	-0.519000	0.06260	-0.205000	0.10219	0.533000	0.62120	AGC	C1orf65	-	NULL	ENSG00000178395		0.652	C1orf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf65	HGNC	protein_coding	OTTHUMT00000092718.1	23	0.00	0	A			223567997	223567997	+1	no_errors	ENST00000366875	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	0.003	C
FANCD2OS	115795	genome.wustl.edu	37	3	10146177	10146177	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:10146177G>C	ENST00000450660.2	-	2	498	c.282C>G	c.(280-282)atC>atG	p.I94M	FANCD2OS_ENST00000524279.1_Missense_Mutation_p.I94M	NM_001164839.1	NP_001158311.1	Q96PS1	FACOS_HUMAN	FANCD2 opposite strand	94																	CACTGAGGCGGATGGGCTGGG	0.532																																						dbGAP											0													122.0	112.0	116.0					3																	10146177		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF230334	CCDS2596.1	3p25.3	2012-11-12	2012-11-12	2012-11-12	ENSG00000163705	ENSG00000163705			28623	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 24"""	C3orf24		12477932	Standard	NM_001164839		Approved	MGC40179	uc003buz.3	Q96PS1	OTTHUMG00000128669	ENST00000450660.2:c.282C>G	3.37:g.10146177G>C	ENSP00000429608:p.Ile94Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.I94M	ENST00000450660.2	37	c.282	CCDS2596.1	3	.	.	.	.	.	.	.	.	.	.	G	10.56	1.385656	0.25031	.	.	ENSG00000163705	ENST00000524279;ENST00000450660	.	.	.	5.6	2.78	0.32641	.	0.268788	0.31102	N	0.008246	T	0.19208	0.0461	N	0.14661	0.345	0.24192	N	0.995545	B	0.17268	0.021	B	0.17979	0.02	T	0.17745	-1.0359	9	0.87932	D	0	.	4.757	0.13090	0.0775:0.2796:0.4987:0.1442	.	94	Q96PS1	CC024_HUMAN	M	94	.	ENSP00000429608:I94M	I	-	3	3	C3orf24	10121177	0.997000	0.39634	0.997000	0.53966	0.827000	0.46813	0.347000	0.20014	0.306000	0.22856	-0.896000	0.02909	ATC	C3orf24	-	NULL	ENSG00000163705		0.532	FANCD2OS-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf24	HGNC	protein_coding	OTTHUMT00000339891.2	359	0.00	0	G	NM_173472		10146177	10146177	-1	no_errors	ENST00000450660	ensembl	human	known	69_37n	missense	298	41.55	214	SNP	1.000	C
C9orf3	84909	genome.wustl.edu	37	9	97563249	97563249	+	Silent	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr9:97563249C>T	ENST00000375315.2	+	4	1329	c.1329C>T	c.(1327-1329)atC>atT	p.I443I	C9orf3_ENST00000277198.2_Silent_p.I443I|C9orf3_ENST00000297979.5_Silent_p.I443I|C9orf3_ENST00000395357.2_Silent_p.I63I	NM_001193329.1	NP_001180258.1	Q8N6M6	AMPO_HUMAN	chromosome 9 open reading frame 3	443					leukotriene biosynthetic process (GO:0019370)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(12)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				OV - Ovarian serous cystadenocarcinoma(323;0.000275)		ATGTTCTCATCGTCCCTGCCA	0.522																																						dbGAP											0													129.0	125.0	127.0					9																	97563249		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF043896	CCDS6713.1, CCDS55327.1, CCDS55328.1	9q22	2013-06-27			ENSG00000148120	ENSG00000148120			1361	protein-coding gene	gene with protein product	aminopeptidase O					15687497	Standard	NM_001193329		Approved	C90RF3, FLJ14675, APO, AOPEP, AP-O	uc004ava.3	Q8N6M6	OTTHUMG00000020276	ENST00000375315.2:c.1329C>T	9.37:g.97563249C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T9B1|Q5T9B3|Q5T9B4|Q8WUL6|Q96M23|Q96SS1	Silent	SNP	pfam_Peptidase_M1_N,pfam_Peptidase_M1_C,superfamily_ARM-type_fold	p.I443	ENST00000375315.2	37	c.1329	CCDS55328.1	9																																																																																			C9orf3	-	pfam_Peptidase_M1_N	ENSG00000148120		0.522	C9orf3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf3	HGNC	protein_coding		128	0.00	0	C	NM_032823		97563249	97563249	+1	no_errors	ENST00000375315	ensembl	human	known	69_37n	silent	75	25.00	25	SNP	0.523	T
CAMSAP1	157922	genome.wustl.edu	37	9	138774817	138774817	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr9:138774817G>A	ENST00000389532.4	-	2	332	c.268C>T	c.(268-270)Cgt>Tgt	p.R90C	CAMSAP1_ENST00000409386.3_Missense_Mutation_p.R90C|CAMSAP1_ENST00000312405.6_5'Flank	NM_015447.3	NP_056262.3	Q5T5Y3	CAMP1_HUMAN	calmodulin regulated spectrin-associated protein 1	90					cytoskeleton organization (GO:0007010)|neuron projection development (GO:0031175)|regulation of cell morphogenesis (GO:0022604)	cytoplasm (GO:0005737)|microtubule (GO:0005874)	calmodulin binding (GO:0005516)|microtubule binding (GO:0008017)|spectrin binding (GO:0030507)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(11)|lung(16)|ovary(3)|pancreas(1)|skin(1)	47				OV - Ovarian serous cystadenocarcinoma(145;1.4e-06)|Epithelial(140;1.11e-05)		CTGCAGACACGGCAGTACAGC	0.567																																						dbGAP											0													66.0	68.0	68.0					9																	138774817		692	1591	2283	-	-	-	SO:0001583	missense	0			AJ519841	CCDS35176.2	9q34.3	2008-02-05			ENSG00000130559	ENSG00000130559			19946	protein-coding gene	gene with protein product		613774				12477932	Standard	NM_015447		Approved	FLJ31228, DKFZp434F195	uc004cgr.4	Q5T5Y3	OTTHUMG00000020918	ENST00000389532.4:c.268C>T	9.37:g.138774817G>A	ENSP00000374183:p.Arg90Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L2|B2REB2|B2REB3|Q70W33|Q8NCY0|Q96E80|Q96FM3|Q9UFJ5	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.R90C	ENST00000389532.4	37	c.268	CCDS35176.2	9	.	.	.	.	.	.	.	.	.	.	G	25.4	4.629653	0.87660	.	.	ENSG00000130559	ENST00000389532;ENST00000409386	T;T	0.19938	2.11;2.11	5.6	5.6	0.85130	.	0.000000	0.85682	U	0.000000	T	0.50205	0.1602	M	0.82823	2.61	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53099	-0.8486	10	0.87932	D	0	-2.6355	14.7804	0.69764	0.0:0.0:0.8556:0.1444	.	90	Q5T5Y3	CAMP1_HUMAN	C	90	ENSP00000374183:R90C;ENSP00000386420:R90C	ENSP00000374183:R90C	R	-	1	0	CAMSAP1	137914638	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	7.548000	0.82154	2.800000	0.96347	0.655000	0.94253	CGT	CAMSAP1	-	NULL	ENSG00000130559		0.567	CAMSAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMSAP1	HGNC	protein_coding	OTTHUMT00000055024.2	156	0.00	0	G	XM_351857		138774817	138774817	-1	no_errors	ENST00000409386	ensembl	human	known	69_37n	missense	117	22.00	33	SNP	1.000	A
COL8A1	1295	genome.wustl.edu	37	3	99514307	99514307	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:99514307C>T	ENST00000261037.3	+	5	1942	c.1562C>T	c.(1561-1563)cCg>cTg	p.P521L	COL8A1_ENST00000273342.4_Missense_Mutation_p.P521L	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	521	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						AAAGGGGAGCCGGGCCTCCCA	0.672																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.1562C>T	3.37:g.99514307C>T	ENSP00000261037:p.Pro521Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN42|Q53XI6|Q96D07	Missense_Mutation	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.P521L	ENST00000261037.3	37	c.1562	CCDS2934.1	3	.	.	.	.	.	.	.	.	.	.	C	10.77	1.443944	0.25987	.	.	ENSG00000144810	ENST00000261037;ENST00000273342	D;D	0.95622	-3.76;-3.76	5.82	4.93	0.64822	.	0.428470	0.27447	N	0.019332	D	0.93533	0.7936	M	0.81682	2.555	0.36661	D	0.877971	P;P	0.35468	0.503;0.503	B;B	0.17098	0.017;0.017	D	0.94148	0.7403	10	0.62326	D	0.03	.	11.6935	0.51529	0.3218:0.6782:0.0:0.0	.	522;521	E7EPK9;P27658	.;CO8A1_HUMAN	L	521	ENSP00000261037:P521L;ENSP00000273342:P521L	ENSP00000261037:P521L	P	+	2	0	COL8A1	100996997	0.005000	0.15991	0.995000	0.50966	0.865000	0.49528	0.371000	0.20450	1.421000	0.47157	0.557000	0.71058	CCG	COL8A1	-	pfam_Collagen	ENSG00000144810		0.672	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL8A1	HGNC	protein_coding	OTTHUMT00000309001.1	23	0.00	0	C	NM_001850		99514307	99514307	+1	no_errors	ENST00000261037	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.664	T
CREB3L2	64764	genome.wustl.edu	37	7	137597730	137597730	+	Intron	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr7:137597730G>A	ENST00000330387.6	-	4	935				CREB3L2_ENST00000456390.1_Intron|CREB3L2_ENST00000452463.1_Missense_Mutation_p.S197F|CREB3L2_ENST00000458726.1_Missense_Mutation_p.S134F	NM_194071.3	NP_919047.2	Q70SY1	CR3L2_HUMAN	cAMP responsive element binding protein 3-like 2						cartilage development (GO:0051216)|chondrocyte differentiation (GO:0002062)|ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of transcription, DNA-templated (GO:0045893)|response to endoplasmic reticulum stress (GO:0034976)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	cAMP response element binding (GO:0035497)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)		FUS/CREB3L2(158)	breast(1)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19						AGGGAGGGCAGACAGACCTTC	0.473			T	FUS	fibromyxoid sarcoma																																	dbGAP		Dom	yes		7	7q34	64764	cAMP responsive element binding protein 3-like 2		M	0													52.0	47.0	49.0					7																	137597730		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AJ549092	CCDS34760.1, CCDS59083.1	7q34	2013-01-10			ENSG00000182158	ENSG00000182158		"""basic leucine zipper proteins"""	23720	protein-coding gene	gene with protein product		608834					Standard	NM_194071		Approved	BBF2H7, TCAG_1951439	uc003vtw.3	Q70SY1	OTTHUMG00000155744	ENST00000330387.6:c.583+6C>T	7.37:g.137597730G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P454|Q6ZMR6	Missense_Mutation	SNP	NULL	p.S197F	ENST00000330387.6	37	c.590	CCDS34760.1	7	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177770	0.38413	.	.	ENSG00000182158	ENST00000452463;ENST00000458726;ENST00000420629	T;T;T	0.49432	0.86;0.85;0.78	5.81	-6.46	0.01908	.	.	.	.	.	T	0.31702	0.0805	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.35500	-0.9786	8	0.66056	D	0.02	.	9.2325	0.37446	0.2924:0.4298:0.2777:0.0	.	197	Q70SY1-3	.	F	197;134;190	ENSP00000410314:S197F;ENSP00000388917:S134F;ENSP00000402889:S190F	ENSP00000402889:S190F	S	-	2	0	CREB3L2	137248270	0.000000	0.05858	0.001000	0.08648	0.083000	0.17756	-0.558000	0.05978	-1.172000	0.02762	-0.150000	0.13652	TCT	CREB3L2	-	NULL	ENSG00000182158		0.473	CREB3L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREB3L2	HGNC	protein_coding	OTTHUMT00000341462.1	156	0.00	0	G	NM_194071		137597730	137597730	-1	no_errors	ENST00000452463	ensembl	human	known	69_37n	missense	54	30.77	24	SNP	0.001	A
CSPG4	1464	genome.wustl.edu	37	15	75968731	75968731	+	Silent	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr15:75968731C>T	ENST00000308508.5	-	10	6221	c.6129G>A	c.(6127-6129)gtG>gtA	p.V2043V	CTD-2026K11.1_ENST00000569467.1_RNA|AC105020.1_ENST00000435356.1_5'Flank	NM_001897.4	NP_001888.2	Q6UVK1	CSPG4_HUMAN	chondroitin sulfate proteoglycan 4	2043	Cysteine-containing.|Neurite growth inhibition. {ECO:0000250}.				activation of MAPK activity (GO:0000187)|angiogenesis (GO:0001525)|carbohydrate metabolic process (GO:0005975)|cell proliferation (GO:0008283)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|intracellular signal transduction (GO:0035556)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|small molecule metabolic process (GO:0044281)|tissue remodeling (GO:0048771)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell projection (GO:0042995)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(1)|cervix(2)|endometrium(5)|kidney(5)|large_intestine(3)|liver(2)|lung(18)|ovary(2)|pancreas(2)|prostate(4)|skin(4)	48						GCAGAGCCCTCACAGTGACGT	0.617																																						dbGAP											0													64.0	51.0	55.0					15																	75968731		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			X96753, AY359468	CCDS10284.1	15q24.2	2010-04-19	2007-02-16		ENSG00000173546	ENSG00000173546		"""Proteoglycans / Cell surface : Other"""	2466	protein-coding gene	gene with protein product	"""melanoma-associated chondroitin sulfate proteoglycan"""	601172	"""chondroitin sulfate proteoglycan 4 (melanoma-associated)"""			8790396, 16407841	Standard	NM_001897		Approved	MCSPG, MEL-CSPG, MSK16, NG2, MCSP, HMW-MAA	uc002baw.3	Q6UVK1	OTTHUMG00000142836	ENST00000308508.5:c.6129G>A	15.37:g.75968731C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW77|Q92675	Silent	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	p.V2043	ENST00000308508.5	37	c.6129	CCDS10284.1	15																																																																																			CSPG4	-	NULL	ENSG00000173546		0.617	CSPG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSPG4	HGNC	protein_coding	OTTHUMT00000286472.1	38	0.00	0	C	NM_001897		75968731	75968731	-1	no_errors	ENST00000308508	ensembl	human	known	69_37n	silent	17	32.00	8	SNP	0.413	T
CUL5	8065	genome.wustl.edu	37	11	107975024	107975024	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr11:107975024G>C	ENST00000393094.2	+	19	2872	c.2256G>C	c.(2254-2256)atG>atC	p.M752I	RP11-144G7.2_ENST00000525548.1_RNA	NM_003478.3	NP_003469.2	Q93034	CUL5_HUMAN	cullin 5	752					calcium ion transmembrane transport (GO:0070588)|cell cycle arrest (GO:0007050)|cell proliferation (GO:0008283)|cytosolic calcium ion homeostasis (GO:0051480)|G1/S transition of mitotic cell cycle (GO:0000082)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|protein ubiquitination (GO:0016567)|response to osmotic stress (GO:0006970)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	Cul5-RING ubiquitin ligase complex (GO:0031466)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|receptor activity (GO:0004872)|ubiquitin protein ligase binding (GO:0031625)			endometrium(2)|kidney(1)|large_intestine(8)|lung(9)|ovary(1)|prostate(1)|skin(1)	23		all_cancers(61;7.09e-10)|all_epithelial(67;2.97e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|Melanoma(852;4.48e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		BRCA - Breast invasive adenocarcinoma(274;3.58e-05)|Epithelial(105;4.68e-05)|all cancers(92;0.00122)|OV - Ovarian serous cystadenocarcinoma(223;0.217)		AAAAGAAAATGATAAAAGAGC	0.289																																						dbGAP											0													76.0	82.0	80.0					11																	107975024		2201	4294	6495	-	-	-	SO:0001583	missense	0			X81882	CCDS31668.1	11q22.3	2011-05-24			ENSG00000166266	ENSG00000166266			2556	protein-coding gene	gene with protein product		601741				8681378, 9037604	Standard	XM_005271682		Approved	VACM-1	uc001pjv.3	Q93034	OTTHUMG00000166369	ENST00000393094.2:c.2256G>C	11.37:g.107975024G>C	ENSP00000376808:p.Met752Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K960|O14766|Q9BZC6	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.M752I	ENST00000393094.2	37	c.2256	CCDS31668.1	11	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762601	0.31228	.	.	ENSG00000166266	ENST00000393094	T	0.69926	-0.44	5.57	3.67	0.42095	Cullin protein, neddylation domain (2);Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.57533	0.2060	L	0.42529	1.33	0.80722	D	1	B	0.26445	0.149	B	0.31016	0.123	T	0.49615	-0.8921	10	0.08837	T	0.75	-13.2997	15.1564	0.72746	0.0:0.0:0.7442:0.2558	.	752	Q93034	CUL5_HUMAN	I	752	ENSP00000376808:M752I	ENSP00000376808:M752I	M	+	3	0	CUL5	107480234	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	9.378000	0.97191	0.806000	0.34183	-1.028000	0.02416	ATG	CUL5	-	pfam_Cullin_neddylation_domain,smart_Cullin_neddylation_domain	ENSG00000166266		0.289	CUL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL5	HGNC	protein_coding	OTTHUMT00000389429.1	220	0.00	0	G			107975024	107975024	+1	no_errors	ENST00000393094	ensembl	human	known	69_37n	missense	152	12.14	21	SNP	1.000	C
CYP2A13	1553	genome.wustl.edu	37	19	41601717	41601717	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr19:41601717C>G	ENST00000330436.3	+	9	1356	c.1356C>G	c.(1354-1356)ttC>ttG	p.F452L		NM_000766.4	NP_000757.2	Q16696	CP2AD_HUMAN	cytochrome P450, family 2, subfamily A, polypeptide 13	452					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	aromatase activity (GO:0070330)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(3)|endometrium(6)|kidney(4)|large_intestine(8)|lung(13)|ovary(3)|prostate(3)|skin(2)	42					Methoxsalen(DB00553)|Nicotine(DB00184)|Testosterone(DB00624)	TCTTTCTCTTCTTCACCACCA	0.552																																						dbGAP											0													184.0	167.0	173.0					19																	41601717		2203	4300	6503	-	-	-	SO:0001583	missense	0			U22028	CCDS12571.1	19q13.2	2013-11-11	2003-01-14		ENSG00000197838	ENSG00000197838		"""Cytochrome P450s"""	2608	protein-coding gene	gene with protein product		608055	"""cytochrome P450, subfamily IIA (phenobarbital-inducible), polypeptide 13"""			7668294, 15128046	Standard	NM_000766		Approved	CPAD, CYP2A	uc002opt.4	Q16696	OTTHUMG00000182762	ENST00000330436.3:c.1356C>G	19.37:g.41601717C>G	ENSP00000332679:p.Phe452Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YR8|Q6R569|Q6R570|Q9H2X2	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2A-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV	p.F452L	ENST00000330436.3	37	c.1356	CCDS12571.1	19	.	.	.	.	.	.	.	.	.	.	.	13.92	2.380938	0.42207	.	.	ENSG00000197838	ENST00000330436	T	0.68765	-0.35	4.18	1.89	0.25635	.	0.186848	0.46758	N	0.000267	T	0.46541	0.1398	N	0.21617	0.685	0.20563	N	0.999886	B	0.18166	0.026	B	0.27076	0.076	T	0.28332	-1.0047	10	0.41790	T	0.15	.	3.3865	0.07273	0.1991:0.5437:0.0:0.2572	.	452	Q16696	CP2AD_HUMAN	L	452	ENSP00000332679:F452L	ENSP00000332679:F452L	F	+	3	2	CYP2A13	46293557	0.192000	0.23301	0.994000	0.49952	0.944000	0.59088	0.780000	0.26760	0.983000	0.38602	0.568000	0.79292	TTC	CYP2A13	-	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	ENSG00000197838		0.552	CYP2A13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2A13	HGNC	protein_coding	OTTHUMT00000463505.1	430	0.00	0	C	NM_000766		41601717	41601717	+1	no_errors	ENST00000330436	ensembl	human	known	69_37n	missense	268	34.63	142	SNP	0.990	G
CXCL17	284340	genome.wustl.edu	37	19	42946982	42946982	+	Start_Codon_SNP	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr19:42946982C>T	ENST00000601181.1	-	1	218	c.3G>A	c.(1-3)atG>atA	p.M1I	LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000457234.2_RNA|LIPE-AS1_ENST00000593740.2_RNA|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000594688.1_RNA	NM_198477.1	NP_940879.1	Q6UXB2	VCC1_HUMAN	chemokine (C-X-C motif) ligand 17	1					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)	extracellular region (GO:0005576)				large_intestine(2)|skin(1)	3		Prostate(69;0.00899)				TTAGAACTTTCATCGCAACTG	0.493																																						dbGAP											0													86.0	76.0	79.0					19																	42946982		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0				CCDS12608.1	19q13.2	2007-10-15				ENSG00000189377			19232	protein-coding gene	gene with protein product		611387				17201934	Standard	NM_198477		Approved	Dcip1, UNQ473, DMC, VCC1	uc002otu.3	Q6UXB2		ENST00000601181.1:c.3G>A	19.37:g.42946982C>T	ENSP00000472467:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAC0	Missense_Mutation	SNP	NULL	p.M1I	ENST00000601181.1	37	c.3	CCDS12608.1	19	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284950	0.23392	.	.	ENSG00000189377	ENST00000341918	.	.	.	3.45	2.41	0.29592	.	0.126178	0.37715	N	0.001979	T	0.22820	0.0551	.	.	.	0.29168	N	0.877305	P	0.36535	0.557	B	0.30572	0.117	T	0.19353	-1.0308	8	0.87932	D	0	-8.6547	6.7181	0.23314	0.0:0.8713:0.0:0.1287	.	1	Q6UXB2	VCC1_HUMAN	I	1	.	ENSP00000345317:M1I	M	-	3	0	CXCL17	47638822	1.000000	0.71417	0.780000	0.31762	0.319000	0.28217	1.759000	0.38420	1.012000	0.39366	0.555000	0.69702	ATG	CXCL17	-	NULL	ENSG00000189377		0.493	CXCL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL17	HGNC	protein_coding	OTTHUMT00000463872.1	318	0.00	0	C		Missense_Mutation	42946982	42946982	-1	no_errors	ENST00000341918	ensembl	human	known	69_37n	missense	305	14.25	51	SNP	0.901	T
DNAH11	8701	genome.wustl.edu	37	7	21744181	21744181	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr7:21744181G>C	ENST00000409508.3	+	38	6434	c.6403G>C	c.(6403-6405)Gaa>Caa	p.E2135Q	DNAH11_ENST00000328843.6_Missense_Mutation_p.E2142Q	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2142					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.E2142Q(1)		NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						GCTGCACTTTGAACAGATGGT	0.537									Kartagener syndrome																													dbGAP											1	Substitution - Missense(1)	lung(1)											71.0	73.0	73.0					7																	21744181		1999	4177	6176	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6403G>C	7.37:g.21744181G>C	ENSP00000475939:p.Glu2135Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.E2142Q	ENST00000409508.3	37	c.6424		7	.	.	.	.	.	.	.	.	.	.	G	33	5.281282	0.95489	.	.	ENSG00000105877	ENST00000328843	T	0.39592	1.07	5.44	5.44	0.79542	.	0.104902	0.64402	D	0.000006	T	0.58538	0.2129	.	.	.	0.80722	D	1	D	0.69078	0.997	P	0.58130	0.833	T	0.53315	-0.8456	9	0.34782	T	0.22	.	19.6049	0.95576	0.0:0.0:1.0:0.0	.	2142	Q96DT5	DYH11_HUMAN	Q	2142	ENSP00000330671:E2142Q	ENSP00000330671:E2142Q	E	+	1	0	DNAH11	21710706	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.813000	0.99286	2.706000	0.92434	0.563000	0.77884	GAA	DNAH11	-	NULL	ENSG00000105877		0.537	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	173	0.00	0	G	NM_003777		21744181	21744181	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	179	16.74	36	SNP	1.000	C
DOCK10	55619	genome.wustl.edu	37	2	225729686	225729686	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:225729686G>A	ENST00000258390.7	-	12	1443	c.1376C>T	c.(1375-1377)tCt>tTt	p.S459F	DOCK10_ENST00000409592.3_Missense_Mutation_p.S453F	NM_014689.2	NP_055504.2	Q96BY6	DOC10_HUMAN	dedicator of cytokinesis 10	459					regulation of cell migration (GO:0030334)|small GTPase mediated signal transduction (GO:0007264)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(10)|large_intestine(16)|lung(40)|ovary(2)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	87		Renal(207;0.0113)|all_lung(227;0.0486)|Lung NSC(271;0.0653)|all_hematologic(139;0.14)		Epithelial(121;2.37e-10)|all cancers(144;2.26e-07)|Lung(261;0.0143)|LUSC - Lung squamous cell carcinoma(224;0.0178)		CAAAGCCACAGAAGCCCCCAA	0.458																																						dbGAP											0													161.0	155.0	157.0					2																	225729686		1933	4149	6082	-	-	-	SO:0001583	missense	0			AB014594	CCDS46528.1, CCDS74661.1	2q36.3	2013-01-10			ENSG00000135905	ENSG00000135905		"""Pleckstrin homology (PH) domain containing"""	23479	protein-coding gene	gene with protein product	"""zizimin3"""	611518				12432077	Standard	NM_014689		Approved	ZIZ3, KIAA0694	uc010fwz.1	Q96BY6	OTTHUMG00000153428	ENST00000258390.7:c.1376C>T	2.37:g.225729686G>A	ENSP00000258390:p.Ser459Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3FL70|O75178|Q9NW06|Q9NXI8	Missense_Mutation	SNP	pfam_DOCK,pfam_DUF3398,pfam_Pleckstrin_homology,superfamily_ARM-type_fold,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S459F	ENST00000258390.7	37	c.1376	CCDS46528.1	2	.	.	.	.	.	.	.	.	.	.	G	17.18	3.323934	0.60634	.	.	ENSG00000135905	ENST00000409592;ENST00000258390	T;T	0.50813	0.73;0.73	5.77	5.77	0.91146	.	0.852561	0.11001	N	0.610463	T	0.70193	0.3196	M	0.82323	2.585	0.09310	N	1	P;P;P	0.45176	0.787;0.852;0.48	B;P;B	0.53102	0.398;0.718;0.398	T	0.64521	-0.6388	10	0.72032	D	0.01	.	20.3472	0.98799	0.0:0.0:1.0:0.0	.	459;459;453	Q96BY6;Q96BY6-2;B3FL70	DOC10_HUMAN;.;.	F	453;459	ENSP00000386694:S453F;ENSP00000258390:S459F	ENSP00000258390:S459F	S	-	2	0	DOCK10	225437930	0.643000	0.27269	0.009000	0.14445	0.615000	0.37417	4.494000	0.60347	2.890000	0.99128	0.650000	0.86243	TCT	DOCK10	-	NULL	ENSG00000135905		0.458	DOCK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK10	HGNC	protein_coding	OTTHUMT00000331246.1	218	0.00	0	G			225729686	225729686	-1	no_errors	ENST00000258390	ensembl	human	known	69_37n	missense	145	27.14	54	SNP	0.075	A
ENPP6	133121	genome.wustl.edu	37	4	185045320	185045320	+	Missense_Mutation	SNP	G	G	A	rs575851730	byFrequency	TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr4:185045320G>A	ENST00000296741.2	-	3	668	c.527C>T	c.(526-528)tCc>tTc	p.S176F		NM_153343.3	NP_699174.1	Q6UWR7	ENPP6_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 6	176					choline metabolic process (GO:0019695)|lipid catabolic process (GO:0016042)|lipid metabolic process (GO:0006629)	anchored component of membrane (GO:0031225)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	glycerophosphocholine cholinephosphodiesterase activity (GO:0047390)|glycerophosphodiester phosphodiesterase activity (GO:0008889)|phosphoric diester hydrolase activity (GO:0008081)			breast(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	15		all_lung(41;7.99e-12)|Lung NSC(41;1.46e-11)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;4.98e-27)|Epithelial(43;3.15e-24)|OV - Ovarian serous cystadenocarcinoma(60;4.09e-12)|Colorectal(24;3.78e-05)|STAD - Stomach adenocarcinoma(60;4.5e-05)|COAD - Colon adenocarcinoma(29;0.000154)|GBM - Glioblastoma multiforme(59;0.000167)|BRCA - Breast invasive adenocarcinoma(30;0.000378)|LUSC - Lung squamous cell carcinoma(40;0.0151)		TTACTTGAAGGAGTCAAGAGC	0.443																																						dbGAP											0													139.0	143.0	142.0					4																	185045320		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057370	CCDS3834.1	4q35.1	2008-02-05			ENSG00000164303	ENSG00000164303			23409	protein-coding gene	gene with protein product							Standard	NM_153343		Approved	MGC33971	uc003iwc.3	Q6UWR7	OTTHUMG00000160617	ENST00000296741.2:c.527C>T	4.37:g.185045320G>A	ENSP00000296741:p.Ser176Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5Q1|Q96M57	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	p.S176F	ENST00000296741.2	37	c.527	CCDS3834.1	4	.	.	.	.	.	.	.	.	.	.	G	3.221	-0.159584	0.06544	.	.	ENSG00000164303	ENST00000296741;ENST00000512353	T;T	0.72835	-0.69;-0.69	5.67	3.85	0.44370	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.928281	0.08921	N	0.874350	T	0.55162	0.1903	N	0.20401	0.57	0.39071	D	0.960719	B	0.10296	0.003	B	0.14023	0.01	T	0.29731	-1.0002	10	0.10111	T	0.7	-2.7159	11.8144	0.52202	0.1498:0.0:0.8502:0.0	.	176	Q6UWR7	ENPP6_HUMAN	F	176;88	ENSP00000296741:S176F;ENSP00000423497:S88F	ENSP00000296741:S176F	S	-	2	0	ENPP6	185282314	0.987000	0.35691	0.872000	0.34217	0.535000	0.34838	3.409000	0.52657	0.671000	0.31185	0.655000	0.94253	TCC	ENPP6	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000164303		0.443	ENPP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP6	HGNC	protein_coding	OTTHUMT00000361428.1	279	0.00	0	G	NM_153343		185045320	185045320	-1	no_errors	ENST00000296741	ensembl	human	known	69_37n	missense	124	30.34	54	SNP	0.927	A
ENTPD4	9583	genome.wustl.edu	37	8	23291938	23291938	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr8:23291938G>A	ENST00000358689.4	-	12	1749	c.1514C>T	c.(1513-1515)tCg>tTg	p.S505L	ENTPD4_ENST00000356206.6_Missense_Mutation_p.S497L|ENTPD4_ENST00000417069.2_Missense_Mutation_p.S497L|ENTPD4_ENST00000521321.1_5'UTR	NM_001128930.2|NM_004901.4	NP_001122402.1|NP_004892.1	Q9Y227	ENTP4_HUMAN	ectonucleoside triphosphate diphosphohydrolase 4	505					UDP catabolic process (GO:0006256)	cytoplasmic vesicle (GO:0031410)|integral component of Golgi membrane (GO:0030173)|intracellular membrane-bounded organelle (GO:0043231)	uridine-diphosphatase activity (GO:0045134)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	25		Prostate(55;0.114)		Colorectal(74;0.0161)|COAD - Colon adenocarcinoma(73;0.0649)		GACAGGAAACGAAAAGCCCCT	0.473																																						dbGAP											0													112.0	107.0	108.0					8																	23291938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ131358	CCDS6041.1, CCDS47827.1	8p21.3	2014-05-16	2004-09-22	2004-09-22	ENSG00000197217	ENSG00000197217			14573	protein-coding gene	gene with protein product		607577	"""lysosomal apyrase-like 1"""	LYSAL1		10393803, 9205841	Standard	NM_001128930		Approved	LALP70, LAP70, KIAA0392, NTPDase-4, UDPase	uc003xdl.3	Q9Y227	OTTHUMG00000097852	ENST00000358689.4:c.1514C>T	8.37:g.23291938G>A	ENSP00000351520:p.Ser505Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSS3|O15092	Missense_Mutation	SNP	pfam_GDA1_CD39_NTPase	p.S505L	ENST00000358689.4	37	c.1514	CCDS6041.1	8	.	.	.	.	.	.	.	.	.	.	G	14.91	2.677591	0.47886	.	.	ENSG00000197217	ENST00000518471;ENST00000356206;ENST00000358689;ENST00000417069	T;T;T;T	0.12984	2.63;2.63;2.63;2.63	5.66	5.66	0.87406	.	0.058247	0.64402	D	0.000001	T	0.12646	0.0307	L	0.36672	1.1	0.58432	D	0.999994	P;P;P	0.41947	0.593;0.723;0.766	B;B;B	0.35607	0.206;0.131;0.206	T	0.05716	-1.0868	10	0.30854	T	0.27	-10.7978	18.3198	0.90234	0.0:0.0:1.0:0.0	.	497;497;505	Q8NE73;Q9Y227-2;Q9Y227	.;.;ENTP4_HUMAN	L	100;497;505;497	ENSP00000430579:S100L;ENSP00000348536:S497L;ENSP00000351520:S505L;ENSP00000408573:S497L	ENSP00000348536:S497L	S	-	2	0	ENTPD4	23347883	1.000000	0.71417	0.449000	0.26957	0.234000	0.25298	3.880000	0.56145	2.665000	0.90641	0.655000	0.94253	TCG	ENTPD4	-	pfam_GDA1_CD39_NTPase	ENSG00000197217		0.473	ENTPD4-001	KNOWN	basic|CCDS	protein_coding	ENTPD4	HGNC	protein_coding	OTTHUMT00000215142.1	299	0.00	0	G	NM_004901		23291938	23291938	-1	no_errors	ENST00000358689	ensembl	human	known	69_37n	missense	229	22.48	67	SNP	0.925	A
ERAP1	51752	genome.wustl.edu	37	5	96129517	96129517	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr5:96129517G>C	ENST00000443439.2	-	6	1129	c.1063C>G	c.(1063-1065)Ctg>Gtg	p.L355V	ERAP1_ENST00000296754.3_Missense_Mutation_p.L355V	NM_001040458.1|NM_001198541.1	NP_001035548.1|NP_001185470.1	Q9NZ08	ERAP1_HUMAN	endoplasmic reticulum aminopeptidase 1	355					angiogenesis (GO:0001525)|antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|fat cell differentiation (GO:0045444)|membrane protein ectodomain proteolysis (GO:0006509)|positive regulation of angiogenesis (GO:0045766)|regulation of blood pressure (GO:0008217)|regulation of innate immune response (GO:0045088)|response to bacterium (GO:0009617)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	aminopeptidase activity (GO:0004177)|interleukin-1, Type II receptor binding (GO:0005151)|interleukin-6 receptor binding (GO:0005138)|metalloexopeptidase activity (GO:0008235)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|stomach(2)	19		all_cancers(142;1.75e-06)|all_epithelial(76;3.08e-09)|all_lung(232;0.000435)|Lung NSC(167;0.000601)|Ovarian(225;0.024)|Colorectal(57;0.0432)|Breast(839;0.244)		all cancers(79;7.26e-15)|COAD - Colon adenocarcinoma(37;0.071)		TGGTGAGCCAGTTCATGGGCC	0.363																																						dbGAP											0													52.0	47.0	49.0					5																	96129517		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011097	CCDS4085.1, CCDS47250.1	5q15	2014-04-07			ENSG00000164307	ENSG00000164307			18173	protein-coding gene	gene with protein product	"""aminopeptidase regulator of TNFR1 shedding"", ""adipocyte-derived leucine aminopeptidase"", ""puromycin-insensitive leucyl-specific aminopeptidase"""	606832				10220586, 12189246, 16286653	Standard	NM_001198541		Approved	ARTS-1, A-LAP, PILS-AP, KIAA0525, ERAAP1	uc003kml.3	Q9NZ08	OTTHUMG00000128721	ENST00000443439.2:c.1063C>G	5.37:g.96129517G>C	ENSP00000406304:p.Leu355Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O60278|Q6UWY6|Q8NEL4|Q8TAD0|Q9UHF8|Q9UKY2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.L355V	ENST00000443439.2	37	c.1063	CCDS47250.1	5	.	.	.	.	.	.	.	.	.	.	G	21.4	4.151171	0.78001	.	.	ENSG00000164307	ENST00000296754;ENST00000443439;ENST00000414384	T;T	0.03468	3.92;3.92	6.06	5.18	0.71444	Peptidase M1, membrane alanine aminopeptidase, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.18718	0.0449	M	0.76938	2.355	0.58432	D	0.999999	P;D;D	0.89917	0.945;1.0;1.0	P;D;D	0.85130	0.822;0.997;0.986	T	0.00011	-1.2439	10	0.87932	D	0	.	15.4416	0.75187	0.0681:0.0:0.9319:0.0	.	355;355;355	A8K6H1;Q9NZ08;Q9NZ08-2	.;ERAP1_HUMAN;.	V	355	ENSP00000296754:L355V;ENSP00000406304:L355V	ENSP00000296754:L355V	L	-	1	2	ERAP1	96155273	1.000000	0.71417	0.968000	0.41197	0.671000	0.39405	6.562000	0.73960	2.882000	0.98803	0.655000	0.94253	CTG	ERAP1	-	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	ENSG00000164307		0.363	ERAP1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAP1	HGNC	protein_coding	OTTHUMT00000370699.1	153	0.00	0	G	NM_016442		96129517	96129517	-1	no_errors	ENST00000296754	ensembl	human	known	69_37n	missense	105	23.91	33	SNP	1.000	C
ERI1	90459	genome.wustl.edu	37	8	8869082	8869082	+	Silent	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr8:8869082G>C	ENST00000523898.1	+	4	997	c.318G>C	c.(316-318)ctG>ctC	p.L106L	ERI1_ENST00000519292.1_Silent_p.L106L|ERI1_ENST00000250263.7_Silent_p.L106L			Q8IV48	ERI1_HUMAN	exoribonuclease 1	106	SAP. {ECO:0000255|PROSITE- ProRule:PRU00186}.				gene silencing by RNA (GO:0031047)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|rRNA 3'-end processing (GO:0031125)	cytoplasm (GO:0005737)|histone pre-mRNA 3'end processing complex (GO:0071204)|nucleolus (GO:0005730)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|histone pre-mRNA stem-loop binding (GO:0071207)|metal ion binding (GO:0046872)|ribosome binding (GO:0043022)|rRNA binding (GO:0019843)			NS(1)|endometrium(2)|large_intestine(1)|lung(6)|prostate(1)	11						AGAAGAGACTGAAAAACTATT	0.348																																						dbGAP											0													65.0	66.0	66.0					8																	8869082		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035279	CCDS5972.1	8p23.1	2008-12-16	2008-12-16	2008-12-16	ENSG00000104626	ENSG00000104626		"""Enhanced RNAi three prime mRNA exonucleases"""	23994	protein-coding gene	gene with protein product	"""exoribonuclease 1"", ""enhanced RNAi three prime mRNA exonuclease homolog 1 (C.elegans)"""	608739	"""three prime histone mRNA exonuclease 1"""	THEX1		14536070	Standard	NM_153332		Approved	3'HEXO	uc003wsk.2	Q8IV48	OTTHUMG00000129328	ENST00000523898.1:c.318G>C	8.37:g.8869082G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4U7|Q9NSX3	Silent	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_SAP_DNA-bd,superfamily_RNaseH-like_dom,smart_SAP_DNA-bd,smart_Exonuclease,pfscan_SAP_DNA-bd	p.L106	ENST00000523898.1	37	c.318	CCDS5972.1	8																																																																																			ERI1	-	pfam_SAP_DNA-bd,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	ENSG00000104626		0.348	ERI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERI1	HGNC	protein_coding	OTTHUMT00000251471.2	213	0.00	0	G	NM_153332		8869082	8869082	+1	no_errors	ENST00000250263	ensembl	human	known	69_37n	silent	200	18.03	44	SNP	0.996	C
FAM47C	442444	genome.wustl.edu	37	X	37029349	37029349	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chrX:37029349C>A	ENST00000358047.3	+	1	2918	c.2866C>A	c.(2866-2868)Cct>Act	p.P956T		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	956										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AAGTGATGAACCTTTGATTGA	0.443																																						dbGAP											0													119.0	114.0	116.0					X																	37029349		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2866C>A	X.37:g.37029349C>A	ENSP00000367913:p.Pro956Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Missense_Mutation	SNP	NULL	p.P956T	ENST00000358047.3	37	c.2866	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	C	8.077	0.771467	0.16051	.	.	ENSG00000198173	ENST00000358047	T	0.18338	2.22	0.502	0.502	0.16932	.	.	.	.	.	T	0.17534	0.0421	M	0.64997	1.995	0.09310	N	1	P	0.40970	0.734	B	0.39503	0.301	T	0.13845	-1.0494	8	0.54805	T	0.06	.	.	.	.	.	956	Q5HY64	FA47C_HUMAN	T	956	ENSP00000367913:P956T	ENSP00000367913:P956T	P	+	1	0	FAM47C	36939270	0.052000	0.20516	0.028000	0.17463	0.016000	0.09150	0.129000	0.15830	0.479000	0.27511	0.292000	0.19580	CCT	FAM47C	-	NULL	ENSG00000198173		0.443	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	298	0.00	0	C	NM_001013736		37029349	37029349	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	234	22.44	68	SNP	0.028	A
FAM83E	54854	genome.wustl.edu	37	19	49113164	49113164	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr19:49113164C>A	ENST00000263266.3	-	3	916	c.727G>T	c.(727-729)Gac>Tac	p.D243Y		NM_017708.3	NP_060178.2	Q2M2I3	FA83E_HUMAN	family with sequence similarity 83, member E	243										NS(1)|endometrium(2)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(2)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000102)|all cancers(93;0.000117)|GBM - Glioblastoma multiforme(486;0.00627)|Epithelial(262;0.0158)		CTCTCGCCGTCCAGCAGCACA	0.657																																						dbGAP											0													23.0	27.0	26.0					19																	49113164		2095	4193	6288	-	-	-	SO:0001583	missense	0			AK000207	CCDS42587.1	19q13.33	2013-10-24			ENSG00000105523	ENSG00000105523			25972	protein-coding gene	gene with protein product							Standard	NM_017708		Approved	FLJ20200	uc002pjn.2	Q2M2I3	OTTHUMG00000183315	ENST00000263266.3:c.727G>T	19.37:g.49113164C>A	ENSP00000263266:p.Asp243Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NXK1	Missense_Mutation	SNP	pfam_DUF1669,superfamily_Acyl_CoA_acyltransferase	p.D243Y	ENST00000263266.3	37	c.727	CCDS42587.1	19	.	.	.	.	.	.	.	.	.	.	C	21.3	4.134090	0.77662	.	.	ENSG00000105523	ENST00000263266	D	0.83419	-1.72	4.28	4.28	0.50868	.	0.000000	0.64402	D	0.000001	D	0.91580	0.7340	M	0.89287	3.02	0.45718	D	0.998623	D	0.89917	1.0	D	0.91635	0.999	D	0.92882	0.6324	10	0.87932	D	0	-25.7263	12.5792	0.56381	0.0:1.0:0.0:0.0	.	243	Q2M2I3	FA83E_HUMAN	Y	243	ENSP00000263266:D243Y	ENSP00000263266:D243Y	D	-	1	0	FAM83E	53804976	1.000000	0.71417	0.997000	0.53966	0.923000	0.55619	6.384000	0.73177	2.117000	0.64856	0.555000	0.69702	GAC	FAM83E	-	pfam_DUF1669	ENSG00000105523		0.657	FAM83E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83E	HGNC	protein_coding	OTTHUMT00000466145.1	13	0.00	0	C	NM_017708		49113164	49113164	-1	no_errors	ENST00000263266	ensembl	human	known	69_37n	missense	5	68.75	11	SNP	1.000	A
FARP2	9855	genome.wustl.edu	37	2	242373613	242373613	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:242373613G>C	ENST00000264042.3	+	10	1078	c.908G>C	c.(907-909)aGa>aCa	p.R303T	FARP2_ENST00000373287.4_Missense_Mutation_p.R303T|FARP2_ENST00000545004.1_Missense_Mutation_p.R303T	NM_014808.2	NP_055623.1	O94887	FARP2_HUMAN	FERM, RhoGEF and pleckstrin domain protein 2	303	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				actin cytoskeleton reorganization (GO:0031532)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|neuron remodeling (GO:0016322)|osteoclast differentiation (GO:0030316)|podosome assembly (GO:0071800)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|Rac protein signal transduction (GO:0016601)|regulation of integrin activation (GO:0033623)|regulation of Rac GTPase activity (GO:0032314)|semaphorin-plexin signaling pathway (GO:0071526)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)	Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	43		all_cancers(19;4.88e-34)|all_epithelial(40;4.81e-14)|Breast(86;0.000141)|Renal(207;0.0143)|all_lung(227;0.0344)|Lung NSC(271;0.0886)|Ovarian(221;0.0905)|Esophageal squamous(248;0.131)|all_hematologic(139;0.182)|Melanoma(123;0.238)		Epithelial(32;1.81e-33)|all cancers(36;1.61e-30)|OV - Ovarian serous cystadenocarcinoma(60;6.83e-15)|Kidney(56;1.19e-08)|KIRC - Kidney renal clear cell carcinoma(57;8.98e-08)|BRCA - Breast invasive adenocarcinoma(100;1.49e-06)|Lung(119;0.000152)|LUSC - Lung squamous cell carcinoma(224;0.00125)|Colorectal(34;0.0199)|COAD - Colon adenocarcinoma(134;0.121)		TTGGGTAGTAGAGATGAATGT	0.368																																						dbGAP											0													173.0	176.0	175.0					2																	242373613		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018336	CCDS33424.1, CCDS63197.1	2q37.3	2013-01-10			ENSG00000006607	ENSG00000006607		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16460	protein-coding gene	gene with protein product						9872452, 12351724	Standard	NM_001282984		Approved	KIAA0793, FIR, PLEKHC3, FRG	uc002wbi.2	O94887	OTTHUMG00000151574	ENST00000264042.3:c.908G>C	2.37:g.242373613G>C	ENSP00000264042:p.Arg303Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z6J8|F5GZ84|Q53QM5|Q8WU27|Q9UFE7	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_FERM_PH-like_C,pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,superfamily_DH-domain,superfamily_FERM_central,smart_Band_41_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_FERM_domain,pfscan_Pleckstrin_homology,pfscan_DH-domain,prints_Band_41_fam,prints_Ez/rad/moesin	p.R303T	ENST00000264042.3	37	c.908	CCDS33424.1	2	.	.	.	.	.	.	.	.	.	.	G	28.4	4.917062	0.92249	.	.	ENSG00000006607	ENST00000264042;ENST00000545004;ENST00000373287	D;D;D	0.86956	-2.19;-2.19;-2.19	5.21	5.21	0.72293	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.170125	0.49916	D	0.000137	D	0.94059	0.8096	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.981;0.999	D	0.94598	0.7793	10	0.66056	D	0.02	.	18.755	0.91828	0.0:0.0:1.0:0.0	.	303;303;303	O94887-2;F5GZ84;O94887	.;.;FARP2_HUMAN	T	303	ENSP00000264042:R303T;ENSP00000443876:R303T;ENSP00000362384:R303T	ENSP00000264042:R303T	R	+	2	0	FARP2	242022286	1.000000	0.71417	0.985000	0.45067	0.997000	0.91878	9.498000	0.97972	2.420000	0.82092	0.563000	0.77884	AGA	FARP2	-	pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000006607		0.368	FARP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FARP2	HGNC	protein_coding	OTTHUMT00000323153.1	551	0.00	0	G			242373613	242373613	+1	no_errors	ENST00000264042	ensembl	human	known	69_37n	missense	417	17.91	91	SNP	1.000	C
FASTKD5	60493	genome.wustl.edu	37	20	3128515	3128515	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr20:3128515G>A	ENST00000380266.3	-	2	1523	c.1202C>T	c.(1201-1203)tCg>tTg	p.S401L	UBOX5-AS1_ENST00000446537.1_RNA|UBOX5_ENST00000348031.2_Intron|UBOX5_ENST00000217173.2_Intron	NM_021826.4	NP_068598.1	Q7L8L6	FAKD5_HUMAN	FAST kinase domains 5	401					cellular respiration (GO:0045333)	mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)			breast(2)|endometrium(2)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|urinary_tract(2)	19						GCGTAAGGCCGAGCAGTAAAG	0.483																																						dbGAP											0													86.0	81.0	82.0					20																	3128515		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC007413	CCDS13048.1	20p13	2006-07-07			ENSG00000215251	ENSG00000215251			25790	protein-coding gene	gene with protein product		614272				11347906	Standard	NM_021826		Approved	FLJ13149	uc002whz.4	Q7L8L6	OTTHUMG00000031727	ENST00000380266.3:c.1202C>T	20.37:g.3128515G>A	ENSP00000369618:p.Ser401Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JN3|Q9H5D1|Q9H8Y3	Missense_Mutation	SNP	pfam_FAST_2,pfam_FAST_Leu-rich,pfam_RAP,smart_RAP	p.S401L	ENST00000380266.3	37	c.1202	CCDS13048.1	20	.	.	.	.	.	.	.	.	.	.	G	16.73	3.205127	0.58234	.	.	ENSG00000215251	ENST00000380266	T	0.18174	2.23	5.48	5.48	0.80851	.	0.086703	0.48767	D	0.000179	T	0.31918	0.0812	L	0.32530	0.975	0.58432	D	0.999996	D	0.89917	1.0	D	0.64410	0.925	T	0.01553	-1.1326	10	0.51188	T	0.08	.	19.3409	0.94340	0.0:0.0:1.0:0.0	.	401	Q7L8L6	FAKD5_HUMAN	L	401	ENSP00000369618:S401L	ENSP00000369618:S401L	S	-	2	0	FASTKD5	3076515	1.000000	0.71417	0.993000	0.49108	0.186000	0.23388	7.306000	0.78905	2.583000	0.87209	0.313000	0.20887	TCG	FASTKD5	-	NULL	ENSG00000215251		0.483	FASTKD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FASTKD5	HGNC	protein_coding	OTTHUMT00000077701.2	189	0.00	0	G	NM_021826		3128515	3128515	-1	no_errors	ENST00000380266	ensembl	human	known	69_37n	missense	148	22.92	44	SNP	1.000	A
FAT3	120114	genome.wustl.edu	37	11	92533525	92533525	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr11:92533525G>C	ENST00000298047.6	+	9	7363	c.7346G>C	c.(7345-7347)gGa>gCa	p.G2449A	FAT3_ENST00000409404.2_Missense_Mutation_p.G2449A|FAT3_ENST00000525166.1_Missense_Mutation_p.G2299A			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	2449	Cadherin 22. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				AGCAAGAGTGGAGTTATCACA	0.493										TCGA Ovarian(4;0.039)																												dbGAP											0													111.0	106.0	108.0					11																	92533525		1992	4169	6161	-	-	-	SO:0001583	missense	0			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.7346G>C	11.37:g.92533525G>C	ENSP00000298047:p.Gly2449Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_Laminin_G,smart_EGF-like_Ca-bd,prints_Cadherin,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin	p.G2449A	ENST00000298047.6	37	c.7346		11	.	.	.	.	.	.	.	.	.	.	G	19.39	3.819267	0.71028	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000525166	T;T;T	0.56103	0.48;0.48;0.48	5.82	5.82	0.92795	.	.	.	.	.	T	0.81269	0.4787	M	0.93898	3.47	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85296	0.1070	9	0.87932	D	0	.	20.093	0.97828	0.0:0.0:1.0:0.0	.	2449	Q8TDW7-3	.	A	2449;2449;2299	ENSP00000298047:G2449A;ENSP00000387040:G2449A;ENSP00000432586:G2299A	ENSP00000298047:G2449A	G	+	2	0	FAT3	92173173	1.000000	0.71417	0.988000	0.46212	0.989000	0.77384	9.787000	0.99055	2.756000	0.94617	0.561000	0.74099	GGA	FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000165323		0.493	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		234	0.00	0	G	NM_001008781		92533525	92533525	+1	no_errors	ENST00000298047	ensembl	human	known	69_37n	missense	172	18.10	38	SNP	1.000	C
FSIP2	401024	genome.wustl.edu	37	2	186672616	186672616	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:186672616C>G	ENST00000424728.1	+	17	18583	c.18583C>G	c.(18583-18585)Cca>Gca	p.P6195A	FSIP2_ENST00000343098.5_Missense_Mutation_p.P6284A			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6195										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						ATCTATATTTCCAAAAGTACA	0.294																																						dbGAP											0													27.0	24.0	25.0					2																	186672616		1785	4049	5834	-	-	-	SO:0001583	missense	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.18583C>G	2.37:g.186672616C>G	ENSP00000401306:p.Pro6195Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.P6284A	ENST00000424728.1	37	c.18850		2	.	.	.	.	.	.	.	.	.	.	C	13.02	2.113473	0.37339	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.70045	-0.45;-0.43	4.96	4.96	0.65561	.	0.000000	0.52532	D	0.000061	T	0.69797	0.3151	L	0.52011	1.625	0.32003	N	0.603093	.	.	.	.	.	.	T	0.75510	-0.3292	8	0.46703	T	0.11	.	13.5718	0.61851	0.0:1.0:0.0:0.0	.	.	.	.	A	6284;6195	ENSP00000344403:P6284A;ENSP00000401306:P6195A	ENSP00000344403:P6284A	P	+	1	0	FSIP2	186380861	1.000000	0.71417	0.940000	0.37924	0.426000	0.31534	2.363000	0.44178	2.580000	0.87095	0.484000	0.47621	CCA	FSIP2	-	NULL	ENSG00000188738		0.294	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	59	0.00	0	C	NM_173651		186672616	186672616	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	missense	51	15.00	9	SNP	0.933	G
GPR112	139378	genome.wustl.edu	37	X	135405374	135405374	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chrX:135405374G>A	ENST00000394143.1	+	5	799	c.508G>A	c.(508-510)Gag>Aag	p.E170K	GPR112_ENST00000412101.1_Intron|GPR112_ENST00000287534.4_Missense_Mutation_p.E107K|GPR112_ENST00000394141.1_Intron|GPR112_ENST00000370652.1_Missense_Mutation_p.E170K	NM_153834.3	NP_722576.3	Q8IZF6	GP112_HUMAN	G protein-coupled receptor 112	170					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(33)|lung(97)|ovary(5)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(2)	199	Acute lymphoblastic leukemia(192;0.000127)					TGAGAGCAGCGAGGTTAAAAG	0.453																																						dbGAP											0													174.0	152.0	160.0					X																	135405374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY140954	CCDS35409.1	Xq26.3	2014-08-08			ENSG00000156920	ENSG00000156920		"""-"", ""GPCR / Class B : Orphans"""	18992	protein-coding gene	gene with protein product						12435584	Standard	XM_005262367		Approved	RP1-299I16, PGR17	uc004ezu.1	Q8IZF6	OTTHUMG00000022508	ENST00000394143.1:c.508G>A	X.37:g.135405374G>A	ENSP00000377699:p.Glu170Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2J1|A2A2J2|Q5EGP2|Q86SM6	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.E170K	ENST00000394143.1	37	c.508	CCDS35409.1	X	.	.	.	.	.	.	.	.	.	.	G	7.394	0.631343	0.14322	.	.	ENSG00000156920	ENST00000394143;ENST00000370652;ENST00000287534	T;T;T	0.62364	0.03;0.03;0.03	5.62	4.76	0.60689	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	.	.	.	.	T	0.44307	0.1287	N	0.19112	0.55	0.09310	N	1	B	0.27229	0.172	B	0.20184	0.028	T	0.35101	-0.9802	9	0.52906	T	0.07	.	7.0703	0.25175	0.0:0.7251:0.1798:0.0951	.	170	Q8IZF6	GP112_HUMAN	K	170;170;107	ENSP00000377699:E170K;ENSP00000359686:E170K;ENSP00000287534:E107K	ENSP00000287534:E107K	E	+	1	0	GPR112	135233040	0.003000	0.15002	0.003000	0.11579	0.111000	0.19643	0.963000	0.29293	1.126000	0.42016	-0.384000	0.06662	GAG	GPR112	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin	ENSG00000156920		0.453	GPR112-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GPR112	HGNC	protein_coding	OTTHUMT00000286639.1	427	0.00	0	G			135405374	135405374	+1	no_errors	ENST00000370652	ensembl	human	known	69_37n	missense	267	25.35	91	SNP	0.006	A
GPR101	83550	genome.wustl.edu	37	X	136112852	136112852	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chrX:136112852C>T	ENST00000298110.1	-	1	981	c.982G>A	c.(982-984)Gag>Aag	p.E328K		NM_054021.1	NP_473362.1	Q96P66	GP101_HUMAN	G protein-coupled receptor 101	328						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			autonomic_ganglia(1)|endometrium(5)|kidney(2)|large_intestine(11)|lung(18)|ovary(3)|skin(1)|urinary_tract(1)	42	Acute lymphoblastic leukemia(192;0.000127)					CTGTTCTCCTCAACTTTGGTG	0.557																																						dbGAP											0													386.0	281.0	317.0					X																	136112852		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411115	CCDS14662.1	Xq26.3	2014-01-30			ENSG00000165370	ENSG00000165370		"""GPCR / Class A : Orphans"""	14963	protein-coding gene	gene with protein product		300393				11574155	Standard	NM_054021		Approved		uc011mwh.2	Q96P66	OTTHUMG00000022521	ENST00000298110.1:c.982G>A	X.37:g.136112852C>T	ENSP00000298110:p.Glu328Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSM8|Q8NG93	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.E328K	ENST00000298110.1	37	c.982	CCDS14662.1	X	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.612859	0.00835	.	.	ENSG00000165370	ENST00000298110	T	0.63417	-0.04	3.65	0.787	0.18596	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.31327	0.0793	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.19257	-1.0311	9	0.17832	T	0.49	-2.3639	4.266	0.10763	0.0:0.3406:0.4171:0.2423	.	328	Q96P66	GP101_HUMAN	K	328	ENSP00000298110:E328K	ENSP00000298110:E328K	E	-	1	0	GPR101	135940518	0.001000	0.12720	0.001000	0.08648	0.013000	0.08279	0.148000	0.16224	0.042000	0.15717	0.600000	0.82982	GAG	GPR101	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000165370		0.557	GPR101-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR101	HGNC	protein_coding	OTTHUMT00000058519.1	521	0.00	0	C			136112852	136112852	-1	no_errors	ENST00000298110	ensembl	human	known	69_37n	missense	306	20.93	81	SNP	0.050	T
GRID1	2894	genome.wustl.edu	37	10	88123815	88123815	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr10:88123815C>G	ENST00000327946.7	-	2	203	c.118G>C	c.(118-120)Gtg>Ctg	p.V40L		NM_017551.2	NP_060021.1	Q9ULK0	GRID1_HUMAN	glutamate receptor, ionotropic, delta 1	40					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|social behavior (GO:0035176)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|ionotropic glutamate receptor complex (GO:0008328)|postsynaptic membrane (GO:0045211)	extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(24)|lung(46)|ovary(5)|prostate(4)|skin(5)|stomach(4)|upper_aerodigestive_tract(5)	106						AACTGGAACACCCTGTCGTCC	0.577										Multiple Myeloma(13;0.14)																												dbGAP											0													255.0	168.0	197.0					10																	88123815		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033046	CCDS31236.1	10q22	2012-08-29			ENSG00000182771	ENSG00000182771		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4575	protein-coding gene	gene with protein product		610659					Standard	NM_017551		Approved	GluD1, KIAA1220	uc001kdl.1	Q9ULK0	OTTHUMG00000018650	ENST00000327946.7:c.118G>C	10.37:g.88123815C>G	ENSP00000330148:p.Val40Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXD5|B7Z7L0|Q8IXT3	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V40L	ENST00000327946.7	37	c.118	CCDS31236.1	10	.	.	.	.	.	.	.	.	.	.	C	17.78	3.474124	0.63737	.	.	ENSG00000182771	ENST00000327946	D	0.83250	-1.7	4.96	4.96	0.65561	Extracellular ligand-binding receptor (1);	0.210963	0.30320	N	0.009899	T	0.77698	0.4169	L	0.34521	1.04	0.80722	D	1	B	0.25351	0.124	B	0.24701	0.055	T	0.76710	-0.2859	10	0.87932	D	0	.	17.1894	0.86875	0.0:1.0:0.0:0.0	.	40	Q9ULK0	GRID1_HUMAN	L	40	ENSP00000330148:V40L	ENSP00000330148:V40L	V	-	1	0	GRID1	88113795	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.065000	0.41442	2.289000	0.77006	0.484000	0.47621	GTG	GRID1	-	pfam_ANF_lig-bd_rcpt	ENSG00000182771		0.577	GRID1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID1	HGNC	protein_coding	OTTHUMT00000049148.3	154	0.00	0	C	XM_043613		88123815	88123815	-1	no_errors	ENST00000327946	ensembl	human	known	69_37n	missense	111	19.42	27	SNP	1.000	G
IFT172	26160	genome.wustl.edu	37	2	27707103	27707103	+	Silent	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:27707103G>A	ENST00000260570.3	-	4	430	c.327C>T	c.(325-327)ttC>ttT	p.F109F	IFT172_ENST00000359466.6_Silent_p.F109F|IFT172_ENST00000416524.2_Silent_p.F88F	NM_015662.1	NP_056477.1	Q9UG01	IF172_HUMAN	intraflagellar transport 172	109					bone development (GO:0060348)|brain development (GO:0007420)|cilium assembly (GO:0042384)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|epidermis development (GO:0008544)|heart looping (GO:0001947)|hindgut development (GO:0061525)|left/right axis specification (GO:0070986)|limb development (GO:0060173)|negative regulation of epithelial cell proliferation (GO:0050680)|neural tube closure (GO:0001843)|Notch signaling pathway (GO:0007219)|palate development (GO:0060021)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|smoothened signaling pathway (GO:0007224)|spinal cord motor neuron differentiation (GO:0021522)	axoneme (GO:0005930)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|intraciliary transport particle B (GO:0030992)|sperm midpiece (GO:0097225)|sperm principal piece (GO:0097228)|vesicle (GO:0031982)				central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(17)|lung(17)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	43	Acute lymphoblastic leukemia(172;0.155)					CCGTCTGGATGAACTTGTTGC	0.433																																						dbGAP											0													120.0	116.0	117.0					2																	27707103		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033005	CCDS1755.1	2p23.3	2014-07-03	2014-07-03		ENSG00000138002	ENSG00000138002		"""Intraflagellar transport homologs"", ""WD repeat domain containing"""	30391	protein-coding gene	gene with protein product	"""wimple homolog"""	607386	"""intraflagellar transport 172 homolog (Chlamydomonas)"""			10788441, 10574461, 24140113	Standard	XM_005264254		Approved	SLB, wim, osm-1, NPHP17	uc002rku.3	Q9UG01	OTTHUMG00000128425	ENST00000260570.3:c.327C>T	2.37:g.27707103G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ0|B2RNU5|Q86X44|Q96HW4|Q9UFJ9|Q9ULP1	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat	p.F109	ENST00000260570.3	37	c.327	CCDS1755.1	2																																																																																			IFT172	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000138002		0.433	IFT172-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT172	HGNC	protein_coding	OTTHUMT00000250213.2	285	0.00	0	G	NM_015662		27707103	27707103	-1	no_errors	ENST00000260570	ensembl	human	known	69_37n	silent	238	16.78	48	SNP	1.000	A
HOXD8	3234	genome.wustl.edu	37	2	176995644	176995644	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:176995644C>G	ENST00000313173.4	+	1	1177	c.550C>G	c.(550-552)Caa>Gaa	p.Q184E	HOXD8_ENST00000450510.2_Missense_Mutation_p.Q184E|HOXD8_ENST00000544999.1_Missense_Mutation_p.Q184E|HOXD-AS2_ENST00000440016.2_RNA|HOXD8_ENST00000548663.1_Missense_Mutation_p.Q80E|HOXD8_ENST00000429017.1_5'UTR	NM_001199746.1|NM_019558.3	NP_001186675.1|NP_062458.1	P13378	HXD8_HUMAN	homeobox D8	184					anterior/posterior axis specification, embryo (GO:0008595)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system morphogenesis (GO:0048705)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|large_intestine(2)|lung(5)|skin(1)	9			OV - Ovarian serous cystadenocarcinoma(117;0.0207)|Epithelial(96;0.195)	Colorectal(32;0.0224)|READ - Rectum adenocarcinoma(9;0.0556)		GTCTCCTTCTCAAATGTTTCC	0.458																																						dbGAP											0													57.0	56.0	57.0					2																	176995644		2173	4210	6383	-	-	-	SO:0001583	missense	0				CCDS2268.1, CCDS56148.1, CCDS56149.1	2q31.1	2011-06-20	2005-12-22		ENSG00000175879	ENSG00000175879		"""Homeoboxes / ANTP class : HOXL subclass"""	5139	protein-coding gene	gene with protein product		142985	"""homeo box D8"""	HOX4, HOX4E		1973146, 1358459	Standard	NM_001199747		Approved		uc002uko.3	P13378	OTTHUMG00000132513	ENST00000313173.4:c.550C>G	2.37:g.176995644C>G	ENSP00000315949:p.Gln184Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WBG7|Q5BL00|Q8IXZ1	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.Q184E	ENST00000313173.4	37	c.550	CCDS2268.1	2	.	.	.	.	.	.	.	.	.	.	C	14.52	2.559987	0.45590	.	.	ENSG00000175879	ENST00000313173;ENST00000544999;ENST00000548663;ENST00000450510	T;T;D;T	0.95518	1.05;1.05;-3.73;1.05	4.63	4.63	0.57726	Homeodomain-like (1);	0.103295	0.42053	D	0.000777	D	0.90793	0.7109	N	0.16790	0.44	0.41747	D	0.989647	P;P	0.42785	0.79;0.79	B;B	0.39660	0.306;0.306	D	0.90920	0.4782	10	0.33141	T	0.24	.	17.8642	0.88791	0.0:1.0:0.0:0.0	.	184;184	Q8IXZ1;P13378	.;HXD8_HUMAN	E	184;184;80;184	ENSP00000315949:Q184E;ENSP00000437431:Q184E;ENSP00000448196:Q80E;ENSP00000409026:Q184E	ENSP00000315949:Q184E	Q	+	1	0	HOXD8	176703890	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.678000	0.84035	2.258000	0.74832	0.655000	0.94253	CAA	HOXD8	-	superfamily_Homeodomain-like	ENSG00000175879		0.458	HOXD8-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	HOXD8	HGNC	protein_coding	OTTHUMT00000255694.1	19	0.00	0	C			176995644	176995644	+1	no_errors	ENST00000313173	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	1.000	G
IGDCC4	57722	genome.wustl.edu	37	15	65694819	65694819	+	Silent	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr15:65694819G>A	ENST00000352385.2	-	4	779	c.570C>T	c.(568-570)atC>atT	p.I190I		NM_020962.1	NP_066013.1	Q8TDY8	IGDC4_HUMAN	immunoglobulin superfamily, DCC subclass, member 4	190	Ig-like C2-type 2.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(24)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(3)	44						TGGGAAGCACGATGAGCCTTG	0.577																																						dbGAP											0													41.0	35.0	37.0					15																	65694819		2194	4284	6478	-	-	-	SO:0001819	synonymous_variant	0				CCDS10206.1	15q22.31	2013-02-11			ENSG00000103742	ENSG00000103742		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	13770	protein-coding gene	gene with protein product	"""likely ortholog of mouse neighbor of Punc E11"""						Standard	NM_020962		Approved	NOPE, LOC57722	uc002aou.1	Q8TDY8	OTTHUMG00000133136	ENST00000352385.2:c.570C>T	15.37:g.65694819G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HCE4	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I190	ENST00000352385.2	37	c.570	CCDS10206.1	15																																																																																			IGDCC4	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000103742		0.577	IGDCC4-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	IGDCC4	HGNC	protein_coding	OTTHUMT00000256825.2	117	0.00	0	G	NM_020962		65694819	65694819	-1	no_errors	ENST00000352385	ensembl	human	novel	69_37n	silent	83	26.96	31	SNP	0.966	A
KIF1B	23095	genome.wustl.edu	37	1	10421003	10421003	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:10421003G>C	ENST00000377086.1	+	39	4274	c.4072G>C	c.(4072-4074)Gag>Cag	p.E1358Q	KIF1B_ENST00000377081.1_Missense_Mutation_p.E1358Q|KIF1B_ENST00000465635.1_3'UTR|KIF1B_ENST00000263934.6_Missense_Mutation_p.E1312Q			O60333	KIF1B_HUMAN	kinesin family member 1B	1358					anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTACCGCTTTGAGGCTGTGTG	0.473																																						dbGAP											0													211.0	171.0	185.0					1																	10421003		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.4072G>C	1.37:g.10421003G>C	ENSP00000366290:p.Glu1358Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E1312Q	ENST00000377086.1	37	c.3934		1	.	.	.	.	.	.	.	.	.	.	G	34	5.308742	0.95629	.	.	ENSG00000054523	ENST00000355249;ENST00000263934;ENST00000377086;ENST00000377081	T;T;T	0.74632	-0.78;-0.86;-0.86	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.84479	0.5481	L	0.58810	1.83	0.80722	D	1	P;D;P;D;P;D	0.89917	0.933;1.0;0.934;0.992;0.901;0.989	P;D;P;D;P;D	0.70716	0.85;0.97;0.791;0.955;0.637;0.969	D	0.85391	0.1125	10	0.72032	D	0.01	.	19.4149	0.94690	0.0:0.0:1.0:0.0	.	1344;1318;1358;1332;1358;1312	Q4R9M9;Q4R9M7;Q4VXC4;Q4R9M8;O60333;O60333-2	.;.;.;.;KIF1B_HUMAN;.	Q	1358;1312;1358;1358	ENSP00000263934:E1312Q;ENSP00000366290:E1358Q;ENSP00000366284:E1358Q	ENSP00000263934:E1312Q	E	+	1	0	KIF1B	10343590	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.664000	0.90586	0.491000	0.48974	GAG	KIF1B	-	pfam_Kinesin-like	ENSG00000054523		0.473	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	568	0.00	0	G			10421003	10421003	+1	no_errors	ENST00000263934	ensembl	human	known	69_37n	missense	224	30.34	98	SNP	1.000	C
LINGO2	158038	genome.wustl.edu	37	9	27948861	27948861	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr9:27948861C>T	ENST00000379992.2	-	6	2258	c.1809G>A	c.(1807-1809)atG>atA	p.M603I	LINGO2_ENST00000308675.3_Missense_Mutation_p.M603I	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	603						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		AAATCATTTTCATGTTGAACC	0.443																																						dbGAP											0													151.0	136.0	141.0					9																	27948861		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.1809G>A	9.37:g.27948861C>T	ENSP00000369328:p.Met603Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.M603I	ENST00000379992.2	37	c.1809	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	C	18.76	3.691749	0.68271	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.58210	0.35;0.35	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.72993	0.3530	M	0.67397	2.05	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.68926	-0.5280	9	.	.	.	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	603	Q7L985	LIGO2_HUMAN	I	603	ENSP00000369328:M603I;ENSP00000310126:M603I	.	M	-	3	0	LINGO2	27938861	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.884000	0.98904	0.655000	0.94253	ATG	LINGO2	-	NULL	ENSG00000174482		0.443	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	254	0.00	0	C	NM_152570		27948861	27948861	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	missense	212	20.30	54	SNP	1.000	T
LMLN	89782	genome.wustl.edu	37	3	197751548	197751548	+	Silent	SNP	C	C	T	rs532861848		TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:197751548C>T	ENST00000330198.4	+	14	1567	c.1545C>T	c.(1543-1545)ggC>ggT	p.G515G	LMLN_ENST00000420910.2_Silent_p.G552G|LMLN_ENST00000332636.5_Silent_p.G463G|LMLN_ENST00000482695.1_Silent_p.G500G	NM_033029.3	NP_149018.2	Q96KR4	LMLN_HUMAN	leishmanolysin-like (metallopeptidase M8 family)	515					cell adhesion (GO:0007155)|mitotic nuclear division (GO:0007067)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|lipid particle (GO:0005811)|membrane (GO:0016020)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			endometrium(3)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	25	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)	Lung NSC(153;0.132)	Epithelial(36;9.84e-24)|all cancers(36;3.18e-22)|OV - Ovarian serous cystadenocarcinoma(49;5.35e-19)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.111)		AGAACTATGGCGCTGAAAAGT	0.388													C|||	1	0.000199681	0.0	0.0	5008	,	,		14672	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													99.0	96.0	97.0					3																	197751548		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ312398	CCDS3332.1, CCDS46988.1	3q29	2008-02-04			ENSG00000185621	ENSG00000185621	3.4.24.36		15991	protein-coding gene	gene with protein product		609380					Standard	NM_033029		Approved	Gp63, Msp	uc010iar.3	Q96KR4	OTTHUMG00000155375	ENST00000330198.4:c.1545C>T	3.37:g.197751548C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3LDG9|B3LDH0|C9J796|F8WB28|Q96KR5	Silent	SNP	pfam_Peptidase_M8	p.G515	ENST00000330198.4	37	c.1545	CCDS3332.1	3																																																																																			LMLN	-	pfam_Peptidase_M8	ENSG00000185621		0.388	LMLN-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LMLN	HGNC	protein_coding	OTTHUMT00000339701.1	267	0.74	2	C	NM_033029		197751548	197751548	+1	no_errors	ENST00000330198	ensembl	human	known	69_37n	silent	198	45.18	164	SNP	0.993	T
LRBA	987	genome.wustl.edu	37	4	151829582	151829582	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr4:151829582delG	ENST00000357115.3	-	11	1640	c.1397delC	c.(1396-1398)gcafs	p.A466fs	LRBA_ENST00000507224.1_Frame_Shift_Del_p.A466fs|LRBA_ENST00000510413.1_Frame_Shift_Del_p.A466fs|LRBA_ENST00000535741.1_Frame_Shift_Del_p.A466fs	NM_006726.4	NP_006717.2	P50851	LRBA_HUMAN	LPS-responsive vesicle trafficking, beach and anchor containing	466						cytoplasmic membrane-bounded vesicle (GO:0016023)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(20)|lung(32)|ovary(4)|prostate(6)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	91	all_hematologic(180;0.151)					TGAATGCATTGCACTTTGGAT	0.318																																						dbGAP											0													117.0	109.0	112.0					4																	151829582		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AF216648	CCDS3773.1, CCDS58928.1	4q13	2013-01-10		2001-10-05	ENSG00000198589	ENSG00000198589		"""WD repeat domain containing"""	1742	protein-coding gene	gene with protein product		606453		CDC4L		1505956, 11254716	Standard	NM_006726		Approved	BGL, LAB300, LBA	uc010ipj.3	P50851	OTTHUMG00000161443	ENST00000357115.3:c.1397delC	4.37:g.151829582delG	ENSP00000349629:p.Ala466fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5J4|Q4W5L6|Q8NFQ0|Q9H2U3|Q9H2U4	Frame_Shift_Del	DEL	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom	p.A466fs	ENST00000357115.3	37	c.1397	CCDS3773.1	4																																																																																			LRBA	-	superfamily_ARM-type_fold	ENSG00000198589		0.318	LRBA-002	KNOWN	basic|CCDS	protein_coding	LRBA	HGNC	protein_coding	OTTHUMT00000364939.1	371	0.80	3	G			151829582	151829582	-1	no_errors	ENST00000357115	ensembl	human	known	69_37n	frame_shift_del	199	27.02	77	DEL	1.000	-
LRRC19	64922	genome.wustl.edu	37	9	26996420	26996420	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr9:26996420C>T	ENST00000380055.5	-	4	783	c.673G>A	c.(673-675)Gaa>Aaa	p.E225K	IFT74_ENST00000433700.1_Intron|IFT74_ENST00000443698.1_Intron|IFT74_ENST00000380062.5_Intron|LRRC19_ENST00000482770.1_Intron|IFT74_ENST00000429045.2_Intron	NM_022901.2	NP_075052.1	Q9H756	LRC19_HUMAN	leucine rich repeat containing 19	225	LRRCT.					integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|lung(2)	6		all_neural(11;1.81e-09)		Lung(218;1.06e-05)|LUSC - Lung squamous cell carcinoma(38;0.0001)		GAGTGGCATTCAGCCTTATGA	0.358																																						dbGAP											0													103.0	97.0	99.0					9																	26996420		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024955	CCDS6518.1	9p21.1	2008-02-05			ENSG00000184434	ENSG00000184434			23379	protein-coding gene	gene with protein product							Standard	NM_022901		Approved	FLJ21302	uc003zqh.3	Q9H756	OTTHUMG00000019710	ENST00000380055.5:c.673G>A	9.37:g.26996420C>T	ENSP00000369395:p.Glu225Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV00|B9EG91	Missense_Mutation	SNP	smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.E225K	ENST00000380055.5	37	c.673	CCDS6518.1	9	.	.	.	.	.	.	.	.	.	.	C	11.35	1.613391	0.28712	.	.	ENSG00000184434	ENST00000380055	T	0.51817	0.69	5.7	5.7	0.88788	Cysteine-rich flanking region, C-terminal (1);	0.257491	0.32563	N	0.005937	T	0.35393	0.0930	L	0.32530	0.975	0.36706	D	0.880376	B	0.29716	0.255	B	0.16722	0.016	T	0.32188	-0.9916	10	0.16896	T	0.51	-2.2033	16.5405	0.84383	0.0:1.0:0.0:0.0	.	225	Q9H756	LRC19_HUMAN	K	225	ENSP00000369395:E225K	ENSP00000369395:E225K	E	-	1	0	LRRC19	26986420	0.959000	0.32827	0.997000	0.53966	0.167000	0.22549	1.052000	0.30429	2.694000	0.91930	0.650000	0.86243	GAA	LRRC19	-	smart_Cys-rich_flank_reg_C	ENSG00000184434		0.358	LRRC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC19	HGNC	protein_coding	OTTHUMT00000051961.2	314	0.00	0	C	NM_022901		26996420	26996420	-1	no_errors	ENST00000380055	ensembl	human	known	69_37n	missense	277	15.24	50	SNP	0.999	T
LRTM1	57408	genome.wustl.edu	37	3	54952782	54952782	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:54952782C>T	ENST00000273286.5	-	3	904	c.742G>A	c.(742-744)Ggc>Agc	p.G248S	LRTM1_ENST00000493075.1_Missense_Mutation_p.G172S|CACNA2D3_ENST00000474759.1_Intron|CACNA2D3_ENST00000288197.5_Intron|CACNA2D3_ENST00000490478.1_Intron|CACNA2D3_ENST00000415676.2_Intron	NM_020678.2	NP_065729.1	Q9HBL6	LRTM1_HUMAN	leucine-rich repeats and transmembrane domains 1	248						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|large_intestine(7)|lung(6)|prostate(1)|skin(4)	21				KIRC - Kidney renal clear cell carcinoma(284;0.00975)|Kidney(284;0.0112)|OV - Ovarian serous cystadenocarcinoma(275;0.0502)		TGGGCAGAGCCGGGCCACTGA	0.627																																						dbGAP											0													50.0	46.0	47.0					3																	54952782		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF225421	CCDS2876.1	3p14.3	2006-01-02			ENSG00000144771	ENSG00000144771			25023	protein-coding gene	gene with protein product						12477932	Standard	NM_020678		Approved	HT017	uc003dhl.3	Q9HBL6	OTTHUMG00000158578	ENST00000273286.5:c.742G>A	3.37:g.54952782C>T	ENSP00000273286:p.Gly248Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUU2	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.G248S	ENST00000273286.5	37	c.742	CCDS2876.1	3	.	.	.	.	.	.	.	.	.	.	C	3.944	-0.013590	0.07727	.	.	ENSG00000144771	ENST00000273286;ENST00000493075	T;T	0.49432	0.78;1.12	5.75	1.75	0.24633	.	0.811929	0.11955	N	0.513322	T	0.35219	0.0924	L	0.45581	1.43	0.09310	N	1	B	0.26445	0.149	B	0.15052	0.012	T	0.19614	-1.0300	10	0.35671	T	0.21	.	5.5694	0.17188	0.0:0.55:0.1322:0.3178	.	248	Q9HBL6	LRTM1_HUMAN	S	248;172	ENSP00000273286:G248S;ENSP00000419772:G172S	ENSP00000273286:G248S	G	-	1	0	LRTM1	54927822	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.267000	0.18552	0.035000	0.15519	-0.367000	0.07326	GGC	LRTM1	-	NULL	ENSG00000144771		0.627	LRTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRTM1	HGNC	protein_coding	OTTHUMT00000351399.1	133	0.00	0	C	NM_020678		54952782	54952782	-1	no_errors	ENST00000273286	ensembl	human	known	69_37n	missense	87	23.68	27	SNP	0.000	T
MAML2	84441	genome.wustl.edu	37	11	96074861	96074861	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr11:96074861C>T	ENST00000524717.1	-	1	1483	c.199G>A	c.(199-201)Gac>Aac	p.D67N	MIR1260B_ENST00000582890.1_RNA	NM_032427.1	NP_115803.1	Q8IZL2	MAML2_HUMAN	mastermind-like 2 (Drosophila)	67					gene expression (GO:0010467)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	Golgi apparatus (GO:0005794)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)		CRTC3/MAML2(26)|CRTC1/MAML2(516)	breast(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(8)|lung(12)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	43		Acute lymphoblastic leukemia(157;2.63e-05)|all_hematologic(158;0.00837)				CTTTCCCGGTCTGAGCTCTCG	0.612			T	"""MECT1, CRTC3"""	salivary gland mucoepidermoid						OREG0021305	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		11	11q22-q23	84441	mastermind-like 2 (Drosophila)		E	0													21.0	25.0	24.0					11																	96074861		2098	4233	6331	-	-	-	SO:0001583	missense	0			AB058722	CCDS44714.1	11q	2008-02-05	2001-11-28		ENSG00000184384	ENSG00000184384			16259	protein-coding gene	gene with protein product		607537	"""mastermind (Drosophila)-like 2"""			12370315, 12386158	Standard	NM_032427		Approved	KIAA1819, MAM3	uc001pfw.1	Q8IZL2	OTTHUMG00000167677	ENST00000524717.1:c.199G>A	11.37:g.96074861C>T	ENSP00000434552:p.Asp67Asn	Somatic	1317	WXS	Illumina GAIIx	Phase_IV	A7MD26|Q6AI23|Q6Y3A3|Q8IUL3|Q96JK6	Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.D67N	ENST00000524717.1	37	c.199	CCDS44714.1	11	.	.	.	.	.	.	.	.	.	.	C	19.52	3.842979	0.71488	.	.	ENSG00000184384	ENST00000524717;ENST00000440572	T;T	0.55234	0.53;0.53	4.78	4.78	0.61160	Neurogenic mastermind-like, N-terminal (1);	.	.	.	.	T	0.62563	0.2438	L	0.29908	0.895	0.41576	D	0.988719	D	0.89917	1.0	D	0.91635	0.999	T	0.67688	-0.5606	9	0.72032	D	0.01	.	16.6146	0.84903	0.0:1.0:0.0:0.0	.	67	Q8IZL2	MAML2_HUMAN	N	67	ENSP00000434552:D67N;ENSP00000412394:D67N	ENSP00000412394:D67N	D	-	1	0	MAML2	95714509	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.193000	0.72075	2.225000	0.72522	0.561000	0.74099	GAC	MAML2	-	pfam_Neuroggenic_mastermind-like_N	ENSG00000184384		0.612	MAML2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML2	HGNC	protein_coding	OTTHUMT00000395540.1	52	0.00	0	C			96074861	96074861	-1	no_errors	ENST00000440572	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	T
MAP3K15	389840	genome.wustl.edu	37	X	19390837	19390837	+	Silent	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chrX:19390837G>A	ENST00000338883.4	-	22	3041	c.3042C>T	c.(3040-3042)atC>atT	p.I1014I	MAP3K15_ENST00000518578.1_5'UTR|MAP3K15_ENST00000359173.3_Silent_p.I449I|MAP3K15_ENST00000469203.2_Silent_p.I846I	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	1014							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					TTTTGTACAGGATGGCACGGC	0.632											OREG0019699	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													79.0	69.0	72.0					X																	19390837		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.3042C>T	X.37:g.19390837G>A		Somatic	732	WXS	Illumina GAIIx	Phase_IV	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I1014	ENST00000338883.4	37	c.3042		X																																																																																			MAP3K15	-	NULL	ENSG00000180815		0.632	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		127	0.00	0	G	NM_001001671		19390837	19390837	-1	no_errors	ENST00000338883	ensembl	human	known	69_37n	silent	86	18.10	19	SNP	1.000	A
MSH6	2956	genome.wustl.edu	37	2	48032158	48032158	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:48032158T>A	ENST00000234420.5	+	6	3700	c.3548T>A	c.(3547-3549)aTa>aAa	p.I1183K	MSH6_ENST00000538136.1_Missense_Mutation_p.I881K|MSH6_ENST00000540021.1_Missense_Mutation_p.I1053K|FBXO11_ENST00000405808.1_Intron	NM_000179.2	NP_000170.1	P52701	MSH6_HUMAN	mutS homolog 6	1183					ATP catabolic process (GO:0006200)|determination of adult lifespan (GO:0008340)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|meiotic mismatch repair (GO:0000710)|mismatch repair (GO:0006298)|negative regulation of DNA recombination (GO:0045910)|positive regulation of helicase activity (GO:0051096)|reciprocal meiotic recombination (GO:0007131)|response to UV (GO:0009411)|somatic hypermutation of immunoglobulin genes (GO:0016446)|somatic recombination of immunoglobulin gene segments (GO:0016447)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|MutSalpha complex (GO:0032301)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA-dependent ATPase activity (GO:0008094)|guanine/thymine mispair binding (GO:0032137)|methylated histone binding (GO:0035064)|mismatched DNA binding (GO:0030983)	p.0?(2)		breast(8)|central_nervous_system(29)|cervix(1)|endometrium(32)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(75)|lung(25)|ovary(3)|prostate(3)|skin(10)|stomach(22)|thyroid(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	229		Acute lymphoblastic leukemia(82;0.0299)|all_hematologic(82;0.0358)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			TCAGACAGAATAATGTCAGGT	0.388			"""Mis, N, F, S"""		colorectal	"""colorectal, endometrial, ovarian"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	Hereditary non-polyposis colorectal cancer	2	2p16	2956	mutS homolog 6 (E. coli)		E	2	Whole gene deletion(2)	haematopoietic_and_lymphoid_tissue(2)											144.0	126.0	132.0					2																	48032158		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U54777	CCDS1836.1, CCDS62906.1, CCDS62907.1	2p16	2014-09-17	2013-09-12		ENSG00000116062	ENSG00000116062			7329	protein-coding gene	gene with protein product		600678	"""mutS (E. coli) homolog 6"", ""mutS homolog 6 (E. coli)"""	GTBP		7604266	Standard	NM_000179		Approved		uc002rwd.4	P52701	OTTHUMG00000129129	ENST00000234420.5:c.3548T>A	2.37:g.48032158T>A	ENSP00000234420:p.Ile1183Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF41|B4E3I4|F5H2F9|O43706|O43917|Q8TCX4|Q9BTB5	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS-lik_N,pfam_DNA_mismatch_repair_MutS_core,pfam_PWWP,pfam_DNA_mismatch_repair_MutS_clamp,pfam_DNA_mismatch_repair_MutS_connt,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_N,superfamily_DNA_mismatch_repair_MutS_connt,smart_PWWP,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6,pfscan_PWWP	p.I1183K	ENST00000234420.5	37	c.3548	CCDS1836.1	2	.	.	.	.	.	.	.	.	.	.	T	28.0	4.877822	0.91664	.	.	ENSG00000116062	ENST00000234420;ENST00000543270;ENST00000540021;ENST00000538136	D;D;D	0.86562	-2.14;-2.14;-2.14	5.35	5.35	0.76521	DNA mismatch repair protein MutS, C-terminal (2);	0.000000	0.85682	D	0.000000	D	0.95284	0.8470	H	0.94964	3.605	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.96561	0.9415	10	0.87932	D	0	-20.3861	15.3358	0.74250	0.0:0.0:0.0:1.0	.	1053;1183	B4DF41;P52701	.;MSH6_HUMAN	K	1183;149;1053;881	ENSP00000234420:I1183K;ENSP00000446475:I1053K;ENSP00000438580:I881K	ENSP00000234420:I1183K	I	+	2	0	MSH6	47885662	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	7.724000	0.84798	2.023000	0.59567	0.374000	0.22700	ATA	MSH6	-	pfam_DNA_mismatch_repair_MutS_C,smart_DNA_mismatch_repair_MutS_C,pirsf_DNA_mismatch_repair_Msh6	ENSG00000116062		0.388	MSH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH6	HGNC	protein_coding	OTTHUMT00000251180.4	412	0.72	3	T	NM_000179		48032158	48032158	+1	no_errors	ENST00000234420	ensembl	human	known	69_37n	missense	287	37.20	170	SNP	1.000	A
NGLY1	55768	genome.wustl.edu	37	3	25761536	25761536	+	Silent	SNP	T	T	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:25761536T>G	ENST00000280700.5	-	11	1918	c.1758A>C	c.(1756-1758)cgA>cgC	p.R586R	NGLY1_ENST00000428257.1_Silent_p.R568R|NGLY1_ENST00000417874.2_Silent_p.R544R|NGLY1_ENST00000396649.3_Intron|NGLY1_ENST00000467224.1_Intron|NGLY1_ENST00000422724.2_3'UTR	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	586	PAW. {ECO:0000255|PROSITE- ProRule:PRU00731}.				glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						CTGTATCAGATCGCAATTTCC	0.373																																						dbGAP											0													124.0	116.0	119.0					3																	25761536		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1758A>C	3.37:g.25761536T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Silent	SNP	pfam_PUB_domain,pfam_Transglutaminase-like,pfam_Rad4/PNGase_transGLS-fold,pfam_Peptide_N_glycanase_PAW_dom,superfamily_Galactose-bd-like,smart_PUG-dom,smart_Transglutaminase-like,smart_Peptide_N_glycanase_PAW_dom	p.R586	ENST00000280700.5	37	c.1758	CCDS33719.1	3																																																																																			NGLY1	-	superfamily_Galactose-bd-like	ENSG00000151092		0.373	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGLY1	HGNC	protein_coding	OTTHUMT00000340832.2	341	0.00	0	T			25761536	25761536	-1	no_errors	ENST00000280700	ensembl	human	known	69_37n	silent	216	22.86	64	SNP	0.017	G
NOTCH4	4855	genome.wustl.edu	37	6	32190509	32190509	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:32190509C>A	ENST00000375023.3	-	3	368	c.230G>T	c.(229-231)gGa>gTa	p.G77V		NM_004557.3	NP_004548.3	Q99466	NOTC4_HUMAN	notch 4	77	EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell differentiation (GO:0030154)|cell fate determination (GO:0001709)|embryo development (GO:0009790)|endothelial cell morphogenesis (GO:0001886)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|mammary gland development (GO:0030879)|morphogenesis of a branching structure (GO:0001763)|negative regulation of cell differentiation (GO:0045596)|negative regulation of endothelial cell differentiation (GO:0045602)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|patterning of blood vessels (GO:0001569)|positive regulation of transcription of Notch receptor target (GO:0007221)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(47)|ovary(5)|prostate(4)|skin(10)|upper_aerodigestive_tract(1)|urinary_tract(1)	100						GCAGCTGCCTCCATTTTGGCA	0.627																																						dbGAP											0													51.0	54.0	53.0					6																	32190509		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34420.1	6p21.3	2013-01-10	2010-06-24		ENSG00000204301	ENSG00000204301		"""Ankyrin repeat domain containing"""	7884	protein-coding gene	gene with protein product		164951	"""Notch (Drosophila) homolog 4"", ""Notch homolog 4 (Drosophila)"""	INT3		7835890	Standard	NM_004557		Approved		uc003obb.3	Q99466	OTTHUMG00000031044	ENST00000375023.3:c.230G>T	6.37:g.32190509C>A	ENSP00000364163:p.Gly77Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B0V183|B0V1X5|O00306|Q5SSY7|Q99458|Q99940|Q9H3S8|Q9UII9|Q9UIJ0	Missense_Mutation	SNP	pfam_EGF-like_dom,pfam_Ankyrin_rpt,pfam_EGF-like_Ca-bd,pfam_Notch_dom,pfam_Notch_NODP_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_4,prints_Notch_dom	p.G77V	ENST00000375023.3	37	c.230	CCDS34420.1	6	.	.	.	.	.	.	.	.	.	.	C	18.54	3.647163	0.67358	.	.	ENSG00000204301	ENST00000375023	D	0.83992	-1.79	4.13	4.13	0.48395	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.43919	D	0.000517	D	0.90518	0.7029	M	0.92459	3.31	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	D	0.91616	0.5307	10	0.87932	D	0	.	9.1985	0.37242	0.2166:0.7834:0.0:0.0	.	77;77	Q6P3V5;Q99466	.;NOTC4_HUMAN	V	77	ENSP00000364163:G77V	ENSP00000364163:G77V	G	-	2	0	NOTCH4	32298487	0.918000	0.31147	1.000000	0.80357	0.951000	0.60555	2.046000	0.41260	2.129000	0.65627	0.555000	0.69702	GGA	NOTCH4	-	smart_EGF-like_Ca-bd,smart_EGF-like,pirsf_Notch,pfscan_EG-like_dom	ENSG00000204301		0.627	NOTCH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH4	HGNC	protein_coding	OTTHUMT00000076045.2	142	0.00	0	C			32190509	32190509	-1	no_errors	ENST00000375023	ensembl	human	known	69_37n	missense	101	15.13	18	SNP	0.999	A
OGFRL1	79627	genome.wustl.edu	37	6	72011289	72011289	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:72011289G>A	ENST00000370435.4	+	7	1027	c.893G>A	c.(892-894)cGg>cAg	p.R298Q	RP11-154D6.1_ENST00000586232.1_RNA|RP11-154D6.1_ENST00000585882.1_RNA|RP11-154D6.1_ENST00000591156.1_RNA|RP11-154D6.1_ENST00000586030.1_RNA|RP11-154D6.1_ENST00000587253.1_RNA|RP11-154D6.1_ENST00000450998.1_RNA|RP11-154D6.1_ENST00000587397.1_RNA|RP11-154D6.1_ENST00000412751.1_RNA|RP11-154D6.1_ENST00000423255.1_RNA|RP11-154D6.1_ENST00000588612.1_RNA|RP11-154D6.1_ENST00000432050.1_RNA|RP11-154D6.1_ENST00000587036.1_RNA|RP3-331H24.5_ENST00000602823.1_lincRNA	NM_024576.3	NP_078852.3	Q5TC84	OGRL1_HUMAN	opioid growth factor receptor-like 1	298						membrane (GO:0016020)	receptor activity (GO:0004872)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|upper_aerodigestive_tract(1)	13						AAGCTCCTGCGGTTCGCCCAG	0.453																																						dbGAP											0													56.0	59.0	58.0					6																	72011289		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS34482.1	6q13	2008-02-05			ENSG00000119900	ENSG00000119900			21378	protein-coding gene	gene with protein product							Standard	NM_024576		Approved	dJ331H24.1	uc003pfx.1	Q5TC84	OTTHUMG00000015000	ENST00000370435.4:c.893G>A	6.37:g.72011289G>A	ENSP00000359464:p.Arg298Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAC1|Q8NEQ4|Q9H7B5	Missense_Mutation	SNP	pfam_OGF_rcpt	p.R298Q	ENST00000370435.4	37	c.893	CCDS34482.1	6	.	.	.	.	.	.	.	.	.	.	G	23.0	4.359543	0.82353	.	.	ENSG00000119900	ENST00000370435	T	0.49432	0.78	5.92	5.92	0.95590	Opioid growth factor receptor (OGFr) conserved domain (1);	0.000000	0.85682	D	0.000000	T	0.58921	0.2156	L	0.47716	1.5	0.48236	D	0.999615	D	0.89917	1.0	D	0.87578	0.998	T	0.55604	-0.8115	10	0.51188	T	0.08	-16.0521	20.3151	0.98650	0.0:0.0:1.0:0.0	.	298	Q5TC84	OGRL1_HUMAN	Q	298	ENSP00000359464:R298Q	ENSP00000359464:R298Q	R	+	2	0	OGFRL1	72068010	1.000000	0.71417	0.068000	0.19968	0.614000	0.37383	7.863000	0.87023	2.809000	0.96659	0.467000	0.42956	CGG	OGFRL1	-	pfam_OGF_rcpt	ENSG00000119900		0.453	OGFRL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OGFRL1	HGNC	protein_coding	OTTHUMT00000041153.2	72	0.00	0	G	NM_024576		72011289	72011289	+1	no_errors	ENST00000370435	ensembl	human	known	69_37n	missense	60	20.00	15	SNP	0.904	A
OTOGL	283310	genome.wustl.edu	37	12	80770937	80770937	+	Silent	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr12:80770937C>T	ENST00000547103.1	+	57	6759	c.6753C>T	c.(6751-6753)atC>atT	p.I2251I	OTOGL_ENST00000546620.1_Silent_p.I282I|OTOGL_ENST00000458043.2_Silent_p.I2263I			Q3ZCN5	OTOGL_HUMAN	otogelin-like	2251	CTCK. {ECO:0000255|PROSITE- ProRule:PRU00039}.				L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						AGAAAGTGATCATTAAATCGG	0.308																																						dbGAP											0													83.0	84.0	84.0					12																	80770937		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.6753C>T	12.37:g.80770937C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,superfamily_TIL_dom,smart_Unchr_dom_Cys-rich,smart_Cys_knot_C,pfscan_Cys_knot_C	p.S671L	ENST00000547103.1	37	c.2012		12	.	.	.	.	.	.	.	.	.	.	C	10.05	1.243065	0.22796	.	.	ENSG00000165899	ENST00000298820	.	.	.	5.32	-4.03	0.04021	.	.	.	.	.	T	0.36744	0.0978	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.38001	-0.9681	4	.	.	.	.	1.3802	0.02229	0.2612:0.1942:0.0955:0.449	.	.	.	.	L	671	.	.	S	+	2	0	OTOGL	79295068	0.908000	0.30866	0.989000	0.46669	0.961000	0.63080	-0.012000	0.12699	-0.341000	0.08376	0.467000	0.42956	TCA	OTOGL	-	smart_Cys_knot_C,pfscan_Cys_knot_C	ENSG00000165899		0.308	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	212	0.00	0	C	NM_173591		80770937	80770937	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000298820	ensembl	human	novel	69_37n	missense	186	19.48	45	SNP	0.963	T
PACRG	135138	genome.wustl.edu	37	6	163483209	163483209	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:163483209C>G	ENST00000337019.3	+	4	543	c.319C>G	c.(319-321)Cat>Gat	p.H107D	PACRG_ENST00000366888.2_Missense_Mutation_p.H107D|PACRG_ENST00000366889.2_Missense_Mutation_p.H107D	NM_152410.2	NP_689623.2	Q96M98	PACRG_HUMAN	PARK2 co-regulated	107					spermatid development (GO:0007286)	cell body (GO:0044297)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|sperm midpiece (GO:0097225)		p.H107N(1)		endometrium(2)|large_intestine(6)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Breast(66;2.41e-05)|Ovarian(120;0.0245)|Prostate(117;0.0273)|all_neural(5;0.0416)|Glioma(2;0.203)		OV - Ovarian serous cystadenocarcinoma(33;4.31e-19)|GBM - Glioblastoma multiforme(2;7.42e-11)|BRCA - Breast invasive adenocarcinoma(81;3.19e-05)|KIRC - Kidney renal clear cell carcinoma(3;0.205)|Kidney(3;0.242)		GGATTACCATCATTATCTGCC	0.453																																						dbGAP											1	Substitution - Missense(1)	lung(1)											106.0	108.0	107.0					6																	163483209		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057286	CCDS5284.1, CCDS43524.1	6q26	2004-07-01			ENSG00000112530	ENSG00000112530			19152	protein-coding gene	gene with protein product		608427				12547187	Standard	NM_001080378		Approved	PARK2CRG, FLJ32724, Glup, HAK005771	uc003qua.3	Q96M98	OTTHUMG00000016116	ENST00000337019.3:c.319C>G	6.37:g.163483209C>G	ENSP00000337946:p.His107Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5B5|Q6IMB8|Q8IZM1|Q8NHP5|Q9H1V9	Nonsense_Mutation	SNP	pfam_Parkin_co-regulated_protein,superfamily_ARM-type_fold	p.S22*	ENST00000337019.3	37	c.65	CCDS5284.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.6|20.6	4.023396|4.023396	0.75390|0.75390	.|.	.|.	ENSG00000112530|ENSG00000112530	ENST00000337019;ENST00000366889;ENST00000366888|ENST00000534958	T|.	0.65178|.	-0.14|.	4.85|4.85	4.85|4.85	0.62838|0.62838	.|.	0.048760|.	0.85682|.	D|.	0.000000|.	T|.	0.74222|.	0.3688|.	M|M	0.88979|0.88979	2.995|2.995	0.50632|0.50632	D|D	0.999882|0.999882	D;D|.	0.69078|.	0.987;0.997|.	P;D|.	0.70227|.	0.888;0.968|.	T|.	0.78763|.	-0.2077|.	10|.	0.48119|.	T|.	0.1|.	-18.3034|-18.3034	12.2978|12.2978	0.54859|0.54859	0.0:0.9106:0.0:0.0894|0.0:0.9106:0.0:0.0894	.|.	107;107|.	Q96M98-2;Q96M98|.	.;PACRG_HUMAN|.	D|X	107|22	ENSP00000337946:H107D|.	ENSP00000337946:H107D|.	H|S	+|+	1|2	0|0	PACRG|PACRG	163403199|163403199	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.621000|4.621000	0.61233|0.61233	2.401000|2.401000	0.81631|0.81631	0.609000|0.609000	0.83330|0.83330	CAT|TCA	PACRG	-	pfam_Parkin_co-regulated_protein	ENSG00000112530		0.453	PACRG-003	KNOWN	basic|CCDS	protein_coding	PACRG	HGNC	protein_coding	OTTHUMT00000400424.1	322	0.00	0	C	NM_152410		163483209	163483209	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000534958	ensembl	human	putative	69_37n	nonsense	119	30.00	51	SNP	1.000	G
PACS2	23241	genome.wustl.edu	37	14	105834442	105834442	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr14:105834442C>A	ENST00000325438.8	+	6	1122	c.618C>A	c.(616-618)ttC>ttA	p.F206L	PACS2_ENST00000458164.2_Missense_Mutation_p.F206L|PACS2_ENST00000547217.1_Missense_Mutation_p.F176L|PACS2_ENST00000430725.2_Missense_Mutation_p.F139L|PACS2_ENST00000447393.1_Missense_Mutation_p.F206L			Q86VP3	PACS2_HUMAN	phosphofurin acidic cluster sorting protein 2	206					apoptotic process (GO:0006915)|autophagic vacuole assembly (GO:0000045)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to plasma membrane (GO:0072661)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|mitochondrion (GO:0005739)				endometrium(2)|kidney(2)|lung(7)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	21		all_cancers(154;0.0351)|all_epithelial(191;0.153)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.0145)|Epithelial(46;0.036)	Epithelial(152;0.138)		ATGAGAGCTTCTCCTCCGAGC	0.652																																						dbGAP											0													48.0	50.0	49.0					14																	105834442		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB011174	CCDS32168.1, CCDS45178.1, CCDS45178.2, CCDS58339.1	14q32	2005-02-15	2005-02-15	2005-02-15		ENSG00000179364			23794	protein-coding gene	gene with protein product		610423	"""phosphofurin acidic cluster sorting protein 1-like"""	PACS1L		15692567	Standard	NM_001100913		Approved	KIAA0602	uc001yqu.3	Q86VP3	OTTHUMG00000170450	ENST00000325438.8:c.618C>A	14.37:g.105834442C>A	ENSP00000321834:p.Phe206Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2VDJ9|G8JLK3|O60342|Q6P191|Q96FL7	Missense_Mutation	SNP	pfam_Phosphofurin_acidic_CS-1	p.F206L	ENST00000325438.8	37	c.618	CCDS32168.1	14	.	.	.	.	.	.	.	.	.	.	C	21.4	4.148728	0.78001	.	.	ENSG00000179364	ENST00000430725;ENST00000325438;ENST00000458164;ENST00000447393;ENST00000547217	T;T;T;T;T	0.16324	2.35;2.35;2.35;2.35;2.35	4.14	0.493	0.16878	.	0.000000	0.85682	D	0.000000	T	0.30823	0.0777	M	0.73962	2.25	0.58432	D	0.999997	P;P;D;D	0.62365	0.948;0.936;0.991;0.99	P;P;P;D	0.63703	0.49;0.511;0.725;0.917	T	0.13469	-1.0508	10	0.19147	T	0.46	-27.0416	8.5502	0.33447	0.0:0.6177:0.0:0.3823	.	206;206;206;215	E9PB38;Q86VP3-2;Q86VP3;Q86VP3-3	.;.;PACS2_HUMAN;.	L	139;206;206;206;176	ENSP00000393524:F139L;ENSP00000321834:F206L;ENSP00000399732:F206L;ENSP00000393559:F206L;ENSP00000449525:F176L	ENSP00000321834:F206L	F	+	3	2	PACS2	104905487	0.997000	0.39634	1.000000	0.80357	0.951000	0.60555	0.548000	0.23314	0.199000	0.20427	0.491000	0.48974	TTC	PACS2	-	NULL	ENSG00000179364		0.652	PACS2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PACS2	HGNC	protein_coding	OTTHUMT00000409209.1	68	0.00	0	C	XM_377355		105834442	105834442	+1	no_errors	ENST00000458164	ensembl	human	known	69_37n	missense	64	12.33	9	SNP	1.000	A
PCDHA8	56140	genome.wustl.edu	37	5	140222591	140222591	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr5:140222591C>T	ENST00000531613.1	+	1	1685	c.1685C>T	c.(1684-1686)gCg>gTg	p.A562V	PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.A562V|PCDHA5_ENST00000529859.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	562	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGACAACGCGCCGGCACTG	0.706																																						dbGAP											0													54.0	61.0	58.0					5																	140222591		2196	4261	6457	-	-	-	SO:0001583	missense	0			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.1685C>T	5.37:g.140222591C>T	ENSP00000434655:p.Ala562Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A562V	ENST00000531613.1	37	c.1685	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	C	12.35	1.912253	0.33721	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.23552	1.9;1.9	3.72	3.72	0.42706	Cadherin (4);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.36444	U	0.002581	T	0.32704	0.0838	M	0.75447	2.3	0.27204	N	0.960096	P;P	0.46621	0.609;0.881	B;B	0.41764	0.323;0.366	T	0.36480	-0.9746	10	0.51188	T	0.08	.	15.5305	0.75956	0.0:1.0:0.0:0.0	.	562;562	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	V	562	ENSP00000434655:A562V;ENSP00000367363:A562V	ENSP00000367363:A562V	A	+	2	0	PCDHA8	140202775	0.026000	0.19158	0.998000	0.56505	0.140000	0.21249	1.348000	0.33987	1.790000	0.52503	0.306000	0.20318	GCG	PCDHA8	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	ENSG00000204962		0.706	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	82	0.00	0	C	NM_018911		140222591	140222591	+1	no_errors	ENST00000531613	ensembl	human	known	69_37n	missense	32	49.21	31	SNP	1.000	T
PDCL3	79031	genome.wustl.edu	37	2	101188161	101188161	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:101188161G>C	ENST00000264254.6	+	5	856	c.478G>C	c.(478-480)Gat>Cat	p.D160H		NM_024065.4	NP_076970.1	Q9H2J4	PDCL3_HUMAN	phosducin-like 3	160	Thioredoxin fold. {ECO:0000250}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|negative regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000059)|positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell proliferation (GO:0001938)|protein folding (GO:0006457)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|viral process (GO:0016032)	cytoplasm (GO:0005737)	protein binding involved in protein folding (GO:0044183)			endometrium(3)|large_intestine(2)|liver(1)|lung(6)	12						CAATTATCCTGATAGGAATCT	0.448																																						dbGAP											0													111.0	120.0	117.0					2																	101188161		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF267853	CCDS33261.1	2q12	2008-02-05			ENSG00000115539	ENSG00000115539			28860	protein-coding gene	gene with protein product		611678					Standard	NM_024065		Approved	VIAF1	uc002tao.2	Q9H2J4	OTTHUMG00000153141	ENST00000264254.6:c.478G>C	2.37:g.101188161G>C	ENSP00000264254:p.Asp160His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA00|Q53S68	Missense_Mutation	SNP	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold,tigrfam_Antitoxin_Phd/YefM	p.D160H	ENST00000264254.6	37	c.478	CCDS33261.1	2	.	.	.	.	.	.	.	.	.	.	.	22.5	4.300966	0.81136	.	.	ENSG00000115539	ENST00000264254	T	0.14144	2.53	4.88	4.88	0.63580	Phosducin, thioredoxin-like domain (1);Thioredoxin-like fold (2);	0.045093	0.85682	D	0.000000	T	0.50137	0.1598	M	0.93978	3.48	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.65450	-0.6165	10	0.87932	D	0	-24.6114	18.4413	0.90667	0.0:0.0:1.0:0.0	.	160	Q9H2J4	PDCL3_HUMAN	H	160	ENSP00000264254:D160H	ENSP00000264254:D160H	D	+	1	0	PDCL3	100554593	1.000000	0.71417	0.362000	0.25862	0.886000	0.51366	9.835000	0.99442	2.432000	0.82394	0.644000	0.83932	GAT	PDCL3	-	pfam_Phosducin_thioredoxin-like_dom,superfamily_Thioredoxin-like_fold	ENSG00000115539		0.448	PDCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDCL3	HGNC	protein_coding	OTTHUMT00000329734.1	351	0.00	0	G	NM_024065		101188161	101188161	+1	no_errors	ENST00000264254	ensembl	human	known	69_37n	missense	316	17.92	69	SNP	1.000	C
PGD	5226	genome.wustl.edu	37	1	10477061	10477061	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:10477061C>T	ENST00000270776.8	+	9	900	c.862C>T	c.(862-864)Cgg>Tgg	p.R288W	PGD_ENST00000538557.1_Missense_Mutation_p.R275W|PGD_ENST00000541529.1_Missense_Mutation_p.R266W|PGD_ENST00000498356.1_3'UTR	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	288					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	TGTCTTTGCTCGGTGCTTATC	0.468																																						dbGAP											0													79.0	73.0	75.0					1																	10477061		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.862C>T	1.37:g.10477061C>T	ENSP00000270776:p.Arg288Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	pfam_6PGDH_C,pfam_6PGDH_NADP-bd,superfamily_6-PGluconate_DH_C-like,tigrfam_6PGDH_decarbox	p.R288W	ENST00000270776.8	37	c.862	CCDS113.1	1	.	.	.	.	.	.	.	.	.	.	C	21.1	4.090498	0.76756	.	.	ENSG00000142657	ENST00000541529;ENST00000543846;ENST00000270776;ENST00000538557	T;T;T	0.67523	-0.27;-0.27;-0.27	4.82	3.9	0.45041	6-phosphogluconate dehydrogenase, C-terminal (1);Dehydrogenase, multihelical (1);6-phosphogluconate dehydrogenase, C-terminal-like (1);	0.058024	0.64402	D	0.000002	D	0.88847	0.6548	H	0.99042	4.41	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.93;1.0;1.0	D	0.93057	0.6471	10	0.87932	D	0	-10.0057	14.7543	0.69552	0.1458:0.8542:0.0:0.0	.	266;288;288	F5H7U0;A8K2Y9;P52209	.;.;6PGD_HUMAN	W	266;234;288;275	ENSP00000442285:R266W;ENSP00000270776:R288W;ENSP00000437822:R275W	ENSP00000270776:R288W	R	+	1	2	PGD	10399648	0.999000	0.42202	0.603000	0.28903	0.991000	0.79684	3.134000	0.50538	1.151000	0.42436	0.650000	0.86243	CGG	PGD	-	pfam_6PGDH_C,superfamily_6-PGluconate_DH_C-like,tigrfam_6PGDH_decarbox	ENSG00000142657		0.468	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGD	HGNC	protein_coding	OTTHUMT00000005398.1	263	0.38	1	C	NM_002631		10477061	10477061	+1	no_errors	ENST00000270776	ensembl	human	known	69_37n	missense	94	40.99	66	SNP	0.997	T
PIGN	23556	genome.wustl.edu	37	18	59828374	59828374	+	Silent	SNP	C	C	A	rs370553142	byFrequency	TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr18:59828374C>A	ENST00000357637.5	-	4	628	c.213G>T	c.(211-213)ccG>ccT	p.P71P	PIGN_ENST00000400334.3_Silent_p.P71P|PIGN_ENST00000593225.1_5'Flank	NM_176787.4	NP_789744.1	O95427	PIGN_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class N	71					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			breast(3)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(73;0.187)				ACCTAATAAACGGTGCTCTAG	0.378																																						dbGAP											0													126.0	115.0	118.0					18																	59828374		1918	4136	6054	-	-	-	SO:0001819	synonymous_variant	0			AF109219	CCDS45879.1	18q21.33	2013-02-26	2006-06-28		ENSG00000197563	ENSG00000197563		"""Phosphatidylinositol glycan anchor biosynthesis"""	8967	protein-coding gene	gene with protein product		606097	"""phosphatidylinositol glycan, class N"""			10069808, 10574991	Standard	NM_012327		Approved	MDC4, PIG-N	uc021ulb.1	O95427	OTTHUMG00000180098	ENST00000357637.5:c.213G>T	18.37:g.59828374C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L8F8|Q8TC01|Q9NT05	Silent	SNP	pfam_GPI_EtnP_transferase_1_C,pfam_Phosphodiest/P_Trfase,pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.P71	ENST00000357637.5	37	c.213	CCDS45879.1	18																																																																																			PIGN	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000197563		0.378	PIGN-001	KNOWN	non_canonical_genome_sequence_error|basic|appris_principal|CCDS	protein_coding	PIGN	HGNC	protein_coding	OTTHUMT00000449757.2	504	0.00	0	C	NM_176787		59828374	59828374	-1	no_errors	ENST00000357637	ensembl	human	known	69_37n	silent	224	28.89	91	SNP	0.973	A
PKHD1	5314	genome.wustl.edu	37	6	51934282	51934282	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:51934282C>T	ENST00000371117.3	-	11	1026	c.751G>A	c.(751-753)Gat>Aat	p.D251N	PKHD1_ENST00000340994.4_Missense_Mutation_p.D251N	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	251					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					AGGAAAAGATCCTGTTTAGCA	0.438																																						dbGAP											0													284.0	262.0	269.0					6																	51934282		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.751G>A	6.37:g.51934282C>T	ENSP00000360158:p.Asp251Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.D251N	ENST00000371117.3	37	c.751	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	28.3	4.909238	0.92107	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.86769	-1.97;-2.17	5.15	5.15	0.70609	Immunoglobulin-like fold (1);	0.373853	0.26140	N	0.026107	T	0.82029	0.4948	L	0.44542	1.39	0.31291	N	0.689453	P;P	0.46142	0.873;0.651	P;B	0.49047	0.599;0.212	T	0.77900	-0.2415	10	0.22109	T	0.4	.	18.034	0.89293	0.0:1.0:0.0:0.0	.	251;251	P08F94-2;P08F94	.;PKHD1_HUMAN	N	251	ENSP00000360158:D251N;ENSP00000341097:D251N	ENSP00000341097:D251N	D	-	1	0	PKHD1	52042241	1.000000	0.71417	1.000000	0.80357	0.956000	0.61745	4.718000	0.61930	2.585000	0.87301	0.558000	0.71614	GAT	PKHD1	-	NULL	ENSG00000170927		0.438	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	423	0.00	0	C	NM_138694		51934282	51934282	-1	no_errors	ENST00000371117	ensembl	human	known	69_37n	missense	369	16.82	75	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110418568	110418568	+	Silent	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr8:110418568C>T	ENST00000378402.5	+	17	1778	c.1674C>T	c.(1672-1674)ttC>ttT	p.F558F		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	558					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCAAAGTCTTCCTACCTGCTG	0.368										HNSCC(38;0.096)																												dbGAP											0													44.0	38.0	40.0					8																	110418568		1853	4030	5883	-	-	-	SO:0001819	synonymous_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1674C>T	8.37:g.110418568C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.F558	ENST00000378402.5	37	c.1674	CCDS47911.1	8																																																																																			PKHD1L1	-	NULL	ENSG00000205038		0.368	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	199	0.00	0	C	NM_177531		110418568	110418568	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	silent	191	18.72	44	SNP	0.784	T
POTEJ	653781	genome.wustl.edu	37	2	131390121	131390121	+	Missense_Mutation	SNP	G	G	C	rs202134345		TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:131390121G>C	ENST00000409602.1	+	9	1242	c.1190G>C	c.(1189-1191)aGt>aCt	p.S397T		NM_001277083.1	NP_001264012.1	P0CG39	POTEJ_HUMAN	POTE ankyrin domain family, member J	397					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(5)	5						GAAAACCTGAGTAATGGTGTC	0.368																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59432.1	2q21.1	2013-01-10			ENSG00000222038	ENSG00000222038		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37094	protein-coding gene	gene with protein product						16364570	Standard	NM_001277083		Approved	POTE2beta	uc021vor.2	P0CG39	OTTHUMG00000154050	ENST00000409602.1:c.1190G>C	2.37:g.131390121G>C	ENSP00000387176:p.Ser397Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.S397T	ENST00000409602.1	37	c.1190	CCDS59432.1	2	.	.	.	.	.	.	.	.	.	.	.	0.001	-3.281453	0.00020	.	.	ENSG00000222038	ENST00000409602	T	0.13420	2.59	0.427	-0.854	0.10705	.	.	.	.	.	T	0.02649	0.0080	N	0.01168	-0.975	0.09310	N	1	.	.	.	.	.	.	T	0.30995	-0.9959	6	0.02654	T	1	.	.	.	.	.	.	.	.	T	397	ENSP00000387176:S397T	ENSP00000387176:S397T	S	+	2	0	POTEJ	131106591	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-1.945000	0.01537	-1.807000	0.01236	-1.041000	0.02371	AGT	POTEJ	-	NULL	ENSG00000222038		0.368	POTEJ-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEJ	HGNC	protein_coding	OTTHUMT00000333665.1	37	0.00	0	G	XM_929706		131390121	131390121	+1	no_errors	ENST00000409602	ensembl	human	novel	69_37n	missense	20	13.04	3	SNP	0.000	C
PPEF1	5475	genome.wustl.edu	37	X	18767947	18767947	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chrX:18767947G>A	ENST00000361511.4	+	7	767	c.273G>A	c.(271-273)atG>atA	p.M91I	PPEF1_ENST00000543630.1_Missense_Mutation_p.M91I|PPEF1_ENST00000349874.5_Missense_Mutation_p.M91I|PPEF1_ENST00000359763.6_Intron|PPEF1_ENST00000471570.1_3'UTR|PPEF1_ENST00000544635.1_Missense_Mutation_p.M26I	NM_006240.2|NM_152224.1	NP_006231.2|NP_689410.1	O14829	PPE1_HUMAN	protein phosphatase, EF-hand calcium binding domain 1	91					detection of stimulus involved in sensory perception (GO:0050906)|phototransduction, visible light (GO:0007603)|protein dephosphorylation (GO:0006470)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|protein serine/threonine phosphatase activity (GO:0004722)			breast(3)|endometrium(6)|kidney(2)|large_intestine(8)|lung(19)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	43	Hepatocellular(33;0.183)					AACAGGACATGAGGGATAGAT	0.453																																						dbGAP											0													151.0	126.0	134.0					X																	18767947		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036026	CCDS14188.1, CCDS43920.1	Xp22	2013-01-10			ENSG00000086717	ENSG00000086717		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9243	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, alpha isozyme"""	300109		PPEF		9215685, 9326663	Standard	NM_152224		Approved	PPP7CA	uc004cyq.3	O14829	OTTHUMG00000021219	ENST00000361511.4:c.273G>A	X.37:g.18767947G>A	ENSP00000354871:p.Met91Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHP4|A8K348|O15253|Q9NU21|Q9UJH0	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,pfam_EF-hand,pfam_PPP_dom,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pirsf_Ser/Thr-Pase_EF-hand_contain,pfscan_EF_HAND_2,pfscan_IQ_motif_EF-hand-BS,prints_Ser/Thr-sp_prot-phosphatase	p.M91I	ENST00000361511.4	37	c.273	CCDS14188.1	X	.	.	.	.	.	.	.	.	.	.	G	5.432	0.264922	0.10294	.	.	ENSG00000086717	ENST00000361511;ENST00000349874;ENST00000543630;ENST00000472826;ENST00000544635	T;T;T;T;T	0.40225	3.36;1.04;1.04;1.06;3.37	4.63	0.75	0.18387	.	1.304660	0.05111	N	0.488874	T	0.19446	0.0467	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.14868	-1.0457	10	0.17832	T	0.49	3.3875	1.1384	0.01760	0.1737:0.4344:0.1801:0.2118	.	91;91;91	O14829-5;O14829;O14829-3	.;PPE1_HUMAN;.	I	91;91;91;1;26	ENSP00000354871:M91I;ENSP00000341892:M91I;ENSP00000437785:M91I;ENSP00000419948:M1I;ENSP00000441289:M26I	ENSP00000341892:M91I	M	+	3	0	PPEF1	18677868	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.100000	0.10990	-0.094000	0.12374	-1.023000	0.02433	ATG	PPEF1	-	pirsf_Ser/Thr-Pase_EF-hand_contain	ENSG00000086717		0.453	PPEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF1	HGNC	protein_coding	OTTHUMT00000055953.3	186	0.53	1	G	NM_006240		18767947	18767947	+1	no_errors	ENST00000361511	ensembl	human	known	69_37n	missense	146	21.51	40	SNP	0.000	A
PSG1	5669	genome.wustl.edu	37	19	43382380	43382380	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr19:43382380C>G	ENST00000436291.2	-	2	231	c.115G>C	c.(115-117)Gaa>Caa	p.E39Q	PSG1_ENST00000312439.6_Missense_Mutation_p.E39Q|PSG1_ENST00000601073.1_5'UTR|PSG1_ENST00000403380.3_Missense_Mutation_p.E39Q|PSG1_ENST00000595124.1_Missense_Mutation_p.E39Q|PSG1_ENST00000244296.2_Missense_Mutation_p.E39Q|PSG1_ENST00000595356.1_Missense_Mutation_p.E39Q	NM_001184825.1|NM_001184826.1	NP_001171754.1|NP_001171755.1	P11464	PSG1_HUMAN	pregnancy specific beta-1-glycoprotein 1	39	Ig-like V-type.				female pregnancy (GO:0007565)	extracellular region (GO:0005576)				breast(2)|endometrium(4)|kidney(2)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30		Prostate(69;0.00682)				GGCTCGGCTTCAATCGTGACT	0.468																																						dbGAP											0													148.0	165.0	160.0					19																	43382380		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS12612.1, CCDS54275.1, CCDS59392.1, CCDS74380.1	19q13.2	2013-01-29			ENSG00000231924	ENSG00000231924		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9514	protein-coding gene	gene with protein product		176390		PSBG1			Standard	NM_006905		Approved	PSGGA, CD66f, PBG1		P11464	OTTHUMG00000151123	ENST00000436291.2:c.115G>C	19.37:g.43382380C>G	ENSP00000413041:p.Glu39Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O75236|P11462|P11463|Q15231|Q15241|Q15243|Q16660|Q6ICR4|Q9P1W5|Q9UQ79	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E39Q	ENST00000436291.2	37	c.115	CCDS54275.1	19	.	.	.	.	.	.	.	.	.	.	N	12.29	1.895034	0.33442	.	.	ENSG00000231924	ENST00000270059;ENST00000436291;ENST00000403380;ENST00000312439;ENST00000244296	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	1.46	1.46	0.22682	Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.79764	0.4502	M	0.91663	3.23	0.09310	N	1	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.99;0.991;0.999;0.999;0.995;1.0;0.993;0.999	D;D;D;D;D;D;D;D;D	0.97110	1.0;0.932;0.947;0.999;0.986;0.982;0.998;0.955;0.983	T	0.64508	-0.6391	9	0.87932	D	0	.	6.4075	0.21672	0.0:1.0:0.0:0.0	.	39;39;39;39;39;39;39;39;39	O75238;P11464-4;G5E9F7;P11464;Q8NBY8;P11464-3;Q9UPK8;O75237;P11464-2	.;.;.;PSG1_HUMAN;.;.;.;.;.	Q	39	ENSP00000413041:E39Q;ENSP00000385386:E39Q;ENSP00000308970:E39Q;ENSP00000244296:E39Q	ENSP00000244296:E39Q	E	-	1	0	PSG1	48074220	0.000000	0.05858	0.004000	0.12327	0.008000	0.06430	-0.006000	0.12833	1.130000	0.42092	0.184000	0.17185	GAA	PSG1	-	pfam_Ig_V-set	ENSG00000231924		0.468	PSG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PSG1	HGNC	protein_coding	OTTHUMT00000321426.1	1034	0.95	10	C			43382380	43382380	-1	no_errors	ENST00000312439	ensembl	human	known	69_37n	missense	648	34.09	345	SNP	0.005	G
PPP6R1	22870	genome.wustl.edu	37	19	55750982	55750982	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr19:55750982C>T	ENST00000412770.2	-	14	2199	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K	PPP6R1_ENST00000587283.1_Missense_Mutation_p.E545K	NM_014931.3	NP_055746.3	Q9UPN7	PP6R1_HUMAN	protein phosphatase 6, regulatory subunit 1	545					regulation of phosphoprotein phosphatase activity (GO:0043666)	cytoplasm (GO:0005737)	protein phosphatase binding (GO:0019903)			breast(1)	1						ACAGCCTCCTCAGGGAAGTTG	0.647																																						dbGAP											0													54.0	62.0	59.0					19																	55750982		2138	4243	6381	-	-	-	SO:0001583	missense	0			AB029038	CCDS46186.1	19q13.42	2012-04-17	2010-06-28	2010-06-28	ENSG00000105063	ENSG00000105063		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"""	29195	protein-coding gene	gene with protein product		610875	"""KIAA1115"", ""SAPS domain family, member 1"""	KIAA1115, SAPS1		16769727	Standard	NM_014931		Approved	SAP190	uc002qjw.4	Q9UPN7		ENST00000412770.2:c.1633G>A	19.37:g.55750982C>T	ENSP00000414202:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2H3|Q504V2|Q6NVJ6|Q9BU97	Missense_Mutation	SNP	pfam_SAPS,superfamily_ARM-type_fold	p.E545K	ENST00000412770.2	37	c.1633	CCDS46186.1	19	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195895	0.38806	.	.	ENSG00000105063	ENST00000412770	T	0.42900	0.96	4.79	3.68	0.42216	.	0.102956	0.41396	D	0.000884	T	0.22044	0.0531	N	0.14661	0.345	0.36547	D	0.871623	B	0.19706	0.038	B	0.19148	0.024	T	0.11251	-1.0595	10	0.07644	T	0.81	-32.7492	11.6991	0.51560	0.0:0.6764:0.3236:0.0	.	545	Q9UPN7	PP6R1_HUMAN	K	545	ENSP00000414202:E545K	ENSP00000414202:E545K	E	-	1	0	PPP6R1	60442794	0.982000	0.34865	0.961000	0.40146	0.556000	0.35491	1.912000	0.39946	2.643000	0.89663	0.655000	0.94253	GAG	PPP6R1	-	superfamily_ARM-type_fold	ENSG00000105063		0.647	PPP6R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP6R1	HGNC	protein_coding	OTTHUMT00000452663.1	215	0.00	0	C	NM_014931		55750982	55750982	-1	no_errors	ENST00000412770	ensembl	human	known	69_37n	missense	174	16.35	34	SNP	0.992	T
PTPRF	5792	genome.wustl.edu	37	1	44035447	44035447	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:44035447C>T	ENST00000359947.4	+	6	906	c.566C>T	c.(565-567)tCa>tTa	p.S189L	PTPRF_ENST00000372413.3_Missense_Mutation_p.S189L|PTPRF_ENST00000372414.3_Missense_Mutation_p.S189L|PTPRF_ENST00000438120.1_Missense_Mutation_p.S189L	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F	189	Ig-like C2-type 2.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CAGCTGCGTTCAGGTGAGCAG	0.597																																						dbGAP											0													38.0	36.0	37.0					1																	44035447		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.566C>T	1.37:g.44035447C>T	ENSP00000353030:p.Ser189Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt	p.S189L	ENST00000359947.4	37	c.566	CCDS489.2	1	.	.	.	.	.	.	.	.	.	.	C	35	5.472418	0.96274	.	.	ENSG00000142949	ENST00000359947;ENST00000438120;ENST00000372414;ENST00000372413;ENST00000437607	T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93	4.82	4.82	0.62117	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.28834	N	0.013998	T	0.59865	0.2225	L	0.55213	1.73	0.80722	D	1	D;D;D;D	0.89917	1.0;0.983;1.0;0.997	D;P;D;D	0.97110	1.0;0.757;0.999;0.968	T	0.54153	-0.8336	10	0.25751	T	0.34	.	18.2874	0.90119	0.0:1.0:0.0:0.0	.	189;189;189;189	Q5T020;P10586-2;P10586;Q5T019	.;.;PTPRF_HUMAN;.	L	189	ENSP00000353030:S189L;ENSP00000398822:S189L;ENSP00000361491:S189L;ENSP00000361490:S189L;ENSP00000413306:S189L	ENSP00000353030:S189L	S	+	2	0	PTPRF	43808034	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.818000	0.86416	2.401000	0.81631	0.561000	0.74099	TCA	PTPRF	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000142949		0.597	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	94	0.00	0	C			44035447	44035447	+1	no_errors	ENST00000359947	ensembl	human	known	69_37n	missense	99	10.81	12	SNP	1.000	T
PTPRM	5797	genome.wustl.edu	37	18	8296428	8296428	+	Silent	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr18:8296428G>A	ENST00000332175.8	+	18	3815	c.2778G>A	c.(2776-2778)aaG>aaA	p.K926K	PTPRM_ENST00000580170.1_Silent_p.K939K|PTPRM_ENST00000400053.4_Silent_p.K864K|PTPRM_ENST00000444013.1_Silent_p.K713K|PTPRM_ENST00000400060.4_Silent_p.K940K	NM_002845.3	NP_002836.3	P28827	PTPRM_HUMAN	protein tyrosine phosphatase, receptor type, M	926	Tyrosine-protein phosphatase 1. {ECO:0000255|PROSITE-ProRule:PRU00160}.				homophilic cell adhesion (GO:0007156)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|neuron projection development (GO:0031175)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of vasodilation (GO:0045909)|protein dephosphorylation (GO:0006470)|response to drug (GO:0042493)|retina layer formation (GO:0010842)|retinal ganglion cell axon guidance (GO:0031290)|signal transduction (GO:0007165)	cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|perinuclear region of cytoplasm (GO:0048471)	cadherin binding (GO:0045296)|identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(32)|lung(25)|ovary(2)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	90		Colorectal(10;0.234)				ACAGAATGAAGAACAGATACG	0.428																																						dbGAP											0													225.0	191.0	202.0					18																	8296428		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X58288	CCDS11840.1, CCDS58613.1	18p11.2	2013-02-11			ENSG00000173482	ENSG00000173482		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	9675	protein-coding gene	gene with protein product		176888		PTPRL1		1655529, 8404049	Standard	NM_002845		Approved	RPTPU, hR-PTPu	uc010dkv.3	P28827	OTTHUMG00000131575	ENST00000332175.8:c.2778G>A	18.37:g.8296428G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7MBN1|D3DUH8|J3QL11	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_MAM_dom,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_MAM_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_MAM_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like,prints_Tyr_Pase_rcpt/non-rcpt,prints_MAM_dom	p.K940	ENST00000332175.8	37	c.2820	CCDS11840.1	18																																																																																			PTPRM	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000173482		0.428	PTPRM-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRM	HGNC	protein_coding	OTTHUMT00000254456.1	488	0.41	2	G			8296428	8296428	+1	no_errors	ENST00000400060	ensembl	human	known	69_37n	silent	280	25.33	95	SNP	1.000	A
PTX3	5806	genome.wustl.edu	37	3	157160269	157160269	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:157160269C>T	ENST00000295927.3	+	3	792	c.647C>T	c.(646-648)aCa>aTa	p.T216I	VEPH1_ENST00000362010.2_Intron|VEPH1_ENST00000392833.2_Intron|VEPH1_ENST00000543418.1_Intron|VEPH1_ENST00000392832.2_Intron	NM_002852.3	NP_002843.2	P26022	PTX3_HUMAN	pentraxin 3, long	216	Pentaxin.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of exo-alpha-sialidase activity (GO:1903016)|negative regulation of glycoprotein metabolic process (GO:1903019)|negative regulation of viral entry into host cell (GO:0046597)|opsonization (GO:0008228)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of phagocytosis (GO:0050766)|response to yeast (GO:0001878)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	(1->3)-beta-D-glucan binding (GO:0001872)|complement component C1q binding (GO:0001849)|virion binding (GO:0046790)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(4)|stomach(1)	10			Lung(72;0.0272)|LUSC - Lung squamous cell carcinoma(72;0.0461)			GTCAAAGCCACAGATGTATTA	0.418																																						dbGAP											0													104.0	101.0	102.0					3																	157160269		2203	4300	6503	-	-	-	SO:0001583	missense	0			X63613	CCDS3180.1	3q25	2010-03-11	2010-03-11		ENSG00000163661	ENSG00000163661			9692	protein-coding gene	gene with protein product		602492	"""pentaxin-related gene, rapidly induced by IL-1 beta"", ""tumor necrosis factor, alpha-induced protein 5"", ""pentraxin-related gene, rapidly induced by IL-1 beta"""	TNFAIP5		1429570	Standard	NM_002852		Approved	TSG-14	uc003fbl.4	P26022	OTTHUMG00000158750	ENST00000295927.3:c.647C>T	3.37:g.157160269C>T	ENSP00000295927:p.Thr216Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6T6|Q38M82	Missense_Mutation	SNP	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_LamG-like,prints_Pentaxin	p.T216I	ENST00000295927.3	37	c.647	CCDS3180.1	3	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435909	0.62955	.	.	ENSG00000163661	ENST00000295927	T	0.61040	0.14	5.5	5.5	0.81552	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);	0.000000	0.85682	D	0.000000	T	0.80670	0.4667	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83747	0.0207	10	0.87932	D	0	-13.2832	19.3998	0.94623	0.0:1.0:0.0:0.0	.	216	P26022	PTX3_HUMAN	I	216	ENSP00000295927:T216I	ENSP00000295927:T216I	T	+	2	0	PTX3	158642963	1.000000	0.71417	0.997000	0.53966	0.361000	0.29550	7.187000	0.77730	2.586000	0.87340	0.655000	0.94253	ACA	PTX3	-	pfam_Pentaxin,superfamily_ConA-like_lec_gl,smart_Pentaxin,smart_LamG-like,prints_Pentaxin	ENSG00000163661		0.418	PTX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTX3	HGNC	protein_coding	OTTHUMT00000352028.1	166	0.00	0	C	NM_002852		157160269	157160269	+1	no_errors	ENST00000295927	ensembl	human	known	69_37n	missense	165	17.09	34	SNP	1.000	T
RICTOR	253260	genome.wustl.edu	37	5	38944651	38944651	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr5:38944651C>T	ENST00000357387.3	-	36	4840	c.4810G>A	c.(4810-4812)Gat>Aat	p.D1604N	RICTOR_ENST00000296782.5_Missense_Mutation_p.D1628N	NM_152756.3	NP_689969.2			RPTOR independent companion of MTOR, complex 2											NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(14)|lung(33)|ovary(3)|prostate(3)|skin(5)	75	all_lung(31;0.000396)					ATTGGTGTATCATCTGGAATT	0.303																																						dbGAP											0													84.0	83.0	84.0					5																	38944651		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34148.1, CCDS68861.1	5p13.1	2009-07-09			ENSG00000164327	ENSG00000164327			28611	protein-coding gene	gene with protein product	"""rapamycin-insensitive companion of mTOR"", ""pianissimo"""	609022				12477932	Standard	XM_005248278		Approved	MGC39830, AVO3, PIA, KIAA1999	uc003jlp.2	Q6R327	OTTHUMG00000162037	ENST00000357387.3:c.4810G>A	5.37:g.38944651C>T	ENSP00000349959:p.Asp1604Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D1628N	ENST00000357387.3	37	c.4882	CCDS34148.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.440828	0.96168	.	.	ENSG00000164327	ENST00000357387;ENST00000296782	T;T	0.56611	0.47;0.45	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.71048	0.3294	L	0.59436	1.845	0.80722	D	1	D;D	0.67145	0.996;0.996	D;D	0.79784	0.993;0.993	T	0.72855	-0.4166	10	0.87932	D	0	-17.8385	19.4767	0.94992	0.0:1.0:0.0:0.0	.	1604;1628	Q6R327;Q6R327-3	RICTR_HUMAN;.	N	1604;1628	ENSP00000349959:D1604N;ENSP00000296782:D1628N	ENSP00000296782:D1628N	D	-	1	0	RICTOR	38980408	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.355000	0.59424	2.601000	0.87937	0.563000	0.77884	GAT	RICTOR	-	NULL	ENSG00000164327		0.303	RICTOR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RICTOR	HGNC	protein_coding	OTTHUMT00000366985.1	278	0.00	0	C	NM_152756		38944651	38944651	-1	no_errors	ENST00000296782	ensembl	human	known	69_37n	missense	266	17.13	55	SNP	1.000	T
ROBO2	6092	genome.wustl.edu	37	3	77607107	77607107	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr3:77607107G>C	ENST00000461745.1	+	9	2144	c.1244G>C	c.(1243-1245)aGa>aCa	p.R415T	ROBO2_ENST00000332191.8_Missense_Mutation_p.R415T|ROBO2_ENST00000487694.3_Missense_Mutation_p.R431T	NM_002942.4	NP_002933.1	Q9HCK4	ROBO2_HUMAN	roundabout, axon guidance receptor, homolog 2 (Drosophila)	415					apoptotic process involved in luteolysis (GO:0061364)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|brain development (GO:0007420)|cellular response to hormone stimulus (GO:0032870)|central nervous system development (GO:0007417)|homophilic cell adhesion (GO:0007156)|metanephros development (GO:0001656)|negative regulation of negative chemotaxis (GO:0050925)|negative regulation of synapse assembly (GO:0051964)|olfactory bulb interneuron development (GO:0021891)|positive regulation of axonogenesis (GO:0050772)|retinal ganglion cell axon guidance (GO:0031290)|ureteric bud development (GO:0001657)	axolemma (GO:0030673)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)			NS(1)|biliary_tract(5)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(23)|liver(1)|lung(52)|ovary(2)|pancreas(2)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	117				Epithelial(33;0.00199)|LUSC - Lung squamous cell carcinoma(21;0.008)|BRCA - Breast invasive adenocarcinoma(55;0.00884)|Lung(72;0.0183)|KIRC - Kidney renal clear cell carcinoma(39;0.0832)|Kidney(39;0.103)		TTGACAGATAGACCTCCACCT	0.413																																						dbGAP											0													76.0	79.0	78.0					3																	77607107		1863	4086	5949	-	-	-	SO:0001583	missense	0			AF040991	CCDS43109.1, CCDS54609.1	3p12.3	2013-02-11	2001-11-28		ENSG00000185008	ENSG00000185008		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10250	protein-coding gene	gene with protein product		602431	"""roundabout (axon guidance receptor, Drosophila) homolog 2"""			9458045	Standard	NM_002942		Approved	KIAA1568	uc003dpy.4	Q9HCK4	OTTHUMG00000158935	ENST00000461745.1:c.1244G>C	3.37:g.77607107G>C	ENSP00000417164:p.Arg415Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43608|Q19AB4|Q19AB5	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R415T	ENST00000461745.1	37	c.1244	CCDS43109.1	3	.	.	.	.	.	.	.	.	.	.	G	15.87	2.962029	0.53400	.	.	ENSG00000185008	ENST00000487694;ENST00000403211;ENST00000343019;ENST00000461745;ENST00000332191;ENST00000398467	T;T;T	0.64085	-0.08;-0.04;-0.05	5.68	4.8	0.61643	.	0.260251	0.26750	N	0.022698	T	0.74921	0.3780	M	0.65677	2.01	0.43890	D	0.996516	P;D;P	0.58970	0.944;0.984;0.944	P;D;P	0.65874	0.776;0.939;0.694	T	0.76724	-0.2854	9	0.30854	T	0.27	.	14.8627	0.70392	0.0691:0.0:0.9309:0.0	.	431;415;415	Q19AB5;F8W703;Q9HCK4	.;.;ROBO2_HUMAN	T	431;431;435;415;415;136	ENSP00000417335:R431T;ENSP00000417164:R415T;ENSP00000327536:R415T	ENSP00000327536:R415T	R	+	2	0	ROBO2	77689797	1.000000	0.71417	1.000000	0.80357	0.257000	0.26127	9.813000	0.99286	1.549000	0.49425	-0.225000	0.12378	AGA	ROBO2	-	NULL	ENSG00000185008		0.413	ROBO2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ROBO2	HGNC	protein_coding	OTTHUMT00000352600.2	124	0.00	0	G	XM_031246		77607107	77607107	+1	no_errors	ENST00000461745	ensembl	human	known	69_37n	missense	87	19.64	22	SNP	1.000	C
SHANK2	22941	genome.wustl.edu	37	11	70331543	70331543	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr11:70331543G>T	ENST00000423696.2	-	15	3754	c.3718C>A	c.(3718-3720)Cca>Aca	p.P1240T	SHANK2_ENST00000409161.1_Missense_Mutation_p.P1023T|SHANK2_ENST00000449833.2_Missense_Mutation_p.P1024T|SHANK2_ENST00000338508.4_Missense_Mutation_p.P1620T			Q9UPX8	SHAN2_HUMAN	SH3 and multiple ankyrin repeat domains 2	1240					adult behavior (GO:0030534)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|vocalization behavior (GO:0071625)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|cell junction (GO:0030054)|ciliary membrane (GO:0060170)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|growth cone (GO:0030426)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	GKAP/Homer scaffold activity (GO:0030160)|ionotropic glutamate receptor binding (GO:0035255)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(30)|ovary(3)|pancreas(2)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	62			LUSC - Lung squamous cell carcinoma(11;4.72e-09)|STAD - Stomach adenocarcinoma(18;0.071)			TTTGCCTTTGGGCCTGAGAGA	0.542																																						dbGAP											0													93.0	94.0	94.0					11																	70331543		2200	4294	6494	-	-	-	SO:0001583	missense	0			AF141901		11q13.2	2013-01-10			ENSG00000162105	ENSG00000162105		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	14295	protein-coding gene	gene with protein product		603290	"""cortactin binding protein 1"""	CORTBP1		10506216	Standard	XM_005277930		Approved	CTTNBP1, ProSAP1, SHANK, SPANK-3	uc001oqc.3	Q9UPX8	OTTHUMG00000154615	ENST00000423696.2:c.3718C>A	11.37:g.70331543G>T	ENSP00000394536:p.Pro1240Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	C0SPG8|C0SPG9|Q3Y8G9|Q52LK2|Q9UKP1	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,pfam_SH3_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SAM/pointed,superfamily_SH3_domain,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.P1620T	ENST00000423696.2	37	c.4858		11	.	.	.	.	.	.	.	.	.	.	G	15.84	2.951049	0.53186	.	.	ENSG00000162105	ENST00000449833;ENST00000409161;ENST00000424924;ENST00000338508;ENST00000423696;ENST00000433693;ENST00000294018	T;T;T;T;T;T	0.38560	2.42;2.42;3.13;1.13;2.55;2.55	5.66	5.66	0.87406	.	0.162846	0.56097	D	0.000030	T	0.62841	0.2461	M	0.69358	2.11	0.80722	D	1	B;D;D	0.89917	0.397;1.0;0.984	B;D;P	0.91635	0.057;0.999;0.757	T	0.54397	-0.8300	10	0.15066	T	0.55	.	19.756	0.96291	0.0:0.0:1.0:0.0	.	1240;1619;1024	Q9UPX8;Q9UPX8-3;Q9UPX8-4	SHAN2_HUMAN;.;.	T	1024;1023;898;1620;1240;1258;1243	ENSP00000399423:P1024T;ENSP00000386491:P1023T;ENSP00000402944:P898T;ENSP00000345193:P1620T;ENSP00000394536:P1240T;ENSP00000294018:P1243T	ENSP00000294018:P1243T	P	-	1	0	SHANK2	70009191	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.840000	0.62817	2.665000	0.90641	0.655000	0.94253	CCA	SHANK2	-	NULL	ENSG00000162105		0.542	SHANK2-203	KNOWN	basic	protein_coding	SHANK2	HGNC	protein_coding		159	0.00	0	G	NM_012309		70331543	70331543	-1	no_errors	ENST00000338508	ensembl	human	known	69_37n	missense	76	25.49	26	SNP	1.000	T
SLC22A4	6583	genome.wustl.edu	37	5	131657966	131657966	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr5:131657966C>G	ENST00000200652.3	+	4	916	c.742C>G	c.(742-744)Ctg>Gtg	p.L248V	AC034220.3_ENST00000417795.1_RNA	NM_003059.2	NP_003050.2	Q9H015	S22A4_HUMAN	solute carrier family 22 (organic cation/zwitterion transporter), member 4	248					body fluid secretion (GO:0007589)|carnitine metabolic process (GO:0009437)|carnitine transmembrane transport (GO:1902603)|carnitine transport (GO:0015879)|cation transmembrane transport (GO:0098655)|organic cation transport (GO:0015695)|quaternary ammonium group transport (GO:0015697)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)|triglyceride metabolic process (GO:0006641)	apical plasma membrane (GO:0016324)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|carnitine transmembrane transporter activity (GO:0015226)|cation:cation antiporter activity (GO:0015491)|nucleotide binding (GO:0000166)|PDZ domain binding (GO:0030165)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)|symporter activity (GO:0015293)			endometrium(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|urinary_tract(1)	16		all_cancers(142;0.0752)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Amiloride(DB00594)|Aminohippurate(DB00345)|Benzylpenicillin(DB01053)|Choline(DB00122)|Cimetidine(DB00501)|Clonidine(DB00575)|Desipramine(DB01151)|Guanidine(DB00536)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|L-Arginine(DB00125)|L-Carnitine(DB00583)|L-Lysine(DB00123)|Levofloxacin(DB01137)|Mepyramine(DB06691)|Nicotine(DB00184)|Ofloxacin(DB01165)|Procainamide(DB01035)|Quinidine(DB00908)|Quinine(DB00468)|Spermine(DB00127)|Testosterone(DB00624)|Tiotropium(DB01409)|Verapamil(DB00661)	GCTGCTGCCACTGTTTGCTTA	0.502																																						dbGAP											0													171.0	153.0	159.0					5																	131657966		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007448	CCDS4153.1	5q23.3	2013-07-18	2013-07-18		ENSG00000197208	ENSG00000197208		"""Solute carriers"""	10968	protein-coding gene	gene with protein product		604190	"""solute carrier family 22 (organic cation/ergothioneine transporter), member 4"""			9426230, 15795384	Standard	NM_003059		Approved	OCTN1, MGC34546	uc003kwq.3	Q9H015	OTTHUMG00000059648	ENST00000200652.3:c.742C>G	5.37:g.131657966C>G	ENSP00000200652:p.Leu248Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O14546	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.L248V	ENST00000200652.3	37	c.742	CCDS4153.1	5	.	.	.	.	.	.	.	.	.	.	C	23.1	4.374471	0.82573	.	.	ENSG00000197208	ENST00000200652	T	0.61510	0.1	6.06	5.2	0.72013	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.074381	0.56097	D	0.000031	T	0.71609	0.3360	M	0.75884	2.315	0.80722	D	1	D	0.54601	0.967	P	0.58391	0.838	T	0.72057	-0.4405	10	0.35671	T	0.21	.	15.57	0.76326	0.0:0.934:0.0:0.066	.	248	Q9H015	S22A4_HUMAN	V	248	ENSP00000200652:L248V	ENSP00000200652:L248V	L	+	1	2	SLC22A4	131685865	0.977000	0.34250	0.976000	0.42696	0.997000	0.91878	2.482000	0.45224	1.566000	0.49654	0.655000	0.94253	CTG	SLC22A4	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	ENSG00000197208		0.502	SLC22A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A4	HGNC	protein_coding	OTTHUMT00000132661.1	540	0.37	2	C	NM_003059		131657966	131657966	+1	no_errors	ENST00000200652	ensembl	human	known	69_37n	missense	339	20.98	90	SNP	1.000	G
SLC35A1	10559	genome.wustl.edu	37	6	88221166	88221166	+	Silent	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:88221166C>G	ENST00000369552.4	+	8	963	c.936C>G	c.(934-936)ctC>ctG	p.L312L	SLC35A1_ENST00000369557.5_3'UTR|C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000369556.3_Silent_p.L253L|SLC35A1_ENST00000544441.1_Silent_p.L178L|SLC35A1_ENST00000464978.1_3'UTR	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1	312					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CCATATATCTCTATGGATTAC	0.393																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	dbGAP											0													116.0	105.0	109.0					6																	88221166		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.936C>G	6.37:g.88221166C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W1L8	Silent	SNP	pfam_Nuc_sug_transpt,pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	p.L312	ENST00000369552.4	37	c.936	CCDS5010.1	6																																																																																			SLC35A1	-	pfam_UAA,pirsf_UDP/CMP-sugar_transptr,tigrfam_UDPgal_transpt	ENSG00000164414		0.393	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A1	HGNC	protein_coding	OTTHUMT00000041446.1	297	0.00	0	C			88221166	88221166	+1	no_errors	ENST00000369552	ensembl	human	known	69_37n	silent	142	24.06	45	SNP	0.916	G
SPTA1	6708	genome.wustl.edu	37	1	158648273	158648273	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:158648273C>T	ENST00000368147.4	-	6	910	c.730G>A	c.(730-732)Gct>Act	p.A244T		NM_003126.2	NP_003117.2	P02549	SPTA1_HUMAN	spectrin, alpha, erythrocytic 1	244					actin filament capping (GO:0051693)|actin filament organization (GO:0007015)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|lymphocyte homeostasis (GO:0002260)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of protein binding (GO:0032092)|positive regulation of T cell proliferation (GO:0042102)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|cuticular plate (GO:0032437)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(3)|breast(7)|cervix(1)|endometrium(22)|kidney(9)|large_intestine(29)|liver(2)|lung(183)|ovary(5)|prostate(18)|skin(11)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(6)	307	all_hematologic(112;0.0378)					TCCCAGGCAGCATTCACCTCA	0.443																																						dbGAP											0													85.0	80.0	82.0					1																	158648273		1883	4110	5993	-	-	-	SO:0001583	missense	0			M61877	CCDS41423.1	1q21	2014-06-23	2014-06-23		ENSG00000163554	ENSG00000163554		"""EF-hand domain containing"""	11272	protein-coding gene	gene with protein product	"""elliptocytosis 2"""	182860	"""spectrin, alpha, erythrocytic 1 (elliptocytosis 2)"""				Standard	NM_003126		Approved	EL2	uc001fst.1	P02549	OTTHUMG00000019636	ENST00000368147.4:c.730G>A	1.37:g.158648273C>T	ENSP00000357129:p.Ala244Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15514|Q5VYL1|Q5VYL2|Q6LDY5	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3	p.A244T	ENST00000368147.4	37	c.730	CCDS41423.1	1	.	.	.	.	.	.	.	.	.	.	C	6.442	0.449762	0.12223	.	.	ENSG00000163554	ENST00000368148;ENST00000368147	T;T	0.34667	1.35;1.35	4.66	-4.18	0.03846	.	0.854588	0.09527	N	0.790116	T	0.07638	0.0192	N	0.13098	0.295	0.09310	N	1	B	0.09022	0.002	B	0.15484	0.013	T	0.36212	-0.9757	10	0.33940	T	0.23	.	12.551	0.56225	0.0:0.4361:0.0:0.5639	.	244	P02549	SPTA1_HUMAN	T	244	ENSP00000357130:A244T;ENSP00000357129:A244T	ENSP00000357129:A244T	A	-	1	0	SPTA1	156914897	0.043000	0.20138	0.000000	0.03702	0.354000	0.29330	-0.023000	0.12456	-0.754000	0.04715	-0.142000	0.14014	GCT	SPTA1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000163554		0.443	SPTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTA1	HGNC	protein_coding	OTTHUMT00000051851.3	223	0.89	2	C	NM_003126		158648273	158648273	-1	no_errors	ENST00000368148	ensembl	human	known	69_37n	missense	230	28.26	91	SNP	0.000	T
SRPR	6734	genome.wustl.edu	37	11	126136424	126136424	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr11:126136424T>C	ENST00000332118.6	-	6	941	c.787A>G	c.(787-789)Act>Gct	p.T263A	SRPR_ENST00000532259.1_Missense_Mutation_p.T235A|FOXRED1_ENST00000442061.2_5'Flank|FOXRED1_ENST00000532125.1_5'Flank|SRPR_ENST00000530680.1_5'Flank|FOXRED1_ENST00000263578.5_5'Flank	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	263					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		GTGGTGGGAGTACTGTAATCC	0.502																																						dbGAP											0													116.0	115.0	115.0					11																	126136424		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.787A>G	11.37:g.126136424T>C	ENSP00000328023:p.Thr263Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	pfam_Sig_recog_particle_rcpt_asu_N,pfam_Signal_recog_part_SRP54_GTPase,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_Signal_recog_part_SRP54_GTPase	p.T263A	ENST00000332118.6	37	c.787	CCDS31717.1	11	.	.	.	.	.	.	.	.	.	.	T	3.221	-0.159484	0.06544	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	5.65	-6.79	0.01715	Signal recognition particle receptor, alpha subunit, N-terminal (1);	0.580439	0.19606	N	0.110274	T	0.11239	0.0274	N	0.04959	-0.14	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.34551	-0.9824	9	0.08837	T	0.75	-0.7224	8.8857	0.35402	0.0:0.3878:0.1932:0.419	.	235;263	E9PJS4;P08240	.;SRPR_HUMAN	A	263;235	.	ENSP00000328023:T263A	T	-	1	0	SRPR	125641634	0.000000	0.05858	0.011000	0.14972	0.821000	0.46438	-0.817000	0.04472	-1.016000	0.03371	0.533000	0.62120	ACT	SRPR	-	pfam_Sig_recog_particle_rcpt_asu_N	ENSG00000182934		0.502	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	HGNC	protein_coding	OTTHUMT00000386425.2	243	0.00	0	T	NM_003139		126136424	126136424	-1	no_errors	ENST00000332118	ensembl	human	known	69_37n	missense	206	12.10	30	SNP	0.001	C
SRSF2	6427	genome.wustl.edu	37	17	74732502	74732502	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr17:74732502G>C	ENST00000392485.2	-	2	579	c.407C>G	c.(406-408)tCc>tGc	p.S136C	MFSD11_ENST00000593181.1_5'Flank|SRSF2_ENST00000508921.3_Missense_Mutation_p.S124C|MFSD11_ENST00000355954.3_5'Flank|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000586622.1_5'UTR|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000336509.4_5'Flank|MFSD11_ENST00000591864.1_5'Flank|SRSF2_ENST00000359995.5_Missense_Mutation_p.S136C|MFSD11_ENST00000590514.1_5'Flank|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000588460.1_5'UTR	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	136	Arg/Ser-rich (RS domain).				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						GCGAGACCTGGAACGACTCCG	0.682			Mis		"""MDS, CLL"""																																	dbGAP		Dom	yes		17	17q25	6427	serine/arginine-rich splicing factor 2		L	0													50.0	44.0	46.0					17																	74732502		2203	4300	6503	-	-	-	SO:0001583	missense	0			M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.407C>G	17.37:g.74732502G>C	ENSP00000376276:p.Ser136Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWD5|B4DN89|H0YG49	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.S136C	ENST00000392485.2	37	c.407	CCDS11749.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.24|15.24	2.774189|2.774189	0.49786|0.49786	.|.	.|.	ENSG00000161547|ENSG00000161547	ENST00000452355|ENST00000392485;ENST00000508921;ENST00000358156;ENST00000359995	.|T;T	.|0.45668	.|1.79;0.89	4.81|4.81	3.82|3.82	0.43975|0.43975	.|.	.|0.350509	.|0.26220	.|N	.|0.025634	T|T	0.65144|0.65144	0.2663|0.2663	M|M	0.80982|0.80982	2.52|2.52	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.77557	.|0.99;0.99	T|T	0.67937|0.67937	-0.5541|-0.5541	6|10	0.35671|0.44086	T|T	0.21|0.13	.|.	14.9214|14.9214	0.70841|0.70841	0.0:0.1442:0.8558:0.0|0.0:0.1442:0.8558:0.0	.|.	.|124;136	.|B4DN89;Q01130	.|.;SRSF2_HUMAN	A|C	86|136;163;124;116	.|ENSP00000376276:S136C;ENSP00000441780:S163C	ENSP00000391278:P86A|ENSP00000350877:S124C	P|S	-|-	1|2	0|0	SRSF2|SRSF2	72244097|72244097	1.000000|1.000000	0.71417|0.71417	0.007000|0.007000	0.13788|0.13788	0.775000|0.775000	0.43874|0.43874	9.432000|9.432000	0.97498|0.97498	0.977000|0.977000	0.38444|0.38444	0.563000|0.563000	0.77884|0.77884	CCA|TCC	SRSF2	-	NULL	ENSG00000161547		0.682	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SRSF2	HGNC	protein_coding	OTTHUMT00000437489.1	50	0.00	0	G	NM_003016		74732502	74732502	-1	no_errors	ENST00000359995	ensembl	human	known	69_37n	missense	21	25.00	7	SNP	0.997	C
SYT14	255928	genome.wustl.edu	37	1	210334230	210334230	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:210334230C>G	ENST00000472886.1	+	8	1525	c.1511C>G	c.(1510-1512)tCt>tGt	p.S504C	SYT14_ENST00000422431.1_Missense_Mutation_p.S568C|SYT14_ENST00000271745.7_3'UTR|SYT14_ENST00000399639.2_3'UTR|SYT14_ENST00000537238.1_Missense_Mutation_p.S466C|SYT14_ENST00000367019.1_Missense_Mutation_p.S523C|SYT14_ENST00000367015.1_Missense_Mutation_p.S466C|SYT14_ENST00000534859.1_Missense_Mutation_p.S530C			Q8NB59	SYT14_HUMAN	synaptotagmin XIV	504	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				cell death (GO:0008219)	integral component of membrane (GO:0016021)	phospholipid binding (GO:0005543)			endometrium(4)|large_intestine(11)|lung(17)|ovary(1)|prostate(1)|skin(3)	37				OV - Ovarian serous cystadenocarcinoma(81;0.085)		CTCATACTGTCTGTGTATAAC	0.418																																						dbGAP											0													148.0	146.0	147.0					1																	210334230		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK091517	CCDS31014.1, CCDS53470.1, CCDS58058.1	1q32.2	2013-01-21			ENSG00000143469	ENSG00000143469		"""Synaptotagmins"""	23143	protein-coding gene	gene with protein product		610949					Standard	NM_001256006		Approved	sytXIV, FLJ34198	uc001hhs.5	Q8NB59	OTTHUMG00000036652	ENST00000472886.1:c.1511C>G	1.37:g.210334230C>G	ENSP00000418901:p.Ser504Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJU0|B1AJU1|F5H426|Q5THX7|Q707N3|Q707N4|Q707N5|Q707N6|Q707N7	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.S568C	ENST00000472886.1	37	c.1703	CCDS31014.1	1	.	.	.	.	.	.	.	.	.	.	C	18.33	3.601171	0.66332	.	.	ENSG00000143469	ENST00000422431;ENST00000534859;ENST00000537238;ENST00000367019;ENST00000472886;ENST00000367015	T;T;T;T;T;T	0.70282	-0.47;-0.47;-0.47;-0.47;-0.47;-0.47	5.54	5.54	0.83059	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.87861	0.6284	M	0.89534	3.04	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.85130	0.997;0.996;0.98;0.996	D	0.89586	0.3824	10	0.87932	D	0	-6.187	19.8284	0.96626	0.0:1.0:0.0:0.0	.	551;504;523;568	A1L3Y1;Q8NB59;Q8NB59-6;F5H426	.;SYT14_HUMAN;.;.	C	568;530;466;523;504;466	ENSP00000389039:S568C;ENSP00000442891:S530C;ENSP00000437423:S466C;ENSP00000355986:S523C;ENSP00000418901:S504C;ENSP00000355982:S466C	ENSP00000355982:S466C	S	+	2	0	SYT14	208400853	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.382000	0.79729	2.751000	0.94390	0.585000	0.79938	TCT	SYT14	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000143469		0.418	SYT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT14	HGNC	protein_coding	OTTHUMT00000089124.1	358	0.00	0	C	NM_153262		210334230	210334230	+1	no_errors	ENST00000422431	ensembl	human	known	69_37n	missense	513	12.01	70	SNP	1.000	G
TACC2	10579	genome.wustl.edu	37	10	123842793	123842793	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr10:123842793A>G	ENST00000369005.1	+	4	1118	c.778A>G	c.(778-780)Aca>Gca	p.T260A	TACC2_ENST00000515603.1_Missense_Mutation_p.T260A|TACC2_ENST00000453444.2_Missense_Mutation_p.T260A|TACC2_ENST00000358010.1_Intron|TACC2_ENST00000334433.3_Missense_Mutation_p.T260A|TACC2_ENST00000513429.1_Intron|TACC2_ENST00000515273.1_Missense_Mutation_p.T260A	NM_206862.2	NP_996744.2	O95359	TACC2_HUMAN	transforming, acidic coiled-coil containing protein 2	260					astral microtubule organization (GO:0030953)|cerebral cortex development (GO:0021987)|interkinetic nuclear migration (GO:0022027)|neurogenesis (GO:0022008)|regulation of microtubule-based process (GO:0032886)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	nuclear hormone receptor binding (GO:0035257)			NS(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(15)|lung(27)|ovary(6)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	83		all_neural(114;0.0656)|Lung NSC(174;0.136)|all_lung(145;0.17)|Breast(234;0.197)				CCAGCAGGGCACAGAAAGCTC	0.617																																						dbGAP											0													44.0	51.0	49.0					10																	123842793		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF095791	CCDS7625.1, CCDS7626.1, CCDS7627.1, CCDS7628.1	10q26	2008-07-29			ENSG00000138162	ENSG00000138162			11523	protein-coding gene	gene with protein product		605302				14767476	Standard	XM_005269388		Approved	AZU-1	uc001lfv.3	O95359	OTTHUMG00000019181	ENST00000369005.1:c.778A>G	10.37:g.123842793A>G	ENSP00000358001:p.Thr260Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXL0|Q4VXL3|Q4VXL6|Q4VXL7|Q5U5T7|Q86WG6|Q86WG7|Q8TCK9|Q9BVQ1|Q9NZ41|Q9NZR5	Missense_Mutation	SNP	pfam_TACC	p.T260A	ENST00000369005.1	37	c.778	CCDS7626.1	10	.	.	.	.	.	.	.	.	.	.	A	12.44	1.937428	0.34189	.	.	ENSG00000138162	ENST00000369005;ENST00000515273;ENST00000515603;ENST00000334433;ENST00000453444;ENST00000340076	T;T;T;T;T	0.02812	4.16;4.15;4.15;4.16;4.15	5.77	-6.88	0.01665	.	1.430160	0.04844	N	0.441066	T	0.01940	0.0061	N	0.14661	0.345	0.09310	N	1	B;B;B	0.16396	0.017;0.017;0.017	B;B;B	0.11329	0.006;0.006;0.006	T	0.49331	-0.8951	10	0.46703	T	0.11	-1.4851	8.0779	0.30726	0.3159:0.4207:0.2634:0.0	.	260;260;260	E9PBC6;E7EMZ9;O95359	.;.;TACC2_HUMAN	A	260;260;260;260;260;250	ENSP00000358001:T260A;ENSP00000424467:T260A;ENSP00000427618:T260A;ENSP00000334280:T260A;ENSP00000395048:T260A	ENSP00000334280:T260A	T	+	1	0	TACC2	123832783	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.970000	0.03810	-0.787000	0.04510	0.454000	0.30748	ACA	TACC2	-	NULL	ENSG00000138162		0.617	TACC2-001	KNOWN	basic|CCDS	protein_coding	TACC2	HGNC	protein_coding	OTTHUMT00000090004.1	75	0.00	0	A			123842793	123842793	+1	no_errors	ENST00000334433	ensembl	human	known	69_37n	missense	42	37.31	25	SNP	0.000	G
TEX15	56154	genome.wustl.edu	37	8	30695443	30695443	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr8:30695443T>C	ENST00000256246.2	-	3	7282	c.7208A>G	c.(7207-7209)aAc>aGc	p.N2403S		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2403					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GTCTTTTGGGTTCTCTAAGGG	0.373																																						dbGAP											0													224.0	223.0	223.0					8																	30695443		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.7208A>G	8.37:g.30695443T>C	ENSP00000256246:p.Asn2403Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.N2403S	ENST00000256246.2	37	c.7208	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481027	0.26598	.	.	ENSG00000133863	ENST00000256246	T	0.09350	2.99	4.41	-0.853	0.10709	.	0.674836	0.12961	N	0.424961	T	0.07279	0.0184	L	0.35414	1.06	0.09310	N	1	B	0.14012	0.009	B	0.15484	0.013	T	0.31806	-0.9930	10	0.87932	D	0	.	4.0562	0.09818	0.0:0.3303:0.1866:0.4831	.	2403	Q9BXT5	TEX15_HUMAN	S	2403	ENSP00000256246:N2403S	ENSP00000256246:N2403S	N	-	2	0	TEX15	30814985	0.000000	0.05858	0.000000	0.03702	0.455000	0.32408	-0.130000	0.10498	-0.225000	0.09913	0.379000	0.24179	AAC	TEX15	-	NULL	ENSG00000133863		0.373	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	516	0.19	1	T			30695443	30695443	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	missense	441	19.34	106	SNP	0.000	C
TRMT2B	79979	genome.wustl.edu	37	X	100274321	100274321	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chrX:100274321C>A	ENST00000372936.3	-	12	2012	c.1240G>T	c.(1240-1242)Gat>Tat	p.D414Y	TRMT2B_ENST00000338687.7_Missense_Mutation_p.D369Y|TRMT2B_ENST00000372939.1_Missense_Mutation_p.D369Y|TRMT2B_ENST00000372931.5_Missense_Mutation_p.D414Y|TRMT2B_ENST00000545398.1_Missense_Mutation_p.D414Y|TRMT2B_ENST00000372935.1_Missense_Mutation_p.D414Y	NM_024917.5	NP_079193.2	Q96GJ1	TRM2_HUMAN	tRNA methyltransferase 2 homolog B (S. cerevisiae)	414						mitochondrion (GO:0005739)	S-adenosylmethionine-dependent tRNA (m5U54) methyltransferase activity (GO:0030697)			breast(3)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	24						GACTGTCCATCTTCCTTTGAC	0.473																																						dbGAP											0													147.0	110.0	123.0					X																	100274321		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020116	CCDS14477.1, CCDS55464.1	Xq22.1	2012-06-12	2012-06-12	2008-09-17	ENSG00000188917	ENSG00000188917			25748	protein-coding gene	gene with protein product			"""chromosome X open reading frame 34"""	CXorf34		14702039	Standard	NM_024917		Approved	FLJ12687	uc004egq.3	Q96GJ1	OTTHUMG00000022017	ENST00000372936.3:c.1240G>T	X.37:g.100274321C>A	ENSP00000362027:p.Asp414Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDG5|A6NEI9|A6NMG6|Q5JPF0|Q5JVY6|Q96HU7|Q96IH9|Q9H9K2	Missense_Mutation	SNP	pfam_U5_MeTrfase,pfam_Small_mtfrase_dom	p.D414Y	ENST00000372936.3	37	c.1240	CCDS14477.1	X	.	.	.	.	.	.	.	.	.	.	C	11.60	1.686916	0.29962	.	.	ENSG00000188917	ENST00000338687;ENST00000545398;ENST00000372939;ENST00000372935;ENST00000372936;ENST00000372931	T;T;T;T;T;T	0.66638	-0.22;-0.22;-0.22;-0.22;-0.22;-0.22	5.17	0.375	0.16188	.	1.398120	0.04329	N	0.351984	T	0.67804	0.2932	M	0.62088	1.915	0.23421	N	0.997719	P;P;P	0.38617	0.492;0.473;0.64	B;B;B	0.42738	0.157;0.308;0.396	T	0.52830	-0.8523	10	0.33940	T	0.23	-14.5857	8.7811	0.34792	0.0:0.4684:0.0:0.5316	.	369;414;414	Q96GJ1-3;F2Z384;Q96GJ1	.;.;TRM2_HUMAN	Y	369;414;369;414;414;414	ENSP00000340970:D369Y;ENSP00000438134:D414Y;ENSP00000362030:D369Y;ENSP00000362026:D414Y;ENSP00000362027:D414Y;ENSP00000362022:D414Y	ENSP00000340970:D369Y	D	-	1	0	TRMT2B	100160977	0.772000	0.28567	0.180000	0.23079	0.388000	0.30384	0.786000	0.26844	-0.306000	0.08818	0.600000	0.82982	GAT	TRMT2B	-	pfam_U5_MeTrfase	ENSG00000188917		0.473	TRMT2B-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	TRMT2B	HGNC	protein_coding	OTTHUMT00000057512.1	407	0.00	0	C	NM_024917		100274321	100274321	-1	no_errors	ENST00000372935	ensembl	human	known	69_37n	missense	283	23.72	88	SNP	0.342	A
UNC79	57578	genome.wustl.edu	37	14	93943917	93943917	+	Silent	SNP	G	G	A	rs139388481		TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr14:93943917G>A	ENST00000393151.2	+	4	462	c.462G>A	c.(460-462)tcG>tcA	p.S154S	UNC79_ENST00000256339.4_5'UTR|UNC79_ENST00000555664.1_Silent_p.S154S|UNC79_ENST00000553484.1_Silent_p.S154S			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	154					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TTGGACAGTCGATATTTTATA	0.328																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.462G>A	14.37:g.93943917G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDL6|Q6ZUT7	Silent	SNP	superfamily_ARM-type_fold	p.S154	ENST00000393151.2	37	c.462		14																																																																																			UNC79	-	NULL	ENSG00000133958		0.328	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	287	0.00	0	G	XM_028395		93943917	93943917	+1	no_errors	ENST00000553484	ensembl	human	known	69_37n	silent	285	17.39	60	SNP	0.984	A
USP46	64854	genome.wustl.edu	37	4	53492238	53492238	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr4:53492238C>T	ENST00000441222.3	-	4	692	c.508G>A	c.(508-510)Gag>Aag	p.E170K	USP46_ENST00000451218.2_Missense_Mutation_p.E143K|USP46_ENST00000508499.1_Missense_Mutation_p.E163K	NM_022832.3	NP_073743.2	P62068	UBP46_HUMAN	ubiquitin specific peptidase 46	170	USP.				adult feeding behavior (GO:0008343)|behavioral fear response (GO:0001662)|behavioral response to ethanol (GO:0048149)|protein deubiquitination (GO:0016579)|regulation of synaptic transmission, GABAergic (GO:0032228)|righting reflex (GO:0060013)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(2)	12			LUSC - Lung squamous cell carcinoma(32;0.0295)			TGAAAAATCTCATGGACCCAG	0.393																																						dbGAP											0													132.0	124.0	126.0					4																	53492238		1864	4131	5995	-	-	-	SO:0001583	missense	0			AK022614	CCDS47053.1, CCDS47054.1	4q12	2008-02-05	2005-08-08		ENSG00000109189	ENSG00000109189		"""Ubiquitin-specific peptidases"""	20075	protein-coding gene	gene with protein product		612849	"""ubiquitin specific protease 46"""			12838346	Standard	NM_022832		Approved	FLJ12552	uc003gzn.3	P62068	OTTHUMG00000160640	ENST00000441222.3:c.508G>A	4.37:g.53492238C>T	ENSP00000407818:p.Glu170Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3Y7|B7Z675|B7Z7S3|G8ACC7|Q80V95|Q9H7U4|Q9H9T8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E170K	ENST00000441222.3	37	c.508	CCDS47053.1	4	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191840	0.78902	.	.	ENSG00000109189	ENST00000441222;ENST00000451218;ENST00000508499	T;T;T	0.28895	1.59;1.59;1.59	5.08	5.08	0.68730	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.189634	0.36815	N	0.002396	T	0.32585	0.0834	N	0.11698	0.16	0.80722	D	1	B;B;D;P	0.54397	0.004;0.021;0.966;0.855	B;B;P;P	0.59643	0.019;0.026;0.861;0.69	T	0.08411	-1.0723	10	0.15952	T	0.53	-22.1738	17.8419	0.88717	0.0:1.0:0.0:0.0	.	54;158;170;163	P62068-2;P62068-4;P62068;P62068-3	.;.;UBP46_HUMAN;.	K	170;143;163	ENSP00000407818:E170K;ENSP00000390102:E143K;ENSP00000423244:E163K	ENSP00000407818:E170K	E	-	1	0	USP46	53186995	1.000000	0.71417	1.000000	0.80357	0.630000	0.37929	7.776000	0.85560	2.528000	0.85240	0.650000	0.86243	GAG	USP46	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000109189		0.393	USP46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP46	HGNC	protein_coding	OTTHUMT00000361516.2	654	0.00	0	C	NM_022832		53492238	53492238	-1	no_errors	ENST00000441222	ensembl	human	known	69_37n	missense	407	21.08	109	SNP	1.000	T
WDR43	23160	genome.wustl.edu	37	2	29135533	29135533	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr2:29135533G>A	ENST00000407426.3	+	4	619	c.563G>A	c.(562-564)cGa>cAa	p.R188Q	SNORD92_ENST00000585078.1_RNA	NM_015131.1	NP_055946.1	Q15061	WDR43_HUMAN	WD repeat domain 43	188						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	20	Acute lymphoblastic leukemia(172;0.155)					TCAGCTGGTCGAACAATCAAA	0.378																																						dbGAP											0													118.0	112.0	114.0					2																	29135533		1849	4096	5945	-	-	-	SO:0001583	missense	0			D87716	CCDS46251.1	2p23.3	2013-01-09			ENSG00000163811	ENSG00000163811		"""WD repeat domain containing"""	28945	protein-coding gene	gene with protein product	"""UTP5, small subunit (SSU) processome component, homolog (yeast)"""					7584026, 7584028, 17699751	Standard	NM_015131		Approved	KIAA0007, NET12, UTP5	uc002rmo.2	Q15061	OTTHUMG00000152015	ENST00000407426.3:c.563G>A	2.37:g.29135533G>A	ENSP00000384302:p.Arg188Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15395|Q92577	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R188Q	ENST00000407426.3	37	c.563	CCDS46251.1	2	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784285	0.90282	.	.	ENSG00000163811	ENST00000407426;ENST00000440983;ENST00000296126	T;T;T	0.70869	-0.01;-0.01;-0.52	5.81	5.81	0.92471	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.256459	0.37348	N	0.002124	T	0.72914	0.3520	L	0.43923	1.385	0.43559	D	0.995872	D	0.60160	0.987	P	0.49597	0.616	T	0.71784	-0.4488	10	0.41790	T	0.15	-7.3855	20.0896	0.97814	0.0:0.0:1.0:0.0	.	188	Q15061	WDR43_HUMAN	Q	188;99;7	ENSP00000384302:R188Q;ENSP00000415355:R99Q;ENSP00000296126:R7Q	ENSP00000296126:R7Q	R	+	2	0	WDR43	28989037	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	5.796000	0.69080	2.741000	0.93983	0.650000	0.86243	CGA	WDR43	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000163811		0.378	WDR43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR43	HGNC	protein_coding	OTTHUMT00000324865.1	334	0.00	0	G	XM_087089		29135533	29135533	+1	no_errors	ENST00000407426	ensembl	human	known	69_37n	missense	309	18.59	71	SNP	1.000	A
ZFP64	55734	genome.wustl.edu	37	20	50701660	50701660	+	Silent	SNP	T	T	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr20:50701660T>C	ENST00000361387.2	-	9	1434	c.1374A>G	c.(1372-1374)aaA>aaG	p.K458K	ZFP64_ENST00000371518.2_Intron|ZFP64_ENST00000371523.4_Silent_p.K239K	NM_199427.2	NP_955459.2	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	441					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GGATGTGCGATTTGAGATTCG	0.597																																						dbGAP											0													76.0	72.0	73.0					20																	50701660		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000361387.2:c.1374A>G	20.37:g.50701660T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTS7|Q9NVH4	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K458	ENST00000361387.2	37	c.1374	CCDS13439.1	20																																																																																			ZFP64	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000020256		0.597	ZFP64-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079743.2	85	0.00	0	T	NM_018197		50701660	50701660	-1	no_errors	ENST00000361387	ensembl	human	known	69_37n	silent	81	22.12	23	SNP	1.000	C
ZNF608	57507	genome.wustl.edu	37	5	123976948	123976948	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr5:123976948G>C	ENST00000306315.5	-	7	4882	c.4447C>G	c.(4447-4449)Caa>Gaa	p.Q1483E	ZNF608_ENST00000504926.1_Missense_Mutation_p.Q1056E|ZNF608_ENST00000513985.1_5'UTR	NM_020747.2	NP_065798.2	Q9ULD9	ZN608_HUMAN	zinc finger protein 608	1483							metal ion binding (GO:0046872)			breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(12)|ovary(3)|skin(6)|urinary_tract(1)	46		all_cancers(142;0.186)|Prostate(80;0.081)	KIRC - Kidney renal clear cell carcinoma(527;0.159)|Kidney(363;0.221)	OV - Ovarian serous cystadenocarcinoma(64;0.00126)|Epithelial(69;0.00238)|all cancers(49;0.00783)		TGCTGACCTTGAAAAGGGTCA	0.488																																						dbGAP											0													212.0	214.0	213.0					5																	123976948		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033107	CCDS34219.1	5q23.2	2008-05-02			ENSG00000168916	ENSG00000168916		"""Zinc fingers, C2H2-type"""	29238	protein-coding gene	gene with protein product						10574462, 10508479	Standard	NM_020747		Approved	KIAA1281, DKFZp434M098, NY-REN-36	uc003ktq.1	Q9ULD9	OTTHUMG00000162999	ENST00000306315.5:c.4447C>G	5.37:g.123976948G>C	ENSP00000307746:p.Gln1483Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2W9|Q3SYM6|Q68D12|Q8IY05|Q9Y5A1	Missense_Mutation	SNP	NULL	p.Q1483E	ENST00000306315.5	37	c.4447	CCDS34219.1	5	.	.	.	.	.	.	.	.	.	.	G	9.773	1.173277	0.21704	.	.	ENSG00000168916	ENST00000504926;ENST00000306315	T;T	0.45276	0.9;0.91	5.4	5.4	0.78164	.	0.200076	0.44688	D	0.000439	T	0.53045	0.1772	L	0.56769	1.78	0.80722	D	1	P	0.51933	0.949	P	0.50659	0.647	T	0.50676	-0.8800	10	0.44086	T	0.13	.	19.5297	0.95223	0.0:0.0:1.0:0.0	.	1483	Q9ULD9	ZN608_HUMAN	E	1056;1483	ENSP00000427657:Q1056E;ENSP00000307746:Q1483E	ENSP00000307746:Q1483E	Q	-	1	0	ZNF608	124004847	1.000000	0.71417	1.000000	0.80357	0.207000	0.24258	6.751000	0.74893	2.695000	0.91970	0.643000	0.83706	CAA	ZNF608	-	NULL	ENSG00000168916		0.488	ZNF608-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF608	HGNC	protein_coding	OTTHUMT00000371300.1	193	0.00	0	G	XM_114432		123976948	123976948	-1	no_errors	ENST00000306315	ensembl	human	known	69_37n	missense	110	20.14	28	SNP	1.000	C
ZNF695	57116	genome.wustl.edu	37	1	247150728	247150728	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr1:247150728C>G	ENST00000339986.7	-	4	1236	c.1089G>C	c.(1087-1089)caG>caC	p.Q363H	ZNF695_ENST00000498046.2_Intron|ZNF695_ENST00000487338.2_Intron	NM_020394.4	NP_065127	Q8IW36	ZN695_HUMAN	zinc finger protein 695	363					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			endometrium(1)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	13	all_cancers(71;4.01e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			GATGTGAGCTCTGGTTAAAGG	0.383																																						dbGAP											0													49.0	52.0	51.0					1																	247150728		2141	4265	6406	-	-	-	SO:0001583	missense	0				CCDS44344.1, CCDS55694.1	1q44	2013-01-08			ENSG00000197472	ENSG00000197472		"""Zinc fingers, C2H2-type"", ""-"""	30954	protein-coding gene	gene with protein product						12477932	Standard	NM_020394		Approved	SBZF3	uc009xgu.3	Q8IW36	OTTHUMG00000040707	ENST00000339986.7:c.1089G>C	1.37:g.247150728C>G	ENSP00000341236:p.Gln363His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T0N9|Q5T0P1|Q5T0P3|Q7Z2W8|Q7Z648	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q363H	ENST00000339986.7	37	c.1089	CCDS44344.1	1	.	.	.	.	.	.	.	.	.	.	C	5.490	0.275381	0.10403	.	.	ENSG00000197472	ENST00000339986	T	0.07327	3.2	0.642	-0.92	0.10475	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05777	0.0151	N	0.11064	0.09	0.09310	N	1	D	0.65815	0.995	P	0.53006	0.715	T	0.26815	-1.0092	9	0.27785	T	0.31	.	2.3245	0.04219	0.0:0.3949:0.3341:0.271	.	363	Q8IW36	ZN695_HUMAN	H	363	ENSP00000341236:Q363H	ENSP00000341236:Q363H	Q	-	3	2	ZNF695	245217351	0.000000	0.05858	0.021000	0.16686	0.855000	0.48748	-0.048000	0.11944	-0.321000	0.08627	0.205000	0.17691	CAG	ZNF695	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197472		0.383	ZNF695-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF695	HGNC	protein_coding	OTTHUMT00000097823.5	218	0.00	0	C	NM_020394		247150728	247150728	-1	no_errors	ENST00000339986	ensembl	human	known	69_37n	missense	174	15.87	33	SNP	0.002	G
ZSCAN16	80345	genome.wustl.edu	37	6	28097614	28097614	+	Silent	SNP	G	G	A			TCGA-BH-A1EV-01A-11D-A135-09	TCGA-BH-A1EV-11A-24D-A135-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	43fbe2a9-078a-4be2-b67c-b855329091f0	5a28c2e5-4aec-49d5-beaa-3546005f5ba5	g.chr6:28097614G>A	ENST00000340487.4	+	4	1082	c.933G>A	c.(931-933)caG>caA	p.Q311Q	ZSCAN16-AS1_ENST00000602810.1_RNA|ZSCAN16-AS1_ENST00000600652.1_RNA	NM_025231.1	NP_079507.1	Q9H4T2	ZSC16_HUMAN	zinc finger and SCAN domain containing 16	311					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(5)|liver(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	10						TTCAGCATCAGAGAATCCACA	0.418																																						dbGAP											0													63.0	61.0	62.0					6																	28097614		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025844	CCDS4644.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000196812	ENSG00000196812		"""-"", ""Zinc fingers, C2H2-type"""	20813	protein-coding gene	gene with protein product			"""zinc finger protein 392"", ""zinc finger protein 435"""	ZNF392, ZNF435			Standard	NM_025231		Approved	FLJ22191, dJ265C24.3	uc003nkm.3	Q9H4T2	OTTHUMG00000014509	ENST00000340487.4:c.933G>A	6.37:g.28097614G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H6K2	Silent	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.Q311	ENST00000340487.4	37	c.933	CCDS4644.1	6																																																																																			ZSCAN16	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196812		0.418	ZSCAN16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN16	HGNC	protein_coding	OTTHUMT00000040177.1	234	0.85	2	G	NM_025231		28097614	28097614	+1	no_errors	ENST00000340487	ensembl	human	known	69_37n	silent	103	37.58	62	SNP	0.997	A
