#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA4	24	genome.wustl.edu	37	1	94520718	94520718	+	Missense_Mutation	SNP	C	C	A	rs61754027		TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr1:94520718C>A	ENST00000370225.3	-	16	2622	c.2536G>T	c.(2536-2538)Gat>Tat	p.D846Y	ABCA4_ENST00000535735.1_Missense_Mutation_p.D772Y	NM_000350.2	NP_000341.2	P78363	ABCA4_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 4	846			D -> H. {ECO:0000269|PubMed:9054934}.		phospholipid transfer to membrane (GO:0006649)|photoreceptor cell maintenance (GO:0045494)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|phospholipid-translocating ATPase activity (GO:0004012)|transporter activity (GO:0005215)			NS(2)|breast(6)|central_nervous_system(5)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(10)|large_intestine(25)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(10)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	147		all_lung(203;0.000757)|Lung NSC(277;0.00335)		all cancers(265;0.00432)|GBM - Glioblastoma multiforme(16;0.00715)|Epithelial(280;0.171)		ACAGCAGCATCAAGGAGCATC	0.517																																						dbGAP											0			GRCh37	CM990032	ABCA4	M	rs61754027						186.0	137.0	154.0					1																	94520718		2203	4300	6503	-	-	-	SO:0001583	missense	0			U88667	CCDS747.1	1p22	2013-01-23			ENSG00000198691	ENSG00000198691		"""ATP binding cassette transporters / subfamily A"""	34	protein-coding gene	gene with protein product	"""Stargardt disease"""	601691	"""ATP-binding cassette transporter, retinal-specific"""	STGD1, ABCR, RP19, STGD		9490294	Standard	NM_000350		Approved	FFM, ARMD2, CORD3	uc001dqh.3	P78363	OTTHUMG00000010622	ENST00000370225.3:c.2536G>T	1.37:g.94520718C>A	ENSP00000359245:p.Asp846Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O15112|O60438|O60915|Q0QD48|Q4LE31	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_Rim_ABC_transpt	p.D846Y	ENST00000370225.3	37	c.2536	CCDS747.1	1	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238128	0.79800	.	.	ENSG00000198691	ENST00000370225;ENST00000535735	D;D	0.87809	-2.3;-2.3	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.95513	0.8542	H	0.95114	3.625	0.58432	D	0.999997	D;D	0.89917	1.0;0.986	D;D	0.91635	0.999;0.938	D	0.96535	0.9396	10	0.87932	D	0	.	18.7922	0.91978	0.0:1.0:0.0:0.0	.	772;846	F5H6E5;P78363	.;ABCA4_HUMAN	Y	846;772	ENSP00000359245:D846Y;ENSP00000437682:D772Y	ENSP00000359245:D846Y	D	-	1	0	ABCA4	94293306	1.000000	0.71417	0.951000	0.38953	0.614000	0.37383	7.818000	0.86416	2.557000	0.86248	0.555000	0.69702	GAT	ABCA4	-	tigrfam_Rim_ABC_transpt	ENSG00000198691		0.517	ABCA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA4	HGNC	protein_coding	OTTHUMT00000029320.1	76	0.00	0	C	NM_000350		94520718	94520718	-1	no_errors	ENST00000370225	ensembl	human	known	69_37n	missense	45	30.77	20	SNP	1.000	A
ACBD4	79777	genome.wustl.edu	37	17	43213950	43213950	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr17:43213950C>T	ENST00000376955.4	+	3	469	c.172C>T	c.(172-174)Cgg>Tgg	p.R58W	ACBD4_ENST00000591859.1_Missense_Mutation_p.R58W|ACBD4_ENST00000592162.1_Missense_Mutation_p.R58W|ACBD4_ENST00000591136.1_3'UTR|ACBD4_ENST00000586346.1_Missense_Mutation_p.R58W|ACBD4_ENST00000321854.8_Missense_Mutation_p.R58W|ACBD4_ENST00000398322.3_Missense_Mutation_p.R58W|ACBD4_ENST00000431281.1_Missense_Mutation_p.R58W	NM_001135707.1	NP_001129179.1	Q8NC06	ACBD4_HUMAN	acyl-CoA binding domain containing 4	58	ACB. {ECO:0000255|PROSITE- ProRule:PRU00573}.						fatty-acyl-CoA binding (GO:0000062)|lipid binding (GO:0008289)			kidney(1)|lung(3)|ovary(1)	5						CCTGGTCCCCCGGCCCGGGTT	0.607																																						dbGAP											0													50.0	57.0	55.0					17																	43213950		1865	4091	5956	-	-	-	SO:0001583	missense	0			BC029164	CCDS42348.1, CCDS45710.1, CCDS45711.1	17q21.31	2012-10-02	2010-04-30		ENSG00000181513	ENSG00000181513			23337	protein-coding gene	gene with protein product			"""acyl-Coenzyme A binding domain containing 4"""				Standard	NM_001135704		Approved	FLJ13322	uc002iie.3	Q8NC06	OTTHUMG00000180111	ENST00000376955.4:c.172C>T	17.37:g.43213950C>T	ENSP00000366154:p.Arg58Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX64|Q8IUT1|Q9H8Q4	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,prints_Acyl-CoA-binding_protein	p.R58W	ENST00000376955.4	37	c.172	CCDS45711.1	17	.	.	.	.	.	.	.	.	.	.	C	19.92	3.916766	0.73098	.	.	ENSG00000181513	ENST00000431281;ENST00000321854;ENST00000398322;ENST00000376955	T;T;T;T	0.27402	1.67;1.67;1.67;1.67	5.15	1.73	0.24493	FERM/acyl-CoA-binding protein, 3-helical bundle (1);Acyl-CoA-binding protein, ACBP (4);	0.070788	0.56097	D	0.000033	T	0.57829	0.2080	M	0.89095	3.005	0.40821	D	0.983505	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.74023	0.972;0.916;0.982	T	0.67624	-0.5623	10	0.87932	D	0	.	12.2822	0.54771	0.4384:0.5616:0.0:0.0	.	58;58;58	Q8NC06-3;Q8NC06;Q8NC06-2	.;ACBD4_HUMAN;.	W	58	ENSP00000405969:R58W;ENSP00000314440:R58W;ENSP00000381367:R58W;ENSP00000366154:R58W	ENSP00000314440:R58W	R	+	1	2	ACBD4	40569476	0.067000	0.21026	0.999000	0.59377	0.988000	0.76386	0.349000	0.20055	0.701000	0.31803	0.561000	0.74099	CGG	ACBD4	-	pfam_Acyl-CoA-binding_protein,superfamily_Acyl-CoA-binding_protein,prints_Acyl-CoA-binding_protein	ENSG00000181513		0.607	ACBD4-006	KNOWN	basic|CCDS	protein_coding	ACBD4	HGNC	protein_coding	OTTHUMT00000449816.1	41	0.00	0	C	NM_024722		43213950	43213950	+1	no_errors	ENST00000431281	ensembl	human	known	69_37n	missense	5	70.59	12	SNP	0.987	T
ADAM18	8749	genome.wustl.edu	37	8	39495190	39495190	+	Silent	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr8:39495190C>T	ENST00000265707.5	+	9	840	c.795C>T	c.(793-795)atC>atT	p.I265I	ADAM18_ENST00000379866.1_Silent_p.I241I|ADAM18_ENST00000541111.1_5'UTR	NM_014237.2	NP_055052.1	Q9Y3Q7	ADA18_HUMAN	ADAM metallopeptidase domain 18	265	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(31)|ovary(1)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(3)	71		all_cancers(7;1.32e-05)|all_epithelial(6;3.08e-10)|all_lung(54;0.00187)|Hepatocellular(245;0.00745)|Lung NSC(58;0.00769)|Breast(189;0.0112)	LUSC - Lung squamous cell carcinoma(45;0.000199)			ACTATCTCATCCTACGGCCCC	0.353																																						dbGAP											0													105.0	101.0	102.0					8																	39495190		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ133004	CCDS6113.1, CCDS55225.1	8p11.22	2008-08-07	2005-08-18		ENSG00000168619	ENSG00000168619		"""ADAM metallopeptidase domain containing"""	196	protein-coding gene	gene with protein product			"""a disintegrin and metalloproteinase domain 18"""			12200459	Standard	NM_014237		Approved	tMDCIII, ADAM27	uc003xni.3	Q9Y3Q7	OTTHUMG00000164040	ENST00000265707.5:c.795C>T	8.37:g.39495190C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9Y0|Q0VAI4|Q6IRW9|Q6UXJ9	Silent	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B	p.I265	ENST00000265707.5	37	c.795	CCDS6113.1	8																																																																																			ADAM18	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000168619		0.353	ADAM18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM18	HGNC	protein_coding	OTTHUMT00000376916.1	121	0.00	0	C	NM_014237		39495190	39495190	+1	no_errors	ENST00000265707	ensembl	human	known	69_37n	silent	120	20.00	30	SNP	0.001	T
ANKRD30A	91074	genome.wustl.edu	37	10	37508553	37508553	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr10:37508553G>T	ENST00000602533.1	+	34	3844	c.3745G>T	c.(3745-3747)Gaa>Taa	p.E1249*	ANKRD30A_ENST00000374660.1_Nonsense_Mutation_p.E1368*|ANKRD30A_ENST00000361713.1_Nonsense_Mutation_p.E1249*			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	1305					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GTATCAAAACGAACAAGATAA	0.363																																						dbGAP											0													76.0	65.0	68.0					10																	37508553		1915	4121	6036	-	-	-	SO:0001587	stop_gained	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.3745G>T	10.37:g.37508553G>T	ENSP00000473551:p.Glu1249*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W025	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E1249*	ENST00000602533.1	37	c.3745		10	.	.	.	.	.	.	.	.	.	.	g	37	6.046296	0.97231	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	.	.	.	2.95	1.03	0.20045	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	6.5401	0.22375	0.26:0.0:0.74:0.0	.	.	.	.	X	1249;1368	.	ENSP00000354432:E1249X	E	+	1	0	ANKRD30A	37548559	0.996000	0.38824	0.001000	0.08648	0.008000	0.06430	4.068000	0.57534	0.028000	0.15324	0.471000	0.43371	GAA	ANKRD30A	-	NULL	ENSG00000148513		0.363	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	80	0.00	0	G	NM_052997		37508553	37508553	+1	no_errors	ENST00000361713	ensembl	human	known	69_37n	nonsense	85	12.37	12	SNP	0.024	T
ARSK	153642	genome.wustl.edu	37	5	94936385	94936385	+	Intron	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr5:94936385G>A	ENST00000380009.4	+	7	1301					NM_198150.2	NP_937793.1	Q6UWY0	ARSK_HUMAN	arylsulfatase family, member K						cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(1)	16		all_cancers(142;3.38e-06)|all_epithelial(76;6.57e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.00473)		all cancers(79;6.5e-16)		catggccagtggggtaagcat	0.378																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS4073.1	5q15	2013-02-14	2006-03-07		ENSG00000164291	ENSG00000164291		"""Arylsulfatase family"""	25239	protein-coding gene	gene with protein product		610011	"""arylsulfatase K"""			12975309, 16174644	Standard	NM_198150		Approved	DKFZp313G1735, TSULF	uc003kld.3	Q6UWY0	OTTHUMG00000121166	ENST00000380009.4:c.1097-166G>A	5.37:g.94936385G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDE3|B4E1I4|Q3ZCW3|Q8N3Q8	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.G385R	ENST00000380009.4	37	c.1153	CCDS4073.1	5																																																																																			ARSK	-	NULL	ENSG00000164291		0.378	ARSK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSK	HGNC	protein_coding	OTTHUMT00000241652.2	21	0.00	0	G	NM_198150		94936385	94936385	+1	no_errors	ENST00000504873	ensembl	human	known	69_37n	missense	21	32.26	10	SNP	0.001	A
ATP2B3	492	genome.wustl.edu	37	X	152807837	152807837	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chrX:152807837G>A	ENST00000349466.2	+	5	1047	c.721G>A	c.(721-723)Gag>Aag	p.E241K	ATP2B3_ENST00000393842.1_Missense_Mutation_p.E241K|ATP2B3_ENST00000359149.3_Missense_Mutation_p.E241K|ATP2B3_ENST00000263519.4_Missense_Mutation_p.E241K|ATP2B3_ENST00000370186.1_Missense_Mutation_p.E241K|ATP2B3_ENST00000370181.2_Missense_Mutation_p.E241K			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	241					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CAAGATCGACGAGAGCTCCCT	0.652																																						dbGAP											0													94.0	68.0	77.0					X																	152807837		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.721G>A	X.37:g.152807837G>A	ENSP00000343886:p.Glu241Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.E241K	ENST00000349466.2	37	c.721	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	G	35	5.588019	0.96590	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.93307	-3.2;-3.2;-3.2;-3.2;-3.2;-3.2	5.45	5.45	0.79879	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.112090	0.64402	D	0.000018	D	0.98197	0.9404	H	0.98612	4.28	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.99834	1.1056	10	0.87932	D	0	-14.5919	16.9818	0.86329	0.0:0.0:1.0:0.0	.	241;241	Q16720;Q16720-2	AT2B3_HUMAN;.	K	241	ENSP00000359205:E241K;ENSP00000343886:E241K;ENSP00000377425:E241K;ENSP00000352062:E241K;ENSP00000263519:E241K;ENSP00000359200:E241K	ENSP00000263519:E241K	E	+	1	0	ATP2B3	152461031	1.000000	0.71417	0.976000	0.42696	0.746000	0.42486	9.813000	0.99286	2.273000	0.75805	0.513000	0.50165	GAG	ATP2B3	-	pfam_ATPase_P-typ_ATPase-assoc-dom,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000067842		0.652	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	43	0.00	0	G	NM_021949		152807837	152807837	+1	no_errors	ENST00000263519	ensembl	human	known	69_37n	missense	26	36.59	15	SNP	1.000	A
CACNA1A	773	genome.wustl.edu	37	19	13565940	13565940	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr19:13565940G>T	ENST00000360228.5	-	2	379	c.380C>A	c.(379-381)aCc>aAc	p.T127N	CACNA1A_ENST00000573710.2_Missense_Mutation_p.T127N	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	127					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	AGACATCGGGGTCTTGTCATC	0.483																																						dbGAP											0													184.0	183.0	183.0					19																	13565940		2029	4211	6240	-	-	-	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.380C>A	19.37:g.13565940G>T	ENSP00000353362:p.Thr127Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.T127N	ENST00000360228.5	37	c.380	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	G	13.99	2.402059	0.42613	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084	T	0.54479	0.57	5.01	5.01	0.66863	.	0.000000	0.64402	D	0.000001	T	0.66479	0.2793	L	0.42744	1.35	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.80764	0.991;0.994	T	0.69461	-0.5139	10	0.87932	D	0	.	17.4451	0.87575	0.0:0.0:1.0:0.0	.	127;127	O00555;Q9NS88	CAC1A_HUMAN;.	N	127	ENSP00000353362:T127N	ENSP00000317661:T127N	T	-	2	0	CACNA1A	13426940	1.000000	0.71417	0.999000	0.59377	0.707000	0.40811	9.695000	0.98691	2.489000	0.83994	0.655000	0.94253	ACC	CACNA1A	-	NULL	ENSG00000141837		0.483	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	90	0.00	0	G	NM_000068		13565940	13565940	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	missense	64	22.89	19	SNP	1.000	T
CCAR1	55749	genome.wustl.edu	37	10	70507134	70507134	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr10:70507134C>T	ENST00000265872.6	+	8	756	c.637C>T	c.(637-639)Cag>Tag	p.Q213*	CCAR1_ENST00000535016.1_Nonsense_Mutation_p.Q198*|CCAR1_ENST00000543719.1_Nonsense_Mutation_p.Q198*	NM_001282959.1|NM_001282960.1|NM_018237.2	NP_001269888.1|NP_001269889.1|NP_060707.2	Q8IX12	CCAR1_HUMAN	cell division cycle and apoptosis regulator 1	213					apoptotic process (GO:0006915)|cell cycle (GO:0007049)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(9)|lung(13)|ovary(7)|skin(3)	56						ATTGAAGAATCAGTCGCAAAC	0.388																																						dbGAP											0													97.0	96.0	96.0					10																	70507134		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY249140	CCDS7282.1, CCDS60547.1	10q22.1	2004-02-19			ENSG00000060339	ENSG00000060339			24236	protein-coding gene	gene with protein product		612569				12816952	Standard	NM_018237		Approved	FLJ10590, CARP-1, CARP1	uc001joo.3	Q8IX12	OTTHUMG00000018361	ENST00000265872.6:c.637C>T	10.37:g.70507134C>T	ENSP00000265872:p.Gln213*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JLT7|A1L4P7|A8K9D4|B4DNP8|B4DRK8|Q32NE3|Q5EBM3|Q5VUP6|Q6PIZ0|Q6X935|Q9H8N4|Q9NVA7|Q9NVQ0|Q9NWM6	Nonsense_Mutation	SNP	pfam_SAP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd	p.Q213*	ENST00000265872.6	37	c.637	CCDS7282.1	10	.	.	.	.	.	.	.	.	.	.	C	16.72	3.201360	0.58234	.	.	ENSG00000060339	ENST00000265872;ENST00000535016;ENST00000543719;ENST00000539539;ENST00000543225;ENST00000536012;ENST00000540807	.	.	.	5.52	5.52	0.82312	.	0.283676	0.40908	D	0.000994	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-10.8255	19.8034	0.96518	0.0:1.0:0.0:0.0	.	.	.	.	X	213;198;198;198;187;18;18	.	ENSP00000265872:Q213X	Q	+	1	0	CCAR1	70177140	1.000000	0.71417	1.000000	0.80357	0.161000	0.22273	5.228000	0.65310	2.760000	0.94817	0.655000	0.94253	CAG	CCAR1	-	superfamily_NA-bd_OB-fold-like	ENSG00000060339		0.388	CCAR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCAR1	HGNC	protein_coding	OTTHUMT00000048356.2	104	0.95	1	C	NM_018237		70507134	70507134	+1	no_errors	ENST00000265872	ensembl	human	known	69_37n	nonsense	16	70.37	38	SNP	1.000	T
EED	8726	genome.wustl.edu	37	11	85966327	85966327	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr11:85966327G>A	ENST00000263360.6	+	4	1110	c.424G>A	c.(424-426)Gat>Aat	p.D142N	EED_ENST00000351625.6_Missense_Mutation_p.D142N|EED_ENST00000327320.4_Missense_Mutation_p.D142N|EED_ENST00000528180.1_Missense_Mutation_p.D142N	NM_003797.3	NP_003788.2	O75530	EED_HUMAN	embryonic ectoderm development	142	Interaction with EZH2. {ECO:0000250}.				negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of histone H3-K27 methylation (GO:0061087)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|ESC/E(Z) complex (GO:0035098)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pronucleus (GO:0045120)|sex chromatin (GO:0001739)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	21		Acute lymphoblastic leukemia(157;7.24e-07)|all_hematologic(158;0.00092)				CGTGGATGCTGATGTATCCTT	0.299																																						dbGAP											0													103.0	93.0	97.0					11																	85966327		2202	4297	6499	-	-	-	SO:0001583	missense	0			AF078933	CCDS8273.1, CCDS8274.1	11q14.2-q22.3	2013-01-10			ENSG00000074266	ENSG00000074266		"""WD repeat domain containing"""	3188	protein-coding gene	gene with protein product	"""WD protein associating with integrin cytoplasmic tails 1"""	605984				9765275, 9806832	Standard	NM_003797		Approved	WAIT-1, HEED	uc001pbp.3	O75530	OTTHUMG00000167209	ENST00000263360.6:c.424G>A	11.37:g.85966327G>A	ENSP00000263360:p.Asp142Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7V5|O00149|Q6NTH2|Q7LDA5|Q7LDG8|Q86VV2|Q9UNY7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D142N	ENST00000263360.6	37	c.424	CCDS8273.1	11	.	.	.	.	.	.	.	.	.	.	G	21.1	4.102016	0.76983	.	.	ENSG00000074266	ENST00000263360;ENST00000528180;ENST00000351625;ENST00000327320;ENST00000537092	T;T;T;T	0.28666	1.6;1.6;1.6;1.6	5.44	5.44	0.79542	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.51787	0.1695	L	0.51422	1.61	0.80722	D	1	B;B;D;B	0.89917	0.184;0.014;1.0;0.241	B;B;D;B	0.97110	0.271;0.024;1.0;0.177	T	0.40194	-0.9576	9	.	.	.	-15.0678	19.2736	0.94021	0.0:0.0:1.0:0.0	.	142;142;142;142	O75530-3;E9PJK2;O75530-2;O75530	.;.;.;EED_HUMAN	N	142	ENSP00000263360:D142N;ENSP00000431778:D142N;ENSP00000338186:D142N;ENSP00000315587:D142N	.	D	+	1	0	EED	85643975	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.298000	0.96132	2.563000	0.86464	0.467000	0.42956	GAT	EED	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000074266		0.299	EED-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EED	HGNC	protein_coding	OTTHUMT00000393733.1	168	0.59	1	G	NM_003797		85966327	85966327	+1	no_errors	ENST00000263360	ensembl	human	known	69_37n	missense	131	21.08	35	SNP	1.000	A
EYS	346007	genome.wustl.edu	37	6	65767562	65767562	+	Silent	SNP	G	G	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr6:65767562G>T	ENST00000370621.3	-	13	2608	c.2082C>A	c.(2080-2082)gcC>gcA	p.A694A	EYS_ENST00000503581.1_Silent_p.A694A|EYS_ENST00000370616.2_Silent_p.A694A			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	694	EGF-like 8; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						CAATGCAGGTGGCTCCATTTT	0.373																																						dbGAP											0													223.0	179.0	192.0					6																	65767562		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2082C>A	6.37:g.65767562G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Silent	SNP	pfam_Laminin_G,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.A694	ENST00000370621.3	37	c.2082		6																																																																																			EYS	-	pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000188107		0.373	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	142	0.00	0	G	XM_294050		65767562	65767562	-1	no_errors	ENST00000370616	ensembl	human	known	69_37n	silent	92	13.21	14	SNP	0.853	T
F2R	2149	genome.wustl.edu	37	5	76028288	76028288	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr5:76028288C>G	ENST00000319211.4	+	2	503	c.238C>G	c.(238-240)Ctt>Gtt	p.L80V		NM_001992.3	NP_001983.2	P25116	PAR1_HUMAN	coagulation factor II (thrombin) receptor	80					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of MAPKK activity (GO:0000186)|anatomical structure morphogenesis (GO:0009653)|blood coagulation (GO:0007596)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|G-protein coupled receptor signaling pathway (GO:0007186)|homeostasis of number of cells within a tissue (GO:0048873)|inflammatory response (GO:0006954)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glomerular filtration (GO:0003105)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of renin secretion into blood stream (GO:1900134)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|platelet activation (GO:0030168)|platelet dense granule organization (GO:0060155)|positive regulation of blood coagulation (GO:0030194)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-6 secretion (GO:2000778)|positive regulation of interleukin-8 secretion (GO:2000484)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of Rho protein signal transduction (GO:0035025)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vasoconstriction (GO:0045907)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood coagulation (GO:0030193)|regulation of interleukin-1 beta production (GO:0032651)|regulation of sensory perception of pain (GO:0051930)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|STAT protein import into nucleus (GO:0007262)|tyrosine phosphorylation of STAT protein (GO:0007260)	caveola (GO:0005901)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|platelet dense tubular network (GO:0031094)|postsynaptic membrane (GO:0045211)	G-protein alpha-subunit binding (GO:0001965)|G-protein beta-subunit binding (GO:0031681)|G-protein coupled receptor activity (GO:0004930)|receptor binding (GO:0005102)|thrombin receptor activity (GO:0015057)			NS(1)|breast(1)|endometrium(3)|kidney(1)|lung(7)|ovary(3)	16		all_lung(232;0.000414)|Lung NSC(167;0.0011)|Prostate(461;0.00955)|Ovarian(174;0.0129)		all cancers(79;4.43e-43)	Streptokinase(DB00086)	AAGCAGTCCTCTTCAAAAACA	0.423																																						dbGAP											0													154.0	158.0	157.0					5																	76028288		2203	4300	6503	-	-	-	SO:0001583	missense	0			M62424	CCDS4032.1	5q13	2012-08-08			ENSG00000181104	ENSG00000181104		"""GPCR / Class A : Protease activated receptors"""	3537	protein-coding gene	gene with protein product		187930				8395910	Standard	NM_001992		Approved	TR, CF2R, PAR1, PAR-1	uc003ken.4	P25116	OTTHUMG00000131299	ENST00000319211.4:c.238C>G	5.37:g.76028288C>G	ENSP00000321326:p.Leu80Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XV0|Q96RF7|Q9BUN4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Thrmbn_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Protea_act_rcpt,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	p.L80V	ENST00000319211.4	37	c.238	CCDS4032.1	5	.	.	.	.	.	.	.	.	.	.	C	3.166	-0.171061	0.06421	.	.	ENSG00000181104	ENST00000319211	T	0.75260	-0.92	4.68	2.84	0.33178	.	0.911325	0.09387	N	0.809065	T	0.62648	0.2445	L	0.51422	1.61	0.09310	N	1	B	0.23442	0.085	B	0.22386	0.039	T	0.48281	-0.9049	10	0.15499	T	0.54	-1.6992	3.278	0.06906	0.159:0.5505:0.1548:0.1357	.	80	P25116	PAR1_HUMAN	V	80	ENSP00000321326:L80V	ENSP00000321326:L80V	L	+	1	0	F2R	76064044	0.000000	0.05858	0.009000	0.14445	0.056000	0.15407	0.024000	0.13555	1.273000	0.44346	0.555000	0.69702	CTT	F2R	-	NULL	ENSG00000181104		0.423	F2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F2R	HGNC	protein_coding	OTTHUMT00000254068.2	110	0.00	0	C			76028288	76028288	+1	no_errors	ENST00000319211	ensembl	human	known	69_37n	missense	112	22.76	33	SNP	0.000	G
FAT4	79633	genome.wustl.edu	37	4	126328230	126328230	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr4:126328230A>C	ENST00000394329.3	+	3	5516	c.5503A>C	c.(5503-5505)Aat>Cat	p.N1835H	FAT4_ENST00000335110.5_Missense_Mutation_p.N133H	NM_024582.4	NP_078858.4	Q6V0I7	FAT4_HUMAN	FAT atypical cadherin 4	1835	Cadherin 17. {ECO:0000255|PROSITE- ProRule:PRU00043}.				branching involved in ureteric bud morphogenesis (GO:0001658)|cerebral cortex development (GO:0021987)|digestive tract development (GO:0048565)|heart morphogenesis (GO:0003007)|heterophilic cell-cell adhesion (GO:0007157)|hippo signaling (GO:0035329)|homophilic cell adhesion (GO:0007156)|inner ear receptor stereocilium organization (GO:0060122)|neurogenesis (GO:0022008)|ossification involved in bone maturation (GO:0043931)|plasma membrane organization (GO:0007009)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)	apical part of cell (GO:0045177)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|autonomic_ganglia(1)|breast(4)|central_nervous_system(3)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(93)|liver(3)|lung(120)|ovary(9)|pancreas(2)|prostate(21)|skin(31)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(6)	355						CAGTGATGTGAATGACCATAC	0.448																																						dbGAP											0													149.0	142.0	144.0					4																	126328230		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY356402	CCDS3732.3	4q28.1	2013-05-31	2013-05-31		ENSG00000196159	ENSG00000196159		"""Cadherins / Cadherin-related"""	23109	protein-coding gene	gene with protein product	"""cadherin-related family member 11"""	612411	"""FAT tumor suppressor homolog 4 (Drosophila)"""			15003449	Standard	NM_024582		Approved	CDHF14, FAT-J, CDHR11	uc003ifj.4	Q6V0I7	OTTHUMG00000133100	ENST00000394329.3:c.5503A>C	4.37:g.126328230A>C	ENSP00000377862:p.Asn1835His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Z6|B5MDG4|Q3LIA6|Q8TCK7|Q9H5T6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.N1835H	ENST00000394329.3	37	c.5503	CCDS3732.3	4	.	.	.	.	.	.	.	.	.	.	A	18.33	3.600009	0.66332	.	.	ENSG00000196159	ENST00000394329;ENST00000335110	T;T	0.75704	-0.96;-0.96	5.41	5.41	0.78517	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.36482	U	0.002577	D	0.91405	0.7288	H	0.97918	4.105	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.999	D	0.94446	0.7663	10	0.72032	D	0.01	.	15.7481	0.77962	1.0:0.0:0.0:0.0	.	133;1835	Q6V0I7-2;Q6V0I7	.;FAT4_HUMAN	H	1835;133	ENSP00000377862:N1835H;ENSP00000335169:N133H	ENSP00000335169:N133H	N	+	1	0	FAT4	126547680	1.000000	0.71417	0.998000	0.56505	0.336000	0.28762	8.865000	0.92300	2.168000	0.68352	0.528000	0.53228	AAT	FAT4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000196159		0.448	FAT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT4	HGNC	protein_coding	OTTHUMT00000256765.2	45	0.00	0	A	NM_024582		126328230	126328230	+1	no_errors	ENST00000394329	ensembl	human	known	69_37n	missense	59	10.61	7	SNP	1.000	C
FOXP1	27086	genome.wustl.edu	37	3	71161786	71161786	+	Silent	SNP	T	T	C			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr3:71161786T>C	ENST00000318789.4	-	7	708	c.183A>G	c.(181-183)gcA>gcG	p.A61A	FOXP1_ENST00000468577.1_Silent_p.A61A|FOXP1_ENST00000475937.1_Silent_p.A61A|FOXP1_ENST00000491238.1_Silent_p.A63A|FOXP1_ENST00000493089.1_Silent_p.A61A|FOXP1_ENST00000484350.1_Silent_p.A61A|FOXP1_ENST00000498215.1_Silent_p.A61A	NM_001244810.1|NM_001244813.1|NM_032682.5	NP_001231739.1|NP_001231742.1|NP_116071.2	Q9H334	FOXP1_HUMAN	forkhead box P1	61	Gln-rich.				negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	31		Lung NSC(201;4.62e-05)|Prostate(10;0.0181)|Hepatocellular(537;0.186)|Myeloproliferative disorder(1037;0.209)		BRCA - Breast invasive adenocarcinoma(55;1.17e-05)|Epithelial(33;1.39e-05)|LUSC - Lung squamous cell carcinoma(21;2.35e-05)|Lung(16;4.26e-05)		CCACCTGAAGTGCCTGGAAGG	0.473			T	PAX5	ALL																																	dbGAP		Dom	yes		3	3p14.1	27086	forkhead box P1		L	0													129.0	124.0	126.0					3																	71161786		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF146696	CCDS2914.1, CCDS33785.1, CCDS58837.1, CCDS58838.1, CCDS58839.1, CCDS74963.1, CCDS74964.1	3p14.1	2008-07-18			ENSG00000114861	ENSG00000114861		"""Forkhead boxes"""	3823	protein-coding gene	gene with protein product	"""fork head-related protein like B"", ""glutamine-rich factor 1"", ""PAX5/FOXP1 fusion protein"""	605515				8265594, 11751404	Standard	NM_032682		Approved	QRF1, 12CC4, HSPC215, hFKH1B	uc003doj.3	Q9H334	OTTHUMG00000158803	ENST00000318789.4:c.183A>G	3.37:g.71161786T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A3QVP8|B3KV70|G5E9V8|Q8NAN6|Q9BSG9|Q9H332|Q9H333|Q9P0R1	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A61	ENST00000318789.4	37	c.183	CCDS2914.1	3																																																																																			FOXP1	-	NULL	ENSG00000114861		0.473	FOXP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FOXP1	HGNC	protein_coding	OTTHUMT00000352250.1	135	0.00	0	T	NM_032682		71161786	71161786	-1	no_errors	ENST00000318789	ensembl	human	known	69_37n	silent	59	33.70	31	SNP	0.460	C
MROH2B	133558	genome.wustl.edu	37	5	41049479	41049479	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr5:41049479C>A	ENST00000399564.4	-	14	1854	c.1404G>T	c.(1402-1404)gaG>gaT	p.E468D	MROH2B_ENST00000506092.2_Missense_Mutation_p.E23D	NM_173489.4	NP_775760.3	Q7Z745	MRO2B_HUMAN	maestro heat-like repeat family member 2B	468			E -> V (in dbSNP:rs17198125).														TAAACAGGGGCTCCAGAGCTT	0.483																																						dbGAP											0													70.0	66.0	67.0					5																	41049479		1914	4126	6040	-	-	-	SO:0001583	missense	0				CCDS47202.1	5p13.1	2012-12-19	2012-12-19	2012-12-19	ENSG00000171495	ENSG00000171495		"""maestro heat-like repeat containing"""	26857	protein-coding gene	gene with protein product			"""HEAT repeat family member 7B2"""	HEATR7B2		12477932	Standard	NM_173489		Approved	DKFZp781F0822, FLJ40243	uc003jmj.4	Q7Z745	OTTHUMG00000162151	ENST00000399564.4:c.1404G>T	5.37:g.41049479C>A	ENSP00000382476:p.Glu468Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DM1|Q7Z4U4|Q8N7X3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E468D	ENST00000399564.4	37	c.1404	CCDS47202.1	5	.	.	.	.	.	.	.	.	.	.	C	3.275	-0.148353	0.06627	.	.	ENSG00000171495	ENST00000506092;ENST00000296803;ENST00000399564	T;T	0.08008	3.14;3.14	5.7	-7.47	0.01365	Armadillo-type fold (1);	1.888760	0.02548	N	0.095394	T	0.02610	0.0079	N	0.00926	-1.1	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.40040	-0.9584	10	0.16896	T	0.51	.	10.6381	0.45577	0.0:0.3253:0.2244:0.4503	.	468	Q7Z745	HTRB2_HUMAN	D	23;172;468	ENSP00000441504:E23D;ENSP00000382476:E468D	ENSP00000296803:E172D	E	-	3	2	HEATR7B2	41085236	0.000000	0.05858	0.001000	0.08648	0.100000	0.18952	-0.900000	0.04097	-2.245000	0.00705	-0.153000	0.13522	GAG	HEATR7B2	-	superfamily_ARM-type_fold	ENSG00000171495		0.483	MROH2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR7B2	HGNC	protein_coding	OTTHUMT00000367558.2	62	0.00	0	C	NM_173489		41049479	41049479	-1	no_errors	ENST00000399564	ensembl	human	known	69_37n	missense	65	26.97	24	SNP	0.000	A
HECW1	23072	genome.wustl.edu	37	7	43506115	43506115	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr7:43506115C>T	ENST00000395891.2	+	15	3466	c.2861C>T	c.(2860-2862)gCg>gTg	p.A954V	HECW1_ENST00000453890.1_Missense_Mutation_p.A920V	NM_015052.3	NP_055867.3	Q76N89	HECW1_HUMAN	HECT, C2 and WW domain containing E3 ubiquitin protein ligase 1	954					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			NS(2)|breast(10)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(17)|lung(57)|ovary(8)|pancreas(2)|prostate(2)|skin(6)|urinary_tract(3)	125						CAGTCCCCAGCGGTCAAGTTC	0.498																																						dbGAP											0													113.0	106.0	108.0					7																	43506115		1946	4141	6087	-	-	-	SO:0001583	missense	0			AB048365	CCDS5469.2, CCDS69286.1	7p13	2004-12-13			ENSG00000002746	ENSG00000002746			22195	protein-coding gene	gene with protein product		610384				12690205, 14684739	Standard	XM_005249665		Approved	KIAA0322, NEDL1	uc003tid.1	Q76N89	OTTHUMG00000128917	ENST00000395891.2:c.2861C>T	7.37:g.43506115C>T	ENSP00000379228:p.Ala954Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X0|A8MYS3|B4DH42|O15036|Q9HCC7	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_WW_Rsp5_WWP,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.A954V	ENST00000395891.2	37	c.2861	CCDS5469.2	7	.	.	.	.	.	.	.	.	.	.	C	27.3	4.823251	0.90873	.	.	ENSG00000002746	ENST00000395891;ENST00000453890;ENST00000265522	D;D	0.84442	-1.85;-1.85	5.8	5.8	0.92144	.	0.141567	0.64402	D	0.000005	D	0.91720	0.7382	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;0.997	D;B	0.81914	0.995;0.406	D	0.91353	0.5106	10	0.59425	D	0.04	.	20.0706	0.97721	0.0:1.0:0.0:0.0	.	920;954	B4DH42;Q76N89	.;HECW1_HUMAN	V	954;920;954	ENSP00000379228:A954V;ENSP00000407774:A920V	ENSP00000265522:A954V	A	+	2	0	HECW1	43472640	1.000000	0.71417	0.856000	0.33681	1.000000	0.99986	5.550000	0.67268	2.744000	0.94065	0.655000	0.94253	GCG	HECW1	-	NULL	ENSG00000002746		0.498	HECW1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HECW1	HGNC	protein_coding	OTTHUMT00000250893.2	83	0.00	0	C	NM_015052		43506115	43506115	+1	no_errors	ENST00000395891	ensembl	human	known	69_37n	missense	60	55.22	74	SNP	0.996	T
HUWE1	10075	genome.wustl.edu	37	X	53588774	53588774	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chrX:53588774G>A	ENST00000342160.3	-	54	7907	c.7450C>T	c.(7450-7452)Cgc>Tgc	p.R2484C	HUWE1_ENST00000262854.6_Missense_Mutation_p.R2484C			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2484	Asp-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CGGTCAAAGCGCTCAAATCGG	0.468																																						dbGAP											0													141.0	105.0	117.0					X																	53588774		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7450C>T	X.37:g.53588774G>A	ENSP00000340648:p.Arg2484Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.R2484C	ENST00000342160.3	37	c.7450	CCDS35301.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.98|14.98	2.697973|2.697973	0.48307|0.48307	.|.	.|.	ENSG00000086758|ENSG00000086758	ENST00000427052|ENST00000342160;ENST00000262854	.|T;T	.|0.38077	.|1.16;1.16	5.4|5.4	5.4|5.4	0.78164|0.78164	.|.	.|0.300709	.|0.30235	.|N	.|0.010090	T|T	0.45074|0.45074	0.1324|0.1324	N|N	0.19112|0.19112	0.55|0.55	0.58432|0.58432	D|D	0.999999|0.999999	.|D;P	.|0.89917	.|1.0;0.95	.|D;B	.|0.71414	.|0.973;0.409	T|T	0.39313|0.39313	-0.9620|-0.9620	5|10	.|0.36615	.|T	.|0.2	.|.	16.8602|16.8602	0.86016|0.86016	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|2484;2484	.|Q7Z6Z7;Q7Z6Z7-2	.|HUWE1_HUMAN;.	V|C	1517|2484	.|ENSP00000340648:R2484C;ENSP00000262854:R2484C	.|ENSP00000262854:R2484C	A|R	-|-	2|1	0|0	HUWE1|HUWE1	53605499|53605499	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	4.375000|4.375000	0.59549|0.59549	2.242000|2.242000	0.73789|0.73789	0.506000|0.506000	0.49869|0.49869	GCG|CGC	HUWE1	-	NULL	ENSG00000086758		0.468	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	103	0.00	0	G	XM_497119		53588774	53588774	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	79	34.71	42	SNP	1.000	A
ITIH6	347365	genome.wustl.edu	37	X	54817311	54817311	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chrX:54817311G>A	ENST00000218436.6	-	4	604	c.575C>T	c.(574-576)cCa>cTa	p.P192L	ITIH6_ENST00000498398.1_5'Flank	NM_198510.2	NP_940912.1	Q6UXX5	ITIH6_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 6	192					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)										CCTCAGGGGTGGTATGTGCAC	0.547																																						dbGAP											0													136.0	98.0	111.0					X																	54817311		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358170	CCDS14361.1	Xp11.22-p11.21	2011-10-26	2011-10-26	2011-10-26	ENSG00000102313	ENSG00000102313			28907	protein-coding gene	gene with protein product			"""inter-alpha (globulin) inhibitor H5-like"""	ITIH5L		12975309	Standard	NM_198510		Approved	UNQ6369	uc004dtj.2	Q6UXX5	OTTHUMG00000021634	ENST00000218436.6:c.575C>T	X.37:g.54817311G>A	ENSP00000218436:p.Pro192Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN03	Missense_Mutation	SNP	pfam_VIT,pfam_ITI_HC_C,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.P192L	ENST00000218436.6	37	c.575	CCDS14361.1	X	.	.	.	.	.	.	.	.	.	.	G	0.643	-0.812727	0.02798	.	.	ENSG00000102313	ENST00000218436	T	0.02140	4.43	4.84	-1.3	0.09259	.	0.325369	0.23524	N	0.047258	T	0.00845	0.0028	N	0.04335	-0.225	0.09310	N	1	B	0.17852	0.024	B	0.11329	0.006	T	0.46925	-0.9156	10	0.02654	T	1	.	5.3229	0.15891	0.6569:0.0:0.179:0.1642	.	192	Q6UXX5	ITH5L_HUMAN	L	192	ENSP00000218436:P192L	ENSP00000218436:P192L	P	-	2	0	ITIH5L	54834036	0.939000	0.31865	0.000000	0.03702	0.011000	0.07611	2.677000	0.46892	-0.292000	0.08999	0.377000	0.23210	CCA	ITIH6	-	NULL	ENSG00000102313		0.547	ITIH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITIH6	HGNC	protein_coding	OTTHUMT00000056814.2	68	0.00	0	G	NM_198510		54817311	54817311	-1	no_errors	ENST00000218436	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.003	A
KCNG4	93107	genome.wustl.edu	37	16	84270709	84270709	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr16:84270709G>A	ENST00000308251.4	-	2	451	c.383C>T	c.(382-384)gCg>gTg	p.A128V	KCNG4_ENST00000568181.1_Missense_Mutation_p.A128V	NM_172347.2	NP_758857.1	Q8TDN1	KCNG4_HUMAN	potassium voltage-gated channel, subfamily G, member 4	128					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	31						CTTCCCGGCCGCCAGGAAGCT	0.637																																						dbGAP											0													48.0	51.0	50.0					16																	84270709		2200	4300	6500	-	-	-	SO:0001583	missense	0			AF348984	CCDS10945.1	16q24.1	2011-07-05			ENSG00000168418	ENSG00000168418		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	19697	protein-coding gene	gene with protein product		607603				12060745, 16382104	Standard	NM_172347		Approved	Kv6.4	uc010voc.2	Q8TDN1	OTTHUMG00000137638	ENST00000308251.4:c.383C>T	16.37:g.84270709G>A	ENSP00000312129:p.Ala128Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96H24	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.A128V	ENST00000308251.4	37	c.383	CCDS10945.1	16	.	.	.	.	.	.	.	.	.	.	G	19.41	3.822851	0.71028	.	.	ENSG00000168418	ENST00000308251	T	0.76709	-1.04	5.12	5.12	0.69794	BTB/POZ-like (1);BTB/POZ fold (2);Potassium channel, voltage dependent, Kv, tetramerisation (1);	0.000000	0.85682	D	0.000000	D	0.87313	0.6146	M	0.70787	2.145	0.41318	D	0.987154	D;D	0.89917	0.999;1.0	D;D	0.74348	0.946;0.983	D	0.88752	0.3251	10	0.66056	D	0.02	.	17.5478	0.87867	0.0:0.0:1.0:0.0	.	128;128	Q8TDN1;Q8TDN1-2	KCNG4_HUMAN;.	V	128	ENSP00000312129:A128V	ENSP00000312129:A128V	A	-	2	0	KCNG4	82828210	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	4.632000	0.61311	2.374000	0.81015	0.549000	0.68633	GCG	KCNG4	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,prints_K_chnl,prints_K_chnl_volt-dep_Kv9	ENSG00000168418		0.637	KCNG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNG4	HGNC	protein_coding	OTTHUMT00000269079.2	44	0.00	0	G	NM_172347		84270709	84270709	-1	no_errors	ENST00000308251	ensembl	human	known	69_37n	missense	14	34.78	8	SNP	0.996	A
KCTD8	386617	genome.wustl.edu	37	4	44177076	44177077	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr4:44177076_44177077insA	ENST00000360029.3	-	2	1435_1436	c.1152_1153insT	c.(1150-1155)cctaacfs	p.N385fs		NM_198353.2	NP_938167.1	Q6ZWB6	KCTD8_HUMAN	potassium channel tetramerization domain containing 8	385					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)|receptor complex (GO:0043235)				central_nervous_system(3)|endometrium(4)|kidney(2)|large_intestine(5)|lung(19)|ovary(1)|prostate(3)|upper_aerodigestive_tract(4)	41						GTTAAAGTGTTAGGTTGGTGAG	0.51										HNSCC(17;0.042)																												dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK123347	CCDS3467.1	4p13	2013-06-20	2013-06-20		ENSG00000183783	ENSG00000183783			22394	protein-coding gene	gene with protein product			"""potassium channel tetramerisation domain containing 8"""				Standard	NM_198353		Approved		uc003gwu.3	Q6ZWB6	OTTHUMG00000099409	ENST00000360029.3:c.1153dupT	4.37:g.44177077_44177077dupA	ENSP00000353129:p.Asn385fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU39	Frame_Shift_Ins	INS	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.N384fs	ENST00000360029.3	37	c.1153_1152	CCDS3467.1	4																																																																																			KCTD8	-	NULL	ENSG00000183783		0.510	KCTD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD8	HGNC	protein_coding	OTTHUMT00000216868.1	142	0.70	1	-			44177076	44177077	-1	no_errors	ENST00000360029	ensembl	human	known	69_37n	frame_shift_ins	162	14.74	28	INS	0.980:0.743	A
KIF4B	285643	genome.wustl.edu	37	5	154395548	154395548	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr5:154395548C>T	ENST00000435029.4	+	1	2289	c.2129C>T	c.(2128-2130)gCc>gTc	p.A710V		NM_001099293.1	NP_001092763.1	Q2VIQ3	KIF4B_HUMAN	kinesin family member 4B	710	Interaction with PRC1. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|plus-end-directed microtubule motor activity (GO:0008574)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(13)|lung(27)|ovary(2)|upper_aerodigestive_tract(1)	58	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GCAGCAGCTGCCAACAAGCGA	0.488																																						dbGAP											0													89.0	90.0	90.0					5																	154395548		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF241316	CCDS47324.1	5q33.2	2010-06-22			ENSG00000226650	ENSG00000226650		"""Kinesins"""	6322	protein-coding gene	gene with protein product		609184					Standard	NM_001099293		Approved		uc010jih.1	Q2VIQ3	OTTHUMG00000164143	ENST00000435029.4:c.2129C>T	5.37:g.154395548C>T	ENSP00000387875:p.Ala710Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A710V	ENST00000435029.4	37	c.2129	CCDS47324.1	5	.	.	.	.	.	.	.	.	.	.	c	12.62	1.992737	0.35131	.	.	ENSG00000226650	ENST00000435029	T	0.16743	2.32	2.54	2.54	0.30619	.	.	.	.	.	T	0.17492	0.0420	L	0.41710	1.295	0.80722	D	1	P	0.45283	0.855	P	0.48304	0.573	T	0.04650	-1.0936	9	0.15499	T	0.54	.	10.7682	0.46305	0.0:1.0:0.0:0.0	.	710	Q2VIQ3	KIF4B_HUMAN	V	710	ENSP00000387875:A710V	ENSP00000387875:A710V	A	+	2	0	KIF4B	154375741	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.310000	0.51911	1.138000	0.42230	0.563000	0.77884	GCC	KIF4B	-	NULL	ENSG00000226650		0.488	KIF4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4B	HGNC	protein_coding	OTTHUMT00000377478.1	101	0.00	0	C			154395548	154395548	+1	no_errors	ENST00000435029	ensembl	human	known	69_37n	missense	121	36.65	70	SNP	1.000	T
MLNR	2862	genome.wustl.edu	37	13	49796405	49796405	+	Silent	SNP	G	G	A			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr13:49796405G>A	ENST00000218721.1	+	2	1131	c.1131G>A	c.(1129-1131)ccG>ccA	p.P377P	MLNR_ENST00000398307.1_3'UTR	NM_001507.1	NP_001498.1	O43193	MTLR_HUMAN	motilin receptor	377					digestion (GO:0007586)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|growth hormone-releasing hormone receptor activity (GO:0016520)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)	14		all_lung(13;8.31e-06)|Lung NSC(96;0.000251)|Breast(56;0.0008)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;6.1e-09)		AGTCCAGGCCGAGAGGCTTCC	0.552																																						dbGAP											0													67.0	67.0	67.0					13																	49796405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034632	CCDS9414.1	13q14-q21	2012-08-08	2004-05-27	2004-05-28	ENSG00000102539	ENSG00000102539		"""GPCR / Class A : Motilin receptors"""	4495	protein-coding gene	gene with protein product		602885	"""G protein-coupled receptor 38"""	GPR38		9441746	Standard	NM_001507		Approved		uc010tgj.2	O43193	OTTHUMG00000016909	ENST00000218721.1:c.1131G>A	13.37:g.49796405G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_GHS1_rcpt	p.P377	ENST00000218721.1	37	c.1131	CCDS9414.1	13																																																																																			MLNR	-	NULL	ENSG00000102539		0.552	MLNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLNR	HGNC	protein_coding	OTTHUMT00000044897.1	54	0.00	0	G	NM_001507		49796405	49796405	+1	no_errors	ENST00000218721	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	0.000	A
NID1	4811	genome.wustl.edu	37	1	236143802	236143802	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr1:236143802C>T	ENST00000264187.6	-	17	3461	c.3379G>A	c.(3379-3381)Gat>Aat	p.D1127N	NID1_ENST00000366595.3_Missense_Mutation_p.D994N	NM_002508.2	NP_002499.2	P14543	NID1_HUMAN	nidogen 1	1127					basement membrane organization (GO:0071711)|cell-matrix adhesion (GO:0007160)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)|positive regulation of cell-substrate adhesion (GO:0010811)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|cell periphery (GO:0071944)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|laminin binding (GO:0043236)|proteoglycan binding (GO:0043394)			breast(4)|endometrium(9)|kidney(1)|large_intestine(23)|lung(20)|pancreas(1)|prostate(4)|skin(3)|urinary_tract(1)	66	Ovarian(103;0.0544)|Breast(184;0.23)	all_cancers(173;0.00491)|Prostate(94;0.184)|Acute lymphoblastic leukemia(190;0.229)	OV - Ovarian serous cystadenocarcinoma(106;0.00162)		Urokinase(DB00013)	TCACCTGCATCCACCCAGCAG	0.577																																						dbGAP											0													89.0	75.0	79.0					1																	236143802		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC045606	CCDS1608.1	1q43	2011-05-08	2005-06-02	2005-06-02	ENSG00000116962	ENSG00000116962			7821	protein-coding gene	gene with protein product		131390	"""nidogen (enactin)"""	NID		2471408, 7557988	Standard	NM_002508		Approved	entactin	uc001hxo.3	P14543	OTTHUMG00000040071	ENST00000264187.6:c.3379G>A	1.37:g.236143802C>T	ENSP00000264187:p.Asp1127Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14942|Q59FL2|Q5TAF2|Q5TAF3|Q86XD7	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EGF-like_Ca-bd,smart_EGF-like,smart_G2_nidogen/fibulin_G2F,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.D1127N	ENST00000264187.6	37	c.3379	CCDS1608.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.713121	0.96830	.	.	ENSG00000116962	ENST00000264187;ENST00000366595	T;T	0.38077	1.16;1.16	5.65	5.65	0.86999	Six-bladed beta-propeller, TolB-like (1);	0.041279	0.85682	D	0.000000	T	0.72070	0.3415	M	0.93763	3.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.997	T	0.78927	-0.2011	10	0.87932	D	0	.	20.0887	0.97806	0.0:1.0:0.0:0.0	.	994;1127	P14543-2;P14543	.;NID1_HUMAN	N	1127;994	ENSP00000264187:D1127N;ENSP00000355554:D994N	ENSP00000264187:D1127N	D	-	1	0	NID1	234210425	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.729000	0.84864	2.825000	0.97269	0.655000	0.94253	GAT	NID1	-	smart_LDLR_classB_rpt	ENSG00000116962		0.577	NID1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID1	HGNC	protein_coding	OTTHUMT00000096647.2	72	0.00	0	C	NM_002508		236143802	236143802	-1	no_errors	ENST00000264187	ensembl	human	known	69_37n	missense	44	31.25	20	SNP	1.000	T
NLRP5	126206	genome.wustl.edu	37	19	56515226	56515226	+	Silent	SNP	C	C	G			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr19:56515226C>G	ENST00000390649.3	+	2	207	c.207C>G	c.(205-207)ctC>ctG	p.L69L		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	69	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		AATGGTGTCTCTATGAGCTAG	0.428																																						dbGAP											0													108.0	102.0	104.0					19																	56515226		1871	4117	5988	-	-	-	SO:0001819	synonymous_variant	0			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.207C>G	19.37:g.56515226C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTY4|Q86W29	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L69	ENST00000390649.3	37	c.207	CCDS12938.1	19																																																																																			NLRP5	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000171487		0.428	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	99	0.00	0	C	NM_153447		56515226	56515226	+1	no_errors	ENST00000390649	ensembl	human	known	69_37n	silent	98	14.04	16	SNP	0.038	G
OR13C8	138802	genome.wustl.edu	37	9	107332253	107332253	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr9:107332253G>C	ENST00000335040.1	+	1	805	c.805G>C	c.(805-807)Gat>Cat	p.D269H		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	269						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						AGCCTCTGTTGATTCAGGTAA	0.453																																						dbGAP											0													110.0	96.0	101.0					9																	107332253		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.805G>C	9.37:g.107332253G>C	ENSP00000334068:p.Asp269His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVG0|Q96R44	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D269H	ENST00000335040.1	37	c.805	CCDS35090.1	9	.	.	.	.	.	.	.	.	.	.	G	0.902	-0.722045	0.03182	.	.	ENSG00000186943	ENST00000335040	T	0.00123	8.7	4.34	3.44	0.39384	GPCR, rhodopsin-like superfamily (1);	1.267620	0.05478	N	0.554237	T	0.00178	0.0005	L	0.41573	1.285	0.09310	N	1	B	0.06786	0.001	B	0.10450	0.005	T	0.47535	-0.9110	10	0.62326	D	0.03	.	10.5183	0.44903	0.0965:0.0:0.9035:0.0	.	269	Q8NGS7	O13C8_HUMAN	H	269	ENSP00000334068:D269H	ENSP00000334068:D269H	D	+	1	0	OR13C8	106372074	0.007000	0.16637	0.008000	0.14137	0.001000	0.01503	0.939000	0.28978	1.410000	0.46936	0.561000	0.74099	GAT	OR13C8	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186943		0.453	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C8	HGNC	protein_coding	OTTHUMT00000053480.1	74	0.00	0	G			107332253	107332253	+1	no_errors	ENST00000335040	ensembl	human	known	69_37n	missense	32	37.25	19	SNP	0.003	C
OR6K2	81448	genome.wustl.edu	37	1	158669983	158669983	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr1:158669983T>C	ENST00000359610.2	-	1	503	c.460A>G	c.(460-462)Aca>Gca	p.T154A		NM_001005279.1	NP_001005279.1	Q8NGY2	OR6K2_HUMAN	olfactory receptor, family 6, subfamily K, member 2	154						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	46	all_hematologic(112;0.0378)					GGAAGGGGTGTGATAAAGCCA	0.488																																						dbGAP											0													125.0	108.0	114.0					1																	158669983		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004196	CCDS30902.1	1q23.1	2012-08-09			ENSG00000196171	ENSG00000196171		"""GPCR / Class A : Olfactory receptors"""	15029	protein-coding gene	gene with protein product							Standard	NM_001005279		Approved		uc001fsu.1	Q8NGY2	OTTHUMG00000022768	ENST00000359610.2:c.460A>G	1.37:g.158669983T>C	ENSP00000352626:p.Thr154Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH33|Q6IFR6	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.T154A	ENST00000359610.2	37	c.460	CCDS30902.1	1	.	.	.	.	.	.	.	.	.	.	T	8.640	0.895854	0.17686	.	.	ENSG00000196171	ENST00000359610	T	0.36157	1.27	4.84	2.49	0.30216	GPCR, rhodopsin-like superfamily (1);	0.188890	0.25753	N	0.028521	T	0.07863	0.0197	N	0.13235	0.315	0.09310	N	1	P	0.42161	0.772	P	0.47251	0.542	T	0.08330	-1.0727	10	0.16896	T	0.51	-1.637	0.8363	0.01140	0.1606:0.1744:0.1672:0.4978	.	154	Q8NGY2	OR6K2_HUMAN	A	154	ENSP00000352626:T154A	ENSP00000352626:T154A	T	-	1	0	OR6K2	156936607	0.000000	0.05858	0.030000	0.17652	0.986000	0.74619	-0.564000	0.05936	0.328000	0.23435	0.528000	0.53228	ACA	OR6K2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000196171		0.488	OR6K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K2	HGNC	protein_coding	OTTHUMT00000059061.1	80	0.00	0	T	NM_001005279		158669983	158669983	-1	no_errors	ENST00000359610	ensembl	human	known	69_37n	missense	54	39.33	35	SNP	0.012	C
PLXNB2	23654	genome.wustl.edu	37	22	50719361	50719361	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr22:50719361C>T	ENST00000449103.1	-	24	3945	c.3805G>A	c.(3805-3807)Gag>Aag	p.E1269K	PLXNB2_ENST00000359337.4_Missense_Mutation_p.E1269K|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1269					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.E1312K(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ATGCCGGCCTCGTGCACGTCG	0.647																																						dbGAP											1	Substitution - Missense(1)	cervix(1)											77.0	89.0	85.0					22																	50719361		2167	4250	6417	-	-	-	SO:0001583	missense	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3805G>A	22.37:g.50719361C>T	ENSP00000409171:p.Glu1269Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.E1269K	ENST00000449103.1	37	c.3805	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821542	0.90873	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.03242	4.0;4.0	4.38	4.38	0.52667	.	0.306262	0.27715	N	0.018156	T	0.15132	0.0365	M	0.68593	2.085	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.13926	-1.0491	10	0.20519	T	0.43	.	17.0975	0.86639	0.0:1.0:0.0:0.0	.	1269	O15031	PLXB2_HUMAN	K	1269	ENSP00000409171:E1269K;ENSP00000352288:E1269K	ENSP00000352288:E1269K	E	-	1	0	PLXNB2	49061488	1.000000	0.71417	0.993000	0.49108	0.548000	0.35241	7.329000	0.79170	2.270000	0.75569	0.561000	0.74099	GAG	PLXNB2	-	NULL	ENSG00000196576		0.647	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	77	0.00	0	C	NM_012401		50719361	50719361	-1	no_errors	ENST00000359337	ensembl	human	known	69_37n	missense	8	70.37	19	SNP	1.000	T
RAB38	23682	genome.wustl.edu	37	11	87908404	87908404	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr11:87908404A>T	ENST00000243662.6	-	1	231	c.149T>A	c.(148-150)gTg>gAg	p.V50E	MIR3166_ENST00000577344.1_RNA	NM_022337.2	NP_071732.1	P57729	RAB38_HUMAN	RAB38, member RAS oncogene family	50					endosome to melanosome transport (GO:0035646)|GTP catabolic process (GO:0006184)|melanosome organization (GO:0032438)|phagosome acidification (GO:0090383)|platelet dense granule organization (GO:0060155)|protein localization to membrane (GO:0072657)|protein transport (GO:0015031)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|early endosome (GO:0005769)|melanosome (GO:0042470)|membrane (GO:0016020)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)	AP-1 adaptor complex binding (GO:0035650)|AP-3 adaptor complex binding (GO:0035651)|GTP binding (GO:0005525)|GTP-dependent protein binding (GO:0030742)|GTPase activity (GO:0003924)|protein complex binding (GO:0032403)			large_intestine(2)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				CCAGTGGAGCACCTTGAGCGC	0.657																																						dbGAP											0													81.0	58.0	66.0					11																	87908404		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF235022	CCDS8281.1	11q14	2008-05-14			ENSG00000123892	ENSG00000123892		"""RAB, member RAS oncogene"""	9776	protein-coding gene	gene with protein product		606281				10910072	Standard	NM_022337		Approved	NY-MEL-1	uc001pcj.2	P57729	OTTHUMG00000167288	ENST00000243662.6:c.149T>A	11.37:g.87908404A>T	ENSP00000243662:p.Val50Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XK7	Splice_Site	SNP	-	e1+2	ENST00000243662.6	37	c.197+2	CCDS8281.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	25.7|25.7	4.662269|4.662269	0.88251|0.88251	.|.	.|.	ENSG00000123892|ENSG00000123892	ENST00000526372|ENST00000243662	.|T	.|0.75260	.|-0.92	5.2|5.2	5.2|5.2	0.72013|0.72013	.|Small GTP-binding protein domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	.|T	.|0.73745	.|0.3626	N|N	0.12471|0.12471	0.22|0.22	0.80722|0.80722	D|D	1|1	.|D	.|0.67145	.|0.996	.|D	.|0.73380	.|0.98	.|T	.|0.73968	.|-0.3815	.|9	.|.	.|.	.|.	.|-2.4681	15.238|15.238	0.73447|0.73447	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	.|50	.|P57729	.|RAB38_HUMAN	.|E	-1|50	.|ENSP00000243662:V50E	.|.	.|V	-|-	.|2	.|0	RAB38|RAB38	87548052|87548052	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	9.028000|9.028000	0.93712|0.93712	2.174000|2.174000	0.68829|0.68829	0.533000|0.533000	0.62120|0.62120	.|GTG	RAB38	-	-	ENSG00000123892		0.657	RAB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB38	HGNC	protein_coding	OTTHUMT00000394015.2	45	0.00	0	A			87908404	87908404	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000526372	ensembl	human	putative	69_37n	splice_site	12	31.58	6	SNP	1.000	T
SEC16A	9919	genome.wustl.edu	37	9	139368956	139368956	+	Missense_Mutation	SNP	C	C	G	rs371501249		TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr9:139368956C>G	ENST00000371706.3	-	1	2611	c.2578G>C	c.(2578-2580)Gac>Cac	p.D860H	SEC16A_ENST00000431893.2_Missense_Mutation_p.D860H|SEC16A_ENST00000290037.6_Missense_Mutation_p.D860H|SEC16A_ENST00000313050.7_Missense_Mutation_p.D1038H			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	860					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TAAAAACGGTCAAGGTTAGGC	0.587																																						dbGAP											0													23.0	24.0	24.0					9																	139368956		1910	4126	6036	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2578G>C	9.37:g.139368956C>G	ENSP00000360771:p.Asp860His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.D1038H	ENST00000371706.3	37	c.3112		9	.	.	.	.	.	.	.	.	.	.	C	16.31	3.088178	0.55968	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.24723	1.84;1.84;1.84;1.84	5.54	5.54	0.83059	.	0.286274	0.39210	N	0.001433	T	0.42944	0.1225	M	0.63428	1.95	0.43084	D	0.994748	D;D;D	0.71674	0.997;0.998;0.998	P;P;P	0.58873	0.707;0.847;0.847	T	0.16748	-1.0392	10	0.46703	T	0.11	-21.2148	13.7782	0.63066	0.0:0.7461:0.2539:0.0	.	1038;860;860	F1T0I1;O15027-5;O15027-4	.;.;.	H	1038;860;860;860	ENSP00000325827:D1038H;ENSP00000360771:D860H;ENSP00000290037:D860H;ENSP00000387583:D860H	ENSP00000290037:D860H	D	-	1	0	SEC16A	138488777	1.000000	0.71417	0.036000	0.18154	0.013000	0.08279	4.227000	0.58612	2.760000	0.94817	0.655000	0.94253	GAC	SEC16A	-	NULL	ENSG00000148396		0.587	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	24	0.00	0	C	XM_088459		139368956	139368956	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	19	47.22	17	SNP	0.193	G
SEC16A	9919	genome.wustl.edu	37	9	139369265	139369265	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr9:139369265C>G	ENST00000371706.3	-	1	2302	c.2269G>C	c.(2269-2271)Gag>Cag	p.E757Q	SEC16A_ENST00000431893.2_Missense_Mutation_p.E757Q|SEC16A_ENST00000290037.6_Missense_Mutation_p.E757Q|SEC16A_ENST00000313050.7_Missense_Mutation_p.E935Q			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	757					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		ACCAAGTTCTCTGGAACTGGC	0.473																																						dbGAP											0													98.0	97.0	98.0					9																	139369265		1885	4130	6015	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2269G>C	9.37:g.139369265C>G	ENSP00000360771:p.Glu757Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.E935Q	ENST00000371706.3	37	c.2803		9	.	.	.	.	.	.	.	.	.	.	C	3.998	-0.003138	0.07773	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.22945	1.93;1.93;1.93;1.93	4.51	-0.806	0.10875	.	1.636150	0.03170	N	0.170525	T	0.12987	0.0315	N	0.12182	0.205	0.09310	N	1	B;B;B	0.11235	0.003;0.004;0.004	B;B;B	0.13407	0.004;0.009;0.009	T	0.18587	-1.0332	10	0.13470	T	0.59	-1.4176	4.5119	0.11915	0.0:0.3117:0.2646:0.4236	.	935;757;757	F1T0I1;O15027-5;O15027-4	.;.;.	Q	935;757;757;757	ENSP00000325827:E935Q;ENSP00000360771:E757Q;ENSP00000290037:E757Q;ENSP00000387583:E757Q	ENSP00000290037:E757Q	E	-	1	0	SEC16A	138489086	0.009000	0.17119	0.000000	0.03702	0.394000	0.30568	0.613000	0.24299	0.051000	0.15978	-0.302000	0.09304	GAG	SEC16A	-	NULL	ENSG00000148396		0.473	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	40	0.00	0	C	XM_088459		139369265	139369265	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	82	34.92	44	SNP	0.000	G
SEC16A	9919	genome.wustl.edu	37	9	139369436	139369436	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr9:139369436C>T	ENST00000371706.3	-	1	2131	c.2098G>A	c.(2098-2100)Gat>Aat	p.D700N	SEC16A_ENST00000431893.2_Missense_Mutation_p.D700N|SEC16A_ENST00000290037.6_Missense_Mutation_p.D700N|SEC16A_ENST00000313050.7_Missense_Mutation_p.D878N			O15027	SC16A_HUMAN	SEC16 homolog A (S. cerevisiae)	700					COPII vesicle coating (GO:0048208)|endoplasmic reticulum organization (GO:0007029)|protein transport (GO:0015031)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)				breast(1)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(15)|lung(14)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Myeloproliferative disorder(178;0.0511)		Epithelial(140;2.9e-06)|OV - Ovarian serous cystadenocarcinoma(145;5.88e-06)		TCCCCAGAATCACCACCGAGA	0.498																																						dbGAP											0													36.0	37.0	37.0					9																	139369436		1986	4160	6146	-	-	-	SO:0001583	missense	0			AK074565	CCDS55351.1, CCDS75936.1	9q34.3	2007-06-20	2007-06-20	2007-06-20	ENSG00000148396	ENSG00000148396			29006	protein-coding gene	gene with protein product		612854	"""KIAA0310"""	KIAA0310		9205841	Standard	NM_014866		Approved	p250	uc004chx.3	O15027	OTTHUMG00000020932	ENST00000371706.3:c.2098G>A	9.37:g.139369436C>T	ENSP00000360771:p.Asp700Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1YCA4|Q4G0D7|Q5SXP0|Q5SXP1|Q8N347|Q96HP1	Missense_Mutation	SNP	NULL	p.D878N	ENST00000371706.3	37	c.2632		9	.	.	.	.	.	.	.	.	.	.	C	25.8	4.680102	0.88542	.	.	ENSG00000148396	ENST00000313050;ENST00000371706;ENST00000290037;ENST00000431893	T;T;T;T	0.22743	1.95;1.94;1.94;1.94	5.41	5.41	0.78517	.	0.234087	0.31909	N	0.006869	T	0.38081	0.1027	M	0.63428	1.95	0.80722	D	1	D;D;D	0.63046	0.986;0.992;0.992	P;P;P	0.55923	0.738;0.787;0.787	T	0.02132	-1.1208	10	0.25106	T	0.35	-24.692	18.5432	0.91037	0.0:1.0:0.0:0.0	.	878;700;700	F1T0I1;O15027-5;O15027-4	.;.;.	N	878;700;700;700	ENSP00000325827:D878N;ENSP00000360771:D700N;ENSP00000290037:D700N;ENSP00000387583:D700N	ENSP00000290037:D700N	D	-	1	0	SEC16A	138489257	0.746000	0.28272	0.071000	0.20095	0.437000	0.31866	3.526000	0.53509	2.704000	0.92352	0.655000	0.94253	GAT	SEC16A	-	NULL	ENSG00000148396		0.498	SEC16A-001	KNOWN	basic	protein_coding	SEC16A	HGNC	protein_coding	OTTHUMT00000055077.1	35	0.00	0	C	XM_088459		139369436	139369436	-1	no_errors	ENST00000313050	ensembl	human	known	69_37n	missense	51	31.08	23	SNP	0.536	T
SEMA3C	10512	genome.wustl.edu	37	7	80418832	80418834	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr7:80418832_80418834delCTC	ENST00000265361.3	-	12	1703_1705	c.1142_1144delGAG	c.(1141-1146)ggagca>gca	p.G381del	SEMA3C_ENST00000544525.1_In_Frame_Del_p.G399del|SEMA3C_ENST00000419255.2_In_Frame_Del_p.G381del	NM_006379.3	NP_006370.1	Q99985	SEM3C_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3C	381	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|blood vessel remodeling (GO:0001974)|cardiac right ventricle morphogenesis (GO:0003215)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|immune response (GO:0006955)|limb bud formation (GO:0060174)|neural crest cell migration (GO:0001755)|neural tube development (GO:0021915)|outflow tract morphogenesis (GO:0003151)|post-embryonic development (GO:0009791)|pulmonary myocardium development (GO:0003350)|response to drug (GO:0042493)|somitogenesis (GO:0001756)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	receptor activity (GO:0004872)			NS(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						GGTGTAAATGCTCCTCCTGGACA	0.365																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AB000220	CCDS5596.1	7q21-q31	2013-01-11			ENSG00000075223	ENSG00000075223		"""Semaphorins"", ""Immunoglobulin superfamily / I-set domain containing"""	10725	protein-coding gene	gene with protein product		602645		SEMAE		7748561, 9168980	Standard	NM_006379		Approved	SemE	uc003uhj.3	Q99985	OTTHUMG00000023447	ENST00000265361.3:c.1142_1144delGAG	7.37:g.80418835_80418837delCTC	ENSP00000265361:p.Gly381del	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRL8	In_Frame_Del	DEL	pfam_Semaphorin/CD100_Ag,pfam_Ig_I-set,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.G399in_frame_del	ENST00000265361.3	37	c.1198_1196	CCDS5596.1	7																																																																																			SEMA3C	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000075223		0.365	SEMA3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3C	HGNC	protein_coding	OTTHUMT00000253279.1	70	0.00	0	CTC	NM_006379		80418832	80418834	-1	no_errors	ENST00000544525	ensembl	human	known	69_37n	in_frame_del	54	38.89	35	DEL	1.000:1.000:1.000	-
SEPT14	346288	genome.wustl.edu	37	7	55914275	55914275	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr7:55914275C>T	ENST00000388975.3	-	3	226	c.110G>A	c.(109-111)tGt>tAt	p.C37Y	SEPT14_ENST00000477628.1_5'UTR	NM_207366.2	NP_997249.2	Q6ZU15	SEP14_HUMAN	septin 14	37					cell cycle (GO:0007049)|cell division (GO:0051301)	septin complex (GO:0031105)	GTP binding (GO:0005525)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(15)|skin(2)	23	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			ATTGGGCAAACATTCAAAACC	0.303																																						dbGAP											0													146.0	137.0	140.0					7																	55914275		1828	4096	5924	-	-	-	SO:0001583	missense	0			AK126048	CCDS5519.2	7p11.2	2013-01-21			ENSG00000154997	ENSG00000154997		"""Septins"""	33280	protein-coding gene	gene with protein product		612140					Standard	NM_207366		Approved	FLJ44060	uc003tqz.2	Q6ZU15	OTTHUMG00000129341	ENST00000388975.3:c.110G>A	7.37:g.55914275C>T	ENSP00000373627:p.Cys37Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCC2|B4DXD6	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pirsf_Septin	p.C37Y	ENST00000388975.3	37	c.110	CCDS5519.2	7	.	.	.	.	.	.	.	.	.	.	c	21.3	4.131932	0.77662	.	.	ENSG00000154997	ENST00000388975	T	0.32753	1.44	4.4	4.4	0.53042	.	0.553563	0.15010	N	0.285641	T	0.32224	0.0822	L	0.27053	0.805	0.42002	D	0.990897	D	0.54397	0.966	P	0.49421	0.61	T	0.21348	-1.0248	10	0.87932	D	0	.	15.2825	0.73797	0.0:1.0:0.0:0.0	.	37	Q6ZU15	SEP14_HUMAN	Y	37	ENSP00000373627:C37Y	ENSP00000373627:C37Y	C	-	2	0	SEPT14	55881769	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.977000	0.49297	2.385000	0.81259	0.655000	0.94253	TGT	SEPT14	-	pirsf_Septin	ENSG00000154997		0.303	SEPT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT14	HGNC	protein_coding	OTTHUMT00000251489.2	93	0.00	0	C	NM_207366		55914275	55914275	-1	no_errors	ENST00000388975	ensembl	human	known	69_37n	missense	50	38.27	31	SNP	1.000	T
SLC25A3P1	163742	genome.wustl.edu	37	1	53904389	53904389	+	RNA	SNP	G	G	C	rs1299818	byFrequency	TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr1:53904389G>C	ENST00000566100.1	-	0	849									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		ACCTGTAGAGGTCCTCTACCG	0.632													C|||	1833	0.366014	0.7693	0.1686	5008	,	,		15792	0.2599		0.169	False		,,,				2504	0.273					dbGAP											0																																										-	-	-			0					1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53904389G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			SLC25A3P1	-	-	ENSG00000236253		0.632	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	8	0.00	0	G	NM_178501		53904389	53904389	-1	no_errors	ENST00000562700	ensembl	human	known	69_37n	rna	7	46.15	6	SNP	0.879	C
STAT2	6773	genome.wustl.edu	37	12	56737619	56737619	+	Missense_Mutation	SNP	C	C	A	rs376647660		TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr12:56737619C>A	ENST00000314128.4	-	23	2426	c.2403G>T	c.(2401-2403)gaG>gaT	p.E801D	STAT2_ENST00000557235.1_Missense_Mutation_p.E797D|STAT2_ENST00000556539.1_5'UTR			P52630	STAT2_HUMAN	signal transducer and activator of transcription 2, 113kDa	801					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|JAK-STAT cascade (GO:0007259)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			NS(1)|endometrium(2)|kidney(5)|large_intestine(7)|liver(2)|lung(10)|ovary(1)|skin(3)	31						TTTCCATTGGCTCAGTGTTCA	0.483																																						dbGAP											0													220.0	192.0	201.0					12																	56737619		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051284	CCDS8917.1, CCDS55836.1	12q13.2	2013-02-14	2002-08-29			ENSG00000170581		"""SH2 domain containing"""	11363	protein-coding gene	gene with protein product		600556	"""signal transducer and activator of transcription 2, 113kD"""			7885841	Standard	NM_005419		Approved	STAT113	uc001slc.3	P52630		ENST00000314128.4:c.2403G>T	12.37:g.56737619C>A	ENSP00000315768:p.Glu801Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLC7|G3V2M6|Q16430|Q16431|Q9UDL4	Missense_Mutation	SNP	pfam_STAT_TF_DNA-bd,pfam_STAT_TF_alpha,pfam_STAT_TF_prot_interaction,pfam_STAT2_C,pfam_SH2,superfamily_p53-like_TF_DNA-bd,superfamily_STAT_TF_coiled-coil,superfamily_STAT_TF_prot_interaction,smart_STAT_TF_prot_interaction,smart_SH2,pfscan_SH2	p.E801D	ENST00000314128.4	37	c.2403	CCDS8917.1	12	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095345	0.36952	.	.	ENSG00000170581	ENST00000314128;ENST00000557235	T;T	0.48836	0.8;0.8	4.24	-2.53	0.06326	Signal transducer and activation of transcription 2, C-terminal (1);	1.351780	0.04858	N	0.443540	T	0.24624	0.0597	N	0.17082	0.46	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.12156	0.004;0.007	T	0.08889	-1.0700	10	0.14252	T	0.57	-1.055	1.2425	0.01966	0.4247:0.2632:0.139:0.1731	.	797;801	G3V2M6;P52630	.;STAT2_HUMAN	D	801;797	ENSP00000315768:E801D;ENSP00000450751:E797D	ENSP00000315768:E801D	E	-	3	2	STAT2	55023886	0.000000	0.05858	0.000000	0.03702	0.817000	0.46193	-2.423000	0.01030	-0.500000	0.06614	-0.314000	0.08810	GAG	STAT2	-	pfam_STAT2_C	ENSG00000170581		0.483	STAT2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STAT2	HGNC	protein_coding	OTTHUMT00000410277.1	101	0.98	1	C	NM_005419		56737619	56737619	-1	no_errors	ENST00000314128	ensembl	human	known	69_37n	missense	74	41.41	53	SNP	0.000	A
ZNF598	90850	genome.wustl.edu	37	16	2048316	2048316	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr16:2048316C>T	ENST00000563630.1	-	12	2709	c.2467G>A	c.(2467-2469)Gat>Aat	p.D823N	ZNF598_ENST00000431526.1_Missense_Mutation_p.D878N|ZNF598_ENST00000562103.1_Missense_Mutation_p.D823N|AC005606.15_ENST00000567515.1_lincRNA			Q86UK7	ZN598_HUMAN	zinc finger protein 598	878							poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|lung(7)|skin(1)|urinary_tract(1)	16						CTGCTGGCATCGCCATGCGCG	0.682																																						dbGAP											0													69.0	80.0	76.0					16																	2048316		2107	4222	6329	-	-	-	SO:0001583	missense	0			BC029270		16p13.3	2008-05-02				ENSG00000167962		"""Zinc fingers, C2H2-type"""	28079	protein-coding gene	gene with protein product							Standard	NM_178167		Approved	FLJ00086	uc002cof.2	Q86UK7		ENST00000563630.1:c.2467G>A	16.37:g.2048316C>T	ENSP00000455882:p.Asp823Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IW49|Q8N3D9|Q96FG3|Q9H7J3	Missense_Mutation	SNP	superfamily_PAH,smart_Znf_C2H2-like,pfscan_Znf_RING	p.D878N	ENST00000563630.1	37	c.2632		16	.	.	.	.	.	.	.	.	.	.	.	17.56	3.420836	0.62622	.	.	ENSG00000167962	ENST00000431526	T	0.32988	1.43	4.42	4.42	0.53409	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.61286	0.2335	M	0.86420	2.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.70281	-0.4915	10	0.87932	D	0	-28.2948	16.2139	0.82191	0.0:1.0:0.0:0.0	.	878;870	Q86UK7;Q86UK7-2	ZN598_HUMAN;.	N	878	ENSP00000411409:D878N	ENSP00000411409:D878N	D	-	1	0	ZNF598	1988317	1.000000	0.71417	0.165000	0.22776	0.088000	0.18126	7.070000	0.76763	2.290000	0.77057	0.563000	0.77884	GAT	ZNF598	-	smart_Znf_C2H2-like	ENSG00000167962		0.682	ZNF598-001	NOVEL	basic	protein_coding	ZNF598	HGNC	protein_coding	OTTHUMT00000434439.1	47	0.00	0	C	NM_178167		2048316	2048316	-1	no_errors	ENST00000431526	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	0.998	T
ZNF700	90592	genome.wustl.edu	37	19	12060223	12060223	+	Missense_Mutation	SNP	C	C	G	rs147964839		TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr19:12060223C>G	ENST00000254321.5	+	4	1527	c.1384C>G	c.(1384-1386)Cga>Gga	p.R462G	CTD-2006C1.12_ENST00000586394.1_RNA|ZNF763_ENST00000591944.1_Intron|ZNF763_ENST00000590798.1_Intron|ZNF763_ENST00000538752.1_Intron|ZNF700_ENST00000482090.1_Missense_Mutation_p.R444G	NM_001271848.1|NM_144566.1	NP_001258777.1|NP_653167.1	Q9H0M5	ZN700_HUMAN	zinc finger protein 700	462					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)		ZNF700/MAST1_ENST00000251472(2)	breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|pancreas(1)|prostate(1)|urinary_tract(1)	33						CTCACACCTTCGAGTGCATGG	0.468																																						dbGAP											0													83.0	80.0	81.0					19																	12060223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136732	CCDS32915.1, CCDS74289.1	19p13.2	2013-01-08			ENSG00000196757	ENSG00000196757		"""Zinc fingers, C2H2-type"", ""-"""	25292	protein-coding gene	gene with protein product							Standard	NM_144566		Approved	DKFZp434I1610	uc031rjk.1	Q9H0M5	OTTHUMG00000156421	ENST00000254321.5:c.1384C>G	19.37:g.12060223C>G	ENSP00000254321:p.Arg462Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGU4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R462G	ENST00000254321.5	37	c.1384	CCDS32915.1	19	.	.	.	.	.	.	.	.	.	.	c	6.817	0.519782	0.13005	.	.	ENSG00000196757	ENST00000254321	T	0.35973	1.28	0.419	0.419	0.16438	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.38321	0.1036	M	0.82132	2.575	0.09310	N	1	P	0.43973	0.823	P	0.45099	0.469	T	0.25222	-1.0138	9	0.31617	T	0.26	.	2.5547	0.04757	0.3105:0.3783:0.3112:0.0	.	462	Q9H0M5	ZN700_HUMAN	G	462	ENSP00000254321:R462G	ENSP00000254321:R462G	R	+	1	2	ZNF700	11921223	0.000000	0.05858	0.012000	0.15200	0.077000	0.17291	-3.436000	0.00471	0.444000	0.26612	0.195000	0.17529	CGA	ZNF700	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196757		0.468	ZNF700-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF700	HGNC	protein_coding	OTTHUMT00000344126.2	82	0.00	0	C	NM_144566		12060223	12060223	+1	no_errors	ENST00000254321	ensembl	human	known	69_37n	missense	110	32.93	54	SNP	0.008	G
ZNF804B	219578	genome.wustl.edu	37	7	88956679	88956679	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FM-01A-11D-A13L-09	TCGA-BH-A1FM-11B-23D-A188-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	7cb17736-03da-4f77-8397-145585a25b1e	e50ac0fd-6812-4747-b18d-243a19c00af5	g.chr7:88956679C>T	ENST00000333190.4	+	3	880	c.271C>T	c.(271-273)Cgg>Tgg	p.R91W		NM_181646.2	NP_857597.1	A4D1E1	Z804B_HUMAN	zinc finger protein 804B	91							metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(5)|kidney(5)|large_intestine(20)|lung(78)|ovary(5)|pancreas(5)|prostate(2)|skin(11)|soft_tissue(1)|upper_aerodigestive_tract(9)	144	all_hematologic(106;0.125)|Lung NSC(181;0.15)|all_lung(186;0.151)		STAD - Stomach adenocarcinoma(171;0.0513)			ATTAAAGCAACGGGAATTTGC	0.338										HNSCC(36;0.09)																												dbGAP											0													69.0	73.0	72.0					7																	88956679		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK056672	CCDS5613.1	7q21.13	2012-10-05	2006-12-18		ENSG00000182348	ENSG00000182348			21958	protein-coding gene	gene with protein product			"""zinc finger 804B"""				Standard	NM_181646		Approved	FLJ32110	uc011khi.2	A4D1E1	OTTHUMG00000131037	ENST00000333190.4:c.271C>T	7.37:g.88956679C>T	ENSP00000329638:p.Arg91Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTV2|Q7Z714|Q96MN7	Missense_Mutation	SNP	pfam_Znf_C2H2_jaz	p.R91W	ENST00000333190.4	37	c.271	CCDS5613.1	7	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392804	0.62066	.	.	ENSG00000182348	ENST00000333190	T	0.20069	2.1	5.04	4.16	0.48862	.	0.000000	0.53938	D	0.000058	T	0.47600	0.1454	M	0.78456	2.415	0.43846	D	0.996438	D	0.89917	1.0	D	0.91635	0.999	T	0.51772	-0.8663	10	0.87932	D	0	-11.7398	14.1916	0.65641	0.3776:0.6224:0.0:0.0	.	91	A4D1E1	Z804B_HUMAN	W	91	ENSP00000329638:R91W	ENSP00000329638:R91W	R	+	1	2	ZNF804B	88794615	1.000000	0.71417	0.898000	0.35279	0.945000	0.59286	4.321000	0.59209	0.830000	0.34757	-0.824000	0.03097	CGG	ZNF804B	-	NULL	ENSG00000182348		0.338	ZNF804B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF804B	HGNC	protein_coding	OTTHUMT00000253683.2	79	0.00	0	C	NM_181646		88956679	88956679	+1	no_errors	ENST00000333190	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	1.000	T
