#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
A2M	2	genome.wustl.edu	37	12	9254262	9254262	+	Nonsense_Mutation	SNP	G	G	T	rs201110464	byFrequency	TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr12:9254262G>T	ENST00000318602.7	-	12	1582	c.1275C>A	c.(1273-1275)taC>taA	p.Y425*		NM_000014.4	NP_000005	P01023	A2MG_HUMAN	alpha-2-macroglobulin	425					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of complement activation, lectin pathway (GO:0001869)|negative regulation of endopeptidase activity (GO:0010951)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|stem cell differentiation (GO:0048863)	blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule lumen (GO:0031093)	calcium-dependent protein binding (GO:0048306)|enzyme binding (GO:0019899)|growth factor binding (GO:0019838)|interleukin-1 binding (GO:0019966)|interleukin-8 binding (GO:0019959)|protease binding (GO:0002020)|receptor binding (GO:0005102)|serine-type endopeptidase inhibitor activity (GO:0004867)|tumor necrosis factor binding (GO:0043120)			breast(1)|central_nervous_system(6)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(17)|lung(30)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	77					Bacitracin(DB00626)|Becaplermin(DB00102)|Ocriplasmin(DB08888)	TACGATCCTTGTAATTGACCT	0.373																																						dbGAP											0													46.0	43.0	44.0					12																	9254262		1857	4107	5964	-	-	-	SO:0001587	stop_gained	0			BX647329, X68728, M11313	CCDS44827.1	12p13.31	2010-02-24			ENSG00000175899	ENSG00000175899			7	protein-coding gene	gene with protein product		103950					Standard	XM_006719056		Approved	FWP007, S863-7, CPAMD5	uc001qvk.1	P01023	OTTHUMG00000150267	ENST00000318602.7:c.1275C>A	12.37:g.9254262G>T	ENSP00000323929:p.Tyr425*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13677|Q59F47|Q5QTS0|Q68DN2|Q6PIY3|Q6PN97	Nonsense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd,superfamily_Beta-lactam/transpept-like,superfamily_Cupredoxin	p.Y425*	ENST00000318602.7	37	c.1275	CCDS44827.1	12	.	.	.	.	.	.	.	.	.	.	G	37	6.519212	0.97633	.	.	ENSG00000175899	ENST00000318602;ENST00000540099	.	.	.	5.69	4.79	0.61399	.	0.960533	0.08677	N	0.910059	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.1914	0.54273	0.0828:0.0:0.9172:0.0	.	.	.	.	X	425;440	.	ENSP00000323929:Y425X	Y	-	3	2	A2M	9145529	1.000000	0.71417	0.203000	0.23512	0.026000	0.11368	2.960000	0.49161	1.397000	0.46682	0.655000	0.94253	TAC	A2M	-	superfamily_Beta-lactam/transpept-like	ENSG00000175899		0.373	A2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A2M	HGNC	protein_coding	OTTHUMT00000317233.2	82	0.00	0	G	NM_000014		9254262	9254262	-1	no_errors	ENST00000318602	ensembl	human	known	69_37n	nonsense	26	63.38	45	SNP	0.969	T
ADAM12	8038	genome.wustl.edu	37	10	127789701	127789701	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr10:127789701A>G	ENST00000368679.4	-	9	1169	c.860T>C	c.(859-861)cTg>cCg	p.L287P	ADAM12_ENST00000368676.4_Missense_Mutation_p.L287P	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12	287	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		CCTCCAGTCCAGAAATTCATG	0.473																																						dbGAP											0													104.0	87.0	92.0					10																	127789701		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.860T>C	10.37:g.127789701A>G	ENSP00000357668:p.Leu287Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,prints_Blood-coag_inhib_Disintegrin,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B	p.L287P	ENST00000368679.4	37	c.860	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	A	26.7	4.759423	0.89932	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	D;D	0.87571	-2.27;-2.27	5.32	5.32	0.75619	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	0.000000	0.64402	D	0.000009	D	0.94042	0.8091	M	0.87269	2.87	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.94612	0.7805	10	0.56958	D	0.05	.	15.448	0.75248	1.0:0.0:0.0:0.0	.	284;284;287;284;287	A8K6G4;O43184-3;O43184-2;O43184-4;O43184	.;.;.;.;ADA12_HUMAN	P	287	ENSP00000357668:L287P;ENSP00000357665:L287P	ENSP00000357665:L287P	L	-	2	0	ADAM12	127779691	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.139000	0.94554	2.233000	0.73108	0.533000	0.62120	CTG	ADAM12	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000148848		0.473	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	101	0.98	1	A			127789701	127789701	-1	no_errors	ENST00000368679	ensembl	human	known	69_37n	missense	54	22.86	16	SNP	1.000	G
ADAMTS2	9509	genome.wustl.edu	37	5	178549700	178549700	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:178549700G>C	ENST00000251582.7	-	20	3134	c.3033C>G	c.(3031-3033)atC>atG	p.I1011M		NM_014244.4	NP_055059.2	O95450	ATS2_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 2	1011	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|lung development (GO:0030324)|protein processing (GO:0016485)|skin development (GO:0043588)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(31)|ovary(1)|pancreas(3)|prostate(2)|skin(7)	72	all_cancers(89;0.000456)|all_epithelial(37;0.000138)|Renal(175;0.000159)|Lung NSC(126;0.00184)|all_lung(126;0.00326)	all_cancers(40;0.00604)|all_neural(177;0.00411)|Medulloblastoma(196;0.00508)|Lung NSC(249;0.0569)|all_lung(500;0.129)|all_hematologic(541;0.211)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)	GBM - Glioblastoma multiforme(465;0.0473)		CCTCCTGGCAGATGCCGAAGC	0.687																																						dbGAP											0													24.0	23.0	23.0					5																	178549700		2139	4210	6349	-	-	-	SO:0001583	missense	0			AJ003125	CCDS4444.1, CCDS34311.1	5q23-q24	2008-07-18	2005-08-19		ENSG00000087116	ENSG00000087116		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	218	protein-coding gene	gene with protein product	"""procollagen I N-proteinase"", ""procollagen N-endopeptidase"""	604539	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 2"""			10094461, 15373769	Standard	NM_014244		Approved	ADAMTS-3, hPCPNI, PCINP, ADAM-TS2, NPI	uc003mjw.3	O95450	OTTHUMG00000130915	ENST00000251582.7:c.3033C>G	5.37:g.178549700G>C	ENSP00000251582:p.Ile1011Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.I1011M	ENST00000251582.7	37	c.3033	CCDS4444.1	5	.	.	.	.	.	.	.	.	.	.	G	11.89	1.773678	0.31411	.	.	ENSG00000087116	ENST00000251582	T	0.51817	0.69	4.72	3.84	0.44239	.	1.131280	0.06688	N	0.769070	T	0.28797	0.0714	N	0.02368	-0.58	0.80722	D	1	P	0.35155	0.487	B	0.39771	0.309	T	0.02313	-1.1178	10	0.38643	T	0.18	.	8.5597	0.33503	0.0827:0.2929:0.6244:0.0	.	1011	O95450	ATS2_HUMAN	M	1011	ENSP00000251582:I1011M	ENSP00000251582:I1011M	I	-	3	3	ADAMTS2	178482306	0.821000	0.29204	0.997000	0.53966	0.964000	0.63967	1.190000	0.32126	0.977000	0.38444	0.561000	0.74099	ATC	ADAMTS2	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Pept_M12B_ADAM-TS2,pfscan_Thrombospondin_1_rpt	ENSG00000087116		0.687	ADAMTS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS2	HGNC	protein_coding	OTTHUMT00000253507.1	16	0.00	0	G	NM_014244		178549700	178549700	-1	no_errors	ENST00000251582	ensembl	human	known	69_37n	missense	8	33.33	4	SNP	0.936	C
ANK2	287	genome.wustl.edu	37	4	114177049	114177049	+	Silent	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:114177049C>G	ENST00000357077.4	+	11	1202	c.1149C>G	c.(1147-1149)ctC>ctG	p.L383L	ANK2_ENST00000394537.3_Silent_p.L383L|ANK2_ENST00000264366.6_Silent_p.L383L|ANK2_ENST00000506722.1_Silent_p.L362L	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	383					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		TAACCAAACTCCTTTTAGACA	0.498																																						dbGAP											0													138.0	126.0	130.0					4																	114177049		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.1149C>G	4.37:g.114177049C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Silent	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.L383	ENST00000357077.4	37	c.1149	CCDS3702.1	4																																																																																			ANK2	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000145362		0.498	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	38	0.00	0	C	NM_001148		114177049	114177049	+1	no_errors	ENST00000357077	ensembl	human	known	69_37n	silent	36	42.86	27	SNP	0.956	G
APOF	319	genome.wustl.edu	37	12	56755197	56755197	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr12:56755197C>G	ENST00000398189.3	-	2	870	c.793G>C	c.(793-795)Gac>Cac	p.D265H	STAT2_ENST00000557235.1_5'Flank|STAT2_ENST00000418572.2_5'Flank|APOF_ENST00000541105.1_Missense_Mutation_p.D247H|STAT2_ENST00000314128.4_5'Flank	NM_001638.2	NP_001629.1	Q13790	APOF_HUMAN	apolipoprotein F	265					cholesterol efflux (GO:0033344)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|triglyceride metabolic process (GO:0006641)	extracellular region (GO:0005576)|high-density lipoprotein particle (GO:0034364)|low-density lipoprotein particle (GO:0034362)	cholesterol binding (GO:0015485)|lipid transporter activity (GO:0005319)|receptor binding (GO:0005102)			breast(1)|lung(3)|prostate(1)|stomach(1)	6						ATGTTTGCGTCTTTCTGATCT	0.493																																						dbGAP											0													107.0	107.0	107.0					12																	56755197		1972	4153	6125	-	-	-	SO:0001583	missense	0			L27050	CCDS44923.1	12q13	2013-01-24				ENSG00000175336		"""Apolipoproteins"""	615	protein-coding gene	gene with protein product		107760				8093033	Standard	NM_001638		Approved		uc001sle.1	Q13790		ENST00000398189.3:c.793G>C	12.37:g.56755197C>G	ENSP00000381250:p.Asp265His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC13	Missense_Mutation	SNP	NULL	p.D265H	ENST00000398189.3	37	c.793	CCDS44923.1	12	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855667	0.32791	.	.	ENSG00000175336	ENST00000398189;ENST00000541105	T;T	0.52526	0.66;0.67	5.21	2.39	0.29439	.	0.916622	0.08978	N	0.866241	T	0.32526	0.0832	N	0.24115	0.695	0.09310	N	1	B	0.33512	0.415	B	0.34301	0.179	T	0.30592	-0.9973	10	0.66056	D	0.02	-0.571	4.7399	0.13007	0.0:0.6322:0.1809:0.187	.	265	Q13790	APOF_HUMAN	H	265;247	ENSP00000381250:D265H;ENSP00000440997:D247H	ENSP00000381250:D265H	D	-	1	0	APOF	55041464	0.841000	0.29509	0.004000	0.12327	0.001000	0.01503	2.140000	0.42159	0.860000	0.35481	-0.136000	0.14681	GAC	APOF	-	NULL	ENSG00000175336		0.493	APOF-001	KNOWN	basic|CCDS	protein_coding	APOF	HGNC	protein_coding	OTTHUMT00000410076.1	114	0.00	0	C			56755197	56755197	-1	no_errors	ENST00000398189	ensembl	human	known	69_37n	missense	64	29.67	27	SNP	0.091	G
ARR3	407	genome.wustl.edu	37	X	69496109	69496110	+	Frame_Shift_Del	DEL	AT	AT	-			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chrX:69496109_69496110delAT	ENST00000307959.8	+	6	374_375	c.323_324delAT	c.(322-324)aatfs	p.N108fs	ARR3_ENST00000374495.3_Frame_Shift_Del_p.N108fs	NM_004312.2	NP_004303.2	P36575	ARRC_HUMAN	arrestin 3, retinal (X-arrestin)	108					endocytosis (GO:0006897)|regulation of protein phosphorylation (GO:0001932)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)				endometrium(3)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	16						CTAGGGGACAATGCCTACCCCT	0.574																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS14399.1	Xq13.1	2013-10-11			ENSG00000120500	ENSG00000120500			710	protein-coding gene	gene with protein product	"""arrestin 4"""	301770				8224247	Standard	NM_004312		Approved	ARRX	uc004dyb.2	P36575	OTTHUMG00000021768	ENST00000307959.8:c.323_324delAT	X.37:g.69496109_69496110delAT	ENSP00000311538:p.Asn108fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5B0B9|Q5JT23|Q5JT24|Q6IBF5|Q96EN2	Frame_Shift_Del	DEL	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.N108fs	ENST00000307959.8	37	c.323_324	CCDS14399.1	X																																																																																			ARR3	-	pfam_Arrestin-like_N,superfamily_Ig_E-set	ENSG00000120500		0.574	ARR3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ARR3	HGNC	protein_coding	OTTHUMT00000057055.2	119	0.00	0	AT	NM_004312		69496109	69496110	+1	no_errors	ENST00000307959	ensembl	human	known	69_37n	frame_shift_del	55	27.63	21	DEL	0.998:0.997	-
ARL13A	392509	genome.wustl.edu	37	X	100229143	100229143	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chrX:100229143G>C	ENST00000450049.2	+	3	200	c.87G>C	c.(85-87)ttG>ttC	p.L29F		NM_001162491.1	NP_001155963.1	Q5H913	AR13A_HUMAN	ADP-ribosylation factor-like 13A	29					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			endometrium(1)|ovary(1)	2						TCATTGGCTTGAACAACTCTG	0.413																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS55463.1	Xq22.1	2014-05-09	2005-11-18	2005-11-18	ENSG00000174225	ENSG00000174225		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	31709	protein-coding gene	gene with protein product			"""ADP-ribosylation factor-like 13"""	ARL13			Standard	NM_001162491		Approved		uc011mrf.2	Q5H913	OTTHUMG00000022013	ENST00000450049.2:c.87G>C	X.37:g.100229143G>C	ENSP00000398637:p.Leu29Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT6|B4DX50	Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR	p.L29F	ENST00000450049.2	37	c.87	CCDS55463.1	X	.	.	.	.	.	.	.	.	.	.	G	6.813	0.519068	0.13005	.	.	ENSG00000174225	ENST00000450049	T	0.79352	-1.26	3.24	0.48	0.16804	.	0.000000	0.64402	D	0.000002	D	0.87845	0.6280	M	0.94101	3.495	0.09310	N	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77705	-0.2488	10	0.87932	D	0	.	5.329	0.15922	0.4224:0.0:0.5776:0.0	.	29;29	B2RTT6;Q5H913	.;AR13A_HUMAN	F	29	ENSP00000398637:L29F	ENSP00000398637:L29F	L	+	3	2	ARL13A	100115799	0.625000	0.27111	0.014000	0.15608	0.068000	0.16541	0.761000	0.26489	-0.014000	0.14175	-0.881000	0.02953	TTG	ARL13A	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Small_GTPase,smart_Small_GTPase_ARF,smart_Small_GTPase_SAR1,prints_Small_GTPase_ARF/SAR	ENSG00000174225		0.413	ARL13A-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ARL13A	HGNC	protein_coding	OTTHUMT00000057504.2	161	0.00	0	G	XM_373358		100229143	100229143	+1	no_errors	ENST00000450457	ensembl	human	known	69_37n	missense	89	37.56	77	SNP	0.013	C
ARVCF	421	genome.wustl.edu	37	22	19966462	19966462	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr22:19966462G>T	ENST00000263207.3	-	7	1829	c.1538C>A	c.(1537-1539)gCc>gAc	p.A513D	ARVCF_ENST00000406259.1_Missense_Mutation_p.A513D|ARVCF_ENST00000344269.3_Missense_Mutation_p.A450D|ARVCF_ENST00000406522.1_Missense_Mutation_p.A450D|ARVCF_ENST00000401994.1_Missense_Mutation_p.A450D|ARVCF_ENST00000487793.1_5'Flank	NM_001670.2	NP_001661.1	O00192	ARVC_HUMAN	armadillo repeat gene deleted in velocardiofacial syndrome	513					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|single organismal cell-cell adhesion (GO:0016337)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|endometrium(3)|liver(1)|lung(4)|prostate(1)|urinary_tract(2)	13	Colorectal(54;0.0993)					TGTCCACTCGGCGTCCCGTGG	0.622																																						dbGAP											0													154.0	103.0	120.0					22																	19966462		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13771.1	22q11.21	2013-02-14	2010-04-28		ENSG00000099889	ENSG00000099889		"""Armadillo repeat containing"""	728	protein-coding gene	gene with protein product		602269				9126485, 15456900	Standard	NM_001670		Approved		uc002zqz.3	O00192	OTTHUMG00000030426	ENST00000263207.3:c.1538C>A	22.37:g.19966462G>T	ENSP00000263207:p.Ala513Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNV2	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A513D	ENST00000263207.3	37	c.1538	CCDS13771.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.384289	0.82792	.	.	ENSG00000099889	ENST00000263207;ENST00000344269;ENST00000401994;ENST00000406522;ENST00000406259	T;T;T;T;T	0.75589	-0.95;-0.95;-0.95;-0.95;-0.95	4.43	4.43	0.53597	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.83889	0.5352	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	0.994;1.0	P;D	0.73708	0.885;0.981	D	0.83835	0.0254	9	.	.	.	-5.8494	17.6161	0.88068	0.0:0.0:1.0:0.0	.	513;35	O00192;E7EV58	ARVC_HUMAN;.	D	513;450;450;450;513	ENSP00000263207:A513D;ENSP00000342042:A450D;ENSP00000384341:A450D;ENSP00000384732:A450D;ENSP00000385444:A513D	.	A	-	2	0	ARVCF	18346462	0.998000	0.40836	0.877000	0.34402	0.507000	0.33981	4.407000	0.59754	2.472000	0.83506	0.563000	0.77884	GCC	ARVCF	-	superfamily_ARM-type_fold	ENSG00000099889		0.622	ARVCF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARVCF	HGNC	protein_coding	OTTHUMT00000075314.5	74	0.00	0	G	NM_001670		19966462	19966462	-1	no_errors	ENST00000263207	ensembl	human	known	69_37n	missense	39	43.48	30	SNP	1.000	T
ASL	435	genome.wustl.edu	37	7	65546942	65546942	+	Silent	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr7:65546942C>T	ENST00000304874.9	+	3	267	c.165C>T	c.(163-165)ctC>ctT	p.L55L	ASL_ENST00000380839.4_Silent_p.L55L|ASL_ENST00000395332.3_Silent_p.L55L|ASL_ENST00000395331.3_Silent_p.L55L	NM_000048.3	NP_000039.2	P04424	ARLY_HUMAN	argininosuccinate lyase	55					arginine biosynthetic process via ornithine (GO:0042450)|arginine catabolic process (GO:0006527)|cellular nitrogen compound metabolic process (GO:0034641)|internal protein amino acid acetylation (GO:0006475)|small molecule metabolic process (GO:0044281)|urea cycle (GO:0000050)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	argininosuccinate lyase activity (GO:0004056)	p.L55L(1)		breast(3)|endometrium(3)|large_intestine(2)|lung(9)|upper_aerodigestive_tract(1)	18					L-Arginine(DB00125)	CAGGGCTCCTCACCAAGGCCG	0.617																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											47.0	40.0	43.0					7																	65546942		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5531.1, CCDS47597.1, CCDS47598.1	7q11.21	2012-10-02			ENSG00000126522	ENSG00000126522	4.3.2.1		746	protein-coding gene	gene with protein product		608310					Standard	NM_001024943		Approved		uc003tuo.3	P04424	OTTHUMG00000022876	ENST00000304874.9:c.165C>T	7.37:g.65546942C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMI0|E9PE48|Q6LDS5|Q96HS2	Silent	SNP	pfam_Lyase1_N,superfamily_L-Aspartase-like,prints_D_crystallin,prints_Fumarate_lyase,tigrfam_Argininosuccinate_lyase	p.L55	ENST00000304874.9	37	c.165	CCDS5531.1	7																																																																																			ASL	-	pfam_Lyase1_N,superfamily_L-Aspartase-like,tigrfam_Argininosuccinate_lyase	ENSG00000126522		0.617	ASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASL	HGNC	protein_coding	OTTHUMT00000251695.2	25	0.00	0	C	NM_000048		65546942	65546942	+1	no_errors	ENST00000304874	ensembl	human	known	69_37n	silent	19	34.48	10	SNP	0.997	T
ASPM	259266	genome.wustl.edu	37	1	197086988	197086988	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:197086988C>G	ENST00000367409.4	-	17	4252	c.3996G>C	c.(3994-3996)caG>caC	p.Q1332H	ASPM_ENST00000294732.7_Missense_Mutation_p.Q1332H|ASPM_ENST00000367408.1_Missense_Mutation_p.Q582H	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1332					developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						ATAATTTTCTCTGTGCTAAGA	0.308																																						dbGAP											0													136.0	150.0	145.0					1																	197086988		2201	4298	6499	-	-	-	SO:0001583	missense	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.3996G>C	1.37:g.197086988C>G	ENSP00000356379:p.Gln1332His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.Q1332H	ENST00000367409.4	37	c.3996	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	15.78	2.935628	0.52972	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408	D;T;T	0.83591	-1.74;1.77;1.77	5.6	1.63	0.23807	.	0.546545	0.17940	N	0.156885	D	0.88599	0.6480	M	0.76574	2.34	0.25174	N	0.990257	D;D	0.69078	0.989;0.997	P;D	0.72982	0.873;0.979	T	0.79678	-0.1703	10	0.66056	D	0.02	.	9.1259	0.36814	0.0:0.7086:0.0:0.2914	.	1332;1332	Q4G1H1;Q8IZT6	.;ASPM_HUMAN	H	1332;1332;582	ENSP00000356379:Q1332H;ENSP00000294732:Q1332H;ENSP00000356378:Q582H	ENSP00000294732:Q1332H	Q	-	3	2	ASPM	195353611	0.664000	0.27457	0.022000	0.16811	0.749000	0.42624	0.210000	0.17455	0.051000	0.15978	0.557000	0.71058	CAG	ASPM	-	pfam_IQ_motif_EF-hand-BS,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS	ENSG00000066279		0.308	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	186	0.00	0	C	NM_018136		197086988	197086988	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	missense	264	14.29	44	SNP	0.881	G
ATP6V1B1	525	genome.wustl.edu	37	2	71191567	71191567	+	Splice_Site	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:71191567G>C	ENST00000234396.4	+	12	1216		c.e12-1		ATP6V1B1_ENST00000412314.1_Splice_Site|RN7SL160P_ENST00000468558.2_RNA|AC007040.11_ENST00000606025.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1						ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						TTCTCCCTCAGATCTACCCCC	0.532											OREG0014686	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													92.0	88.0	89.0					2																	71191567		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.1144-1G>C	2.37:g.71191567G>C		Somatic	1128	WXS	Illumina GAIIx	Phase_IV	Q53FY0|Q6P4H6	Splice_Site	SNP	-	e12-1	ENST00000234396.4	37	c.1144-1	CCDS1912.1	2	.	.	.	.	.	.	.	.	.	.	G	12.51	1.959837	0.34565	.	.	ENSG00000116039	ENST00000234396;ENST00000483246;ENST00000412314	.	.	.	3.77	2.89	0.33648	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0688	0.36480	0.1116:0.0:0.8884:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATP6V1B1	71045075	1.000000	0.71417	0.868000	0.34077	0.568000	0.35870	9.456000	0.97628	0.778000	0.33520	0.462000	0.41574	.	ATP6V1B1	-	-	ENSG00000116039		0.532	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1B1	HGNC	protein_coding	OTTHUMT00000251920.2	120	0.00	0	G	NM_001692	Intron	71191567	71191567	+1	no_errors	ENST00000234396	ensembl	human	known	69_37n	splice_site	64	23.81	20	SNP	1.000	C
BAAT	570	genome.wustl.edu	37	9	104125001	104125001	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr9:104125001G>A	ENST00000395051.3	-	3	1036	c.966C>T	c.(964-966)ttC>ttT	p.F322F	BAAT_ENST00000259407.2_Silent_p.F322F			Q14032	BAAT_HUMAN	bile acid CoA:amino acid N-acyltransferase	322					acyl-CoA metabolic process (GO:0006637)|bile acid and bile salt transport (GO:0015721)|bile acid biosynthetic process (GO:0006699)|bile acid conjugation (GO:0002152)|bile acid metabolic process (GO:0008206)|fatty acid metabolic process (GO:0006631)|glycine metabolic process (GO:0006544)|liver development (GO:0001889)|organ regeneration (GO:0031100)|small molecule metabolic process (GO:0044281)|taurine metabolic process (GO:0019530)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carboxylic ester hydrolase activity (GO:0052689)|glycine N-choloyltransferase activity (GO:0047963)|long-chain acyl-CoA hydrolase activity (GO:0052816)|medium-chain acyl-CoA hydrolase activity (GO:0052815)|N-acyltransferase activity (GO:0016410)|palmitoyl-CoA hydrolase activity (GO:0016290)|receptor binding (GO:0005102)|very long chain acyl-CoA hydrolase activity (GO:0052817)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	23		Acute lymphoblastic leukemia(62;0.0559)			Glycine(DB00145)	CTCCTACAATGAAGAGGAATT	0.468																																						dbGAP											0													139.0	127.0	131.0					9																	104125001		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L34081	CCDS6752.1	9q22.3	2014-06-24	2014-06-24		ENSG00000136881	ENSG00000136881	2.3.1.65		932	protein-coding gene	gene with protein product	"""glycine N-choloyltransferase"""	602938	"""bile acid Coenzyme A:amino acid N-acyltransferase (glycine N-choloyltransferase)"", ""bile acid CoA: amino acid N-acyltransferase (glycine N-choloyltransferase)"""				Standard	NM_001701		Approved	BAT	uc010mtd.3	Q14032	OTTHUMG00000020377	ENST00000395051.3:c.966C>T	9.37:g.104125001G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3B7W9|Q96L31	Silent	SNP	pfam_BAAT_C,pfam_Thio_Ohase/aa_AcTrfase,pirsf_Acyl-CoA_thioEstase_long-chain	p.F322	ENST00000395051.3	37	c.966	CCDS6752.1	9																																																																																			BAAT	-	pfam_BAAT_C,pirsf_Acyl-CoA_thioEstase_long-chain	ENSG00000136881		0.468	BAAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAAT	HGNC	protein_coding	OTTHUMT00000053433.1	81	0.00	0	G			104125001	104125001	-1	no_errors	ENST00000259407	ensembl	human	known	69_37n	silent	31	48.33	29	SNP	0.998	A
NUTM1	256646	genome.wustl.edu	37	15	34648639	34648639	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr15:34648639G>C	ENST00000333756.4	+	7	2501	c.2346G>C	c.(2344-2346)gaG>gaC	p.E782D	NUTM1_ENST00000537011.1_Missense_Mutation_p.E810D|NUTM1_ENST00000438749.3_Missense_Mutation_p.E800D	NM_175741.1	NP_786883	Q86Y26	NUTM1_HUMAN	NUT midline carcinoma, family member 1	782						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GGGATACGGAGAGCAGTGTGA	0.562																																						dbGAP											0													70.0	70.0	70.0					15																	34648639		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF482429	CCDS32190.1, CCDS61584.1, CCDS61585.1	15q14	2014-01-28	2013-03-14	2013-03-14	ENSG00000184507	ENSG00000184507			29919	protein-coding gene	gene with protein product	"""nuclear protein in testis"""	608963	"""chromosome 15 open reading frame 55"""	C15orf55		12543779	Standard	NM_175741		Approved	NUT, DKFZp434O192, FAM22H	uc001zif.3	Q86Y26	OTTHUMG00000172348	ENST00000333756.4:c.2346G>C	15.37:g.34648639G>C	ENSP00000329448:p.Glu782Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZ00|B7Z7Y4|E7EVE8|F5H4I6|Q86YS8|Q8N7F2|Q9NTB3	Missense_Mutation	SNP	NULL	p.E782D	ENST00000333756.4	37	c.2346	CCDS32190.1	15	.	.	.	.	.	.	.	.	.	.	G	6.626	0.483869	0.12581	.	.	ENSG00000184507	ENST00000537011;ENST00000438749;ENST00000333756	T;T;T	0.08984	3.04;3.03;3.04	4.95	-2.32	0.06745	.	0.441392	0.21608	N	0.071829	T	0.03477	0.0100	N	0.12182	0.205	0.09310	N	1	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.001;0.002;0.001	T	0.34304	-0.9834	10	0.36615	T	0.2	.	4.8584	0.13571	0.4001:0.3206:0.2793:0.0	.	800;810;782	E7EVE8;F5H4I6;Q86Y26	.;.;NUT_HUMAN	D	810;800;782	ENSP00000444896:E810D;ENSP00000407031:E800D;ENSP00000329448:E782D	ENSP00000329448:E782D	E	+	3	2	C15orf55	32435931	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.783000	0.04638	-0.245000	0.09625	-0.264000	0.10439	GAG	C15orf55	-	NULL	ENSG00000184507		0.562	NUTM1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf55	HGNC	protein_coding	OTTHUMT00000418026.1	36	0.00	0	G	NM_175741		34648639	34648639	+1	no_errors	ENST00000333756	ensembl	human	known	69_37n	missense	6	80.00	24	SNP	0.000	C
CADPS	8618	genome.wustl.edu	37	3	62648054	62648054	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr3:62648054C>T	ENST00000383710.4	-	4	1253	c.904G>A	c.(904-906)Gag>Aag	p.E302K	CADPS_ENST00000357948.3_Missense_Mutation_p.E302K|CADPS_ENST00000490353.2_Missense_Mutation_p.E302K|CADPS_ENST00000283269.9_Missense_Mutation_p.E302K	NM_003716.3	NP_003707.2	Q9ULU8	CAPS1_HUMAN	Ca++-dependent secretion activator	302					catecholamine secretion (GO:0050432)|exocytosis (GO:0006887)|protein transport (GO:0015031)|synaptic vesicle priming (GO:0016082)|vesicle organization (GO:0016050)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|membrane (GO:0016020)|synapse (GO:0045202)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)|protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(24)|lung(38)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(2)	92		Lung SC(41;0.0452)		BRCA - Breast invasive adenocarcinoma(55;5.98e-05)|KIRC - Kidney renal clear cell carcinoma(15;0.0246)|Kidney(15;0.0334)		GCTGCTTGCTCATCTGGATTG	0.478																																						dbGAP											0													149.0	121.0	130.0					3																	62648054		2203	4300	6503	-	-	-	SO:0001583	missense	0			U36448	CCDS2898.1, CCDS2899.1, CCDS46858.1	3p21.1	2013-01-10	2008-08-28		ENSG00000163618	ENSG00000163618		"""Pleckstrin homology (PH) domain containing"""	1426	protein-coding gene	gene with protein product		604667				1516133	Standard	NM_183393		Approved	CAPS, KIAA1121, CAPS1	uc003dll.2	Q9ULU8	OTTHUMG00000158651	ENST00000383710.4:c.904G>A	3.37:g.62648054C>T	ENSP00000373215:p.Glu302Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF60|Q13339|Q6GQQ6|Q8N2Z5|Q8N3M7|Q8NFR0|Q96BC2	Missense_Mutation	SNP	pfam_Ca-dep_secretion_activator,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E302K	ENST00000383710.4	37	c.904	CCDS46858.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.242624	0.95272	.	.	ENSG00000163618	ENST00000383709;ENST00000383710;ENST00000357948;ENST00000283269;ENST00000490353	D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	D	0.93051	0.7788	M	0.83483	2.645	0.80722	D	1	D;D;D	0.89917	1.0;0.974;0.997	D;D;D	0.91635	0.999;0.969;0.98	D	0.93708	0.7021	10	0.87932	D	0	.	18.2515	0.90005	0.0:1.0:0.0:0.0	.	302;302;302	Q9ULU8-2;Q9ULU8-3;Q9ULU8	.;.;CAPS1_HUMAN	K	302	ENSP00000373215:E302K;ENSP00000350632:E302K;ENSP00000283269:E302K;ENSP00000418736:E302K	ENSP00000283269:E302K	E	-	1	0	CADPS	62623094	1.000000	0.71417	1.000000	0.80357	0.886000	0.51366	7.111000	0.77077	2.606000	0.88127	0.655000	0.94253	GAG	CADPS	-	NULL	ENSG00000163618		0.478	CADPS-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CADPS	HGNC	protein_coding	OTTHUMT00000351951.5	162	0.00	0	C	NM_003716, NM_183393, NM_183394		62648054	62648054	-1	no_errors	ENST00000383710	ensembl	human	known	69_37n	missense	18	73.13	49	SNP	1.000	T
CDH22	64405	genome.wustl.edu	37	20	44869708	44869708	+	Silent	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr20:44869708C>T	ENST00000372262.3	-	2	844	c.444G>A	c.(442-444)ctG>ctA	p.L148L	CDH22_ENST00000537909.1_Silent_p.L148L	NM_021248.1	NP_067071.1	Q9UJ99	CAD22_HUMAN	cadherin 22, type 2	148	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				brain development (GO:0007420)|calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(9)|lung(16)|ovary(4)|pancreas(1)|prostate(3)|skin(4)|urinary_tract(3)	44		Myeloproliferative disorder(115;0.0122)				ACTCGGGCTCCAGTAGGCGGT	0.622																																						dbGAP											0													83.0	65.0	71.0					20																	44869708		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035300	CCDS13395.1	20q13.1	2010-01-26	2009-11-20		ENSG00000149654	ENSG00000149654		"""Cadherins / Major cadherins"""	13251	protein-coding gene	gene with protein product		609920	"""cadherin-like 22"""	C20orf25		8626716	Standard	NM_021248		Approved	dJ998H6.1	uc010ghk.2	Q9UJ99	OTTHUMG00000033073	ENST00000372262.3:c.444G>A	20.37:g.44869708C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK7|O43205	Silent	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,superfamily_MFS_dom_general_subst_transpt,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L148	ENST00000372262.3	37	c.444	CCDS13395.1	20																																																																																			CDH22	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000149654		0.622	CDH22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH22	HGNC	protein_coding	OTTHUMT00000080491.1	44	0.00	0	C	NM_021248		44869708	44869708	-1	no_errors	ENST00000372262	ensembl	human	known	69_37n	silent	20	41.18	14	SNP	1.000	T
CEP63	80254	genome.wustl.edu	37	3	134264532	134264532	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr3:134264532C>G	ENST00000337090.3	+	7	833	c.660C>G	c.(658-660)atC>atG	p.I220M	CEP63_ENST00000354446.3_Missense_Mutation_p.I220M|CEP63_ENST00000513612.2_Missense_Mutation_p.I220M|CEP63_ENST00000383229.3_Missense_Mutation_p.I220M|CEP63_ENST00000606977.1_Missense_Mutation_p.I220M|CEP63_ENST00000332047.5_Missense_Mutation_p.I220M			Q96MT8	CEP63_HUMAN	centrosomal protein 63kDa	220					centriole replication (GO:0007099)|DNA damage checkpoint (GO:0000077)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|signal transduction in response to DNA damage (GO:0042770)|spindle assembly (GO:0051225)	centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)|spindle pole (GO:0000922)				kidney(1)|large_intestine(6)|lung(12)|ovary(1)|prostate(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27						ATGACACTATCTGTGCCAATG	0.438																																						dbGAP											0													100.0	92.0	95.0					3																	134264532		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056465	CCDS3086.1, CCDS43152.1, CCDS43153.1, CCDS43154.1	3q22.1	2014-02-20			ENSG00000182923	ENSG00000182923			25815	protein-coding gene	gene with protein product		614724				14654843, 24240477	Standard	NM_001042383		Approved	FLJ13386	uc003eqo.1	Q96MT8	OTTHUMG00000159725	ENST00000337090.3:c.660C>G	3.37:g.134264532C>G	ENSP00000336524:p.Ile220Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DND8|D3DND9|D3DNE0|Q96CR0|Q9H8F5|Q9H8N0	Missense_Mutation	SNP	NULL	p.I220M	ENST00000337090.3	37	c.660	CCDS3086.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.40|16.40	3.113476|3.113476	0.56398|0.56398	.|.	.|.	ENSG00000182923|ENSG00000182923	ENST00000332047;ENST00000354446;ENST00000337090;ENST00000383229;ENST00000513612|ENST00000508778	T;T;T;T;T|.	0.35048|.	1.33;1.72;2.01;1.33;2.01|.	5.88|5.88	3.91|3.91	0.45181|0.45181	.|.	0.231777|.	0.40908|.	D|.	0.000987|.	T|T	0.63271|0.63271	0.2497|0.2497	M|M	0.66939|0.66939	2.045|2.045	0.37965|0.37965	D|D	0.933091|0.933091	D;P;D;D|.	0.89917|.	1.0;0.903;0.988;1.0|.	D;P;P;D|.	0.87578|.	0.998;0.707;0.881;0.989|.	T|T	0.65981|0.65981	-0.6036|-0.6036	10|5	0.45353|.	T|.	0.12|.	-9.5669|-9.5669	8.9279|8.9279	0.35652|0.35652	0.1313:0.7309:0.0:0.1378|0.1313:0.7309:0.0:0.1378	.|.	220;220;220;220|.	Q96MT8;Q96MT8-2;Q96MT8-4;Q96MT8-3|.	CEP63_HUMAN;.;.;.|.	M|C	220|126	ENSP00000328382:I220M;ENSP00000346432:I220M;ENSP00000336524:I220M;ENSP00000372716:I220M;ENSP00000426129:I220M|.	ENSP00000328382:I220M|.	I|S	+|+	3|2	3|0	CEP63|CEP63	135747222|135747222	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.984000|0.984000	0.73092|0.73092	0.668000|0.668000	0.25127|0.25127	1.494000|1.494000	0.48533|0.48533	0.650000|0.650000	0.86243|0.86243	ATC|TCT	CEP63	-	NULL	ENSG00000182923		0.438	CEP63-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEP63	HGNC	protein_coding	OTTHUMT00000470139.1	76	0.00	0	C	NM_025180		134264532	134264532	+1	no_errors	ENST00000337090	ensembl	human	known	69_37n	missense	90	23.08	27	SNP	1.000	G
CHD6	84181	genome.wustl.edu	37	20	40043946	40043946	+	Silent	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr20:40043946G>C	ENST00000373233.3	-	34	6996	c.6819C>G	c.(6817-6819)gtC>gtG	p.V2273V	CHD6_ENST00000480022.1_5'Flank	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6	2273					ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				GGCTTCCATTGACAATCTGTC	0.527																																						dbGAP											0													86.0	77.0	80.0					20																	40043946		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.6819C>G	20.37:g.40043946G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Silent	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_BRK_domain,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.V2273	ENST00000373233.3	37	c.6819	CCDS13317.1	20																																																																																			CHD6	-	NULL	ENSG00000124177		0.527	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	105	0.00	0	G			40043946	40043946	-1	no_errors	ENST00000373233	ensembl	human	known	69_37n	silent	59	39.00	39	SNP	1.000	C
CHKB	1120	genome.wustl.edu	37	22	51019010	51019010	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr22:51019010C>A	ENST00000406938.2	-	5	878	c.661G>T	c.(661-663)Gag>Tag	p.E221*	CHKB-AS1_ENST00000380711.3_RNA|CPT1B_ENST00000360719.2_5'Flank|CPT1B_ENST00000405237.3_5'Flank|CHKB_ENST00000463053.1_5'UTR|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000434492.2_5'Flank|CPT1B_ENST00000395650.2_5'Flank|CPT1B_ENST00000440709.1_5'Flank|CHKB-CPT1B_ENST00000453634.1_5'Flank|CPT1B_ENST00000457250.1_5'Flank|CPT1B_ENST00000312108.7_5'Flank	NM_005198.4	NP_005189.2	Q9Y259	CHKB_HUMAN	choline kinase beta	221					CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|choline kinase activity (GO:0004103)|ethanolamine kinase activity (GO:0004305)			NS(1)|breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|ovary(3)|skin(1)|urinary_tract(1)	15		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;4.04e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.79e-74)|Epithelial(4;6.17e-70)|GBM - Glioblastoma multiforme(4;5.68e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.205)	Choline(DB00122)	TTGCCCATCTCATCCTTCAGG	0.562																																						dbGAP											0													127.0	96.0	106.0					22																	51019010		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029886	CCDS14099.1	22q13.33	2011-02-16	2004-04-19	2004-04-19	ENSG00000100288	ENSG00000100288			1938	protein-coding gene	gene with protein product		612395	"""choline kinase-like"""	CHKL		9224698, 15003397	Standard	NM_005198		Approved	CHETK	uc003bmv.3	Q9Y259	OTTHUMG00000150275	ENST00000406938.2:c.661G>T	22.37:g.51019010C>A	ENSP00000384400:p.Glu221*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJM6|Q13388	Nonsense_Mutation	SNP	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	p.E221*	ENST00000406938.2	37	c.661	CCDS14099.1	22	.	.	.	.	.	.	.	.	.	.	C	39	7.363255	0.98238	.	.	ENSG00000100288	ENST00000406938	.	.	.	5.04	4.0	0.46444	.	0.055231	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-11.6402	11.1274	0.48325	0.0:0.8137:0.1863:0.0	.	.	.	.	X	221	.	ENSP00000384400:E221X	E	-	1	0	CHKB	49365876	0.995000	0.38212	0.979000	0.43373	0.993000	0.82548	3.602000	0.54066	1.304000	0.44892	0.561000	0.74099	GAG	CHKB	-	pfam_Choline/ethanolamine_kinase,pfam_Aminoglycoside_PTrfase,pfam_DUF227,superfamily_Kinase-like_dom	ENSG00000100288		0.562	CHKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHKB	HGNC	protein_coding	OTTHUMT00000317267.3	150	0.00	0	C	NM_005198		51019010	51019010	-1	no_errors	ENST00000406938	ensembl	human	known	69_37n	nonsense	44	32.31	21	SNP	0.995	A
CHST8	64377	genome.wustl.edu	37	19	34180251	34180251	+	Silent	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:34180251C>T	ENST00000262622.4	+	2	842	c.84C>T	c.(82-84)ttC>ttT	p.F28F	CHST8_ENST00000604556.1_3'UTR|CHST8_ENST00000438847.3_Silent_p.F28F|CHST8_ENST00000434302.1_Silent_p.F28F	NM_022467.3	NP_071912.2	Q9H2A9	CHST8_HUMAN	carbohydrate (N-acetylgalactosamine 4-0) sulfotransferase 8	28					carbohydrate biosynthetic process (GO:0016051)|central nervous system development (GO:0007417)|hormone biosynthetic process (GO:0042446)|proteoglycan biosynthetic process (GO:0030166)|sulfur compound metabolic process (GO:0006790)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)			NS(1)|endometrium(3)|kidney(2)|large_intestine(4)|liver(2)|lung(8)|ovary(1)|prostate(1)|skin(5)	27	Esophageal squamous(110;0.162)					TCCTCCTCTTCATCAGCCTGC	0.642																																						dbGAP											0													94.0	93.0	93.0					19																	34180251		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB047801	CCDS12433.1	19q13.1	2008-02-05				ENSG00000124302		"""Sulfotransferases, membrane-bound"""	15993	protein-coding gene	gene with protein product		610190				10988300, 11001942	Standard	NM_001127895		Approved	GALNAC-4-ST1	uc002nut.4	Q9H2A9		ENST00000262622.4:c.84C>T	19.37:g.34180251C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3N2	Silent	SNP	pfam_Sulfotransferase	p.F28	ENST00000262622.4	37	c.84	CCDS12433.1	19																																																																																			CHST8	-	NULL	ENSG00000124302		0.642	CHST8-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CHST8	HGNC	protein_coding	OTTHUMT00000451453.1	32	0.00	0	C	NM_022467		34180251	34180251	+1	no_errors	ENST00000262622	ensembl	human	known	69_37n	silent	11	54.17	13	SNP	0.993	T
CLEC18B	497190	genome.wustl.edu	37	16	74446736	74446736	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr16:74446736C>T	ENST00000339953.5	-	6	840	c.719G>A	c.(718-720)gGa>gAa	p.G240E		NM_001011880.2	NP_001011880.2	Q6UXF7	CL18B_HUMAN	C-type lectin domain family 18, member B	240	EGF-like. {ECO:0000255|PROSITE- ProRule:PRU00076}.					extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|kidney(9)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	27						GTTGAGACGTCCATGGTTCTG	0.637																																						dbGAP											0													38.0	42.0	40.0					16																	74446736		2197	4277	6474	-	-	-	SO:0001583	missense	0			AY358373	CCDS32484.1	16q22.3	2010-04-27	2009-03-10	2009-03-10		ENSG00000140839		"""C-type lectin domain containing"""	33849	protein-coding gene	gene with protein product							Standard	NM_001011880		Approved		uc002fct.3	Q6UXF7		ENST00000339953.5:c.719G>A	16.37:g.74446736C>T	ENSP00000341051:p.Gly240Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DF90	Missense_Mutation	SNP	pfam_CAP_domain,pfam_C-type_lectin,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EGF-like,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.G240E	ENST00000339953.5	37	c.719	CCDS32484.1	16	.	.	.	.	.	.	.	.	.	.	c	13.83	2.353207	0.41700	.	.	ENSG00000140839	ENST00000429489;ENST00000339953;ENST00000268492;ENST00000425714	T	0.26518	1.73	3.14	3.14	0.36123	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	T	0.44808	0.1311	M	0.69823	2.125	0.45415	D	0.998393	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.999;0.983	T	0.30851	-0.9964	10	0.32370	T	0.25	.	9.9266	0.41496	0.0:1.0:0.0:0.0	.	160;240;240	Q6UXF7-2;C9JSV1;Q6UXF7	.;.;CL18B_HUMAN	E	240;240;240;160	ENSP00000341051:G240E	ENSP00000268492:G240E	G	-	2	0	CLEC18B	73004237	0.997000	0.39634	0.533000	0.28001	0.177000	0.22998	4.451000	0.60047	1.754000	0.51921	0.430000	0.28490	GGA	CLEC18B	-	smart_EGF-like,pfscan_EG-like_dom	ENSG00000140839		0.637	CLEC18B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC18B	HGNC	protein_coding	OTTHUMT00000434697.1	172	0.00	0	C	NM_001011880		74446736	74446736	-1	no_errors	ENST00000339953	ensembl	human	known	69_37n	missense	80	12.09	11	SNP	0.996	T
CPQ	10404	genome.wustl.edu	37	8	98155289	98155289	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr8:98155289C>G	ENST00000220763.5	+	8	1507	c.1297C>G	c.(1297-1299)Cat>Gat	p.H433D	KB-1958F4.1_ENST00000602771.1_RNA	NM_016134.2	NP_057218.1	Q9Y646	CBPQ_HUMAN	carboxypeptidase Q	433					peptide catabolic process (GO:0043171)|proteolysis (GO:0006508)|thyroid hormone generation (GO:0006590)|tissue regeneration (GO:0042246)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)	carboxypeptidase activity (GO:0004180)|metal ion binding (GO:0046872)|metallodipeptidase activity (GO:0070573)|protein homodimerization activity (GO:0042803)										TTTCTTCTTCCATCACTCCCA	0.428																																						dbGAP											0													150.0	139.0	143.0					8																	98155289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF107834	CCDS6273.1	8q22.2	2012-02-17			ENSG00000104324	ENSG00000104324			16910	protein-coding gene	gene with protein product	"""lysosomal dipeptidase"", ""Ser-Met dipeptidase"", ""plasma glutamate carboxypeptidase"""					10206990	Standard	NM_016134		Approved	LDP, PGCP	uc003yhw.3	Q9Y646	OTTHUMG00000164690	ENST00000220763.5:c.1297C>G	8.37:g.98155289C>G	ENSP00000220763:p.His433Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD88|Q8NBZ1|Q9UNM8|Q9Y5X6	Missense_Mutation	SNP	pfam_Peptidase_M28,pfam_Peptidase_M20	p.H433D	ENST00000220763.5	37	c.1297	CCDS6273.1	8	.	.	.	.	.	.	.	.	.	.	C	25.3	4.624476	0.87560	.	.	ENSG00000104324	ENST00000220763	T	0.49720	0.77	5.65	5.65	0.86999	Peptidase M28 (1);	0.000000	0.85682	D	0.000000	T	0.77308	0.4111	M	0.93016	3.37	0.58432	D	0.999998	D	0.89917	1.0	D	0.97110	1.0	T	0.82218	-0.0566	10	0.66056	D	0.02	-41.0273	18.784	0.91946	0.0:1.0:0.0:0.0	.	433	Q9Y646	PGCP_HUMAN	D	433	ENSP00000220763:H433D	ENSP00000220763:H433D	H	+	1	0	AC010859.1	98224465	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.978000	0.76147	2.695000	0.91970	0.650000	0.86243	CAT	CPQ	-	pfam_Peptidase_M28	ENSG00000104324		0.428	CPQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPQ	HGNC	protein_coding	OTTHUMT00000379757.2	215	0.00	0	C	NM_016134		98155289	98155289	+1	no_errors	ENST00000220763	ensembl	human	known	69_37n	missense	63	57.14	84	SNP	1.000	G
CPSF3	51692	genome.wustl.edu	37	2	9613060	9613060	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:9613060G>C	ENST00000238112.3	+	18	2175	c.1969G>C	c.(1969-1971)Gag>Cag	p.E657Q	IAH1_ENST00000470914.1_5'Flank|IAH1_ENST00000497473.1_5'Flank|CPSF3_ENST00000489403.1_3'UTR|IAH1_ENST00000545602.1_5'Flank|IAH1_ENST00000482918.1_5'Flank|CPSF3_ENST00000460593.1_Missense_Mutation_p.E620Q	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	657					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		AGAATGTGAAGAGGGAAGTGA	0.418																																					Colon(194;1259 2048 3845 5218 19985)	dbGAP											0													81.0	73.0	76.0					2																	9613060		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.1969G>C	2.37:g.9613060G>C	ENSP00000238112:p.Glu657Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	pfam_CPSF73-100_C,pfam_Beta_Casp,pfam_Beta-lactamas-like,pfam_RMMBL,smart_Beta-lactamas-like	p.E657Q	ENST00000238112.3	37	c.1969	CCDS1664.1	2	.	.	.	.	.	.	.	.	.	.	G	15.33	2.803072	0.50315	.	.	ENSG00000119203	ENST00000238112;ENST00000540142;ENST00000460593	T;T	0.45668	0.89;0.89	5.14	5.14	0.70334	-end-processing endonuclease polyadenylation factor C-term (1);Pre-mRNA 3&apos (1);	0.128001	0.48767	D	0.000161	T	0.35856	0.0946	L	0.44542	1.39	0.54753	D	0.999981	B	0.30634	0.288	B	0.28991	0.097	T	0.12553	-1.0543	10	0.30078	T	0.28	-29.7748	14.5706	0.68208	0.0:0.1906:0.8094:0.0	.	657	Q9UKF6	CPSF3_HUMAN	Q	657;379;620	ENSP00000238112:E657Q;ENSP00000418957:E620Q	ENSP00000238112:E657Q	E	+	1	0	CPSF3	9530511	1.000000	0.71417	0.997000	0.53966	0.938000	0.57974	6.438000	0.73426	2.395000	0.81488	0.561000	0.74099	GAG	CPSF3	-	pfam_CPSF73-100_C	ENSG00000119203		0.418	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3	HGNC	protein_coding	OTTHUMT00000206843.1	67	0.00	0	G	NM_016207		9613060	9613060	+1	no_errors	ENST00000238112	ensembl	human	known	69_37n	missense	45	36.62	26	SNP	1.000	C
CROT	54677	genome.wustl.edu	37	7	87011255	87011255	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr7:87011255G>A	ENST00000331536.3	+	11	1193	c.1008G>A	c.(1006-1008)gtG>gtA	p.V336V	CROT_ENST00000419147.2_Silent_p.V364V|CROT_ENST00000442291.1_Silent_p.V336V	NM_021151.3	NP_066974.2	Q9UKG9	OCTC_HUMAN	carnitine O-octanoyltransferase	336					carnitine metabolic process (GO:0009437)|cellular lipid metabolic process (GO:0044255)|coenzyme A metabolic process (GO:0015936)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|fatty acid metabolic process (GO:0006631)|fatty acid transport (GO:0015908)|generation of precursor metabolites and energy (GO:0006091)|medium-chain fatty acid metabolic process (GO:0051791)|small molecule metabolic process (GO:0044281)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	carnitine O-octanoyltransferase activity (GO:0008458)|receptor binding (GO:0005102)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37	Esophageal squamous(14;0.0058)|all_lung(186;0.201)|Lung NSC(181;0.203)				L-Carnitine(DB00583)	TGATTATGGTGAACATCAGTT	0.289																																						dbGAP											0													105.0	105.0	105.0					7																	87011255		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS5604.1, CCDS47634.1, CCDS59062.1	7q21.1	2010-02-26			ENSG00000005469	ENSG00000005469			2366	protein-coding gene	gene with protein product		606090				10486279	Standard	NM_021151		Approved	COT	uc003uit.3	Q9UKG9	OTTHUMG00000023653	ENST00000331536.3:c.1008G>A	7.37:g.87011255G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1D6|E7EQF2|Q86V17|Q8IUW9|Q9Y6I2	Silent	SNP	pfam_Carn_acyl_trans	p.V336	ENST00000331536.3	37	c.1008	CCDS5604.1	7																																																																																			CROT	-	pfam_Carn_acyl_trans	ENSG00000005469		0.289	CROT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CROT	HGNC	protein_coding	OTTHUMT00000253485.1	186	0.00	0	G	NM_021151		87011255	87011255	+1	no_errors	ENST00000331536	ensembl	human	known	69_37n	silent	143	16.37	28	SNP	0.010	A
CRYGC	1420	genome.wustl.edu	37	2	208994511	208994511	+	Silent	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:208994511C>T	ENST00000282141.3	-	1	43	c.6G>A	c.(4-6)ggG>ggA	p.G2G		NM_020989.3	NP_066269.1	P07315	CRGC_HUMAN	crystallin, gamma C	2	Beta/gamma crystallin 'Greek key' 1. {ECO:0000255|PROSITE-ProRule:PRU00028}.				camera-type eye development (GO:0043010)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	structural constituent of eye lens (GO:0005212)			NS(1)|endometrium(1)|large_intestine(2)|lung(5)	9				LUSC - Lung squamous cell carcinoma(261;0.0703)|Epithelial(149;0.0858)|Lung(261;0.133)		TGCTCACCTTCCCCATGGCTG	0.448																																						dbGAP											0													108.0	122.0	117.0					2																	208994511		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS2379.1	2q33.3	2013-02-14			ENSG00000163254	ENSG00000163254			2410	protein-coding gene	gene with protein product		123680		CRYG3			Standard	NM_020989		Approved		uc002vco.4	P07315	OTTHUMG00000132942	ENST00000282141.3:c.6G>A	2.37:g.208994511C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R50	Silent	SNP	pfam_Beta/gamma_crystallin,superfamily_G_crystallin-rel,smart_Beta/gamma_crystallin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.G2	ENST00000282141.3	37	c.6	CCDS2379.1	2																																																																																			CRYGC	-	superfamily_G_crystallin-rel,pfscan_Beta/gamma_crystallin	ENSG00000163254		0.448	CRYGC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYGC	HGNC	protein_coding	OTTHUMT00000256474.1	47	0.00	0	C	NM_020989		208994511	208994511	-1	no_errors	ENST00000282141	ensembl	human	known	69_37n	silent	43	33.85	22	SNP	1.000	T
CSMD2	114784	genome.wustl.edu	37	1	33999492	33999492	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:33999492G>A	ENST00000373381.4	-	63	10071	c.9895C>T	c.(9895-9897)Ctc>Ttc	p.L3299F		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CAACGGAAGAGGACTGTGCTT	0.567																																						dbGAP											0													136.0	115.0	122.0					1																	33999492		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9895C>T	1.37:g.33999492G>A	ENSP00000362479:p.Leu3299Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L3299F	ENST00000373381.4	37	c.9895		1	.	.	.	.	.	.	.	.	.	.	G	3.540	-0.093862	0.07053	.	.	ENSG00000121904	ENST00000373381	T	0.64085	-0.08	5.33	4.41	0.53225	Complement control module (2);Sushi/SCR/CCP (3);	0.132116	0.51477	D	0.000085	T	0.29945	0.0749	N	0.03050	-0.425	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.006	T	0.25916	-1.0118	10	0.10636	T	0.68	.	5.7198	0.17980	0.2529:0.0:0.7471:0.0	.	3155;3299	Q7Z408;E7EUA6	CSMD2_HUMAN;.	F	3299	ENSP00000362479:L3299F	ENSP00000241312:L3155F	L	-	1	0	CSMD2	33772079	1.000000	0.71417	1.000000	0.80357	0.719000	0.41307	4.384000	0.59607	2.505000	0.84491	0.591000	0.81541	CTC	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.567	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		123	0.00	0	G	NM_052896		33999492	33999492	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	90	43.04	68	SNP	1.000	A
DENND4C	55667	genome.wustl.edu	37	9	19331976	19331976	+	Splice_Site	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr9:19331976G>A	ENST00000380432.2	+	13	1579	c.1546G>A	c.(1546-1548)Gaa>Aaa	p.E516K	DENND4C_ENST00000434457.2_Splice_Site_p.E752K|DENND4C_ENST00000602925.1_Splice_Site_p.E752K			Q5VZ89	DEN4C_HUMAN	DENN/MADD domain containing 4C	516					cellular response to insulin stimulus (GO:0032869)|positive regulation of Rab GTPase activity (GO:0032851)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)	cytosol (GO:0005829)|insulin-responsive compartment (GO:0032593)|plasma membrane (GO:0005886)|retromer complex (GO:0030904)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(8)|kidney(1)|large_intestine(7)|liver(2)|lung(13)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40						CTCTTTCTAGGAAATAAAAAC	0.338																																						dbGAP											0													62.0	58.0	60.0					9																	19331976		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK000693	CCDS6491.2, CCDS6491.3	9p22.1	2012-10-03	2006-01-27	2006-01-27	ENSG00000137145	ENSG00000137145		"""DENN/MADD domain containing"""	26079	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 55B"", ""chromosome 9 open reading frame 55"""	C9orf55B, C9orf55		12906859	Standard	NM_017925		Approved	FLJ20686, bA513M16.3	uc031tcw.1	Q5VZ89	OTTHUMG00000019627	ENST00000380432.2:c.1546-1G>A	9.37:g.19331976G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3R1|A2A3R2|A2A3R3|A2A3R9|Q6AI48|Q6ZUB3|Q8NCY7|Q9H6N4|Q9NUT1|Q9NWA5|Q9NWT3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_dDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.E516K	ENST00000380432.2	37	c.1546		9	.	.	.	.	.	.	.	.	.	.	G	31	5.083912	0.94050	.	.	ENSG00000137145	ENST00000380437	.	.	.	4.87	4.87	0.63330	.	0.107851	0.64402	D	0.000007	T	0.65933	0.2739	M	0.82056	2.57	0.80722	D	1	P	0.40431	0.717	B	0.36534	0.227	T	0.74734	-0.3565	9	0.87932	D	0	-17.6815	18.167	0.89731	0.0:0.0:1.0:0.0	.	516	Q5VZ89	DEN4C_HUMAN	K	516	.	ENSP00000369802:E516K	E	+	1	0	DENND4C	19321976	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.601000	0.98297	2.696000	0.92011	0.655000	0.94253	GAA	DENND4C	-	NULL	ENSG00000137145		0.338	DENND4C-201	KNOWN	basic	protein_coding	DENND4C	HGNC	protein_coding		103	0.00	0	G	NM_017925	Missense_Mutation	19331976	19331976	+1	no_errors	ENST00000380437	ensembl	human	known	69_37n	missense	98	44.32	78	SNP	1.000	A
DGKI	9162	genome.wustl.edu	37	7	137206651	137206651	+	Missense_Mutation	SNP	C	C	T	rs200760549		TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr7:137206651C>T	ENST00000288490.5	-	21	2209	c.2209G>A	c.(2209-2211)Gaa>Aaa	p.E737K	DGKI_ENST00000453654.2_Missense_Mutation_p.E437K|DGKI_ENST00000446122.1_Missense_Mutation_p.E737K|DGKI_ENST00000424189.2_Missense_Mutation_p.E758K	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota	737					blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						TGGAATCCTTCATAGTCTTGT	0.453													C|||	1	0.000199681	0.0	0.0	5008	,	,		18369	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													123.0	105.0	111.0					7																	137206651		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.2209G>A	7.37:g.137206651C>T	ENSP00000288490:p.Glu737Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q9|Q9NZ49	Missense_Mutation	SNP	pfam_Diacylglycerol_kin_accessory,pfam_Diacylglycerol_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kin_accessory,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E758K	ENST00000288490.5	37	c.2272	CCDS5845.1	7	1	4.578754578754579E-4	0	0.0	0	0.0	1	0.0017482517482517483	0	0.0	C	35	5.568420	0.96540	.	.	ENSG00000157680	ENST00000453654;ENST00000540376;ENST00000424189;ENST00000288490;ENST00000446122	T;T;T	0.43688	1.58;0.94;1.13	5.87	5.87	0.94306	.	0.156824	0.56097	D	0.000024	T	0.62171	0.2406	M	0.64404	1.975	0.80722	D	1	D;D	0.62365	0.957;0.991	P;P	0.61477	0.691;0.889	T	0.60880	-0.7175	10	0.66056	D	0.02	.	20.1777	0.98189	0.0:1.0:0.0:0.0	.	437;737	E9PFX6;O75912	.;DGKI_HUMAN	K	437;685;758;737;737	ENSP00000392161:E437K;ENSP00000288490:E737K;ENSP00000399131:E737K	ENSP00000288490:E737K	E	-	1	0	DGKI	136857191	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.520000	0.73773	2.941000	0.99782	0.655000	0.94253	GAA	DGKI	-	NULL	ENSG00000157680		0.453	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	149	0.00	0	C	NM_004717		137206651	137206651	-1	no_errors	ENST00000424189	ensembl	human	known	69_37n	missense	68	41.38	48	SNP	1.000	T
DIAPH1	1729	genome.wustl.edu	37	5	140953564	140953566	+	In_Frame_Del	DEL	GGA	GGA	-			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:140953564_140953566delGGA	ENST00000398557.4	-	16	1991_1993	c.1851_1853delTCC	c.(1849-1854)cctcca>cca	p.617_618PP>P	DIAPH1_ENST00000389054.3_In_Frame_Del_p.617_618PP>P|DIAPH1_ENST00000398562.2_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000518047.1_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000253811.6_In_Frame_Del_p.617_618PP>P|DIAPH1_ENST00000398566.3_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000389057.5_In_Frame_Del_p.608_609PP>P|DIAPH1_ENST00000520569.1_In_Frame_Del_p.563_564PP>P	NM_005219.4	NP_005210.3	O60610	DIAP1_HUMAN	diaphanous-related formin 1	617	FH1.				actin filament polymerization (GO:0030041)|cellular response to histamine (GO:0071420)|cytoskeleton organization (GO:0007010)|positive regulation of cell migration (GO:0030335)|protein localization to microtubule (GO:0035372)|regulation of cell shape (GO:0008360)|regulation of microtubule-based process (GO:0032886)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|mitotic spindle (GO:0072686)|ruffle membrane (GO:0032587)	ion channel binding (GO:0044325)|poly(A) RNA binding (GO:0044822)|receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(12)|pancreas(1)|skin(2)|stomach(2)	23			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAAaggaggtggaggaggaggag	0.576																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			BC007411		5q31	2013-05-24	2013-05-24		ENSG00000131504	ENSG00000131504			2876	protein-coding gene	gene with protein product		602121	"""diaphanous (Drosophila, homolog) 1"", ""diaphanous homolog 1 (Drosophila)"""	DFNA1		9360932, 1350680	Standard	NM_005219		Approved	hDIA1, LFHL1	uc003llb.4	O60610	OTTHUMG00000149893	ENST00000398557.4:c.1851_1853delTCC	5.37:g.140953573_140953575delGGA	ENSP00000381565:p.Pro620del	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF18|B7ZKW2|E9PEZ2|Q17RN4|Q59FH8|Q9UC76	In_Frame_Del	DEL	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,pfam_Formin_homology_1,pfam_Drf_DAD,superfamily_ARM-type_fold,superfamily_FH2_actin-bd,superfamily_tRNA-bd_arm,smart_Actin-bd_FH2/DRF_autoreg	p.P620in_frame_del	ENST00000398557.4	37	c.1853_1851	CCDS43374.1	5																																																																																			DIAPH1	-	pfam_Formin_homology_1	ENSG00000131504		0.576	DIAPH1-203	KNOWN	basic|appris_candidate|CCDS	protein_coding	DIAPH1	HGNC	protein_coding		43	0.00	0	GGA	NM_005219		140953564	140953566	-1	no_errors	ENST00000253811	ensembl	human	known	69_37n	in_frame_del	26	10.34	3	DEL	0.010:0.008:0.007	-
DIS3	22894	genome.wustl.edu	37	13	73345227	73345227	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr13:73345227G>C	ENST00000377767.4	-	12	1762	c.1662C>G	c.(1660-1662)gaC>gaG	p.D554E	DIS3_ENST00000545453.1_Missense_Mutation_p.D392E|DIS3_ENST00000377780.4_Missense_Mutation_p.D524E	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	554					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		ACCTGTCCACGTCACATTTTA	0.358										Multiple Myeloma(4;0.011)																												dbGAP											0													120.0	114.0	116.0					13																	73345227		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.1662C>G	13.37:g.73345227G>C	ENSP00000366997:p.Asp554Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Missense_Mutation	SNP	pfam_RNase_II/R,smart_PINc_nuc-bd,smart_RNase_II/R	p.D554E	ENST00000377767.4	37	c.1662	CCDS9447.1	13	.	.	.	.	.	.	.	.	.	.	G	6.193	0.403713	0.11754	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	T;T;T	0.44881	0.91;0.91;0.91	5.41	-7.78	0.01223	Ribonuclease II/R (2);	0.128919	0.64402	D	0.000001	T	0.25938	0.0632	L	0.28608	0.87	0.29086	N	0.88238	B;B	0.11235	0.004;0.001	B;B	0.17433	0.01;0.018	T	0.01375	-1.1371	10	0.33141	T	0.24	.	16.0766	0.80971	0.7933:0.0:0.2067:0.0	.	524;554	Q9Y2L1-2;Q9Y2L1	.;RRP44_HUMAN	E	554;524;392	ENSP00000366997:D554E;ENSP00000367011:D524E;ENSP00000440058:D392E	ENSP00000366997:D554E	D	-	3	2	DIS3	72243228	0.212000	0.23540	0.472000	0.27241	0.033000	0.12548	-0.166000	0.09954	-1.790000	0.01263	-1.350000	0.01237	GAC	DIS3	-	pfam_RNase_II/R,smart_RNase_II/R	ENSG00000083520		0.358	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3	HGNC	protein_coding	OTTHUMT00000045250.2	184	0.00	0	G	NM_014953		73345227	73345227	-1	no_errors	ENST00000377767	ensembl	human	known	69_37n	missense	194	27.61	74	SNP	0.844	C
DMD	1756	genome.wustl.edu	37	X	32380914	32380914	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chrX:32380914C>G	ENST00000357033.4	-	37	5522	c.5316G>C	c.(5314-5316)aaG>aaC	p.K1772N	DMD_ENST00000378677.2_Missense_Mutation_p.K1768N	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1772	Interaction with SYNM. {ECO:0000250}.				cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				CCTTTCCAGTCTTAATTCTGT	0.478																																						dbGAP											0													178.0	140.0	153.0					X																	32380914		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5316G>C	X.37:g.32380914C>G	ENSP00000354923:p.Lys1772Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.K1772N	ENST00000357033.4	37	c.5316	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426010	0.43020	.	.	ENSG00000198947	ENST00000534884;ENST00000378682;ENST00000378684;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	T;T	0.52295	0.67;0.67	5.36	4.48	0.54585	.	0.000000	0.36555	U	0.002536	T	0.47691	0.1459	M	0.63843	1.955	0.80722	D	1	B;P;B;B;B	0.48589	0.004;0.912;0.005;0.005;0.005	B;P;B;B;B	0.47603	0.004;0.551;0.007;0.007;0.007	T	0.47086	-0.9144	10	0.51188	T	0.08	.	5.65	0.17610	0.1628:0.6761:0.0:0.1611	.	1764;1772;1768;431;428	P11532-4;P11532;E9PDN5;E7EQS7;E7EQS6	.;DMD_HUMAN;.;.;.	N	1764;431;428;1768;1772;1772;1649	ENSP00000367948:K1768N;ENSP00000354923:K1772N	ENSP00000354923:K1772N	K	-	3	2	DMD	32290835	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.021000	0.41020	0.993000	0.38866	0.544000	0.68410	AAG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.478	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	151	0.00	0	C	NM_004006		32380914	32380914	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	missense	91	41.40	65	SNP	1.000	G
DNAH7	56171	genome.wustl.edu	37	2	196619103	196619103	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:196619103C>T	ENST00000312428.6	-	63	11822	c.11722G>A	c.(11722-11724)Gaa>Aaa	p.E3908K	DNAH7_ENST00000409063.1_Missense_Mutation_p.E391K	NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	3908					cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						TCCATCACTTCATAGTCAAAC	0.463																																						dbGAP											0													123.0	120.0	121.0					2																	196619103		1916	4128	6044	-	-	-	SO:0001583	missense	0			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.11722G>A	2.37:g.196619103C>T	ENSP00000311273:p.Glu3908Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.E3908K	ENST00000312428.6	37	c.11722	CCDS42794.1	2	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950731	0.73787	.	.	ENSG00000118997	ENST00000312428;ENST00000409063	T;T	0.09163	3.01;3.01	5.55	5.55	0.83447	Dynein heavy chain (1);	0.052296	0.64402	D	0.000001	T	0.22126	0.0533	M	0.63208	1.945	0.80722	D	1	P	0.38473	0.633	P	0.46208	0.507	T	0.00311	-1.1827	10	0.30078	T	0.28	.	19.2868	0.94082	0.0:1.0:0.0:0.0	.	3908	Q8WXX0	DYH7_HUMAN	K	3908;391	ENSP00000311273:E3908K;ENSP00000386912:E391K	ENSP00000311273:E3908K	E	-	1	0	DNAH7	196327348	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	3.541000	0.53618	2.885000	0.99019	0.655000	0.94253	GAA	DNAH7	-	pfam_Dynein_heavy	ENSG00000118997		0.463	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	104	0.00	0	C	NM_018897		196619103	196619103	-1	no_errors	ENST00000312428	ensembl	human	known	69_37n	missense	44	55.10	54	SNP	1.000	T
DOCK11	139818	genome.wustl.edu	37	X	117722098	117722098	+	Splice_Site	SNP	A	A	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chrX:117722098A>T	ENST00000276202.7	+	17	1858		c.e17-1		DOCK11_ENST00000276204.6_Splice_Site	NM_144658.3	NP_653259.3	Q5JSL3	DOC11_HUMAN	dedicator of cytokinesis 11						blood coagulation (GO:0007596)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(4)|cervix(2)|endometrium(8)|kidney(5)|large_intestine(17)|liver(1)|lung(35)|ovary(4)|prostate(3)|skin(3)|stomach(1)|urinary_tract(1)	84						TCCCTGCTATAGATTGTATTA	0.323																																						dbGAP											0													90.0	87.0	88.0					X																	117722098		2201	4291	6492	-	-	-	SO:0001630	splice_region_variant	0			AK125641	CCDS35373.1	Xq24	2013-10-25			ENSG00000147251	ENSG00000147251		"""Pleckstrin homology (PH) domain containing"""	23483	protein-coding gene	gene with protein product	"""zizimin2"""	300681				12432077, 16968698	Standard	NM_144658		Approved	FLJ32122, FLJ43653, ZIZ2, ACG	uc004eqp.2	Q5JSL3	OTTHUMG00000022256	ENST00000276202.7:c.1796-1A>T	X.37:g.117722098A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMF0|Q66M66|Q6ZUJ5|Q86VU8|Q96MN3	Splice_Site	SNP	-	e17-2	ENST00000276202.7	37	c.1796-2	CCDS35373.1	X	.	.	.	.	.	.	.	.	.	.	A	18.74	3.688132	0.68271	.	.	ENSG00000147251	ENST00000276204;ENST00000276202	.	.	.	6.06	6.06	0.98353	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.6107	0.68514	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	DOCK11	117606126	1.000000	0.71417	0.976000	0.42696	0.804000	0.45430	8.886000	0.92447	2.050000	0.60909	0.481000	0.45027	.	DOCK11	-	-	ENSG00000147251		0.323	DOCK11-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DOCK11	HGNC	protein_coding	OTTHUMT00000356002.1	157	0.00	0	A	NM_144658	Intron	117722098	117722098	+1	no_errors	ENST00000276202	ensembl	human	known	69_37n	splice_site	131	16.03	25	SNP	1.000	T
DSPP	1834	genome.wustl.edu	37	4	88534180	88534180	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:88534180A>G	ENST00000282478.7	+	3	875	c.842A>G	c.(841-843)gAg>gGg	p.E281G	RP11-742B18.1_ENST00000506480.1_RNA|DSPP_ENST00000399271.1_Missense_Mutation_p.E281G			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	281					biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		AAGGGCCAGGAGGGCCAGGAC	0.443																																						dbGAP											0													113.0	122.0	119.0					4																	88534180		2009	4167	6176	-	-	-	SO:0001583	missense	0			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.842A>G	4.37:g.88534180A>G	ENSP00000282478:p.Glu281Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUI0|O95815	Missense_Mutation	SNP	NULL	p.E281G	ENST00000282478.7	37	c.842	CCDS43248.1	4	.	.	.	.	.	.	.	.	.	.	A	12.76	2.035962	0.35893	.	.	ENSG00000152591	ENST00000399271;ENST00000282478	D;D	0.94138	-3.36;-3.36	4.59	2.09	0.27110	.	.	.	.	.	D	0.89107	0.6621	L	0.46157	1.445	0.09310	N	1	B	0.14012	0.009	B	0.17979	0.02	T	0.77346	-0.2622	9	0.32370	T	0.25	-6.9253	8.0855	0.30769	0.8266:0.0:0.1734:0.0	.	281	Q9NZW4	DSPP_HUMAN	G	281	ENSP00000382213:E281G;ENSP00000282478:E281G	ENSP00000282478:E281G	E	+	2	0	DSPP	88753204	0.007000	0.16637	0.032000	0.17829	0.273000	0.26683	0.630000	0.24553	0.277000	0.22141	0.455000	0.32223	GAG	DSPP	-	NULL	ENSG00000152591		0.443	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	100	0.99	1	A	NM_014208		88534180	88534180	+1	no_errors	ENST00000282478	ensembl	human	known	69_37n	missense	85	21.30	23	SNP	0.067	G
EFCAB13	124989	genome.wustl.edu	37	17	45421643	45421643	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:45421643C>G	ENST00000331493.2	+	7	830	c.419C>G	c.(418-420)tCt>tGt	p.S140C	ITGB3_ENST00000435993.2_3'UTR|EFCAB13_ENST00000517484.1_Missense_Mutation_p.S140C|ITGB3_ENST00000560629.1_3'UTR	NM_152347.4	NP_689560.3	Q8IY85	EFC13_HUMAN	EF-hand calcium binding domain 13	140						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)										CTTTGTACATCTTCTGCAATT	0.388																																						dbGAP											0													209.0	195.0	200.0					17																	45421643		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC036407	CCDS11512.1, CCDS56034.1	17q21.32	2013-01-11	2012-07-20	2012-07-20	ENSG00000178852	ENSG00000178852		"""EF-hand domain containing"""	26864	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 57"""	C17orf57			Standard	NM_152347		Approved	FLJ40342	uc002iln.3	Q8IY85	OTTHUMG00000164767	ENST00000331493.2:c.419C>G	17.37:g.45421643C>G	ENSP00000332111:p.Ser140Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	G3V128|Q49AG9	Missense_Mutation	SNP	NULL	p.S140C	ENST00000331493.2	37	c.419	CCDS11512.1	17	.	.	.	.	.	.	.	.	.	.	C	12.99	2.102943	0.37145	.	.	ENSG00000178852	ENST00000331493;ENST00000517484;ENST00000344176	T;T	0.68025	0.21;-0.3	3.08	3.08	0.35506	.	0.483082	0.17817	N	0.160994	T	0.74642	0.3743	L	0.54323	1.7	0.09310	N	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71414	0.973;0.957;0.957	T	0.62690	-0.6801	10	0.87932	D	0	-15.1433	9.9026	0.41357	0.0:1.0:0.0:0.0	.	140;140;140	Q8N7U2;Q8IY85;G3V128	.;CQ057_HUMAN;.	C	140	ENSP00000332111:S140C;ENSP00000430048:S140C	ENSP00000332111:S140C	S	+	2	0	C17orf57	42776642	0.067000	0.21026	0.317000	0.25265	0.008000	0.06430	0.779000	0.26746	2.025000	0.59659	0.585000	0.79938	TCT	EFCAB13	-	NULL	ENSG00000178852		0.388	EFCAB13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFCAB13	HGNC	protein_coding	OTTHUMT00000380147.4	171	0.00	0	C	NM_152347		45421643	45421643	+1	no_errors	ENST00000331493	ensembl	human	known	69_37n	missense	132	20.48	34	SNP	0.425	G
DUS1L	64118	genome.wustl.edu	37	17	80018821	80018821	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:80018821C>T	ENST00000354321.7	-	8	1344	c.859G>A	c.(859-861)Gag>Aag	p.E287K	DUS1L_ENST00000306796.5_Missense_Mutation_p.E287K			Q6P1R4	DUS1L_HUMAN	dihydrouridine synthase 1-like (S. cerevisiae)	287							flavin adenine dinucleotide binding (GO:0050660)|tRNA dihydrouridine synthase activity (GO:0017150)			breast(1)|endometrium(1)|lung(2)|ovary(1)|skin(1)	6	all_neural(118;0.0878)|Ovarian(332;0.227)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0114)|OV - Ovarian serous cystadenocarcinoma(97;0.0211)			TCTCGCAGCTCCTGGTGCACC	0.687																																						dbGAP											0													37.0	35.0	36.0					17																	80018821		2200	4299	6499	-	-	-	SO:0001583	missense	0				CCDS32775.1	17q25.3	2005-08-09				ENSG00000169718			30086	protein-coding gene	gene with protein product						12477932	Standard	NM_022156		Approved	PP3111, DUS1	uc002kdr.4	Q6P1R4		ENST00000354321.7:c.859G>A	17.37:g.80018821C>T	ENSP00000346280:p.Glu287Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHV4|Q96AI3	Missense_Mutation	SNP	pfam_tRNA_hU_synthase	p.E287K	ENST00000354321.7	37	c.859	CCDS32775.1	17	.	.	.	.	.	.	.	.	.	.	C	14.10	2.435736	0.43224	.	.	ENSG00000169718	ENST00000354321;ENST00000306796;ENST00000542088;ENST00000538833	T;T;T	0.23552	1.9;1.9;1.9	5.28	2.07	0.26955	.	0.299519	0.36444	N	0.002586	T	0.28532	0.0706	L	0.57536	1.79	0.25870	N	0.98372	B;B	0.15473	0.004;0.013	B;B	0.26517	0.038;0.07	T	0.22871	-1.0204	10	0.28530	T	0.3	-13.4233	16.5834	0.84720	0.0:0.5194:0.4806:0.0	.	287;156	Q6P1R4;Q9BTJ3	DUS1L_HUMAN;.	K	287;287;150;155	ENSP00000346280:E287K;ENSP00000303515:E287K;ENSP00000445110:E155K	ENSP00000303515:E287K	E	-	1	0	DUS1L	77612110	1.000000	0.71417	0.998000	0.56505	0.863000	0.49368	3.040000	0.49799	0.192000	0.20272	-0.234000	0.12200	GAG	DUS1L	-	NULL	ENSG00000169718		0.687	DUS1L-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUS1L	HGNC	protein_coding	OTTHUMT00000442347.1	38	0.00	0	C	NM_022156		80018821	80018821	-1	no_errors	ENST00000306796	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	T
ENPP2	5168	genome.wustl.edu	37	8	120602841	120602841	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr8:120602841C>G	ENST00000075322.6	-	13	1169	c.1111G>C	c.(1111-1113)Gag>Cag	p.E371Q	ENPP2_ENST00000259486.6_Missense_Mutation_p.E423Q|ENPP2_ENST00000427067.2_Missense_Mutation_p.E367Q|ENPP2_ENST00000522826.1_Missense_Mutation_p.E371Q|ENPP2_ENST00000522167.1_Missense_Mutation_p.E10Q	NM_001040092.2	NP_001035181.1	Q13822	ENPP2_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 2	371					cellular component movement (GO:0006928)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|phosphate-containing compound metabolic process (GO:0006796)|phosphatidylcholine catabolic process (GO:0034638)|phospholipid catabolic process (GO:0009395)|regulation of cell migration (GO:0030334)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alkylglycerophosphoethanolamine phosphodiesterase activity (GO:0047391)|calcium ion binding (GO:0005509)|hydrolase activity (GO:0016787)|lysophospholipase activity (GO:0004622)|nucleic acid binding (GO:0003676)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(30)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)	69	Lung NSC(37;5.03e-06)|Ovarian(258;0.0249)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			CTCAAGAACTCAGTTCTATCA	0.348																																					Melanoma(20;305 879 2501 4818 31020)	dbGAP											0													98.0	100.0	99.0					8																	120602841		2203	4300	6503	-	-	-	SO:0001583	missense	0			D45421	CCDS6329.1, CCDS34936.1, CCDS47914.1	8q24.12	2014-04-09	2008-08-01		ENSG00000136960	ENSG00000136960	3.1.4.1, 3.6.1.9		3357	protein-coding gene	gene with protein product	"""autotaxin"""	601060		PDNP2		8586446	Standard	NM_001040092		Approved	ATX, PD-IALPHA	uc003yos.2	Q13822	OTTHUMG00000164995	ENST00000075322.6:c.1111G>C	8.37:g.120602841C>G	ENSP00000075322:p.Glu371Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8UHA1|E9PHP7|Q13827|Q14555|Q15117|Q9UCQ8|Q9UCR0|Q9UCR1|Q9UCR2|Q9UCR3|Q9UCR4	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.E423Q	ENST00000075322.6	37	c.1267	CCDS34936.1	8	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857813	0.91433	.	.	ENSG00000136960	ENST00000259486;ENST00000427067;ENST00000522167;ENST00000522826;ENST00000075322	T;T;T;T;T	0.72282	-0.64;-0.64;-0.64;-0.64;-0.64	5.66	5.66	0.87406	Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.83718	0.5315	M	0.67700	2.07	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;1.0	T	0.83078	-0.0139	10	0.49607	T	0.09	.	19.7534	0.96277	0.0:1.0:0.0:0.0	.	371;371;423;10	E9PHP7;Q13822;Q13822-2;E5RIA2	.;ENPP2_HUMAN;.;.	Q	423;367;10;371;371	ENSP00000259486:E423Q;ENSP00000403315:E367Q;ENSP00000429476:E10Q;ENSP00000428291:E371Q;ENSP00000075322:E371Q	ENSP00000075322:E371Q	E	-	1	0	ENPP2	120672022	1.000000	0.71417	0.998000	0.56505	0.950000	0.60333	7.398000	0.79919	2.673000	0.90976	0.650000	0.86243	GAG	ENPP2	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000136960		0.348	ENPP2-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENPP2	HGNC	protein_coding	OTTHUMT00000381390.1	124	0.00	0	C			120602841	120602841	-1	no_errors	ENST00000259486	ensembl	human	known	69_37n	missense	150	18.92	35	SNP	1.000	G
EVC2	132884	genome.wustl.edu	37	4	5627522	5627522	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:5627522A>G	ENST00000344408.5	-	13	2053	c.2000T>C	c.(1999-2001)cTc>cCc	p.L667P	EVC2_ENST00000344938.1_Missense_Mutation_p.L667P|EVC2_ENST00000310917.2_Missense_Mutation_p.L587P	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	667					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						TTTTTGGTGGAGCTTTTTCTT	0.378																																						dbGAP											0													209.0	199.0	203.0					4																	5627522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2000T>C	4.37:g.5627522A>G	ENSP00000342144:p.Leu667Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_EVC2-like	p.L667P	ENST00000344408.5	37	c.2000	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	A	16.24	3.066087	0.55539	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	D;D;D	0.85171	-1.95;-1.93;-1.94	5.54	5.54	0.83059	.	0.211712	0.45606	D	0.000353	D	0.90950	0.7155	M	0.61703	1.905	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91789	0.5442	10	0.72032	D	0.01	-18.4079	14.8544	0.70326	1.0:0.0:0.0:0.0	.	667	Q86UK5	LBN_HUMAN	P	667;587;667	ENSP00000339954:L667P;ENSP00000311683:L587P;ENSP00000342144:L667P	ENSP00000311683:L587P	L	-	2	0	EVC2	5678423	1.000000	0.71417	0.248000	0.24265	0.465000	0.32709	5.306000	0.65756	2.103000	0.63969	0.528000	0.53228	CTC	EVC2	-	NULL	ENSG00000173040		0.378	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	366	0.00	0	A	NM_147127		5627522	5627522	-1	no_errors	ENST00000344408	ensembl	human	known	69_37n	missense	114	35.59	63	SNP	0.944	G
FCER1A	2205	genome.wustl.edu	37	1	159275777	159275777	+	Splice_Site	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:159275777G>A	ENST00000368115.1	+	5	430		c.e5-1		FCER1A_ENST00000368114.1_Splice_Site	NM_002001.3	NP_001992.1	P12319	FCERA_HUMAN	Fc fragment of IgE, high affinity I, receptor for; alpha polypeptide						activation of JUN kinase activity (GO:0007257)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|leukotriene biosynthetic process (GO:0019370)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of granulocyte macrophage colony-stimulating factor biosynthetic process (GO:0045425)|positive regulation of interleukin-3 biosynthetic process (GO:0045401)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of type I hypersensitivity (GO:0001812)|serotonin secretion (GO:0001820)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(19)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	33	all_hematologic(112;0.0429)				Benzylpenicilloyl Polylysine(DB00895)|Omalizumab(DB00043)	ATGTTCTTCAGACTGGCTGCT	0.458																																						dbGAP											0													34.0	36.0	35.0					1																	159275777		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC015195	CCDS1184.1	1q23	2013-01-11			ENSG00000179639	ENSG00000179639		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3609	protein-coding gene	gene with protein product		147140		FCE1A		8245459	Standard	NM_002001		Approved		uc001ftq.3	P12319	OTTHUMG00000037176	ENST00000368115.1:c.332-1G>A	1.37:g.159275777G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e4-1	ENST00000368115.1	37	c.332-1	CCDS1184.1	1	.	.	.	.	.	.	.	.	.	.	G	16.82	3.228561	0.58777	.	.	ENSG00000179639	ENST00000368115;ENST00000368114	.	.	.	4.78	4.78	0.61160	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.1928	0.59722	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FCER1A	157542401	1.000000	0.71417	0.880000	0.34516	0.879000	0.50718	4.452000	0.60054	2.470000	0.83445	0.650000	0.86243	.	FCER1A	-	-	ENSG00000179639		0.458	FCER1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCER1A	HGNC	protein_coding	OTTHUMT00000090328.2	61	0.00	0	G	NM_002001	Intron	159275777	159275777	+1	no_errors	ENST00000368115	ensembl	human	known	69_37n	splice_site	79	19.00	19	SNP	0.992	A
F13B	2165	genome.wustl.edu	37	1	197031086	197031086	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:197031086C>A	ENST00000367412.1	-	3	322	c.279G>T	c.(277-279)aaG>aaT	p.K93N		NM_001994.2	NP_001985.2	P05160	F13B_HUMAN	coagulation factor XIII, B polypeptide	93	Sushi 2. {ECO:0000255|PROSITE- ProRule:PRU00302}.				blood coagulation (GO:0007596)	extracellular region (GO:0005576)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(5)|liver(1)|lung(40)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)	66						TCAGGTCAGGCTTAGTGCATT	0.313																																						dbGAP											0													63.0	57.0	59.0					1																	197031086		2202	4300	6502	-	-	-	SO:0001583	missense	0			M14057	CCDS1388.1	1q31-q32.1	2012-10-02			ENSG00000143278	ENSG00000143278			3534	protein-coding gene	gene with protein product		134580				2339067, 2271707	Standard	NM_001994		Approved	FXIIIB	uc001gtt.1	P05160	OTTHUMG00000036519	ENST00000367412.1:c.279G>T	1.37:g.197031086C>A	ENSP00000356382:p.Lys93Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E5|Q5VYL5	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.K93N	ENST00000367412.1	37	c.279	CCDS1388.1	1	.	.	.	.	.	.	.	.	.	.	C	15.39	2.819730	0.50633	.	.	ENSG00000143278	ENST00000367412	T	0.64618	-0.11	5.85	4.76	0.60689	Complement control module (2);Sushi/SCR/CCP (3);	0.232996	0.22210	N	0.063108	T	0.70527	0.3234	L	0.58101	1.795	0.42799	D	0.993925	D	0.76494	0.999	D	0.74674	0.984	T	0.63795	-0.6556	10	0.15499	T	0.54	.	10.5143	0.44881	0.0:0.8032:0.0:0.1968	.	93	P05160	F13B_HUMAN	N	93	ENSP00000356382:K93N	ENSP00000356382:K93N	K	-	3	2	F13B	195297709	1.000000	0.71417	0.993000	0.49108	0.526000	0.34562	0.984000	0.29565	2.768000	0.95171	0.655000	0.94253	AAG	F13B	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000143278		0.313	F13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F13B	HGNC	protein_coding	OTTHUMT00000088821.2	86	0.00	0	C	NM_001994		197031086	197031086	-1	no_errors	ENST00000367412	ensembl	human	known	69_37n	missense	113	12.40	16	SNP	1.000	A
FHDC1	85462	genome.wustl.edu	37	4	153875460	153875460	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:153875460G>C	ENST00000511601.1	+	4	840	c.652G>C	c.(652-654)Gag>Cag	p.E218Q	FHDC1_ENST00000260008.3_Missense_Mutation_p.E218Q			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	218	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.								ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					GTTTTTGCCAGAGTCAGAAGA	0.388																																						dbGAP											0													99.0	105.0	103.0					4																	153875460		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.652G>C	4.37:g.153875460G>C	ENSP00000427567:p.Glu218Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.E218Q	ENST00000511601.1	37	c.652	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	19.74	3.884638	0.72410	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.17370	2.28;2.28	5.76	4.92	0.64577	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.147853	0.64402	D	0.000015	T	0.42517	0.1206	M	0.78916	2.43	0.47407	D	0.999418	D	0.67145	0.996	D	0.68765	0.96	T	0.44559	-0.9320	10	0.72032	D	0.01	.	14.6615	0.68876	0.0695:0.0:0.9305:0.0	.	218	Q9C0D6	FHDC1_HUMAN	Q	218	ENSP00000427567:E218Q;ENSP00000260008:E218Q	ENSP00000260008:E218Q	E	+	1	0	FHDC1	154094910	1.000000	0.71417	0.995000	0.50966	0.967000	0.64934	5.689000	0.68234	1.461000	0.47929	0.650000	0.86243	GAG	FHDC1	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000137460		0.388	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	170	0.00	0	G	NM_033393		153875460	153875460	+1	no_errors	ENST00000260008	ensembl	human	known	69_37n	missense	103	34.81	55	SNP	0.993	C
FLG2	388698	genome.wustl.edu	37	1	152326689	152326689	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:152326689A>T	ENST00000388718.5	-	3	3645	c.3573T>A	c.(3571-3573)agT>agA	p.S1191R	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1191	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			GTTGTCCAGAACTAGAGAAAT	0.498																																						dbGAP											0													101.0	99.0	99.0					1																	152326689		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3573T>A	1.37:g.152326689A>T	ENSP00000373370:p.Ser1191Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S1191R	ENST00000388718.5	37	c.3573	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	A	7.632	0.679089	0.14907	.	.	ENSG00000143520	ENST00000388718	T	0.21361	2.01	2.67	-5.12	0.02893	.	.	.	.	.	T	0.03477	0.0100	L	0.31752	0.955	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.41448	-0.9508	9	0.28530	T	0.3	.	6.1146	0.20120	0.1881:0.1693:0.6425:0.0	.	1191	Q5D862	FILA2_HUMAN	R	1191	ENSP00000373370:S1191R	ENSP00000373370:S1191R	S	-	3	2	FLG2	150593313	0.125000	0.22332	0.000000	0.03702	0.108000	0.19459	0.402000	0.20965	-1.227000	0.02571	0.254000	0.18369	AGT	FLG2	-	NULL	ENSG00000143520		0.498	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	155	0.00	0	A	NM_001014342		152326689	152326689	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	144	18.08	32	SNP	0.000	T
FMO1	2326	genome.wustl.edu	37	1	171254413	171254413	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:171254413C>G	ENST00000354841.4	+	8	1460	c.1329C>G	c.(1327-1329)atC>atG	p.I443M	FMO1_ENST00000469112.1_3'UTR|FMO1_ENST00000367750.3_Missense_Mutation_p.I443M|FMO1_ENST00000402921.2_Missense_Mutation_p.I380M	NM_001282692.1	NP_001269621.1	Q01740	FMO1_HUMAN	flavin containing monooxygenase 1	443					NADPH oxidation (GO:0070995)|organic acid metabolic process (GO:0006082)|small molecule metabolic process (GO:0044281)|toxin metabolic process (GO:0009404)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum lumen (GO:0005788)|integral component of membrane (GO:0016021)	flavin adenine dinucleotide binding (GO:0050660)|monooxygenase activity (GO:0004497)|N,N-dimethylaniline monooxygenase activity (GO:0004499)|NADP binding (GO:0050661)			NS(1)|breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|prostate(2)|skin(2)	27	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)				Cevimeline(DB00185)|Cimetidine(DB00501)|Lorcaserin(DB04871)|Tamoxifen(DB00675)|Vandetanib(DB05294)|Voriconazole(DB00582)	TGACCTATATCAATGCAAAAC	0.443																																						dbGAP											0													162.0	149.0	153.0					1																	171254413		2203	4300	6503	-	-	-	SO:0001583	missense	0			M64082	CCDS1294.1, CCDS60351.1	1q24.3	2011-08-04			ENSG00000010932	ENSG00000010932	1.14.13.8		3769	protein-coding gene	gene with protein product		136130					Standard	XM_005245037		Approved		uc001ghl.3	Q01740	OTTHUMG00000035502	ENST00000354841.4:c.1329C>G	1.37:g.171254413C>G	ENSP00000346901:p.Ile443Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K248|B7Z3P4|Q5QPT2|Q9UJC2	Missense_Mutation	SNP	pfam_Flavin_mOase-like,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase,prints_Flavin_mOase_1,prints_Flavin_mOase_2	p.I443M	ENST00000354841.4	37	c.1329	CCDS1294.1	1	.	.	.	.	.	.	.	.	.	.	C	16.26	3.073125	0.55646	.	.	ENSG00000010932	ENST00000367750;ENST00000402921;ENST00000354841	T;T;T	0.60299	0.2;0.2;0.2	5.82	0.597	0.17504	.	0.407810	0.27240	N	0.020270	T	0.32102	0.0818	M	0.74389	2.26	0.38033	D	0.935231	P;B	0.35468	0.503;0.352	B;B	0.32980	0.156;0.111	T	0.11036	-1.0604	10	0.59425	D	0.04	-1.9359	2.8066	0.05429	0.1187:0.3427:0.3466:0.192	.	380;443	B7Z3P4;Q01740	.;FMO1_HUMAN	M	443;380;443	ENSP00000356724:I443M;ENSP00000385543:I380M;ENSP00000346901:I443M	ENSP00000346901:I443M	I	+	3	3	FMO1	169521037	0.007000	0.16637	0.003000	0.11579	0.968000	0.65278	-1.189000	0.03061	-0.121000	0.11787	0.563000	0.77884	ATC	FMO1	-	pfam_Flavin_mOase-like,pirsf_DiMe-aniline_mOase,prints_Flavin_mOase_2	ENSG00000010932		0.443	FMO1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FMO1	HGNC	protein_coding	OTTHUMT00000086212.1	136	0.00	0	C	NM_002021		171254413	171254413	+1	no_errors	ENST00000354841	ensembl	human	known	69_37n	missense	179	19.00	42	SNP	0.733	G
FSCB	84075	genome.wustl.edu	37	14	44973863	44973863	+	Silent	SNP	A	A	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr14:44973863A>C	ENST00000340446.4	-	1	2619	c.2328T>G	c.(2326-2328)gtT>gtG	p.V776V	RP11-163M18.1_ENST00000557465.1_RNA|RP11-163M18.1_ENST00000555433.1_RNA	NM_032135.3	NP_115511.3	Q5H9T9	FSCB_HUMAN	fibrous sheath CABYR binding protein	776						sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(47)|ovary(2)|pancreas(1)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	89				GBM - Glioblastoma multiforme(112;0.128)		CTTCCAAAACAACCGATCCTA	0.413																																						dbGAP											0													82.0	89.0	86.0					14																	44973863		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK124110	CCDS9679.1	14q21.3	2007-11-22	2007-11-22	2007-11-22	ENSG00000189139	ENSG00000189139			20494	protein-coding gene	gene with protein product		611779	"""chromosome 14 open reading frame 155"""	C14orf155		17855365	Standard	NM_032135		Approved	DKFZP434F1017	uc001wvn.3	Q5H9T9	OTTHUMG00000140262	ENST00000340446.4:c.2328T>G	14.37:g.44973863A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U7|Q86YI2|Q9H0J3	Silent	SNP	NULL	p.V776	ENST00000340446.4	37	c.2328	CCDS9679.1	14																																																																																			FSCB	-	NULL	ENSG00000189139		0.413	FSCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FSCB	HGNC	protein_coding	OTTHUMT00000276788.1	42	0.00	0	A	NM_032135		44973863	44973863	-1	no_errors	ENST00000340446	ensembl	human	known	69_37n	silent	56	22.22	16	SNP	0.001	C
GRID2	2895	genome.wustl.edu	37	4	94159585	94159585	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:94159585C>T	ENST00000282020.4	+	8	1447	c.1189C>T	c.(1189-1191)Cac>Tac	p.H397Y	GRID2_ENST00000510992.1_Missense_Mutation_p.H302Y	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2	397					cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TCCCAATGTCCACTTTGAAAT	0.408																																						dbGAP											0													115.0	118.0	117.0					4																	94159585		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.1189C>T	4.37:g.94159585C>T	ENSP00000282020:p.His397Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.H397Y	ENST00000282020.4	37	c.1189	CCDS3637.1	4	.	.	.	.	.	.	.	.	.	.	C	13.69	2.311668	0.40895	.	.	ENSG00000152208	ENST00000282020;ENST00000510992	D;D	0.81739	-1.53;-1.53	6.03	6.03	0.97812	Extracellular ligand-binding receptor (1);	0.246269	0.41097	D	0.000943	T	0.66406	0.2786	N	0.22421	0.69	0.38398	D	0.94557	B;B;B	0.15141	0.0;0.0;0.012	B;B;B	0.14578	0.002;0.002;0.011	T	0.61628	-0.7024	10	0.21014	T	0.42	.	9.2188	0.37364	0.1466:0.7808:0.0:0.0726	.	302;397;302	E9PH24;O43424;Q4KKU8	.;GRID2_HUMAN;.	Y	397;302	ENSP00000282020:H397Y;ENSP00000421257:H302Y	ENSP00000282020:H397Y	H	+	1	0	GRID2	94378608	0.967000	0.33354	1.000000	0.80357	0.739000	0.42172	2.294000	0.43567	2.868000	0.98415	0.557000	0.71058	CAC	GRID2	-	pfam_ANF_lig-bd_rcpt	ENSG00000152208		0.408	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	119	0.00	0	C			94159585	94159585	+1	no_errors	ENST00000282020	ensembl	human	known	69_37n	missense	78	44.68	63	SNP	0.994	T
GRK1	6011	genome.wustl.edu	37	13	114321853	114321853	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr13:114321853G>A	ENST00000335678.6	+	1	384	c.152G>A	c.(151-153)cGc>cAc	p.R51H		NM_002929.2	NP_002920.1	Q15835	RK_HUMAN	G protein-coupled receptor kinase 1	51	N-terminal.				negative regulation of apoptotic process (GO:0043066)|photoreceptor cell morphogenesis (GO:0008594)|phototransduction, visible light (GO:0007603)|positive regulation of phosphorylation (GO:0042327)|post-embryonic retina morphogenesis in camera-type eye (GO:0060060)|protein autophosphorylation (GO:0046777)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|protein kinase activity (GO:0004672)|rhodopsin kinase activity (GO:0050254)			ovary(2)	2	Lung NSC(43;0.0113)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.00696)|all_epithelial(44;0.00347)|all_lung(25;0.0221)|Breast(118;0.0411)|Lung NSC(25;0.0839)	all cancers(43;0.234)			GAGTCCCTCCGCGACAGCCTC	0.612																																						dbGAP											0													32.0	36.0	35.0					13																	114321853		2098	4219	6317	-	-	-	SO:0001583	missense	0					13q34	2013-09-02	2004-03-23	2004-03-24	ENSG00000185974	ENSG00000185974	2.7.11.14		10013	protein-coding gene	gene with protein product		180381	"""rhodopsin kinase"""	RHOK		8812493, 15057823	Standard	NM_002929		Approved	GPRK1, RK	uc010tkf.2	Q15835	OTTHUMG00000185528	ENST00000335678.6:c.152G>A	13.37:g.114321853G>A	ENSP00000334876:p.Arg51His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53X14	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_GPCR_kinase,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom	p.R51H	ENST00000335678.6	37	c.152		13	.	.	.	.	.	.	.	.	.	.	G	12.39	1.922244	0.33908	.	.	ENSG00000185974	ENST00000335678	T	0.02606	4.23	5.1	4.25	0.50352	Regulator of G protein signalling superfamily (1);	0.059933	0.64402	D	0.000002	T	0.02267	0.0070	.	.	.	0.39602	D	0.969743	P	0.50617	0.937	B	0.30401	0.115	T	0.57112	-0.7867	9	0.87932	D	0	-21.9939	8.1984	0.31411	0.1826:0.0:0.8174:0.0	.	51	Q15835	RK_HUMAN	H	51	ENSP00000334876:R51H	ENSP00000334876:R51H	R	+	2	0	GRK1	113369854	0.981000	0.34729	0.068000	0.19968	0.023000	0.10783	2.289000	0.43523	1.124000	0.41980	0.561000	0.74099	CGC	GRK1	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000185974		0.612	GRK1-001	KNOWN	basic|appris_principal	protein_coding	GRK1	HGNC	protein_coding	OTTHUMT00000470655.1	39	0.00	0	G	NM_002929		114321853	114321853	+1	no_errors	ENST00000335678	ensembl	human	known	69_37n	missense	41	23.64	13	SNP	0.959	A
HMCN1	83872	genome.wustl.edu	37	1	186114610	186114610	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:186114610A>T	ENST00000271588.4	+	92	14571	c.14342A>T	c.(14341-14343)tAc>tTc	p.Y4781F	HMCN1_ENST00000367492.2_Missense_Mutation_p.Y4781F	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4781	TSP type-1 5. {ECO:0000255|PROSITE- ProRule:PRU00210}.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						ATGCGGCGGTACCGCACATGT	0.567																																						dbGAP											0													95.0	86.0	89.0					1																	186114610		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.14342A>T	1.37:g.186114610A>T	ENSP00000271588:p.Tyr4781Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.Y4781F	ENST00000271588.4	37	c.14342	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	A	21.8	4.195404	0.78902	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.54279	0.58;0.58	5.44	4.3	0.51218	.	0.167535	0.56097	N	0.000039	T	0.45975	0.1369	L	0.43646	1.37	0.51233	D	0.999914	B	0.21452	0.056	B	0.26202	0.067	T	0.36138	-0.9760	10	0.48119	T	0.1	.	11.6937	0.51532	0.8673:0.0:0.0:0.1327	.	4781	Q96RW7	HMCN1_HUMAN	F	4781	ENSP00000271588:Y4781F;ENSP00000356462:Y4781F	ENSP00000271588:Y4781F	Y	+	2	0	HMCN1	184381233	1.000000	0.71417	0.976000	0.42696	0.696000	0.40369	5.839000	0.69395	0.874000	0.35823	0.533000	0.62120	TAC	HMCN1	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000143341		0.567	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	78	0.00	0	A	NM_031935		186114610	186114610	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	57	32.94	28	SNP	1.000	T
IKBKAP	8518	genome.wustl.edu	37	9	111674596	111674596	+	Silent	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr9:111674596C>G	ENST00000374647.5	-	11	1444	c.1137G>C	c.(1135-1137)cgG>cgC	p.R379R	IKBKAP_ENST00000537196.1_Silent_p.R30R	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	379					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)			NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						CTCCCACGCTCCGGTCAGTCG	0.547																																						dbGAP											0													109.0	90.0	97.0					9																	111674596		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.1137G>C	9.37:g.111674596C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSV2|Q9H327|Q9UG87	Silent	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.R379	ENST00000374647.5	37	c.1137	CCDS6773.1	9																																																																																			IKBKAP	-	pfam_IKI3,pirsf_IKI3	ENSG00000070061		0.547	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	59	0.00	0	C			111674596	111674596	-1	no_errors	ENST00000374647	ensembl	human	known	69_37n	silent	53	19.70	13	SNP	1.000	G
IPP	3652	genome.wustl.edu	37	1	46206927	46206927	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:46206927G>A	ENST00000396478.3	-	3	472	c.370C>T	c.(370-372)Cat>Tat	p.H124Y		NM_005897.2	NP_005888.1	Q9Y573	IPP_HUMAN	intracisternal A particle-promoted polypeptide	124						actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	actin binding (GO:0003779)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|stomach(2)	20	Acute lymphoblastic leukemia(166;0.155)					CAGCAAAGATGAACAACTTCA	0.383																																						dbGAP											0													62.0	62.0	62.0					1																	46206927		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032544	CCDS30702.1, CCDS44132.1	1p34-p32	2013-01-30			ENSG00000197429	ENSG00000197429		"""Kelch-like"", ""BTB/POZ domain containing"""	6108	protein-coding gene	gene with protein product	"""kelch-like family member 27"""	147485				1905535, 8432546	Standard	NM_005897		Approved	KLHL27	uc001cou.3	Q9Y573	OTTHUMG00000008004	ENST00000396478.3:c.370C>T	1.37:g.46206927G>A	ENSP00000379739:p.His124Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A6V4|D3DQ11|Q8N5C3	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.H124Y	ENST00000396478.3	37	c.370	CCDS30702.1	1	.	.	.	.	.	.	.	.	.	.	G	13.73	2.322904	0.41096	.	.	ENSG00000197429	ENST00000359942;ENST00000396478	T;T	0.67523	-0.27;-0.27	5.19	-4.8	0.03190	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.699166	0.15310	N	0.269124	T	0.45816	0.1361	N	0.21194	0.64	0.20403	N	0.999906	B;B	0.26775	0.005;0.159	B;B	0.21360	0.006;0.034	T	0.36212	-0.9757	10	0.87932	D	0	.	11.3184	0.49405	0.0:0.1383:0.74:0.1218	.	124;124	Q9Y573;A2A6V3	IPP_HUMAN;.	Y	124	ENSP00000353024:H124Y;ENSP00000379739:H124Y	ENSP00000353024:H124Y	H	-	1	0	IPP	45979514	0.953000	0.32496	0.970000	0.41538	0.994000	0.84299	0.291000	0.18994	-0.620000	0.05641	-0.274000	0.10170	CAT	IPP	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000197429		0.383	IPP-001	KNOWN	mRNA_end_NF|basic|appris_principal|CCDS	protein_coding	IPP	HGNC	protein_coding	OTTHUMT00000021974.3	53	0.00	0	G	NM_005897		46206927	46206927	-1	no_errors	ENST00000396478	ensembl	human	known	69_37n	missense	67	19.28	16	SNP	0.923	A
IRF1	3659	genome.wustl.edu	37	5	131822339	131822339	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:131822339G>A	ENST00000245414.4	-	6	712	c.454C>T	c.(454-456)Ctc>Ttc	p.L152F	IRF1_ENST00000463784.1_5'UTR|IRF1_ENST00000405885.2_Missense_Mutation_p.L152F	NM_002198.2	NP_002189.1	P10914	IRF1_HUMAN	interferon regulatory factor 1	152					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|CD8-positive, alpha-beta T cell differentiation (GO:0043374)|cell cycle arrest (GO:0007050)|cellular response to interferon-beta (GO:0035458)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of regulatory T cell differentiation (GO:0045590)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|regulation of adaptive immune response (GO:0002819)|regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000564)|regulation of cell cycle (GO:0051726)|regulation of innate immune response (GO:0045088)|regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034124)|transcription from RNA polymerase II promoter (GO:0006366)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|urinary_tract(1)	11		all_cancers(142;0.026)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	LUAD - Lung adenocarcinoma(142;0.247)		GAGCTGCTGAGTCCATCAGAG	0.572																																						dbGAP											0													120.0	111.0	114.0					5																	131822339		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4155.1	5q23-q31	2008-07-18			ENSG00000125347	ENSG00000125347			6116	protein-coding gene	gene with protein product	"""interferon regulatory factor-1"""	147575				2726461, 1680796	Standard	NM_002198		Approved	MAR	uc003kxa.2	P10914	OTTHUMG00000059497	ENST00000245414.4:c.454C>T	5.37:g.131822339G>A	ENSP00000245414:p.Leu152Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96GG7	Missense_Mutation	SNP	pfam_Interferon_reg_fact_DNA-bd_dom,smart_Interferon_reg_fact_DNA-bd_dom,pirsf_Interferon_reg_fac-1/2,prints_Interferon_reg_fact_DNA-bd_dom	p.L152F	ENST00000245414.4	37	c.454	CCDS4155.1	5	.	.	.	.	.	.	.	.	.	.	G	20.5	3.994112	0.74703	.	.	ENSG00000125347	ENST00000245414;ENST00000405885;ENST00000437654;ENST00000458069	D;D;D;D	0.98996	-5.31;-5.31;-5.27;-5.28	5.96	5.09	0.68999	.	3.842630	0.00567	N	0.000285	D	0.99020	0.9665	M	0.64997	1.995	0.47094	D	0.999319	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	D	0.93699	0.7014	10	0.10636	T	0.68	-21.4785	10.1683	0.42893	0.1446:0.0:0.8554:0.0	.	152;152	Q5FBX3;P10914	.;IRF1_HUMAN	F	152	ENSP00000245414:L152F;ENSP00000384406:L152F;ENSP00000405655:L152F;ENSP00000396318:L152F	ENSP00000245414:L152F	L	-	1	0	IRF1	131850238	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.131000	0.50515	2.824000	0.97209	0.655000	0.94253	CTC	IRF1	-	pirsf_Interferon_reg_fac-1/2	ENSG00000125347		0.572	IRF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF1	HGNC	protein_coding	OTTHUMT00000132340.1	132	0.00	0	G	NM_002198		131822339	131822339	-1	no_errors	ENST00000245414	ensembl	human	known	69_37n	missense	56	42.27	41	SNP	0.997	A
KIAA0195	9772	genome.wustl.edu	37	17	73484883	73484883	+	Missense_Mutation	SNP	C	C	A	rs369687856		TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:73484883C>A	ENST00000314256.7	+	7	1050	c.656C>A	c.(655-657)cCc>cAc	p.P219H	KIAA0195_ENST00000375248.5_Missense_Mutation_p.P229H|KIAA0195_ENST00000583795.1_3'UTR|KIAA0195_ENST00000579208.1_Intron	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	219						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTCTTCCCCCCCTTCTCCCCT	0.637																																						dbGAP											0													67.0	73.0	71.0					17																	73484883		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.656C>A	17.37:g.73484883C>A	ENSP00000313885:p.Pro219His	Somatic		WXS	Illumina GAIIx	Phase_IV	O75536|Q86XF1	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.P219H	ENST00000314256.7	37	c.656	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	C	25.0	4.597458	0.87055	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.48201	0.82;0.82	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.67173	0.2865	L	0.56769	1.78	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.994	T	0.69614	-0.5098	10	0.72032	D	0.01	-14.7812	18.8431	0.92192	0.0:1.0:0.0:0.0	.	229;219	C9JL75;Q12767	.;K0195_HUMAN	H	219;229	ENSP00000313885:P219H;ENSP00000364397:P229H	ENSP00000313885:P219H	P	+	2	0	KIAA0195	70996478	1.000000	0.71417	0.991000	0.47740	0.831000	0.47069	7.395000	0.79876	2.449000	0.82847	0.561000	0.74099	CCC	KIAA0195	-	NULL	ENSG00000177728		0.637	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	33	0.00	0	C	NM_014738		73484883	73484883	+1	no_errors	ENST00000314256	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	A
KIAA0556	23247	genome.wustl.edu	37	16	27761615	27761615	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr16:27761615A>T	ENST00000261588.4	+	16	3353	c.3334A>T	c.(3334-3336)Acc>Tcc	p.T1112S		NM_015202.2	NP_056017.2	O60303	K0556_HUMAN	KIAA0556	1112						extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(7)|kidney(8)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	76						GGCCTCTGGAACCCTGGCGGG	0.498																																						dbGAP											0													68.0	73.0	71.0					16																	27761615		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB011128	CCDS32415.1	16p12.1-p11.2	2012-11-30			ENSG00000047578	ENSG00000047578			29068	protein-coding gene	gene with protein product						9628581	Standard	NM_015202		Approved		uc002dow.3	O60303	OTTHUMG00000176780	ENST00000261588.4:c.3334A>T	16.37:g.27761615A>T	ENSP00000261588:p.Thr1112Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C2	Missense_Mutation	SNP	superfamily_Thaumatin	p.T1112S	ENST00000261588.4	37	c.3334	CCDS32415.1	16	.	.	.	.	.	.	.	.	.	.	A	20.7	4.031547	0.75504	.	.	ENSG00000047578	ENST00000261588	T	0.13089	2.62	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	T	0.27559	0.0677	L	0.59436	1.845	0.51767	D	0.99993	P	0.48834	0.916	P	0.54629	0.757	T	0.00664	-1.1620	10	0.40728	T	0.16	-19.6082	15.2388	0.73452	1.0:0.0:0.0:0.0	.	1112	O60303	K0556_HUMAN	S	1112	ENSP00000261588:T1112S	ENSP00000261588:T1112S	T	+	1	0	KIAA0556	27669116	1.000000	0.71417	0.973000	0.42090	0.449000	0.32228	7.320000	0.79064	2.119000	0.64992	0.528000	0.53228	ACC	KIAA0556	-	NULL	ENSG00000047578		0.498	KIAA0556-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0556	HGNC	protein_coding	OTTHUMT00000433724.1	63	0.00	0	A	NM_015202		27761615	27761615	+1	no_errors	ENST00000261588	ensembl	human	known	69_37n	missense	30	31.11	14	SNP	1.000	T
KIAA1244	57221	genome.wustl.edu	37	6	138582743	138582743	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr6:138582743C>T	ENST00000251691.4	+	11	1350	c.1184C>T	c.(1183-1185)tCa>tTa	p.S395L		NM_020340.4	NP_065073.3			KIAA1244											NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(11)|lung(17)|ovary(2)|skin(2)	44	Breast(32;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00102)|GBM - Glioblastoma multiforme(68;0.00259)		AGATCAATTTCAAAAAGAAAG	0.393																																						dbGAP											0													45.0	44.0	45.0					6																	138582743		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB033070	CCDS5189.2	6q23.3	2012-04-17			ENSG00000112379	ENSG00000112379		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21213	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 33"""		"""chromosome 6 open reading frame 92"""	C6orf92			Standard	NM_020340		Approved	dJ171N11.1, BIG3, PPP1R33	uc003qhu.3	Q5TH69	OTTHUMG00000015670	ENST00000251691.4:c.1184C>T	6.37:g.138582743C>T	ENSP00000251691:p.Ser395Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold,superfamily_Sec7,smart_Sec7	p.S395L	ENST00000251691.4	37	c.1184	CCDS5189.2	6	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596830	0.86953	.	.	ENSG00000112379	ENST00000251691	T	0.20463	2.07	5.83	5.83	0.93111	.	0.000000	0.85682	D	0.000000	T	0.13457	0.0326	L	0.60455	1.87	0.54753	D	0.999984	B	0.15141	0.012	B	0.11329	0.006	T	0.01692	-1.1294	10	0.56958	D	0.05	-0.0146	13.347	0.60580	0.0:0.9283:0.0:0.0717	.	395	Q5TH69	BIG3_HUMAN	L	395	ENSP00000251691:S395L	ENSP00000251691:S395L	S	+	2	0	KIAA1244	138624436	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.600000	0.67599	2.763000	0.94921	0.563000	0.77884	TCA	KIAA1244	-	superfamily_ARM-type_fold	ENSG00000112379		0.393	KIAA1244-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	KIAA1244	HGNC	protein_coding	OTTHUMT00000042425.4	118	0.00	0	C	NM_020340		138582743	138582743	+1	no_errors	ENST00000251691	ensembl	human	known	69_37n	missense	126	53.16	143	SNP	1.000	T
KIFC3	3801	genome.wustl.edu	37	16	57803851	57803852	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr16:57803851_57803852insA	ENST00000379655.4	-	8	1212_1213	c.955_956insT	c.(955-957)tcafs	p.S319fs	KIFC3_ENST00000543930.1_Frame_Shift_Ins_p.S180fs|KIFC3_ENST00000540079.2_Frame_Shift_Ins_p.S217fs|KIFC3_ENST00000541240.1_Frame_Shift_Ins_p.S341fs|KIFC3_ENST00000465878.2_Frame_Shift_Ins_p.S180fs|KIFC3_ENST00000562903.1_Frame_Shift_Ins_p.S180fs|KIFC3_ENST00000539578.1_Frame_Shift_Ins_p.S261fs|KIFC3_ENST00000445690.2_Frame_Shift_Ins_p.S319fs|KIFC3_ENST00000566975.1_5'Flank|KIFC3_ENST00000421376.2_Frame_Shift_Ins_p.S180fs	NM_005550.3	NP_005541.3	Q9BVG8	KIFC3_HUMAN	kinesin family member C3	319					ATP catabolic process (GO:0006200)|epithelial cell-cell adhesion (GO:0090136)|Golgi organization (GO:0007030)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|visual perception (GO:0007601)|zonula adherens maintenance (GO:0045218)	centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|zonula adherens (GO:0005915)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(3)|endometrium(4)|large_intestine(3)|lung(6)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	23		all_neural(199;0.224)				CTCCAGCTCTGACTCGTACATG	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC001211	CCDS10789.2, CCDS45493.1, CCDS45494.1	16q13-q21	2008-02-05			ENSG00000140859	ENSG00000140859		"""Kinesins"""	6326	protein-coding gene	gene with protein product		604535				9782090	Standard	NM_001130099		Approved		uc002emp.3	Q9BVG8	OTTHUMG00000133455	ENST00000379655.4:c.956dupT	16.37:g.57803852_57803852dupA	ENSP00000368976:p.Ser319fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S2|B7Z484|O75299|Q49A29|Q49AQ0|Q59G19|Q8IUT3|Q96HW6	Frame_Shift_Ins	INS	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S319fs	ENST00000379655.4	37	c.956_955	CCDS10789.2	16																																																																																			KIFC3	-	NULL	ENSG00000140859		0.604	KIFC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIFC3	HGNC	protein_coding	OTTHUMT00000257329.2	43	0.00	0	-	NM_005550		57803851	57803852	-1	no_errors	ENST00000379655	ensembl	human	known	69_37n	frame_shift_ins	21	30.00	9	INS	0.674:0.677	A
L3MBTL3	84456	genome.wustl.edu	37	6	130374131	130374131	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr6:130374131G>C	ENST00000529410.1	+	9	1056	c.577G>C	c.(577-579)Gaa>Caa	p.E193Q	L3MBTL3_ENST00000368136.2_Missense_Mutation_p.E193Q|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.E193Q|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.E168Q|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.E168Q|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.E168Q			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	193					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GAGAGATGATGAAATGGTGAG	0.468																																						dbGAP											0													75.0	63.0	67.0					6																	130374131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.577G>C	6.37:g.130374131G>C	ENSP00000431962:p.Glu193Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.E193Q	ENST00000529410.1	37	c.577	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	G	17.96	3.514977	0.64634	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.16073	2.37;2.41;2.37;2.41;2.41;2.37	5.0	5.0	0.66597	.	1.129670	0.06539	N	0.742821	T	0.28200	0.0696	M	0.62723	1.935	0.43863	D	0.996462	D;D	0.71674	0.998;0.984	D;P	0.65684	0.937;0.786	T	0.02925	-1.1093	10	0.18276	T	0.48	.	16.4241	0.83808	0.0:0.0:1.0:0.0	.	168;193	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	Q	193;168;193;168;168;193	ENSP00000431962:E193Q;ENSP00000437185:E168Q;ENSP00000354526:E193Q;ENSP00000357121:E168Q;ENSP00000436706:E168Q;ENSP00000357118:E193Q	ENSP00000354526:E193Q	E	+	1	0	L3MBTL3	130415824	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	6.148000	0.71788	2.488000	0.83962	0.462000	0.41574	GAA	L3MBTL3	-	NULL	ENSG00000198945		0.468	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	47	0.00	0	G	XM_027074		130374131	130374131	+1	no_errors	ENST00000361794	ensembl	human	known	69_37n	missense	47	47.19	42	SNP	1.000	C
LRIT3	345193	genome.wustl.edu	37	4	110791367	110791367	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:110791367G>C	ENST00000594814.1	+	4	1462	c.1462G>C	c.(1462-1464)Gaa>Caa	p.E488Q	LRIT3_ENST00000379920.3_Missense_Mutation_p.E443Q|LRIT3_ENST00000409621.2_Missense_Mutation_p.E305Q|LRIT3_ENST00000327908.3_Missense_Mutation_p.E305Q	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	488	Fibronectin type-III. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		TGCCGCAATAGAAAACCTCAG	0.443																																						dbGAP											0													107.0	101.0	103.0					4																	110791367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1462G>C	4.37:g.110791367G>C	ENSP00000469759:p.Glu488Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E443Q	ENST00000594814.1	37	c.1327	CCDS3688.3	4	.	.	.	.	.	.	.	.	.	.	G	16.12	3.031641	0.54790	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.28895	1.59;1.59;1.59	5.06	2.99	0.34606	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.377447	0.32244	N	0.006370	T	0.21718	0.0523	L	0.44542	1.39	0.23168	N	0.998183	P;P	0.38922	0.651;0.589	B;B	0.36608	0.084;0.229	T	0.10683	-1.0619	10	0.42905	T	0.14	.	5.5908	0.17299	0.4075:0.0:0.5925:0.0	.	443;305	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	Q	305;443;305	ENSP00000328222:E305Q;ENSP00000369252:E443Q;ENSP00000386734:E305Q	ENSP00000328222:E305Q	E	+	1	0	LRIT3	111010816	1.000000	0.71417	0.894000	0.35097	0.734000	0.41952	2.226000	0.42963	1.093000	0.41377	0.655000	0.94253	GAA	LRIT3	-	superfamily_Fibronectin_type3	ENSG00000183423		0.443	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT3	HGNC	protein_coding	OTTHUMT00000335270.2	80	0.00	0	G	NM_198506		110791367	110791367	+1	no_errors	ENST00000379920	ensembl	human	known	69_37n	missense	38	40.62	26	SNP	0.993	C
LRRFIP1	9208	genome.wustl.edu	37	2	238672126	238672126	+	Silent	SNP	T	T	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:238672126T>C	ENST00000392000.4	+	11	1887	c.1770T>C	c.(1768-1770)gaT>gaC	p.D590D	LRRFIP1_ENST00000308482.9_Intron|LRRFIP1_ENST00000244815.5_Silent_p.D566D|LRRFIP1_ENST00000289175.6_Silent_p.D534D	NM_001137552.1	NP_001131024.1	Q32MZ4	LRRF1_HUMAN	leucine rich repeat (in FLII) interacting protein 1	590	Lys-rich.				innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|protein homodimerization activity (GO:0042803)			NS(1)|breast(4)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)	29		Breast(86;0.00257)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;9.75e-23)|OV - Ovarian serous cystadenocarcinoma(60;1.01e-10)|Kidney(56;4.85e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.31e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000151)|Lung(119;0.0137)|LUSC - Lung squamous cell carcinoma(224;0.0325)|COAD - Colon adenocarcinoma(134;0.228)		CCCTTAAAGATGTTAAAAAAG	0.383																																						dbGAP											0													46.0	49.0	48.0					2																	238672126		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AJ223075	CCDS2521.1, CCDS46551.1, CCDS46552.1, CCDS46553.1	2q37.3	2010-09-30			ENSG00000124831	ENSG00000124831			6702	protein-coding gene	gene with protein product	"""GC-binding factor 2"""	603256				9705290, 9525888, 16199883	Standard	NM_004735		Approved	FLAP-1, FLIIAP1, TRIP, GCF-2, HUFI-1	uc002vxe.3	Q32MZ4	OTTHUMG00000133339	ENST00000392000.4:c.1770T>C	2.37:g.238672126T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGZ2|O75766|O75799|Q32MZ5|Q53T49|Q6PKG2|Q9Y607	Silent	SNP	pfam_Leu-rich_rep_flightless-int_pr	p.D590	ENST00000392000.4	37	c.1770	CCDS46552.1	2																																																																																			LRRFIP1	-	NULL	ENSG00000124831		0.383	LRRFIP1-003	KNOWN	basic|CCDS	protein_coding	LRRFIP1	HGNC	protein_coding	OTTHUMT00000317198.1	106	0.00	0	T	NM_004735		238672126	238672126	+1	no_errors	ENST00000392000	ensembl	human	known	69_37n	silent	65	22.62	19	SNP	0.000	C
LRRK2	120892	genome.wustl.edu	37	12	40681167	40681167	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr12:40681167C>A	ENST00000298910.7	+	20	2573	c.2515C>A	c.(2515-2517)Cta>Ata	p.L839I	LRRK2_ENST00000343742.2_Missense_Mutation_p.L839I	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	839					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				AGCATCTACACTAGCAAGAAT	0.363																																						dbGAP											0													83.0	77.0	79.0					12																	40681167		2203	4299	6502	-	-	-	SO:0001583	missense	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2515C>A	12.37:g.40681167C>A	ENSP00000298910:p.Leu839Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.L839I	ENST00000298910.7	37	c.2515	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	C	14.12	2.440717	0.43326	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	T;T	0.78816	1.43;-1.21	5.49	3.65	0.41850	.	0.000000	0.64402	D	0.000004	T	0.80449	0.4625	L	0.36672	1.1	0.36929	D	0.89177	D;D	0.89917	0.999;1.0	D;D	0.85130	0.991;0.997	T	0.82987	-0.0184	10	0.66056	D	0.02	.	8.7254	0.34467	0.0:0.712:0.0:0.288	.	839;839	E9PC85;Q5S007	.;LRRK2_HUMAN	I	839	ENSP00000341930:L839I;ENSP00000298910:L839I	ENSP00000298910:L839I	L	+	1	2	LRRK2	38967434	0.271000	0.24162	0.874000	0.34290	0.380000	0.30137	0.226000	0.17776	1.317000	0.45149	-0.350000	0.07774	CTA	LRRK2	-	NULL	ENSG00000188906		0.363	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	116	0.00	0	C	XM_058513		40681167	40681167	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	missense	71	21.98	20	SNP	0.959	A
MACF1	23499	genome.wustl.edu	37	1	39895636	39895636	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:39895636G>C	ENST00000372915.3	+	63	16801	c.16714G>C	c.(16714-16716)Gag>Cag	p.E5572Q	MACF1_ENST00000539005.1_Missense_Mutation_p.E3484Q|MACF1_ENST00000317713.7_Missense_Mutation_p.E3614Q|MACF1_ENST00000545844.1_Missense_Mutation_p.E3614Q|MACF1_ENST00000564288.1_Missense_Mutation_p.E5676Q|MACF1_ENST00000361689.2_Missense_Mutation_p.E3614Q|MACF1_ENST00000289893.4_Missense_Mutation_p.E4116Q|MACF1_ENST00000567887.1_Missense_Mutation_p.E5713Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	5572					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GTCTACTTATGAGGAACTGAC	0.547																																						dbGAP											0													40.0	41.0	41.0					1																	39895636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.16714G>C	1.37:g.39895636G>C	ENSP00000362006:p.Glu5572Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E3614Q	ENST00000372915.3	37	c.10840		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.7|21.7	4.194684|4.194684	0.78902|0.78902	.|.	.|.	ENSG00000127603|ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000289893|ENST00000372925	T;T;T;T;T;T|.	0.63744|.	-0.06;1.24;-0.06;1.24;0.16;1.09|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.098852|.	0.44097|.	D|.	0.000495|.	T|.	0.70876|.	0.3274|.	L|L	0.47190|0.47190	1.495|1.495	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.996;0.995;0.973|.	P;D;P|.	0.66497|.	0.908;0.944;0.726|.	T|.	0.64045|.	-0.6499|.	10|.	0.62326|.	D|.	0.03|.	.|.	20.6721|20.6721	0.99693|0.99693	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	5572;3614;3558|.	Q9UPN3;F8W8Q1;Q9UPN3-3|.	MACF1_HUMAN;.;.|.	Q|S	3614;5572;3614;3614;3484;4116|2617	ENSP00000439537:E3614Q;ENSP00000362006:E5572Q;ENSP00000354573:E3614Q;ENSP00000313438:E3614Q;ENSP00000444364:E3484Q;ENSP00000289893:E4116Q|.	ENSP00000289893:E4116Q|.	E|X	+|+	1|2	0|2	MACF1|MACF1	39668223|39668223	1.000000|1.000000	0.71417|0.71417	0.996000|0.996000	0.52242|0.52242	0.794000|0.794000	0.44872|0.44872	6.539000|6.539000	0.73856|0.73856	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	GAG|TGA	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.547	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	49	0.00	0	G	NM_033044		39895636	39895636	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	92	25.81	32	SNP	1.000	C
MAB21L3	126868	genome.wustl.edu	37	1	116666885	116666885	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:116666885G>C	ENST00000369500.3	+	4	653	c.388G>C	c.(388-390)Gat>Cat	p.D130H	MAB21L3_ENST00000464946.1_3'UTR	NM_152367.2	NP_689580.2	Q8N8X9	MB213_HUMAN	mab-21-like 3 (C. elegans)	130										breast(2)|endometrium(1)|large_intestine(3)|lung(8)|prostate(2)|skin(2)|urinary_tract(1)	19						GCATGAGACAGATGTGAACAT	0.577																																						dbGAP											0													123.0	111.0	115.0					1																	116666885		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096035	CCDS886.1	1p13.1	2011-02-23	2011-02-23	2011-02-23	ENSG00000173212	ENSG00000173212			26787	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 161"""	C1orf161		14702039	Standard	NM_152367		Approved	FLJ38716	uc001egc.1	Q8N8X9	OTTHUMG00000012110	ENST00000369500.3:c.388G>C	1.37:g.116666885G>C	ENSP00000358512:p.Asp130His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDL7	Missense_Mutation	SNP	pfam_Mab-21_dom	p.D130H	ENST00000369500.3	37	c.388	CCDS886.1	1	.	.	.	.	.	.	.	.	.	.	G	11.99	1.803525	0.31869	.	.	ENSG00000173212	ENST00000369500	T	0.19669	2.13	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000019	T	0.34978	0.0916	M	0.78223	2.4	0.20638	N	0.999873	D	0.89917	1.0	D	0.80764	0.994	T	0.19712	-1.0297	10	0.30078	T	0.28	3.8453	16.619	0.84925	0.0:0.0:1.0:0.0	.	130	Q8N8X9	MB213_HUMAN	H	130	ENSP00000358512:D130H	ENSP00000358512:D130H	D	+	1	0	MAB21L3	116468408	1.000000	0.71417	0.037000	0.18230	0.028000	0.11728	4.327000	0.59247	2.344000	0.79699	0.650000	0.86243	GAT	MAB21L3	-	NULL	ENSG00000173212		0.577	MAB21L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L3	HGNC	protein_coding	OTTHUMT00000033486.1	88	0.00	0	G	NM_152367		116666885	116666885	+1	no_errors	ENST00000369500	ensembl	human	known	69_37n	missense	39	42.65	29	SNP	0.215	C
MAN2B2	23324	genome.wustl.edu	37	4	6612888	6612888	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr4:6612888G>C	ENST00000285599.3	+	15	2482	c.2446G>C	c.(2446-2448)Gtc>Ctc	p.V816L	MAN2B2_ENST00000504248.1_Missense_Mutation_p.V765L	NM_015274.1	NP_056089.1	Q9Y2E5	MA2B2_HUMAN	mannosidase, alpha, class 2B, member 2	816					mannose metabolic process (GO:0006013)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)	alpha-mannosidase activity (GO:0004559)|carbohydrate binding (GO:0030246)|zinc ion binding (GO:0008270)			breast(2)|cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(4)|prostate(2)|skin(2)|urinary_tract(1)	30						CGACACCTCAGTCGTCCACCC	0.647																																						dbGAP											0													60.0	59.0	59.0					4																	6612888		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033307	CCDS33951.1	4p16.2	2005-11-09			ENSG00000013288	ENSG00000013288			29623	protein-coding gene	gene with protein product	"""core-specific lysosomal alpha-1,6-Mannosidase"""					10231032, 16115860	Standard	XR_241647		Approved	KIAA0935	uc003gjf.1	Q9Y2E5	OTTHUMG00000160073	ENST00000285599.3:c.2446G>C	4.37:g.6612888G>C	ENSP00000285599:p.Val816Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q66MP2|Q86T67	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.V816L	ENST00000285599.3	37	c.2446	CCDS33951.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.09|11.09	1.536598|1.536598	0.27475|0.27475	.|.	.|.	ENSG00000013288|ENSG00000013288	ENST00000505907|ENST00000285599;ENST00000504248	.|T;T	.|0.77229	.|-1.08;-1.08	4.76|4.76	-6.66|-6.66	0.01789|0.01789	.|Glycosyl hydrolases 38, C-terminal (1);Glycoside hydrolase-type carbohydrate-binding (1);	.|0.522953	.|0.19926	.|N	.|0.102968	T|T	0.73745|0.73745	0.3626|0.3626	M|M	0.73962|0.73962	2.25|2.25	0.09310|0.09310	N|N	1|1	.|B;B;B	.|0.31581	.|0.329;0.329;0.18	.|B;B;B	.|0.35813	.|0.211;0.211;0.112	T|T	0.61028|0.61028	-0.7145|-0.7145	5|10	.|0.46703	.|T	.|0.11	-6.7467|-6.7467	13.8567|13.8567	0.63531|0.63531	0.3657:0.0:0.6343:0.0|0.3657:0.0:0.6343:0.0	.|.	.|765;816;816	.|E9PCD7;Q9Y2E5;Q9Y2E5-2	.|.;MA2B2_HUMAN;.	H|L	814|816;765	.|ENSP00000285599:V816L;ENSP00000423129:V765L	.|ENSP00000285599:V816L	Q|V	+|+	3|1	2|0	MAN2B2|MAN2B2	6663789|6663789	0.025000|0.025000	0.19082|0.19082	0.000000|0.000000	0.03702|0.03702	0.017000|0.017000	0.09413|0.09413	0.283000|0.283000	0.18846|0.18846	-2.408000|-2.408000	0.00573|0.00573	-1.049000|-1.049000	0.02347|0.02347	CAG|GTC	MAN2B2	-	pfam_Glyco_hydro_38_C,superfamily_Glyco_hydro-type_carb-bd	ENSG00000013288		0.647	MAN2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2B2	HGNC	protein_coding	OTTHUMT00000359106.2	33	0.00	0	G	NM_015274		6612888	6612888	+1	no_errors	ENST00000285599	ensembl	human	known	69_37n	missense	7	65.00	13	SNP	0.000	C
MTX2	10651	genome.wustl.edu	37	2	177188193	177188193	+	Splice_Site	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:177188193G>A	ENST00000249442.6	+	4	419		c.e4+1		MTX2_ENST00000443241.1_Intron|MTX2_ENST00000392529.2_Splice_Site	NM_006554.4	NP_006545.1	O75431	MTX2_HUMAN	metaxin 2						cellular protein metabolic process (GO:0044267)|mitochondrial transport (GO:0006839)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)			TCTCCATCTGGTAAGTGTGTT	0.313																																						dbGAP											0													217.0	190.0	199.0					2																	177188193		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF053551	CCDS2272.1	2q31.1	2012-02-07			ENSG00000128654	ENSG00000128654			7506	protein-coding gene	gene with protein product		608555				10381257, 17624330	Standard	NM_006554		Approved		uc002ukx.3	O75431	OTTHUMG00000132514	ENST00000249442.6:c.208+1G>A	2.37:g.177188193G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8JZZ4|Q53S50|Q53SQ2|Q5M7Z6|Q8IZ68	Splice_Site	SNP	-	e4+1	ENST00000249442.6	37	c.208+1	CCDS2272.1	2	.	.	.	.	.	.	.	.	.	.	G	21.6	4.175919	0.78564	.	.	ENSG00000128654	ENST00000249442;ENST00000392529;ENST00000452865	.	.	.	5.14	5.14	0.70334	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.6237	0.91330	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MTX2	176896439	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.972000	0.76110	2.397000	0.81536	0.484000	0.47621	.	MTX2	-	-	ENSG00000128654		0.313	MTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTX2	HGNC	protein_coding	OTTHUMT00000255695.4	288	0.00	0	G	NM_006554	Intron	177188193	177188193	+1	no_errors	ENST00000249442	ensembl	human	known	69_37n	splice_site	306	14.25	51	SNP	1.000	A
MUC12	10071	genome.wustl.edu	37	7	100635040	100635040	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr7:100635040C>T	ENST00000379442.3	+	5	1625	c.1625C>T	c.(1624-1626)tCa>tTa	p.S542L	MUC12_ENST00000536621.1_Missense_Mutation_p.S399L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	542	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						ACAAAATCTTCAACTCCTAGC	0.498																																						dbGAP											0													437.0	455.0	450.0					7																	100635040		692	1591	2283	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.1625C>T	7.37:g.100635040C>T	ENSP00000368755:p.Ser542Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.S542L	ENST00000379442.3	37	c.1625		7	.	.	.	.	.	.	.	.	.	.	C	9.467	1.094543	0.20471	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.12569	2.67;2.67	.	.	.	.	.	.	.	.	T	0.06188	0.0160	N	0.08118	0	0.20563	N	0.99989	.	.	.	.	.	.	T	0.42632	-0.9440	6	0.27082	T	0.32	.	5.844	0.18652	0.0:0.9991:0.0:9.0E-4	.	.	.	.	L	542;399	ENSP00000368755:S542L;ENSP00000441929:S399L	ENSP00000368755:S542L	S	+	2	0	MUC12	100421760	0.000000	0.05858	0.115000	0.21578	0.105000	0.19272	0.142000	0.16096	0.064000	0.16427	0.064000	0.15345	TCA	MUC12	-	NULL	ENSG00000205277		0.498	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	644	0.00	0	C	XM_379904		100635040	100635040	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	280	26.82	103	SNP	0.961	T
MUC4	4585	genome.wustl.edu	37	3	195475921	195475921	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr3:195475921G>C	ENST00000346145.4	-	23	3217	c.3178C>G	c.(3178-3180)Ctg>Gtg	p.L1060V	MUC4_ENST00000475231.1_Missense_Mutation_p.L5244V|MUC4_ENST00000349607.4_Missense_Mutation_p.L1009V|MUC4_ENST00000463781.3_Missense_Mutation_p.L5296V	NM_004532.5	NP_004523.3	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	2053					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		TAAGCCTTCAGCGTGCTCACG	0.537																																						dbGAP											0													72.0	64.0	67.0					3																	195475921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000346145.4:c.3178C>G	3.37:g.195475921G>C	ENSP00000304207:p.Leu1060Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EGF-like,pfscan_AMOP,pfscan_EG-like_dom	p.L5296V	ENST00000346145.4	37	c.15886	CCDS3310.1	3	.	.	.	.	.	.	.	.	.	.	g	0.854	-0.737526	0.03111	.	.	ENSG00000145113	ENST00000349607;ENST00000346145;ENST00000463781;ENST00000475231;ENST00000392409	T;T;T;T	0.51071	0.72;1.07;0.94;1.07	5.04	3.26	0.37387	.	0.000000	0.38837	N	0.001553	T	0.61248	0.2332	M	0.68593	2.085	0.09310	N	1	D;D;D;D;D;D	0.76494	0.993;0.999;0.999;0.999;0.999;0.998	D;D;D;D;D;D	0.76071	0.987;0.966;0.966;0.98;0.98;0.971	T	0.51379	-0.8713	10	0.66056	D	0.02	-9.6154	7.1665	0.25693	0.1965:0.0:0.8035:0.0	.	5168;1009;1060;5296;5244;2001	E7ESK3;Q99102-12;Q99102-13;E9PDY6;E7ENC5;Q99102-10	.;.;.;.;.;.	V	1009;1060;5296;5244;1796	ENSP00000338109:L1009V;ENSP00000304207:L1060V;ENSP00000417498:L5296V;ENSP00000420243:L5244V	ENSP00000304207:L1060V	L	-	1	2	MUC4	196961592	0.977000	0.34250	0.046000	0.18839	0.033000	0.12548	2.065000	0.41442	0.734000	0.32515	-0.269000	0.10298	CTG	MUC4	-	NULL	ENSG00000145113		0.537	MUC4-015	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000341862.1	21	0.00	0	G	NM_018406		195475921	195475921	-1	no_errors	ENST00000463781	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	0.135	C
MYO10	4651	genome.wustl.edu	37	5	16877797	16877797	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:16877797C>G	ENST00000513610.1	-	2	495	c.41G>C	c.(40-42)aGa>aCa	p.R14T	MYO10_ENST00000507288.1_Missense_Mutation_p.R14T	NM_012334.2	NP_036466.2	Q9HD67	MYO10_HUMAN	myosin X	14					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cytoskeleton-dependent intracellular transport (GO:0030705)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|positive regulation of cell-cell adhesion (GO:0022409)|regulation of cell shape (GO:0008360)|regulation of filopodium assembly (GO:0051489)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|plus-end directed microfilament motor activity (GO:0060002)|spectrin binding (GO:0030507)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|lung(28)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	86						GCCATTTTCTCTCAGCCAGAC	0.463																																						dbGAP											0													74.0	74.0	74.0					5																	16877797		1969	4168	6137	-	-	-	SO:0001583	missense	0			AF247457	CCDS54834.1	5p15.1-p14.3	2013-01-10				ENSG00000145555		"""Myosins / Myosin superfamily : Class X"", ""Pleckstrin homology (PH) domain containing"""	7593	protein-coding gene	gene with protein product		601481				8884266	Standard	NM_012334		Approved	KIAA0799	uc003jft.4	Q9HD67		ENST00000513610.1:c.41G>C	5.37:g.16877797C>G	ENSP00000421280:p.Arg14Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D1|O94893|Q8IVX5|Q9NYM7|Q9P110|Q9P111|Q9UHF6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_Pleckstrin_homology,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_Ras-assoc,superfamily_FERM_central,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology,prints_Myosin_head_motor_dom	p.R14T	ENST00000513610.1	37	c.41	CCDS54834.1	5	.	.	.	.	.	.	.	.	.	.	C	9.178	1.022922	0.19433	.	.	ENSG00000145555	ENST00000513610;ENST00000513882;ENST00000507288	D;D;D	0.87179	-2.19;-2.22;-1.89	5.32	1.57	0.23409	.	.	.	.	.	T	0.79179	0.4402	L	0.46157	1.445	0.80722	D	1	P;B	0.39782	0.688;0.09	B;B	0.36134	0.218;0.023	T	0.69658	-0.5086	9	0.25106	T	0.35	.	8.1412	0.31084	0.0:0.6636:0.0:0.3364	.	14;14	Q8IVX5;Q9HD67	.;MYO10_HUMAN	T	14;25;14	ENSP00000421280:R14T;ENSP00000421309:R25T;ENSP00000426664:R14T	ENSP00000426664:R14T	R	-	2	0	MYO10	16930797	1.000000	0.71417	0.989000	0.46669	0.994000	0.84299	2.025000	0.41059	0.249000	0.21456	0.561000	0.74099	AGA	MYO10	-	NULL	ENSG00000145555		0.463	MYO10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO10	HGNC	protein_coding	OTTHUMT00000366167.1	64	0.00	0	C	NM_012334		16877797	16877797	-1	no_errors	ENST00000513610	ensembl	human	known	69_37n	missense	27	50.00	27	SNP	0.988	G
NADK2	133686	genome.wustl.edu	37	5	36195293	36195293	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:36195293T>G	ENST00000381937.4	-	12	1281	c.1282A>C	c.(1282-1284)Atg>Ctg	p.M428L	NADK2_ENST00000282512.3_Missense_Mutation_p.M265L|NADK2_ENST00000506945.1_Missense_Mutation_p.M287L|NADK2_ENST00000514504.1_Missense_Mutation_p.M396L|NADK2_ENST00000397338.1_Missense_Mutation_p.M265L|NADK2_ENST00000511613.1_5'UTR	NM_001085411.1	NP_001078880.1	Q4G0N4	NAKD2_HUMAN	NAD kinase 2, mitochondrial	428					NAD metabolic process (GO:0019674)|NADP biosynthetic process (GO:0006741)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|NAD+ kinase activity (GO:0003951)|protein homodimerization activity (GO:0042803)										TTATTGATCATCATCGAAGCA	0.398																																						dbGAP											0													135.0	131.0	133.0					5																	36195293		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC062567	CCDS3917.1, CCDS47197.1, CCDS75235.1	5p13.2	2013-04-30	2013-04-30	2013-04-30	ENSG00000152620	ENSG00000152620			26404	protein-coding gene	gene with protein product	"""mitochondrial NAD kinase"""	615787	"""chromosome 5 open reading frame 33"", ""NAD kinase domain containing 1"""	C5orf33, NADKD1		23616928	Standard	NM_001085411		Approved	FLJ30596, MNADK	uc003jkf.4	Q4G0N4	OTTHUMG00000131105	ENST00000381937.4:c.1282A>C	5.37:g.36195293T>G	ENSP00000371362:p.Met428Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC93|Q6UTX5|Q96NM0	Missense_Mutation	SNP	pirsf_ATP-NAD-like_euk	p.M265L	ENST00000381937.4	37	c.793	CCDS47197.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	15.00|15.00	2.703879|2.703879	0.48412|0.48412	.|.	.|.	ENSG00000152620|ENSG00000152620	ENST00000397338;ENST00000282512;ENST00000381937;ENST00000506945;ENST00000514504|ENST00000502355	.|.	.|.	.|.	5.91|5.91	4.73|4.73	0.59995|0.59995	.|.	0.338646|.	0.42172|.	N|.	0.000759|.	T|.	0.17408|.	0.0418|.	N|N	0.08118|0.08118	0|0	0.27711|0.27711	N|N	0.945443|0.945443	B;B;B|.	0.02656|.	0.0;0.0;0.0|.	B;B;B|.	0.04013|.	0.001;0.0;0.0|.	T|.	0.18650|.	-1.0330|.	9|.	0.31617|.	T|.	0.26|.	-7.6404|-7.6404	5.3942|5.3942	0.16261|0.16261	0.3753:0.0756:0.0:0.5491|0.3753:0.0756:0.0:0.5491	.|.	287;396;428|.	B7Z8V7;Q4G0N4-2;Q4G0N4|.	.;.;NAKD1_HUMAN|.	L|C	265;265;428;287;396|122	.|.	ENSP00000282512:M265L|.	M|X	-|-	1|3	0|0	NADKD1|NADKD1	36231050|36231050	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	2.100000|2.100000	0.41777|0.41777	1.016000|1.016000	0.39470|0.39470	0.533000|0.533000	0.62120|0.62120	ATG|TGA	NADKD1	-	pirsf_ATP-NAD-like_euk	ENSG00000152620		0.398	NADK2-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	NADKD1	HGNC	protein_coding	OTTHUMT00000367541.1	170	0.58	1	T	NM_153013		36195293	36195293	-1	no_errors	ENST00000397338	ensembl	human	known	69_37n	missense	102	41.38	72	SNP	1.000	G
NBPF9	400818	genome.wustl.edu	37	1	144813815	144813815	+	Silent	SNP	A	A	G	rs371436644		TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:144813815A>G	ENST00000440491.2	+	2	288	c.288A>G	c.(286-288)gcA>gcG	p.A96A	NBPF9_ENST00000338347.4_Silent_p.A96A|NBPF9_ENST00000281815.8_5'UTR|NBPF9_ENST00000468645.1_3'UTR	NM_001037675.2	NP_001032764.2	Q3BBW0	NBPF9_HUMAN	neuroblastoma breakpoint family, member 9	354						cytoplasm (GO:0005737)		p.A96A(5)		NS(2)|prostate(1)	3						AGAAGCTTGCAGAGCAGCTGA	0.532																																						dbGAP											5	Substitution - coding silent(5)	kidney(4)|endometrium(1)											1.0	1.0	1.0					1																	144813815		263	708	971	-	-	-	SO:0001819	synonymous_variant	0				CCDS72895.1, CCDS72896.1	1q21.1	2013-01-17			ENSG00000168614	ENSG00000269713		"""neuroblastoma breakpoint family"""	31991	protein-coding gene	gene with protein product		613999				16079250	Standard	NM_001037675		Approved	AE01		Q3BBW0	OTTHUMG00000013845	ENST00000440491.2:c.288A>G	1.37:g.144813815A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_NBPF_dom	p.Q95R	ENST00000440491.2	37	c.284		1	.	.	.	.	.	.	.	.	.	.	.	1.684	-0.505860	0.04261	.	.	ENSG00000168614	ENST00000375552	.	.	.	0.723	-0.563	0.11778	.	.	.	.	.	T	0.07908	0.0198	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.36040	-0.9764	4	.	.	.	.	2.9279	0.05789	0.6738:0.0:0.3262:0.0	.	.	.	.	R	95	.	.	Q	+	2	0	NBPF9	143525172	0.031000	0.19500	0.003000	0.11579	0.003000	0.03518	0.134000	0.15932	-0.209000	0.10156	-1.211000	0.01629	CAG	NBPF9	-	NULL	ENSG00000168614		0.532	NBPF9-203	KNOWN	basic	protein_coding	NBPF9	HGNC	protein_coding		104	0.95	1	A	NM_001037675		144813815	144813815	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000375552	ensembl	human	known	69_37n	missense	147	10.91	18	SNP	0.004	G
NBR1	4077	genome.wustl.edu	37	17	41349048	41349048	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:41349048G>T	ENST00000422280.1	+	16	2410	c.1951G>T	c.(1951-1953)Gag>Tag	p.E651*	NBR1_ENST00000589872.1_Nonsense_Mutation_p.E651*|NBR1_ENST00000389312.4_Nonsense_Mutation_p.E651*|NBR1_ENST00000590996.1_Nonsense_Mutation_p.E651*|NBR1_ENST00000542611.1_Nonsense_Mutation_p.E630*|NBR1_ENST00000341165.6_Nonsense_Mutation_p.E651*	NM_031858.2	NP_114064.1	Q14596	NBR1_HUMAN	neighbor of BRCA1 gene 1	651					macroautophagy (GO:0016236)|negative regulation of osteoblast differentiation (GO:0045668)|protein oligomerization (GO:0051259)|regulation of bone mineralization (GO:0030500)|regulation of stress-activated MAPK cascade (GO:0032872)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|pre-autophagosomal structure (GO:0000407)	mitogen-activated protein kinase binding (GO:0051019)|ubiquitin binding (GO:0043130)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(1)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(3)	24		Breast(137;0.00086)		BRCA - Breast invasive adenocarcinoma(366;0.0934)		GTTTGTGTGTGAGACAGTAAT	0.502																																						dbGAP											0													145.0	126.0	132.0					17																	41349048		1568	3582	5150	-	-	-	SO:0001587	stop_gained	0			X76952	CCDS45694.1	17q21.31	2008-02-01	2005-02-15	2005-02-16		ENSG00000188554			6746	protein-coding gene	gene with protein product		166945	"""membrane component, chromosome 17, surface marker 2 (ovarian carcinoma antigen CA125)"""	M17S2		8069304	Standard	XM_006721903		Approved	CA125, KIAA0049, 1A1-3B	uc010whv.2	Q14596		ENST00000422280.1:c.1951G>T	17.37:g.41349048G>T	ENSP00000411250:p.Glu651*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13173|Q15026|Q5J7Q8|Q96GB6|Q9NRF7	Nonsense_Mutation	SNP	pfam_OPR_PB1,pfam_Znf_ZZ,superfamily_UBA-like,smart_OPR_PB1,smart_Znf_ZZ,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_ZZ	p.E651*	ENST00000422280.1	37	c.1951	CCDS45694.1	17	.	.	.	.	.	.	.	.	.	.	G	43	10.185304	0.99354	.	.	ENSG00000188554	ENST00000422280;ENST00000542611;ENST00000341165;ENST00000389312;ENST00000389311	.	.	.	5.67	5.67	0.87782	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.366	19.7632	0.96332	0.0:0.0:1.0:0.0	.	.	.	.	X	651;630;651;651;651	.	ENSP00000343479:E651X	E	+	1	0	NBR1	38704574	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.274000	0.78538	2.680000	0.91292	0.591000	0.81541	GAG	NBR1	-	NULL	ENSG00000188554		0.502	NBR1-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBR1	HGNC	protein_coding	OTTHUMT00000453461.1	114	0.00	0	G	NM_005899		41349048	41349048	+1	no_errors	ENST00000341165	ensembl	human	known	69_37n	nonsense	53	36.90	31	SNP	1.000	T
NIPBL	25836	genome.wustl.edu	37	5	36976318	36976318	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:36976318T>G	ENST00000282516.8	+	9	1808	c.1309T>G	c.(1309-1311)Tta>Gta	p.L437V	NIPBL_ENST00000504430.1_3'UTR|NIPBL_ENST00000448238.2_Missense_Mutation_p.L437V	NM_015384.4|NM_133433.3	NP_056199.2|NP_597677.2	Q6KC79	NIPBL_HUMAN	Nipped-B homolog (Drosophila)	437	Gln-rich.				brain development (GO:0007420)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to X-ray (GO:0071481)|cognition (GO:0050890)|developmental growth (GO:0048589)|ear morphogenesis (GO:0042471)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic forelimb morphogenesis (GO:0035115)|embryonic viscerocranium morphogenesis (GO:0048703)|external genitalia morphogenesis (GO:0035261)|eye morphogenesis (GO:0048592)|face morphogenesis (GO:0060325)|fat cell differentiation (GO:0045444)|forelimb morphogenesis (GO:0035136)|gall bladder development (GO:0061010)|heart morphogenesis (GO:0003007)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|metanephros development (GO:0001656)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|outflow tract morphogenesis (GO:0003151)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of ossification (GO:0045778)|regulation of developmental growth (GO:0048638)|regulation of embryonic development (GO:0045995)|regulation of hair cycle (GO:0042634)|sensory perception of sound (GO:0007605)|stem cell maintenance (GO:0019827)|uterus morphogenesis (GO:0061038)	extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMC loading complex (GO:0032116)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|histone deacetylase binding (GO:0042826)|protein C-terminus binding (GO:0008022)|protein N-terminus binding (GO:0047485)			autonomic_ganglia(1)|breast(4)|endometrium(9)|kidney(22)|large_intestine(21)|liver(1)|lung(47)|ovary(7)|pancreas(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	128	all_lung(31;0.000447)|Hepatocellular(1;0.108)		Epithelial(62;0.072)|COAD - Colon adenocarcinoma(61;0.14)|all cancers(62;0.191)|Colorectal(62;0.202)			AGTGCCTGTTTTACAACAGAA	0.423																																						dbGAP											0													79.0	80.0	80.0					5																	36976318		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB019494	CCDS3920.1, CCDS47198.1	5p13.2	2009-08-28			ENSG00000164190	ENSG00000164190			28862	protein-coding gene	gene with protein product	"""sister chromatid cohesion 2 homolog (yeast)"""	608667				15146186, 15146185	Standard	NM_133433		Approved	IDN3, DKFZp434L1319, FLJ11203, FLJ12597, FLJ13354, FLJ13648, Scc2	uc003jkl.4	Q6KC79	OTTHUMG00000090795	ENST00000282516.8:c.1309T>G	5.37:g.36976318T>G	ENSP00000282516:p.Leu437Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6KCD6|Q6N080|Q6ZT92|Q7Z2E6|Q8N4M5|Q9Y6Y3|Q9Y6Y4	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L437V	ENST00000282516.8	37	c.1309	CCDS3920.1	5	.	.	.	.	.	.	.	.	.	.	T	19.58	3.854328	0.71719	.	.	ENSG00000164190	ENST00000282516;ENST00000448238	D;D	0.94576	-3.45;-3.46	5.58	4.4	0.53042	.	0.000000	0.64402	D	0.000003	D	0.94042	0.8091	L	0.29908	0.895	0.37383	D	0.912114	D;D	0.67145	0.993;0.996	D;D	0.72625	0.952;0.978	D	0.93062	0.6475	10	0.25751	T	0.34	.	11.7662	0.51933	0.0:0.0705:0.0:0.9295	.	437;437	Q6KC79;Q6KC79-2	NIPBL_HUMAN;.	V	437	ENSP00000282516:L437V;ENSP00000406266:L437V	ENSP00000282516:L437V	L	+	1	2	NIPBL	37012075	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.035000	0.49759	2.133000	0.65898	0.377000	0.23210	TTA	NIPBL	-	NULL	ENSG00000164190		0.423	NIPBL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPBL	HGNC	protein_coding	OTTHUMT00000207582.1	74	0.00	0	T	NM_015384		36976318	36976318	+1	no_errors	ENST00000282516	ensembl	human	known	69_37n	missense	55	37.50	33	SNP	1.000	G
NPHS1	4868	genome.wustl.edu	37	19	36332657	36332657	+	Silent	SNP	G	G	T	rs386833925		TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:36332657G>T	ENST00000378910.5	-	20	2774	c.2775C>A	c.(2773-2775)gcC>gcA	p.A925A	NPHS1_ENST00000353632.6_Silent_p.A925A	NM_004646.3	NP_004637.1	O60500	NPHN_HUMAN	nephrosis 1, congenital, Finnish type (nephrin)	925	Ig-like C2-type 8.				cell adhesion (GO:0007155)|excretion (GO:0007588)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell development (GO:0072015)|JNK cascade (GO:0007254)|myoblast fusion (GO:0007520)|positive regulation of actin filament polymerization (GO:0030838)|regulation of excretion (GO:0044062)|skeletal muscle tissue development (GO:0007519)	cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|slit diaphragm (GO:0036057)	myosin binding (GO:0017022)			NS(2)|breast(1)|cervix(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(1)|lung(26)|ovary(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	74	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			CCGAGCCAAGGGCGTTGGTGG	0.582																																						dbGAP											0													209.0	153.0	172.0					19																	36332657		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32996.1	19q12-q13.1	2014-09-17				ENSG00000161270		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7908	protein-coding gene	gene with protein product		602716				9915943, 9660941	Standard	NM_004646		Approved	CNF, NPHN	uc002oby.3	O60500		ENST00000378910.5:c.2775C>A	19.37:g.36332657G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDH2|C3RX61	Silent	SNP	pfam_CD80_C2-set,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A925	ENST00000378910.5	37	c.2775	CCDS32996.1	19																																																																																			NPHS1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000161270		0.582	NPHS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHS1	HGNC	protein_coding	OTTHUMT00000452553.1	156	0.00	0	G			36332657	36332657	-1	no_errors	ENST00000378910	ensembl	human	known	69_37n	silent	95	20.17	24	SNP	1.000	T
OR52B2	255725	genome.wustl.edu	37	11	6191248	6191248	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr11:6191248G>A	ENST00000530810.1	-	1	390	c.309C>T	c.(307-309)ggC>ggT	p.G103G	RP11-290F24.3_ENST00000529961.1_RNA	NM_001004052.1	NP_001004052.1	Q96RD2	O52B2_HUMAN	olfactory receptor, family 52, subfamily B, member 2	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(3)|endometrium(1)|large_intestine(1)|lung(15)	21		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.114)		Epithelial(150;3.69e-08)|BRCA - Breast invasive adenocarcinoma(625;0.135)		GGACAAAGAAGCCTTGGGTGA	0.493																																					NSCLC(5;186 261 1778 7098 14207)	dbGAP											0													112.0	115.0	114.0					11																	6191248		2174	4282	6456	-	-	-	SO:0001819	synonymous_variant	0			AB065763	CCDS53598.1	11p15.4	2012-08-09				ENSG00000255307		"""GPCR / Class A : Olfactory receptors"""	15207	protein-coding gene	gene with protein product							Standard	NM_001004052		Approved		uc010qzy.2	Q96RD2		ENST00000530810.1:c.309C>T	11.37:g.6191248G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NGM7	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.G103	ENST00000530810.1	37	c.309	CCDS53598.1	11																																																																																			OR52B2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000255307		0.493	OR52B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52B2	HGNC	protein_coding	OTTHUMT00000385977.1	58	0.00	0	G	NM_001004052		6191248	6191248	-1	no_errors	ENST00000530810	ensembl	human	known	69_37n	silent	30	37.25	19	SNP	0.998	A
NUDT22	84304	genome.wustl.edu	37	11	63995111	63995111	+	Silent	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr11:63995111C>T	ENST00000279206.3	+	3	708	c.552C>T	c.(550-552)tcC>tcT	p.S184S	TRPT1_ENST00000546089.1_5'Flank|DNAJC4_ENST00000355040.4_5'Flank|RP11-783K16.14_ENST00000534988.1_RNA|TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000541278.1_5'Flank|TRPT1_ENST00000317459.6_5'Flank|TRPT1_ENST00000394546.2_5'Flank|TRPT1_ENST00000546133.1_5'Flank|DNAJC4_ENST00000321685.3_5'Flank|NUDT22_ENST00000441250.2_Intron|TRPT1_ENST00000394547.3_5'Flank	NM_001128612.2|NM_032344.2	NP_001122084.1|NP_115720	Q9BRQ3	NUD22_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 22	184	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.						hydrolase activity (GO:0016787)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)	8						AACTCTTTTCCAGTGTCCTTC	0.592																																						dbGAP											0													112.0	99.0	103.0					11																	63995111		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BC006129	CCDS8061.1, CCDS44640.1	11q13.1	2008-02-05			ENSG00000149761	ENSG00000149761		"""Nudix motif containing"""	28189	protein-coding gene	gene with protein product						12477932	Standard	NM_032344		Approved	MGC13045	uc009ype.4	Q9BRQ3	OTTHUMG00000167791	ENST00000279206.3:c.552C>T	11.37:g.63995111C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JY06|Q71RD5	Silent	SNP	superfamily_NUDIX_hydrolase_dom-like	p.S184	ENST00000279206.3	37	c.552	CCDS8061.1	11																																																																																			NUDT22	-	NULL	ENSG00000149761		0.592	NUDT22-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	NUDT22	HGNC	protein_coding	OTTHUMT00000396304.2	74	0.00	0	C	NM_032344		63995111	63995111	+1	no_errors	ENST00000279206	ensembl	human	known	69_37n	silent	41	37.88	25	SNP	1.000	T
NRXN2	9379	genome.wustl.edu	37	11	64435963	64435963	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr11:64435963G>T	ENST00000377551.1	-	7	1522	c.1311C>A	c.(1309-1311)gaC>gaA	p.D437E	NRXN2_ENST00000409571.1_Missense_Mutation_p.D430E|NRXN2_ENST00000265459.6_Missense_Mutation_p.D437E|NRXN2_ENST00000377559.3_Missense_Mutation_p.D406E			Q9P2S2	NRX2A_HUMAN	neurexin 2	437	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						AGCCCGGCAGGTCAGCTGTGT	0.602																																						dbGAP											0													93.0	85.0	88.0					11																	64435963		2201	4297	6498	-	-	-	SO:0001583	missense	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.1311C>A	11.37:g.64435963G>T	ENSP00000366774:p.Asp437Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C1|Q9Y2D6	Missense_Mutation	SNP	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.D437E	ENST00000377551.1	37	c.1311	CCDS8077.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	21.1|21.1|21.1	4.097575|4.097575|4.097575	0.76870|0.76870|0.76870	.|.|.	.|.|.	ENSG00000110076|ENSG00000110076|ENSG00000110076	ENST00000377551;ENST00000377559;ENST00000265459;ENST00000345863;ENST00000409571;ENST00000442300|ENST00000437746|ENST00000417749	T;T;T;T;T|.|.	0.79247|.|.	-1.05;-1.25;-1.05;-1.05;-1.05|.|.	4.91|4.91|4.91	4.0|4.0|4.0	0.46444|0.46444|0.46444	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);|.|.	0.000000|.|.	0.44483|.|.	U|.|.	0.000460|.|.	T|T|T	0.57592|0.57592|0.57592	0.2064|0.2064|0.2064	L|L|L	0.46157|0.46157|0.46157	1.445|1.445|1.445	0.45066|0.45066|0.45066	D|D|D	0.998087|0.998087|0.998087	D;P;P|.|.	0.65815|.|.	0.995;0.756;0.916|.|.	D;P;D|.|.	0.75020|.|.	0.985;0.689;0.932|.|.	T|T|T	0.54091|0.54091|0.54091	-0.8345|-0.8345|-0.8345	10|5|5	0.72032|.|.	D|.|.	0.01|.|.	.|.|.	10.9276|10.9276|10.9276	0.47199|0.47199|0.47199	0.0914:0.0:0.9086:0.0|0.0914:0.0:0.9086:0.0|0.0914:0.0:0.9086:0.0	.|.|.	406;437;183|.|.	Q9P2S2-2;Q9P2S2;E7EV67|.|.	.;NRX2A_HUMAN;.|.|.	E|T|N	437;406;437;406;430;193|212|183	ENSP00000366774:D437E;ENSP00000366782:D406E;ENSP00000265459:D437E;ENSP00000386416:D430E;ENSP00000388971:D193E|.|.	ENSP00000265459:D437E|.|.	D|P|T	-|-|-	3|1|2	2|0|0	NRXN2|NRXN2|NRXN2	64192539|64192539|64192539	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.999000|0.999000|0.999000	0.59377|0.59377|0.59377	0.986000|0.986000|0.986000	0.74619|0.74619|0.74619	1.403000|1.403000|1.403000	0.34612|0.34612|0.34612	1.283000|1.283000|1.283000	0.44513|0.44513|0.44513	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAC|CCT|ACC	NRXN2	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000110076		0.602	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	57	0.00	0	G	NM_015080		64435963	64435963	-1	no_errors	ENST00000265459	ensembl	human	known	69_37n	missense	28	41.67	20	SNP	1.000	T
PDE4B	5142	genome.wustl.edu	37	1	66384309	66384309	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:66384309G>C	ENST00000329654.4	+	3	259	c.72G>C	c.(70-72)ttG>ttC	p.L24F	PDE4B_ENST00000371049.3_Missense_Mutation_p.L24F	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	24					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	AATGTAGCTTGAGTAAATCCT	0.383																																						dbGAP											0													71.0	70.0	70.0					1																	66384309		2203	4300	6503	-	-	-	SO:0001583	missense	0			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.72G>C	1.37:g.66384309G>C	ENSP00000332116:p.Leu24Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.L24F	ENST00000329654.4	37	c.72	CCDS632.1	1	.	.	.	.	.	.	.	.	.	.	G	13.58	2.281103	0.40394	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049	T;T;T	0.23754	1.89;1.89;1.89	5.6	4.67	0.58626	.	2.398170	0.01267	N	0.009353	T	0.34308	0.0893	L	0.38175	1.15	0.34381	D	0.693067	D	0.65815	0.995	D	0.70487	0.969	T	0.03306	-1.1050	10	0.56958	D	0.05	.	13.664	0.62384	0.0771:0.0:0.9229:0.0	.	24	Q07343	PDE4B_HUMAN	F	24	ENSP00000332116:L24F;ENSP00000342637:L24F;ENSP00000360088:L24F	ENSP00000332116:L24F	L	+	3	2	PDE4B	66156897	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	0.629000	0.24538	2.626000	0.88956	0.650000	0.86243	TTG	PDE4B	-	NULL	ENSG00000184588		0.383	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	81	0.00	0	G	NM_002600		66384309	66384309	+1	no_errors	ENST00000329654	ensembl	human	known	69_37n	missense	78	21.21	21	SNP	1.000	C
PDSS1	23590	genome.wustl.edu	37	10	27024211	27024211	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr10:27024211G>A	ENST00000376215.5	+	9	927	c.874G>A	c.(874-876)Gcc>Acc	p.A292T	PDSS1_ENST00000376203.5_Intron|PDSS1_ENST00000470978.1_3'UTR	NM_014317.3	NP_055132.2	Q5T2R2	DPS1_HUMAN	prenyl (decaprenyl) diphosphate synthase, subunit 1	292					isoprenoid biosynthetic process (GO:0008299)|protein heterotetramerization (GO:0051290)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)	metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|trans-hexaprenyltranstransferase activity (GO:0000010)|trans-octaprenyltranstransferase activity (GO:0050347)			autonomic_ganglia(1)|endometrium(1)|kidney(7)|large_intestine(6)|lung(5)|prostate(1)	21						GCATGAGATCGCCTATCAGTA	0.448																																						dbGAP											0													229.0	224.0	226.0					10																	27024211		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF118395	CCDS31168.1	10p12.2	2006-04-12	2006-02-14	2006-02-14	ENSG00000148459	ENSG00000148459			17759	protein-coding gene	gene with protein product	"""coenzyme Q1 homolog (yeast)"""	607429	"""trans-prenyltransferase"""	TPRT		10972372	Standard	NM_014317		Approved	TPT, COQ1	uc001isv.3	Q5T2R2	OTTHUMG00000017844	ENST00000376215.5:c.874G>A	10.37:g.27024211G>A	ENSP00000365388:p.Ala292Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53F75|Q6P473|Q86WQ8|Q9Y2W5	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.A292T	ENST00000376215.5	37	c.874	CCDS31168.1	10	.	.	.	.	.	.	.	.	.	.	G	26.7	4.761586	0.89932	.	.	ENSG00000148459	ENST00000376215;ENST00000396343	T	0.64438	-0.1	5.42	5.42	0.78866	Terpenoid synthase (2);	0.000000	0.85682	D	0.000000	T	0.76350	0.3975	M	0.88181	2.935	0.80722	D	1	P;P	0.50443	0.62;0.935	B;P	0.48921	0.365;0.595	T	0.80688	-0.1271	10	0.52906	T	0.07	-9.8424	19.5704	0.95409	0.0:0.0:1.0:0.0	.	30;292	B4DJY1;Q5T2R2	.;DPS1_HUMAN	T	292;253	ENSP00000365388:A292T	ENSP00000365388:A292T	A	+	1	0	PDSS1	27064217	1.000000	0.71417	0.996000	0.52242	0.951000	0.60555	9.837000	0.99465	2.704000	0.92352	0.655000	0.94253	GCC	PDSS1	-	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	ENSG00000148459		0.448	PDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDSS1	HGNC	protein_coding	OTTHUMT00000047276.1	247	0.00	0	G			27024211	27024211	+1	no_errors	ENST00000376215	ensembl	human	known	69_37n	missense	111	44.78	90	SNP	1.000	A
PGBD5	79605	genome.wustl.edu	37	1	230459309	230459309	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:230459309G>A	ENST00000525115.1	-	7	1253	c.1230C>T	c.(1228-1230)atC>atT	p.I410I	PGBD5_ENST00000391860.1_Silent_p.I364I|PGBD5_ENST00000321327.2_Silent_p.I509I|PGBD5_ENST00000530424.1_5'UTR			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	410						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		TGGCGATGCTGATGGCGAACC	0.507																																						dbGAP											0													152.0	142.0	145.0					1																	230459309		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.1230C>T	1.37:g.230459309G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Silent	SNP	NULL	p.I509	ENST00000525115.1	37	c.1527		1																																																																																			PGBD5	-	NULL	ENSG00000177614		0.507	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	HGNC	protein_coding	OTTHUMT00000382617.1	135	0.00	0	G	NM_024554		230459309	230459309	-1	no_errors	ENST00000321327	ensembl	human	known	69_37n	silent	103	39.77	68	SNP	1.000	A
PKD1L1	168507	genome.wustl.edu	37	7	47835714	47835714	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr7:47835714C>G	ENST00000289672.2	-	55	8278	c.8228G>C	c.(8227-8229)aGa>aCa	p.R2743T	C7orf69_ENST00000258776.4_Intron|C7orf69_ENST00000418326.2_Intron	NM_138295.3	NP_612152.1	Q8TDX9	PK1L1_HUMAN	polycystic kidney disease 1 like 1	2743					detection of mechanical stimulus (GO:0050982)|detection of nodal flow (GO:0003127)|left/right axis specification (GO:0070986)|single organismal cell-cell adhesion (GO:0016337)	calcium channel complex (GO:0034704)|cilium (GO:0005929)|membrane (GO:0016020)|nonmotile primary cilium (GO:0031513)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.R2743T(1)	BBS9/PKD1L1(2)	NS(1)|breast(9)|central_nervous_system(1)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(27)|lung(44)|ovary(12)|prostate(5)|skin(8)|stomach(4)|upper_aerodigestive_tract(5)	142						AAAAGATTTTCTTTTTTGGGG	0.343																																						dbGAP											1	Substitution - Missense(1)	lung(1)											68.0	72.0	70.0					7																	47835714		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB061683	CCDS34633.1	7p12.3	2008-07-18			ENSG00000158683	ENSG00000158683			18053	protein-coding gene	gene with protein product	"""polycystin-1L1"""	609721				11863367	Standard	NM_138295		Approved	PRO19563	uc003tny.2	Q8TDX9	OTTHUMG00000155649	ENST00000289672.2:c.8228G>C	7.37:g.47835714C>G	ENSP00000289672:p.Arg2743Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UWK1	Missense_Mutation	SNP	pfam_PKD/REJ-like,pfam_PKD1_2_channel,pfam_PKD_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,superfamily_PKD_dom,smart_PKD/Chitinase_dom,smart_LipOase_LH2,pfscan_PKD_dom,pfscan_LipOase_LH2,pfscan_REJ-like	p.R2743T	ENST00000289672.2	37	c.8228	CCDS34633.1	7	.	.	.	.	.	.	.	.	.	.	C	9.379	1.072518	0.20147	.	.	ENSG00000158683	ENST00000289672	T	0.19394	2.15	5.31	4.31	0.51392	.	0.917295	0.09171	N	0.838871	T	0.26484	0.0647	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	P	0.61397	0.888	T	0.03728	-1.1009	10	0.30854	T	0.27	-22.0617	5.9554	0.19271	0.0:0.8348:0.0:0.1652	.	2743	Q8TDX9	PK1L1_HUMAN	T	2743	ENSP00000289672:R2743T	ENSP00000289672:R2743T	R	-	2	0	PKD1L1	47802239	0.013000	0.17824	0.225000	0.23894	0.096000	0.18686	1.095000	0.30964	2.477000	0.83638	0.655000	0.94253	AGA	PKD1L1	-	NULL	ENSG00000158683		0.343	PKD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKD1L1	HGNC	protein_coding	OTTHUMT00000340974.1	114	0.00	0	C	NM_138295		47835714	47835714	-1	no_errors	ENST00000289672	ensembl	human	known	69_37n	missense	118	36.56	68	SNP	0.853	G
POLR1A	25885	genome.wustl.edu	37	2	86308729	86308729	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:86308729G>A	ENST00000263857.6	-	8	1296	c.918C>T	c.(916-918)ccC>ccT	p.P306P	POLR1A_ENST00000409681.1_Silent_p.P306P			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	306					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						ATTACCTTGAGGGCGGCACCA	0.423																																						dbGAP											0													87.0	80.0	82.0					2																	86308729		1853	4100	5953	-	-	-	SO:0001819	synonymous_variant	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.918C>T	2.37:g.86308729G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Silent	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.P306	ENST00000263857.6	37	c.918	CCDS42706.1	2																																																																																			POLR1A	-	pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	ENSG00000068654		0.423	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	134	0.00	0	G	NM_015425		86308729	86308729	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	silent	73	34.23	38	SNP	0.840	A
PPP1R3C	5507	genome.wustl.edu	37	10	93390161	93390164	+	Frame_Shift_Del	DEL	CAGA	CAGA	-			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	CAGA	CAGA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr10:93390161_93390164delCAGA	ENST00000238994.5	-	2	558_561	c.474_477delTCTG	c.(472-477)tgtctgfs	p.CL158fs		NM_005398.5	NP_005389.1			protein phosphatase 1, regulatory subunit 3C											breast(1)|endometrium(1)|large_intestine(5)|lung(4)|upper_aerodigestive_tract(1)	12		Colorectal(252;0.235)				AGCAGTTCTCCAGACAGACAAAGT	0.412																																						dbGAP											0										0,4264		0,0,2132						4.9	1.0			90	1,8253		0,1,4126	no	frameshift	PPP1R3C	NM_005398.4		0,1,6258	A1A1,A1R,RR		0.0121,0.0,0.0080				1,12517				-	-	-	SO:0001589	frameshift_variant	0			Y18207	CCDS7416.1	10q23-q24	2012-04-17	2011-10-04	2001-08-01	ENSG00000119938	ENSG00000119938		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9293	protein-coding gene	gene with protein product	"""Phosphatase 1, regulatory inhibitor subunit 5"", ""protein targeting to glycogen"""	602999	"""protein phosphatase 1, regulatory (inhibitor) subunit 3C"""	PPP1R5		8985175	Standard	NM_005398		Approved	PTG	uc001kho.3	Q9UQK1	OTTHUMG00000018745	ENST00000238994.5:c.474_477delTCTG	10.37:g.93390165_93390168delCAGA	ENSP00000238994:p.Cys158fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_CBM_21,pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	p.C158fs	ENST00000238994.5	37	c.477_474	CCDS7416.1	10																																																																																			PPP1R3C	-	pfam_CBM_21,pirsf_Pase-1_Glycogen_target-su_met,pfscan_CBM_21	ENSG00000119938		0.412	PPP1R3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3C	HGNC	protein_coding	OTTHUMT00000049372.1	98	0.00	0	CAGA	NM_005398		93390161	93390164	-1	no_errors	ENST00000238994	ensembl	human	known	69_37n	frame_shift_del	28	53.33	32	DEL	1.000:1.000:1.000:0.998	-
PRKCSH	5589	genome.wustl.edu	37	19	11557971	11557971	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:11557971C>T	ENST00000589838.1	+	9	845	c.845C>T	c.(844-846)tCc>tTc	p.S282F	PRKCSH_ENST00000592741.1_Missense_Mutation_p.S282F|PRKCSH_ENST00000587327.1_Missense_Mutation_p.S282F|PRKCSH_ENST00000591462.1_Missense_Mutation_p.S282F|PRKCSH_ENST00000412601.1_Missense_Mutation_p.S282F|PRKCSH_ENST00000252455.2_Missense_Mutation_p.S282F			P14314	GLU2B_HUMAN	protein kinase C substrate 80K-H	282	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|liver development (GO:0001889)|N-glycan processing (GO:0006491)|negative regulation of neuron projection development (GO:0010977)|nitrogen compound metabolic process (GO:0006807)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein heterooligomerization (GO:0051291)|protein N-linked glycosylation via asparagine (GO:0018279)|renal system development (GO:0072001)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|intracellular (GO:0005622)	calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|phosphoprotein binding (GO:0051219)|protein kinase C binding (GO:0005080)|RNA binding (GO:0003723)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)|pancreas(1)|prostate(3)	19						AAGTACCGGTCCGAGGTCAGT	0.647																																						dbGAP											0													81.0	69.0	73.0					19																	11557971		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32911.1, CCDS45977.1, CCDS74286.1	19p13.2	2014-01-30			ENSG00000130175	ENSG00000130175	2.7.11.1	"""EF-hand domain containing"""	9411	protein-coding gene	gene with protein product		177060	"""polycystic liver disease"""	G19P1, PCLD, PLD1		12529853	Standard	NM_002743		Approved		uc002mrt.3	P14314	OTTHUMG00000182029	ENST00000589838.1:c.845C>T	19.37:g.11557971C>T	ENSP00000465461:p.Ser282Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K318|Q96BU9|Q96D06|Q9P0W9	Missense_Mutation	SNP	pfam_PRKCSH,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_LDrepeatLR_classA_rpt,pfscan_EF_HAND_2	p.S282F	ENST00000589838.1	37	c.845	CCDS32911.1	19	.	.	.	.	.	.	.	.	.	.	c	16.48	3.135223	0.56828	.	.	ENSG00000130175	ENST00000252455;ENST00000412601	T;T	0.73047	-0.71;-0.71	4.95	3.82	0.43975	.	0.258612	0.40064	N	0.001188	T	0.73521	0.3597	L	0.55481	1.735	0.22199	N	0.9993	D;P;D	0.67145	0.996;0.747;0.996	P;B;P	0.59056	0.851;0.396;0.851	T	0.63462	-0.6632	10	0.10111	T	0.7	-18.2276	13.1792	0.59645	0.1709:0.8291:0.0:0.0	.	282;282;282	E7EQZ9;A8K318;P14314	.;.;GLU2B_HUMAN	F	282	ENSP00000252455:S282F;ENSP00000395616:S282F	ENSP00000252455:S282F	S	+	2	0	PRKCSH	11418971	0.084000	0.21492	0.848000	0.33437	0.726000	0.41606	3.529000	0.53532	2.292000	0.77174	0.486000	0.48141	TCC	PRKCSH	-	NULL	ENSG00000130175		0.647	PRKCSH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKCSH	HGNC	protein_coding	OTTHUMT00000458817.1	37	0.00	0	C			11557971	11557971	+1	no_errors	ENST00000252455	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.213	T
PTPRQ	374462	genome.wustl.edu	37	12	81004320	81004320	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr12:81004320A>G	ENST00000266688.5	+	33	4822	c.4822A>G	c.(4822-4824)Atc>Gtc	p.I1608V				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1654	Fibronectin type-III 17. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						TTCTGTAGTGATCACTGCATT	0.308																																						dbGAP											0													93.0	74.0	80.0					12																	81004320		692	1589	2281	-	-	-	SO:0001583	missense	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.4822A>G	12.37:g.81004320A>G	ENSP00000266688:p.Ile1608Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.I1608V	ENST00000266688.5	37	c.4822		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	6.029|6.029	0.373674|0.373674	0.11409|0.11409	.|.	.|.	ENSG00000139304|ENSG00000139304	ENST00000266688|ENST00000532722	T|.	0.33654|.	1.4|.	5.9|5.9	2.32|2.32	0.28847|0.28847	Fibronectin, type III (4);Immunoglobulin-like fold (1);|.	.|.	.|.	.|.	.|.	T|.	0.44095|.	0.1277|.	.|.	.|.	.|.	0.31987|0.31987	N|N	0.60516|0.60516	B|.	0.09022|.	0.002|.	B|.	0.12156|.	0.007|.	T|.	0.49184|.	-0.8966|.	8|.	0.02654|.	T|.	1|.	.|.	9.2572|9.2572	0.37590|0.37590	0.6796:0.0:0.3204:0.0|0.6796:0.0:0.3204:0.0	.|.	1654|.	Q9UMZ3|.	PTPRQ_HUMAN|.	V|W	1608|1308	ENSP00000266688:I1608V|.	ENSP00000266688:I1608V|.	I|X	+|+	1|3	0|0	PTPRQ|PTPRQ	79528451|79528451	1.000000|1.000000	0.71417|0.71417	0.976000|0.976000	0.42696|0.42696	0.899000|0.899000	0.52679|0.52679	1.909000|1.909000	0.39917|0.39917	0.170000|0.170000	0.19704|0.19704	0.528000|0.528000	0.53228|0.53228	ATC|TGA	PTPRQ	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.308	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		80	0.00	0	A	NM_001145026		81004320	81004320	+1	no_errors	ENST00000266688	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	0.678	G
PWP2	5822	genome.wustl.edu	37	21	45542081	45542081	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr21:45542081G>C	ENST00000291576.7	+	14	1787	c.1660G>C	c.(1660-1662)Gat>Cat	p.D554H		NM_005049.2	NP_005040.2	Q15269	PWP2_HUMAN	PWP2 periodic tryptophan protein homolog (yeast)	554					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(6)|large_intestine(6)|lung(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	21				STAD - Stomach adenocarcinoma(101;0.172)|Colorectal(79;0.2)		TTTTCGCCCTGATGGTGCGGA	0.597																																						dbGAP											0													186.0	142.0	157.0					21																	45542081		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33579.1	21q22.3	2013-01-10	2001-11-28	2006-11-24	ENSG00000241945	ENSG00000241945		"""WD repeat domain containing"""	9711	protein-coding gene	gene with protein product		601475	"""PWP2 (periodic tryptophan protein, yeast) homolog"""	PWP2H		8893822	Standard	NM_005049		Approved	EHOC-17, UTP1	uc002zeb.3	Q15269	OTTHUMG00000086893	ENST00000291576.7:c.1660G>C	21.37:g.45542081G>C	ENSP00000291576:p.Asp554His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAG8|Q96A77	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_SSU_processome_Utp12,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.D554H	ENST00000291576.7	37	c.1660	CCDS33579.1	21	.	.	.	.	.	.	.	.	.	.	G	20.9	4.073353	0.76415	.	.	ENSG00000241945	ENST00000291576	T	0.09073	3.02	5.17	4.29	0.51040	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40-repeat-containing domain (1);	0.046212	0.85682	D	0.000000	T	0.35307	0.0927	M	0.92649	3.33	0.50467	D	0.999878	D	0.89917	1.0	D	0.65987	0.94	T	0.49224	-0.8962	10	0.87932	D	0	-23.201	13.654	0.62327	0.075:0.0:0.925:0.0	.	554	Q15269	PWP2_HUMAN	H	554	ENSP00000291576:D554H	ENSP00000291576:D554H	D	+	1	0	PWP2	44366509	1.000000	0.71417	0.597000	0.28824	0.962000	0.63368	7.128000	0.77217	1.309000	0.44985	0.591000	0.81541	GAT	PWP2	-	superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000241945		0.597	PWP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP2	HGNC	protein_coding	OTTHUMT00000195736.3	97	0.00	0	G	NM_005049		45542081	45542081	+1	no_errors	ENST00000291576	ensembl	human	known	69_37n	missense	71	25.26	24	SNP	0.997	C
RAD51	5888	genome.wustl.edu	37	15	40998407	40998407	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr15:40998407C>A	ENST00000267868.3	+	4	526	c.258C>A	c.(256-258)ttC>ttA	p.F86L	RAD51_ENST00000557850.1_Intron|RAD51_ENST00000382643.3_Intron|RAD51_ENST00000423169.2_Missense_Mutation_p.F86L|RAD51_ENST00000532743.1_Intron	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase	86					ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		CAATGGGTTTCACCACTGCAA	0.383								Homologous recombination																														dbGAP											0													75.0	72.0	73.0					15																	40998407		2203	4300	6503	-	-	-	SO:0001583	missense	0			D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.258C>A	15.37:g.40998407C>A	ENSP00000267868:p.Phe86Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_DNA_recomb/repair_RecA,pfam_Circ_KaiC/RadA,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_AAA+_ATPase,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd,pfscan_RecA_monomer-monomer_interface,tigrfam_DNA_recomb/repair_Rad51	p.F86L	ENST00000267868.3	37	c.258	CCDS10062.1	15	.	.	.	.	.	.	.	.	.	.	C	23.3	4.402972	0.83230	.	.	ENSG00000051180	ENST00000527860;ENST00000423169;ENST00000267868	T;T;T	0.56941	0.43;0.43;0.43	4.55	0.571	0.17352	DNA recombination and repair protein Rad51, C-terminal (1);	.	.	.	.	T	0.63581	0.2523	M	0.92880	3.355	0.80722	D	1	B;B	0.17852	0.024;0.004	B;B	0.33750	0.047;0.169	T	0.63368	-0.6653	9	0.87932	D	0	.	9.5229	0.39147	0.0:0.6303:0.0:0.3697	.	86;86	Q06609-3;Q06609	.;RAD51_HUMAN	L	86	ENSP00000432759:F86L;ENSP00000406602:F86L;ENSP00000267868:F86L	ENSP00000267868:F86L	F	+	3	2	RAD51	38785699	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	1.160000	0.31761	-0.045000	0.13468	0.460000	0.39030	TTC	RAD51	-	pfam_DNA_recomb/repair_Rad51_C,pirsf_DNA_recomb/repair_RecA-like,tigrfam_DNA_recomb/repair_Rad51	ENSG00000051180		0.383	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RAD51	HGNC	protein_coding	OTTHUMT00000252358.1	100	0.00	0	C	NM_002875, NM_133487		40998407	40998407	+1	no_errors	ENST00000267868	ensembl	human	known	69_37n	missense	23	63.49	40	SNP	1.000	A
RASSF7	8045	genome.wustl.edu	37	11	563350	563350	+	Intron	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr11:563350G>A	ENST00000397583.3	+	4	1384				RASSF7_ENST00000454668.2_Intron|RASSF7_ENST00000397582.3_Silent_p.V328V|C11orf35_ENST00000329451.3_5'Flank|MIR210HG_ENST00000500447.1_lincRNA|RASSF7_ENST00000344375.4_Intron|RASSF7_ENST00000431809.1_Silent_p.V328V	NM_003475.3	NP_003466.1	Q02833	RASF7_HUMAN	Ras association (RalGDS/AF-6) domain family (N-terminal) member 7						apoptotic process (GO:0006915)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|skin(3)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GCTGGGAGGTGAGGACCTGGC	0.701																																					Pancreas(184;1170 3913 7268)	dbGAP											0													17.0	20.0	19.0					11																	563350		2202	4297	6499	-	-	-	SO:0001627	intron_variant	0			M91083	CCDS7702.1, CCDS44505.1, CCDS44506.1	11p15.5	2008-02-22	2008-02-22	2005-09-14	ENSG00000099849	ENSG00000099849			1166	protein-coding gene	gene with protein product		143023	"""chromosome 11 open reading frame 13"""	C11orf13		1339391	Standard	NM_001143993		Approved	HRC1, HRAS1	uc001lqc.3	Q02833	OTTHUMG00000132004	ENST00000397583.3:c.951+33G>A	11.37:g.563350G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9N9|Q3KP41|Q3KP42	Silent	SNP	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc	p.V328	ENST00000397583.3	37	c.984	CCDS7702.1	11																																																																																			RASSF7	-	NULL	ENSG00000099849		0.701	RASSF7-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF7	HGNC	protein_coding	OTTHUMT00000254972.2	13	0.00	0	G	NM_003475		563350	563350	+1	no_errors	ENST00000397582	ensembl	human	known	69_37n	silent	8	38.46	5	SNP	0.000	A
RB1	5925	genome.wustl.edu	37	13	48916747	48916747	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr13:48916747C>T	ENST00000267163.4	+	3	415	c.277C>T	c.(277-279)Caa>Taa	p.Q93*		NM_000321.2	NP_000312.2	P06400	RB_HUMAN	retinoblastoma 1	93					androgen receptor signaling pathway (GO:0030521)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell morphogenesis involved in neuron differentiation (GO:0048667)|chromatin remodeling (GO:0006338)|digestive tract development (GO:0048565)|enucleate erythrocyte differentiation (GO:0043353)|G1/S transition of mitotic cell cycle (GO:0000082)|glial cell apoptotic process (GO:0034349)|hepatocyte apoptotic process (GO:0097284)|maintenance of mitotic sister chromatid cohesion (GO:0034088)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|myoblast differentiation (GO:0045445)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071930)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|neuron maturation (GO:0042551)|neuron projection development (GO:0031175)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein localization to chromosome, centromeric region (GO:0071459)|Ras protein signal transduction (GO:0007265)|regulation of centromere complex assembly (GO:0090230)|regulation of cohesin localization to chromatin (GO:0071922)|regulation of lipid kinase activity (GO:0043550)|regulation of mitotic cell cycle (GO:0007346)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|sister chromatid biorientation (GO:0031134)|skeletal muscle cell differentiation (GO:0035914)|striated muscle cell differentiation (GO:0051146)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|Rb-E2F complex (GO:0035189)|spindle (GO:0005819)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|phosphoprotein binding (GO:0051219)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)	p.0?(15)|p.?(5)		NS(3)|adrenal_gland(1)|bone(22)|breast(30)|central_nervous_system(48)|cervix(3)|endometrium(14)|eye(95)|gastrointestinal_tract_(site_indeterminate)(1)|haematopoietic_and_lymphoid_tissue(20)|kidney(3)|large_intestine(10)|liver(3)|lung(153)|oesophagus(1)|ovary(13)|pancreas(5)|pituitary(1)|prostate(14)|salivary_gland(2)|skin(9)|soft_tissue(9)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(31)	496		all_cancers(8;6.9e-71)|all_epithelial(8;4.61e-22)|Acute lymphoblastic leukemia(8;1.1e-21)|all_hematologic(8;2.3e-21)|all_lung(13;1.51e-09)|Lung NSC(96;7.03e-07)|Breast(56;1.53e-05)|Prostate(109;0.000493)|Myeloproliferative disorder(33;0.0179)|Hepatocellular(98;0.0207)|all_neural(104;0.0227)|Glioma(44;0.0286)|Lung SC(185;0.0301)		GBM - Glioblastoma multiforme(2;9.98e-18)|LUSC - Lung squamous cell carcinoma(3;0.013)	"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	AGGTTATATTCAAAAGAAAAA	0.308		6	"""D, Mis, N, F, S"""		"""retinoblastoma, sarcoma, breast, small cell lung"""	"""retinoblastoma, sarcoma, breast, small cell lung"""			Hereditary Retinoblastoma	TCGA GBM(7;6.82e-08)|TSP Lung(12;0.097)|TCGA Ovarian(6;0.080)																												dbGAP	yes	Rec	yes	Familial retinoblastoma	13	13q14	5925	retinoblastoma gene		"""L, E, M, O"""	20	Whole gene deletion(15)|Unknown(5)	bone(10)|breast(6)|eye(1)|soft_tissue(1)|haematopoietic_and_lymphoid_tissue(1)|endometrium(1)											73.0	83.0	80.0					13																	48916747		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database		M15400	CCDS31973.1	13q14.2	2014-09-17	2008-07-31		ENSG00000139687	ENSG00000139687		"""Endogenous ligands"""	9884	protein-coding gene	gene with protein product	"""prepro-retinoblastoma-associated protein"", ""protein phosphatase 1, regulatory subunit 130"""	614041	"""osteosarcoma"""	OSRC		1857421, 15057823	Standard	NM_000321		Approved	RB, PPP1R130	uc001vcb.3	P06400	OTTHUMG00000016900	ENST00000267163.4:c.277C>T	13.37:g.48916747C>T	ENSP00000267163:p.Gln93*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E3|P78499|Q5VW46|Q8IZL4	Nonsense_Mutation	SNP	pfam_Rb_C,pfam_RB_A,pfam_RB_B,pfam_DUF3452_retinoblatoma-assoc,superfamily_Cyclin-like,superfamily_FH2_actin-bd,smart_Cyclin-like	p.Q93*	ENST00000267163.4	37	c.277	CCDS31973.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.646624	0.96704	.	.	ENSG00000139687	ENST00000542917;ENST00000267163	.	.	.	5.39	5.39	0.77823	.	0.255981	0.41396	D	0.000895	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0115	0.71552	0.0:1.0:0.0:0.0	.	.	.	.	X	72;93	.	ENSP00000267163:Q93X	Q	+	1	0	RB1	47814748	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	0.866000	0.27954	2.667000	0.90743	0.603000	0.83216	CAA	RB1	-	superfamily_Cyclin-like	ENSG00000139687		0.308	RB1-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RB1	HGNC	protein_coding	OTTHUMT00000044884.1	109	0.00	0	C			48916747	48916747	+1	no_errors	ENST00000267163	ensembl	human	known	69_37n	nonsense	23	71.95	59	SNP	1.000	T
RNF157	114804	genome.wustl.edu	37	17	74208563	74208563	+	Splice_Site	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:74208563C>T	ENST00000269391.6	-	2	221	c.89G>A	c.(88-90)gGa>gAa	p.G30E	RNF157_ENST00000319945.6_Splice_Site_p.G30E|RNF157_ENST00000592271.1_Splice_Site_p.G30E	NM_052916.2	NP_443148.1	Q96PX1	RN157_HUMAN	ring finger protein 157	30							zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(3)|lung(12)|ovary(2)|prostate(1)|skin(1)|stomach(2)|urinary_tract(1)	25			LUSC - Lung squamous cell carcinoma(166;0.187)			AAAATAGCTTCCTAGAGAGGA	0.368																																					GBM(186;507 2120 27388 27773 52994)	dbGAP											0													56.0	52.0	53.0					17																	74208563		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AK091467	CCDS32740.1	17q25.3	2004-02-27			ENSG00000141576	ENSG00000141576		"""RING-type (C3HC4) zinc fingers"""	29402	protein-coding gene	gene with protein product						11572484	Standard	NM_052916		Approved	KIAA1917	uc002jqz.3	Q96PX1	OTTHUMG00000132627	ENST00000269391.6:c.89-1G>A	17.37:g.74208563C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB72|Q96N56	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.G30E	ENST00000269391.6	37	c.89	CCDS32740.1	17	.	.	.	.	.	.	.	.	.	.	C	28.5	4.923459	0.92319	.	.	ENSG00000141576	ENST00000269391;ENST00000319945	T;T	0.23552	1.9;1.9	5.79	5.79	0.91817	.	0.055012	0.64402	D	0.000001	T	0.56124	0.1964	M	0.86953	2.85	0.80722	D	1	D;P	0.54964	0.969;0.644	P;P	0.61070	0.883;0.659	T	0.61983	-0.6950	10	0.87932	D	0	.	18.8598	0.92267	0.0:1.0:0.0:0.0	.	30;30	Q96PX1-2;Q96PX1	.;RN157_HUMAN	E	30	ENSP00000269391:G30E;ENSP00000321837:G30E	ENSP00000269391:G30E	G	-	2	0	RNF157	71720158	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	7.407000	0.80029	2.761000	0.94854	0.543000	0.68304	GGA	RNF157	-	NULL	ENSG00000141576		0.368	RNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF157	HGNC	protein_coding	OTTHUMT00000255874.2	58	0.00	0	C	XM_290732	Missense_Mutation	74208563	74208563	-1	no_errors	ENST00000269391	ensembl	human	known	69_37n	missense	35	39.66	23	SNP	1.000	T
RRBP1	6238	genome.wustl.edu	37	20	17640650	17640650	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr20:17640650G>T	ENST00000377813.1	-	3	806	c.503C>A	c.(502-504)gCc>gAc	p.A168D	RRBP1_ENST00000377807.2_Missense_Mutation_p.A168D|RRBP1_ENST00000360807.4_Missense_Mutation_p.A168D|RRBP1_ENST00000246043.4_Missense_Mutation_p.A168D|RRBP1_ENST00000455029.2_Intron			Q9P2E9	RRBP1_HUMAN	ribosome binding protein 1	168					osteoblast differentiation (GO:0001649)|protein transport (GO:0015031)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(6)	28						TTCCAAGATGGCAGCCTTCGA	0.537																																						dbGAP											0													68.0	56.0	60.0					20																	17640650		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037819	CCDS13128.1	20p12	2012-12-07	2012-12-07		ENSG00000125844	ENSG00000125844			10448	protein-coding gene	gene with protein product		601418	"""ribosome binding protein 1 (dog 180kD homolog)"", ""ribosome binding protein 1 homolog 180kDa (dog)"""			8812507	Standard	NM_001042576		Approved	ES/130, hES	uc002wpw.1	Q9P2E9	OTTHUMG00000031945	ENST00000377813.1:c.503C>A	20.37:g.17640650G>T	ENSP00000367044:p.Ala168Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2S6|A6NCN6|O75300|O75301|Q5W165|Q96SB2|Q9BWP1|Q9H476	Missense_Mutation	SNP	pfam_Rib_rcpt_KP,superfamily_Ribosome_recyc_fac_dom	p.A168D	ENST00000377813.1	37	c.503		20	.	.	.	.	.	.	.	.	.	.	G	16.73	3.203389	0.58234	.	.	ENSG00000125844	ENST00000360807;ENST00000377813;ENST00000377807;ENST00000246043;ENST00000398782	T;T;T;T	0.43294	0.95;1.68;0.95;1.68	4.73	4.73	0.59995	.	0.000000	0.34628	N	0.003819	T	0.46964	0.1420	L	0.36672	1.1	0.80722	D	1	D	0.61697	0.99	P	0.57152	0.814	T	0.21930	-1.0231	10	0.13853	T	0.58	-13.7615	17.0717	0.86576	0.0:0.0:1.0:0.0	.	168	Q9P2E9-3	.	D	168	ENSP00000354045:A168D;ENSP00000367044:A168D;ENSP00000367038:A168D;ENSP00000246043:A168D	ENSP00000246043:A168D	A	-	2	0	RRBP1	17588650	1.000000	0.71417	1.000000	0.80357	0.116000	0.19942	6.287000	0.72671	2.366000	0.80165	0.563000	0.77884	GCC	RRBP1	-	pfam_Rib_rcpt_KP	ENSG00000125844		0.537	RRBP1-002	NOVEL	basic	protein_coding	RRBP1	HGNC	protein_coding	OTTHUMT00000078125.1	132	0.00	0	G	NM_001042576		17640650	17640650	-1	no_errors	ENST00000246043	ensembl	human	known	69_37n	missense	44	58.88	63	SNP	0.995	T
NCAPD2	9918	genome.wustl.edu	37	12	6619500	6619500	+	Intron	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr12:6619500C>T	ENST00000315579.5	+	4	1061				NCAPD2_ENST00000545962.1_Intron|SCARNA10_ENST00000459255.1_RNA	NM_014865.3	NP_055680.3	Q15021	CND1_HUMAN	non-SMC condensin I complex, subunit D2						mitotic cell cycle (GO:0000278)|mitotic chromosome condensation (GO:0007076)	condensed chromosome (GO:0000793)|condensin complex (GO:0000796)|condensin core heterodimer (GO:0000797)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|pronucleus (GO:0045120)	histone binding (GO:0042393)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(7)|lung(15)|ovary(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	48						TATGTGTGTTCACTGTAAGGG	0.438																																						dbGAP											0													262.0	242.0	248.0					12																	6619500		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			D63880	CCDS8548.1	12p13.31	2008-02-04			ENSG00000010292	ENSG00000010292			24305	protein-coding gene	gene with protein product	"""chromosome condensation related SMC associated protein 1"""	615638				8590280, 10958694	Standard	NM_014865		Approved	CNAP1, hCAP-D2, CAP-D2, KIAA0159	uc001qoo.2	Q15021	OTTHUMG00000168513	ENST00000315579.5:c.262+201C>T	12.37:g.6619500C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUR4|Q8N6U3	RNA	SNP	-	NULL	ENST00000315579.5	37	NULL	CCDS8548.1	12																																																																																			SCARNA10	-	-	ENSG00000239002		0.438	NCAPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCARNA10	HGNC	protein_coding	OTTHUMT00000399964.1	40	0.00	0	C	NM_014865		6619500	6619500	+1	no_errors	ENST00000459255	ensembl	human	known	69_37n	rna	20	28.57	8	SNP	0.798	T
SETX	23064	genome.wustl.edu	37	9	135205210	135205210	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr9:135205210A>C	ENST00000224140.5	-	10	1957	c.1775T>G	c.(1774-1776)aTt>aGt	p.I592S	SETX_ENST00000393220.1_Missense_Mutation_p.I592S|SETX_ENST00000372169.2_Missense_Mutation_p.I592S	NM_015046.5	NP_055861.3	Q7Z333	SETX_HUMAN	senataxin	592					cell death (GO:0008219)|circadian rhythm (GO:0007623)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|RNA processing (GO:0006396)|termination of RNA polymerase II transcription (GO:0006369)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(25)|liver(1)|lung(36)|ovary(2)|prostate(2)|skin(1)|stomach(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	97		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;6.82e-06)|Epithelial(140;0.000171)		TATGTTTCTAATAATTTGCTT	0.353																																						dbGAP											0													52.0	50.0	51.0					9																	135205210		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB014525	CCDS6947.1	9q34	2014-09-17	2005-11-29	2005-11-29	ENSG00000107290	ENSG00000107290			445	protein-coding gene	gene with protein product		608465	"""amyotrophic lateral sclerosis 4"", ""spinocerebellar ataxia, recessive, non-Friedreich type 1"""	ALS4, SCAR1		9497266, 11022012	Standard	NM_015046		Approved	KIAA0625, AOA2	uc004cbk.3	Q7Z333	OTTHUMG00000020834	ENST00000224140.5:c.1775T>G	9.37:g.135205210A>C	ENSP00000224140:p.Ile592Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A396|B2RPB2|B5ME16|C9JQ10|O75120|Q3KQX4|Q5JUJ1|Q68DW5|Q6AZD7|Q7Z3J6|Q8WX33|Q9H9D1|Q9NVP9	Missense_Mutation	SNP	NULL	p.I592S	ENST00000224140.5	37	c.1775	CCDS6947.1	9	.	.	.	.	.	.	.	.	.	.	A	20.2	3.941273	0.73557	.	.	ENSG00000107290	ENST00000224140;ENST00000372169;ENST00000393220	D;D;D	0.83591	-1.74;-1.74;-1.74	5.92	5.92	0.95590	.	0.212075	0.40554	N	0.001066	D	0.86514	0.5951	L	0.29908	0.895	0.39388	D	0.966377	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.85130	0.997;0.946;0.988	D	0.88757	0.3254	10	0.87932	D	0	.	15.5416	0.76052	1.0:0.0:0.0:0.0	.	592;592;592	Q7Z333-3;Q7Z333;Q7Z333-4	.;SETX_HUMAN;.	S	592	ENSP00000224140:I592S;ENSP00000361242:I592S;ENSP00000376913:I592S	ENSP00000224140:I592S	I	-	2	0	SETX	134195031	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.414000	0.73318	2.260000	0.74910	0.528000	0.53228	ATT	SETX	-	NULL	ENSG00000107290		0.353	SETX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETX	HGNC	protein_coding	OTTHUMT00000054774.3	73	0.00	0	A	NM_015046		135205210	135205210	-1	no_errors	ENST00000372169	ensembl	human	known	69_37n	missense	37	31.48	17	SNP	1.000	C
SGCA	6442	genome.wustl.edu	37	17	48247653	48247653	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:48247653G>A	ENST00000262018.3	+	7	933	c.897G>A	c.(895-897)ctG>ctA	p.L299L	SGCA_ENST00000513942.1_Intron|HILS1_ENST00000504307.1_RNA|SGCA_ENST00000344627.6_Intron|SGCA_ENST00000543315.1_Intron	NM_000023.2	NP_000014.1	Q16586	SGCA_HUMAN	sarcoglycan, alpha (50kDa dystrophin-associated glycoprotein)	299					muscle contraction (GO:0006936)|muscle organ development (GO:0007517)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|lung(7)|ovary(2)|skin(1)	14						TGCCCCTGCTGGTGGCCCTGC	0.637																																						dbGAP											0													116.0	99.0	105.0					17																	48247653		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L34355	CCDS32679.1, CCDS45729.1	17q21	2014-09-17	2002-08-29		ENSG00000108823	ENSG00000108823			10805	protein-coding gene	gene with protein product	"""50kD DAG"", ""Sarcoglycan, alpha (50kD dystrophin-associated glycoprotein; adhalin)"", ""adhalin (limb girdle muscular dystrophy 2D)"""	600119	"""sarcoglycan, alpha (50kD dystrophin-associated glycoprotein)"""	ADL		7937874	Standard	NM_000023		Approved	SCARMD1, LGMD2D, adhalin, DMDA2, A2	uc002iqi.3	Q16586	OTTHUMG00000162024	ENST00000262018.3:c.897G>A	17.37:g.48247653G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEB8|A8K3K7|Q13710|Q13712	Missense_Mutation	SNP	pfam_Sarcoglycan_2	p.G72S	ENST00000262018.3	37	c.214	CCDS32679.1	17	.	.	.	.	.	.	.	.	.	.	G	10.32	1.318099	0.23994	.	.	ENSG00000108823	ENST00000504073	.	.	.	5.62	3.49	0.39957	.	.	.	.	.	T	0.55497	0.1924	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51996	-0.8634	4	.	.	.	-13.4537	6.6039	0.22714	0.0823:0.0:0.4862:0.4315	.	.	.	.	S	72	.	.	G	+	1	0	SGCA	45602652	0.983000	0.35010	1.000000	0.80357	0.998000	0.95712	0.787000	0.26858	1.355000	0.45865	0.655000	0.94253	GGT	SGCA	-	pfam_Sarcoglycan_2	ENSG00000108823		0.637	SGCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCA	HGNC	protein_coding	OTTHUMT00000366841.1	89	0.00	0	G	NM_000023		48247653	48247653	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000504073	ensembl	human	novel	69_37n	missense	51	23.88	16	SNP	0.971	A
SHCBP1L	81626	genome.wustl.edu	37	1	182908337	182908337	+	Silent	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:182908337C>G	ENST00000367547.3	-	5	1286	c.1050G>C	c.(1048-1050)ctG>ctC	p.L350L	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_Silent_p.L231L	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	422										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						CCCACATTTTCAGTAATCCAC	0.343																																						dbGAP											0													78.0	76.0	77.0					1																	182908337		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.1050G>C	1.37:g.182908337C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G195|Q9BZQ3|Q9H2B6	Silent	SNP	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	p.L350	ENST00000367547.3	37	c.1050	CCDS30955.1	1																																																																																			SHCBP1L	-	NULL	ENSG00000157060		0.343	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1L	HGNC	protein_coding	OTTHUMT00000085956.1	77	0.00	0	C	NM_030933		182908337	182908337	-1	no_errors	ENST00000367547	ensembl	human	known	69_37n	silent	106	24.29	34	SNP	0.997	G
SLC2A3	6515	genome.wustl.edu	37	12	8078450	8078450	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr12:8078450G>A	ENST00000075120.7	-	7	1196	c.956C>T	c.(955-957)aCt>aTt	p.T319I		NM_006931.2	NP_008862.1	P11169	GTR3_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 3	319					carbohydrate metabolic process (GO:0005975)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glucose transmembrane transporter activity (GO:0005355)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(14)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30				Kidney(36;0.0866)		AGAAACTACAGTGAAGATAGT	0.428																																					Colon(96;424 1461 14416 20933 23688)	dbGAP											0													125.0	123.0	124.0					12																	8078450		2203	4300	6503	-	-	-	SO:0001583	missense	0			M20681	CCDS8586.1	12p13.3	2013-05-22			ENSG00000059804	ENSG00000059804		"""Solute carriers"""	11007	protein-coding gene	gene with protein product		138170		GLUT3			Standard	NM_006931		Approved		uc001qtr.3	P11169	OTTHUMG00000133685	ENST00000075120.7:c.956C>T	12.37:g.8078450G>A	ENSP00000075120:p.Thr319Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R606|D3DUU6|Q6I9U2|Q9UG15	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glc_transpt_3,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.T319I	ENST00000075120.7	37	c.956	CCDS8586.1	12	.	.	.	.	.	.	.	.	.	.	G	22.0	4.226559	0.79576	.	.	ENSG00000059804	ENST00000075120;ENST00000540978	T	0.79845	-1.31	3.88	3.88	0.44766	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	D	0.90689	0.7079	M	0.90425	3.115	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92546	0.6046	10	0.87932	D	0	.	13.7349	0.62811	0.0:0.0:1.0:0.0	.	319	P11169	GTR3_HUMAN	I	319;245	ENSP00000075120:T319I	ENSP00000075120:T319I	T	-	2	0	SLC2A3	7969717	1.000000	0.71417	0.995000	0.50966	0.981000	0.71138	8.835000	0.92100	2.165000	0.68154	0.467000	0.42956	ACT	SLC2A3	-	pfam_Sub_transporter,pfam_MFS,pfam_Folate_carrier,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000059804		0.428	SLC2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A3	HGNC	protein_coding	OTTHUMT00000257914.1	156	0.64	1	G	NM_006931		8078450	8078450	-1	no_errors	ENST00000075120	ensembl	human	known	69_37n	missense	87	27.50	33	SNP	1.000	A
SLC43A1	8501	genome.wustl.edu	37	11	57265233	57265233	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr11:57265233C>A	ENST00000278426.3	-	6	906	c.551G>T	c.(550-552)gGa>gTa	p.G184V	SLC43A1_ENST00000528450.1_Missense_Mutation_p.G184V|SLC43A1_ENST00000533515.1_5'UTR	NM_003627.5	NP_003618.1			solute carrier family 43 (amino acid system L transporter), member 1											breast(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TACCTTGATTCCTGGGAACGT	0.547																																						dbGAP											0													95.0	82.0	86.0					11																	57265233		2201	4296	6497	-	-	-	SO:0001583	missense	0			AF045584	CCDS7958.1	11q12.1	2013-07-17	2013-07-17	2003-09-12	ENSG00000149150	ENSG00000149150		"""Solute carriers"""	9225	protein-coding gene	gene with protein product		603733	"""prostate cancer overexpressed gene 1"""	POV1		9255310, 9722952	Standard	NM_003627		Approved	R00504, PB39	uc001nkk.3	O75387	OTTHUMG00000167030	ENST00000278426.3:c.551G>T	11.37:g.57265233C>A	ENSP00000278426:p.Gly184Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.G184V	ENST00000278426.3	37	c.551	CCDS7958.1	11	.	.	.	.	.	.	.	.	.	.	C	8.867	0.948394	0.18356	.	.	ENSG00000149150	ENST00000278426;ENST00000528450	T;T	0.54866	0.55;0.55	5.38	3.35	0.38373	Major facilitator superfamily domain, general substrate transporter (1);	0.215507	0.47455	D	0.000228	T	0.50171	0.1600	M	0.69823	2.125	0.51482	D	0.999927	P	0.39480	0.675	P	0.44946	0.465	T	0.52888	-0.8515	10	0.02654	T	1	-2.3735	9.4752	0.38867	0.1522:0.6786:0.1692:0.0	.	184	O75387	LAT3_HUMAN	V	184	ENSP00000278426:G184V;ENSP00000435673:G184V	ENSP00000278426:G184V	G	-	2	0	SLC43A1	57021809	0.047000	0.20315	0.130000	0.21974	0.815000	0.46073	0.811000	0.27198	1.219000	0.43474	0.555000	0.69702	GGA	SLC43A1	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	ENSG00000149150		0.547	SLC43A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC43A1	HGNC	protein_coding	OTTHUMT00000392541.1	67	0.00	0	C	NM_003627		57265233	57265233	-1	no_errors	ENST00000278426	ensembl	human	known	69_37n	missense	52	20.00	13	SNP	0.497	A
SPTBN4	57731	genome.wustl.edu	37	19	41066253	41066253	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:41066253C>A	ENST00000352632.3	+	27	5945	c.5859C>A	c.(5857-5859)gaC>gaA	p.D1953E	SPTBN4_ENST00000392025.1_Missense_Mutation_p.D696E|SPTBN4_ENST00000598249.1_Missense_Mutation_p.D1953E|SPTBN4_ENST00000392023.1_Missense_Mutation_p.D629E|SPTBN4_ENST00000338932.3_Missense_Mutation_p.D1953E|SPTBN4_ENST00000595535.1_Missense_Mutation_p.D1953E			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	1953					actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			AAGTCCGCGACCTGCTCTCCT	0.662																																						dbGAP											0													69.0	63.0	65.0					19																	41066253		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.5859C>A	19.37:g.41066253C>A	ENSP00000263373:p.Asp1953Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.D1953E	ENST00000352632.3	37	c.5859	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	C	13.70	2.316238	0.40996	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000392025;ENST00000392023	T;T;T;T	0.62364	0.82;0.82;0.82;0.03	4.47	3.44	0.39384	.	0.160762	0.38436	N	0.001687	T	0.59689	0.2212	L	0.42686	1.345	0.33705	D	0.615055	B;B;B;B	0.31435	0.144;0.323;0.267;0.01	B;B;P;B	0.44990	0.034;0.102;0.466;0.006	T	0.61749	-0.6999	10	0.12103	T	0.63	.	11.2444	0.48987	0.0:0.9088:0.0:0.0912	.	696;629;1953;1953	C9JY79;E9PGQ5;Q9H254;Q71S06	.;.;SPTN4_HUMAN;.	E	1953;1953;1953;696;629	ENSP00000263373:D1953E;ENSP00000340345:D1953E;ENSP00000375879:D696E;ENSP00000375877:D629E	ENSP00000340345:D1953E	D	+	3	2	SPTBN4	45758093	0.964000	0.33143	0.989000	0.46669	0.924000	0.55760	0.132000	0.15891	1.105000	0.41606	0.591000	0.81541	GAC	SPTBN4	-	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000160460		0.662	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	13	0.00	0	C			41066253	41066253	+1	no_errors	ENST00000352632	ensembl	human	known	69_37n	missense	9	30.77	4	SNP	1.000	A
STK10	6793	genome.wustl.edu	37	5	171517330	171517330	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr5:171517330G>A	ENST00000176763.5	-	10	1934	c.1591C>T	c.(1591-1593)Cgc>Tgc	p.R531C	STK10_ENST00000517775.1_5'Flank	NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	531					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			ACAAATTTGCGTGTCCGCTTG	0.502																																						dbGAP											0													248.0	226.0	233.0					5																	171517330		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.1591C>T	5.37:g.171517330G>A	ENSP00000176763:p.Arg531Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R531C	ENST00000176763.5	37	c.1591	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	G	16.78	3.218921	0.58560	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	D	0.82711	-1.64	4.6	4.6	0.57074	.	0.000000	0.85682	D	0.000000	D	0.90631	0.7062	M	0.86028	2.79	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.91395	0.5138	10	0.72032	D	0.01	.	10.2364	0.43286	0.0:0.0:0.802:0.198	.	531	O94804	STK10_HUMAN	C	531	ENSP00000176763:R531C	ENSP00000176763:R531C	R	-	1	0	STK10	171449935	0.900000	0.30661	0.992000	0.48379	0.903000	0.53119	1.303000	0.33470	2.122000	0.65172	0.455000	0.32223	CGC	STK10	-	NULL	ENSG00000072786		0.502	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	183	0.00	0	G	NM_005990		171517330	171517330	-1	no_errors	ENST00000176763	ensembl	human	known	69_37n	missense	104	26.24	37	SNP	0.879	A
SULT6B1	391365	genome.wustl.edu	37	2	37415655	37415655	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:37415655T>A	ENST00000535679.1	-	1	128	c.129A>T	c.(127-129)gaA>gaT	p.E43D	SULT6B1_ENST00000407963.1_Missense_Mutation_p.E5D|SULT6B1_ENST00000260637.3_Missense_Mutation_p.E5D|SULT6B1_ENST00000379149.2_Missense_Mutation_p.E43D			Q6IMI4	ST6B1_HUMAN	sulfotransferase family, cytosolic, 6B, member 1	43						cytoplasm (GO:0005737)	sulfotransferase activity (GO:0008146)			NS(1)|breast(1)|central_nervous_system(1)|large_intestine(3)|lung(5)|ovary(1)	12		all_hematologic(82;0.248)				CTTGGAAAGTTTCTGAGGTGC	0.428																																						dbGAP											0													191.0	167.0	175.0					2																	37415655		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY289770, AY289774	CCDS33182.1	2p22.2	2007-07-26			ENSG00000138068	ENSG00000138068		"""Sulfotransferases, cytosolic"""	33433	protein-coding gene	gene with protein product						14676822	Standard	XM_005264307		Approved		uc002rpu.3	Q6IMI4	OTTHUMG00000152160	ENST00000535679.1:c.129A>T	2.37:g.37415655T>A	ENSP00000444081:p.Glu43Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTS7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.E43D	ENST00000535679.1	37	c.129		2	.	.	.	.	.	.	.	.	.	.	T	14.47	2.546264	0.45383	.	.	ENSG00000138068	ENST00000535679;ENST00000379149;ENST00000260637;ENST00000407963;ENST00000433192;ENST00000416345;ENST00000420611	T;T;T;T	0.11930	2.73;2.73;2.73;2.73	4.39	-0.807	0.10872	.	0.000000	0.85682	D	0.000000	T	0.13670	0.0331	N	0.08118	0	0.45822	D	0.998695	D	0.89917	1.0	D	0.74348	0.983	T	0.04268	-1.0964	10	0.40728	T	0.16	.	9.155	0.36988	0.0:0.5642:0.0:0.4358	.	43	Q6IMI4	ST6B1_HUMAN	D	43;43;5;5;5;5;5	ENSP00000444081:E43D;ENSP00000368444:E43D;ENSP00000260637:E5D;ENSP00000384950:E5D	ENSP00000260637:E5D	E	-	3	2	SULT6B1	37269159	0.988000	0.35896	0.965000	0.40720	0.870000	0.49936	-0.059000	0.11731	-0.308000	0.08792	0.533000	0.62120	GAA	SULT6B1	-	NULL	ENSG00000138068		0.428	SULT6B1-203	KNOWN	basic|appris_principal	protein_coding	SULT6B1	HGNC	protein_coding		187	0.00	0	T	NM_001032377		37415655	37415655	-1	no_errors	ENST00000535679	ensembl	human	known	69_37n	missense	119	30.41	52	SNP	0.988	A
SYT3	84258	genome.wustl.edu	37	19	51135658	51135658	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:51135658C>A	ENST00000338916.4	-	2	1192	c.559G>T	c.(559-561)Gag>Tag	p.E187*	SYT3_ENST00000544769.1_Nonsense_Mutation_p.E187*|SYT3_ENST00000593901.1_Nonsense_Mutation_p.E187*|SYT3_ENST00000600079.1_Nonsense_Mutation_p.E187*	NM_032298.2	NP_115674.1	Q9BQG1	SYT3_HUMAN	synaptotagmin III	187					calcium ion-dependent exocytosis (GO:0017156)|positive regulation of vesicle fusion (GO:0031340)|response to calcium ion (GO:0051592)	cell junction (GO:0030054)|endosome (GO:0005768)|integral component of membrane (GO:0016021)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|metal ion binding (GO:0046872)|phosphatidylserine binding (GO:0001786)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(2)|skin(3)|urinary_tract(2)	35		all_neural(266;0.131)		OV - Ovarian serous cystadenocarcinoma(262;0.00462)|GBM - Glioblastoma multiforme(134;0.0188)		GAGGGCAGCTCAGGGGATGTT	0.637																																						dbGAP											0													37.0	39.0	38.0					19																	51135658		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL136594	CCDS12798.1	19q13.33	2014-07-02			ENSG00000213023	ENSG00000213023		"""Synaptotagmins"""	11511	protein-coding gene	gene with protein product		600327				7749232	Standard	NM_032298		Approved		uc002psv.3	Q9BQG1	OTTHUMG00000183064	ENST00000338916.4:c.559G>T	19.37:g.51135658C>A	ENSP00000340914:p.Glu187*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5Z1|Q8N640	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin,prints_C2_dom	p.E187*	ENST00000338916.4	37	c.559	CCDS12798.1	19	.	.	.	.	.	.	.	.	.	.	C	43	10.182221	0.99354	.	.	ENSG00000213023	ENST00000338916;ENST00000544769	.	.	.	5.24	4.2	0.49525	.	0.283001	0.26828	U	0.022291	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	12.5425	0.56179	0.0:0.9168:0.0:0.0832	.	.	.	.	X	187	.	ENSP00000340914:E187X	E	-	1	0	SYT3	55827470	0.997000	0.39634	0.985000	0.45067	0.979000	0.70002	3.645000	0.54389	2.605000	0.88082	0.655000	0.94253	GAG	SYT3	-	NULL	ENSG00000213023		0.637	SYT3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SYT3	HGNC	protein_coding	OTTHUMT00000464910.1	19	0.00	0	C	NM_032298		51135658	51135658	-1	no_errors	ENST00000338916	ensembl	human	known	69_37n	nonsense	11	52.17	12	SNP	0.955	A
TGM7	116179	genome.wustl.edu	37	15	43569149	43569149	+	Silent	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr15:43569149G>C	ENST00000452443.2	-	12	1888	c.1884C>G	c.(1882-1884)gtC>gtG	p.V628V		NM_052955.2	NP_443187.1	Q96PF1	TGM7_HUMAN	transglutaminase 7	628					peptide cross-linking (GO:0018149)		metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(16)|ovary(2)|prostate(4)|skin(1)	39		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;9.14e-07)	L-Glutamine(DB00130)	TGGTGAGGGTGACATGGACTC	0.572																																						dbGAP											0													136.0	114.0	121.0					15																	43569149		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AF363393	CCDS32213.1	15q15.2	2004-07-01				ENSG00000159495		"""Transglutaminases"""	30790	protein-coding gene	gene with protein product	"""transglutaminase Z"""	606776				11390390	Standard	NM_052955		Approved	TGMZ	uc001zrf.1	Q96PF1		ENST00000452443.2:c.1884C>G	15.37:g.43569149G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Transglutaminase_N,pfam_Transglutaminase_C,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.V628	ENST00000452443.2	37	c.1884	CCDS32213.1	15																																																																																			TGM7	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000159495		0.572	TGM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM7	HGNC	protein_coding	OTTHUMT00000432489.1	89	0.00	0	G	NM_052955		43569149	43569149	-1	no_errors	ENST00000452443	ensembl	human	known	69_37n	silent	16	58.97	23	SNP	0.986	C
TP53	7157	genome.wustl.edu	37	17	7577099	7577099	+	Missense_Mutation	SNP	C	C	G	rs121912660		TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr17:7577099C>G	ENST00000269305.4	-	8	1028	c.839G>C	c.(838-840)aGa>aCa	p.R280T	TP53_ENST00000420246.2_Missense_Mutation_p.R280T|TP53_ENST00000359597.4_Missense_Mutation_p.R280T|TP53_ENST00000413465.2_Intron|TP53_ENST00000455263.2_Missense_Mutation_p.R280T|TP53_ENST00000574684.1_5'Flank|TP53_ENST00000445888.2_Missense_Mutation_p.R280T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	280	Interaction with AXIN1. {ECO:0000250}.|Interaction with DNA.|Interaction with E4F1.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with ZNF385A.		R -> G (in sporadic cancers; somatic mutation).|R -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974}.|R -> K (in a familial cancer not matching LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1694291}.|R -> P (in a sporadic cancer; somatic mutation).|R -> S (in sporadic cancers; somatic mutation).|R -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1631151}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R280T(65)|p.R280K(49)|p.R280I(16)|p.0?(8)|p.?(2)|p.R280_D281delRD(2)|p.A276_R283delACPGRDRR(1)|p.C275fs*20(1)|p.A276fs*64(1)|p.L265_K305del41(1)|p.G279_R280delGR(1)|p.F270_D281del12(1)|p.G279fs*59(1)|p.D281fs*24(1)|p.R280fs*62(1)|p.S269fs*21(1)|p.V272_K292del21(1)|p.C275_R283delCACPGRDRR(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GCGCCGGTCTCTCCCAGGACA	0.542		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	154	Substitution - Missense(130)|Deletion - In frame(8)|Whole gene deletion(8)|Deletion - Frameshift(6)|Unknown(2)	urinary_tract(50)|breast(22)|lung(20)|upper_aerodigestive_tract(14)|haematopoietic_and_lymphoid_tissue(8)|large_intestine(5)|central_nervous_system(5)|stomach(4)|biliary_tract(4)|oesophagus(4)|skin(4)|ovary(4)|bone(4)|prostate(3)|small_intestine(1)|endometrium(1)|vagina(1)	GRCh37	CM993218	TP53	M	rs121912660						77.0	67.0	70.0					17																	7577099		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.839G>C	17.37:g.7577099C>G	ENSP00000269305:p.Arg280Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R280T	ENST00000269305.4	37	c.839	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.091761	0.94149	.	.	ENSG00000141510	ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000509690	D;D;D;D;D;D	0.99866	-7.3;-7.3;-7.3;-7.3;-7.3;-7.3	5.13	5.13	0.70059	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99885	0.9945	M	0.92649	3.33	0.80722	D	1	D;D;D;D	0.89917	0.998;1.0;0.998;0.992	D;D;D;D	0.97110	0.984;1.0;0.984;0.977	D	0.96400	0.9296	10	0.87932	D	0	-21.0303	16.1198	0.81342	0.0:1.0:0.0:0.0	.	280;280;280;280	P04637-2;P04637-3;P04637;Q1MSW8	.;.;P53_HUMAN;.	T	280;280;280;280;280;269;148	ENSP00000352610:R280T;ENSP00000269305:R280T;ENSP00000398846:R280T;ENSP00000391127:R280T;ENSP00000391478:R280T;ENSP00000425104:R148T	ENSP00000269305:R280T	R	-	2	0	TP53	7517824	0.978000	0.34361	1.000000	0.80357	0.980000	0.70556	7.587000	0.82613	2.667000	0.90743	0.462000	0.41574	AGA	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.542	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	111	0.00	0	C	NM_000546		7577099	7577099	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	16	65.96	31	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179584070	179584070	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr2:179584070A>G	ENST00000591111.1	-	81	23320	c.23096T>C	c.(23095-23097)gTt>gCt	p.V7699A	TTN_ENST00000460472.2_Intron|TTN_ENST00000359218.5_Intron|TTN_ENST00000342992.6_Missense_Mutation_p.V6772A|TTN_ENST00000589042.1_Missense_Mutation_p.V8016A|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000342175.6_Intron			Q8WZ42	TITIN_HUMAN	titin	13242	Ig-like 59.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AAACCAGCCAACTGAAATCGG	0.517																																						dbGAP											0													109.0	111.0	110.0					2																	179584070		1890	4110	6000	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.23096T>C	2.37:g.179584070A>G	ENSP00000465570:p.Val7699Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V6772A	ENST00000591111.1	37	c.20315		2	.	.	.	.	.	.	.	.	.	.	A	14.61	2.587222	0.46110	.	.	ENSG00000155657	ENST00000342992	T	0.76578	-1.03	6.08	6.08	0.98989	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	D	0.84047	0.5386	M	0.74881	2.28	0.80722	D	1	P	0.50819	0.939	P	0.51453	0.67	D	0.86101	0.1556	9	0.87932	D	0	.	16.6438	0.85155	1.0:0.0:0.0:0.0	.	7699	Q8WZ42	TITIN_HUMAN	A	6772	ENSP00000343764:V6772A	ENSP00000343764:V6772A	V	-	2	0	TTN	179292315	0.997000	0.39634	0.855000	0.33649	0.939000	0.58152	7.298000	0.78815	2.333000	0.79357	0.533000	0.62120	GTT	TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000155657		0.517	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	62	0.00	0	A	NM_133378		179584070	179584070	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	94	10.48	11	SNP	0.977	G
UFSP1	402682	genome.wustl.edu	37	7	100486535	100486535	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr7:100486535C>G	ENST00000388761.2	-	1	804	c.358G>C	c.(358-360)Gac>Cac	p.D120H		NM_001015072.3	NP_001015072.2	Q6NVU6	UFSP1_HUMAN	UFM1-specific peptidase 1 (non-functional)	120						extracellular vesicular exosome (GO:0070062)	thiolester hydrolase activity (GO:0016790)|UFM1 hydrolase activity (GO:0071567)			lung(1)|stomach(1)	2	Lung NSC(181;0.041)|all_lung(186;0.0581)					GAGTTGGGGTCAAAGGCTGCA	0.562																																						dbGAP											0													176.0	150.0	159.0					7																	100486535		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF312032	CCDS34710.1	7q22.1	2008-03-25			ENSG00000176125	ENSG00000176125			33821	protein-coding gene	gene with protein product		611481				17182609, 18321862	Standard	NM_001015072		Approved	UFSP	uc003uxc.4	Q6NVU6	OTTHUMG00000159662	ENST00000388761.2:c.358G>C	7.37:g.100486535C>G	ENSP00000373413:p.Asp120His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2E4|A8K8V2|B6ZDG6|Q9BXP6	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2	p.D120H	ENST00000388761.2	37	c.358	CCDS34710.1	7	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940843	0.52972	.	.	ENSG00000176125	ENST00000388761	T	0.30448	1.53	5.52	4.5	0.54988	.	0.166361	0.38111	N	0.001814	T	0.24661	0.0598	L	0.48877	1.53	0.39139	D	0.962004	B	0.29085	0.232	B	0.25405	0.06	T	0.10314	-1.0635	10	0.52906	T	0.07	-23.478	7.1379	0.25539	0.0:0.7626:0.0:0.2374	.	120	Q6NVU6	UFSP1_HUMAN	H	120	ENSP00000373413:D120H	ENSP00000373413:D120H	D	-	1	0	UFSP1	100324471	1.000000	0.71417	0.980000	0.43619	0.810000	0.45777	2.113000	0.41902	1.071000	0.40834	0.585000	0.79938	GAC	UFSP1	-	pfam_Peptidase_C78_UfSP1/2	ENSG00000176125		0.562	UFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFSP1	HGNC	protein_coding	OTTHUMT00000356751.1	87	0.00	0	C	NM_001015072		100486535	100486535	-1	no_errors	ENST00000388761	ensembl	human	known	69_37n	missense	10	74.36	29	SNP	0.983	G
USP54	159195	genome.wustl.edu	37	10	75258420	75258420	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr10:75258420G>A	ENST00000339859.4	-	23	5122	c.5022C>T	c.(5020-5022)atC>atT	p.I1674I	RP11-137L10.6_ENST00000600607.1_RNA|USP54_ENST00000497106.1_5'UTR|PPP3CB_ENST00000360663.5_5'Flank|RP11-137L10.6_ENST00000600887.1_RNA|RP11-137L10.6_ENST00000595069.1_RNA|USP54_ENST00000422491.2_Silent_p.I809I|RP11-137L10.6_ENST00000422977.1_RNA|USP54_ENST00000394811.2_Silent_p.I715I|PPP3CB_ENST00000394829.2_5'Flank|RP11-137L10.6_ENST00000593790.1_RNA|RP11-137L10.6_ENST00000600206.1_RNA|PPP3CB_ENST00000394828.2_5'Flank|RP11-137L10.6_ENST00000442133.4_RNA|PPP3CB_ENST00000342558.3_5'Flank|RP11-137L10.6_ENST00000595935.1_RNA|RP11-137L10.6_ENST00000596320.1_RNA|USP54_ENST00000428547.1_Silent_p.I1524I|USP54_ENST00000408019.1_Silent_p.I1674I|RP11-137L10.6_ENST00000597958.1_RNA|PPP3CB_ENST00000545874.1_5'Flank|PPP3CB_ENST00000394822.2_5'Flank			Q70EL1	UBP54_HUMAN	ubiquitin specific peptidase 54	1674					ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitinyl hydrolase activity (GO:0036459)			breast(5)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(12)|ovary(1)|prostate(1)	30	Prostate(51;0.0112)					CTCTAGCCCTGATCTGCTCTC	0.512																																					Colon(195;880 2046 8854 25025 38456)	dbGAP											0													130.0	125.0	127.0					10																	75258420		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ583820	CCDS7329.2	10q22.3	2006-09-26	2005-08-08	2004-01-30	ENSG00000166348	ENSG00000166348		"""Ubiquitin-specific peptidases"""	23513	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 29"", ""ubiquitin specific protease 54"""	C10orf29		14715245	Standard	NM_152586		Approved	FLJ37318, bA137L10.3, bA137L10.4	uc001juo.3	Q70EL1	OTTHUMG00000018469	ENST00000339859.4:c.5022C>T	10.37:g.75258420G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4Q4|A3KFK3|A3KFK5|A3KFK6|A3KFK7|A6PVS4|A6PVS5|A6PVS6|A6PVS7|B3KVY1|B9ZVM1|Q5F2F4|Q6P1N6|Q6ZSP1|Q6ZSR1|Q6ZTM0|Q8N1X2	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.I1674	ENST00000339859.4	37	c.5022	CCDS7329.2	10																																																																																			USP54	-	NULL	ENSG00000166348		0.512	USP54-014	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	USP54	HGNC	protein_coding	OTTHUMT00000316563.2	122	0.00	0	G	NM_152586		75258420	75258420	-1	no_errors	ENST00000339859	ensembl	human	known	69_37n	silent	18	92.80	232	SNP	0.194	A
VNN2	8875	genome.wustl.edu	37	6	133078597	133078597	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr6:133078597G>A	ENST00000326499.6	-	2	426	c.302C>T	c.(301-303)cCa>cTa	p.P101L	VNN2_ENST00000525270.1_Missense_Mutation_p.P48L|VNN2_ENST00000526192.1_5'UTR|VNN2_ENST00000525289.1_Missense_Mutation_p.P101L	NM_004665.2	NP_004656	O95498	VNN2_HUMAN	vanin 2	101	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				cellular component movement (GO:0006928)|pantothenate metabolic process (GO:0015939)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|lung(14)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(155;0.00237)|GBM - Glioblastoma multiforme(226;0.0267)		CTGAGGGTCTGGGATATCCTC	0.428																																						dbGAP											0													87.0	90.0	89.0					6																	133078597		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026705	CCDS5161.1, CCDS5162.1, CCDS56451.1	6q23-q24	2013-02-13			ENSG00000112303	ENSG00000112303	3.5.1.92	"""Vanins"""	12706	protein-coding gene	gene with protein product	"""pantetheinase"""	603571				9790769, 11491533	Standard	NM_078488		Approved	FOAP-4, GPI-80	uc003qdt.3	O95498	OTTHUMG00000015588	ENST00000326499.6:c.302C>T	6.37:g.133078597G>A	ENSP00000322276:p.Pro101Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUZ3|A6NDY1|A8K4E3|A8K7W0|B2DFZ0|B2DFZ1|B2DFZ2|B2DFZ3|F6XL73|Q2XUN1|Q9UJF3|Q9UMW2	Missense_Mutation	SNP	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.P101L	ENST00000326499.6	37	c.302	CCDS5161.1	6	.	.	.	.	.	.	.	.	.	.	G	26.2	4.712359	0.89112	.	.	ENSG00000112303	ENST00000326499;ENST00000525270;ENST00000525289;ENST00000524919;ENST00000530536;ENST00000532012	D;D;D;D;D;D	0.93811	-2.22;-2.22;-2.22;-2.22;-2.22;-3.29	5.27	5.27	0.74061	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (4);	0.000000	0.64402	D	0.000004	D	0.97757	0.9264	M	0.94142	3.5	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.989	D	0.98563	1.0642	10	0.87932	D	0	-15.2871	19.2624	0.93973	0.0:0.0:1.0:0.0	.	101;101	O95498-2;O95498	.;VNN2_HUMAN	L	101;48;101;101;48;101	ENSP00000322276:P101L;ENSP00000436822:P48L;ENSP00000436935:P101L;ENSP00000431451:P101L;ENSP00000434210:P48L;ENSP00000431680:P101L	ENSP00000322276:P101L	P	-	2	0	VNN2	133120290	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.533000	0.60615	2.608000	0.88229	0.609000	0.83330	CCA	VNN2	-	pirsf_Biotinidase_euk,pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	ENSG00000112303		0.428	VNN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VNN2	HGNC	protein_coding	OTTHUMT00000042264.2	87	0.00	0	G			133078597	133078597	-1	no_errors	ENST00000326499	ensembl	human	known	69_37n	missense	126	16.00	24	SNP	1.000	A
XCL1	6375	genome.wustl.edu	37	1	168549314	168549314	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr1:168549314A>C	ENST00000367818.3	+	2	240	c.75A>C	c.(73-75)gaA>gaC	p.E25D		NM_002995.2	NP_002986.1	P47992	XCL1_HUMAN	chemokine (C motif) ligand 1	25					cell-cell signaling (GO:0007267)|cellular response to interleukin-4 (GO:0071353)|cellular response to transforming growth factor beta stimulus (GO:0071560)|immune response (GO:0006955)|mature natural killer cell chemotaxis (GO:0035782)|negative regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000562)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of T cell cytokine production (GO:0002725)|negative regulation of T-helper 1 cell activation (GO:2000518)|negative regulation of T-helper 1 type immune response (GO:0002826)|negative regulation of transcription, DNA-templated (GO:0045892)|neutrophil chemotaxis (GO:0030593)|positive regulation of B cell chemotaxis (GO:2000538)|positive regulation of CD4-positive, alpha-beta T cell proliferation (GO:2000563)|positive regulation of CD8-positive, alpha-beta T cell proliferation (GO:2000566)|positive regulation of granzyme A production (GO:2000513)|positive regulation of granzyme B production (GO:0071663)|positive regulation of immunoglobulin production in mucosal tissue (GO:2000558)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of natural killer cell chemotaxis (GO:2000503)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of T cell chemotaxis (GO:0010820)|positive regulation of T cell cytokine production (GO:0002726)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 cell cytokine production (GO:2000556)|positive regulation of T-helper 2 cell cytokine production (GO:2000553)|positive regulation of thymocyte migration (GO:2000412)|positive regulation of transforming growth factor beta production (GO:0071636)|regulation of inflammatory response (GO:0050727)|release of sequestered calcium ion into cytosol (GO:0051209)|response to virus (GO:0009615)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|chemokine receptor binding (GO:0042379)|protein homodimerization activity (GO:0042803)			kidney(2)|lung(7)|upper_aerodigestive_tract(1)	10	all_hematologic(923;0.208)					TAGGGAGTGAAGTCTCAGATA	0.433																																						dbGAP											0													122.0	125.0	124.0					1																	168549314		2203	4300	6503	-	-	-	SO:0001583	missense	0			D43768	CCDS1274.1	1q24.2	2014-01-30	2002-08-22	2002-08-23	ENSG00000143184	ENSG00000143184		"""Endogenous ligands"""	10645	protein-coding gene	gene with protein product		600250	"""small inducible cytokine subfamily C, member 1 (lymphotactin)"""	LTN, SCYC1		7602097, 7875320	Standard	NM_002995		Approved	LPTN, ATAC, SCM-1a, SCM-1, lymphotactin	uc001gfo.2	P47992	OTTHUMG00000034548	ENST00000367818.3:c.75A>C	1.37:g.168549314A>C	ENSP00000356792:p.Glu25Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52MA8	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_lymphotactin_XCL1	p.E25D	ENST00000367818.3	37	c.75	CCDS1274.1	1	.	.	.	.	.	.	.	.	.	.	A	14.91	2.676420	0.47886	.	.	ENSG00000143184	ENST00000367818	T	0.03272	3.99	4.36	3.23	0.37069	Chemokine interleukin-8-like domain (1);	0.090463	0.47852	D	0.000205	T	0.04770	0.0129	M	0.67397	2.05	0.26547	N	0.973971	D	0.76494	0.999	D	0.85130	0.997	T	0.32214	-0.9915	9	0.13470	T	0.59	-23.8413	6.6496	0.22955	0.8923:0.0:0.1077:0.0	.	25	P47992	XCL1_HUMAN	D	25	ENSP00000356792:E25D	ENSP00000356792:E25D	E	+	3	2	XCL1	166815938	0.998000	0.40836	0.985000	0.45067	0.627000	0.37826	1.615000	0.36922	0.829000	0.34733	0.533000	0.62120	GAA	XCL1	-	superfamily_Chemokine_IL8-like_dom,prints_Chemokine_lymphotactin_XCL1	ENSG00000143184		0.433	XCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XCL1	HGNC	protein_coding	OTTHUMT00000083612.1	154	0.00	0	A	NM_002995		168549314	168549314	+1	no_errors	ENST00000367818	ensembl	human	known	69_37n	missense	230	21.69	64	SNP	0.995	C
ZBTB24	9841	genome.wustl.edu	37	6	109803079	109803079	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr6:109803079delG	ENST00000230122.3	-	2	318	c.151delC	c.(151-153)cacfs	p.H51fs		NM_001164313.1|NM_014797.2	NP_001157785.1|NP_055612.2	O43167	ZBT24_HUMAN	zinc finger and BTB domain containing 24	51	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				hematopoietic progenitor cell differentiation (GO:0002244)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	22		all_cancers(87;0.000189)|Acute lymphoblastic leukemia(125;3.07e-08)|all_hematologic(75;3.33e-06)|all_epithelial(87;0.00686)|Lung SC(18;0.0743)|Colorectal(196;0.101)|all_lung(197;0.149)		Epithelial(106;0.0154)|all cancers(137;0.0216)|OV - Ovarian serous cystadenocarcinoma(136;0.0242)|BRCA - Breast invasive adenocarcinoma(108;0.059)		AAGGCTTTGTGGGCCCGGAAA	0.473																																						dbGAP											0													95.0	92.0	93.0					6																	109803079		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB007901	CCDS34509.1	6q21	2014-09-17	2004-04-15	2004-04-16	ENSG00000112365	ENSG00000112365		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	21143	protein-coding gene	gene with protein product	"""POZ (BTB) and AT hook containing zinc finger 2"""	614064	"""zinc finger protein 450"""	ZNF450		9455477	Standard	NM_014797		Approved	KIAA0441, BIF1, PATZ2	uc003ptl.1	O43167	OTTHUMG00000015349	ENST00000230122.3:c.151delC	6.37:g.109803079delG	ENSP00000230122:p.His51fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RC6|Q5TED5|Q8N455	Frame_Shift_Del	DEL	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.H51fs	ENST00000230122.3	37	c.151	CCDS34509.1	6																																																																																			ZBTB24	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	ENSG00000112365		0.473	ZBTB24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB24	HGNC	protein_coding	OTTHUMT00000041758.1	63	0.00	0	G	NM_014797		109803079	109803079	-1	no_errors	ENST00000230122	ensembl	human	known	69_37n	frame_shift_del	117	19.59	29	DEL	1.000	-
ZNF48	197407	genome.wustl.edu	37	16	30408955	30408955	+	Silent	SNP	G	G	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr16:30408955G>A	ENST00000320159.2	+	2	760	c.384G>A	c.(382-384)gtG>gtA	p.V128V	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	128					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CAGATCTGGTGAAACACCAGC	0.602																																						dbGAP											0													47.0	55.0	53.0					16																	30408955		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.384G>A	16.37:g.30408955G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15920|Q4G0R3|Q69YP3|Q96IL9	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.V128	ENST00000320159.2	37	c.384	CCDS10679.1	16																																																																																			ZNF48	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180035		0.602	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	HGNC	protein_coding	OTTHUMT00000255549.2	38	0.00	0	G	NM_152652		30408955	30408955	+1	no_errors	ENST00000320159	ensembl	human	known	69_37n	silent	25	43.18	19	SNP	0.999	A
ZNF541	84215	genome.wustl.edu	37	19	48052598	48052598	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:48052598C>T	ENST00000391901.3	-	2	451	c.452G>A	c.(451-453)aGc>aAc	p.S151N	ZNF541_ENST00000448976.1_Missense_Mutation_p.S151N|ZNF541_ENST00000314121.4_Missense_Mutation_p.S151N			Q9H0D2	ZN541_HUMAN	zinc finger protein 541	151					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(1)|lung(2)|prostate(1)|skin(1)	9						AGAACTGGCGCTGCTGAACAC	0.577																																						dbGAP											0													141.0	124.0	129.0					19																	48052598		692	1591	2283	-	-	-	SO:0001583	missense	0			AL136846	CCDS46133.1, CCDS46133.2	19q13.33	2013-01-08			ENSG00000118156	ENSG00000118156		"""Zinc fingers, C2H2-type"""	25294	protein-coding gene	gene with protein product						11230166	Standard	NM_001277075		Approved	DKFZp434I1930	uc002phg.5	Q9H0D2	OTTHUMG00000141262	ENST00000391901.3:c.452G>A	19.37:g.48052598C>T	ENSP00000375770:p.Ser151Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDK8	Missense_Mutation	SNP	pfam_ELM2_dom,pfam_Znf_C2H2,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_SANT/Myb,pfscan_ELM2_dom,pfscan_Znf_C2H2	p.S151N	ENST00000391901.3	37	c.452		19	.	.	.	.	.	.	.	.	.	.	C	16.04	3.009037	0.54361	.	.	ENSG00000118156	ENST00000391901;ENST00000314121;ENST00000448976	T;T;T	0.76060	-0.99;-0.99;-0.99	5.71	5.71	0.89125	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.74589	0.3736	N	0.08118	0	0.37125	D	0.901012	D	0.71674	0.998	D	0.78314	0.991	T	0.81980	-0.0684	9	0.66056	D	0.02	-19.2692	16.7703	0.85535	0.0:1.0:0.0:0.0	.	151	Q9H0D2	ZN541_HUMAN	N	151	ENSP00000375770:S151N;ENSP00000313258:S151N;ENSP00000410847:S151N	ENSP00000313258:S151N	S	-	2	0	ZNF541	52744410	1.000000	0.71417	0.995000	0.50966	0.324000	0.28378	4.425000	0.59875	2.694000	0.91930	0.557000	0.71058	AGC	ZNF541	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000118156		0.577	ZNF541-001	KNOWN	basic|appris_candidate|exp_conf	protein_coding	ZNF541	HGNC	protein_coding	OTTHUMT00000280415.1	132	0.75	1	C	NM_032255		48052598	48052598	-1	no_errors	ENST00000314121	ensembl	human	known	69_37n	missense	83	19.42	20	SNP	0.997	T
ZNF629	23361	genome.wustl.edu	37	16	30794530	30794530	+	Silent	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr16:30794530C>T	ENST00000262525.4	-	3	1326	c.1119G>A	c.(1117-1119)ccG>ccA	p.P373P		NM_001080417.1	NP_001073886.1	Q9UEG4	ZN629_HUMAN	zinc finger protein 629	373					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|prostate(3)|urinary_tract(1)	22			Colorectal(24;0.198)			GGCACTTGAACGGGTCCTCGC	0.652																																						dbGAP											0													32.0	33.0	33.0					16																	30794530		2196	4300	6496	-	-	-	SO:0001819	synonymous_variant	0			AB002324	CCDS45463.1	16p11.2	2013-01-08				ENSG00000102870		"""Zinc fingers, C2H2-type"""	29008	protein-coding gene	gene with protein product			"""zinc finger protein 65"""	ZNF65		9205841	Standard	NM_001080417		Approved	KIAA0326	uc002dzs.1	Q9UEG4		ENST00000262525.4:c.1119G>A	16.37:g.30794530C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15938	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P373	ENST00000262525.4	37	c.1119	CCDS45463.1	16																																																																																			ZNF629	-	pfscan_Znf_C2H2	ENSG00000102870		0.652	ZNF629-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF629	HGNC	protein_coding	OTTHUMT00000434291.1	78	0.00	0	C	NM_015309		30794530	30794530	-1	no_errors	ENST00000262525	ensembl	human	known	69_37n	silent	33	44.07	26	SNP	0.971	T
ZNF682	91120	genome.wustl.edu	37	19	20135146	20135146	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:20135146G>C	ENST00000397165.2	-	2	203	c.43C>G	c.(43-45)Ctg>Gtg	p.L15V	ZNF682_ENST00000397162.1_5'UTR|ZNF682_ENST00000595736.1_Intron|ZNF682_ENST00000596019.1_Missense_Mutation_p.L15V|ZNF682_ENST00000593468.1_Missense_Mutation_p.L15V|ZNF682_ENST00000597972.1_Missense_Mutation_p.L21V|ZNF682_ENST00000358523.5_5'UTR|AC006539.1_ENST00000578235.1_RNA	NM_033196.2	NP_149973.1	O95780	ZN682_HUMAN	zinc finger protein 682	15	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(1)	14						CACTCCTCCAGAGAGAATTCT	0.433																																						dbGAP											0													64.0	68.0	67.0					19																	20135146		2188	4296	6484	-	-	-	SO:0001583	missense	0			AC006539	CCDS42533.1, CCDS42534.1	19p12	2014-02-13			ENSG00000197124	ENSG00000197124		"""Zinc fingers, C2H2-type"", ""-"""	28857	protein-coding gene	gene with protein product							Standard	NM_033196		Approved	BC39498_3	uc002noq.3	O95780	OTTHUMG00000182650	ENST00000397165.2:c.43C>G	19.37:g.20135146G>C	ENSP00000380351:p.Leu15Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU64|E9PFJ5|Q96JV9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L15V	ENST00000397165.2	37	c.43	CCDS42533.1	19	.	.	.	.	.	.	.	.	.	.	g	0.009	-1.813764	0.00600	.	.	ENSG00000197124	ENST00000397165	T	0.01821	4.62	0.898	-1.8	0.07907	Krueppel-associated box (4);	.	.	.	.	T	0.06280	0.0162	M	0.83692	2.655	0.23174	N	0.998173	D	0.61697	0.99	D	0.62955	0.909	T	0.11867	-1.0570	9	0.33141	T	0.24	.	2.8381	0.05521	0.2519:0.0:0.4947:0.2534	.	15	O95780	ZN682_HUMAN	V	15	ENSP00000380351:L15V	ENSP00000380351:L15V	L	-	1	2	ZNF682	19996146	0.001000	0.12720	0.440000	0.26846	0.446000	0.32137	-2.731000	0.00805	-1.984000	0.00985	-1.959000	0.00480	CTG	ZNF682	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197124		0.433	ZNF682-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF682	HGNC	protein_coding	OTTHUMT00000462888.1	140	0.00	0	G	NM_033196		20135146	20135146	-1	no_errors	ENST00000397165	ensembl	human	known	69_37n	missense	67	50.00	67	SNP	0.360	C
ZNF831	128611	genome.wustl.edu	37	20	57768189	57768189	+	Silent	SNP	T	T	G			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr20:57768189T>G	ENST00000371030.2	+	1	2115	c.2115T>G	c.(2113-2115)acT>acG	p.T705T		NM_178457.1	NP_848552.1	Q5JPB2	ZN831_HUMAN	zinc finger protein 831	705							metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(71)|ovary(2)|pancreas(1)|prostate(4)|skin(16)|upper_aerodigestive_tract(2)|urinary_tract(3)	125	all_lung(29;0.0085)					CCTTGGTGACTGAACCCACTA	0.622																																						dbGAP											0													21.0	25.0	24.0					20																	57768189		2039	4170	6209	-	-	-	SO:0001819	synonymous_variant	0			AL121919	CCDS42894.1	20q13.32	2008-10-20	2008-03-25	2008-03-25	ENSG00000124203	ENSG00000124203			16167	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 174"""	C20orf174			Standard	NM_178457		Approved	dJ492J12.1	uc002yan.3	Q5JPB2	OTTHUMG00000032864	ENST00000371030.2:c.2115T>G	20.37:g.57768189T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TDR4|Q8TCP0	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T705	ENST00000371030.2	37	c.2115	CCDS42894.1	20																																																																																			ZNF831	-	NULL	ENSG00000124203		0.622	ZNF831-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF831	HGNC	protein_coding	OTTHUMT00000079916.2	33	0.00	0	T	NM_178457		57768189	57768189	+1	no_errors	ENST00000371030	ensembl	human	novel	69_37n	silent	17	39.29	11	SNP	0.000	G
ZNF91	7644	genome.wustl.edu	37	19	23542876	23542876	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr19:23542876C>T	ENST00000300619.7	-	4	3110	c.2905G>A	c.(2905-2907)Gaa>Aaa	p.E969K	ZNF91_ENST00000596528.1_5'Flank|ZNF91_ENST00000397082.2_Missense_Mutation_p.E937K|ZNF91_ENST00000599743.1_Intron	NM_003430.2	NP_003421.2	Q05481	ZNF91_HUMAN	zinc finger protein 91	969					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				CCACATTCTTCACATTTGTAG	0.373																																						dbGAP											0													62.0	66.0	65.0					19																	23542876		2136	4270	6406	-	-	-	SO:0001583	missense	0			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000300619.7:c.2905G>A	19.37:g.23542876C>T	ENSP00000300619:p.Glu969Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E1|B7Z6G6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E969K	ENST00000300619.7	37	c.2905	CCDS42541.1	19	.	.	.	.	.	.	.	.	.	.	C	2.006	-0.428245	0.04701	.	.	ENSG00000167232	ENST00000300619;ENST00000397082	T;T	0.07216	3.21;3.21	1.52	-3.04	0.05412	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05502	0.0145	N	0.12443	0.215	0.09310	N	1	D;D	0.64830	0.993;0.994	B;P	0.59761	0.302;0.863	T	0.10683	-1.0619	9	0.02654	T	1	.	0.3654	0.00371	0.2078:0.1614:0.2096:0.4212	.	937;969	Q05481-2;Q05481	.;ZNF91_HUMAN	K	969;937	ENSP00000300619:E969K;ENSP00000380272:E937K	ENSP00000300619:E969K	E	-	1	0	ZNF91	23334716	0.000000	0.05858	0.410000	0.26471	0.060000	0.15804	-5.350000	0.00129	-1.057000	0.03201	0.205000	0.17691	GAA	ZNF91	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167232		0.373	ZNF91-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF91	HGNC	protein_coding	OTTHUMT00000465891.1	82	0.00	0	C	NM_003430		23542876	23542876	-1	no_errors	ENST00000300619	ensembl	human	known	69_37n	missense	42	44.00	33	SNP	0.067	T
ZSCAN29	146050	genome.wustl.edu	37	15	43661287	43661287	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A1FN-01A-11D-A13L-09	TCGA-BH-A1FN-11A-34D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bf92d76e-31ff-4273-82ea-982c4c26394b	a5d31e3a-08d6-40c1-a1e5-ee2b2eb6c544	g.chr15:43661287C>A	ENST00000396976.2	-	2	491	c.357G>T	c.(355-357)gaG>gaT	p.E119D	ZSCAN29_ENST00000568898.1_Missense_Mutation_p.E118D|TUBGCP4_ENST00000564079.1_5'Flank|TUBGCP4_ENST00000260383.7_5'Flank|ZSCAN29_ENST00000562072.1_Missense_Mutation_p.E118D|ZSCAN29_ENST00000396972.1_Missense_Mutation_p.E119D|ZSCAN29_ENST00000563508.1_5'Flank	NM_152455.3	NP_689668.3	Q8IWY8	ZSC29_HUMAN	zinc finger and SCAN domain containing 29	119					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(9)|lung(7)|skin(2)	24		all_cancers(109;2.12e-14)|all_epithelial(112;1.99e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;8.97e-07)		GTGTCATCTTCTCCAAGCGCA	0.512																																						dbGAP											0													86.0	82.0	84.0					15																	43661287		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF525399	CCDS10095.2	15q15.3	2013-01-08	2007-03-08	2007-03-08	ENSG00000140265	ENSG00000140265		"""-"", ""Zinc fingers, C2H2-type"""	26673	protein-coding gene	gene with protein product			"""zinc finger protein 690"""	ZNF690		12434312	Standard	NM_152455		Approved	FLJ35867, Zfp690	uc001zrk.1	Q8IWY8	OTTHUMG00000130767	ENST00000396976.2:c.357G>T	15.37:g.43661287C>A	ENSP00000380174:p.Glu119Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVB9|Q32M75|Q32M76|Q8NA40	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E119D	ENST00000396976.2	37	c.357	CCDS10095.2	15	.	.	.	.	.	.	.	.	.	.	C	14.80	2.643080	0.47153	.	.	ENSG00000140265	ENST00000396976;ENST00000396972	T;T	0.09630	2.96;2.98	5.42	5.42	0.78866	Transcription regulator SCAN (1);	0.000000	0.51477	D	0.000088	T	0.30854	0.0778	M	0.72353	2.195	0.23708	N	0.99706	P;P;B;D	0.58970	0.906;0.468;0.357;0.984	B;B;B;D	0.68192	0.416;0.348;0.343;0.956	T	0.05273	-1.0895	10	0.40728	T	0.16	-11.788	15.0612	0.71955	0.0:1.0:0.0:0.0	.	119;118;119;119	Q8IWY8-4;C9K0J8;Q8IWY8-3;Q8IWY8	.;.;.;ZSC29_HUMAN	D	119	ENSP00000380174:E119D;ENSP00000380170:E119D	ENSP00000380170:E119D	E	-	3	2	ZSCAN29	41448579	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.876000	0.39588	2.690000	0.91761	0.655000	0.94253	GAG	ZSCAN29	-	smart_Tscrpt_reg_SCAN	ENSG00000140265		0.512	ZSCAN29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN29	HGNC	protein_coding	OTTHUMT00000253278.1	96	0.00	0	C	NM_152455		43661287	43661287	-1	no_errors	ENST00000396976	ensembl	human	known	69_37n	missense	19	62.00	31	SNP	1.000	A
