#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARHGEF9	23229	genome.wustl.edu	37	X	62875545	62875545	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chrX:62875545C>T	ENST00000253401.6	-	8	1929	c.1129G>A	c.(1129-1131)Gag>Aag	p.E377K	ARHGEF9_ENST00000433323.2_Missense_Mutation_p.E104K|ARHGEF9_ENST00000374870.4_Missense_Mutation_p.E275K|ARHGEF9_ENST00000374872.1_Missense_Mutation_p.E356K|ARHGEF9_ENST00000437457.2_Missense_Mutation_p.E324K|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374878.1_Missense_Mutation_p.E375K	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	377	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						CTGCCATCCTCAATGTCAACT	0.433																																						dbGAP											0													204.0	167.0	180.0					X																	62875545		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.1129G>A	X.37:g.62875545C>T	ENSP00000253401:p.Glu377Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E377K	ENST00000253401.6	37	c.1129	CCDS35315.1	X	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154507	0.57259	.	.	ENSG00000131089	ENST00000253401;ENST00000374878;ENST00000437457;ENST00000374870;ENST00000433323;ENST00000374872	T;T;T;T;D;T	0.88201	-0.87;-0.87;-0.87;-0.87;-2.35;-0.87	5.54	5.54	0.83059	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.115998	0.64402	D	0.000019	D	0.91192	0.7225	M	0.90814	3.15	0.44295	D	0.997167	B;B;B;B	0.32071	0.047;0.022;0.022;0.355	B;B;B;B	0.32805	0.022;0.035;0.022;0.153	D	0.90344	0.4361	10	0.37606	T	0.19	.	17.0196	0.86430	0.0:1.0:0.0:0.0	.	324;375;377;377	B4DHC7;B1AMR4;O43307;A8K1S8	.;.;ARHG9_HUMAN;.	K	377;375;324;275;104;356	ENSP00000253401:E377K;ENSP00000364012:E375K;ENSP00000399994:E324K;ENSP00000364004:E275K;ENSP00000404478:E104K;ENSP00000364006:E356K	ENSP00000253401:E377K	E	-	1	0	ARHGEF9	62792270	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.339000	0.59322	2.332000	0.79248	0.436000	0.28706	GAG	ARHGEF9	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000131089		0.433	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1	331	0.00	0	C			62875545	62875545	-1	no_errors	ENST00000253401	ensembl	human	known	69_37n	missense	373	10.98	46	SNP	1.000	T
DDX21	9188	genome.wustl.edu	37	10	70737326	70737326	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr10:70737326A>G	ENST00000354185.4	+	12	1882	c.1784A>G	c.(1783-1785)aAa>aGa	p.K595R		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	595					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						AGTCACTTCAAACAATCAGCT	0.498																																						dbGAP											0													129.0	127.0	128.0					10																	70737326		2203	4300	6503	-	-	-	SO:0001583	missense	0			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.1784A>G	10.37:g.70737326A>G	ENSP00000346120:p.Lys595Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.K595R	ENST00000354185.4	37	c.1784	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	A	8.725	0.915311	0.17907	.	.	ENSG00000165732	ENST00000354185	T	0.15834	2.39	5.61	4.46	0.54185	.	0.156392	0.56097	D	0.000031	T	0.06462	0.0166	N	0.04746	-0.17	0.38663	D	0.952115	B	0.12013	0.005	B	0.13407	0.009	T	0.21211	-1.0252	10	0.05833	T	0.94	-48.9216	8.1709	0.31254	0.8528:0.0:0.1472:0.0	.	595	Q9NR30	DDX21_HUMAN	R	595	ENSP00000346120:K595R	ENSP00000346120:K595R	K	+	2	0	DDX21	70407332	1.000000	0.71417	1.000000	0.80357	0.474000	0.32979	2.341000	0.43983	2.254000	0.74563	0.533000	0.62120	AAA	DDX21	-	NULL	ENSG00000165732		0.498	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	HGNC	protein_coding	OTTHUMT00000048374.1	134	0.00	0	A	NM_004728		70737326	70737326	+1	no_errors	ENST00000354185	ensembl	human	known	69_37n	missense	122	26.06	43	SNP	1.000	G
DPM1	8813	genome.wustl.edu	37	20	49575041	49575041	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr20:49575041C>T	ENST00000371588.5	-	1	46	c.20G>A	c.(19-21)aGt>aAt	p.S7N	MOCS3_ENST00000244051.1_5'Flank|DPM1_ENST00000371583.5_Missense_Mutation_p.S7N|DPM1_ENST00000466152.1_5'UTR|DPM1_ENST00000371582.4_Missense_Mutation_p.S7N	NM_003859.1	NP_003850.1	O60762	DPM1_HUMAN	dolichyl-phosphate mannosyltransferase polypeptide 1, catalytic subunit	7					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|dolichol metabolic process (GO:0019348)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose metabolic process (GO:0019673)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|protein mannosylation (GO:0035268)|protein N-linked glycosylation via asparagine (GO:0018279)|protein O-linked mannosylation (GO:0035269)	dolichol-phosphate-mannose synthase complex (GO:0033185)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|membrane (GO:0016020)|nucleus (GO:0005634)	alcohol binding (GO:0043178)|dolichyl-phosphate beta-D-mannosyltransferase activity (GO:0004582)|dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|mannose binding (GO:0005537)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	7						AGGACTACGACTGACTTCCAA	0.567																																						dbGAP											0													60.0	56.0	57.0					20																	49575041		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF007875	CCDS13434.1	20q13.1	2013-02-26			ENSG00000000419	ENSG00000000419	2.4.1.83	"""Glycosyltransferase family 2 domain containing"""	3005	protein-coding gene	gene with protein product	"""DPM synthase complex, catalytic subunit"""	603503				9223280, 9535917	Standard	NM_003859		Approved	MPDS, CDGIE	uc002xvw.1	O60762	OTTHUMG00000032742	ENST00000371588.5:c.20G>A	20.37:g.49575041C>T	ENSP00000360644:p.Ser7Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O15157|Q6IB78|Q96HK0	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.S7N	ENST00000371588.5	37	c.20	CCDS13434.1	20	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989209	0.35131	.	.	ENSG00000000419	ENST00000371588;ENST00000371582;ENST00000449701;ENST00000371583;ENST00000413082	D;D;D;D	0.86164	-2.06;-2.08;-2.06;-1.65	5.48	0.974	0.19715	.	0.341764	0.26432	N	0.024408	T	0.70386	0.3218	N	0.08118	0	0.09310	N	1	B	0.19583	0.037	B	0.13407	0.009	T	0.56056	-0.8042	9	.	.	.	-2.1635	11.1322	0.48354	0.1255:0.5065:0.368:0.0	.	7	O60762	DPM1_HUMAN	N	7	ENSP00000360644:S7N;ENSP00000360638:S7N;ENSP00000360639:S7N;ENSP00000394921:S7N	.	S	-	2	0	DPM1	49008448	0.000000	0.05858	0.001000	0.08648	0.017000	0.09413	-0.185000	0.09684	0.629000	0.30376	0.650000	0.86243	AGT	DPM1	-	NULL	ENSG00000000419		0.567	DPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPM1	HGNC	protein_coding	OTTHUMT00000079716.1	67	0.00	0	C	NM_003859		49575041	49575041	-1	no_errors	ENST00000371582	ensembl	human	known	69_37n	missense	65	29.35	27	SNP	0.000	T
GOLGA6L2	283685	genome.wustl.edu	37	15	23685826	23685828	+	In_Frame_Del	DEL	TCT	TCT	-	rs372813065		TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr15:23685826_23685828delTCT	ENST00000567107.1	-	8	1846_1848	c.1794_1796delAGA	c.(1792-1797)gaagat>gat	p.E598del	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						tgctgccacatcttcttctgctc	0.581																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.1794_1796delAGA	15.37:g.23685832_23685834delTCT	ENSP00000454407:p.Glu598del	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	In_Frame_Del	DEL	NULL	p.E598in_frame_del	ENST00000567107.1	37	c.1796_1794		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.581	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	26	0.00	0	TCT	NM_182561		23685826	23685828	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	in_frame_del	34	15.00	6	DEL	0.000:0.000:0.000	-
GPR55	9290	genome.wustl.edu	37	2	231775625	231775625	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr2:231775625A>G	ENST00000392040.1	-	2	245	c.53T>C	c.(52-54)cTg>cCg	p.L18P	AC012507.4_ENST00000454890.1_RNA|GPR55_ENST00000392039.2_Missense_Mutation_p.L18P	NM_005683.3	NP_005674.2	Q9Y2T6	GPR55_HUMAN	G protein-coupled receptor 55	18					activation of phospholipase C activity (GO:0007202)|bone resorption (GO:0045453)|cannabinoid signaling pathway (GO:0038171)|G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of osteoclast differentiation (GO:0045671)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rho protein signal transduction (GO:0035025)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Renal(207;0.0112)|all_lung(227;0.0741)|all_hematologic(139;0.0748)|Acute lymphoblastic leukemia(138;0.167)|Lung NSC(271;0.204)		Epithelial(121;1.04e-11)|all cancers(144;4.22e-09)|LUSC - Lung squamous cell carcinoma(224;0.0119)|Lung(119;0.0145)		GGTTTTCATCAGCTCGTTGAC	0.532																																						dbGAP											0													122.0	115.0	117.0					2																	231775625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF096786	CCDS2480.1	2q37	2012-08-21			ENSG00000135898	ENSG00000135898		"""GPCR / Class A : Orphans"""	4511	protein-coding gene	gene with protein product		604107				9931487	Standard	NM_005683		Approved		uc002vrg.3	Q9Y2T6	OTTHUMG00000133224	ENST00000392040.1:c.53T>C	2.37:g.231775625A>G	ENSP00000375894:p.Leu18Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N580	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.L18P	ENST00000392040.1	37	c.53	CCDS2480.1	2	.	.	.	.	.	.	.	.	.	.	A	12.42	1.933903	0.34096	.	.	ENSG00000135898	ENST00000392040;ENST00000392039;ENST00000438398	T;T;T	0.37411	1.2;1.2;1.2	4.82	4.82	0.62117	.	0.573739	0.16547	N	0.209653	T	0.34135	0.0887	M	0.64997	1.995	0.41219	D	0.986499	P	0.38167	0.621	B	0.30572	0.117	T	0.37407	-0.9707	10	0.72032	D	0.01	-17.0488	12.4566	0.55708	1.0:0.0:0.0:0.0	.	18	Q9Y2T6	GPR55_HUMAN	P	18	ENSP00000375894:L18P;ENSP00000375893:L18P;ENSP00000412768:L18P	ENSP00000375893:L18P	L	-	2	0	GPR55	231483869	.	.	0.153000	0.22517	0.008000	0.06430	.	.	2.043000	0.60533	0.477000	0.44152	CTG	GPR55	-	NULL	ENSG00000135898		0.532	GPR55-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR55	HGNC	protein_coding	OTTHUMT00000332618.1	89	0.00	0	A	NM_005683		231775625	231775625	-1	no_errors	ENST00000392039	ensembl	human	known	69_37n	missense	63	25.88	22	SNP	0.528	G
KIAA0430	9665	genome.wustl.edu	37	16	15702158	15702158	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr16:15702158T>C	ENST00000396368.3	-	21	4378	c.4172A>G	c.(4171-4173)cAt>cGt	p.H1391R	KIAA0430_ENST00000602337.1_Missense_Mutation_p.H1388R|KIAA0430_ENST00000344181.3_Missense_Mutation_p.H993R|KIAA0430_ENST00000551742.1_Missense_Mutation_p.H1391R|KIAA0430_ENST00000540441.2_Missense_Mutation_p.H1226R|CTB-193M12.1_ENST00000549756.1_RNA|KIAA0430_ENST00000547936.1_5'Flank|KIAA0430_ENST00000548025.1_Missense_Mutation_p.H1388R	NM_001184998.1|NM_001184999.1|NM_014647.3	NP_001171927.1|NP_001171928.1|NP_055462.2	Q9Y4F3	MARF1_HUMAN	KIAA0430	1391	HTH OST-type 6. {ECO:0000255|PROSITE- ProRule:PRU00975}.				double-strand break repair (GO:0006302)|female meiotic division (GO:0007143)|negative regulation of phosphatase activity (GO:0010923)|oogenesis (GO:0048477)|regulation of gene expression (GO:0010468)	membrane (GO:0016020)|peroxisome (GO:0005777)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(4)|endometrium(8)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(5)|skin(1)	40						CTTCACGACATGGCAGAGTTT	0.358																																						dbGAP											0													65.0	58.0	60.0					16																	15702158		1832	4088	5920	-	-	-	SO:0001583	missense	0			AB007890	CCDS10562.2, CCDS53990.1, CCDS55991.1	16p13.11	2013-01-11			ENSG00000166783	ENSG00000166783		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29562	protein-coding gene	gene with protein product	"""limkain b1"", ""protein phosphatase 1, regulatory subunit 34"", ""meiosis arrest female 1"""	614593				9455477, 10493829, 15932519, 22442484, 23090997	Standard	NM_014647		Approved	LKAP, PPP1R34, Marf1	uc010uzw.2	Q9Y4F3	OTTHUMG00000129884	ENST00000396368.3:c.4172A>G	16.37:g.15702158T>C	ENSP00000379654:p.His1391Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSK2|B2RNX2|B4DYY9|B7ZMG1|B7ZMG2|F8VV09|Q6P1R6|Q8WYR2|Q9Y4J9	Missense_Mutation	SNP	pfam_Limkain_b1_cons_dom,pfam_NYN_limkain-b1,smart_RRM_dom,pfscan_RRM_dom	p.H1391R	ENST00000396368.3	37	c.4172	CCDS10562.2	16	.	.	.	.	.	.	.	.	.	.	T	21.1	4.096841	0.76870	.	.	ENSG00000166783	ENST00000396368;ENST00000540441;ENST00000321370;ENST00000344181;ENST00000548025;ENST00000551742;ENST00000551298	T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.54208	0.1844	L	0.29908	0.895	0.80722	D	1	D;D;D;D	0.89917	0.997;1.0;1.0;0.997	D;D;D;D	0.87578	0.993;0.998;0.998;0.996	T	0.56890	-0.7904	10	0.62326	D	0.03	.	16.2688	0.82603	0.0:0.0:0.0:1.0	.	1390;1388;1387;1390	Q9Y4F3-5;F8VV09;Q9Y4F3-4;Q9Y4F3	.;.;.;LKAP_HUMAN	R	1391;1226;1331;993;1388;1391;1171	ENSP00000379654:H1391R;ENSP00000439819:H1226R;ENSP00000341939:H993R;ENSP00000449376:H1388R;ENSP00000450309:H1391R	ENSP00000315718:H1331R	H	-	2	0	KIAA0430	15609659	1.000000	0.71417	1.000000	0.80357	0.803000	0.45373	7.384000	0.79751	2.244000	0.73946	0.533000	0.62120	CAT	KIAA0430	-	NULL	ENSG00000166783		0.358	KIAA0430-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA0430	HGNC	protein_coding	OTTHUMT00000252131.2	62	0.00	0	T	NM_014647		15702158	15702158	-1	no_errors	ENST00000396368	ensembl	human	known	69_37n	missense	52	29.73	22	SNP	1.000	C
LAMC3	10319	genome.wustl.edu	37	9	133917083	133917083	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr9:133917083G>A	ENST00000361069.4	+	7	1476	c.1343G>A	c.(1342-1344)tGc>tAc	p.C448Y	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	448	Laminin EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AGTGGGCGCTGCCCCTGCAAA	0.562																																						dbGAP											0													50.0	45.0	46.0					9																	133917083		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1343G>A	9.37:g.133917083G>A	ENSP00000354360:p.Cys448Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.C448Y	ENST00000361069.4	37	c.1343	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	26.5	4.742337	0.89573	.	.	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	D	0.94330	-3.4	4.97	4.97	0.65823	EGF-like, laminin (4);	0.000000	0.85682	D	0.000000	D	0.98308	0.9439	H	0.99286	4.5	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99844	1.1064	10	0.87932	D	0	.	16.8071	0.85708	0.0:0.0:1.0:0.0	.	448	Q9Y6N6	LAMC3_HUMAN	Y	448	ENSP00000354360:C448Y	ENSP00000325873:C448Y	C	+	2	0	LAMC3	132906904	1.000000	0.71417	0.974000	0.42286	0.972000	0.66771	9.452000	0.97615	2.311000	0.77944	0.462000	0.41574	TGC	LAMC3	-	pfam_EGF_laminin,smart_EGF_laminin,pfscan_EGF_laminin	ENSG00000050555		0.562	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	63	0.00	0	G	NM_006059		133917083	133917083	+1	no_errors	ENST00000361069	ensembl	human	known	69_37n	missense	69	22.47	20	SNP	1.000	A
NUP35	129401	genome.wustl.edu	37	2	184023015	184023015	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr2:184023015C>A	ENST00000295119.4	+	7	717	c.614C>A	c.(613-615)tCt>tAt	p.S205Y	NUP35_ENST00000409798.1_Missense_Mutation_p.S188Y|NUP35_ENST00000541912.1_Missense_Mutation_p.S70Y	NM_138285.3	NP_612142.2	Q8NFH5	NUP53_HUMAN	nucleoporin 35kDa	205	RRM Nup35-type. {ECO:0000255|PROSITE- ProRule:PRU00804}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(2)	8						TTGCAGATGTCTAATACAGGA	0.308																																						dbGAP											0													48.0	48.0	48.0					2																	184023015		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF514993	CCDS2290.1, CCDS74614.1	2q32	2008-02-05			ENSG00000163002	ENSG00000163002			29797	protein-coding gene	gene with protein product		608140					Standard	XM_005246284		Approved	MP44	uc002upf.3	Q8NFH5	OTTHUMG00000132621	ENST00000295119.4:c.614C>A	2.37:g.184023015C>A	ENSP00000295119:p.Ser205Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DP57|B4DYB4|Q4ZFZ9|Q53S95|Q8TDJ1	Missense_Mutation	SNP	pfam_RRM_NUP35_dom,pirsf_Nucleoporin_NUP53	p.S205Y	ENST00000295119.4	37	c.614	CCDS2290.1	2	.	.	.	.	.	.	.	.	.	.	C	29.9	5.042889	0.93685	.	.	ENSG00000163002	ENST00000409798;ENST00000295119;ENST00000541912	.	.	.	5.77	5.77	0.91146	.	0.047551	0.85682	D	0.000000	T	0.60090	0.2242	L	0.39245	1.2	0.80722	D	1	D	0.55385	0.971	P	0.55391	0.775	T	0.51772	-0.8663	9	0.02654	T	1	.	19.3504	0.94381	0.0:1.0:0.0:0.0	.	205	Q8NFH5	NUP53_HUMAN	Y	188;205;70	.	ENSP00000295119:S205Y	S	+	2	0	NUP35	183731260	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.519000	0.81809	2.885000	0.99019	0.655000	0.94253	TCT	NUP35	-	pfam_RRM_NUP35_dom,pirsf_Nucleoporin_NUP53	ENSG00000163002		0.308	NUP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP35	HGNC	protein_coding	OTTHUMT00000255865.1	86	0.00	0	C	NM_138285		184023015	184023015	+1	no_errors	ENST00000295119	ensembl	human	known	69_37n	missense	124	17.33	26	SNP	1.000	A
TENM1	10178	genome.wustl.edu	37	X	123514548	123514548	+	Silent	SNP	C	C	G			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chrX:123514548C>G	ENST00000371130.3	-	31	8079	c.8016G>C	c.(8014-8016)ggG>ggC	p.G2672G	TENM1_ENST00000422452.2_Silent_p.G2679G|STAG2_ENST00000469481.1_Intron	NM_014253.3	NP_055068.2	Q9UKZ4	TEN1_HUMAN	teneurin transmembrane protein 1	2672					immune response (GO:0006955)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuropeptide signaling pathway (GO:0007218)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	heparin binding (GO:0008201)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)										ATGCCCTAATCCCCTCTTCCC	0.512																																						dbGAP											0													170.0	160.0	163.0					X																	123514548		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF100772	CCDS14609.1, CCDS55488.1	Xq25	2012-10-02	2012-10-02	2012-10-02	ENSG00000009694	ENSG00000009694			8117	protein-coding gene	gene with protein product		300588	"""tenascin M"", ""odz, odd Oz/ten-m homolog 1 (Drosophila)"""	ODZ3, TNM, ODZ1		10331952, 10341219	Standard	NM_001163278		Approved	TEN-M1	uc010nqy.3	Q9UKZ4	OTTHUMG00000022721	ENST00000371130.3:c.8016G>C	X.37:g.123514548C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR5|Q5JZ17	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,smart_EGF-like,pfscan_EG-like_dom,tigrfam_YD	p.G2679	ENST00000371130.3	37	c.8037	CCDS14609.1	X																																																																																			ODZ1	-	NULL	ENSG00000009694		0.512	TENM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ODZ1	HGNC	protein_coding	OTTHUMT00000058985.1	264	0.00	0	C	NM_014253		123514548	123514548	-1	no_errors	ENST00000422452	ensembl	human	known	69_37n	silent	305	26.86	112	SNP	0.001	G
PRKX	5613	genome.wustl.edu	37	X	3544506	3544506	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chrX:3544506G>T	ENST00000262848.5	-	5	1123	c.769C>A	c.(769-771)Ctt>Att	p.L257I	PRKX_ENST00000425240.1_5'UTR	NM_005044.4	NP_005035.1	P51817	PRKX_HUMAN	protein kinase, X-linked	257	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|endothelial cell migration (GO:0043542)|endothelial cell proliferation (GO:0001935)|epithelial tube morphogenesis (GO:0060562)|kidney morphogenesis (GO:0060993)|myeloid cell differentiation (GO:0030099)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of epithelial cell differentiation involved in kidney development (GO:2000696)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)			kidney(1)|large_intestine(2)|lung(6)|pancreas(1)|skin(2)	12		all_lung(23;0.000396)|Lung NSC(23;0.00123)				TTGCCTGCAAGAATTTTCTGA	0.348																																						dbGAP											0													117.0	102.0	107.0					X																	3544506		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14125.1	Xp22.3	2008-08-01			ENSG00000183943	ENSG00000183943	2.7.11.1		9441	protein-coding gene	gene with protein product		300083				7633447	Standard	NM_005044		Approved	PKX1	uc010nde.3	P51817	OTTHUMG00000021087	ENST00000262848.5:c.769C>A	X.37:g.3544506G>T	ENSP00000262848:p.Leu257Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L257I	ENST00000262848.5	37	c.769	CCDS14125.1	X	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936098	0.52972	.	.	ENSG00000183943	ENST00000262848	T	0.68765	-0.35	3.47	3.47	0.39725	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	T	0.66327	0.2778	N	0.21545	0.675	0.58432	D	0.999994	D	0.89917	1.0	D	0.91635	0.999	T	0.66732	-0.5849	10	0.56958	D	0.05	-18.0323	6.5063	0.22196	0.1412:0.0:0.8588:0.0	.	257	P51817	PRKX_HUMAN	I	257	ENSP00000262848:L257I	ENSP00000262848:L257I	L	-	1	0	PRKX	3554506	1.000000	0.71417	0.968000	0.41197	0.833000	0.47200	5.288000	0.65651	1.374000	0.46228	0.529000	0.55759	CTT	PRKX	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000183943		0.348	PRKX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKX	HGNC	protein_coding	OTTHUMT00000055659.1	422	0.00	0	G	NM_005044		3544506	3544506	-1	no_errors	ENST00000262848	ensembl	human	known	69_37n	missense	395	28.57	158	SNP	1.000	T
PDZD4	57595	genome.wustl.edu	37	X	153073934	153073934	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chrX:153073934G>C	ENST00000164640.4	-	2	368	c.177C>G	c.(175-177)gaC>gaG	p.D59E	PDZD4_ENST00000544474.1_Intron|PDZD4_ENST00000393758.2_5'UTR|PDZD4_ENST00000475140.1_5'UTR	NM_032512.2	NP_115901.2	Q76G19	PDZD4_HUMAN	PDZ domain containing 4	59						cytoplasm (GO:0005737)				breast(3)|cervix(1)|endometrium(5)|lung(13)|skin(1)	23	all_lung(58;3.39e-06)|all_hematologic(71;4.25e-06)|Lung NSC(58;4.7e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GACAGGAGCTGTCCCCCCGGA	0.657																																						dbGAP											0													45.0	35.0	38.0					X																	153073934		2202	4297	6499	-	-	-	SO:0001583	missense	0			AK091444	CCDS14732.1	Xq28	2008-02-05		2006-01-24	ENSG00000067840	ENSG00000067840			21167	protein-coding gene	gene with protein product		300634		PDZK4		10819331, 15077175	Standard	NM_032512		Approved	KIAA1444, LU1, FLJ34125, PDZRN4L	uc004fiz.1	Q76G19	OTTHUMG00000024209	ENST00000164640.4:c.177C>G	X.37:g.153073934G>C	ENSP00000164640:p.Asp59Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXB1|B7ZKY3|Q8NB75|Q9BUH9|Q9P284	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D59E	ENST00000164640.4	37	c.177	CCDS14732.1	X	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011296	0.35511	.	.	ENSG00000067840	ENST00000164640	T	0.04015	3.73	5.52	1.23	0.21249	.	0.470762	0.20009	U	0.101168	T	0.01765	0.0056	N	0.03608	-0.345	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.002;0.001	T	0.50816	-0.8783	10	0.30854	T	0.27	-44.659	1.2866	0.02052	0.3653:0.1381:0.3532:0.1434	.	59;59	Q17RL8;Q76G19	.;PDZD4_HUMAN	E	59	ENSP00000164640:D59E	ENSP00000164640:D59E	D	-	3	2	PDZD4	152727128	0.000000	0.05858	0.996000	0.52242	0.882000	0.50991	0.513000	0.22770	0.441000	0.26529	0.596000	0.82720	GAC	PDZD4	-	NULL	ENSG00000067840		0.657	PDZD4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PDZD4	HGNC	protein_coding	OTTHUMT00000061013.3	29	0.00	0	G	NM_032512		153073934	153073934	-1	no_errors	ENST00000164640	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.981	C
RALBP1	10928	genome.wustl.edu	37	18	9524597	9524597	+	Silent	SNP	C	C	T			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr18:9524597C>T	ENST00000019317.4	+	5	1282	c.1059C>T	c.(1057-1059)agC>agT	p.S353S	RALBP1_ENST00000383432.3_Silent_p.S353S			Q15311	RBP1_HUMAN	ralA binding protein 1	353	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				ATP catabolic process (GO:0006200)|chemotaxis (GO:0006935)|positive regulation of Cdc42 GTPase activity (GO:0043089)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|transport (GO:0006810)	cytosol (GO:0005829)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ATPase activity, coupled to movement of substances (GO:0043492)|GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(3)|upper_aerodigestive_tract(1)	14					Carbamazepine(DB00564)|Doxorubicin(DB00997)|Sorafenib(DB00398)|Vincristine(DB00541)	CTTAGATCAGCAATCGAGTCC	0.343																																						dbGAP											0													53.0	49.0	51.0					18																	9524597		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L42542	CCDS11845.1	18p11.22	2006-04-22			ENSG00000017797	ENSG00000017797			9841	protein-coding gene	gene with protein product		605801				7673236	Standard	NM_006788		Approved	RLIP76, RIP1, RIP	uc002koc.3	Q15311	OTTHUMG00000131596	ENST00000019317.4:c.1059C>T	18.37:g.9524597C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUI0	Silent	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.S353	ENST00000019317.4	37	c.1059	CCDS11845.1	18																																																																																			RALBP1	-	superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000017797		0.343	RALBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALBP1	HGNC	protein_coding	OTTHUMT00000254479.1	114	0.00	0	C	NM_006788		9524597	9524597	+1	no_errors	ENST00000019317	ensembl	human	known	69_37n	silent	83	36.64	48	SNP	1.000	T
RAPGEF4-AS1	91149	genome.wustl.edu	37	2	173591198	173591198	+	RNA	SNP	A	A	G	rs11884105	byFrequency	TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr2:173591198A>G	ENST00000455435.1	-	0	65				RAPGEF4-AS1_ENST00000435328.1_RNA					RAPGEF4 antisense RNA 1																		gtatcctccaatctcctgttt	0.557													A|||	1556	0.310703	0.3638	0.2205	5008	,	,		20469	0.5377		0.1312	False		,,,				2504	0.2536					dbGAP											0																																										-	-	-			0			AL157450		2q31.1	2012-10-12	2012-08-15		ENSG00000228016	ENSG00000228016		"""Long non-coding RNAs"""	28081	non-coding RNA	RNA, long non-coding			"""RAPGEF4 antisense RNA 1 (non-protein coding)"""				Standard	NR_026995		Approved		uc002uht.3		OTTHUMG00000154091		2.37:g.173591198A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000455435.1	37	NULL		2																																																																																			RAPGEF4-AS1	-	-	ENSG00000228016		0.557	RAPGEF4-AS1-001	KNOWN	basic|exp_conf	antisense	RAPGEF4-AS1	HGNC	antisense	OTTHUMT00000333855.1	9	0.00	0	A	NR_026995		173591198	173591198	-1	no_errors	ENST00000435328	ensembl	human	known	69_37n	rna	1	87.50	7	SNP	0.000	G
SF3B1	23451	genome.wustl.edu	37	2	198266834	198266834	+	Missense_Mutation	SNP	T	T	C	rs559063155		TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr2:198266834T>C	ENST00000335508.6	-	15	2189	c.2098A>G	c.(2098-2100)Aaa>Gaa	p.K700E	SNORA4_ENST00000365564.1_RNA|SF3B1_ENST00000462613.1_5'UTR	NM_012433.2	NP_036565.2	O75533	SF3B1_HUMAN	splicing factor 3b, subunit 1, 155kDa	700					anterior/posterior pattern specification (GO:0009952)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)	p.K700E(179)|p.Q699_K700del(2)		NS(35)|breast(10)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(524)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|pancreas(4)|prostate(6)|salivary_gland(1)|skin(4)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	633			OV - Ovarian serous cystadenocarcinoma(117;0.246)			GTCCGAACTTTCTGCTGCTCA	0.408			Mis		myelodysplastic syndrome								T|||	1	0.000199681	0.0	0.0	5008	,	,		17946	0.0		0.0	False		,,,				2504	0.001					dbGAP		Dom	yes		2	2q33.1	23451	"""splicing factor 3b, subunit 1, 155kDa"""		L	181	Substitution - Missense(179)|Deletion - In frame(2)	haematopoietic_and_lymphoid_tissue(153)|NS(20)|breast(5)|pancreas(2)|central_nervous_system(1)																																								-	-	-	SO:0001583	missense	0			AF054284	CCDS33356.1, CCDS46479.1	2q33.1	2014-09-17	2002-08-29		ENSG00000115524	ENSG00000115524			10768	protein-coding gene	gene with protein product		605590	"""splicing factor 3b, subunit 1, 155kD"""			9585501	Standard	XM_005246428		Approved	SAP155, SF3b155, PRPF10, Prp10, Hsh155	uc002uue.3	O75533	OTTHUMG00000154447	ENST00000335508.6:c.2098A>G	2.37:g.198266834T>C	ENSP00000335321:p.Lys700Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PCH3	Missense_Mutation	SNP	pfam_SF3b_su1,superfamily_ARM-type_fold	p.K700E	ENST00000335508.6	37	c.2098	CCDS33356.1	2	.	.	.	.	.	.	.	.	.	.	T	33	5.243295	0.95272	.	.	ENSG00000115524	ENST00000335508	T	0.63580	-0.05	6.02	6.02	0.97574	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	D	0.85609	0.5736	H	0.95504	3.68	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89820	0.3988	10	0.87932	D	0	.	16.542	0.84395	0.0:0.0:0.0:1.0	.	700	O75533	SF3B1_HUMAN	E	700	ENSP00000335321:K700E	ENSP00000335321:K700E	K	-	1	0	SF3B1	197975079	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.555000	0.82223	2.304000	0.77564	0.528000	0.53228	AAA	SF3B1	-	superfamily_ARM-type_fold	ENSG00000115524		0.408	SF3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B1	HGNC	protein_coding	OTTHUMT00000335245.2	91	0.00	0	T			198266834	198266834	-1	no_errors	ENST00000335508	ensembl	human	known	69_37n	missense	88	23.48	27	SNP	1.000	C
SIK3	23387	genome.wustl.edu	37	11	116766967	116766967	+	Splice_Site	SNP	A	A	G			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr11:116766967A>G	ENST00000292055.4	-	6	727		c.e6+1		SIK3_ENST00000375288.1_Splice_Site|SIK3_ENST00000375300.1_Splice_Site|SIK3_ENST00000446921.2_Splice_Site|SIK3_ENST00000434315.2_Splice_Site|SIK3_ENST00000542607.1_Splice_Site	NM_025164.3	NP_079440.3	Q9Y2K2	SIK3_HUMAN	SIK family kinase 3						protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(18)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	57						CGACTCCCTTACCTGTGGACA	0.493																																						dbGAP											0													140.0	138.0	138.0					11																	116766967		2201	4296	6497	-	-	-	SO:0001630	splice_region_variant	0			AB023216	CCDS8379.1, CCDS60974.1, CCDS8379.2	11q23.3	2010-02-17			ENSG00000160584	ENSG00000160584			29165	protein-coding gene	gene with protein product		614776				10231032, 8889548	Standard	NM_025164		Approved	FLJ12240, L19, KIAA0999, QSK	uc001ppy.3	Q9Y2K2	OTTHUMG00000066628	ENST00000292055.4:c.691+1T>C	11.37:g.116766967A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5A8|Q59FY2|Q5M9N1|Q6P3R6|Q8IYM8|Q9HA50	Splice_Site	SNP	-	e6+2	ENST00000292055.4	37	c.865+2	CCDS8379.1	11	.	.	.	.	.	.	.	.	.	.	A	20.9	4.066706	0.76301	.	.	ENSG00000160584	ENST00000445177;ENST00000375300;ENST00000292055;ENST00000542607;ENST00000434315;ENST00000446921;ENST00000413553	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.5398	0.67984	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SIK3	116272177	1.000000	0.71417	1.000000	0.80357	0.776000	0.43924	8.806000	0.91930	2.085000	0.62840	0.460000	0.39030	.	SIK3	-	-	ENSG00000160584		0.493	SIK3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	SIK3	HGNC	protein_coding		98	0	0	A	NM_025164	Intron	116766967	116766967	-1	no_errors	ENST00000375300	ensembl	human	known	69_37n	splice_site	69	31.37	32	SNP	1.000	G
TARSL2	123283	genome.wustl.edu	37	15	102263346	102263346	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr15:102263346C>T	ENST00000335968.3	-	2	535	c.319G>A	c.(319-321)Gac>Aac	p.D107N		NM_152334.2	NP_689547.2	A2RTX5	SYTC2_HUMAN	threonyl-tRNA synthetase-like 2	107					threonyl-tRNA aminoacylation (GO:0006435)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|threonine-tRNA ligase activity (GO:0004829)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(14)|ovary(2)|skin(1)|urinary_tract(1)	29	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000268)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			ATGTCCTTGTCTTGGCTTTGA	0.373																																						dbGAP											0													128.0	111.0	117.0					15																	102263346		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833188	CCDS10394.1	15q26.3	2008-02-05			ENSG00000185418	ENSG00000185418			24728	protein-coding gene	gene with protein product							Standard	NM_152334		Approved	FLJ25005	uc002bxm.3	A2RTX5	OTTHUMG00000149869	ENST00000335968.3:c.319G>A	15.37:g.102263346C>T	ENSP00000338093:p.Asp107Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMP7|Q6B0A1|Q6IS76|Q96LW3|Q96MP4	Missense_Mutation	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_TGS,pfam_tRNA_SAD,superfamily_Thr/Ala-tRNA-synth_IIc_edit,superfamily_Anticodon-bd,superfamily_TGS-like,smart_tRNA_SAD,prints_Thr-tRNA-synth_IIa,pfscan_aa-tRNA-synth_II,tigrfam_Thr-tRNA-synth_IIa	p.D107N	ENST00000335968.3	37	c.319	CCDS10394.1	15	.	.	.	.	.	.	.	.	.	.	.	8.801	0.932797	0.18131	.	.	ENSG00000185418	ENST00000335968;ENST00000333018;ENST00000539112	.	.	.	3.1	3.1	0.35709	.	7.879050	0.00166	N	0.000001	T	0.29256	0.0728	N	0.08118	0	0.23889	N	0.996555	B	0.16166	0.016	B	0.16289	0.015	T	0.18745	-1.0327	9	0.62326	D	0.03	-2.7256	9.9435	0.41593	0.0:1.0:0.0:0.0	.	107	A2RTX5	SYTC2_HUMAN	N	107	.	ENSP00000329291:D107N	D	-	1	0	TARSL2	100080869	0.986000	0.35501	0.518000	0.27811	0.030000	0.12068	2.725000	0.47294	2.048000	0.60808	0.585000	0.79938	GAC	TARSL2	-	NULL	ENSG00000185418		0.373	TARSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TARSL2	HGNC	protein_coding	OTTHUMT00000313619.3	330	0.30	1	C	NM_152334		102263346	102263346	-1	no_errors	ENST00000335968	ensembl	human	known	69_37n	missense	329	26.07	116	SNP	0.618	T
TNFRSF9	3604	genome.wustl.edu	37	1	7980932	7980932	+	Missense_Mutation	SNP	C	C	T	rs554909019	byFrequency	TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr1:7980932C>T	ENST00000377507.3	-	8	897	c.731G>A	c.(730-732)cGa>cAa	p.R244Q		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	244	Interaction with LRR-1.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		TTCTGGAAATCGGCAGCTACA	0.368													C|||	3	0.000599042	0.0	0.0	5008	,	,		17413	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													132.0	138.0	136.0					1																	7980932		2203	4300	6503	-	-	-	SO:0001583	missense	0			L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.731G>A	1.37:g.7980932C>T	ENSP00000366729:p.Arg244Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_9,pfscan_TNFR/NGFR_Cys_rich_reg	p.R244Q	ENST00000377507.3	37	c.731	CCDS92.1	1	.	.	.	.	.	.	.	.	.	.	C	15.73	2.919878	0.52653	.	.	ENSG00000049249	ENST00000377507	T	0.70045	-0.45	6.17	5.23	0.72850	.	0.338095	0.21815	N	0.068713	T	0.56046	0.1959	M	0.70275	2.135	0.32289	N	0.566502	P	0.43885	0.82	B	0.26864	0.074	T	0.66976	-0.5787	10	0.29301	T	0.29	-7.8632	10.1445	0.42755	0.0:0.9037:0.0:0.0963	.	244	Q07011	TNR9_HUMAN	Q	244	ENSP00000366729:R244Q	ENSP00000366729:R244Q	R	-	2	0	TNFRSF9	7903519	0.953000	0.32496	0.895000	0.35142	0.669000	0.39330	2.377000	0.44300	1.543000	0.49345	0.655000	0.94253	CGA	TNFRSF9	-	prints_TNFR_9	ENSG00000049249		0.368	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF9	HGNC	protein_coding	OTTHUMT00000003622.1	160	0.00	0	C			7980932	7980932	-1	no_errors	ENST00000377507	ensembl	human	known	69_37n	missense	185	24.49	60	SNP	0.858	T
XDH	7498	genome.wustl.edu	37	2	31588379	31588379	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A201-01A-11D-A14K-09	TCGA-BH-A201-10A-01D-A14K-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	df6e619f-67a5-49f3-9768-4826aa2c9d1b	ec9e0f5b-4363-422c-bdbd-c6eb48504a93	g.chr2:31588379G>A	ENST00000379416.3	-	23	2536	c.2488C>T	c.(2488-2490)Cgt>Tgt	p.R830C		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	830					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	TCCTCATCACGGTCCAGCATG	0.572																																					Colon(66;682 1445 30109 40147)	dbGAP											0													145.0	122.0	130.0					2																	31588379		2203	4300	6503	-	-	-	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.2488C>T	2.37:g.31588379G>A	ENSP00000368727:p.Arg830Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.R830C	ENST00000379416.3	37	c.2488	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	G	24.0	4.477527	0.84640	.	.	ENSG00000158125	ENST00000379416	T	0.64438	-0.1	6.17	5.28	0.74379	Aldehyde oxidase/xanthine dehydrogenase, molybdopterin binding (3);	0.000000	0.85682	D	0.000000	D	0.87172	0.6111	H	0.97783	4.075	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92229	0.5791	10	0.87932	D	0	.	16.4986	0.84252	0.0:0.0:0.868:0.132	.	830	P47989	XDH_HUMAN	C	830	ENSP00000368727:R830C	ENSP00000368727:R830C	R	-	1	0	XDH	31441883	1.000000	0.71417	0.998000	0.56505	0.915000	0.54546	6.325000	0.72901	1.575000	0.49775	0.655000	0.94253	CGT	XDH	-	pfam_AldOxase/xan_DH_Mopterin-bd,superfamily_AldOxase/xan_DH_Mopterin-bd,pirsf_Ald_Oxase/xanthine_DH	ENSG00000158125		0.572	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	115	0.00	0	G	NM_000379		31588379	31588379	-1	no_errors	ENST00000379416	ensembl	human	known	69_37n	missense	96	24.41	31	SNP	1.000	A
