#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB7	22	genome.wustl.edu	37	X	74273323	74273323	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chrX:74273323T>C	ENST00000373394.3	-	16	2148	c.2141A>G	c.(2140-2142)aAc>aGc	p.N714S	ABCB7_ENST00000339447.4_Missense_Mutation_p.N674S|ABCB7_ENST00000253577.3_Missense_Mutation_p.N715S			O75027	ABCB7_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 7	714					cellular iron ion homeostasis (GO:0006879)|heme transport (GO:0015886)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|heme transporter activity (GO:0015232)			breast(1)|endometrium(5)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)	20						GTTATCATGGTTCTGCACACG	0.423																																						dbGAP											0													115.0	94.0	101.0					X																	74273323		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038950	CCDS14428.1, CCDS65290.1, CCDS65291.1, CCDS75994.1	Xq13.3	2012-03-14			ENSG00000131269	ENSG00000131269		"""ATP binding cassette transporters / subfamily B"""	48	protein-coding gene	gene with protein product		300135		ABC7		9143506	Standard	NM_004299		Approved	EST140535, Atm1p, ASAT	uc004ebz.4	O75027	OTTHUMG00000021862	ENST00000373394.3:c.2141A>G	X.37:g.74273323T>C	ENSP00000362492:p.Asn714Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	G3XAC4|O75345|Q5VWY7|Q5VWY8|Q9BRE1|Q9UND1|Q9UP01	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.N715S	ENST00000373394.3	37	c.2144		X	.	.	.	.	.	.	.	.	.	.	T	9.592	1.126392	0.20959	.	.	ENSG00000131269	ENST00000535115;ENST00000253577;ENST00000339447;ENST00000373394;ENST00000529949	D;D;D;D	0.87809	-2.3;-2.26;-2.3;-2.28	5.76	3.4	0.38934	.	0.703054	0.15254	N	0.272153	T	0.66954	0.2842	N	0.03608	-0.345	0.38582	D	0.950205	B;B;B;B;B	0.13145	0.001;0.007;0.001;0.001;0.007	B;B;B;B;B	0.09377	0.004;0.003;0.001;0.004;0.003	T	0.56992	-0.7887	10	0.09590	T	0.72	-13.4659	6.8391	0.23953	0.0:0.2613:0.0:0.7387	.	688;674;715;714;715	G3V1J3;G3XAC4;B3KM98;O75027;O75027-2	.;.;.;ABCB7_HUMAN;.	S	688;715;674;714;688	ENSP00000253577:N715S;ENSP00000343849:N674S;ENSP00000362492:N714S;ENSP00000436586:N688S	ENSP00000253577:N715S	N	-	2	0	ABCB7	74190048	1.000000	0.71417	0.993000	0.49108	0.956000	0.61745	1.939000	0.40213	0.808000	0.34231	0.486000	0.48141	AAC	ABCB7	-	NULL	ENSG00000131269		0.423	ABCB7-002	KNOWN	basic|appris_candidate	protein_coding	ABCB7	HGNC	protein_coding	OTTHUMT00000057274.1	148	0.00	0	T	NM_004299		74273323	74273323	-1	no_errors	ENST00000253577	ensembl	human	known	69_37n	missense	119	33.89	61	SNP	1.000	C
ADH1C	126	genome.wustl.edu	37	4	100261755	100261755	+	RNA	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr4:100261755G>A	ENST00000510055.1	-	0	872				ADH1C_ENST00000515683.1_RNA			P00326	ADH1G_HUMAN	alcohol dehydrogenase 1C (class I), gamma polypeptide						ethanol oxidation (GO:0006069)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	alcohol dehydrogenase (NAD) activity (GO:0004022)|zinc ion binding (GO:0008270)								OV - Ovarian serous cystadenocarcinoma(123;1.08e-07)	Ethanol(DB00898)|Fomepizole(DB01213)	TCCTTTCCACGTGCGTCCAGT	0.433																																						dbGAP											0													214.0	214.0	214.0					4																	100261755		2203	4300	6503	-	-	-			0			M12272		4q23	2010-03-16			ENSG00000248144	ENSG00000248144	1.1.1.1	"""Alcohol dehydrogenases"""	251	protein-coding gene	gene with protein product		103730		ADH3		3006456	Standard	NM_000669		Approved		uc031sgp.1	P00326	OTTHUMG00000161422		4.37:g.100261755G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4PJ18|Q5WRV0|Q6LBW4|Q6NWV0|Q6NZA7	Missense_Mutation	SNP	NULL	p.T314M	ENST00000510055.1	37	c.941		4																																																																																			ADH1C	-	NULL	ENSG00000248144		0.433	ADH1C-004	KNOWN	mRNA_end_NF|basic	processed_transcript	ADH1C	HGNC	polymorphic_pseudogene	OTTHUMT00000365189.2	109	0.91	1	G	NM_000669		100261755	100261755	-1	pseudogene	ENST00000515683	ensembl	human	known	69_37n	missense	91	38.93	58	SNP	0.929	A
AIDA	64853	genome.wustl.edu	37	1	222849466	222849466	+	Silent	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr1:222849466G>A	ENST00000340020.6	-	7	761	c.555C>T	c.(553-555)atC>atT	p.I185I	AIDA_ENST00000474863.1_5'UTR|AIDA_ENST00000355727.2_Intron|AIDA_ENST00000541237.1_Silent_p.I161I	NM_022831.2	NP_073742.2	Q96BJ3	AIDA_HUMAN	axin interactor, dorsalization associated	185	Axin-binding. {ECO:0000250}.				dorsal/ventral pattern formation (GO:0009953)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|regulation of protein homodimerization activity (GO:0043496)	cytoplasm (GO:0005737)				kidney(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	10						TATAGGGATCGATGCACTGCC	0.373																																						dbGAP											0													100.0	97.0	98.0					1																	222849466		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC043142	CCDS1533.1	1q41	2008-05-22	2008-05-22	2008-05-22	ENSG00000186063	ENSG00000186063			25761	protein-coding gene	gene with protein product	"""axin interaction partner and dorsalization antagonist"""	612375	"""chromosome 1 open reading frame 80"""	C1orf80		8619474, 9110174, 17681137	Standard	NM_022831		Approved	FLJ12806	uc001hnn.3	Q96BJ3	OTTHUMG00000037653	ENST00000340020.6:c.555C>T	1.37:g.222849466G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F0|Q49A81|Q5JRA4|Q658P1|Q9H9E8	Silent	SNP	pfam_AIDA,superfamily_AIDA_N	p.I185	ENST00000340020.6	37	c.555	CCDS1533.1	1																																																																																			AIDA	-	pfam_AIDA	ENSG00000186063		0.373	AIDA-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AIDA	HGNC	protein_coding	OTTHUMT00000091818.1	107	0.00	0	G	NM_022831		222849466	222849466	-1	no_errors	ENST00000340020	ensembl	human	known	69_37n	silent	64	48.80	61	SNP	0.933	A
AKAP1	8165	genome.wustl.edu	37	17	55197673	55197673	+	Silent	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr17:55197673C>T	ENST00000337714.3	+	11	2933	c.2700C>T	c.(2698-2700)taC>taT	p.Y900Y	AKAP1_ENST00000571629.1_Silent_p.Y900Y|AKAP1_ENST00000572557.1_Silent_p.Y900Y|AKAP1_ENST00000539273.1_Silent_p.Y900Y	NM_003488.3	NP_003479.1	Q92667	AKAP1_HUMAN	A kinase (PRKA) anchor protein 1	900					blood coagulation (GO:0007596)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(2)|liver(1)|lung(7)|ovary(2)|pancreas(1)|skin(1)	14	Breast(9;5.46e-08)					ACAGCTACTACACAAGCCTTT	0.478																																						dbGAP											0													142.0	122.0	129.0					17																	55197673		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X97335	CCDS11594.1	17q22	2013-01-23			ENSG00000121057	ENSG00000121057		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Tudor domain containing"""	367	protein-coding gene	gene with protein product	"""protein kinase anchoring protein 1"", ""dual specificity A-kinase-anchoring protein 1"", ""protein phosphatase 1, regulatory subunit 43"", ""tudor domain containing 17"""	602449		PRKA1		8769136, 7499250	Standard	NM_003488		Approved	AKAP121, AKAP149, SAKAP84, S-AKAP84, AKAP84, D-AKAP1, PPP1R43, TDRD17	uc002iux.3	Q92667	OTTHUMG00000140369	ENST00000337714.3:c.2700C>T	17.37:g.55197673C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q1|D3DTZ0|Q13320|Q9BW14	Silent	SNP	pfam_Tudor,pfam_KH_dom_type_1,smart_KH_dom,smart_Tudor,pfscan_Tudor,pfscan_KH_dom_type_1	p.Y900	ENST00000337714.3	37	c.2700	CCDS11594.1	17																																																																																			AKAP1	-	NULL	ENSG00000121057		0.478	AKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP1	HGNC	protein_coding	OTTHUMT00000277069.1	93	0.00	0	C			55197673	55197673	+1	no_errors	ENST00000337714	ensembl	human	known	69_37n	silent	50	39.02	32	SNP	0.003	T
ARAF	369	genome.wustl.edu	37	X	47429359	47429359	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chrX:47429359G>A	ENST00000377045.4	+	14	1681	c.1487G>A	c.(1486-1488)gGg>gAg	p.G496E		NM_001256196.1|NM_001654.4	NP_001243125.1|NP_001645.1	P10398	ARAF_HUMAN	A-Raf proto-oncogene, serine/threonine kinase	496	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cellular protein modification process (GO:0006464)|negative regulation of apoptotic process (GO:0043066)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032434)|regulation of TOR signaling (GO:0032006)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			biliary_tract(1)|endometrium(4)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|skin(1)|urinary_tract(1)	29					Adenosine triphosphate(DB00171)	TATGCCTACGGGGTTGTGCTC	0.602																																						dbGAP											0													93.0	54.0	67.0					X																	47429359		2203	4299	6502	-	-	-	SO:0001583	missense	0			X04790	CCDS35232.1, CCDS59164.1, CCDS75970.1	Xp11.3-p11.23	2014-06-26	2014-06-26	2005-01-19	ENSG00000078061	ENSG00000078061			646	protein-coding gene	gene with protein product		311010	"""v-raf murine sarcoma 3611 viral oncogene homolog 1"""	ARAF1			Standard	NM_001654		Approved		uc004dic.2	P10398	OTTHUMG00000021446	ENST00000377045.4:c.1487G>A	X.37:g.47429359G>A	ENSP00000366244:p.Gly496Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	P07557|Q5H9B2|Q5H9B3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.G496E	ENST00000377045.4	37	c.1487	CCDS35232.1	X	.	.	.	.	.	.	.	.	.	.	G	29.0	4.972877	0.92919	.	.	ENSG00000078061	ENST00000377045	D	0.87809	-2.3	5.43	5.43	0.79202	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96393	0.8823	H	0.99042	4.41	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98041	1.0382	10	0.87932	D	0	.	15.8053	0.78501	0.0:0.0:1.0:0.0	.	496	P10398	ARAF_HUMAN	E	496	ENSP00000366244:G496E	ENSP00000366244:G496E	G	+	2	0	ARAF	47314303	1.000000	0.71417	0.954000	0.39281	0.985000	0.73830	9.447000	0.97595	2.419000	0.82065	0.513000	0.50165	GGG	ARAF	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000078061		0.602	ARAF-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	ARAF	HGNC	protein_coding	OTTHUMT00000056418.1	37	0.00	0	G			47429359	47429359	+1	no_errors	ENST00000377045	ensembl	human	known	69_37n	missense	27	44.90	22	SNP	1.000	A
CAND2	23066	genome.wustl.edu	37	3	12856688	12856688	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr3:12856688G>A	ENST00000456430.2	+	8	1096	c.1055G>A	c.(1054-1056)cGc>cAc	p.R352H	CAND2_ENST00000295989.5_Missense_Mutation_p.R259H	NM_001162499.1	NP_001155971.1	O75155	CAND2_HUMAN	cullin-associated and neddylation-dissociated 2 (putative)	352					positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	intracellular (GO:0005622)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(8)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TGGAAGGTGCGCCGGGCAGCT	0.612																																					GBM(43;676 868 1633 6395 37496)	dbGAP											0													57.0	64.0	62.0					3																	12856688		2148	4255	6403	-	-	-	SO:0001583	missense	0				CCDS43053.1, CCDS54554.1	3p25.2	2008-02-05			ENSG00000144712	ENSG00000144712			30689	protein-coding gene	gene with protein product	"""TBP interacting protein"""	610403				9734811, 10441524	Standard	NM_012298		Approved	TIP120B, KIAA0667, Tp120b	uc003bxk.2	O75155	OTTHUMG00000155397	ENST00000456430.2:c.1055G>A	3.37:g.12856688G>A	ENSP00000387641:p.Arg352His	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGM9|E9KL24	Missense_Mutation	SNP	pfam_TATA-bd_TIP120,pfam_HEAT,superfamily_ARM-type_fold	p.R352H	ENST00000456430.2	37	c.1055	CCDS54554.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.204368	0.95033	.	.	ENSG00000144712	ENST00000295989;ENST00000456430	T;T	0.76060	-0.99;-0.99	4.86	4.86	0.63082	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	D	0.90356	0.6982	H	0.95884	3.735	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.989	D	0.93422	0.6778	10	0.87932	D	0	-28.0645	15.4782	0.75501	0.0:0.0:1.0:0.0	.	352;259	O75155;O75155-2	CAND2_HUMAN;.	H	259;352	ENSP00000295989:R259H;ENSP00000387641:R352H	ENSP00000295989:R259H	R	+	2	0	CAND2	12831688	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.744000	0.98853	2.231000	0.72958	0.561000	0.74099	CGC	CAND2	-	superfamily_ARM-type_fold	ENSG00000144712		0.612	CAND2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CAND2	HGNC	protein_coding	OTTHUMT00000339856.4	13	0.00	0	G	XM_371617		12856688	12856688	+1	no_errors	ENST00000456430	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	1.000	A
CCNA2	890	genome.wustl.edu	37	4	122743762	122743762	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr4:122743762C>A	ENST00000274026.5	-	2	556	c.253G>T	c.(253-255)Gtc>Ttc	p.V85F		NM_001237.3	NP_001228	P20248	CCNA2_HUMAN	cyclin A2	85					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic G2 DNA damage checkpoint (GO:0007095)|mitotic nuclear division (GO:0007067)|organ regeneration (GO:0031100)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of transcription, DNA-templated (GO:0045893)|Ras protein signal transduction (GO:0007265)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|response to estradiol (GO:0032355)|response to glucagon (GO:0033762)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	12						GGAACGGTGACATGCTCATCA	0.418																																						dbGAP											0													108.0	104.0	105.0					4																	122743762		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3723.1	4q27	2012-07-12			ENSG00000145386	ENSG00000145386			1578	protein-coding gene	gene with protein product		123835		CCNA, CCN1		1675006	Standard	NM_001237		Approved		uc003iec.4	P20248	OTTHUMG00000133072	ENST00000274026.5:c.253G>T	4.37:g.122743762C>A	ENSP00000274026:p.Val85Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B6|Q2M3U6|Q4W5P4|Q6LER8	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like,pirsf_Cyclin_A/B/D/E	p.V85F	ENST00000274026.5	37	c.253	CCDS3723.1	4	.	.	.	.	.	.	.	.	.	.	C	8.987	0.976710	0.18812	.	.	ENSG00000145386	ENST00000274026	T	0.14766	2.48	5.74	4.87	0.63330	.	1.882720	0.02064	N	0.051036	T	0.13586	0.0329	L	0.28274	0.84	0.09310	N	1	B	0.24426	0.103	B	0.20955	0.032	T	0.40590	-0.9555	10	0.09084	T	0.74	.	15.7957	0.78409	0.0:0.8641:0.1359:0.0	.	85	P20248	CCNA2_HUMAN	F	85	ENSP00000274026:V85F	ENSP00000274026:V85F	V	-	1	0	CCNA2	122963212	0.003000	0.15002	0.020000	0.16555	0.954000	0.61252	1.827000	0.39102	2.715000	0.92844	0.655000	0.94253	GTC	CCNA2	-	pirsf_Cyclin_A/B/D/E	ENSG00000145386		0.418	CCNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNA2	HGNC	protein_coding	OTTHUMT00000256712.2	63	0.00	0	C	NM_001237		122743762	122743762	-1	no_errors	ENST00000274026	ensembl	human	known	69_37n	missense	57	39.36	37	SNP	0.078	A
CD46	4179	genome.wustl.edu	37	1	207930364	207930364	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr1:207930364T>G	ENST00000358170.2	+	2	259	c.103T>G	c.(103-105)Tgt>Ggt	p.C35G	CD46_ENST00000367042.1_Missense_Mutation_p.C35G|CD46_ENST00000360212.2_Missense_Mutation_p.C35G|CD46_ENST00000354848.1_Missense_Mutation_p.C35G|CD46_ENST00000357714.1_Missense_Mutation_p.C35G|CD46_ENST00000480003.1_Missense_Mutation_p.C35G|CD46_ENST00000441839.2_Missense_Mutation_p.C35G|CD46_ENST00000322918.5_Missense_Mutation_p.C35G|CD46_ENST00000322875.4_Missense_Mutation_p.C35G|CD46_ENST00000469535.1_3'UTR|CD46_ENST00000367047.1_Intron|CD46_ENST00000361067.1_Missense_Mutation_p.C35G|CD46_ENST00000367041.1_Missense_Mutation_p.C35G	NM_002389.4	NP_002380.3	P15529	MCP_HUMAN	CD46 molecule, complement regulatory protein	35	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.		C -> Y (in AHUS2). {ECO:0000269|PubMed:16621965}.		adaptive immune response (GO:0002250)|complement activation, classical pathway (GO:0006958)|innate immune response (GO:0045087)|interleukin-10 production (GO:0032613)|negative regulation of complement activation (GO:0045916)|negative regulation of gene expression (GO:0010629)|positive regulation of gene expression (GO:0010628)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transforming growth factor beta production (GO:0071636)|proteolysis (GO:0006508)|regulation of complement activation (GO:0030449)|regulation of Notch signaling pathway (GO:0008593)|sequestering of extracellular ligand from receptor (GO:0035581)|single fertilization (GO:0007338)|T cell mediated immunity (GO:0002456)|viral process (GO:0016032)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|inner acrosomal membrane (GO:0002079)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cadherin binding (GO:0045296)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(6)|prostate(1)|skin(1)	19						CCTAGATGCCTGTGAGGAGCC	0.408																																						dbGAP											0													67.0	66.0	66.0					1																	207930364		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC030594	CCDS1479.1, CCDS1480.1, CCDS1481.1, CCDS1482.1, CCDS1484.1, CCDS1485.1, CCDS31008.1, CCDS31009.1	1q32	2014-09-17	2006-03-28	2006-02-09	ENSG00000117335	ENSG00000117335		"""CD molecules"", ""Complement system"""	6953	protein-coding gene	gene with protein product		120920	"""antigen identified by monoclonal antibody TRA-2-10"", ""membrane cofactor protein (CD46, trophoblast-lymphocyte cross-reactive antigen)"", ""CD46 antigen, complement regulatory protein"""	MIC10, MCP		7929741	Standard	NM_002389		Approved	TRA2.10, MGC26544, TLX	uc001hgj.3	P15529	OTTHUMG00000036397	ENST00000358170.2:c.103T>G	1.37:g.207930364T>G	ENSP00000350893:p.Cys35Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A0T1T0|A0T1T1|A0T1T2|Q15429|Q53GV9|Q5HY94|Q5VWS6|Q5VWS7|Q5VWS8|Q5VWS9|Q5VWT0|Q5VWT1|Q5VWT2|Q6N0A1|Q7Z3R5|Q9NNW2|Q9NNW3|Q9NNW4|Q9UCJ4	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pirsf_M_CF_CD46,pfscan_Sushi_SCR_CCP	p.C35G	ENST00000358170.2	37	c.103	CCDS1485.1	1	.	.	.	.	.	.	.	.	.	.	T	16.41	3.116381	0.56505	.	.	ENSG00000117335	ENST00000358170;ENST00000354848;ENST00000322918;ENST00000367042;ENST00000367041;ENST00000357714;ENST00000322875;ENST00000441839;ENST00000361067;ENST00000360212;ENST00000480003	D;D;D;D;D;D;D;D;D;D;D	0.99778	-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73;-6.73	3.72	3.72	0.42706	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.49916	D	0.000127	D	0.99661	0.9874	M	0.82193	2.58	0.51767	D	0.999932	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;0.96;0.96;1.0;1.0;1.0;1.0;1.0;0.96;1.0;0.987	D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.998;0.999;1.0;0.943;0.962;1.0;0.999;1.0;0.996;1.0;0.962;0.998;0.985	D	0.97878	1.0290	10	0.87932	D	0	.	9.08	0.36545	0.0:0.0:0.0:1.0	.	35;35;35;35;35;35;35;35;35;35;35;35;35;35	P15529-4;P15529-5;P15529-14;P15529-3;P15529-12;P15529-13;P15529-2;P15529-11;P15529-7;P15529-9;P15529-15;P15529-6;P15529-8;P15529	.;.;.;.;.;.;.;.;.;.;.;.;.;MCP_HUMAN	G	35	ENSP00000350893:C35G;ENSP00000346912:C35G;ENSP00000314664:C35G;ENSP00000356009:C35G;ENSP00000356008:C35G;ENSP00000350346:C35G;ENSP00000313875:C35G;ENSP00000413543:C35G;ENSP00000354358:C35G;ENSP00000353342:C35G;ENSP00000418471:C35G	ENSP00000313875:C35G	C	+	1	0	CD46	205996987	1.000000	0.71417	0.996000	0.52242	0.117000	0.20001	2.728000	0.47319	1.913000	0.55393	0.402000	0.26972	TGT	CD46	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pirsf_M_CF_CD46,pfscan_Sushi_SCR_CCP	ENSG00000117335		0.408	CD46-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD46	HGNC	protein_coding	OTTHUMT00000088588.3	70	0.00	0	T	NM_172361		207930364	207930364	+1	no_errors	ENST00000322875	ensembl	human	known	69_37n	missense	38	47.30	35	SNP	0.997	G
CHIC2	26511	genome.wustl.edu	37	4	54880282	54880282	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr4:54880282C>T	ENST00000263921.3	-	4	724	c.335G>A	c.(334-336)cGa>cAa	p.R112Q	FIP1L1_ENST00000507166.1_Intron|CHIC2_ENST00000512964.1_Intron	NM_012110.3	NP_036242.1	Q9UKJ5	CHIC2_HUMAN	cysteine-rich hydrophobic domain 2	112		Breakpoint for translocation to form CHIC2-ETV6 in AML.				Golgi-associated vesicle (GO:0005798)|plasma membrane (GO:0005886)		p.R112Q(1)		breast(1)|central_nervous_system(1)|large_intestine(1)|lung(1)	4	all_cancers(7;0.0193)|all_neural(26;0.0209)|Lung NSC(11;0.0281)|Glioma(25;0.08)		LUSC - Lung squamous cell carcinoma(32;0.00216)			AATCGATCTTCGTGTCTGGAA	0.403			T	ETV6	AML																																	dbGAP		Dom	yes		4	4q11-q12	26511	cysteine-rich hydrophobic domain 2		L	1	Substitution - Missense(1)	breast(1)											121.0	107.0	112.0					4																	54880282		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF159423	CCDS3493.1	4q12	2013-09-04			ENSG00000109220	ENSG00000109220			1935	protein-coding gene	gene with protein product		604332				10477709	Standard	NM_012110		Approved	BTL	uc003haj.2	Q9UKJ5	OTTHUMG00000102101	ENST00000263921.3:c.335G>A	4.37:g.54880282C>T	ENSP00000263921:p.Arg112Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R639	Missense_Mutation	SNP	pfam_Golgin_A_7/ERF4	p.R112Q	ENST00000263921.3	37	c.335	CCDS3493.1	4	.	.	.	.	.	.	.	.	.	.	C	14.86	2.661649	0.47572	.	.	ENSG00000109220	ENST00000263921	.	.	.	5.44	5.44	0.79542	Golgin subfamily A member 7/ERF4 (1);	0.062945	0.64402	D	0.000006	T	0.56470	0.1987	N	0.24115	0.695	0.80722	D	1	D	0.55800	0.973	P	0.52957	0.714	T	0.51092	-0.8749	9	0.22706	T	0.39	-29.0886	19.2629	0.93975	0.0:1.0:0.0:0.0	.	112	Q9UKJ5	CHIC2_HUMAN	Q	112	.	ENSP00000263921:R112Q	R	-	2	0	CHIC2	54575039	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.605000	0.61119	2.551000	0.86045	0.650000	0.86243	CGA	CHIC2	-	pfam_Golgin_A_7/ERF4	ENSG00000109220		0.403	CHIC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHIC2	HGNC	protein_coding	OTTHUMT00000219937.2	96	0.00	0	C			54880282	54880282	-1	no_errors	ENST00000263921	ensembl	human	known	69_37n	missense	68	42.86	51	SNP	1.000	T
COL15A1	1306	genome.wustl.edu	37	9	101822233	101822233	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr9:101822233C>A	ENST00000375001.3	+	36	3823	c.3400C>A	c.(3400-3402)Ctg>Atg	p.L1134M		NM_001855.3	NP_001846.3	P39059	COFA1_HUMAN	collagen, type XV, alpha 1	1134	Nonhelical region 10 (NC10).			L -> LLGELIPIPADSPPPPALSSN (in Ref. 2; AAC78500). {ECO:0000305}.	angiogenesis (GO:0001525)|cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|signal transduction (GO:0007165)	collagen type XV trimer (GO:0005582)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(20)|liver(1)|lung(42)|ovary(6)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	107		Acute lymphoblastic leukemia(62;0.0562)				ATCCAGAAACCTGGTCAGTAT	0.483																																						dbGAP											0													133.0	130.0	131.0					9																	101822233		2203	4300	6503	-	-	-	SO:0001583	missense	0			L25286	CCDS35081.1	9q21-q22	2013-01-16			ENSG00000204291	ENSG00000204291		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"""	2192	protein-coding gene	gene with protein product	"""collagen type XV proteoglycan"""	120325				1427836	Standard	NM_001855		Approved		uc004azb.2	P39059	OTTHUMG00000020351	ENST00000375001.3:c.3400C>A	9.37:g.101822233C>A	ENSP00000364140:p.Leu1134Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6J4|Q9UDC5|Q9Y4W4	Missense_Mutation	SNP	pfam_Collagenase_NC10/endostatin,pfam_Collagen,superfamily_C-type_lectin_fold,superfamily_ConA-like_lec_gl,smart_Laminin_G	p.L1134M	ENST00000375001.3	37	c.3400	CCDS35081.1	9	.	.	.	.	.	.	.	.	.	.	C	11.91	1.778279	0.31502	.	.	ENSG00000204291	ENST00000375001	T	0.44083	0.93	5.57	-0.0768	0.13721	Collagenase NC10/endostatin (1);	0.295811	0.32918	N	0.005500	T	0.51432	0.1674	L	0.54323	1.7	0.35587	D	0.806778	D	0.89917	1.0	D	0.85130	0.997	T	0.54241	-0.8323	10	0.36615	T	0.2	-9.2437	8.1075	0.30894	0.0:0.4556:0.0:0.5444	.	1134	P39059	COFA1_HUMAN	M	1134	ENSP00000364140:L1134M	ENSP00000364140:L1134M	L	+	1	2	COL15A1	100862054	0.991000	0.36638	0.968000	0.41197	0.594000	0.36715	0.208000	0.17415	-0.191000	0.10448	-1.119000	0.02030	CTG	COL15A1	-	pfam_Collagenase_NC10/endostatin	ENSG00000204291		0.483	COL15A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL15A1	HGNC	protein_coding	OTTHUMT00000053386.3	102	0.00	0	C	NM_001855		101822233	101822233	+1	no_errors	ENST00000375001	ensembl	human	known	69_37n	missense	74	45.59	62	SNP	0.994	A
CPN1	1369	genome.wustl.edu	37	10	101823406	101823406	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr10:101823406A>G	ENST00000370418.3	-	5	1087	c.836T>C	c.(835-837)aTc>aCc	p.I279T		NM_001308.2	NP_001299.1	P15169	CBPN_HUMAN	carboxypeptidase N, polypeptide 1	279	Catalytic.				response to glucocorticoid (GO:0051384)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	33		Colorectal(252;0.234)		Epithelial(162;4.77e-10)|all cancers(201;3.82e-08)		CCCATTGGTGATGCCATCTGG	0.493																																						dbGAP											0													117.0	108.0	111.0					10																	101823406		2203	4300	6503	-	-	-	SO:0001583	missense	0			X14329	CCDS7486.1	10q24.2	2012-02-10	2007-02-23		ENSG00000120054	ENSG00000120054	3.4.17.3		2312	protein-coding gene	gene with protein product	"""anaphylatoxin inactivator"", ""arginine carboxypeptidase"", ""carboxypeptidase K"", ""kininase I"", ""lysine carboxypeptidase"""	603103	"""carboxypeptidase N, polypeptide 1, 50kD"""			9628828, 2912725	Standard	NM_001308		Approved		uc001kql.2	P15169	OTTHUMG00000018896	ENST00000370418.3:c.836T>C	10.37:g.101823406A>G	ENSP00000359446:p.Ile279Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AP59	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_DUF2817,superfamily_CarboxyPept-like_regulatory,smart_Peptidase_M14,prints_Peptidase_M14	p.I279T	ENST00000370418.3	37	c.836	CCDS7486.1	10	.	.	.	.	.	.	.	.	.	.	A	19.20	3.781625	0.70222	.	.	ENSG00000120054	ENST00000370418;ENST00000441382	T;T	0.11604	3.87;2.76	5.61	5.61	0.85477	Peptidase M14, carboxypeptidase A (2);	0.047372	0.85682	D	0.000000	T	0.34571	0.0902	M	0.77103	2.36	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.04650	-1.0936	10	0.39692	T	0.17	-20.7029	15.8036	0.78473	1.0:0.0:0.0:0.0	.	279	P15169	CBPN_HUMAN	T	279;76	ENSP00000359446:I279T;ENSP00000410895:I76T	ENSP00000359446:I279T	I	-	2	0	CPN1	101813396	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.781000	0.91805	2.136000	0.66102	0.454000	0.30748	ATC	CPN1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000120054		0.493	CPN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPN1	HGNC	protein_coding	OTTHUMT00000049828.1	51	0.00	0	A	NM_001308		101823406	101823406	-1	no_errors	ENST00000370418	ensembl	human	known	69_37n	missense	51	28.17	20	SNP	1.000	G
DYNC2H1	79659	genome.wustl.edu	37	11	103091479	103091479	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr11:103091479G>T	ENST00000375735.2	+	57	9218	c.9074G>T	c.(9073-9075)gGt>gTt	p.G3025V	DYNC2H1_ENST00000334267.7_Intron|DYNC2H1_ENST00000398093.3_Missense_Mutation_p.G3025V	NM_001080463.1|NM_001377.2	NP_001073932.1|NP_001368.2	Q8NCM8	DYHC2_HUMAN	dynein, cytoplasmic 2, heavy chain 1	3025	Stalk. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|asymmetric protein localization (GO:0008105)|cilium assembly (GO:0042384)|determination of left/right symmetry (GO:0007368)|dorsal/ventral pattern formation (GO:0009953)|embryonic limb morphogenesis (GO:0030326)|forebrain development (GO:0030900)|Golgi organization (GO:0007030)|intraciliary retrograde transport (GO:0035721)|positive regulation of smoothened signaling pathway (GO:0045880)|protein processing (GO:0016485)|spinal cord motor neuron differentiation (GO:0021522)	apical part of cell (GO:0045177)|axoneme (GO:0005930)|cytosol (GO:0005829)|dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|motile primary cilium (GO:0031512)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(1)|endometrium(4)|kidney(5)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|upper_aerodigestive_tract(2)	33		Acute lymphoblastic leukemia(157;0.000966)|all_hematologic(158;0.00348)		BRCA - Breast invasive adenocarcinoma(274;0.000177)|Epithelial(105;0.0785)		AGGTTGATGGGTATCTTTGAT	0.348																																						dbGAP											0													81.0	76.0	78.0					11																	103091479		1849	4101	5950	-	-	-	SO:0001583	missense	0			AB082528	CCDS44717.1, CCDS53701.1	11q21-q22.1	2011-06-02	2005-11-24	2005-11-24	ENSG00000187240	ENSG00000187240		"""Cytoplasmic dyneins"""	2962	protein-coding gene	gene with protein product		603297	"""dynein, cytoplasmic, heavy polypeptide 2"""	DNCH2		9763680, 9373155	Standard	NM_001080463		Approved	hdhc11, DHC2, DHC1b, DYH1B	uc001phn.1	Q8NCM8	OTTHUMG00000165941	ENST00000375735.2:c.9074G>T	11.37:g.103091479G>T	ENSP00000364887:p.Gly3025Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O00432|Q16693|Q3C1U8|Q4AC93|Q6ZMX7|Q6ZUM6|Q7Z363|Q8N977|Q92815|Q9HAE4	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.G3025V	ENST00000375735.2	37	c.9074	CCDS53701.1	11	.	.	.	.	.	.	.	.	.	.	G	29.1	4.977231	0.92982	.	.	ENSG00000187240	ENST00000375735;ENST00000398093	T;T	0.73897	-0.79;-0.79	6.17	6.17	0.99709	Dynein heavy chain, coiled coil stalk (1);	0.000000	0.85682	D	0.000000	D	0.89770	0.6811	M	0.90814	3.15	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.90263	0.4302	10	0.87932	D	0	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	3025;3025	Q8NCM8;Q8NCM8-2	DYHC2_HUMAN;.	V	3025	ENSP00000364887:G3025V;ENSP00000381167:G3025V	ENSP00000364887:G3025V	G	+	2	0	DYNC2H1	102596689	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	GGT	DYNC2H1	-	NULL	ENSG00000187240		0.348	DYNC2H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC2H1	HGNC	protein_coding	OTTHUMT00000387196.1	70	0.00	0	G	XM_370652		103091479	103091479	+1	no_errors	ENST00000398093	ensembl	human	known	69_37n	missense	49	43.68	38	SNP	1.000	T
DDI1	414301	genome.wustl.edu	37	11	103908332	103908332	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr11:103908332C>T	ENST00000302259.3	+	1	1025	c.782C>T	c.(781-783)tCg>tTg	p.S261L	PDGFD_ENST00000302251.5_Intron|PDGFD_ENST00000393158.2_Intron	NM_001001711.2	NP_001001711.1	Q8WTU0	DDI1_HUMAN	DNA-damage inducible 1 homolog 1 (S. cerevisiae)	261							aspartic-type endopeptidase activity (GO:0004190)			central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(12)|liver(2)|lung(21)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52		Acute lymphoblastic leukemia(157;0.000967)|all_hematologic(158;0.00648)|Melanoma(852;0.055)|all_neural(303;0.164)		BRCA - Breast invasive adenocarcinoma(274;0.00128)|Epithelial(105;0.0631)|all cancers(92;0.169)		TTTGTTGACTCGGGCGCCCAG	0.527																																						dbGAP											0													92.0	97.0	95.0					11																	103908332		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS31660.1	11q22.3	2010-05-04	2010-05-04			ENSG00000170967			18961	protein-coding gene	gene with protein product			"""DDI1, DNA-damage inducible 1, homolog 1 (S. cerevisiae)"""				Standard	NM_001001711		Approved	FLJ36017	uc001phr.2	Q8WTU0		ENST00000302259.3:c.782C>T	11.37:g.103908332C>T	ENSP00000302805:p.Ser261Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z4U6|Q8WTS3	Missense_Mutation	SNP	pfam_Peptidase_aspartic_euk-pred,pfam_Ubiquitin,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.S261L	ENST00000302259.3	37	c.782	CCDS31660.1	11	.	.	.	.	.	.	.	.	.	.	C	17.97	3.518930	0.64634	.	.	ENSG00000170967	ENST00000302259	T	0.53423	0.62	5.21	5.21	0.72293	Peptidase aspartic (1);Peptidase aspartic, eukaryotic predicted (1);Peptidase aspartic, catalytic (1);	0.068497	0.64402	D	0.000009	T	0.75042	0.3796	M	0.92649	3.33	0.58432	D	0.999999	D	0.89917	1.0	D	0.68039	0.955	T	0.81033	-0.1116	10	0.87932	D	0	-33.1778	16.6709	0.85266	0.0:1.0:0.0:0.0	.	261	Q8WTU0	DDI1_HUMAN	L	261	ENSP00000302805:S261L	ENSP00000302805:S261L	S	+	2	0	DDI1	103413542	1.000000	0.71417	0.966000	0.40874	0.012000	0.07955	7.133000	0.77259	2.884000	0.98904	0.655000	0.94253	TCG	DDI1	-	pfam_Peptidase_aspartic_euk-pred,pfam_RVP_2,pfam_Pept_A2A_retrovirus_sg,superfamily_Peptidase_aspartic	ENSG00000170967		0.527	DDI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDI1	HGNC	protein_coding	OTTHUMT00000387326.1	50	0.00	0	C	NM_001001711		103908332	103908332	+1	no_errors	ENST00000302259	ensembl	human	known	69_37n	missense	29	46.30	25	SNP	0.999	T
FAM127C	441518	genome.wustl.edu	37	X	134156443	134156443	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chrX:134156443A>C	ENST00000391440.1	-	1	116	c.47T>G	c.(46-48)cTc>cGc	p.L16R		NM_001078173.1	NP_001071641.1	Q17RB0	F127C_HUMAN	family with sequence similarity 127, member C	16										breast(1)|endometrium(2)|large_intestine(1)|lung(2)	6	Acute lymphoblastic leukemia(192;0.000127)					CGCGGGCCGGAGGGGCCGAGC	0.682																																						dbGAP											0													59.0	66.0	64.0					X																	134156443		2014	4151	6165	-	-	-	SO:0001583	missense	0			BC048268	CCDS43996.1	Xq26.3	2014-05-16			ENSG00000212747	ENSG00000212747			33156	protein-coding gene	gene with protein product						9403077, 15716091	Standard	NM_001078173		Approved	MAR8B, CXX1c	uc004eyc.1	Q17RB0	OTTHUMG00000022464	ENST00000391440.1:c.47T>G	X.37:g.134156443A>C	ENSP00000375268:p.Leu16Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.L16R	ENST00000391440.1	37	c.47	CCDS43996.1	X	.	.	.	.	.	.	.	.	.	.	a	8.288	0.817108	0.16607	.	.	ENSG00000212747	ENST00000391440	T	0.29655	1.56	2.35	1.08	0.20341	.	0.367554	0.13593	U	0.376410	T	0.15219	0.0367	N	0.19112	0.55	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.29427	-1.0012	10	0.17369	T	0.5	.	4.7484	0.13049	0.6722:0.3278:0.0:0.0	.	16	Q17RB0	F127C_HUMAN	R	16	ENSP00000375268:L16R	ENSP00000375268:L16R	L	-	2	0	FAM127C	133984109	0.000000	0.05858	0.000000	0.03702	0.017000	0.09413	0.094000	0.15107	0.203000	0.20529	0.356000	0.21956	CTC	FAM127C	-	NULL	ENSG00000212747		0.682	FAM127C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM127C	HGNC	protein_coding	OTTHUMT00000058389.2	43	0.00	0	A	NM_001078173		134156443	134156443	-1	no_errors	ENST00000391440	ensembl	human	known	69_37n	missense	34	20.45	9	SNP	0.000	C
FAM58A	92002	genome.wustl.edu	37	X	152858123	152858123	+	Silent	SNP	A	A	G			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chrX:152858123A>G	ENST00000406277.2	-	6	594	c.492T>C	c.(490-492)gtT>gtC	p.V164V	FAM58A_ENST00000370175.4_5'UTR	NM_001130997.1|NM_152274.3	NP_001124469.1|NP_689487.2	Q8N1B3	FA58A_HUMAN	family with sequence similarity 58, member A	166					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of transcription, DNA-templated (GO:0006355)					endometrium(2)|kidney(1)|large_intestine(1)|liver(1)|lung(1)	6	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CGGTGACGGCAACAGGGGTCC	0.662																																						dbGAP											0													28.0	24.0	25.0					X																	152858123		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			BC032121	CCDS76054.1	Xq28	2014-08-12	2012-11-30	2012-11-30	ENSG00000147382	ENSG00000262919			28434	protein-coding gene	gene with protein product	"""cyclin M"""	300708				18297069, 24218572	Standard	NM_152274		Approved	MGC29729, FLJ21610	uc011myr.2	Q8N1B3	OTTHUMG00000024206	ENST00000406277.2:c.492T>C	X.37:g.152858123A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2I380|Q330J9|Q96IU5|Q9BUU1	Missense_Mutation	SNP	superfamily_Cyclin-like	p.C59R	ENST00000406277.2	37	c.175		X	.	.	.	.	.	.	.	.	.	.	A	8.217	0.801669	0.16397	.	.	ENSG00000147382	ENST00000440428	.	.	.	4.58	1.27	0.21489	.	.	.	.	.	T	0.51075	0.1653	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.35748	-0.9776	4	.	.	.	-8.0653	4.9221	0.13874	0.469:0.1535:0.3775:0.0	.	.	.	.	R	59	.	.	C	-	1	0	FAM58A	152511317	0.990000	0.36364	0.709000	0.30452	0.735000	0.41995	0.215000	0.17562	0.169000	0.19679	0.340000	0.21749	TGC	FAM58A	-	superfamily_Cyclin-like	ENSG00000147382		0.662	FAM58A-201	KNOWN	basic|appris_principal	protein_coding	FAM58A	HGNC	protein_coding		29	0.00	0	A	NM_152274		152858123	152858123	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440428	ensembl	human	novel	69_37n	missense	19	34.48	10	SNP	0.882	G
FZD6	8323	genome.wustl.edu	37	8	104342280	104342280	+	Missense_Mutation	SNP	C	C	T	rs201432167		TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr8:104342280C>T	ENST00000358755.4	+	6	2256	c.1939C>T	c.(1939-1941)Cgg>Tgg	p.R647W	FZD6_ENST00000540287.1_Missense_Mutation_p.R342W|FZD6_ENST00000522566.1_Missense_Mutation_p.R647W|FZD6_ENST00000523739.1_Missense_Mutation_p.R615W	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	647					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			TGAAAGTGCGCGGAGTGAAGG	0.448																																						dbGAP											0													77.0	76.0	77.0					8																	104342280		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.1939C>T	8.37:g.104342280C>T	ENSP00000351605:p.Arg647Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R647W	ENST00000358755.4	37	c.1939	CCDS6298.1	8	.	.	.	.	.	.	.	.	.	.	C	13.72	2.321701	0.41096	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000540287;ENST00000539487	T;T;T;T	0.77489	-1.07;-1.07;-1.1;-1.04	5.72	5.72	0.89469	.	3.541530	0.00496	N	0.000156	T	0.78547	0.4300	N	0.24115	0.695	0.24520	N	0.994164	D;D;D	0.65815	0.992;0.995;0.976	P;P;B	0.50708	0.513;0.648;0.394	T	0.68352	-0.5431	10	0.72032	D	0.01	.	13.0049	0.58699	0.2004:0.7996:0.0:0.0	.	592;342;647	B4E236;F5H831;O60353	.;.;FZD6_HUMAN	W	647;647;615;342;592	ENSP00000429055:R647W;ENSP00000351605:R647W;ENSP00000429528:R615W;ENSP00000443757:R342W	ENSP00000351605:R647W	R	+	1	2	FZD6	104411456	0.120000	0.22244	0.505000	0.27651	0.012000	0.07955	2.099000	0.41767	2.865000	0.98341	0.655000	0.94253	CGG	FZD6	-	NULL	ENSG00000164930		0.448	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	HGNC	protein_coding	OTTHUMT00000380560.1	54	0.00	0	C	NM_003506		104342280	104342280	+1	no_errors	ENST00000358755	ensembl	human	known	69_37n	missense	86	26.50	31	SNP	0.800	T
GRB14	2888	genome.wustl.edu	37	2	165378582	165378582	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr2:165378582G>A	ENST00000263915.3	-	6	1262	c.724C>T	c.(724-726)Cat>Tat	p.H242Y	GRB14_ENST00000543549.1_Missense_Mutation_p.H155Y	NM_004490.2	NP_004481.2	Q14449	GRB14_HUMAN	growth factor receptor-bound protein 14	242	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				blood coagulation (GO:0007596)|leukocyte migration (GO:0050900)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|plasma membrane (GO:0005886)	SH3/SH2 adaptor activity (GO:0005070)			breast(3)|endometrium(2)|large_intestine(6)|lung(10)|ovary(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32						TCTTTCGCATGTAAGAAACCA	0.289																																						dbGAP											0													44.0	48.0	46.0					2																	165378582		2200	4285	6485	-	-	-	SO:0001583	missense	0				CCDS2222.1	2q22-q24	2013-02-14			ENSG00000115290	ENSG00000115290		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4565	protein-coding gene	gene with protein product		601524				8812444	Standard	XM_005246477		Approved		uc002ucl.3	Q14449	OTTHUMG00000132135	ENST00000263915.3:c.724C>T	2.37:g.165378582G>A	ENSP00000263915:p.His242Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7F9|Q7Z6I1	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.H242Y	ENST00000263915.3	37	c.724	CCDS2222.1	2	.	.	.	.	.	.	.	.	.	.	G	14.22	2.471874	0.43942	.	.	ENSG00000115290	ENST00000263915;ENST00000543549;ENST00000446413	T;T;T	0.74737	-0.87;-0.87;-0.87	5.78	5.78	0.91487	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.043766	0.85682	D	0.000000	T	0.58452	0.2123	N	0.14661	0.345	0.80722	D	1	B;B	0.29552	0.134;0.248	B;B	0.33295	0.053;0.161	T	0.55515	-0.8129	10	0.23891	T	0.37	-13.825	11.6378	0.51213	0.1372:0.0:0.8628:0.0	.	155;242	B7Z7F9;Q14449	.;GRB14_HUMAN	Y	242;155;197	ENSP00000263915:H242Y;ENSP00000443699:H155Y;ENSP00000416786:H197Y	ENSP00000263915:H242Y	H	-	1	0	GRB14	165086828	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.939000	0.48995	2.894000	0.99253	0.655000	0.94253	CAT	GRB14	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000115290		0.289	GRB14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB14	HGNC	protein_coding	OTTHUMT00000255180.2	42	0.00	0	G			165378582	165378582	-1	no_errors	ENST00000263915	ensembl	human	known	69_37n	missense	29	44.23	23	SNP	1.000	A
GLS	2744	genome.wustl.edu	37	2	191827682	191827682	+	Silent	SNP	C	C	T	rs17853842		TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr2:191827682C>T	ENST00000320717.3	+	18	2238	c.1980C>T	c.(1978-1980)acC>acT	p.T660T	GLS_ENST00000409428.1_Silent_p.T165T	NM_014905.4	NP_055720.3	O94925	GLSK_HUMAN	glutaminase	660					cellular amino acid biosynthetic process (GO:0008652)|cellular nitrogen compound metabolic process (GO:0034641)|glutamate biosynthetic process (GO:0006537)|glutamate secretion (GO:0014047)|glutamine catabolic process (GO:0006543)|neurotransmitter secretion (GO:0007269)|protein homotetramerization (GO:0051289)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|small molecule metabolic process (GO:0044281)|suckling behavior (GO:0001967)|synaptic transmission (GO:0007268)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	glutaminase activity (GO:0004359)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.00625)|Epithelial(96;0.0744)|all cancers(119;0.181)		L-Glutamine(DB00130)	AAAATCAAACCGTCCATAAGA	0.363																																						dbGAP											0													90.0	87.0	88.0					2																	191827682		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020645	CCDS2308.1, CCDS58744.1	2q32-q34	2013-01-10			ENSG00000115419	ENSG00000115419	3.5.1.2	"""Ankyrin repeat domain containing"""	4331	protein-coding gene	gene with protein product		138280				10048485	Standard	NM_014905		Approved	KIAA0838, GLS1	uc002usf.3	O94925	OTTHUMG00000132701	ENST00000320717.3:c.1980C>T	2.37:g.191827682C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UL05|Q9UL06|Q9UL07|Q9UN40	Missense_Mutation	SNP	pfam_Glutaminase,superfamily_Beta-lactam/transpept-like,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.P160L	ENST00000320717.3	37	c.479	CCDS2308.1	2	.	.	.	.	.	.	.	.	.	.	C	11.94	1.789034	0.31685	.	.	ENSG00000115419	ENST00000412247	.	.	.	5.34	-8.44	0.00950	.	.	.	.	.	T	0.50854	0.1640	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61778	-0.6993	5	0.59425	D	0.04	-10.6291	4.6214	0.12450	0.1351:0.1004:0.4333:0.3311	.	.	.	.	L	160	.	ENSP00000403329:P160L	P	+	2	0	GLS	191535927	0.312000	0.24545	0.779000	0.31741	0.989000	0.77384	-0.423000	0.07034	-1.347000	0.02208	-0.137000	0.14449	CCG	GLS	-	NULL	ENSG00000115419		0.363	GLS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLS	HGNC	protein_coding	OTTHUMT00000255999.2	47	0.00	0	C			191827682	191827682	+1	no_start_codon	ENST00000412247	ensembl	human	putative	69_37n	missense	37	36.21	21	SNP	0.049	T
GRID2IP	392862	genome.wustl.edu	37	7	6542661	6542661	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr7:6542661C>T	ENST00000457091.2	-	17	3040	c.3041G>A	c.(3040-3042)cGg>cAg	p.R1014Q	GRID2IP_ENST00000435185.1_Missense_Mutation_p.R830Q|GRID2IP_ENST00000452113.1_Missense_Mutation_p.R823Q	NM_001145118.1	NP_001138590.1	A4D2P6	GRD2I_HUMAN	glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein	1014	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				long term synaptic depression (GO:0060292)	cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				endometrium(4)	4						GGCGAGCTTCCGACTGTTTTT	0.622																																						dbGAP											0													129.0	138.0	135.0					7																	6542661		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47537.1	7p22	2007-10-05	2006-03-01		ENSG00000215045	ENSG00000215045			18464	protein-coding gene	gene with protein product		610639	"""glutamate receptor, ionotropic, delta 2 (Grid2) interacting protein 1"""			14612983	Standard	NM_001145118		Approved		uc011jwx.2	A4D2P6	OTTHUMG00000155531	ENST00000457091.2:c.3041G>A	7.37:g.6542661C>T	ENSP00000397351:p.Arg1014Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_PDZ,superfamily_FH2_actin-bd,superfamily_PDZ,smart_PDZ,smart_Actin-bd_FH2/DRF_autoreg,pfscan_PDZ	p.R1014Q	ENST00000457091.2	37	c.3041	CCDS47537.1	7	.	.	.	.	.	.	.	.	.	.	c	17.57	3.421737	0.62622	.	.	ENSG00000215045	ENST00000452113;ENST00000435185;ENST00000457091	T;T;T	0.18174	2.23;2.23;2.23	4.06	3.17	0.36434	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.068192	0.56097	U	0.000022	T	0.10766	0.0263	L	0.37697	1.125	0.37921	D	0.931707	P	0.47604	0.898	B	0.38264	0.269	T	0.05037	-1.0910	10	0.52906	T	0.07	.	5.3673	0.16121	0.0:0.7696:0.0:0.2304	.	1014	A4D2P6	GRD2I_HUMAN	Q	823;830;1014	ENSP00000397887:R823Q;ENSP00000408364:R830Q;ENSP00000397351:R1014Q	ENSP00000408364:R830Q	R	-	2	0	GRID2IP	6509186	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	3.589000	0.53972	2.204000	0.70986	0.457000	0.33378	CGG	GRID2IP	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000215045		0.622	GRID2IP-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	GRID2IP	HGNC	protein_coding	OTTHUMT00000340534.1	69	0.00	0	C	XM_294249		6542661	6542661	-1	no_errors	ENST00000457091	ensembl	human	putative	69_37n	missense	43	50.57	44	SNP	1.000	T
KIF6	221458	genome.wustl.edu	37	6	39507794	39507794	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr6:39507794G>A	ENST00000287152.7	-	13	1724	c.1630C>T	c.(1630-1632)Ctc>Ttc	p.L544F	KIF6_ENST00000373216.3_Missense_Mutation_p.L544F|KIF6_ENST00000373213.4_Missense_Mutation_p.L383F|KIF6_ENST00000538893.1_Intron|KIF6_ENST00000373215.3_Missense_Mutation_p.L544F	NM_145027.4	NP_659464.3	Q6ZMV9	KIF6_HUMAN	kinesin family member 6	544					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|male germ cell nucleus (GO:0001673)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(16)|large_intestine(8)|lung(15)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	52						TTCTTGTGGAGCAAACTGGAT	0.433																																						dbGAP											0													176.0	185.0	182.0					6																	39507794		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832634	CCDS4844.1, CCDS75449.1	6p21.2	2010-03-30			ENSG00000164627	ENSG00000164627		"""Kinesins"""	21202	protein-coding gene	gene with protein product		613919	"""chromosome 6 open reading frame 102"""	C6orf102			Standard	NM_145027		Approved	dJ1043E3.1, MGC33317, dJ137F1.4, dJ188D3.1, DKFZp451I2418	uc003oot.2	Q6ZMV9	OTTHUMG00000014648	ENST00000287152.7:c.1630C>T	6.37:g.39507794G>A	ENSP00000287152:p.Leu544Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2MDE3|Q2MDE4|Q5T8J6|Q6ZWE3|Q86T87|Q8WTV4	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L544F	ENST00000287152.7	37	c.1630	CCDS4844.1	6	.	.	.	.	.	.	.	.	.	.	G	10.89	1.479347	0.26511	.	.	ENSG00000164627	ENST00000287152;ENST00000373216;ENST00000373213;ENST00000373215	T;T;T;T	0.72167	-0.58;-0.59;-0.39;-0.63	6.04	6.04	0.98038	.	.	.	.	.	T	0.59609	0.2206	L	0.39020	1.185	0.80722	D	1	D;B;D	0.57571	0.98;0.028;0.966	P;B;P	0.53649	0.731;0.018;0.543	T	0.56294	-0.8003	9	0.09843	T	0.71	.	16.0949	0.81114	0.0:0.0:1.0:0.0	.	544;544;544	E7EUN7;Q6ZMV9-3;Q6ZMV9	.;.;KIF6_HUMAN	F	544;544;383;544	ENSP00000287152:L544F;ENSP00000362312:L544F;ENSP00000362309:L383F;ENSP00000362311:L544F	ENSP00000287152:L544F	L	-	1	0	KIF6	39615772	1.000000	0.71417	1.000000	0.80357	0.177000	0.22998	2.312000	0.43726	2.873000	0.98535	0.563000	0.77884	CTC	KIF6	-	NULL	ENSG00000164627		0.433	KIF6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF6	HGNC	protein_coding	OTTHUMT00000040455.2	127	0.00	0	G	NM_145027		39507794	39507794	-1	no_errors	ENST00000287152	ensembl	human	known	69_37n	missense	79	40.15	53	SNP	1.000	A
MAP2K4	6416	genome.wustl.edu	37	17	12016616	12016616	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr17:12016616G>T	ENST00000353533.5	+	7	815	c.752G>T	c.(751-753)aGt>aTt	p.S251I	MAP2K4_ENST00000581941.1_3'UTR|MAP2K4_ENST00000415385.3_Missense_Mutation_p.S262I	NM_003010.2	NP_003001.1	P45985	MP2K4_HUMAN	mitogen-activated protein kinase kinase 4	251	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		S -> N (in a metastatic melanoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		apoptotic process (GO:0006915)|cellular response to mechanical stimulus (GO:0071260)|cellular response to sorbitol (GO:0072709)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of DNA replication (GO:0045740)|positive regulation of neuron apoptotic process (GO:0043525)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|nucleus (GO:0005634)|perikaryon (GO:0043204)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)	p.0?(10)|p.S251N(1)|p.?(1)		NS(1)|biliary_tract(2)|breast(22)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(26)|lung(15)|ovary(8)|pancreas(11)|skin(3)|stomach(2)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	100		all_cancers(5;0.0413)|Breast(5;0.000625)|all_epithelial(5;0.00978)|all_lung(20;0.0449)|Lung NSC(33;0.163)		Epithelial(2;4.12e-09)|all cancers(2;6.86e-07)|BRCA - Breast invasive adenocarcinoma(2;8.74e-07)|Colorectal(4;5.32e-05)|COAD - Colon adenocarcinoma(4;0.0039)|READ - Rectum adenocarcinoma(10;0.0681)		TTCGGCATCAGTGGACAGCTT	0.413			"""D, Mis, N"""		"""pancreatic, breast, colorectal"""																																	dbGAP		Rec	yes		17	17p11.2	6416	mitogen-activated protein kinase kinase 4		E	12	Whole gene deletion(10)|Substitution - Missense(1)|Unknown(1)	breast(4)|ovary(4)|biliary_tract(1)|large_intestine(1)|skin(1)|pancreas(1)											105.0	102.0	103.0					17																	12016616		2203	4300	6503	-	-	-	SO:0001583	missense	0			L36870	CCDS11162.1, CCDS62095.1	17p12	2012-03-23			ENSG00000065559	ENSG00000065559	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6844	protein-coding gene	gene with protein product		601335		SERK1		7716521	Standard	NM_003010		Approved	MEK4, JNKK1, PRKMK4, MKK4	uc002gnj.3	P45985		ENST00000353533.5:c.752G>T	17.37:g.12016616G>T	ENSP00000262445:p.Ser251Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7N7|B3KYB2|D3DTS5|Q5U0B8|Q6FHX4|Q6P9H2|Q6PIE6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S262I	ENST00000353533.5	37	c.785	CCDS11162.1	17	.	.	.	.	.	.	.	.	.	.	G	25.7	4.663716	0.88251	.	.	ENSG00000065559	ENST00000353533;ENST00000415385;ENST00000538465;ENST00000536413	T;T	0.70631	-0.5;-0.5	4.41	4.41	0.53225	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.86184	0.5872	M	0.88377	2.95	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	D	0.89279	0.3610	10	0.87932	D	0	.	15.9715	0.80025	0.0:0.0:1.0:0.0	.	123;262;251	B7ZA62;P45985-2;P45985	.;.;MP2K4_HUMAN	I	251;262;228;123	ENSP00000262445:S251I;ENSP00000410402:S262I	ENSP00000262445:S251I	S	+	2	0	MAP2K4	11957341	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.657000	0.98554	2.297000	0.77311	0.591000	0.81541	AGT	MAP2K4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000065559		0.413	MAP2K4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP2K4	HGNC	protein_coding	OTTHUMT00000441226.1	55	0.00	0	G			12016616	12016616	+1	no_errors	ENST00000415385	ensembl	human	known	69_37n	missense	36	32.08	17	SNP	1.000	T
MORC4	79710	genome.wustl.edu	37	X	106221352	106221352	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chrX:106221352G>T	ENST00000355610.4	-	8	1288	c.1014C>A	c.(1012-1014)aaC>aaA	p.N338K	MORC4_ENST00000255495.7_Missense_Mutation_p.N338K|MORC4_ENST00000535534.1_Missense_Mutation_p.N86K	NM_001085354.2|NM_024657.4	NP_001078823.1|NP_078933.3	Q8TE76	MORC4_HUMAN	MORC family CW-type zinc finger 4	338						nucleus (GO:0005634)	zinc ion binding (GO:0008270)			endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	28						TTATGAGTCGGTTGTTATGAT	0.383																																						dbGAP											0													154.0	151.0	152.0					X																	106221352		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021627	CCDS14525.2, CCDS48146.1	Xq22.3	2008-02-05	2005-06-15	2005-06-15	ENSG00000133131	ENSG00000133131			23485	protein-coding gene	gene with protein product			"""zinc finger, CW-type with coiled-coil domain 2"", ""zinc finger, CW type with coiled-coil domain 2"""	ZCWCC2		14607086	Standard	NM_024657		Approved	ZCW4, FLJ11565	uc004emp.4	Q8TE76	OTTHUMG00000022155	ENST00000355610.4:c.1014C>A	X.37:g.106221352G>T	ENSP00000347821:p.Asn338Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1YR23|A1YR24|H7BXF1|Q5JUK7|Q96MZ2|Q9HAI7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Prefoldin,pfscan_Znf_CW	p.N338K	ENST00000355610.4	37	c.1014	CCDS14525.2	X	.	.	.	.	.	.	.	.	.	.	G	16.76	3.212064	0.58452	.	.	ENSG00000133131	ENST00000355610;ENST00000535534;ENST00000255495	T;T;T	0.50277	2.07;0.75;2.06	4.99	2.22	0.28083	.	0.000000	0.85682	D	0.000000	T	0.55289	0.1911	M	0.93462	3.42	0.34321	D	0.686626	P;P;P	0.46395	0.799;0.877;0.732	B;B;B	0.40741	0.214;0.339;0.272	T	0.69514	-0.5125	10	0.87932	D	0	-8.6975	8.3932	0.32542	0.2819:0.0:0.7181:0.0	.	86;338;338	A1YR24;A1YR23;Q8TE76	.;.;MORC4_HUMAN	K	338;86;338	ENSP00000347821:N338K;ENSP00000440359:N86K;ENSP00000255495:N338K	ENSP00000255495:N338K	N	-	3	2	MORC4	106108008	1.000000	0.71417	0.995000	0.50966	0.997000	0.91878	2.016000	0.40971	0.197000	0.20387	0.538000	0.68166	AAC	MORC4	-	NULL	ENSG00000133131		0.383	MORC4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MORC4	HGNC	protein_coding	OTTHUMT00000057816.3	136	0.00	0	G	NM_024657		106221352	106221352	-1	no_errors	ENST00000355610	ensembl	human	known	69_37n	missense	85	40.56	58	SNP	1.000	T
MYBPC1	4604	genome.wustl.edu	37	12	102045070	102045070	+	Silent	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr12:102045070C>T	ENST00000550270.1	+	14	1350	c.1350C>T	c.(1348-1350)atC>atT	p.I450I	MYBPC1_ENST00000549145.1_Silent_p.I463I|MYBPC1_ENST00000541119.1_Silent_p.I438I|MYBPC1_ENST00000441232.1_Silent_p.I450I|MYBPC1_ENST00000551300.1_Silent_p.I351I|MYBPC1_ENST00000360610.2_Silent_p.I450I|MYBPC1_ENST00000361685.2_Silent_p.I475I|MYBPC1_ENST00000547405.1_Silent_p.I424I|MYBPC1_ENST00000361466.2_Silent_p.I475I|MYBPC1_ENST00000550501.1_Intron|MYBPC1_ENST00000553190.1_Silent_p.I450I|MYBPC1_ENST00000392934.3_Silent_p.I437I|MYBPC1_ENST00000547509.1_Silent_p.I436I|MYBPC1_ENST00000452455.2_Silent_p.I450I|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000545503.2_Silent_p.I450I|MYBPC1_ENST00000536007.1_Silent_p.I431I|RP11-755O11.2_ENST00000547027.1_RNA			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	450	Ig-like C2-type 4.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						GAAAAGAAATCTGCCTGAAGT	0.413																																						dbGAP											0													147.0	152.0	151.0					12																	102045070		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1350C>T	12.37:g.102045070C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I475	ENST00000550270.1	37	c.1425	CCDS9085.1	12																																																																																			MYBPC1	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000196091		0.413	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	76	0.00	0	C			102045070	102045070	+1	no_errors	ENST00000361466	ensembl	human	known	69_37n	silent	78	36.59	45	SNP	1.000	T
ICE2	79664	genome.wustl.edu	37	15	60760323	60760323	+	De_novo_Start_OutOfFrame	SNP	G	G	A	rs191697711		TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr15:60760323G>A	ENST00000439632.1	-	0	419				NARG2_ENST00000558654.1_5'UTR|NARG2_ENST00000561114.1_Silent_p.Y115Y|NARG2_ENST00000261520.4_Silent_p.Y115Y	NM_001018089.1	NP_001018099.1														breast(1)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	32						GAATCTTTGCGTATTTAACCA	0.368																																						dbGAP											0													100.0	92.0	94.0					15																	60760323		2203	4300	6503	-	-	-			0																														ENST00000439632.1:c.-67C>T	15.37:g.60760323G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.T62M	ENST00000439632.1	37	c.185		15																																																																																			NARG2	-	NULL	ENSG00000128915		0.368	NARG2-201	KNOWN	basic	protein_coding	NARG2	HGNC	protein_coding		86	0.00	0	G			60760323	60760323	-1	no_errors	ENST00000558181	ensembl	human	known	69_37n	missense	42	41.67	30	SNP	0.882	A
NBAS	51594	genome.wustl.edu	37	2	15307434	15307434	+	Missense_Mutation	SNP	T	T	C	rs368395181	byFrequency	TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr2:15307434T>C	ENST00000281513.5	-	52	6879	c.6854A>G	c.(6853-6855)aAt>aGt	p.N2285S	NBAS_ENST00000441750.1_Missense_Mutation_p.N2165S	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	2285					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TTGGTCACAATTGGAATCATT	0.527													T|||	5	0.000998403	0.0008	0.0	5008	,	,		20388	0.0		0.0	False		,,,				2504	0.0041					dbGAP											0													61.0	55.0	57.0					2																	15307434		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.6854A>G	2.37:g.15307434T>C	ENSP00000281513:p.Asn2285Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.N2285S	ENST00000281513.5	37	c.6854	CCDS1685.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	7.079|7.079	0.569836|0.569836	0.13560|0.13560	.|.	.|.	ENSG00000151779|ENSG00000151779	ENST00000442506|ENST00000441750;ENST00000281513;ENST00000433283	.|T;T	.|0.29397	.|1.57;1.57	5.46|5.46	5.46|5.46	0.80206|0.80206	.|.	.|0.249484	.|0.47093	.|D	.|0.000258	T|T	0.34135|0.34135	0.0887|0.0887	M|M	0.65975|0.65975	2.015|2.015	0.39983|0.39983	D|D	0.974949|0.974949	.|B;B	.|0.28713	.|0.22;0.013	.|B;B	.|0.28849	.|0.095;0.02	T|T	0.30937|0.30937	-0.9961|-0.9961	5|10	.|0.87932	.|D	.|0	.|.	11.9481|11.9481	0.52940|0.52940	0.0:0.0:0.1446:0.8554|0.0:0.0:0.1446:0.8554	.|.	.|2165;2285	.|A2RRP1-2;A2RRP1	.|.;NBAS_HUMAN	V|S	1333|2165;2285;98	.|ENSP00000413201:N2165S;ENSP00000281513:N2285S	.|ENSP00000281513:N2285S	I|N	-|-	1|2	0|0	NBAS|NBAS	15224885|15224885	1.000000|1.000000	0.71417|0.71417	0.654000|0.654000	0.29608|0.29608	0.017000|0.017000	0.09413|0.09413	2.054000|2.054000	0.41335|0.41335	2.062000|2.062000	0.61559|0.61559	0.533000|0.533000	0.62120|0.62120	ATT|AAT	NBAS	-	NULL	ENSG00000151779		0.527	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	43	0.00	0	T	NM_015909		15307434	15307434	-1	no_errors	ENST00000281513	ensembl	human	known	69_37n	missense	22	45.00	18	SNP	0.992	C
OCSTAMP	128506	genome.wustl.edu	37	20	45173985	45173985	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr20:45173985G>A	ENST00000279028.2	-	2	1041	c.1028C>T	c.(1027-1029)aCg>aTg	p.T343M		NM_080721.1	NP_542452.1	Q9BR26	OCSTP_HUMAN	osteoclast stimulatory transmembrane protein	343					cellular response to estrogen stimulus (GO:0071391)|cellular response to tumor necrosis factor (GO:0071356)|multinuclear osteoclast differentiation (GO:0072674)|positive regulation of macrophage fusion (GO:0034241)|positive regulation of osteoclast differentiation (GO:0045672)|positive regulation of osteoclast proliferation (GO:0090290)	integral component of membrane (GO:0016021)				breast(1)|endometrium(1)	2						GACCGTGAGCGTGATGGGCAC	0.542																																						dbGAP											0													19.0	17.0	18.0					20																	45173985		692	1591	2283	-	-	-	SO:0001583	missense	0			AL034424	CCDS54468.1	20q13.12	2012-03-27	2012-03-27	2012-03-27	ENSG00000149635	ENSG00000149635			16116	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 123"""	C20orf123		18064667	Standard	NM_080721		Approved	dJ257E24.3	uc010zxu.2	Q9BR26	OTTHUMG00000032652	ENST00000279028.2:c.1028C>T	20.37:g.45173985G>A	ENSP00000279028:p.Thr343Met	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DC_STAMP-like	p.T343M	ENST00000279028.2	37	c.1028	CCDS54468.1	20	.	.	.	.	.	.	.	.	.	.	G	13.75	2.329842	0.41297	.	.	ENSG00000149635	ENST00000279028	T	0.33654	1.4	5.24	3.18	0.36537	Dendritic cell-specific transmembrane protein-like (1);	0.519190	0.19466	N	0.113593	T	0.41673	0.1169	L	0.32530	0.975	0.24096	N	0.99589	D	0.89917	1.0	D	0.77004	0.989	T	0.09422	-1.0675	10	0.39692	T	0.17	-14.2681	6.1487	0.20301	0.0737:0.2269:0.577:0.1224	.	343	Q9BR26	CT123_HUMAN	M	343	ENSP00000279028:T343M	ENSP00000279028:T343M	T	-	2	0	C20orf123	44607392	0.827000	0.29292	0.981000	0.43875	0.602000	0.36980	1.017000	0.29989	2.426000	0.82243	0.655000	0.94253	ACG	OCSTAMP	-	pfam_DC_STAMP-like	ENSG00000149635		0.542	OCSTAMP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OCSTAMP	HGNC	protein_coding	OTTHUMT00000079573.2	9	0.00	0	G	XM_496476		45173985	45173985	-1	no_errors	ENST00000279028	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.587	A
PDPR	55066	genome.wustl.edu	37	16	70178401	70178401	+	Missense_Mutation	SNP	A	A	T	rs7192962		TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr16:70178401A>T	ENST00000288050.4	+	15	2789	c.1832A>T	c.(1831-1833)aAc>aTc	p.N611I	PDPR_ENST00000542659.1_5'Flank|PDPR_ENST00000562100.1_3'UTR|PDPR_ENST00000567046.1_5'Flank|PDPR_ENST00000398122.3_Missense_Mutation_p.N511I|PDPR_ENST00000568530.1_Missense_Mutation_p.N611I	NM_017990.3	NP_060460.4	Q8NCN5	PDPR_HUMAN	pyruvate dehydrogenase phosphatase regulatory subunit	611					cellular metabolic process (GO:0044237)|glycine catabolic process (GO:0006546)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|mitochondrial matrix (GO:0005759)	aminomethyltransferase activity (GO:0004047)|oxidoreductase activity (GO:0016491)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|skin(2)|stomach(3)	33				BRCA - Breast invasive adenocarcinoma(221;0.124)		AAAGACAGCAACCTGCTCCTG	0.537																																						dbGAP											0													1.0	1.0	1.0					16																	70178401		910	2154	3064	-	-	-	SO:0001583	missense	0				CCDS45520.1	16q22.1	2010-08-24			ENSG00000090857	ENSG00000090857			30264	protein-coding gene	gene with protein product						9395502	Standard	NM_017990		Approved	PDP3	uc002eyf.1	Q8NCN5		ENST00000288050.4:c.1832A>T	16.37:g.70178401A>T	ENSP00000288050:p.Asn611Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E298|A8K8Y7|B3KSE1|Q6AI20|Q6AWC9	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase,pfam_GCV_T_N,pfam_GCV_T_C,pfam_FAD_bind_dom	p.N611I	ENST00000288050.4	37	c.1832	CCDS45520.1	16	260	0.11904761904761904	72	0.14634146341463414	40	0.11049723756906077	39	0.06818181818181818	109	0.1437994722955145	A	9.340	1.062747	0.19987	.	.	ENSG00000090857	ENST00000288050;ENST00000398122;ENST00000205055	D;D	0.84070	-1.8;-1.8	4.66	-0.626	0.11544	Glycine cleavage T-protein, N-terminal (1);	0.311467	0.38778	N	0.001565	T	0.00815	0.0027	L	0.42245	1.32	0.80722	D	1	P;B	0.36909	0.573;0.004	B;B	0.33846	0.171;0.058	T	0.00939	-1.1507	10	0.48119	T	0.1	.	4.9157	0.13844	0.6413:0.0:0.2318:0.1269	rs7192962	339;611	Q9NWE6;Q8NCN5	.;PDPR_HUMAN	I	611;511;339	ENSP00000288050:N611I;ENSP00000381190:N511I	ENSP00000205055:N339I	N	+	2	0	PDPR	68735902	1.000000	0.71417	0.997000	0.53966	0.091000	0.18340	1.928000	0.40104	-0.017000	0.14103	-0.566000	0.04163	AAC	PDPR	-	pfam_GCV_T_N	ENSG00000090857		0.537	PDPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPR	HGNC	protein_coding	OTTHUMT00000434502.1	12	0.00	0	A	NM_017990		70178401	70178401	+1	no_errors	ENST00000288050	ensembl	human	known	69_37n	missense	0	100.00	3	SNP	0.999	T
PRSS50	29122	genome.wustl.edu	37	3	46759116	46759116	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr3:46759116C>T	ENST00000460241.1	-	7	1788	c.118G>A	c.(118-120)Gca>Aca	p.A40T	PRSS50_ENST00000315170.7_Missense_Mutation_p.A40T			Q9UI38	TSP50_HUMAN	protease, serine, 50	40					proteolysis (GO:0006508)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	serine-type endopeptidase activity (GO:0004252)|threonine-type endopeptidase activity (GO:0004298)			endometrium(2)|kidney(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	11						GCTTCCCCTGCGCCCCAGCAA	0.697																																					Pancreas(41;915 1239 11561 17469)	dbGAP											0													31.0	36.0	34.0					3																	46759116		2198	4297	6495	-	-	-	SO:0001583	missense	0			AF100707	CCDS2745.1	3p21.31	2011-05-24			ENSG00000206549	ENSG00000206549		"""Serine peptidases / Serine peptidases"""	17910	protein-coding gene	gene with protein product	"""cancer/testis antigen 20"", ""testes specific protease 50"""	607950				10397268	Standard	NM_013270		Approved	TSP50, CT20	uc003cqe.1	Q9UI38	OTTHUMG00000164067	ENST00000460241.1:c.118G>A	3.37:g.46759116C>T	ENSP00000418875:p.Ala40Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.A40T	ENST00000460241.1	37	c.118	CCDS2745.1	3	.	.	.	.	.	.	.	.	.	.	C	12.26	1.883256	0.33255	.	.	ENSG00000206549	ENST00000315170;ENST00000460241	D;D	0.88354	-2.37;-2.37	3.13	-0.0503	0.13831	.	0.684767	0.12064	N	0.502851	T	0.74092	0.3671	L	0.32530	0.975	0.09310	N	1	P	0.43662	0.814	B	0.27887	0.084	T	0.64630	-0.6362	9	.	.	.	.	3.5641	0.07893	0.4008:0.4522:0.0:0.147	.	40	Q9UI38	TSP50_HUMAN	T	40	ENSP00000326598:A40T;ENSP00000418875:A40T	.	A	-	1	0	PRSS50	46734120	0.000000	0.05858	0.000000	0.03702	0.005000	0.04900	-2.964000	0.00671	-0.037000	0.13646	-0.410000	0.06199	GCA	PRSS50	-	NULL	ENSG00000206549		0.697	PRSS50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS50	HGNC	protein_coding	OTTHUMT00000354544.1	29	0.00	0	C			46759116	46759116	-1	no_errors	ENST00000315170	ensembl	human	known	69_37n	missense	31	39.62	21	SNP	0.000	T
PTTG1	9232	genome.wustl.edu	37	5	159854736	159854736	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr5:159854736G>A	ENST00000393964.1	+	4	788	c.385G>A	c.(385-387)Gac>Aac	p.D129N	PTTG1_ENST00000520452.1_Missense_Mutation_p.D129N|PTTG1_ENST00000352433.5_Missense_Mutation_p.D129N|PTTG1_ENST00000519287.1_3'UTR	NM_001282382.1	NP_001269311.1	O95997	PTTG1_HUMAN	pituitary tumor-transforming 1	129					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|chromosome organization (GO:0051276)|chromosome segregation (GO:0007059)|DNA repair (GO:0006281)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of endopeptidase activity (GO:0010951)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(1)|lung(4)	6	Renal(175;0.00196)	Medulloblastoma(196;0.0354)|all_neural(177;0.116)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	OV - Ovarian serous cystadenocarcinoma(192;0.00219)|Epithelial(171;0.00348)|all cancers(165;0.0104)		TGAGAGTTTTGACCTGCCTGA	0.517																																						dbGAP											0													93.0	88.0	90.0					5																	159854736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF062649	CCDS4353.1	5q35.1	2014-08-04			ENSG00000164611	ENSG00000164611			9690	protein-coding gene	gene with protein product	"""ESP1-associated protein 1"", ""tumor-transforming protein 1"""	604147		TUTR1		9811450, 9892021	Standard	NM_004219		Approved	PTTG, HPTTG, EAP1, securin	uc003lyj.3	O95997	OTTHUMG00000130328	ENST00000393964.1:c.385G>A	5.37:g.159854736G>A	ENSP00000377536:p.Asp129Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Securin_separation_inhibitor	p.D129N	ENST00000393964.1	37	c.385	CCDS4353.1	5	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663508	0.67700	.	.	ENSG00000164611	ENST00000352433;ENST00000520452;ENST00000393964	T;T;T	0.55930	0.49;0.49;0.49	5.68	5.68	0.88126	.	0.201029	0.52532	D	0.000078	T	0.59335	0.2186	M	0.80616	2.505	0.40376	D	0.97939	B	0.18610	0.029	B	0.31191	0.125	T	0.57124	-0.7865	9	.	.	.	-17.591	15.3003	0.73945	0.0:0.0:1.0:0.0	.	129	O95997	PTTG1_HUMAN	N	129	ENSP00000344936:D129N;ENSP00000430642:D129N;ENSP00000377536:D129N	.	D	+	1	0	PTTG1	159787314	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	5.353000	0.66034	2.674000	0.91012	0.655000	0.94253	GAC	PTTG1	-	pfam_Securin_separation_inhibitor	ENSG00000164611		0.517	PTTG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTTG1	HGNC	protein_coding	OTTHUMT00000252677.1	42	0.00	0	G	NM_004219		159854736	159854736	+1	no_errors	ENST00000352433	ensembl	human	known	69_37n	missense	34	41.38	24	SNP	1.000	A
RAD54L2	23132	genome.wustl.edu	37	3	51673686	51673686	+	Splice_Site	SNP	G	G	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr3:51673686G>A	ENST00000409535.2	+	12	2237	c.2112G>A	c.(2110-2112)tgG>tgA	p.W704*	RAD54L2_ENST00000296477.3_Splice_Site_p.W398*	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	704						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)			NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CATATGAATGGGTGAGTCAAG	0.527																																						dbGAP											0													48.0	42.0	44.0					3																	51673686		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.2112+1G>A	3.37:g.51673686G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB57|Q9BV54	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.W704*	ENST00000409535.2	37	c.2112	CCDS33765.2	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	40|40	8.383476|8.383476	0.98786|0.98786	.|.	.|.	ENSG00000164080|ENSG00000164080	ENST00000432863|ENST00000409535;ENST00000296477	.|.	.|.	.|.	5.78|5.78	5.78|5.78	0.91487|0.91487	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|.	0.47322|.	0.1439|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.37009|.	-0.9724|.	3|.	.|0.02654	.|T	.|1	-9.6494|-9.6494	18.985|18.985	0.92766|0.92766	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	S|X	533|704;398	.|.	.|ENSP00000296477:W398X	G|W	+|+	1|3	0|0	RAD54L2|RAD54L2	51648726|51648726	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.775000|0.775000	0.43874|0.43874	9.416000|9.416000	0.97383|0.97383	2.719000|2.719000	0.93026|0.93026	0.655000|0.655000	0.94253|0.94253	GGC|TGG	RAD54L2	-	NULL	ENSG00000164080		0.527	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	46	0.00	0	G	NM_015106	Nonsense_Mutation	51673686	51673686	+1	no_errors	ENST00000409535	ensembl	human	known	69_37n	nonsense	22	50.00	22	SNP	1.000	A
RERE	473	genome.wustl.edu	37	1	8617573	8617573	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr1:8617573C>T	ENST00000337907.3	-	6	1166	c.532G>A	c.(532-534)Gac>Aac	p.D178N	RERE_ENST00000400908.2_Missense_Mutation_p.D178N|RERE_ENST00000400907.2_Missense_Mutation_p.D178N	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	178	BAH. {ECO:0000255|PROSITE- ProRule:PRU00370}.				chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		AGGAGATGGTCCCTCTTACTC	0.433																																						dbGAP											0													106.0	87.0	93.0					1																	8617573		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.532G>A	1.37:g.8617573C>T	ENSP00000338629:p.Asp178Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.D178N	ENST00000337907.3	37	c.532	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	C	25.2	4.609633	0.87258	.	.	ENSG00000142599	ENST00000337907;ENST00000400907;ENST00000400908	D;D;D	0.84730	-1.89;-1.89;-1.89	6.03	6.03	0.97812	Bromo adjacent homology (BAH) domain (3);	.	.	.	.	D	0.90270	0.6957	L	0.42245	1.32	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.90296	0.4326	9	0.72032	D	0.01	-24.0558	19.1207	0.93362	0.0:1.0:0.0:0.0	.	178	Q9P2R6	RERE_HUMAN	N	178	ENSP00000338629:D178N;ENSP00000383699:D178N;ENSP00000383700:D178N	ENSP00000338629:D178N	D	-	1	0	RERE	8540160	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.672000	0.83956	2.861000	0.98227	0.655000	0.94253	GAC	RERE	-	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	ENSG00000142599		0.433	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	42	0.00	0	C			8617573	8617573	-1	no_errors	ENST00000337907	ensembl	human	known	69_37n	missense	7	77.78	28	SNP	1.000	T
SLTM	79811	genome.wustl.edu	37	15	59186732	59186732	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr15:59186732C>T	ENST00000380516.2	-	10	1364	c.1277G>A	c.(1276-1278)tGc>tAc	p.C426Y	AC025918.2_ENST00000452467.1_RNA|SLTM_ENST00000536328.1_5'UTR	NM_001013843.1|NM_024755.2	NP_001013865.1|NP_079031.2	Q9NWH9	SLTM_HUMAN	SAFB-like, transcription modulator	426	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				apoptotic process (GO:0006915)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28						AATGCCATAGCATTTTGCCCC	0.413																																						dbGAP											0													167.0	148.0	155.0					15																	59186732		2192	4292	6484	-	-	-	SO:0001583	missense	0			BC046119	CCDS10168.2	15q21.3	2013-02-12			ENSG00000137776	ENSG00000137776		"""RNA binding motif (RRM) containing"""	20709	protein-coding gene	gene with protein product							Standard	XR_243128		Approved	Met, FLJ13213	uc002afp.3	Q9NWH9	OTTHUMG00000074033	ENST00000380516.2:c.1277G>A	15.37:g.59186732C>T	ENSP00000369887:p.Cys426Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V8|B2RTX3|Q2VPK7|Q52MB3|Q658J7|Q6ZNF2|Q86TK6|Q9H7C3|Q9H8U9	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SAP_DNA-bd,smart_SAP_DNA-bd,smart_RRM_dom,pfscan_SAP_DNA-bd,pfscan_RRM_dom	p.C426Y	ENST00000380516.2	37	c.1277	CCDS10168.2	15	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767017	0.69878	.	.	ENSG00000137776	ENST00000380516;ENST00000432750;ENST00000249736	T;T;T	0.74209	-0.82;-0.82;-0.82	5.96	5.96	0.96718	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.64402	D	0.000004	D	0.88640	0.6491	M	0.84773	2.715	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89121	0.3503	10	0.87932	D	0	.	20.4192	0.99033	0.0:1.0:0.0:0.0	.	426	Q9NWH9	SLTM_HUMAN	Y	426;19;408	ENSP00000369887:C426Y;ENSP00000411534:C19Y;ENSP00000249736:C408Y	ENSP00000249736:C408Y	C	-	2	0	SLTM	56974024	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.814000	0.86154	2.831000	0.97527	0.650000	0.86243	TGC	SLTM	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000137776		0.413	SLTM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLTM	HGNC	protein_coding	OTTHUMT00000157124.1	78	0.00	0	C	NM_024755		59186732	59186732	-1	no_errors	ENST00000380516	ensembl	human	known	69_37n	missense	56	37.78	34	SNP	1.000	T
SPEN	23013	genome.wustl.edu	37	1	16202935	16202936	+	Frame_Shift_Ins	INS	-	-	TA			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr1:16202935_16202936insTA	ENST00000375759.3	+	3	847_848	c.643_644insTA	c.(643-645)gtafs	p.V215fs	SPEN_ENST00000471538.1_3'UTR	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	215	Arg-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		GCCCAGTGTGGTACACAGGGAT	0.535																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.644_645dupTA	1.37:g.16202936_16202937dupTA	ENSP00000364912:p.Val215fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Frame_Shift_Ins	INS	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.H216fs	ENST00000375759.3	37	c.643_644	CCDS164.1	1																																																																																			SPEN	-	NULL	ENSG00000065526		0.535	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	51	0.00	0	-	NM_015001		16202935	16202936	+1	no_errors	ENST00000375759	ensembl	human	known	69_37n	frame_shift_ins	11	67.65	23	INS	1.000:1.000	TA
LLfos-48D6.1	0	genome.wustl.edu	37	19	2353046	2353046	+	RNA	SNP	C	C	G			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr19:2353046C>G	ENST00000609490.1	-	0	450				SPPL2B_ENST00000452401.2_RNA																							CAGCGAAGAACCAGCCACATC	0.687																																						dbGAP											0													22.0	32.0	29.0					19																	2353046		2016	4172	6188	-	-	-			0																															19.37:g.2353046C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000609490.1	37	NULL		19																																																																																			SPPL2B	-	-	ENSG00000005206		0.687	LLfos-48D6.1-001	KNOWN	basic	antisense	SPPL2B	HGNC	antisense	OTTHUMT00000473157.1	18	0.00	0	C			2353046	2353046	+1	no_errors	ENST00000452401	ensembl	human	known	69_37n	rna	14	30.00	6	SNP	0.000	G
STAG2	10735	genome.wustl.edu	37	X	123184970	123184970	+	Splice_Site	DEL	G	G	-			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chrX:123184970delG	ENST00000371160.1	+	12	1307		c.e12-1		STAG2_ENST00000371145.3_Splice_Site|STAG2_ENST00000354548.5_Splice_Site|STAG2_ENST00000371157.3_Splice_Site|STAG2_ENST00000371144.3_Splice_Site|STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Splice_Site	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2						meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTTTTTTTTAGCAAGGTGAAG	0.289																																						dbGAP											0													14.0	15.0	14.0					X																	123184970		2180	4231	6411	-	-	-	SO:0001630	splice_region_variant	0			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1018-1G>-	X.37:g.123184970delG		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Splice_Site	DEL	-	e10-1	ENST00000371160.1	37	c.1018-1	CCDS14607.1	X																																																																																			STAG2	-	-	ENSG00000101972		0.289	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2	9	0.00	0	G	NM_006603	Intron	123184970	123184970	+1	no_errors	ENST00000218089	ensembl	human	known	69_37n	splice_site_del	3	33.33	2	DEL	1.000	-
TJP1	7082	genome.wustl.edu	37	15	30024679	30024679	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr15:30024679C>A	ENST00000346128.6	-	15	2449	c.1975G>T	c.(1975-1977)Gaa>Taa	p.E659*	RP11-680F8.4_ENST00000560740.1_RNA|TJP1_ENST00000545208.2_Nonsense_Mutation_p.E659*|TJP1_ENST00000400011.2_Nonsense_Mutation_p.E663*|TJP1_ENST00000356107.6_Nonsense_Mutation_p.E659*	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	659	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		GCCAGCTTTTCTCTGGCAACA	0.388																																					Melanoma(77;681 1843 6309 6570)	dbGAP											0													124.0	113.0	117.0					15																	30024679		1817	4089	5906	-	-	-	SO:0001587	stop_gained	0				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1975G>T	15.37:g.30024679C>A	ENSP00000281537:p.Glu659*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Nonsense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.E659*	ENST00000346128.6	37	c.1975	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	C	39	7.561993	0.98358	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1092	0.97906	0.0:1.0:0.0:0.0	.	.	.	.	X	659;663;659;659;659	.	.	E	-	1	0	TJP1	27811971	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.677000	0.84024	2.745000	0.94114	0.655000	0.94253	GAA	TJP1	-	smart_Guanylate_kin/L-typ_Ca_channel	ENSG00000104067		0.388	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	89	0.00	0	C	NM_003257		30024679	30024679	-1	no_errors	ENST00000346128	ensembl	human	known	69_37n	nonsense	61	44.04	48	SNP	1.000	A
UAP1L1	91373	genome.wustl.edu	37	9	139972912	139972912	+	Intron	SNP	G	G	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr9:139972912G>T	ENST00000409858.3	+	3	526				UAP1L1_ENST00000476184.1_Intron|UAP1L1_ENST00000360271.3_Silent_p.G28G	NM_207309.2	NP_997192.2	Q3KQV9	UAP1L_HUMAN	UDP-N-acetylglucosamine pyrophosphorylase 1 like 1								uridylyltransferase activity (GO:0070569)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	8	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0821)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;2.96e-05)|Epithelial(140;0.000486)		TGCCTGCAGGGCCAGGCGTAC	0.692																																						dbGAP											0													34.0	33.0	33.0					9																	139972912		2203	4298	6501	-	-	-	SO:0001627	intron_variant	0			AK022632	CCDS7028.2	9q34.3	2014-07-31	2014-07-31		ENSG00000197355	ENSG00000197355			28082	protein-coding gene	gene with protein product							Standard	NM_207309		Approved		uc010ncb.3	Q3KQV9	OTTHUMG00000020962	ENST00000409858.3:c.495-42G>T	9.37:g.139972912G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2AMJ8|Q5SPZ2|Q69YQ3|Q6ZR38	Silent	SNP	pfam_UDPGP_trans	p.G28	ENST00000409858.3	37	c.84	CCDS7028.2	9																																																																																			UAP1L1	-	NULL	ENSG00000197355		0.692	UAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UAP1L1	HGNC	protein_coding	OTTHUMT00000055216.2	21	0.00	0	G	XM_038063		139972912	139972912	+1	no_errors	ENST00000360271	ensembl	human	known	69_37n	silent	8	57.89	11	SNP	0.000	T
ZNF180	7733	genome.wustl.edu	37	19	44980904	44980904	+	Silent	SNP	A	A	T			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr19:44980904A>T	ENST00000221327.4	-	5	2075	c.1794T>A	c.(1792-1794)acT>acA	p.T598T	ZNF180_ENST00000391956.4_Silent_p.T573T|AC069278.4_ENST00000591684.1_lincRNA|ZNF180_ENST00000592529.1_Silent_p.T571T|ZNF180_ENST00000585514.1_5'Flank	NM_013256.3	NP_037388.2	Q9UJW8	ZN180_HUMAN	zinc finger protein 180	598					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(5)|large_intestine(14)|lung(6)|ovary(2)|urinary_tract(1)	33		Prostate(69;0.0435)				CTCCAGTATGAGTTCTCTGAT	0.418																																					Esophageal Squamous(180;1353 2003 32862 46574 49854)	dbGAP											0													107.0	109.0	108.0					19																	44980904		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF192913	CCDS12639.1, CCDS62707.1, CCDS62708.1	19q13.2	2013-01-08	2006-08-22			ENSG00000167384		"""Zinc fingers, C2H2-type"", ""-"""	12970	protein-coding gene	gene with protein product		606740	"""zinc finger protein 180 (HHZ168)"""				Standard	NM_001288762		Approved	HHZ168	uc002ozf.4	Q9UJW8		ENST00000221327.4:c.1794T>A	19.37:g.44980904A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCN6|B3KV56|K7EQX9|Q58F03|Q9P1U2	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T598	ENST00000221327.4	37	c.1794	CCDS12639.1	19																																																																																			ZNF180	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000167384		0.418	ZNF180-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF180	HGNC	protein_coding	OTTHUMT00000451601.1	88	0.00	0	A	NM_013256		44980904	44980904	-1	no_errors	ENST00000221327	ensembl	human	known	69_37n	silent	38	55.29	47	SNP	0.388	T
ZNF469	84627	genome.wustl.edu	37	16	88494721	88494721	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr16:88494721T>A	ENST00000437464.1	+	1	843	c.843T>A	c.(841-843)caT>caA	p.H281Q	ZNF469_ENST00000565624.1_Missense_Mutation_p.H281Q	NM_001127464.1	NP_001120936.1	Q96JG9	ZN469_HUMAN	zinc finger protein 469	281	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(6)|kidney(3)|large_intestine(1)|skin(6)	20						CGGCACTGCATGGGGCCAGCA	0.667																																						dbGAP											0													14.0	20.0	18.0					16																	88494721		692	1588	2280	-	-	-	SO:0001583	missense	0			AB058761	CCDS45544.1	16q24	2010-08-04				ENSG00000225614		"""Zinc fingers, C2H2-type"""	23216	protein-coding gene	gene with protein product		612078				11347906	Standard	NM_001127464		Approved	KIAA1858	uc002fku.2	Q96JG9		ENST00000437464.1:c.843T>A	16.37:g.88494721T>A	ENSP00000402343:p.His281Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H281Q	ENST00000437464.1	37	c.843	CCDS45544.1	16	.	.	.	.	.	.	.	.	.	.	T	6.469	0.454689	0.12283	.	.	ENSG00000225614	ENST00000437464	T	0.10192	2.9	3.24	-4.06	0.03986	.	.	.	.	.	T	0.04770	0.0129	N	0.14661	0.345	0.09310	N	1	B	0.33288	0.406	B	0.28784	0.094	T	0.34850	-0.9812	9	0.51188	T	0.08	.	5.3387	0.15971	0.0:0.4255:0.1386:0.4359	.	281	Q96JG9	ZN469_HUMAN	Q	281	ENSP00000402343:H281Q	ENSP00000402343:H281Q	H	+	3	2	ZNF469	87022222	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-5.450000	0.00121	-0.728000	0.04882	-0.624000	0.04008	CAT	ZNF469	-	NULL	ENSG00000225614		0.667	ZNF469-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF469	HGNC	protein_coding		8	0.00	0	T	NG_012236		88494721	88494721	+1	no_errors	ENST00000437464	ensembl	human	known	69_37n	missense	2	77.78	7	SNP	0.067	A
ZNF691	51058	genome.wustl.edu	37	1	43317408	43317408	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A204-01A-11D-A159-09	TCGA-BH-A204-11A-53D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	2454d30f-1ca5-4f01-bfce-6ae10e84e75a	38726a6a-7c67-43c9-b795-71512b2a6f7f	g.chr1:43317408A>G	ENST00000372506.1	+	4	1119	c.779A>G	c.(778-780)cAc>cGc	p.H260R	ZNF691_ENST00000372504.1_Missense_Mutation_p.H282R|ZNF691_ENST00000372507.1_Missense_Mutation_p.H260R|ZNF691_ENST00000397044.3_Missense_Mutation_p.H291R|ZNF691_ENST00000372508.3_Missense_Mutation_p.H260R|ZNF691_ENST00000372502.1_Missense_Mutation_p.H282R	NM_001242739.1	NP_001229668.1	Q5VV52	ZN691_HUMAN	zinc finger protein 691	291						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(2)|lung(2)|ovary(2)|prostate(1)	7	Ovarian(52;0.00769)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)				TGTGGGAAACACTTCTCCCGG	0.567																																						dbGAP											0													60.0	61.0	61.0					1																	43317408		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS476.1, CCDS55595.1	1p34.2	2013-01-08			ENSG00000164011	ENSG00000164011		"""Zinc fingers, C2H2-type"""	28028	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001242739		Approved	Zfp691	uc021omh.1	Q5VV52	OTTHUMG00000007623	ENST00000372506.1:c.779A>G	1.37:g.43317408A>G	ENSP00000361584:p.His260Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXP6|B4DJR7|O95878|Q9NWE8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H291R	ENST00000372506.1	37	c.872	CCDS476.1	1	.	.	.	.	.	.	.	.	.	.	A	15.52	2.856971	0.51376	.	.	ENSG00000164011	ENST00000372508;ENST00000372507;ENST00000372506;ENST00000397044;ENST00000372504;ENST00000372503;ENST00000372502	T;T;T;T;T;T	0.48836	0.8;0.8;0.8;0.8;0.8;0.8	5.06	5.06	0.68205	Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.113396	0.40222	N	0.001142	T	0.28599	0.0708	N	0.03177	-0.4	0.28139	N	0.929852	P;P	0.42584	0.784;0.784	P;P	0.45167	0.472;0.472	T	0.13602	-1.0503	10	0.72032	D	0.01	-14.7044	8.0148	0.30374	0.9072:0.0:0.0928:0.0	.	291;291	B4DJR7;Q5VV52	.;ZN691_HUMAN	R	260;260;260;291;282;291;282	ENSP00000361586:H260R;ENSP00000361585:H260R;ENSP00000361584:H260R;ENSP00000380237:H291R;ENSP00000361582:H282R;ENSP00000361580:H282R	ENSP00000361580:H282R	H	+	2	0	ZNF691	43089995	0.002000	0.14202	0.988000	0.46212	0.959000	0.62525	1.538000	0.36094	2.208000	0.71279	0.455000	0.32223	CAC	ZNF691	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000164011		0.567	ZNF691-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF691	HGNC	protein_coding	OTTHUMT00000020192.1	17	0.00	0	A	NM_015911		43317408	43317408	+1	no_errors	ENST00000397044	ensembl	human	known	69_37n	missense	2	88.24	15	SNP	0.845	G
