#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
AGAP3	116988	genome.wustl.edu	37	7	150840935	150840935	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr7:150840935G>A	ENST00000463381.1	+	16	2144	c.1648G>A	c.(1648-1650)Ggg>Agg	p.G550R	AGAP3_ENST00000397238.2_Missense_Mutation_p.G881R	NM_001281300.1	NP_001268229.1	Q96P47	AGAP3_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 3	845	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				cellular response to reactive oxygen species (GO:0034614)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein import into nucleus, translocation (GO:0000060)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	cell periphery (GO:0071944)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|liver(2)|lung(9)|ovary(2)|prostate(3)|urinary_tract(1)	28						TGGCTGCCCTGGGGAGGGCTG	0.657																																						dbGAP											0													54.0	58.0	57.0					7																	150840935		1992	4168	6160	-	-	-	SO:0001583	missense	0			AF413079	CCDS43681.1, CCDS55185.1, CCDS64802.1	7q36.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000133612	ENSG00000133612		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16923	protein-coding gene	gene with protein product			"""centaurin, gamma 3"""	CENTG3			Standard	NM_001042535		Approved		uc003wjg.1	Q96P47	OTTHUMG00000158724	ENST00000463381.1:c.1648G>A	7.37:g.150840935G>A	ENSP00000418016:p.Gly550Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNZ8|E9PAL8|Q59EN0|Q96RK3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.G881R	ENST00000463381.1	37	c.2641		7	.	.	.	.	.	.	.	.	.	.	G	14.05	2.419913	0.42918	.	.	ENSG00000133612	ENST00000463381;ENST00000397232;ENST00000397238;ENST00000335355	T;T	0.68331	4.18;-0.32	4.87	4.87	0.63330	.	0.486110	0.18966	N	0.126267	T	0.46814	0.1412	N	0.01576	-0.805	0.80722	D	1	P;P;P;P	0.41188	0.741;0.473;0.589;0.568	P;B;B;B	0.48334	0.574;0.288;0.164;0.264	T	0.53201	-0.8472	10	0.34782	T	0.22	.	10.9257	0.47189	0.0974:0.0:0.9026:0.0	.	845;380;881;550	Q96P47;E7ETI2;Q96P47-4;B3KNZ8	AGAP3_HUMAN;.;.;.	R	550;380;881;845	ENSP00000418016:G550R;ENSP00000380413:G881R	ENSP00000334157:G845R	G	+	1	0	AGAP3	150471868	0.042000	0.20092	0.980000	0.43619	0.996000	0.88848	0.667000	0.25112	2.375000	0.81037	0.655000	0.94253	GGG	AGAP3	-	NULL	ENSG00000133612		0.657	AGAP3-002	NOVEL	basic|exp_conf	protein_coding	AGAP3	HGNC	protein_coding	OTTHUMT00000351909.2	15	0.00	0	G	NM_031946		150840935	150840935	+1	no_errors	ENST00000397238	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	0.997	A
ALMS1	7840	genome.wustl.edu	37	2	73717343	73717343	+	Missense_Mutation	SNP	C	C	G	rs200718841		TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr2:73717343C>G	ENST00000264448.6	+	10	8365	c.8254C>G	c.(8254-8256)Cat>Gat	p.H2752D	AC096546.1_ENST00000408160.1_RNA|ALMS1_ENST00000409009.1_Missense_Mutation_p.H2710D	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2752					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						ATTTAATTCTCATTTCACTGA	0.383																																						dbGAP											0													98.0	91.0	93.0					2																	73717343		1817	4083	5900	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8254C>G	2.37:g.73717343C>G	ENSP00000264448:p.His2752Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.H2752D	ENST00000264448.6	37	c.8254	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998175	0.35226	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06371	3.31;3.31	4.26	3.36	0.38483	.	0.329287	0.22365	N	0.061038	T	0.09024	0.0223	L	0.39898	1.24	0.80722	D	1	D;D;D	0.53462	0.96;0.96;0.96	P;P;P	0.49085	0.6;0.6;0.6	T	0.09250	-1.0683	10	0.66056	D	0.02	.	9.4144	0.38512	0.2121:0.7879:0.0:0.0	.	2752;2710;2752	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	D	2710;2752	ENSP00000386627:H2710D;ENSP00000264448:H2752D	ENSP00000264448:H2752D	H	+	1	0	ALMS1	73570851	0.935000	0.31712	0.997000	0.53966	0.986000	0.74619	0.423000	0.21313	1.331000	0.45412	0.508000	0.49915	CAT	ALMS1	-	NULL	ENSG00000116127		0.383	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	87	0.00	0	C	NM_015120		73717343	73717343	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	19	24.00	6	SNP	0.998	G
ALMS1	7840	genome.wustl.edu	37	2	73717959	73717959	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr2:73717959C>T	ENST00000264448.6	+	10	8981	c.8870C>T	c.(8869-8871)tCa>tTa	p.S2957L	AC096546.1_ENST00000408160.1_RNA|ALMS1_ENST00000409009.1_Missense_Mutation_p.S2915L	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2957					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TCTATAGCTTCAGACCTTCCG	0.443																																						dbGAP											0													150.0	141.0	144.0					2																	73717959		1879	4109	5988	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8870C>T	2.37:g.73717959C>T	ENSP00000264448:p.Ser2957Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.S2957L	ENST00000264448.6	37	c.8870	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	c	5.706	0.314693	0.10789	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	T;T	0.06294	3.32;3.32	4.78	1.88	0.25563	.	1.102770	0.06973	N	0.818439	T	0.07279	0.0184	L	0.43152	1.355	0.27990	N	0.93569	B;B;B	0.12013	0.005;0.005;0.005	B;B;B	0.14578	0.011;0.011;0.011	T	0.36432	-0.9748	10	0.72032	D	0.01	.	5.883	0.18866	0.0:0.6444:0.0:0.3556	.	2957;2915;2957	Q8TCU4-3;B8ZZJ3;Q8TCU4	.;.;ALMS1_HUMAN	L	2915;2957	ENSP00000386627:S2915L;ENSP00000264448:S2957L	ENSP00000264448:S2957L	S	+	2	0	ALMS1	73571467	0.663000	0.27448	0.360000	0.25837	0.197000	0.23852	0.385000	0.20685	0.423000	0.26033	0.650000	0.86243	TCA	ALMS1	-	NULL	ENSG00000116127		0.443	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	115	0.00	0	C	NM_015120		73717959	73717959	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.398	T
ALMS1	7840	genome.wustl.edu	37	2	73718057	73718057	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr2:73718057C>T	ENST00000264448.6	+	10	9079	c.8968C>T	c.(8968-8970)Cag>Tag	p.Q2990*	AC096546.1_ENST00000408160.1_RNA|ALMS1_ENST00000409009.1_Nonsense_Mutation_p.Q2948*	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	2990					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						TCCTCAAGGTCAGGATTGTGT	0.408																																						dbGAP											0													113.0	107.0	109.0					2																	73718057		1894	4118	6012	-	-	-	SO:0001587	stop_gained	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.8968C>T	2.37:g.73718057C>T	ENSP00000264448:p.Gln2990*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Nonsense_Mutation	SNP	NULL	p.Q2990*	ENST00000264448.6	37	c.8968	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	C	50	16.315301	0.99860	.	.	ENSG00000116127	ENST00000409009;ENST00000264448	.	.	.	4.78	3.88	0.44766	.	0.273132	0.26742	N	0.022733	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	11.4162	0.49954	0.0:0.8:0.2:0.0	.	.	.	.	X	2948;2990	.	ENSP00000264448:Q2990X	Q	+	1	0	ALMS1	73571565	1.000000	0.71417	0.934000	0.37439	0.871000	0.50021	1.288000	0.33296	1.571000	0.49722	0.650000	0.86243	CAG	ALMS1	-	NULL	ENSG00000116127		0.408	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	102	0.00	0	C	NM_015120		73718057	73718057	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	nonsense	18	30.77	8	SNP	0.944	T
ASMT	438	genome.wustl.edu	37	X	1755428	1755428	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chrX:1755428G>C	ENST00000381229.4	+	7	837	c.801G>C	c.(799-801)gaG>gaC	p.E267D	ASMT_ENST00000381233.3_Missense_Mutation_p.E220D|ASMT_ENST00000381241.3_Missense_Mutation_p.E295D			P46597	ASMT_HUMAN	acetylserotonin O-methyltransferase	267					cellular nitrogen compound metabolic process (GO:0034641)|indolalkylamine biosynthetic process (GO:0046219)|melatonin biosynthetic process (GO:0030187)|negative regulation of male gonad development (GO:2000019)|small molecule metabolic process (GO:0044281)|translation (GO:0006412)	cytosol (GO:0005829)	acetylserotonin O-methyltransferase activity (GO:0017096)|identical protein binding (GO:0042802)|O-methyltransferase activity (GO:0008171)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(9)|skin(1)	16		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Melatonin(DB01065)	ACCTGCTGGAGAGGATCTACC	0.527																																						dbGAP											0													363.0	325.0	338.0					X																	1755428		2203	4296	6499	-	-	-	SO:0001583	missense	0			M83779	CCDS14117.1, CCDS55364.1	Xp22.3 and Yp11.3	2008-02-05			ENSG00000196433	ENSG00000196433	2.1.1.4	"""Pseudoautosomal regions / PAR1"""	750	protein-coding gene	gene with protein product		300015, 402500				8397829, 7989373	Standard	NM_004043		Approved	HIOMT, ASMTY, HIOMTY	uc010ncy.3	P46597	OTTHUMG00000021065	ENST00000381229.4:c.801G>C	X.37:g.1755428G>C	ENSP00000370627:p.Glu267Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC33|Q16598|Q5JQ72|Q5JQ73	Missense_Mutation	SNP	pfam_O_MeTrfase_2,pirsf_O-MeTrfase_CAOMT-type	p.E295D	ENST00000381229.4	37	c.885		X	.	.	.	.	.	.	.	.	.	.	.	1.828	-0.470617	0.04445	.	.	ENSG00000196433	ENST00000381241;ENST00000381229;ENST00000381233;ENST00000432523	T;T;T;T	0.19669	2.13;2.13;2.13;2.13	2.33	1.26	0.21427	.	2.288380	0.01873	U	0.037336	T	0.16385	0.0394	L	0.46157	1.445	0.09310	N	1	B;P	0.35226	0.296;0.491	B;B	0.26416	0.069;0.069	T	0.23368	-1.0190	10	0.35671	T	0.21	.	2.4277	0.04463	0.2301:0.0:0.3157:0.4542	.	220;295	P46597-2;P46597-3	.;.	D	295;267;220;46	ENSP00000370639:E295D;ENSP00000370627:E267D;ENSP00000370631:E220D;ENSP00000392053:E46D	ENSP00000370627:E267D	E	+	3	2	ASMT	1715428	0.000000	0.05858	0.013000	0.15412	0.013000	0.08279	-0.598000	0.05706	0.958000	0.37956	0.453000	0.30009	GAG	ASMT	-	pfam_O_MeTrfase_2,pirsf_O-MeTrfase_CAOMT-type	ENSG00000196433		0.527	ASMT-002	KNOWN	basic|appris_principal	protein_coding	ASMT	HGNC	protein_coding	OTTHUMT00000055612.1	237	0.00	0	G	NM_004043		1755428	1755428	+1	no_errors	ENST00000381241	ensembl	human	known	69_37n	missense	80	20.00	20	SNP	0.000	C
ARMCX3	51566	genome.wustl.edu	37	X	100880821	100880821	+	Silent	SNP	A	A	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chrX:100880821A>G	ENST00000341189.4	+	5	1718	c.852A>G	c.(850-852)caA>caG	p.Q284Q	ARMCX3_ENST00000537169.1_Silent_p.Q284Q|ARMCX3_ENST00000471229.2_Silent_p.Q284Q|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3-AS1_ENST00000454228.1_RNA	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	284					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						TCAGGGCCCAAGTACCATCTT	0.378																																						dbGAP											0													55.0	52.0	53.0					X																	100880821		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.852A>G	X.37:g.100880821A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HC6|Q7LCF5|Q9NPE4	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.Q284	ENST00000341189.4	37	c.852	CCDS14489.1	X																																																																																			ARMCX3	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000102401		0.378	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX3	HGNC	protein_coding	OTTHUMT00000057568.2	52	0.00	0	A	NM_016607		100880821	100880821	+1	no_errors	ENST00000341189	ensembl	human	known	69_37n	silent	21	16.00	4	SNP	0.991	G
BPIFB1	92747	genome.wustl.edu	37	20	31890728	31890728	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr20:31890728G>A	ENST00000253354.1	+	11	1149	c.988G>A	c.(988-990)Gat>Aat	p.D330N	BPIFB1_ENST00000464032.1_3'UTR	NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1	330					innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										CCAGGCTGCAGATAAGCTGGG	0.582																																						dbGAP											0													77.0	69.0	71.0					20																	31890728		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.988G>A	20.37:g.31890728G>A	ENSP00000253354:p.Asp330Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,pirsf_PLUNC_long_form	p.D330N	ENST00000253354.1	37	c.988	CCDS13218.1	20	.	.	.	.	.	.	.	.	.	.	G	4.104	0.017326	0.07959	.	.	ENSG00000125999	ENST00000253354	T	0.06449	3.3	5.28	-4.01	0.04045	.	1.423640	0.03981	N	0.293292	T	0.05090	0.0136	L	0.29908	0.895	0.09310	N	1	B	0.12630	0.006	B	0.08055	0.003	T	0.45131	-0.9282	10	0.08837	T	0.75	2.4199	11.554	0.50737	0.6959:0.0:0.3041:0.0	.	330	Q8TDL5	BPIB1_HUMAN	N	330	ENSP00000253354:D330N	ENSP00000253354:D330N	D	+	1	0	BPIFB1	31354389	0.000000	0.05858	0.000000	0.03702	0.196000	0.23810	-0.318000	0.08050	-0.984000	0.03507	0.462000	0.41574	GAT	BPIFB1	-	superfamily_Bactericidal_perm-incr_a/b_dom,pirsf_PLUNC_long_form	ENSG00000125999		0.582	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB1	HGNC	protein_coding	OTTHUMT00000106499.2	53	0.00	0	G	NM_033197		31890728	31890728	+1	no_errors	ENST00000253354	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.000	A
EFCC1	79825	genome.wustl.edu	37	3	128758648	128758648	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr3:128758648C>G	ENST00000480450.1	+	8	1754	c.1754C>G	c.(1753-1755)tCt>tGt	p.S585C	EFCC1_ENST00000436022.2_Missense_Mutation_p.S148C			Q9HA90	EFCC1_HUMAN	EF-hand and coiled-coil domain containing 1	585	Poly-Ala.						calcium ion binding (GO:0005509)										GCACCAGCCTCTGCAGCAGCT	0.667																																						dbGAP											0													53.0	51.0	52.0					3																	128758648		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022119	CCDS3054.1, CCDS3054.2	3q21.3	2013-01-11	2013-01-11	2013-01-11	ENSG00000114654	ENSG00000114654		"""EF-hand domain containing"""	25692	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 73"", ""coiled-coil domain containing 48"""	C3orf73, CCDC48			Standard	NM_024768		Approved	FLJ12057	uc011bkt.2	Q9HA90	OTTHUMG00000158996	ENST00000480450.1:c.1754C>G	3.37:g.128758648C>G	ENSP00000420075:p.Ser585Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYE2	Missense_Mutation	SNP	NULL	p.S148C	ENST00000480450.1	37	c.443	CCDS3054.2	3	.	.	.	.	.	.	.	.	.	.	C	7.232	0.599436	0.13939	.	.	ENSG00000114654	ENST00000480450;ENST00000436022	T;T	0.49432	0.78;0.78	3.94	2.97	0.34412	.	0.759992	0.12015	N	0.507504	T	0.50956	0.1646	L	0.51422	1.61	0.09310	N	1	D	0.61697	0.99	P	0.53450	0.726	T	0.36286	-0.9754	10	0.59425	D	0.04	.	7.7979	0.29158	0.27:0.73:0.0:0.0	.	585	Q9HA90	CCD48_HUMAN	C	585;148	ENSP00000420075:S585C;ENSP00000414597:S148C	ENSP00000414597:S148C	S	+	2	0	CCDC48	130241338	0.004000	0.15560	0.010000	0.14722	0.018000	0.09664	1.374000	0.34283	2.020000	0.59435	0.491000	0.48974	TCT	CCDC48	-	NULL	ENSG00000114654		0.667	EFCC1-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CCDC48	HGNC	protein_coding	OTTHUMT00000352832.1	27	0.00	0	C	NM_024768		128758648	128758648	+1	no_errors	ENST00000436022	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.003	G
CFH	3075	genome.wustl.edu	37	1	196654268	196654268	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:196654268G>A	ENST00000359637.2	+	6	735	c.673G>A	c.(673-675)Gaa>Aaa	p.E225K	CFH_ENST00000439155.2_Missense_Mutation_p.E289K|CFH_ENST00000367429.4_Missense_Mutation_p.E289K			P08603	CFAH_HUMAN	complement factor H	289	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heparan sulfate proteoglycan binding (GO:0043395)|heparin binding (GO:0008201)			NS(3)|breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(24)|lung(33)|ovary(1)|prostate(5)|skin(9)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	101						AACTGGAGATGAAATCACGTA	0.388																																						dbGAP											0													122.0	112.0	116.0					1																	196654268		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y00716	CCDS1385.1	1q32	2014-09-17	2004-08-09	2004-08-12	ENSG00000000971	ENSG00000000971		"""Complement system"""	4883	protein-coding gene	gene with protein product	"""beta-1H"", ""H factor 2 (complement)"", ""age-related maculopathy susceptibility 1"""	134370	"""H factor 1 (complement)"""	HF, HF1, HF2		2889480, 2963625	Standard	NM_000186		Approved	HUS, FHL1, ARMS1, ARMD4	uc001gtj.4	P08603	OTTHUMG00000035607	ENST00000359637.2:c.673G>A	1.37:g.196654268G>A	ENSP00000352658:p.Glu225Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL14|P78435|Q14570|Q2TAZ5|Q38G77|Q5TFM3|Q8N708|Q9NU86	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.E289K	ENST00000359637.2	37	c.865		1	.	.	.	.	.	.	.	.	.	.	G	11.02	1.517476	0.27123	.	.	ENSG00000000971	ENST00000367429;ENST00000439155;ENST00000391986;ENST00000359637	T;T;T	0.62364	0.03;0.03;0.03	5.11	0.415	0.16411	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.56396	0.1982	L	0.37561	1.115	0.24263	N	0.995278	P;B;B;B	0.45283	0.855;0.167;0.356;0.082	P;B;B;B	0.56216	0.794;0.065;0.102;0.065	T	0.47142	-0.9140	9	0.09338	T	0.73	.	4.4382	0.11561	0.2462:0.0:0.599:0.1548	.	225;289;289;289	Q5TFM2;P08603-2;P08603;F8WDX4	.;.;CFAH_HUMAN;.	K	289;289;289;225	ENSP00000356399:E289K;ENSP00000402656:E289K;ENSP00000352658:E225K	ENSP00000352658:E225K	E	+	1	0	CFH	194920891	0.000000	0.05858	0.443000	0.26883	0.444000	0.32077	-0.541000	0.06099	-0.170000	0.10816	0.585000	0.79938	GAA	CFH	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000000971		0.388	CFH-002	PUTATIVE	basic|exp_conf	protein_coding	CFH	HGNC	protein_coding	OTTHUMT00000087502.1	55	0.00	0	G	NM_000186		196654268	196654268	+1	no_errors	ENST00000367429	ensembl	human	known	69_37n	missense	6	53.85	7	SNP	0.791	A
CHRDL1	91851	genome.wustl.edu	37	X	110035325	110035325	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chrX:110035325G>C	ENST00000372045.1	-	2	198	c.67C>G	c.(67-69)Caa>Gaa	p.Q23E	CHRDL1_ENST00000444321.2_Missense_Mutation_p.Q29E|CHRDL1_ENST00000394797.4_Missense_Mutation_p.Q29E|CHRDL1_ENST00000372042.1_Missense_Mutation_p.Q29E|CHRDL1_ENST00000434224.1_Missense_Mutation_p.Q29E|CHRDL1_ENST00000218054.4_Missense_Mutation_p.Q29E|CHRDL1_ENST00000482160.1_Missense_Mutation_p.Q29E			Q9BU40	CRDL1_HUMAN	chordin-like 1	23					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|compound eye development (GO:0048749)|eye development (GO:0001654)|negative regulation of BMP signaling pathway (GO:0030514)|nervous system development (GO:0007399)|ossification (GO:0001503)	extracellular region (GO:0005576)				endometrium(1)|large_intestine(12)|liver(1)|lung(15)|prostate(1)|skin(1)	31						CGTTTTACTTGCTCTGTTTTG	0.328																																						dbGAP											0													98.0	83.0	88.0					X																	110035325		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL049176	CCDS14553.1, CCDS48148.1, CCDS48149.1, CCDS48150.1, CCDS48148.2	Xq23	2014-01-31			ENSG00000101938	ENSG00000101938			29861	protein-coding gene	gene with protein product		300350	"""megalocornea 1 (X-linked)"""	MGC1		11441185, 11118896, 22284829	Standard	NM_001143981		Approved	NRLN1, CHL	uc004eow.3	Q9BU40	OTTHUMG00000022199	ENST00000372045.1:c.67C>G	X.37:g.110035325G>C	ENSP00000361115:p.Gln23Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKD0|B4DMP3|D3DUY6|E9PGS5|Q539E4|Q9Y3H7	Missense_Mutation	SNP	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C	p.Q29E	ENST00000372045.1	37	c.85		X	.	.	.	.	.	.	.	.	.	.	G	1.029	-0.682366	0.03353	.	.	ENSG00000101938	ENST00000372045;ENST00000434224;ENST00000218054;ENST00000394797;ENST00000372042;ENST00000482160;ENST00000444321	T;T;T;T;T;T;T	0.29655	2.33;1.56;2.33;2.33;2.6;1.57;2.33	5.06	5.06	0.68205	.	0.181162	0.49916	D	0.000128	T	0.23611	0.0571	L	0.29908	0.895	0.39106	D	0.961377	B;B;B;B;B;B;B	0.21381	0.015;0.015;0.026;0.015;0.015;0.015;0.055	B;B;B;B;B;B;B	0.22386	0.01;0.01;0.022;0.01;0.01;0.01;0.039	T	0.07424	-1.0773	9	.	.	.	0.6323	14.6914	0.69087	0.0:0.0:1.0:0.0	.	29;29;23;8;23;29;29	B4DMP3;E9PGS5;Q9BU40-2;Q59FB2;Q9BU40;D3DUY6;D3YTA8	.;.;.;.;CRDL1_HUMAN;.;.	E	23;29;29;29;29;29;29	ENSP00000361115:Q23E;ENSP00000389627:Q29E;ENSP00000218054:Q29E;ENSP00000378276:Q29E;ENSP00000361112:Q29E;ENSP00000418443:Q29E;ENSP00000399739:Q29E	.	Q	-	1	0	CHRDL1	109921981	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.141000	0.64814	2.426000	0.82243	0.506000	0.49869	CAA	CHRDL1	-	NULL	ENSG00000101938		0.328	CHRDL1-001	KNOWN	basic	protein_coding	CHRDL1	HGNC	protein_coding	OTTHUMT00000057912.1	161	0.00	0	G	NM_145234		110035325	110035325	-1	no_errors	ENST00000372042	ensembl	human	known	69_37n	missense	54	18.18	12	SNP	1.000	C
CLEC12A	160364	genome.wustl.edu	37	12	10137481	10137481	+	Silent	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr12:10137481C>T	ENST00000304361.4	+	6	836	c.654C>T	c.(652-654)aaC>aaT	p.N218N	CLEC12A_ENST00000350667.4_Silent_p.N185N|CLEC12A_ENST00000355690.4_Silent_p.N228N	NM_138337.5|NM_201623.3	NP_612210.4|NP_963917.2	Q5QGZ9	CL12A_HUMAN	C-type lectin domain family 12, member A	218	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)			breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	16						TTATAAGAAACGCACCTGACT	0.284																																					Melanoma(197;1487 2125 16611 22221 34855)	dbGAP											0													52.0	52.0	52.0					12																	10137481		2196	4294	6490	-	-	-	SO:0001819	synonymous_variant	0			AY498550	CCDS8608.1, CCDS8609.1, CCDS55803.1, CCDS73442.1	12p13.31	2010-08-17			ENSG00000172322	ENSG00000172322		"""C-type lectin domain containing"""	31713	protein-coding gene	gene with protein product		612088					Standard	NM_201623		Approved	CLL-1, MICL	uc001qwq.3	Q5QGZ9		ENST00000304361.4:c.654C>T	12.37:g.10137481C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA16|Q6P4H1|Q6RH77|Q6RH78|Q8TDQ6	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.N228	ENST00000304361.4	37	c.684	CCDS8608.1	12																																																																																			CLEC12A	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000172322		0.284	CLEC12A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC12A	HGNC	protein_coding	OTTHUMT00000399545.1	139	0.71	1	C	NM_138337		10137481	10137481	+1	no_errors	ENST00000355690	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	0.001	T
CSMD2	114784	genome.wustl.edu	37	1	34002643	34002643	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:34002643C>G	ENST00000373381.4	-	62	10034	c.9858G>C	c.(9856-9858)caG>caC	p.Q3286H		NM_001281956.1|NM_052896.3	NP_001268885.1|NP_443128.2	Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	3142						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAGAATTGTTCTGTATCCCAA	0.517																																						dbGAP											0													160.0	134.0	143.0					1																	34002643		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373381.4:c.9858G>C	1.37:g.34002643C>G	ENSP00000362479:p.Gln3286His	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.Q3286H	ENST00000373381.4	37	c.9858		1	.	.	.	.	.	.	.	.	.	.	C	24.0	4.487486	0.84854	.	.	ENSG00000121904	ENST00000373381	T	0.64260	-0.09	5.59	5.59	0.84812	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	L	0.43701	1.375	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.79108	0.99;0.992	T	0.65755	-0.6091	10	0.20046	T	0.44	.	18.5881	0.91197	0.0:1.0:0.0:0.0	.	3142;3286	Q7Z408;E7EUA6	CSMD2_HUMAN;.	H	3286	ENSP00000362479:Q3286H	ENSP00000241312:Q3142H	Q	-	3	2	CSMD2	33775230	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.277000	0.51654	2.629000	0.89072	0.555000	0.69702	CAG	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000121904		0.517	CSMD2-201	KNOWN	basic|appris_principal	protein_coding	CSMD2	HGNC	protein_coding		95	0.00	0	C	NM_052896		34002643	34002643	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	31	26.19	11	SNP	1.000	G
CTSE	1510	genome.wustl.edu	37	1	206331149	206331149	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:206331149G>A	ENST00000360218.2	+	8	1117	c.1013G>A	c.(1012-1014)gGa>gAa	p.G338E	CTSE_ENST00000358184.2_Silent_p.G385G|CTSE_ENST00000361052.3_Silent_p.G390G|CTSE_ENST00000432969.2_Missense_Mutation_p.G263E	NM_148964.2	NP_683865.1	P14091	CATE_HUMAN	cathepsin E	0					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|digestion (GO:0007586)|protein autoprocessing (GO:0016540)	endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)	aspartic-type endopeptidase activity (GO:0004190)	p.G385G(1)		endometrium(2)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(3)	16			BRCA - Breast invasive adenocarcinoma(75;0.0754)			TTGACCGTGGGAATAACCGTG	0.562																																						dbGAP											1	Substitution - coding silent(1)	skin(1)											141.0	146.0	145.0					1																	206331149		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC042537	CCDS73012.1, CCDS73013.1	1q32.1	2008-02-05			ENSG00000196188	ENSG00000196188	3.4.23.5	"""Cathepsins"""	2530	protein-coding gene	gene with protein product		116890				2369841, 2674141	Standard	NM_001910		Approved		uc001hdu.3	P14091	OTTHUMG00000036121	ENST00000360218.2:c.1013G>A	1.37:g.206331149G>A	ENSP00000353350:p.Gly338Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TZ01|Q5TZ02|Q9NY58|Q9UCE3|Q9UCE4	Missense_Mutation	SNP	pfam_Peptidase_A1,pfam_Propep_A1,superfamily_Peptidase_aspartic,prints_Peptidase_A1	p.G338E	ENST00000360218.2	37	c.1013	CCDS1461.1	1	.	.	.	.	.	.	.	.	.	.	g	18.72	3.683814	0.68157	.	.	ENSG00000196188	ENST00000360218;ENST00000432969	T;T	0.69175	0.3;-0.38	5.09	-3.12	0.05282	.	0.000000	0.64402	D	0.000001	T	0.40791	0.1131	.	.	.	0.20196	N	0.999922	B;B	0.11235	0.002;0.004	B;B	0.11329	0.003;0.006	T	0.08411	-1.0723	9	0.33141	T	0.24	.	1.6556	0.02781	0.4128:0.1007:0.2821:0.2045	.	263;338	B4DNU8;P14091-2	.;.	E	338;263	ENSP00000353350:G338E;ENSP00000394607:G263E	ENSP00000353350:G338E	G	+	2	0	CTSE	204497772	0.000000	0.05858	0.979000	0.43373	0.988000	0.76386	-2.478000	0.00984	-0.335000	0.08451	0.549000	0.68633	GGA	CTSE	-	NULL	ENSG00000196188		0.562	CTSE-002	KNOWN	basic|CCDS	protein_coding	CTSE	HGNC	protein_coding	OTTHUMT00000087999.1	128	0.00	0	G	NM_001910		206331149	206331149	+1	no_errors	ENST00000360218	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.390	A
CR2	1380	genome.wustl.edu	37	1	207648485	207648485	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:207648485C>G	ENST00000367058.3	+	13	2652	c.2463C>G	c.(2461-2463)atC>atG	p.I821M	CR2_ENST00000367059.3_Missense_Mutation_p.I821M|CR2_ENST00000367057.3_Missense_Mutation_p.I880M|CR2_ENST00000458541.2_Missense_Mutation_p.I794M	NM_001877.4	NP_001868.2	P20023	CR2_HUMAN	complement component (3d/Epstein Barr virus) receptor 2	821	Sushi 13. {ECO:0000255|PROSITE- ProRule:PRU00302}.				B cell differentiation (GO:0030183)|B cell proliferation (GO:0042100)|complement activation, classical pathway (GO:0006958)|immune response (GO:0006955)|innate immune response (GO:0045087)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	complement binding (GO:0001848)|complement receptor activity (GO:0004875)|DNA binding (GO:0003677)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			NS(2)|breast(3)|endometrium(4)|kidney(3)|large_intestine(12)|lung(26)|ovary(1)|pancreas(1)|prostate(1)|skin(12)|upper_aerodigestive_tract(3)|urinary_tract(1)	69						CTGGCTTCATCATGAATGGTA	0.418																																						dbGAP											0													170.0	151.0	157.0					1																	207648485		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26004	CCDS1478.1, CCDS31007.1	1q32	2014-09-17			ENSG00000117322	ENSG00000117322		"""CD molecules"", ""Complement system"""	2336	protein-coding gene	gene with protein product		120650					Standard	NM_001006658		Approved	CD21	uc001hfv.3	P20023	OTTHUMG00000036307	ENST00000367058.3:c.2463C>G	1.37:g.207648485C>G	ENSP00000356025:p.Ile821Met	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JHD2|Q13866|Q14212|Q53EL2|Q5BKT9|Q5SR46|Q5SR48	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.I880M	ENST00000367058.3	37	c.2640	CCDS1478.1	1	.	.	.	.	.	.	.	.	.	.	C	14.81	2.647947	0.47258	.	.	ENSG00000117322	ENST00000367058;ENST00000367057;ENST00000367059;ENST00000458541	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	4.7	2.76	0.32466	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.69233	0.3088	L	0.55017	1.72	0.30510	N	0.769563	D;D;D	0.65815	0.978;0.985;0.995	D;P;D	0.65874	0.917;0.862;0.939	T	0.64757	-0.6332	9	0.52906	T	0.07	.	6.542	0.22385	0.0:0.7133:0.1851:0.1016	.	821;821;880	Q5SR47;P20023;P20023-3	.;CR2_HUMAN;.	M	821;880;821;794	ENSP00000356025:I821M;ENSP00000356024:I880M;ENSP00000356026:I821M;ENSP00000404222:I794M	ENSP00000356024:I880M	I	+	3	3	CR2	205715108	0.840000	0.29493	1.000000	0.80357	0.623000	0.37688	0.294000	0.19047	0.639000	0.30564	0.655000	0.94253	ATC	CR2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000117322		0.418	CR2-001	KNOWN	basic|CCDS	protein_coding	CR2	HGNC	protein_coding	OTTHUMT00000088274.1	168	0.00	0	C	NM_001877		207648485	207648485	+1	no_errors	ENST00000367057	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	1.000	G
CYP2B6	1555	genome.wustl.edu	37	19	41510050	41510050	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr19:41510050C>G	ENST00000324071.4	+	2	323	c.316C>G	c.(316-318)Cca>Gca	p.P106A	CYP2B6_ENST00000593831.1_Missense_Mutation_p.P30A|CYP2B6_ENST00000330446.5_Missense_Mutation_p.P66A|CYP2B6_ENST00000598834.1_3'UTR	NM_000767.4	NP_000758.1	P20813	CP2B6_HUMAN	cytochrome P450, family 2, subfamily B, polypeptide 6	106					cellular ketone metabolic process (GO:0042180)|drug metabolic process (GO:0017144)|exogenous drug catabolic process (GO:0042738)|oxidation-reduction process (GO:0055114)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced flavin or flavoprotein as one donor, and incorporation of one atom of oxygen (GO:0016712)			NS(1)|breast(1)|endometrium(5)|kidney(1)|lung(14)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	28			LUSC - Lung squamous cell carcinoma(20;0.00322)		Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Antipyrine(DB01435)|Artemether(DB06697)|Atorvastatin(DB01076)|Azelastine(DB00972)|Benzphetamine(DB00865)|Benzyl alcohol(DB06770)|Bifonazole(DB04794)|Brompheniramine(DB00835)|Bupropion(DB01156)|Carbamazepine(DB00564)|Carbinoxamine(DB00748)|Cholecalciferol(DB00169)|Cinnarizine(DB00568)|Cisapride(DB00604)|Cisplatin(DB00515)|Citalopram(DB00215)|Clobazam(DB00349)|Clofibrate(DB00636)|Clopidogrel(DB00758)|Clotiazepam(DB01559)|Clotrimazole(DB00257)|Colchicine(DB01394)|Cyclophosphamide(DB00531)|Desipramine(DB01151)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diphenhydramine(DB01075)|Domperidone(DB01184)|Doxorubicin(DB00997)|Efavirenz(DB00625)|Enzalutamide(DB08899)|Epinastine(DB00751)|Erythromycin(DB00199)|Estrone(DB00655)|Ethanol(DB00898)|Ethylmorphine(DB01466)|Flunarizine(DB04841)|Flunitrazepam(DB01544)|Fluoxetine(DB00472)|Fluvastatin(DB01095)|Fluvoxamine(DB00176)|Fosphenytoin(DB01320)|Halothane(DB01159)|Ifosfamide(DB01181)|Imipramine(DB00458)|Irinotecan(DB00762)|Isoflurane(DB00753)|Itraconazole(DB01167)|Ketamine(DB01221)|Ketobemidone(DB06738)|Ketoconazole(DB01026)|Lidocaine(DB00281)|Loperamide(DB00836)|Lopinavir(DB01601)|Lorcaserin(DB04871)|Malathion(DB00772)|Memantine(DB01043)|Methadone(DB00333)|Methimazole(DB00763)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyltestosterone(DB06710)|Mexiletine(DB00379)|Mianserin(DB06148)|Miconazole(DB01110)|Midazolam(DB00683)|Modafinil(DB00745)|Nelfinavir(DB00220)|Nevirapine(DB00238)|Nicardipine(DB00622)|Nicotine(DB00184)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nitric Oxide(DB00435)|Orphenadrine(DB01173)|Ospemifene(DB04938)|Paroxetine(DB00715)|Perhexiline(DB01074)|Permethrin(DB04930)|Perphenazine(DB00850)|Pethidine(DB00454)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Prasugrel(DB06209)|Primidone(DB00794)|Promethazine(DB01069)|Propofol(DB00818)|Quinidine(DB00908)|Raloxifene(DB00481)|Regorafenib(DB08896)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Ritonavir(DB00503)|Ropivacaine(DB00296)|Roxithromycin(DB00778)|Selegiline(DB01037)|Sertraline(DB01104)|Sevoflurane(DB01236)|Simvastatin(DB00641)|Sorafenib(DB00398)|Sulfaphenazole(DB06729)|Sulfinpyrazone(DB01138)|Tamoxifen(DB00675)|Temazepam(DB00231)|Testosterone(DB00624)|Thiotepa(DB04572)|Ticlopidine(DB00208)|Tramadol(DB00193)|Tretinoin(DB00755)|Valproic Acid(DB00313)|Venlafaxine(DB00285)|Verapamil(DB00661)	CATGGTCGACCCATTCTTCCG	0.612																																						dbGAP											0													64.0	66.0	65.0					19																	41510050		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF182277	CCDS12570.1	19q13.2	2013-07-25	2003-01-14		ENSG00000197408	ENSG00000197408		"""Cytochrome P450s"""	2615	protein-coding gene	gene with protein product		123930	"""cytochrome P450, subfamily IIB (phenobarbital-inducible), polypeptide 6"", ""cytochrome P450, family 2, subfamily B"", ""cytochrome P450, subfamily IIB (phenobarbital-inducible)"""	CYP2B		7668294, 15128046	Standard	NM_000767		Approved	CPB6, CYPIIB6	uc002opr.1	P20813	OTTHUMG00000182714	ENST00000324071.4:c.316C>G	19.37:g.41510050C>G	ENSP00000324648:p.Pro106Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWP3|Q2V565|Q9UK46	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-I_CYP2B-like,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I_CYP2A-like	p.P106A	ENST00000324071.4	37	c.316	CCDS12570.1	19	.	.	.	.	.	.	.	.	.	.	.	4.896	0.166450	0.09339	.	.	ENSG00000197408	ENST00000324071;ENST00000330446	T;T	0.67523	-0.27;-0.27	3.98	-2.63	0.06133	.	0.852630	0.10511	N	0.666102	T	0.38506	0.1043	N	0.11818	0.18	0.09310	N	1	B;B	0.19817	0.039;0.005	B;B	0.17979	0.02;0.01	T	0.18335	-1.0340	10	0.23891	T	0.37	.	3.298	0.06973	0.4295:0.2796:0.0:0.2909	.	66;106	B4DWP3;P20813	.;CP2B6_HUMAN	A	106;66	ENSP00000324648:P106A;ENSP00000330650:P66A	ENSP00000324648:P106A	P	+	1	0	CYP2B6	46201890	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	-2.206000	0.01231	0.035000	0.15519	0.289000	0.19496	CCA	CYP2B6	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000197408		0.612	CYP2B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2B6	HGNC	protein_coding	OTTHUMT00000463260.1	48	0.00	0	C	NM_000767		41510050	41510050	+1	no_errors	ENST00000324071	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	0.000	G
DNTT	1791	genome.wustl.edu	37	10	98087355	98087355	+	Silent	SNP	G	G	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr10:98087355G>C	ENST00000371174.2	+	7	1107	c.1005G>C	c.(1003-1005)cgG>cgC	p.R335R	DNTT_ENST00000419175.1_Silent_p.R335R			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	335	Mediates interaction with DNTTIP2.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		GAGGGTTCCGGAGGTAAATAA	0.547																																						dbGAP											0													183.0	169.0	173.0					10																	98087355		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.1005G>C	10.37:g.98087355G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FH1|Q5W103|Q96E50	Silent	SNP	pfam_DNA_pol_lambd_fingers_domain,pfam_BRCT_dom,pfam_Nucleotidyltransferase,superfamily_DNA-dir_DNA_pol_X_beta-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.R335	ENST00000371174.2	37	c.1005	CCDS7447.1	10																																																																																			DNTT	-	pfam_Nucleotidyltransferase,smart_DNA-dir_DNA_pol_X,pirsf_DNA_nucleotidylexotransferase,prints_DNA_nucleotidylexotransferase,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	ENSG00000107447		0.547	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNTT	HGNC	protein_coding	OTTHUMT00000049607.1	108	0.00	0	G	NM_004088		98087355	98087355	+1	no_errors	ENST00000371174	ensembl	human	known	69_37n	silent	36	14.29	6	SNP	0.990	C
ENPEP	2028	genome.wustl.edu	37	4	111474542	111474542	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr4:111474542C>T	ENST00000265162.5	+	18	2915	c.2573C>T	c.(2572-2574)tCa>tTa	p.S858L		NM_001977.3	NP_001968.3	Q07075	AMPE_HUMAN	glutamyl aminopeptidase (aminopeptidase A)	858					angiogenesis (GO:0001525)|angiotensin catabolic process in blood (GO:0002005)|angiotensin maturation (GO:0002003)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|cellular protein metabolic process (GO:0044267)|glomerulus development (GO:0032835)|regulation of systemic arterial blood pressure by renin-angiotensin (GO:0003081)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|brush border (GO:0005903)|cytoplasmic vesicle (GO:0031410)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aminopeptidase activity (GO:0004177)|metalloaminopeptidase activity (GO:0070006)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(12)|lung(22)|ovary(1)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(1)	54		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.0031)		CGATATATCTCATATAACAGC	0.393																																						dbGAP											0													201.0	196.0	197.0					4																	111474542		2203	4300	6503	-	-	-	SO:0001583	missense	0			L12468	CCDS3691.1	4q25	2008-02-05			ENSG00000138792	ENSG00000138792	3.4.11.7	"""CD molecules"""	3355	protein-coding gene	gene with protein product		138297				9268642	Standard	NM_001977		Approved	gp160, CD249	uc003iab.4	Q07075	OTTHUMG00000132546	ENST00000265162.5:c.2573C>T	4.37:g.111474542C>T	ENSP00000265162:p.Ser858Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q504U2	Missense_Mutation	SNP	pfam_Peptidase_M1_N,prints_Peptidase_M1_N	p.S858L	ENST00000265162.5	37	c.2573	CCDS3691.1	4	.	.	.	.	.	.	.	.	.	.	C	35	5.415952	0.96092	.	.	ENSG00000138792	ENST00000265162	T	0.05717	3.4	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.33411	0.0862	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.25572	-1.0128	10	0.72032	D	0.01	.	19.1712	0.93578	0.0:1.0:0.0:0.0	.	858	Q07075	AMPE_HUMAN	L	858	ENSP00000265162:S858L	ENSP00000265162:S858L	S	+	2	0	ENPEP	111693991	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.416000	0.80143	2.524000	0.85096	0.650000	0.86243	TCA	ENPEP	-	NULL	ENSG00000138792		0.393	ENPEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPEP	HGNC	protein_coding	OTTHUMT00000255747.2	251	0.00	0	C			111474542	111474542	+1	no_errors	ENST00000265162	ensembl	human	known	69_37n	missense	50	34.21	26	SNP	1.000	T
FAM21A	387680	genome.wustl.edu	37	10	51853633	51853633	+	Missense_Mutation	SNP	C	C	T	rs199520696	byFrequency	TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr10:51853633C>T	ENST00000282633.5	+	13	1181	c.1136C>T	c.(1135-1137)aCg>aTg	p.T379M	FAM21A_ENST00000351071.6_Missense_Mutation_p.T379M|FAM21A_ENST00000314664.7_Missense_Mutation_p.T379M|FAM21A_ENST00000399339.2_Missense_Mutation_p.T291M	NM_001005751.1	NP_001005751.1	Q641Q2	FA21A_HUMAN	family with sequence similarity 21, member A	379					retrograde transport, endosome to Golgi (GO:0042147)	early endosome (GO:0005769)|membrane (GO:0016020)|WASH complex (GO:0071203)				breast(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	15						GACCTCTTCACGGAAGCCCCC	0.488																																						dbGAP											0													1.0	1.0	1.0					10																	51853633		353	936	1289	-	-	-	SO:0001583	missense	0			BC082258	CCDS41527.1	10q11.23	2014-06-19			ENSG00000099290	ENSG00000099290			23416	protein-coding gene	gene with protein product			"""family with sequence similarity 21, member B"""	FAM21B			Standard	XM_005269805		Approved	bA56A21.1, bA98I6.1, FLJ10824	uc001jjb.3	Q641Q2	OTTHUMG00000018225	ENST00000282633.5:c.1136C>T	10.37:g.51853633C>T	ENSP00000282633:p.Thr379Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3S2|A2A3U6|Q6DHY0	Missense_Mutation	SNP	NULL	p.T379M	ENST00000282633.5	37	c.1136	CCDS41527.1	10	.	.	.	.	.	.	.	.	.	.	C	6.414	0.444490	0.12164	.	.	ENSG00000099290	ENST00000351071;ENST00000314664;ENST00000434114;ENST00000282633;ENST00000399339	.	.	.	3.88	-5.37	0.02681	.	0.781535	0.12699	N	0.446536	T	0.14527	0.0351	N	0.19112	0.55	0.09310	N	1	B;B;B;B;B	0.29253	0.05;0.02;0.005;0.02;0.239	B;B;B;B;B	0.16722	0.013;0.013;0.003;0.013;0.016	T	0.05767	-1.0865	9	0.42905	T	0.14	2.3495	2.2948	0.04147	0.3714:0.2592:0.2739:0.0955	.	379;379;291;379;273	E7ESD2;Q641Q2-2;F8W7U3;Q641Q2;Q5T1D7	.;.;.;FA21A_HUMAN;.	M	379;379;273;379;291	.	ENSP00000282633:T379M	T	+	2	0	FAM21A	51523639	0.024000	0.19004	0.096000	0.21009	0.033000	0.12548	-0.884000	0.04166	-1.796000	0.01253	-1.109000	0.02080	ACG	FAM21A	-	NULL	ENSG00000099290		0.488	FAM21A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM21A	HGNC	protein_coding	OTTHUMT00000276917.2	29	0.00	0	C	NM_001005751		51853633	51853633	+1	no_errors	ENST00000282633	ensembl	human	known	69_37n	missense	14	17.65	3	SNP	0.370	T
FOLH1B	219595	genome.wustl.edu	37	11	89420578	89420578	+	RNA	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr11:89420578C>T	ENST00000532352.1	+	0	1393							Q9HBA9	FOH1B_HUMAN	folate hydrolase 1B							cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	dipeptidase activity (GO:0016805)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(26)|ovary(4)|skin(4)|urinary_tract(2)	48						TAAAAAAAGTCCTTCCCCAGA	0.343																																						dbGAP											0													59.0	62.0	61.0					11																	89420578		2201	4298	6499	-	-	-			0			AF261715		11q14.3	2014-03-18			ENSG00000134612	ENSG00000134612			13636	protein-coding gene	gene with protein product	"""prostate specific membrane antigen like protein"", ""Cell growth-inhibiting gene 26 protein"", ""glutamate carboxypeptidase III"""	609020	"""folate hydrolase 2"""	FOLH2, FOLHP		9838072, 14716746	Standard	NM_153696		Approved	PSMAL, GCPIII	uc001pda.3	Q9HBA9	OTTHUMG00000167376		11.37:g.89420578C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000532352.1	37	NULL		11																																																																																			FOLH1B	-	-	ENSG00000134612		0.343	FOLH1B-004	KNOWN	basic	processed_transcript	FOLH1B	HGNC	pseudogene	OTTHUMT00000395421.1	159	0.62	1	C	NM_153696		89420578	89420578	+1	no_errors	ENST00000525540	ensembl	human	known	69_37n	rna	35	37.50	21	SNP	1.000	T
GH2	2689	genome.wustl.edu	37	17	61957656	61957656	+	3'UTR	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr17:61957656G>A	ENST00000423893.2	-	0	740				GH2_ENST00000456543.2_Silent_p.T225T|GH2_ENST00000449787.2_3'UTR|GH2_ENST00000332800.7_3'UTR			P01242	SOM2_HUMAN	growth hormone 2						JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)	extracellular region (GO:0005576)	hormone activity (GO:0005179)			breast(3)|large_intestine(3)|lung(14)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	24						ACTGGGGAGGGGTCACAGGGA	0.562																																						dbGAP											0													52.0	50.0	51.0					17																	61957656		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			J03756	CCDS11647.1, CCDS11648.1, CCDS45757.1, CCDS45758.1	17q22-q24	2014-01-30						"""Endogenous ligands"""	4262	protein-coding gene	gene with protein product	"""placental-specific growth hormone"", ""placenta-specific growth hormone"""	139240				6306568	Standard	NM_002059		Approved	GH-V, GHV, GHL, hGH-V	uc002jcl.2	P01242		ENST00000423893.2:c.*25C>T	17.37:g.61957656G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1A4H5|B1A4H7|O14643|O14644|P09587	Silent	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core,prints_Somatotropin	p.T225	ENST00000423893.2	37	c.675	CCDS11647.1	17																																																																																			GH2	-	NULL	ENSG00000136487		0.562	GH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GH2	HGNC	protein_coding	OTTHUMT00000417665.1	109	0.00	0	G	NM_002059		61957656	61957656	-1	no_errors	ENST00000456543	ensembl	human	known	69_37n	silent	50	15.25	9	SNP	0.019	A
GOLGA6L2	283685	genome.wustl.edu	37	15	23685300	23685301	+	Frame_Shift_Del	DEL	TT	TT	-			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	TT	TT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr15:23685300_23685301delTT	ENST00000567107.1	-	8	2373_2374	c.2321_2322delAA	c.(2320-2322)gaafs	p.E774fs	GOLGA6L2_ENST00000312015.5_Intron|GOLGA6L2_ENST00000345070.5_Intron			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						ctcctgcatcttctcttgctgc	0.564																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2321_2322delAA	15.37:g.23685300_23685301delTT	ENSP00000454407:p.Glu774fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	Frame_Shift_Del	DEL	NULL	p.E774fs	ENST00000567107.1	37	c.2322_2321		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.564	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	10	0.00	0	TT	NM_182561		23685300	23685301	-1	no_errors	ENST00000567107	ensembl	human	putative	69_37n	frame_shift_del	4	33.33	2	DEL	0.104:0.092	-
GOLGA6L7P	728310	genome.wustl.edu	37	15	29092336	29092336	+	RNA	SNP	A	A	G	rs77625797	byFrequency	TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr15:29092336A>G	ENST00000569815.1	-	0	179					NR_047567.1				golgin A6 family-like 7, pseudogene																		GATAGTCTGTAAACTGTGGAA	0.413													.|||	1608	0.321086	0.6218	0.255	5008	,	,		25345	0.2897		0.1083	False		,,,				2504	0.2127					dbGAP											0																																										-	-	-			0			AK302238		15q13.1	2012-10-05	2011-04-15	2010-04-20	ENSG00000261649	ENSG00000261649			37442	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 6-like 7 (pseudogene)"""	GOLGA6L7			Standard	NR_047567		Approved		uc010uar.2		OTTHUMG00000176345		15.37:g.29092336A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000569815.1	37	NULL		15																																																																																			GOLGA6L7P	-	-	ENSG00000261649		0.413	GOLGA6L7P-002	PUTATIVE	basic	processed_transcript	GOLGA6L7P	HGNC	pseudogene	OTTHUMT00000431796.1	43	0.00	0	A	XR_078490		29092336	29092336	-1	no_errors	ENST00000569815	ensembl	human	putative	69_37n	rna	15	21.05	4	SNP	0.059	G
HDAC1	3065	genome.wustl.edu	37	1	32793146	32793146	+	Silent	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:32793146G>A	ENST00000373548.3	+	6	588	c.504G>A	c.(502-504)caG>caA	p.Q168Q	HDAC1_ENST00000490081.1_3'UTR|HDAC1_ENST00000373541.2_5'UTR	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	168	Histone deacetylase.				ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	GGTATCACCAGAGGGTGCTGT	0.572																																						dbGAP											0													103.0	94.0	97.0					1																	32793146		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.504G>A	1.37:g.32793146G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92534	Silent	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.Q168	ENST00000373548.3	37	c.504	CCDS360.1	1																																																																																			HDAC1	-	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1	ENSG00000116478		0.572	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC1	HGNC	protein_coding	OTTHUMT00000019815.3	27	0.00	0	G	NM_004964		32793146	32793146	+1	no_errors	ENST00000373548	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	1.000	A
HDX	139324	genome.wustl.edu	37	X	83724462	83724462	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chrX:83724462C>G	ENST00000297977.5	-	3	380	c.269G>C	c.(268-270)cGa>cCa	p.R90P	HDX_ENST00000373177.2_Missense_Mutation_p.R90P|HDX_ENST00000506585.2_Missense_Mutation_p.R32P	NM_001177479.1|NM_144657.4	NP_001170950.1|NP_653258.2	Q7Z353	HDX_HUMAN	highly divergent homeobox	90						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|kidney(2)|large_intestine(12)|liver(1)|lung(19)|ovary(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GCTTGAGGGTCGAGCAATATT	0.428																																					Pancreas(53;231 1169 36156 43751 51139)	dbGAP											0													137.0	115.0	122.0					X																	83724462		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538112	CCDS35342.1, CCDS55456.1	Xq21.1	2012-03-09	2007-07-13	2007-07-13	ENSG00000165259	ENSG00000165259		"""Homeoboxes / POU class"""	26411	protein-coding gene	gene with protein product			"""chromosome X open reading frame 43"""	CXorf43			Standard	NM_144657		Approved	FLJ30678	uc004eek.2	Q7Z353	OTTHUMG00000021926	ENST00000297977.5:c.269G>C	X.37:g.83724462C>G	ENSP00000297977:p.Arg90Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1Y5|B7ZL18|Q5JZB4|Q96NK7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.R90P	ENST00000297977.5	37	c.269	CCDS35342.1	X	.	.	.	.	.	.	.	.	.	.	C	4.443	0.082032	0.08533	.	.	ENSG00000165259	ENST00000297977;ENST00000373177;ENST00000506585;ENST00000449553	T;T;T;T	0.63913	1.53;0.81;1.53;-0.07	4.75	-1.82	0.07857	.	1.287240	0.04958	N	0.461481	T	0.51890	0.1701	L	0.45581	1.43	0.09310	N	0.999998	B	0.13145	0.007	B	0.12156	0.007	T	0.25779	-1.0122	10	0.31617	T	0.26	1.1933	6.2184	0.20667	0.0:0.4717:0.1242:0.4041	.	90	Q7Z353	HDX_HUMAN	P	90;32;90;32	ENSP00000297977:R90P;ENSP00000362272:R32P;ENSP00000423670:R90P;ENSP00000387790:R32P	ENSP00000297977:R90P	R	-	2	0	HDX	83611118	0.957000	0.32711	0.000000	0.03702	0.773000	0.43773	0.123000	0.15708	-0.741000	0.04797	-0.312000	0.09012	CGA	HDX	-	NULL	ENSG00000165259		0.428	HDX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HDX	HGNC	protein_coding	OTTHUMT00000057379.2	201	0.00	0	C	NM_144657		83724462	83724462	-1	no_errors	ENST00000297977	ensembl	human	known	69_37n	missense	64	20.00	16	SNP	0.040	G
HUS1	3364	genome.wustl.edu	37	7	48018139	48018139	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr7:48018139C>T	ENST00000258774.5	-	3	255	c.232G>A	c.(232-234)Gag>Aag	p.E78K	HUS1_ENST00000432325.1_Missense_Mutation_p.E57K	NM_004507.3	NP_004498.1	O60921	HUS1_HUMAN	HUS1 checkpoint homolog (S. pombe)	78					cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|double-strand break repair via homologous recombination (GO:0000724)|embryo development (GO:0009790)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of DNA replication (GO:0008156)|protein phosphorylation (GO:0006468)|regulation of protein phosphorylation (GO:0001932)|response to UV (GO:0009411)	checkpoint clamp complex (GO:0030896)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|liver(1)|lung(3)|ovary(2)|prostate(1)	13		Breast(660;0.00139)				AAATAAATCTCATTGTTTTCT	0.398								Direct reversal of damage;Other conserved DNA damage response genes																													Ovarian(103;466 1517 21788 34610 43890)	dbGAP											0													78.0	76.0	76.0					7																	48018139		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y16893	CCDS34635.1	7p13-p12	2008-08-08	2001-11-28		ENSG00000136273	ENSG00000136273			5309	protein-coding gene	gene with protein product	"""hus1+-like protein"""	603760	"""HUS1 (S. pombe) checkpoint homolog"""			9878245, 9524127	Standard	NM_004507		Approved		uc003tod.2	O60921	OTTHUMG00000155645	ENST00000258774.5:c.232G>A	7.37:g.48018139C>T	ENSP00000258774:p.Glu78Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFI9	Missense_Mutation	SNP	pfam_Hus1,pirsf_Cell_cycle_HUS1	p.E78K	ENST00000258774.5	37	c.232	CCDS34635.1	7	.	.	.	.	.	.	.	.	.	.	C	25.8	4.677027	0.88445	.	.	ENSG00000136273	ENST00000258774;ENST00000432325;ENST00000432627;ENST00000446009	T;T;T;T	0.12255	2.7;2.7;2.7;2.7	5.31	5.31	0.75309	.	0.161140	0.53938	D	0.000045	T	0.25531	0.0621	M	0.82630	2.6	0.80722	D	1	B	0.31040	0.305	B	0.39185	0.293	T	0.07578	-1.0765	10	0.12766	T	0.61	-10.2924	16.4847	0.84181	0.0:1.0:0.0:0.0	.	78	O60921	HUS1_HUMAN	K	78;57;57;57	ENSP00000258774:E78K;ENSP00000416588:E57K;ENSP00000404855:E57K;ENSP00000398806:E57K	ENSP00000258774:E78K	E	-	1	0	HUS1	47984664	1.000000	0.71417	0.647000	0.29507	0.993000	0.82548	7.452000	0.80683	2.494000	0.84150	0.655000	0.94253	GAG	HUS1	-	pfam_Hus1,pirsf_Cell_cycle_HUS1	ENSG00000136273		0.398	HUS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUS1	HGNC	protein_coding	OTTHUMT00000340952.1	178	0.00	0	C	NM_004507		48018139	48018139	-1	no_errors	ENST00000258774	ensembl	human	known	69_37n	missense	51	23.88	16	SNP	1.000	T
KIRREL3	84623	genome.wustl.edu	37	11	126391325	126391325	+	Silent	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr11:126391325C>T	ENST00000525144.2	-	4	567	c.318G>A	c.(316-318)ctG>ctA	p.L106L	KIRREL3_ENST00000525704.2_Silent_p.L106L|KIRREL3_ENST00000529097.2_Silent_p.L106L	NM_032531.3	NP_115920.1	Q8IZU9	KIRR3_HUMAN	kin of IRRE like 3 (Drosophila)	106	Ig-like C2-type 1.				hemopoiesis (GO:0030097)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(5)|large_intestine(11)|lung(8)|ovary(3)|prostate(1)	29	all_hematologic(175;0.145)	Lung NSC(97;0.0484)|all_lung(97;0.0522)|Medulloblastoma(222;0.0523)|Breast(109;0.0949)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;6.03e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.12)		GCTCCCCTGACAGGTGGTTCC	0.642																																						dbGAP											0													35.0	45.0	42.0					11																	126391325		2069	4212	6281	-	-	-	SO:0001819	synonymous_variant	0			AB058770	CCDS53723.1, CCDS55796.1, CCDS73413.1	11q24	2013-01-29			ENSG00000149571	ENSG00000149571		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	23204	protein-coding gene	gene with protein product		607761				12424224, 11347906	Standard	NM_032531		Approved	NEPH2, KIAA1867, KIRRE	uc001qea.3	Q8IZU9	OTTHUMG00000165831	ENST00000525144.2:c.318G>A	11.37:g.126391325C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3MIJ7|Q6UWJ9|Q6UWL5|Q96JG0	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L106	ENST00000525144.2	37	c.318	CCDS53723.1	11																																																																																			KIRREL3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000149571		0.642	KIRREL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL3	HGNC	protein_coding	OTTHUMT00000386479.2	53	0.00	0	C	NM_032531		126391325	126391325	-1	no_errors	ENST00000525144	ensembl	human	known	69_37n	silent	28	24.32	9	SNP	1.000	T
LRP1B	53353	genome.wustl.edu	37	2	141819658	141819658	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr2:141819658G>A	ENST00000389484.3	-	8	2169	c.1198C>T	c.(1198-1200)Caa>Taa	p.Q400*		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	400					protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.Q400I(2)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		TTTTTTCCTTGATAGTCCACT	0.393										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											2	Substitution - Missense(2)	lung(2)											207.0	191.0	196.0					2																	141819658		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.1198C>T	2.37:g.141819658G>A	ENSP00000374135:p.Gln400*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Nonsense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.Q400*	ENST00000389484.3	37	c.1198	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	46	12.309769	0.99656	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	.	.	.	5.63	4.73	0.59995	.	0.500540	0.20632	N	0.088576	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	15.9871	0.80168	0.0:0.3745:0.6255:0.0	.	.	.	.	X	400;338	.	ENSP00000374135:Q400X	Q	-	1	0	LRP1B	141536128	1.000000	0.71417	0.997000	0.53966	0.966000	0.64601	2.147000	0.42226	1.470000	0.48102	0.655000	0.94253	CAA	LRP1B	-	pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,smart_LDLR_classB_rpt	ENSG00000168702		0.393	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	275	0.00	0	G	NM_018557		141819658	141819658	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	nonsense	67	15.19	12	SNP	0.985	A
MAGEE1	57692	genome.wustl.edu	37	X	75651058	75651058	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chrX:75651058T>C	ENST00000361470.2	+	1	3013	c.2735T>C	c.(2734-2736)aTg>aCg	p.M912T		NM_020932.2	NP_065983.1	Q9HCI5	MAGE1_HUMAN	melanoma antigen family E, 1	912	Interaction with DTNA. {ECO:0000250}.|MAGE 2. {ECO:0000255|PROSITE- ProRule:PRU00127}.					dendrite (GO:0030425)|dystrophin-associated glycoprotein complex (GO:0016010)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)				breast(3)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	51						ACCTCTAAGATGAAAGCCTTG	0.488																																						dbGAP											0													78.0	74.0	75.0					X																	75651058		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF490507	CCDS14433.1	Xq13	2008-02-05			ENSG00000198934	ENSG00000198934			24934	protein-coding gene	gene with protein product		300759				14623885	Standard	NM_020932		Approved	KIAA1587, DAMAGE	uc004ecm.2	Q9HCI5	OTTHUMG00000021879	ENST00000361470.2:c.2735T>C	X.37:g.75651058T>C	ENSP00000354912:p.Met912Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JXC7|Q86TG0|Q8TD92|Q9H216	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.M912T	ENST00000361470.2	37	c.2735	CCDS14433.1	X	.	.	.	.	.	.	.	.	.	.	.	12.91	2.079303	0.36662	.	.	ENSG00000198934	ENST00000361470	T	0.05025	3.51	2.21	2.21	0.28008	.	.	.	.	.	T	0.17746	0.0426	M	0.77712	2.385	0.26818	N	0.968857	P	0.52842	0.956	P	0.58970	0.849	T	0.04678	-1.0934	9	0.87932	D	0	.	5.6664	0.17697	0.0:0.0:0.0:1.0	.	912	Q9HCI5	MAGE1_HUMAN	T	912	ENSP00000354912:M912T	ENSP00000354912:M912T	M	+	2	0	MAGEE1	75567462	1.000000	0.71417	0.999000	0.59377	0.991000	0.79684	2.127000	0.42035	1.120000	0.41904	0.430000	0.28490	ATG	MAGEE1	-	pfam_MAGE,pfscan_MAGE	ENSG00000198934		0.488	MAGEE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEE1	HGNC	protein_coding	OTTHUMT00000057298.1	114	0.00	0	T	NM_020932		75651058	75651058	+1	no_errors	ENST00000361470	ensembl	human	known	69_37n	missense	45	15.09	8	SNP	0.998	C
MGAM	8972	genome.wustl.edu	37	7	141754683	141754683	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr7:141754683C>T	ENST00000549489.2	+	27	3384	c.3289C>T	c.(3289-3291)Cgc>Tgc	p.R1097C	MGAM_ENST00000475668.2_Missense_Mutation_p.R1097C	NM_004668.2	NP_004659.2	O43451	MGA_HUMAN	maltase-glucoamylase (alpha-glucosidase)	1097	Glucoamylase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)|starch catabolic process (GO:0005983)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|amylase activity (GO:0016160)|carbohydrate binding (GO:0030246)|catalytic activity (GO:0003824)|glucan 1,4-alpha-glucosidase activity (GO:0004339)|maltose alpha-glucosidase activity (GO:0032450)	p.R1097C(2)		cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	13	Melanoma(164;0.0272)				Acarbose(DB00284)|Miglitol(DB00491)|Voglibose(DB04878)	GATTGAAATTCGCCGGAAGAG	0.498																																						dbGAP											2	Substitution - Missense(2)	large_intestine(2)											77.0	74.0	75.0					7																	141754683		1884	4098	5982	-	-	-	SO:0001583	missense	0			AF016833	CCDS47727.1	7q34	2012-10-03			ENSG00000257335	ENSG00000257335			7043	protein-coding gene	gene with protein product		154360				9446624	Standard	NM_004668		Approved	MGA	uc003vwy.3	O43451	OTTHUMG00000158395	ENST00000549489.2:c.3289C>T	7.37:g.141754683C>T	ENSP00000447378:p.Arg1097Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VAX6|Q75ME7|Q86UM5	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.R1097C	ENST00000549489.2	37	c.3289	CCDS47727.1	7	.	.	.	.	.	.	.	.	.	.	C	10.17	1.277063	0.23307	.	.	ENSG00000257335	ENST00000549489;ENST00000475668;ENST00000548812	T	0.13538	2.58	4.24	2.15	0.27550	Glycoside hydrolase-type carbohydrate-binding (1);	0.774326	0.10690	N	0.645363	T	0.42291	0.1196	M	0.90759	3.145	0.19300	N	0.999978	D	0.89917	1.0	D	0.78314	0.991	T	0.14282	-1.0478	10	0.49607	T	0.09	.	10.2669	0.43460	0.4981:0.5019:0.0:0.0	.	1097	O43451	MGA_HUMAN	C	1097;1097;974	ENSP00000447378:R1097C	ENSP00000316431:R974C	R	+	1	0	MGAM	141401152	0.019000	0.18553	0.004000	0.12327	0.026000	0.11368	1.486000	0.35530	0.682000	0.31407	0.460000	0.39030	CGC	MGAM	-	superfamily_Glyco_hydro-type_carb-bd	ENSG00000257335		0.498	MGAM-001	KNOWN	basic|CCDS	protein_coding	MGAM	HGNC	protein_coding	OTTHUMT00000351244.3	87	0.00	0	C			141754683	141754683	+1	no_errors	ENST00000549489	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.098	T
MRPL35	51318	genome.wustl.edu	37	2	86434315	86434315	+	Silent	SNP	C	C	T	rs578131651	byFrequency	TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr2:86434315C>T	ENST00000337109.4	+	3	277	c.243C>T	c.(241-243)ccC>ccT	p.P81P	MRPL35_ENST00000254644.8_Silent_p.P81P|MRPL35_ENST00000409180.1_Silent_p.P81P|MRPL35_ENST00000605125.1_Intron	NM_016622.3	NP_057706.2	Q9NZE8	RM35_HUMAN	mitochondrial ribosomal protein L35	81			P -> L (in dbSNP:rs3192352).		translation (GO:0006412)	mitochondrial ribosome (GO:0005761)	structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(1)|lung(4)|skin(1)|stomach(1)|urinary_tract(2)	14						GAATGGCCCCCGTGCTTCCAA	0.368													C|||	3	0.000599042	0.0	0.0	5008	,	,		16175	0.0		0.0	False		,,,				2504	0.0031					dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AF208849	CCDS1987.1, CCDS1988.1	2p11.2	2012-09-13			ENSG00000132313	ENSG00000132313		"""Mitochondrial ribosomal proteins / large subunits"""	14489	protein-coding gene	gene with protein product		611841				11042152, 11551941	Standard	NM_016622		Approved		uc002srg.4	Q9NZE8	OTTHUMG00000037385	ENST00000337109.4:c.243C>T	2.37:g.86434315C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKV6|B2RB93|Q658U7|Q8WWA2	Silent	SNP	pfam_Ribosomal_L35	p.P81	ENST00000337109.4	37	c.243	CCDS1988.1	2																																																																																			MRPL35	-	NULL	ENSG00000132313		0.368	MRPL35-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPL35	HGNC	protein_coding	OTTHUMT00000091002.2	63	0.00	0	C	NM_016622		86434315	86434315	+1	no_errors	ENST00000337109	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	0.988	T
MYO16	23026	genome.wustl.edu	37	13	109753162	109753162	+	Missense_Mutation	SNP	G	G	T	rs140739382	byFrequency	TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr13:109753162G>T	ENST00000357550.2	+	27	3340	c.3299G>T	c.(3298-3300)cGt>cTt	p.R1100L	MYO16_ENST00000457511.2_Missense_Mutation_p.R612L|MYO16_ENST00000356711.2_Missense_Mutation_p.R1100L|MYO16-AS2_ENST00000412809.1_RNA	NM_001198950.1	NP_001185879.1			myosin XVI											NS(3)|breast(4)|central_nervous_system(2)|endometrium(10)|kidney(8)|large_intestine(27)|lung(51)|ovary(9)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	121	all_lung(23;0.000332)|all_neural(89;0.00294)|Medulloblastoma(90;0.00596)|Lung NSC(43;0.00751)|Lung SC(71;0.104)		BRCA - Breast invasive adenocarcinoma(86;0.19)|all cancers(43;0.201)			ACATTCCTGCGTGAGAAGAAG	0.473																																						dbGAP											0													88.0	75.0	80.0					13																	109753162		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32008.1, CCDS73598.1	13q33.3	2014-06-12			ENSG00000041515	ENSG00000041515		"""Myosins / Myosin superfamily : Class XVI"", ""Ankyrin repeat domain containing"""	29822	protein-coding gene	gene with protein product	"""neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 3"", ""protein phosphatase 1, regulatory subunit 107"""	615479				11588169, 17029291, 21946561	Standard	NM_001198950		Approved	MYR8, KIAA0865, Myo16b, NYAP3, PPP1R107	uc001vqt.1	Q9Y6X6	OTTHUMG00000017333	ENST00000357550.2:c.3299G>T	13.37:g.109753162G>T	ENSP00000350160:p.Arg1100Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Myosin_head_motor_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1100L	ENST00000357550.2	37	c.3299	CCDS32008.1	13	.	.	.	.	.	.	.	.	.	.	G	8.451	0.853006	0.17106	.	.	ENSG00000041515	ENST00000356711;ENST00000357550;ENST00000457511	D;D;D	0.86366	-2.11;-2.11;-2.11	5.24	2.6	0.31112	Myosin head, motor domain (2);	0.175693	0.26708	U	0.022912	T	0.73721	0.3623	N	0.17594	0.5	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.56414	-0.7983	9	.	.	.	.	8.5503	0.33447	0.2451:0.0:0.7549:0.0	.	612;1100	F8W883;Q9Y6X6	.;MYO16_HUMAN	L	1100;1100;612	ENSP00000349145:R1100L;ENSP00000350160:R1100L;ENSP00000401633:R612L	.	R	+	2	0	MYO16	108551163	0.024000	0.19004	0.000000	0.03702	0.002000	0.02628	0.861000	0.27885	0.221000	0.20879	-0.137000	0.14449	CGT	MYO16	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000041515		0.473	MYO16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO16	HGNC	protein_coding	OTTHUMT00000045746.1	81	0.00	0	G	NM_015011		109753162	109753162	+1	no_errors	ENST00000356711	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.002	T
OVCH1	341350	genome.wustl.edu	37	12	29649525	29649525	+	Silent	SNP	A	A	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr12:29649525A>G	ENST00000318184.5	-	2	146	c.147T>C	c.(145-147)agT>agC	p.S49S		NM_183378.2	NP_899234.2	Q7RTY7	OVCH1_HUMAN	ovochymase 1	49	Peptidase S1 1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	metal ion binding (GO:0046872)|serine-type endopeptidase activity (GO:0004252)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(43)|ovary(5)|pancreas(3)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)	92	Lung NSC(12;1.84e-09)|Acute lymphoblastic leukemia(23;0.00885)|all_hematologic(23;0.0155)					AATTTCTCCAACTACTAATTC	0.403																																						dbGAP											0													124.0	119.0	120.0					12																	29649525		1870	4098	5968	-	-	-	SO:0001819	synonymous_variant	0			BN000128		12p11.23	2012-11-08			ENSG00000187950	ENSG00000187950			23080	protein-coding gene	gene with protein product						12838346	Standard	NM_183378		Approved	OVCH	uc001rix.1	Q7RTY7	OTTHUMG00000167741	ENST00000318184.5:c.147T>C	12.37:g.29649525A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,smart_Peptidase_S1_S6,smart_CUB,prints_Peptidase_S1A,pfscan_CUB,pfscan_Peptidase_S1_S6	p.S49	ENST00000318184.5	37	c.147		12																																																																																			OVCH1	-	superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000187950		0.403	OVCH1-001	KNOWN	non_canonical_TEC|basic|appris_principal	protein_coding	OVCH1	HGNC	protein_coding	OTTHUMT00000395997.2	103	0.00	0	A	NM_183378		29649525	29649525	-1	no_errors	ENST00000318184	ensembl	human	known	69_37n	silent	31	31.11	14	SNP	0.018	G
PCSK2	5126	genome.wustl.edu	37	20	17446160	17446160	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr20:17446160G>C	ENST00000262545.2	+	11	1707	c.1392G>C	c.(1390-1392)gaG>gaC	p.E464D	PCSK2_ENST00000536609.1_Missense_Mutation_p.E429D|PCSK2_ENST00000377899.1_Missense_Mutation_p.E445D|PCSK2_ENST00000459871.1_3'UTR	NM_002594.3	NP_002585.2	P16519	NEC2_HUMAN	proprotein convertase subtilisin/kexin type 2	464					cellular protein metabolic process (GO:0044267)|embryo development (GO:0009790)|enkephalin processing (GO:0034230)|insulin processing (GO:0030070)|islet amyloid polypeptide processing (GO:0034231)|nervous system development (GO:0007399)|protein autoprocessing (GO:0016540)|proteolysis (GO:0006508)	dendrite (GO:0030425)|extracellular space (GO:0005615)|membrane (GO:0016020)|perikaryon (GO:0043204)|secretory granule lumen (GO:0034774)	serine-type endopeptidase activity (GO:0004252)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(5)|large_intestine(7)|lung(17)|ovary(3)|pancreas(2)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	53					"""""""Insulin(DB00071)|Insulin Regular(DB00030)"""	CCGTGCCTGAGAGATTCCACT	0.562																																						dbGAP											0													65.0	59.0	61.0					20																	17446160		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK312341	CCDS13125.1, CCDS56179.1, CCDS56180.1	20p11.2	2008-08-01			ENSG00000125851	ENSG00000125851			8744	protein-coding gene	gene with protein product	"""neuroendocrine convertase 2"", ""KEX2-like endoprotease 2"""	162151		NEC2		1765368	Standard	NM_001201528		Approved	PC2, SPC2	uc002wpm.3	P16519	OTTHUMG00000031941	ENST00000262545.2:c.1392G>C	20.37:g.17446160G>C	ENSP00000262545:p.Glu464Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANH9|B4DFQ3|Q14927|Q5JYQ1|Q8IWA8|Q9NQG3|Q9NUG1|Q9UJC6	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_PrprotnconvertsP,superfamily_Peptidase_S8/S53,superfamily_Galactose-bd-like,superfamily_Prot_inh_propept,prints_Peptidase_S8_subtilisin-rel	p.E464D	ENST00000262545.2	37	c.1392	CCDS13125.1	20	.	.	.	.	.	.	.	.	.	.	G	14.24	2.475601	0.43942	.	.	ENSG00000125851	ENST00000377899;ENST00000262545;ENST00000536609	T;T;T	0.64085	-0.08;-0.08;-0.08	5.68	3.74	0.42951	Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.58666	0.2138	M	0.70275	2.135	0.54753	D	0.999987	B;B;B	0.24483	0.059;0.104;0.043	B;B;B	0.28553	0.065;0.065;0.091	T	0.53365	-0.8449	10	0.33141	T	0.24	-35.4404	8.3766	0.32447	0.2392:0.0:0.7608:0.0	.	429;445;464	B4DFQ3;B1ANH9;P16519	.;.;NEC2_HUMAN	D	445;464;429	ENSP00000367131:E445D;ENSP00000262545:E464D;ENSP00000437458:E429D	ENSP00000262545:E464D	E	+	3	2	PCSK2	17394160	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	4.399000	0.59703	0.764000	0.33197	0.555000	0.69702	GAG	PCSK2	-	superfamily_Galactose-bd-like	ENSG00000125851		0.562	PCSK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCSK2	HGNC	protein_coding	OTTHUMT00000078120.2	68	0.00	0	G	NM_002594		17446160	17446160	+1	no_errors	ENST00000262545	ensembl	human	known	69_37n	missense	17	43.33	13	SNP	1.000	C
PDS5B	23047	genome.wustl.edu	37	13	33281097	33281097	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr13:33281097C>T	ENST00000315596.10	+	18	2069	c.1883C>T	c.(1882-1884)tCa>tTa	p.S628L		NM_015032.3	NP_055847.1	Q9NTI5	PDS5B_HUMAN	PDS5, regulator of cohesion maintenance, homolog B (S. cerevisiae)	628					cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic sister chromatid cohesion (GO:0007064)|negative regulation of cell proliferation (GO:0008285)|regulation of cell proliferation (GO:0042127)	chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			NS(2)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(14)|lung(14)|ovary(5)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)	62		Lung SC(185;0.0367)		all cancers(112;5.55e-06)|Epithelial(112;2.7e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00303)|BRCA - Breast invasive adenocarcinoma(63;0.0204)		GTGAACAAATCAATAGATGGA	0.323																																						dbGAP											0													97.0	95.0	95.0					13																	33281097		1875	4099	5974	-	-	-	SO:0001583	missense	0			AB023196	CCDS41878.1	13q12.3	2008-02-05	2007-07-18	2007-07-18	ENSG00000083642	ENSG00000083642			20418	protein-coding gene	gene with protein product		605333	"""androgen-induced proliferation inhibitor"""	APRIN		8812419, 10215036	Standard	NM_015032		Approved	AS3, KIAA0979, FLJ23236, CG008	uc010abf.3	Q9NTI5	OTTHUMG00000016704	ENST00000315596.10:c.1883C>T	13.37:g.33281097C>T	ENSP00000313851:p.Ser628Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3S3|Q5W0K8|Q6NSC3|Q8IXT6|Q9H5N8|Q9Y2I5|Q9Y451	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S628L	ENST00000315596.10	37	c.1883	CCDS41878.1	13	.	.	.	.	.	.	.	.	.	.	C	21.9	4.222667	0.79464	.	.	ENSG00000083642	ENST00000315596;ENST00000421084	.	.	.	5.91	5.91	0.95273	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.48223	0.1488	L	0.31664	0.95	0.80722	D	1	B	0.32188	0.359	B	0.33620	0.167	T	0.39035	-0.9633	9	0.10111	T	0.7	-0.5212	20.3011	0.98612	0.0:1.0:0.0:0.0	.	628	Q9NTI5	PDS5B_HUMAN	L	628	.	ENSP00000313851:S628L	S	+	2	0	PDS5B	32179097	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.689000	0.84165	2.804000	0.96469	0.650000	0.86243	TCA	PDS5B	-	superfamily_ARM-type_fold	ENSG00000083642		0.323	PDS5B-006	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5B	HGNC	protein_coding	OTTHUMT00000044428.3	83	0.00	0	C	NM_015032		33281097	33281097	+1	no_errors	ENST00000315596	ensembl	human	known	69_37n	missense	24	20.00	6	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	95	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	24	47.83	22	SNP	1.000	G
PROSC	11212	genome.wustl.edu	37	8	37633453	37633453	+	Silent	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr8:37633453G>A	ENST00000328195.3	+	7	682	c.615G>A	c.(613-615)cgG>cgA	p.R205R		NM_007198.3	NP_009129.1	O94903	PROSC_HUMAN	proline synthetase co-transcribed homolog (bacterial)	205					alpha-amino acid metabolic process (GO:1901605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrion (GO:0005739)	pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)|prostate(1)	7		Lung NSC(58;0.174)	BRCA - Breast invasive adenocarcinoma(5;6.14e-24)|LUSC - Lung squamous cell carcinoma(8;3.5e-10)		L-Proline(DB00172)	TGTCCCTCCGGGAGGAGCTGT	0.507																																						dbGAP											0													204.0	200.0	202.0					8																	37633453		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018566	CCDS6096.1	8p11.2	2008-01-07	2001-12-04		ENSG00000147471	ENSG00000147471			9457	protein-coding gene	gene with protein product		604436	"""proline synthetase co-transcribed (bacterial homolog)"""				Standard	NM_007198		Approved		uc003xkh.3	O94903	OTTHUMG00000164024	ENST00000328195.3:c.615G>A	8.37:g.37633453G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FI94	Missense_Mutation	SNP	pfam_Ala_racemase_N,pirsf_UPF0001,tigrfam_UPF0001	p.G174E	ENST00000328195.3	37	c.521	CCDS6096.1	8	.	.	.	.	.	.	.	.	.	.	G	4.037	0.004450	0.07866	.	.	ENSG00000147471	ENST00000521494	.	.	.	6.07	0.917	0.19380	.	.	.	.	.	T	0.41328	0.1154	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.22312	-1.0220	4	.	.	.	.	0.5776	0.00706	0.291:0.1126:0.2953:0.3011	.	.	.	.	E	174	.	.	G	+	2	0	PROSC	37752611	0.994000	0.37717	0.532000	0.27989	0.421000	0.31385	0.305000	0.19254	-0.112000	0.11979	0.655000	0.94253	GGG	PROSC	-	pfam_Ala_racemase_N,pirsf_UPF0001,tigrfam_UPF0001	ENSG00000147471		0.507	PROSC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROSC	HGNC	protein_coding	OTTHUMT00000376796.1	132	0.00	0	G	NM_007198		37633453	37633453	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521494	ensembl	human	putative	69_37n	missense	46	36.11	26	SNP	0.186	A
PSMD11	5717	genome.wustl.edu	37	17	30781593	30781593	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr17:30781593C>G	ENST00000261712.3	+	3	537	c.274C>G	c.(274-276)Ctt>Gtt	p.L92V	PSMD11_ENST00000457654.2_Missense_Mutation_p.L92V	NM_001270482.1|NM_002815.3	NP_001257411.1|NP_002806.2	O00231	PSD11_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 11	92					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasome assembly (GO:0043248)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stem cell differentiation (GO:0048863)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)				breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	19		Breast(31;0.159)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.109)			GGTCCGATCTCTTCTTGATCT	0.433																																					Ovarian(130;1038 1716 9294 11987 19279)	dbGAP											0													123.0	103.0	110.0					17																	30781593		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB003102	CCDS11272.1	17q12	2008-05-22			ENSG00000108671	ENSG00000108671		"""Proteasome (prosome, macropain) subunits"""	9556	protein-coding gene	gene with protein product		604449				9426256, 9119060	Standard	NM_001270482		Approved	S9, p44.5, MGC3844, Rpn6	uc010cta.2	O00231	OTTHUMG00000132811	ENST00000261712.3:c.274C>G	17.37:g.30781593C>G	ENSP00000261712:p.Leu92Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3I7|E1P663|O00495|Q53FT5	Missense_Mutation	SNP	pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.L92V	ENST00000261712.3	37	c.274	CCDS11272.1	17	.	.	.	.	.	.	.	.	.	.	C	27.1	4.801038	0.90538	.	.	ENSG00000108671	ENST00000261712	T	0.43294	0.95	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	T	0.65407	0.2688	M	0.86343	2.81	0.80722	D	1	P;B	0.46912	0.886;0.2	P;B	0.56216	0.794;0.285	T	0.69206	-0.5206	10	0.56958	D	0.05	-0.4852	16.7763	0.85551	0.0:1.0:0.0:0.0	.	92;92	B4DTS5;O00231	.;PSD11_HUMAN	V	92	ENSP00000261712:L92V	ENSP00000261712:L92V	L	+	1	0	PSMD11	27805706	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.578000	0.82498	2.824000	0.97209	0.655000	0.94253	CTT	PSMD11	-	NULL	ENSG00000108671		0.433	PSMD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD11	HGNC	protein_coding	OTTHUMT00000256252.2	167	0.00	0	C	NM_002815		30781593	30781593	+1	no_errors	ENST00000261712	ensembl	human	known	69_37n	missense	20	53.49	23	SNP	1.000	G
RERE	473	genome.wustl.edu	37	1	8421432	8421432	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:8421432G>T	ENST00000337907.3	-	19	2769	c.2135C>A	c.(2134-2136)tCc>tAc	p.S712Y	RERE_ENST00000400908.2_Missense_Mutation_p.S712Y|RERE_ENST00000476556.1_Missense_Mutation_p.S158Y|RERE_ENST00000377464.1_Missense_Mutation_p.S444Y|RERE_ENST00000400907.2_Intron	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	712					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		GATGCTCGGGGACGTGCTGCG	0.617																																						dbGAP											0													120.0	112.0	115.0					1																	8421432		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.2135C>A	1.37:g.8421432G>T	ENSP00000338629:p.Ser712Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.S712Y	ENST00000337907.3	37	c.2135	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.368465	0.95900	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T;T	0.65549	-0.16;0.61;2.23;-0.16	5.6	5.6	0.85130	.	.	.	.	.	T	0.78855	0.4349	M	0.67953	2.075	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	T	0.80002	-0.1565	9	0.72032	D	0.01	-33.9561	18.5905	0.91210	0.0:0.0:1.0:0.0	.	444;712	B1AKN3;Q9P2R6	.;RERE_HUMAN	Y	712;444;158;712	ENSP00000338629:S712Y;ENSP00000366684:S444Y;ENSP00000422246:S158Y;ENSP00000383700:S712Y	ENSP00000338629:S712Y	S	-	2	0	RERE	8344019	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.801000	0.99128	2.653000	0.90120	0.561000	0.74099	TCC	RERE	-	pfam_Atrophin-like	ENSG00000142599		0.617	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	140	0.00	0	G			8421432	8421432	-1	no_errors	ENST00000337907	ensembl	human	known	69_37n	missense	59	29.76	25	SNP	1.000	T
RNF40	9810	genome.wustl.edu	37	16	30778177	30778177	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr16:30778177T>A	ENST00000324685.6	+	11	1844	c.1409T>A	c.(1408-1410)cTg>cAg	p.L470Q	RNF40_ENST00000357890.5_Missense_Mutation_p.L370Q|RNF40_ENST00000402121.3_Missense_Mutation_p.L162Q|RNF40_ENST00000563683.1_Missense_Mutation_p.L430Q	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	470					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			GAGCAGAATCTGGCGGCCAAC	0.597																																						dbGAP											0													63.0	45.0	51.0					16																	30778177		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1409T>A	16.37:g.30778177T>A	ENSP00000325677:p.Leu470Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.L470Q	ENST00000324685.6	37	c.1409	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	T	32	5.128135	0.94473	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.39592	1.07;1.07;1.07	5.77	5.77	0.91146	.	0.000000	0.64402	D	0.000001	T	0.67785	0.2930	M	0.84326	2.69	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.997;1.0;0.999;0.999	T	0.73126	-0.4081	10	0.87932	D	0	-15.6038	15.0705	0.72034	0.0:0.0:0.0:1.0	.	162;370;470;470	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	Q	470;370;162	ENSP00000325677:L470Q;ENSP00000350563:L370Q;ENSP00000384942:L162Q	ENSP00000325677:L470Q	L	+	2	0	RNF40	30685678	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.484000	0.81180	2.199000	0.70637	0.533000	0.62120	CTG	RNF40	-	NULL	ENSG00000103549		0.597	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	55	0.00	0	T	NM_014771		30778177	30778177	+1	no_errors	ENST00000324685	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	A
RP2	6102	genome.wustl.edu	37	X	46696579	46696579	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chrX:46696579C>G	ENST00000218340.3	+	1	205	c.44C>G	c.(43-45)tCg>tGg	p.S15W		NM_006915.2	NP_008846.2	O75695	XRP2_HUMAN	retinitis pigmentosa 2 (X-linked recessive)	15					cell morphogenesis (GO:0000902)|CTP biosynthetic process (GO:0006241)|cytoskeleton organization (GO:0007010)|GTP biosynthetic process (GO:0006183)|positive regulation of GTPase activity (GO:0043547)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein transport (GO:0015031)|UTP biosynthetic process (GO:0006228)|visual perception (GO:0007601)	centriole (GO:0005814)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|periciliary membrane compartment (GO:1990075)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|GTPase activator activity (GO:0005096)|nucleoside diphosphate kinase activity (GO:0004550)|unfolded protein binding (GO:0051082)			NS(1)|large_intestine(4)|lung(5)|stomach(1)	11						GACAAGGAGTCGCGGCCCGAG	0.617																																						dbGAP											0													52.0	34.0	40.0					X																	46696579		2153	4149	6302	-	-	-	SO:0001583	missense	0			AJ007590	CCDS14270.1	Xp11.3	2013-01-08			ENSG00000102218	ENSG00000102218			10274	protein-coding gene	gene with protein product		300757				6325945, 9697692, 19852809	Standard	NM_006915		Approved	TBCCD2, NME10, NM23-H10	uc004dgw.4	O75695	OTTHUMG00000021430	ENST00000218340.3:c.44C>G	X.37:g.46696579C>G	ENSP00000218340:p.Ser15Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XJ7|Q9NU67	Missense_Mutation	SNP	pfam_Tubulin-bd_cofactor_C,superfamily_Nucleoside_diP_kinase,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif,pirsf_Protein_XRP2	p.S15W	ENST00000218340.3	37	c.44	CCDS14270.1	X	.	.	.	.	.	.	.	.	.	.	C	12.05	1.820636	0.32145	.	.	ENSG00000102218	ENST00000218340	D	0.89810	-2.57	3.63	2.66	0.31614	.	0.711852	0.13635	N	0.373378	D	0.82430	0.5035	L	0.44542	1.39	0.38751	D	0.9541	P	0.36647	0.563	B	0.34138	0.176	T	0.83275	-0.0041	10	0.72032	D	0.01	-9.2926	6.7783	0.23632	0.278:0.722:0.0:0.0	.	15	O75695	XRP2_HUMAN	W	15	ENSP00000218340:S15W	ENSP00000218340:S15W	S	+	2	0	RP2	46581523	0.952000	0.32445	1.000000	0.80357	0.415000	0.31203	1.920000	0.40025	1.798000	0.52647	0.462000	0.41574	TCG	RP2	-	pirsf_Protein_XRP2	ENSG00000102218		0.617	RP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP2	HGNC	protein_coding	OTTHUMT00000056375.1	34	0.00	0	C	NM_006915		46696579	46696579	+1	no_errors	ENST00000218340	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.997	G
RTN3	10313	genome.wustl.edu	37	11	63487595	63487595	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr11:63487595G>C	ENST00000377819.5	+	3	1775	c.1621G>C	c.(1621-1623)Gag>Cag	p.E541Q	RTN3_ENST00000339997.4_Missense_Mutation_p.E522Q|RTN3_ENST00000341307.2_Intron|RTN3_ENST00000356000.3_Intron|RTN3_ENST00000537981.1_Intron|RTN3_ENST00000354497.4_Intron|RTN3_ENST00000540798.1_Missense_Mutation_p.E429Q	NM_001265589.1	NP_001252518.1	O95197	RTN3_HUMAN	reticulon 3	541					apoptotic process (GO:0006915)|endoplasmic reticulum tubular network organization (GO:0071786)|response to stress (GO:0006950)|vesicle-mediated transport (GO:0016192)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(9)|ovary(1)|skin(1)|urinary_tract(1)	20						AGAAATCAAAGAGATTCCCAG	0.368																																						dbGAP											0													47.0	50.0	49.0					11																	63487595		2200	4297	6497	-	-	-	SO:0001583	missense	0			AF059524	CCDS8048.1, CCDS8049.1, CCDS8050.1, CCDS41664.1, CCDS58141.1, CCDS58142.1, CCDS58143.1	11q13	2011-01-14			ENSG00000133318	ENSG00000133318			10469	protein-coding gene	gene with protein product	"""neuroendocrine-specific protein-like 2"", ""NSP-like protein II"", ""isoforme III"", ""ASY interacting protein"", ""homolog of ASY protein"""	604249				10331947	Standard	NM_006054		Approved	NSPL2, NSPLII, ASYIP, HAP, RTN3-A1	uc001nxq.3	O95197		ENST00000377819.5:c.1621G>C	11.37:g.63487595G>C	ENSP00000367050:p.Glu541Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQS2|B7Z308|B7Z4M0|F5H774|Q147U9|Q496K2|Q53GN3|Q59EP0|Q5UEP2|Q6T930|Q7RTM7|Q7RTM8|Q7RTN3	Missense_Mutation	SNP	pfam_Reticulon,pfscan_Reticulon	p.E541Q	ENST00000377819.5	37	c.1621	CCDS58141.1	11	.	.	.	.	.	.	.	.	.	.	G	14.82	2.649442	0.47362	.	.	ENSG00000133318	ENST00000377819;ENST00000339997;ENST00000540798	T;T;T	0.17854	2.25;2.25;2.25	5.77	4.87	0.63330	.	1.300580	0.05196	N	0.504033	T	0.18341	0.0440	L	0.29908	0.895	0.42075	D	0.991228	P;P;P	0.41848	0.763;0.651;0.763	B;B;B	0.42422	0.308;0.216;0.387	T	0.02269	-1.1185	10	0.26408	T	0.33	-2.428	11.1432	0.48415	0.0849:0.0:0.9151:0.0	.	429;541;522	F5H774;O95197;O95197-2	.;RTN3_HUMAN;.	Q	541;522;429	ENSP00000367050:E541Q;ENSP00000344106:E522Q;ENSP00000442733:E429Q	ENSP00000344106:E522Q	E	+	1	0	RTN3	63244171	0.266000	0.24112	0.084000	0.20598	0.866000	0.49608	1.371000	0.34250	1.588000	0.49971	0.655000	0.94253	GAG	RTN3	-	NULL	ENSG00000133318		0.368	RTN3-002	KNOWN	basic|CCDS	protein_coding	RTN3	HGNC	protein_coding	OTTHUMT00000397846.1	85	0.00	0	G	NM_006054		63487595	63487595	+1	no_errors	ENST00000377819	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	0.201	C
RUFY2	55680	genome.wustl.edu	37	10	70152941	70152941	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr10:70152941T>C	ENST00000602465.1	-	7	704	c.604A>G	c.(604-606)Ata>Gta	p.I202V	RUFY2_ENST00000472394.2_5'UTR|RUFY2_ENST00000454950.2_Missense_Mutation_p.I144V|RUFY2_ENST00000399200.2_Missense_Mutation_p.I168V|RUFY2_ENST00000388768.2_Missense_Mutation_p.I237V			Q8WXA3	RUFY2_HUMAN	RUN and FYVE domain containing 2	251	RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.					nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|upper_aerodigestive_tract(2)	20						TGGTCTAATATGGCAGCAATT	0.264																																						dbGAP											0													53.0	54.0	53.0					10																	70152941		1792	4056	5848	-	-	-	SO:0001583	missense	0			AF461266	CCDS41534.1, CCDS44414.1, CCDS60544.1	10q22.2	2007-01-29			ENSG00000204130	ENSG00000204130		"""Zinc fingers, FYVE domain containing"""	19761	protein-coding gene	gene with protein product		610328				11877430	Standard	NM_001042417		Approved	RABIP4R, FLJ10063, KIAA1537, ZFYVE13	uc001job.3	Q8WXA3	OTTHUMG00000018353	ENST00000602465.1:c.604A>G	10.37:g.70152941T>C	ENSP00000473462:p.Ile202Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXB2|B4DFR0|Q5TC48|Q8IW33|Q96P51|Q9P1Z1	Missense_Mutation	SNP	pfam_Run,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Run,smart_Znf_FYVE,pfscan_Run,pfscan_Znf_FYVE-rel	p.I237V	ENST00000602465.1	37	c.709		10	.	.	.	.	.	.	.	.	.	.	T	6.221	0.408863	0.11812	.	.	ENSG00000204130	ENST00000388768;ENST00000399200;ENST00000454950	T;T;T	0.46451	0.87;2.14;1.68	5.17	4.04	0.47022	.	0.512339	0.22301	N	0.061872	T	0.23806	0.0576	N	0.25789	0.76	0.58432	D	0.999993	B;B;B;B	0.30584	0.286;0.194;0.194;0.002	B;B;B;B	0.26864	0.058;0.074;0.074;0.007	T	0.06180	-1.0841	10	0.02654	T	1	.	10.6902	0.45867	0.0:0.0746:0.0:0.9254	.	144;202;168;237	B4DFR0;Q8WXA3-2;Q8WXA3-4;Q8WXA3-3	.;.;.;.	V	237;168;144	ENSP00000373420:I237V;ENSP00000382151:I168V;ENSP00000404986:I144V	ENSP00000373420:I237V	I	-	1	0	RUFY2	69822947	1.000000	0.71417	0.974000	0.42286	0.914000	0.54420	6.053000	0.71089	0.988000	0.38734	0.482000	0.46254	ATA	RUFY2	-	NULL	ENSG00000204130		0.264	RUFY2-010	KNOWN	basic|appris_principal	protein_coding	RUFY2	HGNC	protein_coding	OTTHUMT00000467567.1	161	0.00	0	T	NM_017987		70152941	70152941	-1	no_errors	ENST00000388768	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	1.000	C
SGK3	23678	genome.wustl.edu	37	8	67740896	67740896	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr8:67740896C>G	ENST00000396596.1	+	7	639	c.425C>G	c.(424-426)tCt>tGt	p.S142C	SGK3_ENST00000521198.2_Missense_Mutation_p.S142C|SGK3_ENST00000520976.1_Missense_Mutation_p.S142C|SGK3_ENST00000522398.1_Missense_Mutation_p.S142C|C8orf44-SGK3_ENST00000519289.1_Missense_Mutation_p.S142C|SGK3_ENST00000345714.4_Missense_Mutation_p.S142C	NM_013257.4	NP_037389.4	Q96BR1	SGK3_HUMAN	serum/glucocorticoid regulated kinase family, member 3	142					ion transmembrane transport (GO:0034220)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|response to stress (GO:0006950)|transmembrane transport (GO:0055085)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chloride channel regulator activity (GO:0017081)|phosphatidylinositol binding (GO:0035091)|potassium channel regulator activity (GO:0015459)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|sodium channel regulator activity (GO:0017080)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|upper_aerodigestive_tract(1)	18	Breast(64;0.186)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0046)|OV - Ovarian serous cystadenocarcinoma(28;0.0112)|all cancers(69;0.0141)|BRCA - Breast invasive adenocarcinoma(89;0.206)			CAGCTACACTCTACCTCACAG	0.318																																						dbGAP											0													177.0	179.0	178.0					8																	67740896		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6195.1, CCDS6196.1	8q12	2008-07-28	2005-09-13	2005-09-13		ENSG00000104205			10812	protein-coding gene	gene with protein product		607591	"""serum/glucocorticoid regulated kinase-like"""	SGK2, SGKL		10585774, 10548550	Standard	NM_013257		Approved		uc003xwr.3	Q96BR1		ENST00000396596.1:c.425C>G	8.37:g.67740896C>G	ENSP00000379842:p.Ser142Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5W3|B3KQC2|Q9P1Q7|Q9UKG5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Phox,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Phox,pfscan_Prot_kinase_cat_dom	p.S142C	ENST00000396596.1	37	c.425	CCDS6195.1	8	.	.	.	.	.	.	.	.	.	.	C	20.4	3.986551	0.74589	.	.	ENSG00000104205	ENST00000519289;ENST00000521198;ENST00000262211;ENST00000521960;ENST00000522398;ENST00000520976;ENST00000396596;ENST00000345714;ENST00000519396	T;T;T;T;T;T;T	0.72942	-0.7;-0.7;-0.7;-0.04;-0.7;-0.7;1.13	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.62575	0.2439	L	0.29908	0.895	0.43522	D	0.995799	B;B	0.32467	0.372;0.256	B;B	0.30179	0.112;0.052	T	0.68247	-0.5459	9	0.59425	D	0.04	.	19.2897	0.94093	0.0:1.0:0.0:0.0	.	142;142	Q96BR1-2;Q96BR1	.;SGK3_HUMAN	C	142;142;142;75;142;142;142;142;24	ENSP00000429022:S142C;ENSP00000430463:S142C;ENSP00000430256:S142C;ENSP00000430691:S142C;ENSP00000379842:S142C;ENSP00000331816:S142C;ENSP00000428529:S24C	ENSP00000262211:S142C	S	+	2	0	SGK3	67903450	1.000000	0.71417	1.000000	0.80357	0.882000	0.50991	5.920000	0.70017	2.559000	0.86315	0.563000	0.77884	TCT	SGK3	-	NULL	ENSG00000104205		0.318	SGK3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SGK3	HGNC	protein_coding	OTTHUMT00000379232.3	293	0.00	0	C			67740896	67740896	+1	no_errors	ENST00000262211	ensembl	human	known	69_37n	missense	96	17.24	20	SNP	1.000	G
SHISA4	149345	genome.wustl.edu	37	1	201859608	201859608	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:201859608C>G	ENST00000362011.6	+	3	559	c.272C>G	c.(271-273)tCa>tGa	p.S91*	SHISA4_ENST00000464117.1_3'UTR	NM_198149.2	NP_937792.2	Q96DD7	SHSA4_HUMAN	shisa family member 4	91						integral component of membrane (GO:0016021)				kidney(1)|lung(4)	5						GGCATCGCCTCAGCTGTGATC	0.557																																						dbGAP											0													227.0	189.0	202.0					1																	201859608		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY358589	CCDS1416.1	1q32.1	2013-07-31	2013-07-31	2008-04-01	ENSG00000198892	ENSG00000198892		"""Shisa homologs"""	27139	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 40"", ""transmembrane protein 58"", ""shisa homolog 4 (Xenopus laevis)"""	C1orf40, TMEM58		12975309	Standard	NR_030775		Approved	hShisa4	uc001gxa.3	Q96DD7	OTTHUMG00000035807	ENST00000362011.6:c.272C>G	1.37:g.201859608C>G	ENSP00000355064:p.Ser91*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFI0|B7ZAJ7|Q5VUU1|Q6P711|Q6UWY7	Nonsense_Mutation	SNP	NULL	p.S91*	ENST00000362011.6	37	c.272	CCDS1416.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.428107	0.96131	.	.	ENSG00000198892	ENST00000362011	.	.	.	5.14	5.14	0.70334	.	0.128500	0.56097	D	0.000040	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-10.0304	9.6862	0.40100	0.0:0.9046:0.0:0.0954	.	.	.	.	X	91	.	ENSP00000355064:S91X	S	+	2	0	SHISA4	200126231	1.000000	0.71417	0.925000	0.36789	0.985000	0.73830	5.505000	0.66981	2.394000	0.81467	0.491000	0.48974	TCA	SHISA4	-	NULL	ENSG00000198892		0.557	SHISA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHISA4	HGNC	protein_coding	OTTHUMT00000087096.1	128	0.00	0	C	NM_198149		201859608	201859608	+1	no_errors	ENST00000362011	ensembl	human	known	69_37n	nonsense	48	15.79	9	SNP	0.995	G
SIGLEC8	27181	genome.wustl.edu	37	19	51958011	51958011	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr19:51958011C>G	ENST00000321424.3	-	5	1141	c.1075G>C	c.(1075-1077)Gtg>Ctg	p.V359L	SIGLEC8_ENST00000597352.1_5'Flank|SIGLEC8_ENST00000430817.1_Missense_Mutation_p.V250L|SIGLEC8_ENST00000340550.5_Missense_Mutation_p.V266L	NM_014442.2	NP_055257.2	Q9NYZ4	SIGL8_HUMAN	sialic acid binding Ig-like lectin 8	359					cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(11)|liver(3)|lung(15)|ovary(2)|skin(4)|stomach(3)|urinary_tract(2)	50		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000627)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		GCCAGTGTCACTTGTGATACA	0.562																																						dbGAP											0													121.0	107.0	112.0					19																	51958011		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF195092	CCDS33086.1	19q13.33-q13.41	2013-01-29			ENSG00000105366	ENSG00000105366		"""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10877	protein-coding gene	gene with protein product		605639				10625619	Standard	XR_243922		Approved	SIGLEC-8, SAF2, SIGLEC8L, MGC59785	uc002pwt.3	Q9NYZ4		ENST00000321424.3:c.1075G>C	19.37:g.51958011C>G	ENSP00000321077:p.Val359Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z728	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V359L	ENST00000321424.3	37	c.1075	CCDS33086.1	19	.	.	.	.	.	.	.	.	.	.	.	0.037	-1.301601	0.01353	.	.	ENSG00000105366	ENST00000430817;ENST00000321424;ENST00000340550	T;T;T	0.04156	3.69;3.69;3.69	1.78	0.605	0.17553	.	1.842820	0.03593	U	0.232111	T	0.05502	0.0145	L	0.48642	1.525	0.09310	N	1	B;B;B	0.30605	0.287;0.124;0.011	B;B;B	0.24974	0.057;0.051;0.01	T	0.41734	-0.9492	10	0.27082	T	0.32	.	5.7619	0.18205	0.0:0.6576:0.3424:0.0	.	250;266;359	C9JT30;Q9NYZ4-2;Q9NYZ4	.;.;SIGL8_HUMAN	L	250;359;266	ENSP00000389142:V250L;ENSP00000321077:V359L;ENSP00000339448:V266L	ENSP00000321077:V359L	V	-	1	0	SIGLEC8	56649823	0.001000	0.12720	0.002000	0.10522	0.007000	0.05969	0.699000	0.25586	0.260000	0.21731	0.393000	0.25936	GTG	SIGLEC8	-	NULL	ENSG00000105366		0.562	SIGLEC8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SIGLEC8	HGNC	protein_coding	OTTHUMT00000463648.2	126	0.00	0	C	NM_014442		51958011	51958011	-1	no_errors	ENST00000321424	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	0.003	G
SLC26A10	65012	genome.wustl.edu	37	12	58018733	58018733	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr12:58018733G>T	ENST00000320442.4	+	10	1623	c.1312G>T	c.(1312-1314)Gag>Tag	p.E438*	SLC26A10_ENST00000379218.2_3'UTR|SLC26A10_ENST00000490243.1_3'UTR	NM_133489.2	NP_597996.2	Q8NG04	S2610_HUMAN	solute carrier family 26, member 10	438	STAS. {ECO:0000255|PROSITE- ProRule:PRU00198}.					integral component of membrane (GO:0016021)	antiporter activity (GO:0015297)|sulfate transmembrane transporter activity (GO:0015116)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(7)	19	Melanoma(17;0.122)					CTGCAACCTGGAGTGGCACCT	0.587																																						dbGAP											0													103.0	106.0	105.0					12																	58018733		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS8949.2	12q13	2013-07-18			ENSG00000135502	ENSG00000135502		"""Solute carriers"""	14470	protein-coding gene	gene with protein product							Standard	NM_133489		Approved		uc001spe.3	Q8NG04	OTTHUMG00000128505	ENST00000320442.4:c.1312G>T	12.37:g.58018733G>T	ENSP00000320217:p.Glu438*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMJ2|B6ZDQ3|Q6ZWI7	Nonsense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	p.E438*	ENST00000320442.4	37	c.1312	CCDS8949.2	12	.	.	.	.	.	.	.	.	.	.	.	28.7	4.947036	0.92593	.	.	ENSG00000135502	ENST00000320442	.	.	.	4.71	2.78	0.32641	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	9.9881	0.41854	0.0:0.0:0.6358:0.3642	.	.	.	.	X	438	.	ENSP00000320217:E438X	E	+	1	0	SLC26A10	56305000	0.869000	0.29996	0.581000	0.28614	0.192000	0.23643	1.956000	0.40382	1.203000	0.43233	-0.268000	0.10319	GAG	SLC26A10	-	pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom	ENSG00000135502		0.587	SLC26A10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A10	HGNC	protein_coding	OTTHUMT00000250311.2	166	0.00	0	G			58018733	58018733	+1	no_errors	ENST00000320442	ensembl	human	known	69_37n	nonsense	44	33.33	22	SNP	0.006	T
SLC39A4	55630	genome.wustl.edu	37	8	145638248	145638248	+	Silent	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr8:145638248G>A	ENST00000301305.3	-	11	1815	c.1710C>T	c.(1708-1710)ttC>ttT	p.F570F	SLC39A4_ENST00000531013.1_5'UTR|SLC39A4_ENST00000276833.5_Silent_p.F545F|GS1-393G12.14_ENST00000607491.1_RNA	NM_130849.2	NP_570901	Q6P5W5	S39A4_HUMAN	solute carrier family 39 (zinc transporter), member 4	570					cellular response to zinc ion starvation (GO:0034224)|cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	14	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;1.12e-40)|all cancers(56;8.17e-36)|BRCA - Breast invasive adenocarcinoma(115;0.0407)|Colorectal(110;0.055)			AGAGACCAGCGAAGGCCGTGA	0.677																																						dbGAP											0													29.0	33.0	32.0					8																	145638248		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AK025537	CCDS6424.1, CCDS43782.1	8q24.3	2013-05-22			ENSG00000147804	ENSG00000147804		"""Solute carriers"""	17129	protein-coding gene	gene with protein product		607059	"""acrodermatitis enteropathica, zinc-deficiency type"""	AEZ		12801924, 12659941, 14709598	Standard	NM_017767		Approved	ZIP4, AWMS2	uc003zcq.3	Q6P5W5		ENST00000301305.3:c.1710C>T	8.37:g.145638248G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7L5S5|Q9H6T8|Q9NXC4	Silent	SNP	pfam_ZIP	p.F570	ENST00000301305.3	37	c.1710	CCDS6424.1	8																																																																																			SLC39A4	-	pfam_ZIP	ENSG00000147804		0.677	SLC39A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC39A4	HGNC	protein_coding	OTTHUMT00000382688.1	12	0.00	0	G			145638248	145638248	-1	no_errors	ENST00000301305	ensembl	human	known	69_37n	silent	3	66.67	6	SNP	0.924	A
SPATA6	54558	genome.wustl.edu	37	1	48918720	48918720	+	Frame_Shift_Del	DEL	T	T	-	rs141429477	byFrequency	TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:48918720delT	ENST00000371847.3	-	2	299	c.135delA	c.(133-135)caafs	p.Q45fs	SPATA6_ENST00000371843.3_Frame_Shift_Del_p.Q45fs|SPATA6_ENST00000396199.3_De_novo_Start_OutOfFrame|SPATA6_ENST00000463938.1_5'UTR	NM_019073.2	NP_061946.1	Q9NWH7	SPAT6_HUMAN	spermatogenesis associated 6	45					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular region (GO:0005576)				breast(1)|endometrium(2)|large_intestine(6)|lung(7)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(1)	21						CTGGGACACATTGTGTCTTTT	0.388																																						dbGAP											0													127.0	121.0	123.0					1																	48918720		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK000869	CCDS551.1, CCDS65535.1, CCDS72787.1	1p32.3	2012-03-15			ENSG00000132122	ENSG00000132122			18309	protein-coding gene	gene with protein product	"""spermatogenesis-related factor-1"""	613947					Standard	XM_005270948		Approved	SRF1, FLJ10007, SRF-1	uc001crr.2	Q9NWH7	OTTHUMG00000007794	ENST00000371847.3:c.135delA	1.37:g.48918720delT	ENSP00000360913:p.Gln45fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3N7|Q8WUE6	Frame_Shift_Del	DEL	NULL	p.Q45fs	ENST00000371847.3	37	c.135	CCDS551.1	1																																																																																			SPATA6	-	NULL	ENSG00000132122		0.388	SPATA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA6	HGNC	protein_coding	OTTHUMT00000021347.1	129	0.00	0	T	NM_019073		48918720	48918720	-1	no_errors	ENST00000371847	ensembl	human	known	69_37n	frame_shift_del	54	11.29	7	DEL	1.000	-
SPPL2A	84888	genome.wustl.edu	37	15	51024862	51024862	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr15:51024862C>T	ENST00000261854.5	-	9	1226	c.952G>A	c.(952-954)Gat>Aat	p.D318N		NM_032802.3	NP_116191.2	Q8TCT8	SPP2A_HUMAN	signal peptide peptidase like 2A	318					membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	15				all cancers(107;0.000712)|GBM - Glioblastoma multiforme(94;0.00314)		CCCAAGATATCCTGTAAAATC	0.308																																					Melanoma(50;790 1209 4069 22965 33125)	dbGAP											0													65.0	63.0	64.0					15																	51024862		2193	4294	6487	-	-	-	SO:0001583	missense	0				CCDS10138.1	15q21.2	2012-02-21			ENSG00000138600	ENSG00000138600			30227	protein-coding gene	gene with protein product	"""intramembrane protease 3"", ""presenilin-like protein 2"""	608238				12077416, 12139484	Standard	NM_032802		Approved	IMP3, PSL2	uc001zyv.3	Q8TCT8	OTTHUMG00000131647	ENST00000261854.5:c.952G>A	15.37:g.51024862C>T	ENSP00000261854:p.Asp318Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	pfam_Peptidase_A22B_SPP,pfam_Protease-assoc_domain,smart_Peptidase_A22	p.D318N	ENST00000261854.5	37	c.952	CCDS10138.1	15	.	.	.	.	.	.	.	.	.	.	C	29.6	5.016952	0.93404	.	.	ENSG00000138600	ENST00000261854	T	0.19669	2.13	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.39545	0.1082	L	0.43152	1.355	0.80722	D	1	D	0.71674	0.998	D	0.70227	0.968	T	0.01269	-1.1400	10	0.22706	T	0.39	-12.9588	20.1379	0.98040	0.0:1.0:0.0:0.0	.	318	Q8TCT8	PSL2_HUMAN	N	318	ENSP00000261854:D318N	ENSP00000261854:D318N	D	-	1	0	AC012100.1	48812154	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.980000	0.63812	2.769000	0.95229	0.644000	0.83932	GAT	SPPL2A	-	pfam_Peptidase_A22B_SPP,smart_Peptidase_A22	ENSG00000138600		0.308	SPPL2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPPL2A	HGNC	protein_coding	OTTHUMT00000254543.3	179	0.00	0	C	NM_032802		51024862	51024862	-1	no_errors	ENST00000261854	ensembl	human	known	69_37n	missense	27	22.86	8	SNP	1.000	T
SULF1	23213	genome.wustl.edu	37	8	70550877	70550877	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr8:70550877C>T	ENST00000260128.4	+	20	3142	c.2425C>T	c.(2425-2427)Cag>Tag	p.Q809*	SULF1_ENST00000521946.1_3'UTR|SULF1_ENST00000458141.2_Nonsense_Mutation_p.Q809*|SULF1_ENST00000419716.3_Nonsense_Mutation_p.Q809*|SULF1_ENST00000402687.4_Nonsense_Mutation_p.Q809*	NM_015170.2	NP_055985.2	Q8IWU6	SULF1_HUMAN	sulfatase 1	809					apoptotic process (GO:0006915)|bone development (GO:0060348)|cartilage development (GO:0051216)|chondrocyte development (GO:0002063)|embryonic skeletal system development (GO:0048706)|esophagus smooth muscle contraction (GO:0014846)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)|glomerular basement membrane development (GO:0032836)|glomerular filtration (GO:0003094)|heparan sulfate proteoglycan metabolic process (GO:0030201)|innervation (GO:0060384)|kidney development (GO:0001822)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell migration (GO:0030336)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast growth factor receptor signaling pathway (GO:0040037)|negative regulation of prostatic bud formation (GO:0060686)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	arylsulfatase activity (GO:0004065)|calcium ion binding (GO:0005509)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)			breast(2)|central_nervous_system(3)|endometrium(5)|kidney(3)|large_intestine(10)|lung(15)|ovary(3)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	Breast(64;0.0654)		Epithelial(68;0.0124)|OV - Ovarian serous cystadenocarcinoma(28;0.0265)|all cancers(69;0.0534)			AGATCCTTATCAGGTAAGACA	0.343																																						dbGAP											0													139.0	135.0	136.0					8																	70550877		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029000	CCDS6204.1	8q13.2	2014-09-11			ENSG00000137573	ENSG00000137573			20391	protein-coding gene	gene with protein product		610012				12368295	Standard	NM_015170		Approved	KIAA1077, SULF-1	uc003xyd.2	Q8IWU6	OTTHUMG00000164466	ENST00000260128.4:c.2425C>T	8.37:g.70550877C>T	ENSP00000260128:p.Gln809*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YV8|Q8NCA2|Q9UPS5	Nonsense_Mutation	SNP	pfam_Sulfatase,pfam_Extracellular_sulfatase_C,pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	p.Q809*	ENST00000260128.4	37	c.2425	CCDS6204.1	8	.	.	.	.	.	.	.	.	.	.	C	46	12.878204	0.99703	.	.	ENSG00000137573	ENST00000458141;ENST00000260128;ENST00000402687;ENST00000419716	.	.	.	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	18.1612	0.89708	0.0:1.0:0.0:0.0	.	.	.	.	X	809	.	ENSP00000260128:Q809X	Q	+	1	0	SULF1	70713431	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.606000	0.82863	2.598000	0.87819	0.650000	0.86243	CAG	SULF1	-	superfamily_Alkaline_phosphatase_core,pirsf_Extracellular_sulfatase	ENSG00000137573		0.343	SULF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULF1	HGNC	protein_coding	OTTHUMT00000378885.2	229	0.00	0	C	NM_015170		70550877	70550877	+1	no_errors	ENST00000260128	ensembl	human	known	69_37n	nonsense	66	18.52	15	SNP	1.000	T
SYNE1	23345	genome.wustl.edu	37	6	152558036	152558036	+	Silent	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr6:152558036C>T	ENST00000367255.5	-	109	20716	c.20115G>A	c.(20113-20115)ctG>ctA	p.L6705L	SYNE1_ENST00000356820.4_Silent_p.L1229L|SYNE1_ENST00000341594.5_Silent_p.L6317L|SYNE1_ENST00000423061.1_Silent_p.L6634L|SYNE1_ENST00000265368.4_Silent_p.L6705L|SYNE1_ENST00000448038.1_Silent_p.L6634L	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6705					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		CCACCACCTCCAGCTGTCTGC	0.522										HNSCC(10;0.0054)																												dbGAP											0													111.0	83.0	93.0					6																	152558036		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.20115G>A	6.37:g.152558036C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L6705	ENST00000367255.5	37	c.20115	CCDS5236.2	6																																																																																			SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_Spectrin/alpha-actinin	ENSG00000131018		0.522	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	87	0.00	0	C	NM_182961		152558036	152558036	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	silent	25	16.67	5	SNP	1.000	T
TNFRSF9	3604	genome.wustl.edu	37	1	7993230	7993231	+	Frame_Shift_Ins	INS	-	-	ATAT			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:7993230_7993231insATAT	ENST00000377507.3	-	7	836_837	c.670_671insATAT	c.(670-672)ttcfs	p.F224fs		NM_001561.5	NP_001552.2	Q07011	TNR9_HUMAN	tumor necrosis factor receptor superfamily, member 9	224	Interaction with LRR-1.				apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			NS(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	19	Ovarian(185;0.0634)|all_lung(157;0.151)	all_epithelial(116;9.63e-21)|all_lung(118;1.29e-06)|Lung NSC(185;7.5e-06)|Renal(390;0.000147)|Breast(348;0.000625)|Colorectal(325;0.000959)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.93e-71)|GBM - Glioblastoma multiforme(8;3.72e-37)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;7.71e-06)|Kidney(185;5.33e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000419)|KIRC - Kidney renal clear cell carcinoma(229;0.000979)|STAD - Stomach adenocarcinoma(132;0.00103)|READ - Rectum adenocarcinoma(331;0.0649)		ACGTTGTTTGAATATATACAGG	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L12964	CCDS92.1	1p36	2008-02-05			ENSG00000049249	ENSG00000049249		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11924	protein-coding gene	gene with protein product		602250		ILA		8262389, 8639902	Standard	NM_001561		Approved	CD137, 4-1BB	uc001aot.3	Q07011	OTTHUMG00000001223	ENST00000377507.3:c.667_670dupATAT	1.37:g.7993231_7993234dupATAT	ENSP00000366729:p.Phe224fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,prints_TNFR_9,pfscan_TNFR/NGFR_Cys_rich_reg	p.F224fs	ENST00000377507.3	37	c.671_670	CCDS92.1	1																																																																																			TNFRSF9	-	prints_TNFR_9	ENSG00000049249		0.376	TNFRSF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF9	HGNC	protein_coding	OTTHUMT00000003622.1	74	0.00	0	-			7993230	7993231	-1	no_errors	ENST00000377507	ensembl	human	known	69_37n	frame_shift_ins	18	10.00	2	INS	0.918:0.008	ATAT
TP53	7157	genome.wustl.edu	37	17	7578290	7578290	+	Splice_Site	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr17:7578290C>G	ENST00000269305.4	-	6	749		c.e6-1		TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Splice_Site|TP53_ENST00000455263.2_Splice_Site|TP53_ENST00000445888.2_Splice_Site|TP53_ENST00000413465.2_Splice_Site|TP53_ENST00000359597.4_Splice_Site	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53						apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.?(40)|p.0?(8)|p.G187fs*16(2)|p.D186_P191delDGLAPP(1)|p.L188fs*19(1)|p.G187_L188delGL(1)|p.G187fs*22(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	GGGGCCAGACCTAAGAGCAAT	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	54	Unknown(40)|Whole gene deletion(8)|Deletion - Frameshift(3)|Deletion - In frame(2)|Insertion - Frameshift(1)	upper_aerodigestive_tract(11)|lung(9)|large_intestine(6)|central_nervous_system(5)|ovary(5)|haematopoietic_and_lymphoid_tissue(4)|bone(4)|liver(3)|oesophagus(2)|breast(2)|stomach(1)|genital_tract(1)|eye(1)	GRCh37	CD043957|CS011574|CS083991	TP53	D|S							82.0	74.0	76.0					17																	7578290		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.560-1G>C	17.37:g.7578290C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Splice_Site	SNP	-	e5-1	ENST00000269305.4	37	c.560-1	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	8.588	0.883886	0.17467	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	.	.	.	4.67	4.67	0.58626	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.89	0.79291	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TP53	7519015	1.000000	0.71417	0.995000	0.50966	0.031000	0.12232	3.449000	0.52950	2.539000	0.85634	0.655000	0.94253	.	TP53	-	-	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	103	0.00	0	C	NM_000546	Intron	7578290	7578290	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	splice_site	33	21.43	9	SNP	1.000	G
TRPC7	57113	genome.wustl.edu	37	5	135692820	135692820	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr5:135692820C>T	ENST00000513104.1	-	2	538	c.256G>A	c.(256-258)Gtg>Atg	p.V86M	TRPC7_ENST00000426057.2_Missense_Mutation_p.V86M|TRPC7_ENST00000355180.3_Missense_Mutation_p.V86M	NM_020389.2	NP_065122.1	Q9HCX4	TRPC7_HUMAN	transient receptor potential cation channel, subfamily C, member 7	86					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|manganese ion transport (GO:0006828)|platelet activation (GO:0030168)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)	p.V86M(2)		NS(1)|breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(3)	46			KIRC - Kidney renal clear cell carcinoma(527;0.0101)|Kidney(363;0.0233)			TCGTTGCCCACGGCCAGCTGC	0.597																																						dbGAP											2	Substitution - Missense(2)	prostate(2)											76.0	85.0	82.0					5																	135692820		2200	4300	6500	-	-	-	SO:0001583	missense	0			AJ272034	CCDS47267.1, CCDS47267.2, CCDS54905.1, CCDS54906.1	5q31.2	2011-12-14			ENSG00000069018	ENSG00000069018		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	20754	protein-coding gene	gene with protein product						11805119, 16382100	Standard	NM_020389		Approved		uc003lbn.2	Q9HCX4	OTTHUMG00000162035	ENST00000513104.1:c.256G>A	5.37:g.135692820C>T	ENSP00000426070:p.Val86Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4Z4|F5H5U9|Q70T26|Q8IWP7	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,pfam_PKD1_2_channel,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,smart_Ankyrin_rpt,prints_TRPC7_channel,prints_TRPC_channel,tigrfam_TRP_channel	p.V86M	ENST00000513104.1	37	c.256	CCDS47267.2	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.2|23.2	4.381713|4.381713	0.82792|0.82792	.|.	.|.	ENSG00000069018|ENSG00000069018	ENST00000352189;ENST00000378459;ENST00000502753|ENST00000355180;ENST00000426057;ENST00000513104;ENST00000265193	.|T;T;T	.|0.67171	.|-0.25;-0.25;-0.25	5.0|5.0	5.0|5.0	0.66597|0.66597	.|Ankyrin repeat-containing domain (3);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.83147|0.83147	0.5191|0.5191	M|M	0.81497|0.81497	2.545|2.545	0.43191|0.43191	D|D	0.995021|0.995021	.|D;D;D;D	.|0.89917	.|0.999;0.999;1.0;1.0	.|D;P;D;D	.|0.91635	.|0.993;0.784;0.999;0.998	D|D	0.85504|0.85504	0.1193|0.1193	5|10	.|0.87932	.|D	.|0	-22.3339|-22.3339	18.5076|18.5076	0.90902|0.90902	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|86;86;86;86	.|Q8IWP7;F5H5U9;Q70T25;Q9HCX4	.|.;.;.;TRPC7_HUMAN	H|M	85|86	.|ENSP00000347312:V86M;ENSP00000441628:V86M;ENSP00000426070:V86M	.|ENSP00000265193:V86M	R|V	-|-	2|1	0|0	TRPC7|TRPC7	135720719|135720719	1.000000|1.000000	0.71417|0.71417	0.951000|0.951000	0.38953|0.38953	0.992000|0.992000	0.81027|0.81027	7.651000|7.651000	0.83577|0.83577	2.608000|2.608000	0.88229|0.88229	0.561000|0.561000	0.74099|0.74099	CGT|GTG	TRPC7	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,tigrfam_TRP_channel	ENSG00000069018		0.597	TRPC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC7	HGNC	protein_coding	OTTHUMT00000366975.1	51	0.00	0	C	NM_020389		135692820	135692820	-1	no_errors	ENST00000513104	ensembl	human	known	69_37n	missense	9	35.71	5	SNP	1.000	T
TSPEAR	54084	genome.wustl.edu	37	21	45929173	45929173	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr21:45929173delG	ENST00000323084.4	-	10	1728	c.1663delC	c.(1663-1665)cagfs	p.Q555fs	TSPEAR_ENST00000397916.1_Frame_Shift_Del_p.Q487fs|TSPEAR-AS1_ENST00000430181.1_RNA|TSPEAR-AS1_ENST00000451035.1_RNA	NM_001272037.1|NM_144991.2	NP_001258966.1|NP_659428.2	Q8WU66	TSEAR_HUMAN	thrombospondin-type laminin G domain and EAR repeats	555					sensory perception of sound (GO:0007605)	cell surface (GO:0009986)|ciliary membrane (GO:0060170)|extracellular region (GO:0005576)|stereocilium (GO:0032420)				breast(1)|central_nervous_system(6)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(1)|pancreas(1)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)	37						GAATCATTCTGGACTTGCATC	0.542																																						dbGAP											0													213.0	132.0	159.0					21																	45929173		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ487962	CCDS13712.1, CCDS74801.1	21q22.3	2012-10-30	2011-01-25	2011-01-25	ENSG00000175894	ENSG00000175894			1268	protein-coding gene	gene with protein product		612920	"""chromosome 21 open reading frame 29"", ""deafness, autosomal recessive 98"""	C21orf29, DFNB98		12095917, 22678063	Standard	NM_144991		Approved	MGC11251, TSP-EAR	uc002zfe.1	Q8WU66	OTTHUMG00000041215	ENST00000323084.4:c.1663delC	21.37:g.45929173delG	ENSP00000321987:p.Gln555fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_EPTP,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_EAR	p.Q555fs	ENST00000323084.4	37	c.1663	CCDS13712.1	21																																																																																			TSPEAR	-	pfscan_EAR	ENSG00000175894		0.542	TSPEAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPEAR	HGNC	protein_coding	OTTHUMT00000098761.1	79	0.00	0	G	NM_144991		45929173	45929173	-1	no_errors	ENST00000323084	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	0.075	-
WDR78	79819	genome.wustl.edu	37	1	67371056	67371056	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr1:67371056T>C	ENST00000371026.3	-	2	228	c.173A>G	c.(172-174)aAc>aGc	p.N58S	WDR78_ENST00000488333.1_5'UTR|WDR78_ENST00000431318.1_5'UTR|WDR78_ENST00000371023.3_Missense_Mutation_p.N58S|WDR78_ENST00000371022.3_Missense_Mutation_p.N58S	NM_024763.4	NP_079039.4	Q5VTH9	WDR78_HUMAN	WD repeat domain 78	58					hematopoietic progenitor cell differentiation (GO:0002244)					NS(1)|endometrium(3)|kidney(6)|large_intestine(6)|lung(10)|ovary(3)|skin(3)	32						TGTGGCATTGTTCCTATATAA	0.313																																						dbGAP											0													74.0	72.0	73.0					1																	67371056		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648840	CCDS635.1, CCDS44157.1	1p31.2	2014-02-21	2013-02-19	2013-02-19	ENSG00000152763	ENSG00000152763		"""WD repeat domain containing"""	26252	protein-coding gene	gene with protein product						21953912	Standard	NM_207014		Approved	DIC4, FLJ23129	uc001dcx.3	Q5VTH9	OTTHUMG00000009165	ENST00000371026.3:c.173A>G	1.37:g.67371056T>C	ENSP00000360065:p.Asn58Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9W5|B5MDT3|H7BY80|Q5VTI0|Q8N5G5|Q9H5R9|Q9UF44	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.N58S	ENST00000371026.3	37	c.173	CCDS635.1	1	.	.	.	.	.	.	.	.	.	.	T	2.902	-0.227273	0.06022	.	.	ENSG00000152763	ENST00000371026;ENST00000371023;ENST00000371022	T;T;T	0.50001	0.76;2.48;1.69	4.1	-8.2	0.01045	.	3.420860	0.00531	N	0.000204	T	0.07369	0.0186	N	0.08118	0	0.21220	N	0.999756	B;B;B	0.10296	0.003;0.001;0.001	B;B;B	0.11329	0.006;0.002;0.002	T	0.03231	-1.1058	10	0.14252	T	0.57	-0.4423	9.3671	0.38230	0.0:0.4166:0.4202:0.1632	.	58;58;58	Q5TAD8;A0AVI9;Q5VTH9	.;.;WDR78_HUMAN	S	58	ENSP00000360065:N58S;ENSP00000360062:N58S;ENSP00000360061:N58S	ENSP00000360061:N58S	N	-	2	0	WDR78	67143644	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.960000	0.00673	-2.309000	0.00651	0.454000	0.30748	AAC	WDR78	-	NULL	ENSG00000152763		0.313	WDR78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR78	HGNC	protein_coding	OTTHUMT00000025404.1	176	0.00	0	T	NM_024763		67371056	67371056	-1	no_errors	ENST00000371026	ensembl	human	known	69_37n	missense	47	21.67	13	SNP	0.000	C
ZNF627	199692	genome.wustl.edu	37	19	11728555	11728555	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr19:11728555C>G	ENST00000361113.5	+	4	1445	c.1237C>G	c.(1237-1239)Cac>Gac	p.H413D	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						TGAAAGAACTCACACTGGAGA	0.398																																					Melanoma(112;173 1614 10731 17751 23322)	dbGAP											0													45.0	49.0	48.0					19																	11728555		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.1237C>G	19.37:g.11728555C>G	ENSP00000354414:p.His413Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O14846|Q4KMP9|Q6NT81|Q9BRG4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H413D	ENST00000361113.5	37	c.1237	CCDS42502.1	19	.	.	.	.	.	.	.	.	.	.	c	19.42	3.824246	0.71143	.	.	ENSG00000198551	ENST00000361113	T	0.67698	-0.28	1.5	1.5	0.22942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.86916	0.6048	H	0.99011	4.4	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87835	0.2647	9	0.87932	D	0	.	8.9507	0.35788	0.0:1.0:0.0:0.0	.	413	Q7L945	ZN627_HUMAN	D	413	ENSP00000354414:H413D	ENSP00000354414:H413D	H	+	1	0	ZNF627	11589555	0.995000	0.38212	0.009000	0.14445	0.947000	0.59692	4.136000	0.58004	1.168000	0.42723	0.467000	0.42956	CAC	ZNF627	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198551		0.398	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF627	HGNC	protein_coding	OTTHUMT00000458875.1	83	0.00	0	C	NM_145295		11728555	11728555	+1	no_errors	ENST00000361113	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	0.975	G
XRCC1	7515	genome.wustl.edu	37	19	44055732	44055732	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A208-01A-11D-A159-09	TCGA-BH-A208-11A-51D-A159-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ae749fbb-6de7-4c51-b9d6-80a2ce7b5a29	e3c69830-05a7-4679-8d75-37591eade0bc	g.chr19:44055732G>A	ENST00000262887.5	-	10	1737	c.1190C>T	c.(1189-1191)cCc>cTc	p.P397L	XRCC1_ENST00000543982.1_Missense_Mutation_p.P366L|L34079.3_ENST00000597119.1_RNA			P18887	XRCC1_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 1	397	BRCT 1. {ECO:0000255|PROSITE- ProRule:PRU00033}.				base-excision repair (GO:0006284)|DNA repair (GO:0006281)|hippocampus development (GO:0021766)|response to drug (GO:0042493)|response to hypoxia (GO:0001666)|response to organic substance (GO:0010033)|single strand break repair (GO:0000012)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Prostate(69;0.0153)				CCTCTGGGAGGGCAGCCGCCG	0.642								Other BER factors																														dbGAP											0													56.0	52.0	54.0					19																	44055732		2203	4300	6503	-	-	-	SO:0001583	missense	0			M36089	CCDS12624.1	19q13.2	2014-09-17				ENSG00000073050			12828	protein-coding gene	gene with protein product		194360		RCC		2247054	Standard	NM_006297		Approved		uc002owt.2	P18887		ENST00000262887.5:c.1190C>T	19.37:g.44055732G>A	ENSP00000262887:p.Pro397Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IBS4|Q9HCB1	Missense_Mutation	SNP	pfam_Xrcc1_N,pfam_BRCT_dom,superfamily_Galactose-bd-like,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.P397L	ENST00000262887.5	37	c.1190	CCDS12624.1	19	.	.	.	.	.	.	.	.	.	.	G	23.3	4.398647	0.83120	.	.	ENSG00000073050	ENST00000458471;ENST00000262887;ENST00000543982	T;T	0.11277	3.3;2.79	5.16	5.16	0.70880	BRCT (2);	0.110724	0.64402	D	0.000006	T	0.33294	0.0858	M	0.73962	2.25	0.80722	D	1	D;P	0.89917	1.0;0.649	D;P	0.73708	0.981;0.528	T	0.00893	-1.1524	10	0.42905	T	0.14	-26.72	16.9559	0.86259	0.0:0.0:1.0:0.0	.	366;397	F5H8D7;P18887	.;XRCC1_HUMAN	L	411;397;366	ENSP00000262887:P397L;ENSP00000443671:P366L	ENSP00000262887:P397L	P	-	2	0	XRCC1	48747572	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	8.194000	0.89721	2.774000	0.95407	0.655000	0.94253	CCC	XRCC1	-	superfamily_BRCT_dom,pfscan_BRCT_dom	ENSG00000073050		0.642	XRCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRCC1	HGNC	protein_coding	OTTHUMT00000463194.1	20	0.00	0	G	NM_006297		44055732	44055732	-1	no_errors	ENST00000262887	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	1.000	A
