#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADORA2A	135	genome.wustl.edu	37	22	24829519	24829519	+	Silent	SNP	G	G	A	rs55661464		TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr22:24829519G>A	ENST00000337539.7	+	2	606	c.147G>A	c.(145-147)gcG>gcA	p.A49A	SPECC1L-ADORA2A_ENST00000358654.2_3'UTR|ADORA2A-AS1_ENST00000326341.4_RNA|ADORA2A-AS1_ENST00000543438.1_RNA|ADORA2A_ENST00000496497.1_Intron	NM_000675.4|NM_001278497.1|NM_001278498.1|NM_001278499.1|NM_001278500.1	NP_000666.2|NP_001265426.1|NP_001265427.1|NP_001265428.1|NP_001265429.1	P29274	AA2AR_HUMAN	adenosine A2a receptor	49					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|apoptotic process (GO:0006915)|blood circulation (GO:0008015)|blood coagulation (GO:0007596)|cAMP biosynthetic process (GO:0006171)|cell-cell signaling (GO:0007267)|cellular defense response (GO:0006968)|central nervous system development (GO:0007417)|inflammatory response (GO:0006954)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phagocytosis (GO:0006909)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|sensory perception (GO:0007600)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|G-protein coupled adenosine receptor activity (GO:0001609)|identical protein binding (GO:0042802)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|liver(1)|lung(7)|skin(1)	21	Colorectal(2;0.196)				Adenosine(DB00640)|Caffeine(DB00201)|Defibrotide(DB04932)|Dyphylline(DB00651)|Enprofylline(DB00824)|Mefloquine(DB00358)|Oxtriphylline(DB01303)|Pentoxifylline(DB00806)|Regadenoson(DB06213)|Theobromine(DB01412)|Theophylline(DB00277)	TGTCACTGGCGGCGGCCGACA	0.617																																						dbGAP											0													165.0	108.0	127.0					22																	24829519		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X68486	CCDS13826.1	22q11.23	2012-08-08			ENSG00000128271	ENSG00000128271		"""GPCR / Class A : Adenosine receptors"""	263	protein-coding gene	gene with protein product		102776		ADORA2		1662665, 2541503	Standard	NM_001278497		Approved	RDC8	uc002zzy.4	P29274	OTTHUMG00000150761	ENST00000337539.7:c.147G>A	22.37:g.24829519G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7E0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adeno_A2A_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Adenosn_rcpt	p.A49	ENST00000337539.7	37	c.147	CCDS13826.1	22																																																																																			ADORA2A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000128271		0.617	ADORA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADORA2A	HGNC	protein_coding	OTTHUMT00000319971.2	36	0.00	0	G	NM_000675		24829519	24829519	+1	no_errors	ENST00000337539	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	0.708	A
AFF1	4299	genome.wustl.edu	37	4	88046286	88046286	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr4:88046286C>G	ENST00000307808.6	+	12	2963	c.2543C>G	c.(2542-2544)tCt>tGt	p.S848C	AFF1_ENST00000544085.1_Missense_Mutation_p.S486C|AFF1_ENST00000395146.4_Missense_Mutation_p.S855C	NM_005935.2	NP_005926.1	P51825	AFF1_HUMAN	AF4/FMR2 family, member 1	848					positive regulation of transcription, DNA-templated (GO:0045893)	transcription elongation factor complex (GO:0008023)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|large_intestine(2)	3		Acute lymphoblastic leukemia(40;0.0935)|all_hematologic(202;0.111)|Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000233)		AAAGAATCTTCTAAAACAAAG	0.378																																						dbGAP											0													79.0	76.0	77.0					4																	88046286		2202	4300	6502	-	-	-	SO:0001583	missense	0			L22179	CCDS3616.1, CCDS54775.1	4q21.3	2009-08-04	2005-06-27	2005-06-27	ENSG00000172493	ENSG00000172493			7135	protein-coding gene	gene with protein product		159557	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 2"", ""pre-B-cell monocytic leukemia partner 1"""	PBM1, MLLT2		7689231, 1423625, 8353274	Standard	NM_005935		Approved	AF-4, AF4	uc011ccz.2	P51825	OTTHUMG00000130603	ENST00000307808.6:c.2543C>G	4.37:g.88046286C>G	ENSP00000305689:p.Ser848Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTU1|E9PBM3	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.S855C	ENST00000307808.6	37	c.2564	CCDS3616.1	4	.	.	.	.	.	.	.	.	.	.	C	14.08	2.428280	0.43122	.	.	ENSG00000172493	ENST00000395146;ENST00000307808;ENST00000544085	T;T;T	0.68025	-0.3;-0.3;-0.3	5.17	3.26	0.37387	.	0.748342	0.12349	N	0.476758	T	0.63698	0.2533	M	0.69185	2.1	0.34740	D	0.730688	B;B;B	0.13594	0.008;0.008;0.008	B;B;B	0.17433	0.018;0.018;0.018	T	0.70114	-0.4961	10	0.56958	D	0.05	-11.1132	9.8394	0.40989	0.1178:0.6354:0.2468:0.0	.	855;848;848	E9PBM3;Q14C88;P51825	.;.;AFF1_HUMAN	C	855;848;486	ENSP00000378578:S855C;ENSP00000305689:S848C;ENSP00000440843:S486C	ENSP00000305689:S848C	S	+	2	0	AFF1	88265310	1.000000	0.71417	0.990000	0.47175	0.964000	0.63967	1.004000	0.29822	2.409000	0.81822	0.585000	0.79938	TCT	AFF1	-	pfam_TF_AF4/FMR2	ENSG00000172493		0.378	AFF1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AFF1	HGNC	protein_coding	OTTHUMT00000253053.3	69	0.00	0	C	NM_005935		88046286	88046286	+1	no_errors	ENST00000395146	ensembl	human	known	69_37n	missense	56	16.42	11	SNP	0.990	G
AGBL3	340351	genome.wustl.edu	37	7	134819891	134819891	+	Missense_Mutation	SNP	G	G	C	rs555385584		TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr7:134819891G>C	ENST00000436302.2	+	17	2894	c.2641G>C	c.(2641-2643)Gaa>Caa	p.E881Q	AGBL3_ENST00000458078.1_Missense_Mutation_p.E936Q|C7orf49_ENST00000459937.1_Intron|AGBL3_ENST00000435976.2_Intron	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	962						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						TCTTCAAGCTGAAGAAACTAA	0.393																																						dbGAP											0													59.0	51.0	53.0					7																	134819891		692	1590	2282	-	-	-	SO:0001583	missense	0			BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.2641G>C	7.37:g.134819891G>C	ENSP00000388275:p.Glu881Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z827|Q9H965	Missense_Mutation	SNP	pfam_Peptidase_M14	p.E936Q	ENST00000436302.2	37	c.2806	CCDS47718.1	7	.	.	.	.	.	.	.	.	.	.	G	15.04	2.715149	0.48622	.	.	ENSG00000146856	ENST00000436302;ENST00000458078	T;T	0.12774	2.77;2.65	4.15	-0.14	0.13456	.	.	.	.	.	T	0.07999	0.0200	L	0.27053	0.805	0.09310	N	1	B	0.29037	0.231	B	0.25405	0.06	T	0.32745	-0.9895	9	0.54805	T	0.06	1.0814	3.3835	0.07262	0.4315:0.2083:0.3602:0.0	.	881	Q8NEM8-4	.	Q	881;936	ENSP00000388275:E881Q;ENSP00000395969:E936Q	ENSP00000388275:E881Q	E	+	1	0	AGBL3	134470431	0.114000	0.22134	0.000000	0.03702	0.863000	0.49368	1.206000	0.32321	-0.028000	0.13850	0.591000	0.81541	GAA	AGBL3	-	NULL	ENSG00000146856		0.393	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL3	HGNC	protein_coding	OTTHUMT00000376655.1	24	0.00	0	G	NM_178563		134819891	134819891	+1	no_errors	ENST00000458078	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.001	C
AHNAK	79026	genome.wustl.edu	37	11	62294670	62294670	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr11:62294670C>G	ENST00000378024.4	-	5	7493	c.7219G>C	c.(7219-7221)Gat>Cat	p.D2407H	AHNAK_ENST00000530124.1_Intron|AHNAK_ENST00000257247.7_Intron	NM_001620.1	NP_001611.1	Q09666	AHNK_HUMAN	AHNAK nucleoprotein	2407					protein oligomerization (GO:0051259)|regulation of RNA splicing (GO:0043484)|regulation of voltage-gated calcium channel activity (GO:1901385)	actin cytoskeleton (GO:0015629)|cell-cell contact zone (GO:0044291)|costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|vesicle (GO:0031982)	poly(A) RNA binding (GO:0044822)|S100 protein binding (GO:0044548)|structural molecule activity conferring elasticity (GO:0097493)			NS(3)|autonomic_ganglia(1)|breast(10)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(33)|large_intestine(40)|liver(1)|lung(108)|ovary(13)|pancreas(4)|prostate(5)|skin(16)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	268		Melanoma(852;0.155)				TTGGGAACATCTACATCCACC	0.483																																						dbGAP											0													73.0	74.0	74.0					11																	62294670		2202	4299	6501	-	-	-	SO:0001583	missense	0			M80899	CCDS31584.1, CCDS44625.1	11q12-q13	2008-02-05	2007-03-30		ENSG00000124942	ENSG00000124942			347	protein-coding gene	gene with protein product	"""desmoyokin"""	103390	"""AHNAK nucleoprotein (desmoyokin)"""			7987395, 12153988	Standard	NM_024060		Approved	MGC5395	uc001ntl.3	Q09666	OTTHUMG00000167558	ENST00000378024.4:c.7219G>C	11.37:g.62294670C>G	ENSP00000367263:p.Asp2407His	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A586	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D2407H	ENST00000378024.4	37	c.7219	CCDS31584.1	11	.	.	.	.	.	.	.	.	.	.	c	11.54	1.667935	0.29604	.	.	ENSG00000124942	ENST00000244934;ENST00000378024	T	0.05513	3.43	4.38	2.35	0.29111	.	.	.	.	.	T	0.14056	0.0340	L	0.52573	1.65	0.09310	N	1	D	0.65815	0.995	D	0.63877	0.919	T	0.10382	-1.0632	9	0.62326	D	0.03	.	5.4248	0.16419	0.3758:0.5209:0.0:0.1033	.	2407	Q09666	AHNK_HUMAN	H	496;2407	ENSP00000367263:D2407H	ENSP00000244934:D496H	D	-	1	0	AHNAK	62051246	0.000000	0.05858	0.961000	0.40146	0.546000	0.35178	-3.896000	0.00340	2.023000	0.59567	0.473000	0.43528	GAT	AHNAK	-	NULL	ENSG00000124942		0.483	AHNAK-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK	HGNC	protein_coding	OTTHUMT00000395572.1	28	0.00	0	C	NM_024060		62294670	62294670	-1	no_errors	ENST00000378024	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	0.014	G
BCR	613	genome.wustl.edu	37	22	23627293	23627293	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr22:23627293G>C	ENST00000305877.8	+	10	3062	c.2311G>C	c.(2311-2313)Gag>Cag	p.E771Q	BCR_ENST00000359540.3_Missense_Mutation_p.E771Q	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region	771	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	GGATGAACTGGAGGCAGTGCC	0.527			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																	dbGAP		Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0													117.0	91.0	99.0					22																	23627293		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.2311G>C	22.37:g.23627293G>C	ENSP00000303507:p.Glu771Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	P78501|Q12842|Q4LE80|Q6NZI3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Bcr-Abl_oncoprot_oligo,pfam_DH-domain,pfam_C2_Ca-dep,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_Bcr-Abl_oncoprot_oligo,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.E771Q	ENST00000305877.8	37	c.2311	CCDS13806.1	22	.	.	.	.	.	.	.	.	.	.	G	21.1	4.099975	0.76983	.	.	ENSG00000186716	ENST00000305877;ENST00000359540;ENST00000334149;ENST00000427791	T;T;T	0.32515	1.45;1.45;2.27	5.06	5.06	0.68205	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.052766	0.64402	D	0.000001	T	0.58524	0.2128	M	0.79926	2.475	0.80722	D	1	P;P;P;D;P	0.76494	0.89;0.89;0.89;0.999;0.885	P;P;P;D;P	0.71656	0.714;0.758;0.714;0.974;0.688	T	0.62656	-0.6808	10	0.56958	D	0.05	.	17.7948	0.88566	0.0:0.0:1.0:0.0	.	360;436;389;771;771	B4E065;Q12843;Q12844;P11274-2;P11274	.;.;.;.;BCR_HUMAN	Q	771;771;436;255	ENSP00000303507:E771Q;ENSP00000352535:E771Q;ENSP00000396531:E255Q	ENSP00000303507:E771Q	E	+	1	0	BCR	21957293	1.000000	0.71417	0.948000	0.38648	0.270000	0.26580	9.550000	0.98110	2.535000	0.85469	0.655000	0.94253	GAG	BCR	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000186716		0.527	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	71	0.00	0	G	NM_004327		23627293	23627293	+1	no_errors	ENST00000305877	ensembl	human	known	69_37n	missense	32	39.62	21	SNP	1.000	C
SPATA33	124045	genome.wustl.edu	37	16	89724783	89724783	+	Frame_Shift_Del	DEL	G	G	-			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:89724783delG	ENST00000301031.4	+	2	162	c.162delG	c.(160-162)ccgfs	p.P54fs	CHMP1A_ENST00000550102.1_5'Flank|CHMP1A_ENST00000397901.3_5'Flank|CHMP1A_ENST00000547614.1_5'Flank|SPATA33_ENST00000579310.1_Frame_Shift_Del_p.P55fs|CHMP1A_ENST00000535997.2_5'Flank|SPATA33_ENST00000568929.1_Frame_Shift_Del_p.P24fs|CHMP1A_ENST00000253475.5_5'Flank	NM_001271908.1|NM_153025.1	NP_001258837.1|NP_694570.1	Q96N06	SPT33_HUMAN	spermatogenesis associated 33	54						cytoplasm (GO:0005737)|nucleus (GO:0005634)											GCCTCCACCCGGGGGCCGGGA	0.627																																						dbGAP											0													16.0	21.0	19.0					16																	89724783		2193	4299	6492	-	-	-	SO:0001589	frameshift_variant	0			AK056168	CCDS10983.1, CCDS62012.1, CCDS73929.1	16q24.3	2013-07-16	2013-07-05	2013-07-05	ENSG00000167523	ENSG00000167523			26463	protein-coding gene	gene with protein product		615409	"""chromosome 16 open reading frame 55"""	C16orf55		23844118	Standard	NM_153025		Approved	FLJ31606	uc010vpk.2	Q96N06	OTTHUMG00000138048	ENST00000301031.4:c.162delG	16.37:g.89724783delG	ENSP00000301031:p.Pro54fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8WFL2|B4DZN8	Frame_Shift_Del	DEL	NULL	p.A57fs	ENST00000301031.4	37	c.165	CCDS10983.1	16																																																																																			C16orf55	-	NULL	ENSG00000167523		0.627	SPATA33-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	C16orf55	HGNC	protein_coding	OTTHUMT00000269924.2	20	0.00	0	G	NM_153025		89724783	89724783	+1	no_errors	ENST00000579310	ensembl	human	known	69_37n	frame_shift_del	11	15.38	2	DEL	0.001	-
CACNA1F	778	genome.wustl.edu	37	X	49062124	49062124	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chrX:49062124C>T	ENST00000376265.2	-	47	5716	c.5655G>A	c.(5653-5655)tcG>tcA	p.S1885S	CACNA1F_ENST00000323022.5_Silent_p.S1874S|CACNA1F_ENST00000376251.1_Silent_p.S1820S|AF196779.1_ENST00000583131.1_RNA	NM_005183.2	NP_005174.2	O60840	CAC1F_HUMAN	calcium channel, voltage-dependent, L type, alpha 1F subunit	1885					axonogenesis (GO:0007409)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|dendrite morphogenesis (GO:0048813)|detection of light stimulus involved in visual perception (GO:0050908)|membrane depolarization during action potential (GO:0086010)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|photoreceptor outer segment (GO:0001750)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			autonomic_ganglia(1)|breast(8)|central_nervous_system(3)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(24)|ovary(5)|prostate(3)|skin(4)|urinary_tract(1)	85					Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Nimodipine(DB00393)|Spironolactone(DB00421)|Verapamil(DB00661)	GGCTGGGGTCCGAGTGGGTTC	0.637																																						dbGAP											0													45.0	32.0	36.0					X																	49062124		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AA019975	CCDS35253.1, CCDS59166.1, CCDS59167.1	Xp11.23	2013-01-23	2007-02-16		ENSG00000102001	ENSG00000102001		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1393	protein-coding gene	gene with protein product		300110	"""Aland island eye disease (Forsius-Eriksson ocular albinism, ocular albinism type 2)"""	CSNB2, AIED		9344658, 9662400, 16382099, 12111638, 17525176	Standard	NM_005183		Approved	Cav1.4, JM8, JMC8, CSNBX2, CORDX3, CSNB2A, OA2	uc010nip.3	O60840	OTTHUMG00000022703	ENST00000376265.2:c.5655G>A	X.37:g.49062124C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI29|F5CIQ9|O43901|O95226|Q9UHB1	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.S1885	ENST00000376265.2	37	c.5655	CCDS35253.1	X																																																																																			CACNA1F	-	NULL	ENSG00000102001		0.637	CACNA1F-007	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1F	HGNC	protein_coding	OTTHUMT00000358157.1	31	0.00	0	C	NM_005183		49062124	49062124	-1	no_errors	ENST00000376265	ensembl	human	known	69_37n	silent	25	32.43	12	SNP	0.000	T
CDH1	999	genome.wustl.edu	37	16	68835596	68835596	+	Nonsense_Mutation	SNP	C	C	T	rs587783047		TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:68835596C>T	ENST00000261769.5	+	3	378	c.187C>T	c.(187-189)Cga>Tga	p.R63*	CDH1_ENST00000422392.2_Nonsense_Mutation_p.R63*|CDH1_ENST00000562836.1_3'UTR	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	63					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.R63G(1)|p.R63*(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		TTGCACCGGTCGACAAAGGAC	0.448			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(2)|Substitution - Missense(1)|Substitution - Nonsense(1)	breast(3)|central_nervous_system(1)	GRCh37	CM980317	CDH1	M							164.0	153.0	156.0					16																	68835596		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.187C>T	16.37:g.68835596C>T	ENSP00000261769:p.Arg63*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R63*	ENST00000261769.5	37	c.187	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	C	28.3	4.910855	0.92178	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	.	.	.	5.43	4.37	0.52481	.	0.335920	0.20846	N	0.084609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	14.645	0.68754	0.1811:0.8189:0.0:0.0	.	.	.	.	X	63	.	ENSP00000261769:R63X	R	+	1	2	CDH1	67393097	0.000000	0.05858	0.219000	0.23793	0.537000	0.34900	1.123000	0.31308	2.707000	0.92482	0.561000	0.74099	CGA	CDH1	-	pfam_Cadherin_pro_dom,superfamily_Cadherin-like	ENSG00000039068		0.448	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	98	0.00	0	C	NM_004360		68835596	68835596	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	nonsense	44	25.42	15	SNP	0.175	T
CHRFAM7A	89832	genome.wustl.edu	37	15	30659709	30659709	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr15:30659709A>G	ENST00000299847.2	-	9	1085	c.632T>C	c.(631-633)aTg>aCg	p.M211T	CHRFAM7A_ENST00000397827.3_Missense_Mutation_p.M120T|CHRFAM7A_ENST00000401522.3_Missense_Mutation_p.M120T	NM_139320.1	NP_647536.1	Q494W8	CRFM7_HUMAN	CHRNA7 (cholinergic receptor, nicotinic, alpha 7, exons 5-10) and FAM7A (family with sequence similarity 7A, exons A-E) fusion	211						integral component of membrane (GO:0016021)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(1)|skin(2)	6		all_lung(180;3.42e-11)|Breast(32;0.000153)		all cancers(64;1.9e-15)|Epithelial(43;3.59e-12)|GBM - Glioblastoma multiforme(186;9e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00177)|Lung(196;0.153)		CACGATGATCATGGTGCTGGC	0.622																																						dbGAP											0													121.0	100.0	107.0					15																	30659709		2190	4288	6478	-	-	-	SO:0001583	missense	0			AF029838	CCDS32184.1, CCDS42008.1	15q13.2	2013-04-24	2006-02-01		ENSG00000166664	ENSG00000166664			15781	protein-coding gene	gene with protein product		609756				11829490	Standard	NM_139320		Approved	D-10, CHRNA7-DR1	uc001zdt.1	Q494W8	OTTHUMG00000175645	ENST00000299847.2:c.632T>C	15.37:g.30659709A>G	ENSP00000299847:p.Met211Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAB9	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel	p.M211T	ENST00000299847.2	37	c.632	CCDS32184.1	15	.	.	.	.	.	.	.	.	.	.	.	17.92	3.507600	0.64410	.	.	ENSG00000166664	ENST00000299847;ENST00000397827;ENST00000401522	D;D;D	0.88354	-2.37;-2.37;-2.37	3.23	3.23	0.37069	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.94608	0.8262	M	0.91090	3.175	0.80722	D	1	D	0.89917	1.0	D	0.77557	0.99	D	0.94538	0.7742	10	0.87932	D	0	.	9.8375	0.40977	1.0:0.0:0.0:0.0	.	211	Q494W8	CRFM7_HUMAN	T	211;120;120	ENSP00000299847:M211T;ENSP00000380927:M120T;ENSP00000385389:M120T	ENSP00000299847:M211T	M	-	2	0	CHRFAM7A	28447001	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.621000	0.90949	1.258000	0.44101	0.327000	0.21459	ATG	CHRFAM7A	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000166664		0.622	CHRFAM7A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRFAM7A	HGNC	protein_coding	OTTHUMT00000430700.1	65	0.00	0	A	NM_148911		30659709	30659709	-1	no_errors	ENST00000299847	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	G
CLCN7	1186	genome.wustl.edu	37	16	1500621	1500621	+	Silent	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:1500621G>A	ENST00000382745.4	-	17	2099	c.1494C>T	c.(1492-1494)ttC>ttT	p.F498F	CLCN7_ENST00000448525.1_Silent_p.F474F|CLCN7_ENST00000262318.8_Silent_p.F474F|LA16c-390E6.4_ENST00000563610.1_RNA	NM_001287.5	NP_001278.1	P51798	CLCN7_HUMAN	chloride channel, voltage-sensitive 7	498					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|response to pH (GO:0009268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|chloride channel activity (GO:0005254)|voltage-gated chloride channel activity (GO:0005247)			breast(2)|central_nervous_system(3)|endometrium(3)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|skin(2)	24		Hepatocellular(780;0.0893)				AGGCCAGGAAGAAGTAGACCA	0.667																																						dbGAP											0													43.0	47.0	46.0					16																	1500621		2192	4295	6487	-	-	-	SO:0001819	synonymous_variant	0			Z67743	CCDS32361.1, CCDS45378.1	16p13	2012-09-26	2012-02-23		ENSG00000103249	ENSG00000103249		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ion channels / Chloride channels : Voltage-sensitive"""	2025	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 63"""	602727	"""chloride channel 7"""			8543009	Standard	NM_001114331		Approved	CLC-7, OPTA2, CLC7, ClC-7, PPP1R63	uc002clv.3	P51798	OTTHUMG00000044467	ENST00000382745.4:c.1494C>T	16.37:g.1500621G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NEJ7|A8K5T9|A8K7X1|B3KPN3|E9PDB9|Q9NYX5	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-7	p.F498	ENST00000382745.4	37	c.1494	CCDS32361.1	16																																																																																			CLCN7	-	pfam_Cl-channel_volt-gated,superfamily_Cl-channel_core	ENSG00000103249		0.667	CLCN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN7	HGNC	protein_coding	OTTHUMT00000103598.2	19	0.00	0	G	NM_001287		1500621	1500621	-1	no_errors	ENST00000382745	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	1.000	A
CNTN6	27255	genome.wustl.edu	37	3	1415621	1415621	+	Silent	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr3:1415621C>G	ENST00000446702.2	+	16	2586	c.1959C>G	c.(1957-1959)ctC>ctG	p.L653L	CNTN6_ENST00000539053.1_Silent_p.L581L|CNTN6_ENST00000350110.2_Silent_p.L653L			Q9UQ52	CNTN6_HUMAN	contactin 6	653	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|Notch signaling pathway (GO:0007219)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(25)|lung(34)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	90		all_cancers(2;0.000164)|all_epithelial(2;0.107)		Epithelial(13;0.000233)|all cancers(10;0.0013)|OV - Ovarian serous cystadenocarcinoma(96;0.0139)		CAGAAATTCTCAATGGTAAGA	0.353																																						dbGAP											0													97.0	94.0	95.0					3																	1415621		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB003592	CCDS2557.1	3p26-p25	2013-02-11			ENSG00000134115	ENSG00000134115		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	2176	protein-coding gene	gene with protein product	"""neural adhesion molecule"""	607220				9486763	Standard	NM_014461		Approved	NB-3	uc003bpa.3	Q9UQ52	OTTHUMG00000119030	ENST00000446702.2:c.1959C>G	3.37:g.1415621C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHM2	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L653	ENST00000446702.2	37	c.1959	CCDS2557.1	3																																																																																			CNTN6	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134115		0.353	CNTN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN6	HGNC	protein_coding	OTTHUMT00000239235.2	103	0.00	0	C	NM_014461		1415621	1415621	+1	no_errors	ENST00000350110	ensembl	human	known	69_37n	silent	69	22.47	20	SNP	0.179	G
CMTM7	112616	genome.wustl.edu	37	3	32493950	32493950	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr3:32493950G>A	ENST00000334983.5	+	4	735	c.499G>A	c.(499-501)Gta>Ata	p.V167I	CMTM7_ENST00000349718.4_Missense_Mutation_p.V134I	NM_138410.2	NP_612419.1	Q96FZ5	CKLF7_HUMAN	CKLF-like MARVEL transmembrane domain containing 7	167					chemotaxis (GO:0006935)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				endometrium(1)|large_intestine(1)|lung(2)	4						GATCTCGTGTGTAACCCAGTC	0.512																																						dbGAP											0													243.0	219.0	227.0					3																	32493950		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF479263	CCDS33730.1, CCDS33731.1	3p22.2	2005-11-08	2005-11-08	2005-11-08	ENSG00000153551	ENSG00000153551			19178	protein-coding gene	gene with protein product		607890	"""chemokine-like factor super family 7"", ""chemokine-like factor superfamily 7"""	CKLFSF7			Standard	NM_138410		Approved	FLJ30992	uc003cey.1	Q96FZ5	OTTHUMG00000155869	ENST00000334983.5:c.499G>A	3.37:g.32493950G>A	ENSP00000335605:p.Val167Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VLK1	Missense_Mutation	SNP	pfam_MARVEL-like_dom	p.V167I	ENST00000334983.5	37	c.499	CCDS33730.1	3	.	.	.	.	.	.	.	.	.	.	G	0.013	-1.615450	0.00828	.	.	ENSG00000153551	ENST00000334983;ENST00000349718	T	0.29397	1.57	5.58	3.52	0.40303	.	0.366588	0.24260	N	0.040097	T	0.12008	0.0292	N	0.03281	-0.365	0.09310	N	1	B;B	0.14012	0.009;0.002	B;B	0.11329	0.006;0.001	T	0.22103	-1.0226	10	0.21540	T	0.41	-30.4427	7.2867	0.26344	0.2659:0.0:0.7341:0.0	.	134;167	Q5VLK1;Q96FZ5	.;CKLF7_HUMAN	I	167;134	ENSP00000335605:V167I	ENSP00000335605:V167I	V	+	1	0	CMTM7	32468954	0.824000	0.29247	0.215000	0.23724	0.112000	0.19704	0.736000	0.26130	1.329000	0.45376	0.650000	0.86243	GTA	CMTM7	-	NULL	ENSG00000153551		0.512	CMTM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMTM7	HGNC	protein_coding	OTTHUMT00000342084.1	106	0.00	0	G			32493950	32493950	+1	no_errors	ENST00000334983	ensembl	human	known	69_37n	missense	78	29.09	32	SNP	0.241	A
COBL	23242	genome.wustl.edu	37	7	51096585	51096585	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr7:51096585C>T	ENST00000265136.7	-	10	2373	c.2208G>A	c.(2206-2208)ctG>ctA	p.L736L	COBL_ENST00000395542.2_Silent_p.L818L	NM_015198.3	NP_056013.2	O75128	COBL_HUMAN	cordon-bleu WH2 repeat protein	736					actin filament network formation (GO:0051639)|actin filament polymerization (GO:0030041)|collateral sprouting in absence of injury (GO:0048669)|digestive tract development (GO:0048565)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|liver development (GO:0001889)|neural tube closure (GO:0001843)|notochord development (GO:0030903)|positive regulation of dendrite development (GO:1900006)|somite specification (GO:0001757)	actin filament (GO:0005884)|axon (GO:0030424)|axonal growth cone (GO:0044295)|cell cortex (GO:0005938)|dendrite (GO:0030425)|dendritic growth cone (GO:0044294)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	actin monomer binding (GO:0003785)			NS(2)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(10)|lung(26)|ovary(3)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Glioma(55;0.08)					CCAAGTTCCCCAGCTCGTCAA	0.512																																					NSCLC(189;2119 2138 12223 30818 34679)	dbGAP											0													96.0	81.0	86.0					7																	51096585		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB014533	CCDS34637.1, CCDS75601.1, CCDS75602.1	7p12.2-p12.1	2012-12-07	2012-12-07		ENSG00000106078	ENSG00000106078			22199	protein-coding gene	gene with protein product		610317	"""cordon-bleu homolog (mouse)"""				Standard	NM_015198		Approved	KIAA0633	uc003tpr.4	O75128	OTTHUMG00000155999	ENST00000265136.7:c.2208G>A	7.37:g.51096585C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D257|A7E2B0|B7ZLW9|B9EGF8|Q2T9J3|Q504Y4|Q86XA7|Q8N304|Q8TCM1	Silent	SNP	pfam_Cordon-bleu_domain,pfam_WH2_dom,smart_WH2_dom,pfscan_WH2_dom	p.L818	ENST00000265136.7	37	c.2454	CCDS34637.1	7																																																																																			COBL	-	NULL	ENSG00000106078		0.512	COBL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	COBL	HGNC	protein_coding	OTTHUMT00000342682.1	23	0.00	0	C	NM_015198		51096585	51096585	-1	no_errors	ENST00000395542	ensembl	human	known	69_37n	silent	24	25.00	8	SNP	0.140	T
COL2A1	1280	genome.wustl.edu	37	12	48374414	48374414	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr12:48374414C>G	ENST00000380518.3	-	39	2712	c.2548G>C	c.(2548-2550)Gag>Cag	p.E850Q	COL2A1_ENST00000337299.6_Missense_Mutation_p.E781Q|COL2A1_ENST00000493991.1_5'UTR	NM_001844.4|NM_033150.2	NP_001835.3|NP_149162.2	P02458	CO2A1_HUMAN	collagen, type II, alpha 1	850	Triple-helical region.				axon guidance (GO:0007411)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to BMP stimulus (GO:0071773)|central nervous system development (GO:0007417)|chondrocyte differentiation (GO:0002062)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal joint morphogenesis (GO:0060272)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart morphogenesis (GO:0003007)|inner ear morphogenesis (GO:0042472)|limb bud formation (GO:0060174)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|notochord development (GO:0030903)|otic vesicle development (GO:0071599)|palate development (GO:0060021)|proteoglycan metabolic process (GO:0006029)|regulation of gene expression (GO:0010468)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|tissue homeostasis (GO:0001894)|visual perception (GO:0007601)	basement membrane (GO:0005604)|collagen type II trimer (GO:0005585)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(25)|ovary(1)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(3)	64		Acute lymphoblastic leukemia(13;0.108)|all_hematologic(14;0.214)			Collagenase(DB00048)	TCTCCTTGCTCACCCTTGGCC	0.622																																						dbGAP											0													31.0	30.0	30.0					12																	48374414		2202	4299	6501	-	-	-	SO:0001583	missense	0			X16468	CCDS8759.1, CCDS41778.1	12q12-q13.2	2013-11-14	2008-02-04		ENSG00000139219	ENSG00000139219		"""Collagens"""	2200	protein-coding gene	gene with protein product		120140	"""collagen, type II, alpha 1 (primary osteoarthritis, spondyloepiphyseal dysplasia, congenital)"", ""arthroophthalmopathy, progressive (Stickler syndrome)"""	SEDC, AOM		1677770	Standard	NM_033150		Approved	STL1	uc001rqu.3	P02458	OTTHUMG00000149896	ENST00000380518.3:c.2548G>C	12.37:g.48374414C>G	ENSP00000369889:p.Glu850Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGA0|Q12985|Q14009|Q14044|Q14045|Q14046|Q14047|Q14056|Q14058|Q16672|Q1JQ82|Q2V4X7|Q6LBY1|Q6LBY2|Q6LBY3|Q96IT5|Q99227|Q9UE38|Q9UE39|Q9UE40|Q9UE41|Q9UE42|Q9UE43	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.E850Q	ENST00000380518.3	37	c.2548	CCDS41778.1	12	.	.	.	.	.	.	.	.	.	.	C	21.8	4.199881	0.79015	.	.	ENSG00000139219	ENST00000380518;ENST00000395281;ENST00000337299	D;D	0.94280	-3.39;-3.39	5.46	5.46	0.80206	.	0.124359	0.52532	D	0.000069	D	0.95169	0.8434	L	0.61218	1.895	0.58432	D	0.999998	B;B	0.33073	0.227;0.396	B;P	0.48598	0.236;0.583	D	0.94017	0.7289	10	0.44086	T	0.13	.	18.9167	0.92508	0.0:1.0:0.0:0.0	.	781;850	P02458-1;P02458	.;CO2A1_HUMAN	Q	850;781;781	ENSP00000369889:E850Q;ENSP00000338213:E781Q	ENSP00000338213:E781Q	E	-	1	0	COL2A1	46660681	1.000000	0.71417	0.983000	0.44433	0.770000	0.43624	7.818000	0.86416	2.573000	0.86826	0.655000	0.94253	GAG	COL2A1	-	pfam_Collagen	ENSG00000139219		0.622	COL2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL2A1	HGNC	protein_coding	OTTHUMT00000313810.2	25	0.00	0	C	NM_001844		48374414	48374414	-1	no_errors	ENST00000380518	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	1.000	G
CWH43	80157	genome.wustl.edu	37	4	49032952	49032952	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr4:49032952C>T	ENST00000226432.4	+	11	1666	c.1483C>T	c.(1483-1485)Cca>Tca	p.P495S	CWH43_ENST00000513409.1_Missense_Mutation_p.P468S	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	495					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						AGACTTTGGTCCAAGCACAAG	0.453																																						dbGAP											0													162.0	160.0	161.0					4																	49032952		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1483C>T	4.37:g.49032952C>T	ENSP00000226432:p.Pro495Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPD7	Missense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.P495S	ENST00000226432.4	37	c.1483	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458117	0.84317	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.79749	-1.3;-1.3	5.44	5.44	0.79542	Endonuclease/exonuclease/phosphatase (1);	0.000000	0.53938	D	0.000048	D	0.90205	0.6938	M	0.83603	2.65	0.48452	D	0.999656	D	0.89917	1.0	D	0.79108	0.992	D	0.90245	0.4289	9	.	.	.	.	17.2205	0.86956	0.0:1.0:0.0:0.0	.	495	Q9H720	PG2IP_HUMAN	S	495;468	ENSP00000226432:P495S;ENSP00000422802:P468S	.	P	+	1	0	CWH43	48727709	1.000000	0.71417	0.946000	0.38457	0.970000	0.65996	4.708000	0.61859	2.833000	0.97629	0.555000	0.69702	CCA	CWH43	-	superfamily_Endo/exonuclease/phosphatase	ENSG00000109182		0.453	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	39	0.00	0	C	NM_025087		49032952	49032952	+1	no_errors	ENST00000226432	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.995	T
DLG1	1739	genome.wustl.edu	37	3	196786826	196786826	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr3:196786826C>G	ENST00000419354.1	-	24	2736	c.2450G>C	c.(2449-2451)aGa>aCa	p.R817T	DLG1_ENST00000392382.2_Missense_Mutation_p.R784T|DLG1_ENST00000448528.2_Missense_Mutation_p.R817T|DLG1_ENST00000357674.4_Missense_Mutation_p.R806T|DLG1_ENST00000443183.1_Missense_Mutation_p.R713T|DLG1_ENST00000346964.2_Missense_Mutation_p.R839T|DLG1_ENST00000452595.1_Missense_Mutation_p.R701T|DLG1_ENST00000314062.3_Missense_Mutation_p.R766T|DLG1_ENST00000450955.1_Missense_Mutation_p.R806T|DLG1_ENST00000422288.1_Missense_Mutation_p.R766T			Q12959	DLG1_HUMAN	discs, large homolog 1 (Drosophila)	817	Guanylate kinase-like. {ECO:0000255|PROSITE-ProRule:PRU00100}.				actin filament organization (GO:0007015)|activation of protein kinase activity (GO:0032147)|amyloid precursor protein metabolic process (GO:0042982)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|cortical actin cytoskeleton organization (GO:0030866)|dephosphorylation (GO:0016311)|embryonic skeletal system morphogenesis (GO:0048704)|endothelial cell proliferation (GO:0001935)|establishment or maintenance of cell polarity (GO:0007163)|hard palate development (GO:0060022)|immunological synapse formation (GO:0001771)|lens development in camera-type eye (GO:0002088)|membrane raft organization (GO:0031579)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell proliferation (GO:0042130)|nucleotide phosphorylation (GO:0046939)|peristalsis (GO:0030432)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of potassium ion transport (GO:0043268)|protein localization to plasma membrane (GO:0072659)|regulation of membrane potential (GO:0042391)|regulation of myelination (GO:0031641)|regulation of sodium ion transmembrane transport (GO:1902305)|reproductive structure development (GO:0048608)|single organismal cell-cell adhesion (GO:0016337)|smooth muscle tissue development (GO:0048745)|synaptic transmission (GO:0007268)|T cell activation (GO:0042110)|T cell cytokine production (GO:0002369)|tight junction assembly (GO:0070830)|viral process (GO:0016032)	basal lamina (GO:0005605)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell projection membrane (GO:0031253)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|immunological synapse (GO:0001772)|intercalated disc (GO:0014704)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|membrane raft (GO:0045121)|microtubule (GO:0005874)|MPP7-DLG1-LIN7 complex (GO:0097025)|myelin sheath abaxonal region (GO:0035748)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	cytoskeletal protein binding (GO:0008092)|guanylate kinase activity (GO:0004385)|ion channel binding (GO:0044325)|L27 domain binding (GO:0097016)|mitogen-activated protein kinase kinase binding (GO:0031434)|phosphatase binding (GO:0019902)|phosphoprotein phosphatase activity (GO:0004721)|potassium channel regulator activity (GO:0015459)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|liver(1)|lung(9)|ovary(3)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(143;6.22e-10)|Ovarian(172;0.0418)|Breast(254;0.0589)	Lung NSC(153;0.133)	Epithelial(36;3.23e-24)|all cancers(36;2.15e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.0148)		AATCTGTAATCTCTTTATGGC	0.348																																						dbGAP											0													111.0	114.0	113.0					3																	196786826		2203	4300	6503	-	-	-	SO:0001583	missense	0			U13897	CCDS3327.1, CCDS43194.1, CCDS56300.1, CCDS56301.1, CCDS75072.1	3q29	2008-12-15	2001-11-28		ENSG00000075711	ENSG00000075711			2900	protein-coding gene	gene with protein product	"""discs large homolog 1"", ""presynaptic protein SAP97"", ""synapse-associated protein 97"""	601014	"""discs, large (Drosophila) homolog 1"""			7937897, 8825652	Standard	NM_004087		Approved	SAP97, SAP-97, hdlg, DLGH1, dJ1061C18.1.1	uc003fxn.4	Q12959	OTTHUMG00000047972	ENST00000419354.1:c.2450G>C	3.37:g.196786826C>G	ENSP00000407531:p.Arg817Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YKK7|B4DGU1|B4DGZ8|B7ZMM0|B9EIQ5|D3DXB8|D3DXB9|E7EWL7|E9PG21|Q12958	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_MAGUK_PEST_N,pfam_L27_1,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_L27,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_L27,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.R839T	ENST00000419354.1	37	c.2516	CCDS43194.1	3	.	.	.	.	.	.	.	.	.	.	C	25.8	4.672279	0.88348	.	.	ENSG00000075711	ENST00000346964;ENST00000359922;ENST00000357674;ENST00000381807;ENST00000314062;ENST00000419354;ENST00000452595;ENST00000422288;ENST00000448528;ENST00000443183;ENST00000392382;ENST00000450955	T;T;T;T;T;T;T;T;T;T	0.43294	0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95;0.95	4.94	4.94	0.65067	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.000000	0.85682	D	0.000000	T	0.61974	0.2390	L	0.60904	1.88	0.80722	D	1	D;D;D;D;D	0.89917	0.995;0.999;1.0;0.999;1.0	D;D;D;D;D	0.97110	0.936;0.978;1.0;0.974;1.0	T	0.63189	-0.6693	10	0.54805	T	0.06	.	17.5413	0.87849	0.0:1.0:0.0:0.0	.	806;701;713;817;839	Q12959-4;E9PG21;E7EWL7;Q12959;Q12959-2	.;.;.;DLG1_HUMAN;.	T	839;830;806;804;766;817;701;766;817;713;784;806	ENSP00000345731:R839T;ENSP00000350303:R806T;ENSP00000321087:R766T;ENSP00000407531:R817T;ENSP00000398939:R701T;ENSP00000413238:R766T;ENSP00000391732:R817T;ENSP00000396658:R713T;ENSP00000376187:R784T;ENSP00000411278:R806T	ENSP00000321087:R766T	R	-	2	0	DLG1	198271223	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.483000	0.83821	0.591000	0.81541	AGA	DLG1	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_Guanylate_kin	ENSG00000075711		0.348	DLG1-008	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DLG1	HGNC	protein_coding	OTTHUMT00000258170.2	55	0.00	0	C	NM_004087		196786826	196786826	-1	no_errors	ENST00000346964	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	G
DNAH11	8701	genome.wustl.edu	37	7	21750285	21750285	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr7:21750285G>T	ENST00000409508.3	+	41	6829	c.6798G>T	c.(6796-6798)tgG>tgT	p.W2266C	DNAH11_ENST00000328843.6_Missense_Mutation_p.W2273C	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	2273	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						ACCCCATGTGGATTGAATCAC	0.368									Kartagener syndrome																													dbGAP											0													92.0	95.0	94.0					7																	21750285		2088	4249	6337	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.6798G>T	7.37:g.21750285G>T	ENSP00000475939:p.Trp2266Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.W2273C	ENST00000409508.3	37	c.6819		7	.	.	.	.	.	.	.	.	.	.	G	23.3	4.405375	0.83230	.	.	ENSG00000105877	ENST00000328843	D	0.98747	-5.11	5.98	5.98	0.97165	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.85682	D	0.000000	D	0.99223	0.9730	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99694	1.1002	9	0.87932	D	0	.	20.452	0.99131	0.0:0.0:1.0:0.0	.	2273	Q96DT5	DYH11_HUMAN	C	2273	ENSP00000330671:W2273C	ENSP00000330671:W2273C	W	+	3	0	DNAH11	21716810	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	6.715000	0.74697	2.838000	0.97847	0.591000	0.81541	TGG	DNAH11	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000105877		0.368	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	68	0.00	0	G	NM_003777		21750285	21750285	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	1.000	T
DRD5	1816	genome.wustl.edu	37	4	9784798	9784798	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr4:9784798C>T	ENST00000304374.2	+	1	1541	c.1145C>T	c.(1144-1146)aCg>aTg	p.T382M		NM_000798.4	NP_000789.1	P21918	DRD5_HUMAN	dopamine receptor D5	382					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|associative learning (GO:0008306)|cellular calcium ion homeostasis (GO:0006874)|cellular response to catecholamine stimulus (GO:0071870)|long term synaptic depression (GO:0060292)|negative regulation of blood pressure (GO:0045776)|negative regulation of NAD(P)H oxidase activity (GO:0033861)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|phospholipase C-activating dopamine receptor signaling pathway (GO:0060158)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|reactive oxygen species metabolic process (GO:0072593)|regulation of female receptivity (GO:0045924)|regulation of systemic arterial blood pressure by vasopressin (GO:0001992)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|sensitization (GO:0046960)|synaptic transmission (GO:0007268)|synaptic transmission, dopaminergic (GO:0001963)|transmission of nerve impulse (GO:0019226)|wound healing (GO:0042060)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity (GO:0004952)|dopamine neurotransmitter receptor activity, coupled via Gs (GO:0001588)			NS(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(22)|prostate(7)|skin(3)|stomach(2)|urinary_tract(1)	57					Apomorphine(DB00714)|Aripiprazole(DB01238)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Cinnarizine(DB00568)|Dopamine(DB00988)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Pergolide(DB01186)|Pramipexole(DB00413)|Quetiapine(DB01224)|Ropinirole(DB00268)|Rotigotine(DB05271)|Trimipramine(DB00726)|Ziprasidone(DB00246)	TGCTCCCGCACGCCGGTGGAG	0.557																																						dbGAP											0													65.0	56.0	59.0					4																	9784798		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58454	CCDS3405.1	4p16.1	2012-08-08			ENSG00000169676	ENSG00000169676		"""GPCR / Class A : Dopamine receptors"""	3026	protein-coding gene	gene with protein product		126453		DRD1L2		1774076	Standard	NM_000798		Approved	DRD1B	uc003gmb.4	P21918	OTTHUMG00000128489	ENST00000304374.2:c.1145C>T	4.37:g.9784798C>T	ENSP00000306129:p.Thr382Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9S3|Q8NEQ8	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Dopa_1B_rcpt,prints_Dopamine_rcpt	p.T382M	ENST00000304374.2	37	c.1145	CCDS3405.1	4	.	.	.	.	.	.	.	.	.	.	c	14.42	2.530390	0.45073	.	.	ENSG00000169676	ENST00000304374	T	0.38240	1.15	4.73	3.88	0.44766	.	0.425905	0.26571	N	0.023634	T	0.49575	0.1565	M	0.69823	2.125	0.48901	D	0.999724	D	0.76494	0.999	P	0.53689	0.732	T	0.52734	-0.8536	10	0.42905	T	0.14	.	14.1461	0.65351	0.0:0.8492:0.1508:0.0	.	382	P21918	DRD5_HUMAN	M	382	ENSP00000306129:T382M	ENSP00000306129:T382M	T	+	2	0	DRD5	9393896	0.997000	0.39634	0.188000	0.23233	0.218000	0.24690	3.515000	0.53429	1.201000	0.43203	0.460000	0.39030	ACG	DRD5	-	prints_Dopa_1B_rcpt	ENSG00000169676		0.557	DRD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD5	HGNC	protein_coding	OTTHUMT00000250293.1	69	0.00	0	C			9784798	9784798	+1	no_errors	ENST00000304374	ensembl	human	known	69_37n	missense	41	14.58	7	SNP	0.998	T
EDDM3A	10876	genome.wustl.edu	37	14	21215831	21215831	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr14:21215831G>A	ENST00000326842.2	+	2	219	c.92G>A	c.(91-93)aGa>aAa	p.R31K		NM_006683.4	NP_006674.2	Q14507	EP3A_HUMAN	epididymal protein 3A	31					sperm displacement (GO:0007321)	extracellular space (GO:0005615)				breast(2)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	6						ATTTACTGGAGAGAATTCATA	0.413																																						dbGAP											0													94.0	92.0	93.0					14																	21215831		2203	4300	6503	-	-	-	SO:0001583	missense	0			X76383	CCDS9556.1	14q11.1	2010-03-19	2010-01-27	2010-01-27	ENSG00000181562	ENSG00000181562			16978	protein-coding gene	gene with protein product		611580	"""family with sequence similarity 12, member A"""	FAM12A		7514008	Standard	NM_006683		Approved	HE3-ALPHA	uc001vyc.3	Q14507	OTTHUMG00000029581	ENST00000326842.2:c.92G>A	14.37:g.21215831G>A	ENSP00000315098:p.Arg31Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KN33	Missense_Mutation	SNP	superfamily_RNaseA_domain	p.R31K	ENST00000326842.2	37	c.92	CCDS9556.1	14	.	.	.	.	.	.	.	.	.	.	G	13.05	2.122818	0.37436	.	.	ENSG00000181562	ENST00000326842	T	0.72615	-0.67	2.46	-1.81	0.07882	Ribonuclease A, domain (2);	0.361764	0.19247	N	0.119033	T	0.58991	0.2161	L	0.58101	1.795	0.09310	N	1	B	0.16396	0.017	B	0.17433	0.018	T	0.49113	-0.8973	10	0.41790	T	0.15	.	6.0433	0.19746	0.6134:0.0:0.3866:0.0	.	31	Q14507	EP3A_HUMAN	K	31	ENSP00000315098:R31K	ENSP00000315098:R31K	R	+	2	0	EDDM3A	20285671	0.000000	0.05858	0.007000	0.13788	0.273000	0.26683	0.008000	0.13197	-0.383000	0.07858	0.313000	0.20887	AGA	EDDM3A	-	superfamily_RNaseA_domain	ENSG00000181562		0.413	EDDM3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDDM3A	HGNC	protein_coding	OTTHUMT00000073742.3	47	0.00	0	G			21215831	21215831	+1	no_errors	ENST00000326842	ensembl	human	known	69_37n	missense	37	15.91	7	SNP	0.018	A
ELMOD3	84173	genome.wustl.edu	37	2	85604484	85604484	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr2:85604484G>C	ENST00000409890.2	+	11	1292	c.625G>C	c.(625-627)Gac>Cac	p.D209H	ELMOD3_ENST00000393852.4_Missense_Mutation_p.D209H|ELMOD3_ENST00000315658.7_Missense_Mutation_p.D209H|ELMOD3_ENST00000428955.2_Missense_Mutation_p.D209H|ELMOD3_ENST00000409344.3_Missense_Mutation_p.D209H|ELMOD3_ENST00000409013.3_Missense_Mutation_p.D209H|ELMOD3_ENST00000490508.1_3'UTR			Q96FG2	ELMD3_HUMAN	ELMO/CED-12 domain containing 3	209	ELMO. {ECO:0000255|PROSITE- ProRule:PRU00664}.				phagocytosis (GO:0006909)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)	12						TCCAGCCACAGACCTGAGAGG	0.587																																						dbGAP											0													92.0	74.0	80.0					2																	85604484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258573	CCDS1973.1, CCDS46352.1	2p11.2	2014-01-28	2008-08-14	2008-08-14	ENSG00000115459	ENSG00000115459		"""RNA binding motif (RRM) containing"""	26158	protein-coding gene	gene with protein product		615427	"""RNA binding motif protein 29"", ""RNA binding motif and ELMO/CED-12 domain 1"", ""deafness, autosomal recessive 88"""	RBM29, RBED1, DFNB88		24039609	Standard	NM_032213		Approved	FLJ21977	uc010ysn.2	Q96FG2	OTTHUMG00000130170	ENST00000409890.2:c.625G>C	2.37:g.85604484G>C	ENSP00000386304:p.Asp209His	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZD6|D6W5K4|Q2M1K3|Q2XSU3|Q2XSU4|Q8NAC1|Q8TCK4|Q8WV70|Q8WY75|Q9H6Q8	Missense_Mutation	SNP	pfam_Engulfment_cell_motility_ELMO	p.D209H	ENST00000409890.2	37	c.625	CCDS46352.1	2	.	.	.	.	.	.	.	.	.	.	G	23.9	4.469256	0.84533	.	.	ENSG00000115459	ENST00000409013;ENST00000409890;ENST00000409344;ENST00000393852;ENST00000428955;ENST00000315658	T;T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3;0.3	5.76	5.76	0.90799	Engulfment/cell motility, ELMO (2);	0.000000	0.85682	D	0.000000	T	0.81669	0.4871	M	0.91406	3.205	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.85261	0.1050	10	0.87932	D	0	-33.8522	17.4632	0.87625	0.0:0.0:1.0:0.0	.	209;209	Q96FG2-6;Q96FG2	.;ELMD3_HUMAN	H	209	ENSP00000387139:D209H;ENSP00000386304:D209H;ENSP00000386248:D209H;ENSP00000377434:D209H;ENSP00000412692:D209H;ENSP00000318264:D209H	ENSP00000318264:D209H	D	+	1	0	ELMOD3	85457995	1.000000	0.71417	1.000000	0.80357	0.769000	0.43574	8.721000	0.91446	2.733000	0.93635	0.655000	0.94253	GAC	ELMOD3	-	pfam_Engulfment_cell_motility_ELMO	ENSG00000115459		0.587	ELMOD3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ELMOD3	HGNC	protein_coding	OTTHUMT00000329124.1	70	0.00	0	G	NM_032213		85604484	85604484	+1	no_errors	ENST00000315658	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	C
ERN2	10595	genome.wustl.edu	37	16	23722312	23722312	+	Silent	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:23722312G>A	ENST00000457008.2	-	2	159	c.121C>T	c.(121-123)Ctg>Ttg	p.L41L	CTD-2385L22.1_ENST00000563611.1_RNA|ERN2_ENST00000256797.4_Silent_p.L89L					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		GACACCAGCAGGAGGTTCTCT	0.582																																						dbGAP											0													111.0	102.0	105.0					16																	23722312		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.121C>T	16.37:g.23722312G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_KEN_RNase_activator,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PUG-dom,pfscan_Prot_kinase_cat_dom	p.L89	ENST00000457008.2	37	c.265		16																																																																																			ERN2	-	superfamily_Quinonprotein_ADH-like,smart_PQQ_beta_propeller_repeat	ENSG00000134398		0.582	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	48	0.00	0	G			23722312	23722312	-1	no_errors	ENST00000256797	ensembl	human	known	69_37n	silent	19	32.14	9	SNP	1.000	A
FAM111A	63901	genome.wustl.edu	37	11	58920087	58920087	+	Frame_Shift_Del	DEL	A	A	-			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr11:58920087delA	ENST00000528737.1	+	5	3764	c.946delA	c.(946-948)aaafs	p.K317fs	FAM111A_ENST00000420244.1_Frame_Shift_Del_p.K317fs|FAM111A_ENST00000533703.1_Frame_Shift_Del_p.K317fs|FAM111A_ENST00000531147.1_Frame_Shift_Del_p.K317fs|FAM111A_ENST00000361723.3_Frame_Shift_Del_p.K317fs			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	317					defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				AAACTTCAAGAAAAAAATGAA	0.323																																						dbGAP											0													32.0	38.0	36.0					11																	58920087		2197	4293	6490	-	-	-	SO:0001589	frameshift_variant	0			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.946delA	11.37:g.58920087delA	ENSP00000434435:p.Lys317fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Frame_Shift_Del	DEL	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.M318fs	ENST00000528737.1	37	c.946	CCDS7973.1	11																																																																																			FAM111A	-	NULL	ENSG00000166801		0.323	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	19	0.00	0	A	NM_022074		58920087	58920087	+1	no_errors	ENST00000361723	ensembl	human	known	69_37n	frame_shift_del	18	10.00	2	DEL	0.000	-
FREM3	166752	genome.wustl.edu	37	4	144621006	144621006	+	Missense_Mutation	SNP	C	C	G	rs143380055	byFrequency	TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr4:144621006C>G	ENST00000329798.5	-	1	822	c.823G>C	c.(823-825)Gag>Cag	p.E275Q	RP13-578N3.3_ENST00000499587.2_RNA	NM_001168235.1	NP_001161707.1	P0C091	FREM3_HUMAN	FRAS1 related extracellular matrix 3	275					cell adhesion (GO:0007155)|cell communication (GO:0007154)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|prostate(1)	8						TCTTGGCCCTCAGGCCCCAGC	0.677																																						dbGAP											0													26.0	28.0	27.0					4																	144621006		692	1591	2283	-	-	-	SO:0001583	missense	0			BX091796	CCDS54808.1	4q31.21	2011-06-09			ENSG00000183090	ENSG00000183090			25172	protein-coding gene	gene with protein product		608946				15345741	Standard	NM_001168235		Approved		uc021xsj.1	P0C091	OTTHUMG00000161577	ENST00000329798.5:c.823G>C	4.37:g.144621006C>G	ENSP00000332886:p.Glu275Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.E275Q	ENST00000329798.5	37	c.823	CCDS54808.1	4	.	.	.	.	.	.	.	.	.	.	C	3.638	-0.074164	0.07184	.	.	ENSG00000183090	ENST00000329798	T	0.21191	2.02	4.23	1.32	0.21799	.	0.346013	0.23834	N	0.044103	T	0.19967	0.0480	L	0.55743	1.74	0.09310	N	1	.	.	.	.	.	.	T	0.21759	-1.0236	8	0.16420	T	0.52	-0.7175	7.4302	0.27124	0.0:0.3907:0.509:0.1003	.	.	.	.	Q	275	ENSP00000332886:E275Q	ENSP00000332886:E275Q	E	-	1	0	FREM3	144840456	0.001000	0.12720	0.000000	0.03702	0.012000	0.07955	0.691000	0.25467	0.035000	0.15519	0.655000	0.94253	GAG	FREM3	-	NULL	ENSG00000183090		0.677	FREM3-001	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	FREM3	HGNC	protein_coding	OTTHUMT00000365391.1	12	0.00	0	C	XM_094074		144621006	144621006	-1	no_errors	ENST00000329798	ensembl	human	putative	69_37n	missense	6	40.00	4	SNP	0.001	G
GART	2618	genome.wustl.edu	37	21	34876575	34876575	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr21:34876575C>T	ENST00000381831.3	-	22	3152	c.2889G>A	c.(2887-2889)gtG>gtA	p.V963V	GART_ENST00000381815.4_Silent_p.V963V|GART_ENST00000381839.3_Silent_p.V963V|GART_ENST00000543717.1_Silent_p.V515V	NM_001136005.1	NP_001129477.1	P22102	PUR2_HUMAN	phosphoribosylglycinamide formyltransferase, phosphoribosylglycinamide synthetase, phosphoribosylaminoimidazole synthetase	963	GART.				'de novo' IMP biosynthetic process (GO:0006189)|brainstem development (GO:0003360)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|glycine metabolic process (GO:0006544)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to inorganic substance (GO:0010035)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)|tetrahydrofolate biosynthetic process (GO:0046654)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|phosphoribosylamine-glycine ligase activity (GO:0004637)|phosphoribosylformylglycinamidine cyclo-ligase activity (GO:0004641)|phosphoribosylglycinamide formyltransferase activity (GO:0004644)			NS(2)|breast(1)|endometrium(3)|large_intestine(3)|lung(13)|ovary(3)|prostate(5)|urinary_tract(1)	31					Pemetrexed(DB00642)	CACCCCTCTTCACGGGAACAG	0.423																																						dbGAP											0													63.0	62.0	63.0					21																	34876575		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M32082	CCDS13627.1, CCDS13628.1	21q22.11	2012-10-02			ENSG00000159131	ENSG00000159131	2.1.2.2, 6.3.3.1, 6.3.4.13		4163	protein-coding gene	gene with protein product		138440		PRGS, PGFT		2050105	Standard	NM_001136005		Approved		uc002yrx.3	P22102	OTTHUMG00000065628	ENST00000381831.3:c.2889G>A	21.37:g.34876575C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K945|A8KA32|D3DSF3|D3DSF4|O14659|Q52M77	Silent	SNP	pfam_PRibGlycinamid_synth_ATP-grasp,pfam_Formyl_transf_N,pfam_PRibGlycinamide_synth_N,pfam_AIR_synth_C,pfam_PRibGlycinamide_synth_C-dom,pfam_AIR_synth,pfam_ATP-grasp_carboxylate-amine,pfam_CbamoylP_synth_lsu-like_ATP-bd,superfamily_Formyl_transf_N,superfamily_AIR_synth_C,superfamily_PurM_N-like,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,pfscan_ATP-grasp,tigrfam_PRibGlycinamide_synth,tigrfam_PurM_cligase,tigrfam_PurN_trans	p.V963	ENST00000381831.3	37	c.2889	CCDS13627.1	21																																																																																			GART	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,tigrfam_PurN_trans	ENSG00000159131		0.423	GART-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GART	HGNC	protein_coding	OTTHUMT00000140626.3	79	0.00	0	C	NM_000819		34876575	34876575	-1	no_errors	ENST00000381815	ensembl	human	known	69_37n	silent	43	14.00	7	SNP	0.647	T
GDF2	2658	genome.wustl.edu	37	10	48413859	48413859	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr10:48413859C>T	ENST00000249598.1	-	2	1168	c.1009G>A	c.(1009-1011)Gag>Aag	p.E337K		NM_016204.1	NP_057288.1	Q9UK05	GDF2_HUMAN	growth differentiation factor 2	337					activin receptor signaling pathway (GO:0032924)|angiogenesis (GO:0001525)|blood vessel morphogenesis (GO:0048514)|BMP signaling pathway (GO:0030509)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to BMP stimulus (GO:0071773)|growth (GO:0040007)|negative regulation of angiogenesis (GO:0016525)|negative regulation of blood vessel endothelial cell migration (GO:0043537)|negative regulation of cell growth (GO:0030308)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of DNA replication (GO:0008156)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|osteoblast differentiation (GO:0001649)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|positive regulation of angiogenesis (GO:0045766)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|endometrium(2)|large_intestine(3)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	28						CCGATGTCCTCGAAGTTTACC	0.612																																						dbGAP											0													74.0	73.0	73.0					10																	48413859		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156891	CCDS73118.1	10q11.22	2014-05-06			ENSG00000128802	ENSG00000263761		"""Endogenous ligands"""	4217	protein-coding gene	gene with protein product		605120				10849432	Standard	NM_016204		Approved	BMP-9, BMP9	uc001jfa.1	Q9UK05	OTTHUMG00000188320	ENST00000249598.1:c.1009G>A	10.37:g.48413859C>T	ENSP00000249598:p.Glu337Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ9|Q9Y571	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_asu	p.E337K	ENST00000249598.1	37	c.1009	CCDS7219.1	10	.	.	.	.	.	.	.	.	.	.	C	0.166	-1.076685	0.01903	.	.	ENSG00000128802	ENST00000249598	D	0.88586	-2.4	5.33	3.22	0.36961	Transforming growth factor-beta, C-terminal (3);	0.087422	0.85682	N	0.000000	T	0.60869	0.2302	N	0.00605	-1.335	0.44000	D	0.9967	B	0.12013	0.005	B	0.09377	0.004	T	0.61821	-0.6984	10	0.02654	T	1	.	6.6606	0.23012	0.0:0.6164:0.0:0.3836	.	337	Q9UK05	GDF2_HUMAN	K	337	ENSP00000249598:E337K	ENSP00000249598:E337K	E	-	1	0	GDF2	48033865	1.000000	0.71417	0.954000	0.39281	0.082000	0.17680	2.748000	0.47483	1.253000	0.44018	0.313000	0.20887	GAG	GDF2	-	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	ENSG00000128802		0.612	GDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDF2	HGNC	protein_coding	OTTHUMT00000047891.1	42	0.00	0	C	NM_016204		48413859	48413859	-1	no_errors	ENST00000249598	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.993	T
GK	2710	genome.wustl.edu	37	X	30671665	30671665	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chrX:30671665C>T	ENST00000378941.3	+	1	11	c.11C>T	c.(10-12)tCa>tTa	p.S4L	GK_ENST00000378946.3_Missense_Mutation_p.S4L|GK_ENST00000427190.1_5'UTR|GK_ENST00000378945.3_Missense_Mutation_p.S4L|GK_ENST00000378943.3_Missense_Mutation_p.S4L			P32189	GLPK_HUMAN	glycerol kinase	4					cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						ATGGCAGCCTCAAAGAAGGCA	0.647																																						dbGAP											0													47.0	46.0	46.0					X																	30671665		2202	4299	6501	-	-	-	SO:0001583	missense	0			X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378941.3:c.11C>T	X.37:g.30671665C>T	ENSP00000368224:p.Ser4Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	Missense_Mutation	SNP	pfam_Carb_kinase_FGGY_N,pfam_Carb_kinase_FGGY_C,tigrfam_Glycerol_kin	p.S4L	ENST00000378941.3	37	c.11		X	.	.	.	.	.	.	.	.	.	.	C	14.83	2.652982	0.47362	.	.	ENSG00000198814	ENST00000378946;ENST00000378943;ENST00000534212;ENST00000378945;ENST00000378941	T;T;T;T	0.44083	2.94;2.92;2.93;0.93	4.4	3.54	0.40534	.	0.522766	0.21644	N	0.071290	T	0.24431	0.0592	N	0.14661	0.345	0.80722	D	1	B;B;B	0.14012	0.009;0.009;0.003	B;B;B	0.21360	0.028;0.034;0.004	T	0.05370	-1.0889	10	0.40728	T	0.16	.	7.5292	0.27672	0.0:0.8829:0.0:0.1171	.	4;4;4	P32189-2;P32189-1;A6NJP5	.;.;.	L	4	ENSP00000368229:S4L;ENSP00000368226:S4L;ENSP00000368228:S4L;ENSP00000368224:S4L	ENSP00000368224:S4L	S	+	2	0	GK	30581586	0.940000	0.31905	0.851000	0.33527	0.879000	0.50718	1.968000	0.40500	1.200000	0.43188	0.600000	0.82982	TCA	GK	-	NULL	ENSG00000198814		0.647	GK-005	PUTATIVE	basic|exp_conf	protein_coding	GK	HGNC	protein_coding	OTTHUMT00000056171.1	31	0.00	0	C	NM_000167		30671665	30671665	+1	no_errors	ENST00000378943	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	0.873	T
GLCCI1	113263	genome.wustl.edu	37	7	8099783	8099784	+	Frame_Shift_Del	DEL	TC	TC	-			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	TC	TC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr7:8099783_8099784delTC	ENST00000223145.5	+	5	1428_1429	c.871_872delTC	c.(871-873)tctfs	p.S291fs	GLCCI1_ENST00000474269.1_3'UTR	NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	291						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		GCCAAAATCATCTGTTTCGCGT	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.871_872delTC	7.37:g.8099783_8099784delTC	ENSP00000223145:p.Ser291fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D103|Q96FD0	Frame_Shift_Del	DEL	NULL	p.S291fs	ENST00000223145.5	37	c.871_872	CCDS34601.1	7																																																																																			GLCCI1	-	NULL	ENSG00000106415		0.376	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCCI1	HGNC	protein_coding	OTTHUMT00000324672.1	70	0.00	0	TC	NM_138426		8099783	8099784	+1	no_errors	ENST00000223145	ensembl	human	known	69_37n	frame_shift_del	69	10.26	8	DEL	0.997:1.000	-
GOLGA6L6	727832	genome.wustl.edu	37	15	20739825	20739825	+	Missense_Mutation	SNP	G	G	A	rs28590435		TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr15:20739825G>A	ENST00000427390.2	-	8	2015	c.1925C>T	c.(1924-1926)aCg>aTg	p.T642M		NM_001145004.1	NP_001138476.1	A8MZA4	GG6L6_HUMAN	golgin A6 family-like 6	642	Gln-rich.|Glu-rich.									NS(3)|endometrium(4)|kidney(1)|skin(3)	11						ctgttcctgcgtcatctcctc	0.542																																						dbGAP											0													5.0	5.0	5.0					15																	20739825		632	1458	2090	-	-	-	SO:0001583	missense	0			AK093450	CCDS45184.1	15q11.2	2014-02-12	2010-02-12		ENSG00000215405	ENSG00000277322			37225	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 6-like 6"""				Standard	NM_001145004		Approved	FLJ36131	uc001ytk.2	A8MZA4	OTTHUMG00000171663	ENST00000427390.2:c.1925C>T	15.37:g.20739825G>A	ENSP00000398615:p.Thr642Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3YTC0	Missense_Mutation	SNP	superfamily_Ribosomal_L7/12_C/ClpS-like,prints_Tropomyosin	p.T642M	ENST00000427390.2	37	c.1925	CCDS45184.1	15	.	.	.	.	.	.	.	.	.	.	A	0.843	-0.741385	0.03088	.	.	ENSG00000215405	ENST00000427390	T	0.08634	3.07	.	.	.	.	.	.	.	.	T	0.06142	0.0159	N	0.03608	-0.345	0.09310	N	1	D	0.69078	0.997	P	0.59056	0.851	T	0.30238	-0.9985	8	0.31617	T	0.26	.	2.6659	0.05051	0.4792:0.0:0.5208:0.0	rs28590435	642	A8MZA4	GG6L6_HUMAN	M	642	ENSP00000398615:T642M	ENSP00000398615:T642M	T	-	2	0	GOLGA6L6	18999839	0.000000	0.05858	0.053000	0.19242	0.053000	0.15095	-3.759000	0.00373	0.159000	0.19401	0.162000	0.16502	ACG	GOLGA6L6	-	NULL	ENSG00000215405		0.542	GOLGA6L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA6L6	HGNC	protein_coding	OTTHUMT00000414660.3	33	0.00	0	G	NM_001145004		20739825	20739825	-1	no_errors	ENST00000427390	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.657	A
GOPC	57120	genome.wustl.edu	37	6	117892082	117892082	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr6:117892082G>T	ENST00000368498.2	-	6	928	c.853C>A	c.(853-855)Cca>Aca	p.P285T	GOPC_ENST00000467125.1_5'UTR|GOPC_ENST00000535237.1_Missense_Mutation_p.P285T|GOPC_ENST00000052569.6_Missense_Mutation_p.P277T	NM_020399.3	NP_065132.1	Q9HD26	GOPC_HUMAN	golgi-associated PDZ and coiled-coil motif containing	285					apical protein localization (GO:0045176)|cytoplasmic sequestering of CFTR protein (GO:0043004)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi to plasma membrane transport (GO:0006893)|protein homooligomerization (GO:0051260)|protein transport (GO:0015031)|spermatid nucleus differentiation (GO:0007289)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|trans-Golgi network transport vesicle (GO:0030140)	ion channel binding (GO:0044325)|small GTPase regulator activity (GO:0005083)		GOPC/ROS1(14)	endometrium(1)|large_intestine(3)|lung(4)|ovary(1)	9		all_cancers(87;0.00844)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0363)|OV - Ovarian serous cystadenocarcinoma(136;0.0821)|all cancers(137;0.0976)		TTTCTAATTGGACCAACACCT	0.343			O	ROS1	glioblastoma																																	dbGAP		Dom	yes		6	6q21	57120	golgi associated PDZ and coiled-coil motif containing		O	0													144.0	141.0	142.0					6																	117892082		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF287894	CCDS5117.1, CCDS34523.1	6q21	2010-02-12	2010-02-12		ENSG00000047932	ENSG00000047932			17643	protein-coding gene	gene with protein product		606845				11162552, 11520064	Standard	NM_020399		Approved	dJ94G16.2, PIST, FIG, GOPC1, CAL		Q9HD26	OTTHUMG00000015457	ENST00000368498.2:c.853C>A	6.37:g.117892082G>T	ENSP00000357484:p.Pro285Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM30|Q59FS4|Q969U8	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.P285T	ENST00000368498.2	37	c.853	CCDS5117.1	6	.	.	.	.	.	.	.	.	.	.	G	24.0	4.486573	0.84854	.	.	ENSG00000047932	ENST00000052569;ENST00000368498;ENST00000535237	T;T;T	0.49720	0.77;0.77;0.77	5.77	5.77	0.91146	PDZ/DHR/GLGF (1);	0.106379	0.64402	D	0.000003	T	0.39091	0.1065	L	0.40543	1.245	0.80722	D	1	P;P;P	0.49090	0.919;0.918;0.843	P;B;P	0.46362	0.514;0.428;0.479	T	0.16247	-1.0409	10	0.45353	T	0.12	-3.9838	19.9922	0.97370	0.0:0.0:1.0:0.0	.	277;285;285	Q9HD26-2;Q9HD26;F5H1Y4	.;GOPC_HUMAN;.	T	277;285;285	ENSP00000052569:P277T;ENSP00000357484:P285T;ENSP00000445690:P285T	ENSP00000052569:P277T	P	-	1	0	GOPC	117998775	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.052000	0.93855	2.740000	0.93945	0.557000	0.71058	CCA	GOPC	-	superfamily_PDZ	ENSG00000047932		0.343	GOPC-002	KNOWN	basic|CCDS	protein_coding	GOPC	HGNC	protein_coding	OTTHUMT00000041988.1	101	0.00	0	G	NM_020399		117892082	117892082	-1	no_errors	ENST00000368498	ensembl	human	known	69_37n	missense	57	16.18	11	SNP	1.000	T
IGSF11	152404	genome.wustl.edu	37	3	118621736	118621736	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr3:118621736G>T	ENST00000393775.2	-	7	1232	c.927C>A	c.(925-927)aaC>aaA	p.N309K	IGSF11_ENST00000354673.2_Missense_Mutation_p.N308K|IGSF11_ENST00000441144.2_Missense_Mutation_p.N284K|IGSF11_ENST00000489689.1_Missense_Mutation_p.N285K|IGSF11_ENST00000425327.2_Missense_Mutation_p.N308K|IGSF11_ENST00000491903.1_Missense_Mutation_p.N281K	NM_001015887.1	NP_001015887.1	Q5DX21	IGS11_HUMAN	immunoglobulin superfamily, member 11	309					cell adhesion (GO:0007155)|regulation of growth (GO:0040008)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(20)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34						AGGTTAGTGTGTTGTTGTCCG	0.443																																						dbGAP											0													122.0	127.0	125.0					3																	118621736		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB079879	CCDS2983.1, CCDS46891.1	3q21.2	2013-01-11			ENSG00000144847	ENSG00000144847		"""Immunoglobulin superfamily / I-set domain containing"""	16669	protein-coding gene	gene with protein product	"""cancer/testis antigen 119"""	608351				12207903	Standard	XM_006713516		Approved	BT-IgSF, MGC35227, Igsf13, VSIG3, CT119	uc003ebw.3	Q5DX21	OTTHUMG00000159387	ENST00000393775.2:c.927C>A	3.37:g.118621736G>T	ENSP00000377370:p.Asn309Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JZN0|Q8N4F1|Q8N7T8|Q8NDD2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.N309K	ENST00000393775.2	37	c.927	CCDS46891.1	3	.	.	.	.	.	.	.	.	.	.	G	16.55	3.153661	0.57259	.	.	ENSG00000144847	ENST00000425327;ENST00000393775;ENST00000489689;ENST00000354673;ENST00000441144;ENST00000491903	T;T;D;T;D;D	0.83506	-0.86;-1.08;-1.73;-0.86;-1.67;-1.52	5.37	4.5	0.54988	.	0.043926	0.85682	D	0.000000	T	0.65322	0.2680	N	0.19112	0.55	0.47183	D	0.999348	P;P;P;P;P	0.41848	0.651;0.763;0.763;0.651;0.651	B;B;B;B;B	0.33392	0.115;0.163;0.163;0.115;0.115	T	0.66448	-0.5921	10	0.07325	T	0.83	.	13.2041	0.59785	0.076:0.0:0.924:0.0	.	281;284;308;285;309	C9JBA5;Q5DX21-3;Q5DX21-2;C9JMW0;Q5DX21	.;.;.;.;IGS11_HUMAN	K	308;309;285;308;284;281	ENSP00000406092:N308K;ENSP00000377370:N309K;ENSP00000420486:N285K;ENSP00000346700:N308K;ENSP00000401240:N284K;ENSP00000417413:N281K	ENSP00000346700:N308K	N	-	3	2	IGSF11	120104426	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	9.150000	0.94667	1.503000	0.48686	0.655000	0.94253	AAC	IGSF11	-	NULL	ENSG00000144847		0.443	IGSF11-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF11	HGNC	protein_coding	OTTHUMT00000355075.2	40	0.00	0	G			118621736	118621736	-1	no_errors	ENST00000393775	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	T
IL12RB2	3595	genome.wustl.edu	37	1	67855809	67855809	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:67855809G>A	ENST00000262345.1	+	15	2684	c.2044G>A	c.(2044-2046)Gag>Aag	p.E682K	IL12RB2_ENST00000541374.1_Intron|IL12RB2_ENST00000544434.1_Missense_Mutation_p.E596K|IL12RB2_ENST00000465396.1_3'UTR|IL12RB2_ENST00000371000.1_Intron	NM_001559.2	NP_001550.1	Q99665	I12R2_HUMAN	interleukin 12 receptor, beta 2	682					cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma production (GO:0032609)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of interferon-gamma production (GO:0032729)|response to lipopolysaccharide (GO:0032496)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)			breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(21)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	45						TCCCATTGCAGAGGTAAGGTA	0.468																																						dbGAP											0													92.0	80.0	84.0					1																	67855809		2203	4300	6503	-	-	-	SO:0001583	missense	0			U64198	CCDS638.1, CCDS58006.1, CCDS58007.1, CCDS72805.1	1p31.3-p31.2	2014-07-15			ENSG00000081985	ENSG00000081985		"""Interleukins and interleukin receptors"", ""Fibronectin type III domain containing"""	5972	protein-coding gene	gene with protein product		601642				9284929, 8943050	Standard	NM_001559		Approved		uc001ddu.3	Q99665	OTTHUMG00000009094	ENST00000262345.1:c.2044G>A	1.37:g.67855809G>A	ENSP00000262345:p.Glu682Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN98|B7ZKL9|F5H7L6|Q2M3V3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_IgC2-like_lig-bd,pfam_IL6_recept-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E682K	ENST00000262345.1	37	c.2044	CCDS638.1	1	.	.	.	.	.	.	.	.	.	.	G	16.03	3.007642	0.54361	.	.	ENSG00000081985	ENST00000262345;ENST00000544434	T;T	0.42131	0.98;1.93	5.34	5.34	0.76211	.	0.379782	0.30869	N	0.008717	T	0.42426	0.1202	L	0.53249	1.67	0.80722	D	1	D;D	0.71674	0.998;0.991	D;P	0.80764	0.994;0.862	T	0.37709	-0.9694	10	0.06236	T	0.91	-26.0439	14.9271	0.70887	0.0:0.0:1.0:0.0	.	596;682	F5H7L6;Q99665	.;I12R2_HUMAN	K	682;596	ENSP00000262345:E682K;ENSP00000442443:E596K	ENSP00000262345:E682K	E	+	1	0	IL12RB2	67628397	1.000000	0.71417	0.995000	0.50966	0.010000	0.07245	3.156000	0.50708	2.665000	0.90641	0.591000	0.81541	GAG	IL12RB2	-	NULL	ENSG00000081985		0.468	IL12RB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB2	HGNC	protein_coding	OTTHUMT00000025202.2	63	0.00	0	G	NM_001559		67855809	67855809	+1	no_errors	ENST00000262345	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	A
ITGA6	3655	genome.wustl.edu	37	2	173335724	173335724	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr2:173335724G>C	ENST00000264106.6	+	5	869	c.666G>C	c.(664-666)aaG>aaC	p.K222N	ITGA6_ENST00000409532.1_Intron|ITGA6_ENST00000343713.4_Intron|ITGA6_ENST00000409080.1_Missense_Mutation_p.K222N|ITGA6_ENST00000264107.7_Missense_Mutation_p.K222N|ITGA6_ENST00000375221.2_Missense_Mutation_p.K222N			P23229	ITA6_HUMAN	integrin, alpha 6	222					amelogenesis (GO:0097186)|blood coagulation (GO:0007596)|brown fat cell differentiation (GO:0050873)|cell adhesion mediated by integrin (GO:0033627)|cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|cellular response to extracellular stimulus (GO:0031668)|cellular response to organic cyclic compound (GO:0071407)|digestive tract development (GO:0048565)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|filopodium assembly (GO:0046847)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|nail development (GO:0035878)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|renal system development (GO:0072001)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)	basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|external side of plasma membrane (GO:0009897)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integrin alpha6-beta4 complex (GO:0034676)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)			NS(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(1)|lung(18)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	44			OV - Ovarian serous cystadenocarcinoma(117;0.0979)			TAGAGCAAAAGAATAACACTT	0.348																																						dbGAP											0													109.0	96.0	100.0					2																	173335724		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2249.1, CCDS46451.1	2q31.1	2010-09-20			ENSG00000091409	ENSG00000091409		"""CD molecules"", ""Integrins"""	6142	protein-coding gene	gene with protein product		147556					Standard	NM_001079818		Approved	CD49f	uc002uhp.1	P23229	OTTHUMG00000132277	ENST00000264106.6:c.666G>C	2.37:g.173335724G>C	ENSP00000264106:p.Lys222Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMU9|B4DG69|B4DKB8|C4AM96|G5E9H1|Q08443|Q0MRC7|Q14646|Q16508|Q53RX7|Q59HB7|Q86VL6|Q9UCT1|Q9UN03	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.K222N	ENST00000264106.6	37	c.666		2	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371302	0.42003	.	.	ENSG00000091409	ENST00000412899;ENST00000264107;ENST00000264106;ENST00000375221;ENST00000409080;ENST00000442250	T;T;T;T;T;T	0.45668	0.89;0.89;0.89;0.89;0.89;0.89	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.30230	0.0758	L	0.27053	0.805	0.80722	D	1	B;B	0.16802	0.019;0.008	B;B	0.17979	0.02;0.014	T	0.07654	-1.0761	10	0.22109	T	0.4	.	12.9742	0.58529	0.0736:0.0:0.9264:0.0	.	222;222	G5E9H1;P23229-2	.;.	N	108;222;222;222;222;222	ENSP00000413470:K108N;ENSP00000264107:K222N;ENSP00000264106:K222N;ENSP00000364369:K222N;ENSP00000386896:K222N;ENSP00000406694:K222N	ENSP00000264106:K222N	K	+	3	2	ITGA6	173043970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.755000	0.74914	2.664000	0.90586	0.650000	0.86243	AAG	ITGA6	-	NULL	ENSG00000091409		0.348	ITGA6-201	KNOWN	basic	protein_coding	ITGA6	HGNC	protein_coding		58	0.00	0	G			173335724	173335724	+1	no_errors	ENST00000264106	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	1.000	C
KCNMB1	3779	genome.wustl.edu	37	5	169805861	169805861	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr5:169805861C>T	ENST00000274629.4	-	4	865	c.423G>A	c.(421-423)ggG>ggA	p.G141G	KCNIP1_ENST00000377360.4_Intron|KCNIP1_ENST00000518527.1_Intron	NM_004137.3	NP_004128.1	Q16558	KCMB1_HUMAN	potassium large conductance calcium-activated channel, subfamily M, beta member 1	141					blood coagulation (GO:0007596)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|response to calcium ion (GO:0051592)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|potassium channel regulator activity (GO:0015459)			endometrium(1)|large_intestine(1)|lung(7)|ovary(2)	11	Renal(175;0.000159)|Lung NSC(126;0.0165)|all_lung(126;0.026)	Medulloblastoma(196;0.0109)|all_neural(177;0.0146)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.175)	Miconazole(DB01110)|Procaine(DB00721)	TGGTTTCGTTCCCCCGAGGTG	0.617																																						dbGAP											0													90.0	86.0	87.0					5																	169805861		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035046	CCDS4373.1	5q34	2012-02-23			ENSG00000145936	ENSG00000145936		"""Potassium channels"""	6285	protein-coding gene	gene with protein product	"""BK channel beta subunit"""	603951				8799178, 9888999	Standard	NM_004137		Approved	hslo-beta	uc003maq.2	Q16558	OTTHUMG00000130439	ENST00000274629.4:c.423G>A	5.37:g.169805861C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O00707|O00708|P78475|Q53YR0|Q8TAX3|Q93005	Silent	SNP	pfam_K_chnl_Ca-activ_BK_bsu,prints_K_chnl_Ca-activ_BK_bsu	p.G141	ENST00000274629.4	37	c.423	CCDS4373.1	5																																																																																			KCNMB1	-	pfam_K_chnl_Ca-activ_BK_bsu	ENSG00000145936		0.617	KCNMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNMB1	HGNC	protein_coding	OTTHUMT00000252830.3	49	0.00	0	C			169805861	169805861	-1	no_errors	ENST00000274629	ensembl	human	known	69_37n	silent	48	17.24	10	SNP	0.002	T
LIN54	132660	genome.wustl.edu	37	4	83857213	83857213	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr4:83857213C>G	ENST00000340417.3	-	11	2143	c.1766G>C	c.(1765-1767)gGa>gCa	p.G589A	LIN54_ENST00000505397.1_Missense_Mutation_p.G589A|LIN54_ENST00000395282.2_3'UTR|LIN54_ENST00000510557.1_Missense_Mutation_p.G368A|LIN54_ENST00000442461.2_Missense_Mutation_p.G368A|LIN54_ENST00000506560.1_Missense_Mutation_p.G500A|LIN54_ENST00000395283.2_Missense_Mutation_p.G500A|LIN54_ENST00000446851.2_Missense_Mutation_p.G368A	NM_194282.2	NP_919258.2	Q6MZP7	LIN54_HUMAN	lin-54 DREAM MuvB core complex component	589	CRC. {ECO:0000255|PROSITE- ProRule:PRU00971}.				G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)			breast(2)|endometrium(2)|kidney(3)|large_intestine(2)|lung(5)	14		Hepatocellular(203;0.114)				ATCAGATTCTCCCTCCTTTCC	0.418																																						dbGAP											0													190.0	168.0	176.0					4																	83857213		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX537919	CCDS3599.1, CCDS47089.1, CCDS75157.1	4q21.22	2014-07-17	2014-07-17		ENSG00000189308	ENSG00000189308			25397	protein-coding gene	gene with protein product	"""CXC domain containing 1"""	613367	"""lin-54 homolog (C. elegans)"""			21498570	Standard	XM_005262749		Approved	MIP120, DKFZp686L1814, JC8.6, CXCDC1	uc003hnx.3	Q6MZP7	OTTHUMG00000130287	ENST00000340417.3:c.1766G>C	4.37:g.83857213C>G	ENSP00000341947:p.Gly589Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q32M68|Q32M69|Q6N071|Q76B60	Missense_Mutation	SNP	pfam_TCR	p.G589A	ENST00000340417.3	37	c.1766	CCDS3599.1	4	.	.	.	.	.	.	.	.	.	.	C	18.02	3.529883	0.64860	.	.	ENSG00000189308	ENST00000340417;ENST00000395283;ENST00000442461;ENST00000446851;ENST00000510557;ENST00000506560;ENST00000505397	.	.	.	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.74168	0.3681	L	0.42529	1.33	0.80722	D	1	D;D;D	0.76494	0.994;0.999;0.999	D;D;D	0.77004	0.98;0.965;0.989	T	0.74435	-0.3666	9	0.54805	T	0.06	-12.6934	19.0569	0.93069	0.0:1.0:0.0:0.0	.	500;461;589	Q6MZP7-2;Q7Z3G2;Q6MZP7	.;.;LIN54_HUMAN	A	589;500;368;368;368;500;589	.	ENSP00000341947:G589A	G	-	2	0	LIN54	84076237	1.000000	0.71417	0.989000	0.46669	0.067000	0.16453	7.593000	0.82686	2.732000	0.93576	0.650000	0.86243	GGA	LIN54	-	NULL	ENSG00000189308		0.418	LIN54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN54	HGNC	protein_coding	OTTHUMT00000252626.2	137	0.00	0	C	NM_194282		83857213	83857213	-1	no_errors	ENST00000340417	ensembl	human	known	69_37n	missense	70	22.22	20	SNP	1.000	G
LMOD3	56203	genome.wustl.edu	37	3	69171352	69171352	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr3:69171352C>T	ENST00000420581.2	-	1	365	c.186G>A	c.(184-186)ccG>ccA	p.P62P	LMOD3_ENST00000475434.1_Silent_p.P62P|LMOD3_ENST00000489031.1_Silent_p.P62P	NM_198271.3	NP_938012.2	Q0VAK6	LMOD3_HUMAN	leiomodin 3 (fetal)	62						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)	13		Lung NSC(201;0.0193)|Prostate(884;0.174)		BRCA - Breast invasive adenocarcinoma(55;7.88e-05)|Epithelial(33;0.000839)|LUSC - Lung squamous cell carcinoma(21;0.0119)|Lung(16;0.0191)|KIRC - Kidney renal clear cell carcinoma(39;0.205)|Kidney(39;0.24)		AGTTTCCTGTCGGTGGCTTGT	0.468																																						dbGAP											0													89.0	83.0	85.0					3																	69171352		1850	4100	5950	-	-	-	SO:0001819	synonymous_variant	0			AK096900	CCDS46862.1	3p14.1	2003-03-07			ENSG00000163380	ENSG00000163380			6649	protein-coding gene	gene with protein product							Standard	NM_198271		Approved		uc003dns.2	Q0VAK6	OTTHUMG00000158774	ENST00000420581.2:c.186G>A	3.37:g.69171352C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DT85|Q0JTT2|Q5JPG6|Q8IUK4|Q96LS4	Silent	SNP	pfam_Tropomodulin	p.P62	ENST00000420581.2	37	c.186	CCDS46862.1	3																																																																																			LMOD3	-	pfam_Tropomodulin	ENSG00000163380		0.468	LMOD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMOD3	HGNC	protein_coding	OTTHUMT00000352138.1	80	0.00	0	C	XM_067529		69171352	69171352	-1	no_errors	ENST00000420581	ensembl	human	known	69_37n	silent	66	21.43	18	SNP	0.003	T
MAML3	55534	genome.wustl.edu	37	4	140811855	140811855	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr4:140811855C>G	ENST00000509479.2	-	2	1591	c.735G>C	c.(733-735)aaG>aaC	p.K245N	MAML3_ENST00000398940.1_5'Flank|MAML3_ENST00000327122.5_Missense_Mutation_p.K89N	NM_018717.4	NP_061187			mastermind-like 3 (Drosophila)											breast(1)|endometrium(7)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(2)|urinary_tract(2)	25	all_hematologic(180;0.162)					GCCTACCATTCTTACTTAGAT	0.478																																						dbGAP											0													105.0	100.0	101.0					4																	140811855		1938	4127	6065	-	-	-	SO:0001583	missense	0			AB058719	CCDS54805.1	4q31.1	2014-08-12	2003-09-24		ENSG00000196782	ENSG00000196782			16272	protein-coding gene	gene with protein product	"""mastermind (drosophila)-like 3"""	608991	"""trinucleotide repeat containing 3"""	TNRC3		12370315, 12386158	Standard	NM_018717		Approved	KIAA1816, MAM2, CAGH3, GDN	uc021xsg.1	Q96JK9	OTTHUMG00000161441	ENST00000509479.2:c.735G>C	4.37:g.140811855C>G	ENSP00000421180:p.Lys245Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Neuroggenic_mastermind-like_N	p.K245N	ENST00000509479.2	37	c.735	CCDS54805.1	4	.	.	.	.	.	.	.	.	.	.	C	6.930	0.541333	0.13250	.	.	ENSG00000196782	ENST00000509479;ENST00000327122	T	0.26810	1.71	5.3	4.45	0.53987	.	0.055629	0.64402	D	0.000001	T	0.32704	0.0838	M	0.68593	2.085	0.80722	D	1	D	0.63880	0.993	P	0.53954	0.738	T	0.09707	-1.0662	10	0.12430	T	0.62	.	7.3061	0.26449	0.0:0.7302:0.0:0.2698	.	245	Q96JK9	MAML3_HUMAN	N	245;89	ENSP00000421180:K245N	ENSP00000313316:K89N	K	-	3	2	MAML3	141031305	1.000000	0.71417	0.996000	0.52242	0.746000	0.42486	3.343000	0.52167	2.469000	0.83416	0.585000	0.79938	AAG	MAML3	-	NULL	ENSG00000196782		0.478	MAML3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAML3	HGNC	protein_coding	OTTHUMT00000364934.2	42	0.00	0	C			140811855	140811855	-1	no_errors	ENST00000509479	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	1.000	G
MAP2	4133	genome.wustl.edu	37	2	210558653	210558653	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr2:210558653G>C	ENST00000360351.4	+	7	2265	c.1759G>C	c.(1759-1761)Gag>Cag	p.E587Q	MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000447185.1_Missense_Mutation_p.E583Q	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	587					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	AAAAAGCATTGAGCCAGGCAG	0.388																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													90.0	85.0	87.0					2																	210558653		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.1759G>C	2.37:g.210558653G>C	ENSP00000353508:p.Glu587Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Missense_Mutation	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.E587Q	ENST00000360351.4	37	c.1759	CCDS2384.1	2	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.446282	0.01089	.	.	ENSG00000078018	ENST00000360351;ENST00000447185	T;T	0.19938	2.11;2.11	6.16	3.36	0.38483	MAP2/Tau projection (1);	0.608078	0.15905	N	0.238862	T	0.04907	0.0132	N	0.00368	-1.59	0.22911	N	0.998574	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.36986	-0.9725	10	0.02654	T	1	-1.8968	12.8787	0.58003	0.1182:0.5647:0.3171:0.0	.	583;587	P11137-3;P11137	.;MAP2_HUMAN	Q	587;583	ENSP00000353508:E587Q;ENSP00000392164:E583Q	ENSP00000353508:E587Q	E	+	1	0	MAP2	210266898	0.034000	0.19679	0.988000	0.46212	0.830000	0.47004	0.389000	0.20751	0.451000	0.26802	-0.959000	0.02639	GAG	MAP2	-	pfam_MAP2_projctn	ENSG00000078018		0.388	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	22	0.00	0	G	NM_001039538		210558653	210558653	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	missense	17	34.62	9	SNP	0.758	C
MCTP2	55784	genome.wustl.edu	37	15	94927324	94927324	+	Silent	SNP	C	C	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr15:94927324C>A	ENST00000357742.4	+	12	1656	c.1656C>A	c.(1654-1656)ctC>ctA	p.L552L	MCTP2_ENST00000451018.3_Silent_p.L552L|MCTP2_ENST00000557742.1_Silent_p.L140L|MCTP2_ENST00000331706.4_Silent_p.L140L	NM_018349.3	NP_060819.3	Q6DN12	MCTP2_HUMAN	multiple C2 domains, transmembrane 2	552	C2 3. {ECO:0000255|PROSITE- ProRule:PRU00041}.				calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(4)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(12)|liver(1)|lung(12)|ovary(1)|pancreas(1)|skin(9)|stomach(2)	49	Lung NSC(78;0.0821)|all_lung(78;0.148)		BRCA - Breast invasive adenocarcinoma(143;0.0323)|OV - Ovarian serous cystadenocarcinoma(32;0.0593)			ACAAAAACCTCAACCCTGAAT	0.433																																						dbGAP											0													132.0	108.0	116.0					15																	94927324		2197	4298	6495	-	-	-	SO:0001819	synonymous_variant	0			AK002037	CCDS32338.1, CCDS53975.1, CCDS53976.1	15q26.2	2006-02-08				ENSG00000140563			25636	protein-coding gene	gene with protein product						15528213	Standard	NM_018349		Approved	FLJ11175, FLJ33303	uc002btj.3	Q6DN12		ENST00000357742.4:c.1656C>A	15.37:g.94927324C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRC2|C6G483|C6G484|Q49AB0|Q8TAX2|Q9NUS2|Q9NUW7	Silent	SNP	pfam_C2_Ca-dep,pfam_PRibTrfase_C,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.L552	ENST00000357742.4	37	c.1656	CCDS32338.1	15																																																																																			MCTP2	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000140563		0.433	MCTP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MCTP2	HGNC	protein_coding	OTTHUMT00000415060.3	59	0.00	0	C	NM_018349		94927324	94927324	+1	no_errors	ENST00000357742	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	1.000	A
MS4A1	931	genome.wustl.edu	37	11	60229921	60229921	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr11:60229921C>G	ENST00000534668.1	+	2	363	c.74C>G	c.(73-75)tCt>tGt	p.S25C	MS4A1_ENST00000528313.1_Missense_Mutation_p.S25C|MS4A1_ENST00000532073.1_Missense_Mutation_p.S25C|MS4A1_ENST00000345732.4_Missense_Mutation_p.S25C|MS4A1_ENST00000389939.2_Missense_Mutation_p.S25C|MS4A1_ENST00000534503.1_3'UTR	NM_152866.2	NP_690605.1	P11836	CD20_HUMAN	membrane-spanning 4-domains, subfamily A, member 1	25					B cell proliferation (GO:0042100)|humoral immune response (GO:0006959)	external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	MHC class II protein complex binding (GO:0023026)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(10)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24					Ibritumomab(DB00078)|Obinutuzumab(DB08935)|Rituximab(DB00073)|Tositumomab(DB00081)	GCTATGCAATCTGGTCCAAAA	0.458																																						dbGAP											0													75.0	77.0	76.0					11																	60229921		2203	4300	6503	-	-	-	SO:0001583	missense	0			M27394	CCDS31570.1	11q12-q13.1	2014-09-17				ENSG00000156738		"""CD molecules"""	7315	protein-coding gene	gene with protein product		112210		CD20		2448768	Standard	NM_152866		Approved	B1, Bp35, MS4A2	uc001npq.3	P11836		ENST00000534668.1:c.74C>G	11.37:g.60229921C>G	ENSP00000433277:p.Ser25Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMS4|B4DT24|P08984|Q13963	Missense_Mutation	SNP	pfam_CD20-like	p.S25C	ENST00000534668.1	37	c.74	CCDS31570.1	11	.	.	.	.	.	.	.	.	.	.	C	12.76	2.036059	0.35893	.	.	ENSG00000156738	ENST00000345732;ENST00000532073;ENST00000534668;ENST00000528313;ENST00000533306;ENST00000389939	T;T;T;T;T	0.33865	2.41;1.83;2.41;1.39;2.41	5.21	5.21	0.72293	.	1.294830	0.05246	N	0.513178	T	0.25158	0.0611	N	0.08118	0	0.09310	N	1	B;B;B;B	0.26147	0.101;0.143;0.143;0.143	B;B;B;B	0.14023	0.01;0.006;0.006;0.006	T	0.13575	-1.0504	10	0.40728	T	0.16	-1.1085	14.2747	0.66173	0.0:1.0:0.0:0.0	.	25;25;25;25	B4DT24;E9PKH8;A8K803;P11836	.;.;.;CD20_HUMAN	C	25;25;25;25;28;25	ENSP00000314620:S25C;ENSP00000433519:S25C;ENSP00000433277:S25C;ENSP00000437002:S28C;ENSP00000374589:S25C	ENSP00000314620:S25C	S	+	2	0	MS4A1	59986497	0.043000	0.20138	0.024000	0.17045	0.013000	0.08279	3.549000	0.53681	2.431000	0.82371	0.655000	0.94253	TCT	MS4A1	-	NULL	ENSG00000156738		0.458	MS4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MS4A1	HGNC	protein_coding	OTTHUMT00000395402.1	46	0.00	0	C			60229921	60229921	+1	no_errors	ENST00000345732	ensembl	human	known	69_37n	missense	46	15.79	9	SNP	0.044	G
MUC16	94025	genome.wustl.edu	37	19	9086173	9086173	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr19:9086173G>A	ENST00000397910.4	-	1	5845	c.5642C>T	c.(5641-5643)aCc>aTc	p.T1881I		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	1881	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CTTAGAAGAGGTATCAGAGCC	0.507																																						dbGAP											0													68.0	64.0	65.0					19																	9086173		1932	4131	6063	-	-	-	SO:0001583	missense	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.5642C>T	19.37:g.9086173G>A	ENSP00000381008:p.Thr1881Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.T1881I	ENST00000397910.4	37	c.5642	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	0.035	-1.313012	0.01331	.	.	ENSG00000181143	ENST00000397910	T	0.02472	4.28	0.225	-0.451	0.12214	.	.	.	.	.	T	0.01558	0.0050	N	0.08118	0	.	.	.	B	0.13145	0.007	B	0.06405	0.002	T	0.44436	-0.9328	7	0.87932	D	0	.	.	.	.	.	1881	B5ME49	.	I	1881	ENSP00000381008:T1881I	ENSP00000381008:T1881I	T	-	2	0	MUC16	8947173	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	0.035000	0.13797	-0.694000	0.05113	-0.680000	0.03767	ACC	MUC16	-	NULL	ENSG00000181143		0.507	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	45	0.00	0	G	NM_024690		9086173	9086173	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	missense	57	24.00	18	SNP	0.003	A
N4BP2L2	10443	genome.wustl.edu	37	13	33092110	33092110	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr13:33092110C>G	ENST00000267068.3	-	6	1745	c.1581G>C	c.(1579-1581)aaG>aaC	p.K527N	N4BP2L2_ENST00000357505.6_Missense_Mutation_p.K83N|N4BP2L2_ENST00000446957.2_Missense_Mutation_p.K527N|N4BP2L2_ENST00000504114.1_Missense_Mutation_p.K83N|N4BP2L2_ENST00000399396.3_Missense_Mutation_p.K98N	NM_014887.2	NP_055702.1	Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2	527					negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		TCTGAGCAATCTTCTTTCGAG	0.358																																						dbGAP											0													122.0	111.0	115.0					13																	33092110		2203	4300	6503	-	-	-	SO:0001583	missense	0			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000267068.3:c.1581G>C	13.37:g.33092110C>G	ENSP00000267068:p.Lys527Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KME8	Missense_Mutation	SNP	NULL	p.K98N	ENST00000267068.3	37	c.294	CCDS9346.1	13	.	.	.	.	.	.	.	.	.	.	C	17.27	3.346156	0.61073	.	.	ENSG00000244754	ENST00000504114;ENST00000357505;ENST00000399396;ENST00000446957;ENST00000505213;ENST00000267068	T;T;T;T;T;T	0.41758	1.12;1.12;1.12;0.99;0.99;0.99	5.34	5.34	0.76211	.	.	.	.	.	T	0.55337	0.1914	L	0.31752	0.955	0.40347	D	0.979099	P;D;P;D	0.89917	0.468;1.0;0.939;1.0	P;D;D;D	0.97110	0.502;1.0;0.934;0.999	T	0.58538	-0.7619	9	0.56958	D	0.05	-6.9043	19.0496	0.93038	0.0:1.0:0.0:0.0	.	83;98;527;527	B4DPY1;Q92802-3;Q92802;Q92802-2	.;.;N42L2_HUMAN;.	N	83;83;98;527;527;527	ENSP00000427477:K83N;ENSP00000350104:K83N;ENSP00000382328:K98N;ENSP00000394239:K527N;ENSP00000423362:K527N;ENSP00000267068:K527N	ENSP00000267068:K527N	K	-	3	2	N4BP2L2	31990110	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.921000	0.63397	2.510000	0.84645	0.467000	0.42956	AAG	N4BP2L2	-	NULL	ENSG00000244754		0.358	N4BP2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP2L2	HGNC	protein_coding	OTTHUMT00000044421.1	90	0.00	0	C	NM_014887		33092110	33092110	-1	no_errors	ENST00000399396	ensembl	human	known	69_37n	missense	92	11.54	12	SNP	1.000	G
NBPF1	55672	genome.wustl.edu	37	1	16891354	16891354	+	Frame_Shift_Del	DEL	T	T	-			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:16891354delT	ENST00000430580.2	-	28	4011	c.3124delA	c.(3124-3126)aggfs	p.R1044fs		NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1	1026	NBPF 7. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ccccttctccttcttttcttc	0.418																																						dbGAP											0													61.0	27.0	43.0					1																	16891354		626	679	1305	-	-	-	SO:0001589	frameshift_variant	0			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.3124delA	1.37:g.16891354delT	ENSP00000474456:p.Arg1044fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4E8|Q9C0H0	RNA	DEL	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-	ENSG00000219481		0.418	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	40	0.00	0	T	NM_017940		16891354	16891354	-1	no_errors	ENST00000401007	ensembl	human	known	69_37n	rna	11	15.38	2	DEL	0.017	-
NT5M	56953	genome.wustl.edu	37	17	17248229	17248229	+	Intron	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr17:17248229G>A	ENST00000389022.4	+	4	760				NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial						dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						ACAGGCAAGTGGCCTGCGACA	0.607																																						dbGAP											0													80.0	67.0	71.0					17																	17248229		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.544+7G>A	17.37:g.17248229G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000389022.4	37	NULL	CCDS32581.1	17																																																																																			NT5M	-	-	ENSG00000205309		0.607	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5M	HGNC	protein_coding	OTTHUMT00000446045.1	45	0.00	0	G			17248229	17248229	+1	no_errors	ENST00000582909	ensembl	human	putative	69_37n	rna	21	36.36	12	SNP	0.937	A
NUP93	9688	genome.wustl.edu	37	16	56782199	56782199	+	Missense_Mutation	SNP	G	G	A	rs528073782		TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:56782199G>A	ENST00000308159.5	+	2	161	c.40G>A	c.(40-42)Gaa>Aaa	p.E14K	NUP93_ENST00000569842.1_Missense_Mutation_p.E14K	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	14					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)	p.E14K(3)		breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						TCAGCAAGCTGAACAGCTTGC	0.517																																					Colon(33;610 796 1305 1705 38917)	dbGAP											3	Substitution - Missense(3)	breast(2)|upper_aerodigestive_tract(1)											67.0	65.0	66.0					16																	56782199		2198	4300	6498	-	-	-	SO:0001583	missense	0			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.40G>A	16.37:g.56782199G>A	ENSP00000310668:p.Glu14Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPQ8|Q14705	Missense_Mutation	SNP	pfam_Nucleoporin_int_Nup93/Nic96	p.E14K	ENST00000308159.5	37	c.40	CCDS10769.1	16	.	.	.	.	.	.	.	.	.	.	G	23.5	4.428130	0.83667	.	.	ENSG00000102900	ENST00000308159	T	0.44083	0.93	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	T	0.37812	0.1017	L	0.39898	1.24	0.80722	D	1	B	0.15473	0.013	B	0.15484	0.013	T	0.22208	-1.0223	10	0.12103	T	0.63	-21.6196	20.8598	0.99761	0.0:0.0:1.0:0.0	.	14	Q8N1F7	NUP93_HUMAN	K	14	ENSP00000310668:E14K	ENSP00000310668:E14K	E	+	1	0	NUP93	55339700	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.685000	0.98661	2.937000	0.99478	0.650000	0.86243	GAA	NUP93	-	NULL	ENSG00000102900		0.517	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP93	HGNC	protein_coding	OTTHUMT00000257058.4	30	0.00	0	G	NM_014669		56782199	56782199	+1	no_errors	ENST00000308159	ensembl	human	known	69_37n	missense	21	16.00	4	SNP	1.000	A
OR51S1	119692	genome.wustl.edu	37	11	4869758	4869758	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr11:4869758C>T	ENST00000322101.2	-	1	756	c.681G>A	c.(679-681)ctG>ctA	p.L227L	MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron	NM_001004758.1	NP_001004758.1	Q8NGJ8	O51S1_HUMAN	olfactory receptor, family 51, subfamily S, member 1	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(15)|ovary(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;5.06e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00438)|LUSC - Lung squamous cell carcinoma(625;0.19)		CCTTGCCAATCAGGCCATAGG	0.542																																						dbGAP											0													74.0	73.0	73.0					11																	4869758		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			AB065796	CCDS31362.1	11p15.4	2012-08-09			ENSG00000176922	ENSG00000176922		"""GPCR / Class A : Olfactory receptors"""	15204	protein-coding gene	gene with protein product							Standard	NM_001004758		Approved		uc010qyo.2	Q8NGJ8	OTTHUMG00000066506	ENST00000322101.2:c.681G>A	11.37:g.4869758C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGZ1|Q6IFI2	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L227	ENST00000322101.2	37	c.681	CCDS31362.1	11																																																																																			OR51S1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176922		0.542	OR51S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51S1	HGNC	protein_coding	OTTHUMT00000142179.1	42	0.00	0	C	NM_001004758		4869758	4869758	-1	no_errors	ENST00000322101	ensembl	human	known	69_37n	silent	19	17.39	4	SNP	0.003	T
PIP5K1A	8394	genome.wustl.edu	37	1	151219428	151219428	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:151219428C>T	ENST00000368888.4	+	15	2095	c.1673C>T	c.(1672-1674)tCa>tTa	p.S558L	PIP5K1A_ENST00000441902.2_Missense_Mutation_p.S518L|PIP5K1A_ENST00000414290.2_Nonsense_Mutation_p.Q167*|PIP5K1A_ENST00000368890.4_Missense_Mutation_p.S496L|PIP5K1A_ENST00000409426.1_Missense_Mutation_p.S546L	NM_001135638.1	NP_001129110.1	Q99755	PI51A_HUMAN	phosphatidylinositol-4-phosphate 5-kinase, type I, alpha	558					actin cytoskeleton reorganization (GO:0031532)|activation of Rac GTPase activity (GO:0032863)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|fibroblast migration (GO:0010761)|focal adhesion assembly (GO:0048041)|glycerophospholipid metabolic process (GO:0006650)|keratinocyte differentiation (GO:0030216)|phagocytosis (GO:0006909)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid biosynthetic process (GO:0008654)|phospholipid metabolic process (GO:0006644)|protein targeting to plasma membrane (GO:0072661)|ruffle assembly (GO:0097178)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|kinase binding (GO:0019900)			breast(1)|central_nervous_system(1)|ovary(1)|skin(1)|stomach(1)	5	Lung SC(34;0.00471)|Ovarian(49;0.0147)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.181)			GTTGCAGAGTCAGAGTTCACC	0.418																																					Pancreas(80;36 1443 2325 16095 21302)	dbGAP											0													169.0	159.0	163.0					1																	151219428		2203	4300	6503	-	-	-	SO:0001583	missense	0			U78575	CCDS990.1, CCDS44219.1, CCDS44220.1, CCDS44221.1	1q21.3	2010-04-08			ENSG00000143398	ENSG00000143398			8994	protein-coding gene	gene with protein product		603275				8955136, 10828584	Standard	NM_003557		Approved		uc001exj.3	Q99755	OTTHUMG00000012351	ENST00000368888.4:c.1673C>T	1.37:g.151219428C>T	ENSP00000357883:p.Ser558Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Q0|B4DIN0|Q99754|Q99756	Nonsense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.Q167*	ENST00000368888.4	37	c.499	CCDS44219.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.15|19.15	3.770827|3.770827	0.69992|0.69992	.|.	.|.	ENSG00000143398|ENSG00000143398	ENST00000414290|ENST00000349792;ENST00000409426;ENST00000441902;ENST00000368890;ENST00000368888	.|T;T;T;T;T	.|0.35789	.|1.66;1.66;1.38;1.29;1.66	4.83|4.83	4.83|4.83	0.62350|0.62350	.|.	.|44.810200	.|0.00664	.|U	.|0.000615	.|T	.|0.30479	.|0.0766	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|B;B;B;B	.|0.30281	.|0.0;0.275;0.0;0.275	.|B;B;B;B	.|0.36289	.|0.001;0.112;0.001;0.221	.|T	.|0.16808	.|-1.0390	.|10	0.05525|0.72032	T|D	0.97|0.01	.|.	13.2961|13.2961	0.60298|0.60298	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|518;496;558;545	.|Q99755-4;Q99755-2;Q99755;Q99755-3	.|.;.;PI51A_HUMAN;.	X|L	167|545;546;518;496;558	.|ENSP00000271663:S545L;ENSP00000386432:S546L;ENSP00000415648:S518L;ENSP00000357885:S496L;ENSP00000357883:S558L	ENSP00000388800:Q167X|ENSP00000271663:S545L	Q|S	+|+	1|2	0|0	PIP5K1A|PIP5K1A	149486052|149486052	0.985000|0.985000	0.35326|0.35326	0.870000|0.870000	0.34147|0.34147	0.993000|0.993000	0.82548|0.82548	1.235000|1.235000	0.32671|0.32671	2.505000|2.505000	0.84491|0.84491	0.563000|0.563000	0.77884|0.77884	CAG|TCA	PIP5K1A	-	NULL	ENSG00000143398		0.418	PIP5K1A-003	KNOWN	basic|CCDS	protein_coding	PIP5K1A	HGNC	protein_coding	OTTHUMT00000034425.2	163	0.00	0	C	NM_003557		151219428	151219428	+1	no_errors	ENST00000414290	ensembl	human	known	69_37n	nonsense	126	32.62	61	SNP	0.994	T
POLG	5428	genome.wustl.edu	37	15	89872184	89872184	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr15:89872184C>T	ENST00000268124.5	-	4	1346	c.1013G>A	c.(1012-1014)aGa>aAa	p.R338K	POLG_ENST00000442287.2_Missense_Mutation_p.R338K	NM_001126131.1|NM_002693.2	NP_001119603.1|NP_002684.1	P54098	DPOG1_HUMAN	polymerase (DNA directed), gamma	338					aging (GO:0007568)|base-excision repair, gap-filling (GO:0006287)|cell death (GO:0008219)|DNA metabolic process (GO:0006259)|DNA-dependent DNA replication (GO:0006261)|mitochondrial DNA replication (GO:0006264)	extracellular vesicular exosome (GO:0070062)|gamma DNA polymerase complex (GO:0005760)|mitochondrial inner membrane (GO:0005743)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|exonuclease activity (GO:0004527)|protease binding (GO:0002020)			breast(2)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(3)|urinary_tract(2)	33	Lung NSC(78;0.0472)|all_lung(78;0.089)		STAD - Stomach adenocarcinoma(125;0.165)			CGCTGGGCCTCTTCTGGCTTT	0.632								DNA polymerases (catalytic subunits)																													Colon(73;648 1203 11348 18386 27782)	dbGAP											0													80.0	71.0	74.0					15																	89872184		2200	4299	6499	-	-	-	SO:0001583	missense	0			X98093	CCDS10350.1	15q24	2014-09-17			ENSG00000140521	ENSG00000140521		"""DNA polymerases"""	9179	protein-coding gene	gene with protein product		174763				9465903	Standard	NM_002693		Approved	POLG1, POLGA	uc002bnr.4	P54098	OTTHUMG00000149646	ENST00000268124.5:c.1013G>A	15.37:g.89872184C>T	ENSP00000268124:p.Arg338Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NFM2|Q92515	Missense_Mutation	SNP	pirsf_DNA-dir_DNA_pol_A_mt_sub,pfam_DNA-dir_DNA_pol_A_palm_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_A_palm_dom,prints_DNA-dir_DNA_pol_A_mt	p.R338K	ENST00000268124.5	37	c.1013	CCDS10350.1	15	.	.	.	.	.	.	.	.	.	.	C	6.695	0.496893	0.12762	.	.	ENSG00000140521	ENST00000268124;ENST00000442287	D;D	0.92446	-3.04;-3.04	6.06	-5.87	0.02297	Ribonuclease H-like (1);	1.717900	0.02651	N	0.106479	T	0.71762	0.3378	N	0.00879	-1.12	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.73874	-0.3845	10	0.06099	T	0.92	4.9828	8.4632	0.32940	0.0:0.197:0.1979:0.6051	.	338	P54098	DPOG1_HUMAN	K	338	ENSP00000268124:R338K;ENSP00000399851:R338K	ENSP00000268124:R338K	R	-	2	0	POLG	87673188	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.094000	0.11094	-0.836000	0.04229	0.655000	0.94253	AGA	POLG	-	pirsf_DNA-dir_DNA_pol_A_mt_sub,superfamily_RNaseH-like_dom	ENSG00000140521		0.632	POLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG	HGNC	protein_coding	OTTHUMT00000312854.2	71	0.00	0	C	NM_002693		89872184	89872184	-1	no_errors	ENST00000268124	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	0.001	T
PREB	10113	genome.wustl.edu	37	2	27355593	27355593	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr2:27355593C>T	ENST00000260643.2	-	5	883	c.630G>A	c.(628-630)ttG>ttA	p.L210L	PREB_ENST00000416802.1_5'Flank|PREB_ENST00000406567.3_Silent_p.L210L	NM_013388.4	NP_037520.1	Q9HCU5	PREB_HUMAN	prolactin regulatory element binding	210					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER to Golgi vesicle-mediated transport (GO:0006888)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|protein transport (GO:0015031)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCACGGTTACCAACTAGTTAG	0.527																																						dbGAP											0													88.0	89.0	88.0					2																	27355593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1738.1	2p23	2013-01-10			ENSG00000138073	ENSG00000138073		"""WD repeat domain containing"""	9356	protein-coding gene	gene with protein product		606395				10194769, 12735795	Standard	NM_013388		Approved	SEC12	uc002rix.1	Q9HCU5	OTTHUMG00000097076	ENST00000260643.2:c.630G>A	2.37:g.27355593C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SZ8|Q9UH94	Silent	SNP	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L210	ENST00000260643.2	37	c.630	CCDS1738.1	2																																																																																			PREB	-	pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000138073		0.527	PREB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREB	HGNC	protein_coding	OTTHUMT00000214195.1	61	0.00	0	C	NM_013388		27355593	27355593	-1	no_errors	ENST00000260643	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	1.000	T
RAD51C	5889	genome.wustl.edu	37	17	56770065	56770065	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr17:56770065C>T	ENST00000337432.4	+	1	132	c.61C>T	c.(61-63)Cca>Tca	p.P21S	TEX14_ENST00000349033.5_5'Flank|TEX14_ENST00000240361.8_5'Flank|TEX14_ENST00000389934.3_5'Flank|RAD51C_ENST00000421782.2_Missense_Mutation_p.P21S|RAD51C_ENST00000487921.1_Intron|RAD51C_ENST00000583539.1_Missense_Mutation_p.P21S	NM_058216.1	NP_478123.1	O43502	RA51C_HUMAN	RAD51 paralog C	21	Required for Holliday junction resolution activity.				blood coagulation (GO:0007596)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|female meiosis sister chromatid cohesion (GO:0007066)|male meiosis I (GO:0007141)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|reciprocal meiotic recombination (GO:0007131)|sister chromatid cohesion (GO:0007062)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Rad51B-Rad51C-Rad51D-XRCC2 complex (GO:0033063)|Rad51C-XRCC3 complex (GO:0033065)|replication fork (GO:0005657)	ATP binding (GO:0005524)|crossover junction endodeoxyribonuclease activity (GO:0008821)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)			upper_aerodigestive_tract(1)	1	Medulloblastoma(34;0.127)|all_neural(34;0.237)					CCCGCTGTCTCCAGCGGTGCG	0.592								Homologous recombination	Hereditary Breast-Ovarian Cancer, non-BRCA1/2																													dbGAP											0													83.0	81.0	82.0					17																	56770065		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BRCAX	AF029670	CCDS11611.1, CCDS45745.1	17q25.1	2014-09-17	2013-07-02		ENSG00000108384	ENSG00000108384		"""Fanconi anemia, complementation groups"""	9820	protein-coding gene	gene with protein product		602774	"""RAD51 (S. cerevisiae) homolog C"", ""RAD51 homolog C (S. cerevisiae)"""			9469824, 22167183	Standard	NM_058216		Approved	RAD51L2, FANCO	uc002iwu.3	O43502	OTTHUMG00000141292	ENST00000337432.4:c.61C>T	17.37:g.56770065C>T	ENSP00000336701:p.Pro21Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O43503|Q3B783	Missense_Mutation	SNP	pfam_DNA_recomb/repair_Rad51_C,pfam_Circ_KaiC/RadA,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,pirsf_DNA_recomb/repair_RecA-like,pfscan_DNA_recomb_RecA/RadB_ATP-bd	p.P21S	ENST00000337432.4	37	c.61	CCDS11611.1	17	.	.	.	.	.	.	.	.	.	.	C	13.73	2.325778	0.41197	.	.	ENSG00000108384	ENST00000337432;ENST00000421782	T;T	0.42513	0.97;1.14	5.75	0.281	0.15687	.	0.312186	0.34676	N	0.003779	T	0.34019	0.0883	M	0.77820	2.39	0.41741	D	0.989611	P;B;B	0.36162	0.54;0.054;0.021	B;B;B	0.32762	0.152;0.043;0.056	T	0.05566	-1.0877	10	0.35671	T	0.21	-8.1593	3.2236	0.06724	0.1227:0.5567:0.1186:0.202	.	12;21;21	B4E0G0;O43502;O43503	.;RA51C_HUMAN;.	S	21	ENSP00000336701:P21S;ENSP00000391450:P21S	ENSP00000336701:P21S	P	+	1	0	RAD51C	54125064	0.972000	0.33761	0.012000	0.15200	0.931000	0.56810	3.491000	0.53252	-0.123000	0.11745	-0.244000	0.11960	CCA	RAD51C	-	superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,pirsf_DNA_recomb/repair_RecA-like	ENSG00000108384		0.592	RAD51C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAD51C	HGNC	protein_coding	OTTHUMT00000280540.2	59	0.00	0	C	NM_058216		56770065	56770065	+1	no_errors	ENST00000337432	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.870	T
RAPGEF1	2889	genome.wustl.edu	37	9	134504605	134504605	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr9:134504605C>G	ENST00000372189.3	-	7	849	c.726G>C	c.(724-726)gaG>gaC	p.E242D	RAPGEF1_ENST00000372195.1_Missense_Mutation_p.E259D|RAPGEF1_ENST00000481260.1_5'UTR|RAPGEF1_ENST00000372190.3_Missense_Mutation_p.E260D	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	242					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		TGTTTAGGATCTCTACCTCGC	0.587																																						dbGAP											0													110.0	115.0	114.0					9																	134504605		1970	4147	6117	-	-	-	SO:0001583	missense	0			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.726G>C	9.37:g.134504605C>G	ENSP00000361263:p.Glu242Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUE4|Q8IV73	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.E260D	ENST00000372189.3	37	c.780	CCDS48047.1	9	.	.	.	.	.	.	.	.	.	.	C	12.24	1.878694	0.33162	.	.	ENSG00000107263	ENST00000266110;ENST00000372195;ENST00000429421;ENST00000372189;ENST00000372190;ENST00000411834;ENST00000337036;ENST00000357686	T;T;T	0.43688	0.94;0.94;0.94	5.56	4.66	0.58398	.	0.157972	0.56097	D	0.000028	T	0.36580	0.0972	L	0.37750	1.13	0.33896	D	0.63791	P;P;P	0.43750	0.72;0.72;0.816	B;B;P	0.45099	0.278;0.278;0.469	T	0.41893	-0.9483	10	0.15952	T	0.53	.	12.7345	0.57216	0.0:0.8569:0.0:0.143	.	259;242;260	Q68DL3;Q13905;Q13905-3	.;RPGF1_HUMAN;.	D	242;259;136;242;260;222;168;259	ENSP00000361269:E259D;ENSP00000361263:E242D;ENSP00000361264:E260D	ENSP00000266110:E242D	E	-	3	2	RAPGEF1	133494426	0.996000	0.38824	1.000000	0.80357	0.181000	0.23173	0.389000	0.20751	0.719000	0.32188	-0.797000	0.03246	GAG	RAPGEF1	-	NULL	ENSG00000107263		0.587	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	HGNC	protein_coding	OTTHUMT00000054759.2	78	0.00	0	C	NM_005312		134504605	134504605	-1	no_errors	ENST00000372190	ensembl	human	known	69_37n	missense	61	12.86	9	SNP	1.000	G
RBBP6	5930	genome.wustl.edu	37	16	24578496	24578496	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:24578496G>C	ENST00000319715.4	+	15	2054	c.1622G>C	c.(1621-1623)aGa>aCa	p.R541T	RBBP6_ENST00000381039.3_Intron|RBBP6_ENST00000348022.2_Missense_Mutation_p.R541T	NM_006910.4	NP_008841.2	Q7Z6E9	RBBP6_HUMAN	retinoblastoma binding protein 6	541					embryonic organ development (GO:0048568)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|somite development (GO:0061053)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(4)|pancreas(1)|prostate(2)|urinary_tract(1)	46				GBM - Glioblastoma multiforme(48;0.0518)		CACAGCGAAAGATCACAGAGG	0.458																																						dbGAP											0													150.0	140.0	144.0					16																	24578496		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10621.1, CCDS10622.1, CCDS45444.1	16p12.2	2008-08-04	2001-11-28		ENSG00000122257	ENSG00000122257			9889	protein-coding gene	gene with protein product	"""proliferation potential-related protein"""	600938	"""retinoblastoma-binding protein 6"""			8595913, 16396680	Standard	NM_006910		Approved	P2P-R, PACT, SNAMA	uc002dmh.3	Q7Z6E9	OTTHUMG00000096991	ENST00000319715.4:c.1622G>C	16.37:g.24578496G>C	ENSP00000317872:p.Arg541Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q147T5|Q15290|Q6DKH4|Q6P4C2|Q6YNC9|Q7Z6E8|Q8N0V2|Q96PH3|Q9H3I8|Q9H5M5|Q9NPX4	Missense_Mutation	SNP	pfam_DWNN_domain,pfam_Ubox_domain,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_CCHC,smart_Znf_RING,pfscan_Znf_RING,pfscan_Znf_CCHC	p.R541T	ENST00000319715.4	37	c.1622	CCDS10621.1	16	.	.	.	.	.	.	.	.	.	.	G	15.79	2.936330	0.52972	.	.	ENSG00000122257	ENST00000319715;ENST00000348022	T;T	0.21031	2.03;2.26	5.8	5.8	0.92144	.	0.000000	0.56097	D	0.000030	T	0.39489	0.1080	L	0.32530	0.975	0.46437	D	0.999048	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.991	T	0.08493	-1.0719	10	0.59425	D	0.04	-27.985	20.0522	0.97631	0.0:0.0:1.0:0.0	.	541;541	Q7Z6E9-2;Q7Z6E9	.;RBBP6_HUMAN	T	541	ENSP00000317872:R541T;ENSP00000316291:R541T	ENSP00000317872:R541T	R	+	2	0	RBBP6	24485997	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.497000	0.73674	2.737000	0.93849	0.563000	0.77884	AGA	RBBP6	-	NULL	ENSG00000122257		0.458	RBBP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBBP6	HGNC	protein_coding	OTTHUMT00000214067.2	73	0.00	0	G	NM_006910		24578496	24578496	+1	no_errors	ENST00000319715	ensembl	human	known	69_37n	missense	42	34.38	22	SNP	1.000	C
RPS6KC1	26750	genome.wustl.edu	37	1	213303216	213303216	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:213303216C>T	ENST00000366960.3	+	6	969	c.819C>T	c.(817-819)ctC>ctT	p.L273L	RPS6KC1_ENST00000366959.3_Silent_p.L261L|RPS6KC1_ENST00000543354.1_Intron|RPS6KC1_ENST00000490299.1_3'UTR|RPS6KC1_ENST00000543470.1_Silent_p.L92L	NM_012424.3	NP_036556.2	Q96S38	KS6C1_HUMAN	ribosomal protein S6 kinase, 52kDa, polypeptide 1	273					signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)	ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(6)|kidney(4)|large_intestine(8)|liver(2)|lung(15)|ovary(3)|prostate(1)|urinary_tract(3)	43				OV - Ovarian serous cystadenocarcinoma(81;0.00705)|all cancers(67;0.016)|GBM - Glioblastoma multiforme(131;0.0663)|Epithelial(68;0.145)		TTGATTTACTCCTAGAAGGTG	0.338																																						dbGAP											0													65.0	65.0	65.0					1																	213303216		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AF037447	CCDS1513.1, CCDS44317.1, CCDS73028.1, CCDS73029.1, CCDS73030.1	1q41	2011-04-05	2002-08-29		ENSG00000136643	ENSG00000136643			10439	protein-coding gene	gene with protein product			"""ribosomal protein S6 kinase, 52kD, polypeptide 1"""			10552933	Standard	XM_005273095		Approved	humS6PKh1	uc010ptr.2	Q96S38	OTTHUMG00000036926	ENST00000366960.3:c.819C>T	1.37:g.213303216C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1APS8|B3KVM4|D3DTA4|Q8TDD3|Q9NSF4|Q9UL66	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_MIT,pfam_Phox,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Phox,smart_Phox,smart_MIT,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Phox,pfscan_Prot_kinase_cat_dom	p.L273	ENST00000366960.3	37	c.819	CCDS1513.1	1																																																																																			RPS6KC1	-	pfam_MIT,smart_MIT	ENSG00000136643		0.338	RPS6KC1-001	KNOWN	basic|CCDS	protein_coding	RPS6KC1	HGNC	protein_coding	OTTHUMT00000089690.3	48	0.00	0	C	NM_012424		213303216	213303216	+1	no_errors	ENST00000366960	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	0.999	T
RYR3	6263	genome.wustl.edu	37	15	33833010	33833010	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr15:33833010G>A	ENST00000389232.4	+	7	635	c.565G>A	c.(565-567)Ggt>Agt	p.G189S	RYR3_ENST00000415757.3_Missense_Mutation_p.G189S	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	189	MIR 2. {ECO:0000255|PROSITE- ProRule:PRU00131}.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		AGTATCAAATGGTAACATACA	0.428																																						dbGAP											0													117.0	114.0	115.0					15																	33833010		1996	4179	6175	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.565G>A	15.37:g.33833010G>A	ENSP00000373884:p.Gly189Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.G189S	ENST00000389232.4	37	c.565	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	26.5	4.739704	0.89573	.	.	ENSG00000198838	ENST00000389232;ENST00000415757;ENST00000361728	D;D	0.98249	-4.82;-4.82	5.8	5.8	0.92144	Inositol 1,4,5-trisphosphate/ryanodine receptor (1);MIR motif (2);	0.060290	0.64402	D	0.000003	D	0.96586	0.8886	L	0.45051	1.395	0.58432	D	0.999996	B;P	0.34462	0.312;0.454	B;B	0.34931	0.103;0.192	D	0.95477	0.8557	10	0.32370	T	0.25	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	189;189	Q15413-2;Q15413	.;RYR3_HUMAN	S	189	ENSP00000373884:G189S;ENSP00000399610:G189S	ENSP00000354735:G189S	G	+	1	0	RYR3	31620302	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.858000	0.86971	2.748000	0.94277	0.655000	0.94253	GGT	RYR3	-	pfam_Ins145_P3_rcpt,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	ENSG00000198838		0.428	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	47	0.00	0	G			33833010	33833010	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	39	18.75	9	SNP	1.000	A
ZBED9	114821	genome.wustl.edu	37	6	28542837	28542837	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr6:28542837C>G	ENST00000452236.2	-	3	2262	c.1645G>C	c.(1645-1647)Gaa>Caa	p.E549Q	SCAND3_ENST00000530247.1_5'Flank	NM_052923.1	NP_443155.1														NS(3)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(14)|liver(1)|lung(29)|ovary(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)	71						TGATCTAATTCATTTTCTGTA	0.393																																						dbGAP											0													99.0	98.0	98.0					6																	28542837		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000452236.2:c.1645G>C	6.37:g.28542837C>G	ENSP00000395259:p.Glu549Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Integrase_cat-core,pfam_HATC,superfamily_Retrov_capsid_C,superfamily_RNaseH-like_dom,smart_Tscrpt_reg_SCAN,pfscan_Integrase_cat-core,pfscan_Tscrpt_reg_SCAN	p.E549Q	ENST00000452236.2	37	c.1645	CCDS34355.1	6	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089405	0.55968	.	.	ENSG00000232040	ENST00000452236	T	0.01484	4.84	2.88	2.88	0.33553	.	.	.	.	.	T	0.02727	0.0082	L	0.49350	1.555	0.23144	N	0.998227	D	0.57571	0.98	D	0.70227	0.968	T	0.46541	-0.9184	9	0.54805	T	0.06	.	9.443	0.38679	0.0:1.0:0.0:0.0	.	549	Q6R2W3	SCND3_HUMAN	Q	549	ENSP00000395259:E549Q	ENSP00000395259:E549Q	E	-	1	0	SCAND3	28650816	0.009000	0.17119	0.999000	0.59377	0.970000	0.65996	0.610000	0.24253	1.913000	0.55393	0.563000	0.77884	GAA	SCAND3	-	NULL	ENSG00000232040		0.393	SCAND3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SCAND3	HGNC	protein_coding	OTTHUMT00000043551.3	86	0.00	0	C			28542837	28542837	-1	no_errors	ENST00000452236	ensembl	human	known	69_37n	missense	38	19.15	9	SNP	1.000	G
SLC38A5	92745	genome.wustl.edu	37	X	48326103	48326103	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chrX:48326103G>C	ENST00000376876.3	-	3	966	c.123C>G	c.(121-123)ttC>ttG	p.F41L	SLC38A5_ENST00000376875.1_5'Flank|SLC38A5_ENST00000317669.5_Missense_Mutation_p.F41L			Q8WUX1	S38A5_HUMAN	solute carrier family 38, member 5	41					amino acid transport (GO:0006865)|ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	glycine transmembrane transporter activity (GO:0015187)			breast(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(3)|skin(1)	19						TCACATCCATGAACTGGACCG	0.612											OREG0019763	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													51.0	38.0	43.0					X																	48326103		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF276889	CCDS14293.1	Xp11.23	2013-05-22			ENSG00000017483	ENSG00000017483		"""Solute carriers"""	18070	protein-coding gene	gene with protein product		300649				11243884	Standard	NM_033518		Approved	SN2, JM24	uc010nid.3	Q8WUX1	OTTHUMG00000024117	ENST00000376876.3:c.123C>G	X.37:g.48326103G>C	ENSP00000366073:p.Phe41Leu	Somatic	953	WXS	Illumina GAIIx	Phase_IV	B3KT20|B5MDE6|B7WPJ9|Q6PIW9|Q8WYU2|Q96PQ4	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.F41L	ENST00000376876.3	37	c.123	CCDS14293.1	X	.	.	.	.	.	.	.	.	.	.	g	17.62	3.434662	0.62955	.	.	ENSG00000017483	ENST00000376876;ENST00000317669;ENST00000440085;ENST00000441948;ENST00000413668;ENST00000416711;ENST00000429543	T;T;T;T;T;T;T	0.47177	3.08;3.08;1.48;1.48;1.51;1.48;0.85	4.46	2.63	0.31362	.	0.343847	0.33691	N	0.004645	T	0.36991	0.0987	M	0.65498	2.005	0.19775	N	0.999952	P	0.37548	0.599	B	0.35607	0.206	T	0.23154	-1.0196	10	0.10902	T	0.67	.	5.5685	0.17184	0.1161:0.1971:0.6868:0.0	.	41	Q8WUX1	S38A5_HUMAN	L	41	ENSP00000366073:F41L;ENSP00000313740:F41L;ENSP00000402988:F41L;ENSP00000407258:F41L;ENSP00000403976:F41L;ENSP00000389644:F41L;ENSP00000416948:F41L	ENSP00000313740:F41L	F	-	3	2	SLC38A5	48211047	1.000000	0.71417	0.340000	0.25575	0.921000	0.55340	2.430000	0.44766	0.186000	0.20125	0.422000	0.28245	TTC	SLC38A5	-	NULL	ENSG00000017483		0.612	SLC38A5-011	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A5	HGNC	protein_coding	OTTHUMT00000060724.1	38	0.00	0	G	NM_033518		48326103	48326103	-1	no_errors	ENST00000317669	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.063	C
SLC4A1	6521	genome.wustl.edu	37	17	42330736	42330736	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr17:42330736C>T	ENST00000262418.6	-	17	2216	c.2061G>A	c.(2059-2061)ctG>ctA	p.L687L		NM_000342.3	NP_000333.1	P02730	B3AT_HUMAN	solute carrier family 4 (anion exchanger), member 1 (Diego blood group)	687	Membrane (anion exchange).		L -> P (in SPH4). {ECO:0000269|PubMed:16227998}.		anion transport (GO:0006820)|bicarbonate transport (GO:0015701)|cellular ion homeostasis (GO:0006873)|chloride transport (GO:0006821)|ion transport (GO:0006811)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cortical cytoskeleton (GO:0030863)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	anion transmembrane transporter activity (GO:0008509)|anion:anion antiporter activity (GO:0015301)|ankyrin binding (GO:0030506)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|inorganic anion exchanger activity (GO:0005452)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|prostate(3)|skin(1)|urinary_tract(1)	40		Breast(137;0.014)|Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.115)		TGCTGACAATCAGCCTACGGT	0.592																																						dbGAP											0													82.0	79.0	80.0					17																	42330736		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11481.1	17q21.31	2014-07-19	2014-01-02		ENSG00000004939	ENSG00000004939		"""CD molecules"", ""Blood group antigens"", ""Solute carriers"""	11027	protein-coding gene	gene with protein product	"""Froese blood group"", ""Swann blood group"", ""Wright blood group"""	109270	"""Waldner blood group"", ""erythrocyte membrane protein band 3"", ""Diego blood group"", ""solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood group)"", ""solute carrier family 4 (anion exchanger), member 1"""	EPB3, AE1, DI, WD		8434259	Standard	NM_000342		Approved	RTA1A, CD233, FR, SW, WR	uc002igf.4	P02730	OTTHUMG00000156843	ENST00000262418.6:c.2061G>A	17.37:g.42330736C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	G4V2I6|P78487|Q1ZZ45|Q4KKW9|Q4VB84|Q9UCY7|Q9UDJ1	Silent	SNP	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Anion_exchange,prints_Anion_exchange_1,tigrfam_HCO3_transpt_euk	p.L687	ENST00000262418.6	37	c.2061	CCDS11481.1	17																																																																																			SLC4A1	-	pfam_HCO3_transpt_C,tigrfam_HCO3_transpt_euk	ENSG00000004939		0.592	SLC4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1	HGNC	protein_coding	OTTHUMT00000346194.1	17	0.00	0	C	NM_000342		42330736	42330736	-1	no_errors	ENST00000262418	ensembl	human	known	69_37n	silent	16	23.81	5	SNP	0.998	T
SLC6A9	6536	genome.wustl.edu	37	1	44476555	44476555	+	Splice_Site	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:44476555C>T	ENST00000360584.2	-	3	441		c.e3-1		SLC6A9_ENST00000492434.2_Splice_Site|SLC6A9_ENST00000372310.3_Splice_Site|SLC6A9_ENST00000537678.1_Intron|SLC6A9_ENST00000475075.2_Intron|SLC6A9_ENST00000372307.3_Splice_Site|SLC6A9_ENST00000357730.2_Splice_Site|SLC6A9_ENST00000372306.3_Splice_Site	NM_201649.3	NP_964012.2	P48067	SC6A9_HUMAN	solute carrier family 6 (neurotransmitter transporter, glycine), member 9						transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glycine:sodium symporter activity (GO:0015375)|neurotransmitter:sodium symporter activity (GO:0005328)			endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|skin(1)|urinary_tract(2)	22	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0511)			Glycine(DB00145)	CAGCACCATTCTGTGGGGACA	0.607																																						dbGAP											0													144.0	122.0	130.0					1																	44476555		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			S70609	CCDS30695.1, CCDS41316.1, CCDS41317.1	1p33	2013-05-22			ENSG00000196517	ENSG00000196517		"""Solute carriers"""	11056	protein-coding gene	gene with protein product		601019				8183239, 7587377	Standard	NM_006934		Approved	GLYT1	uc001cll.4	P48067	OTTHUMG00000008294	ENST00000360584.2:c.250-1G>A	1.37:g.44476555C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDH1|A6NII2|A6NNZ8|Q5TAB8|Q5TAB9|Q5TAC0	Splice_Site	SNP	-	e3-1	ENST00000360584.2	37	c.250-1	CCDS41317.1	1	.	.	.	.	.	.	.	.	.	.	C	23.2	4.388896	0.82902	.	.	ENSG00000196517	ENST00000372306;ENST00000372310;ENST00000360584;ENST00000357730;ENST00000528803;ENST00000466926	.	.	.	5.06	5.06	0.68205	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.3604	0.87348	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC6A9	44249142	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.808000	0.69165	2.623000	0.88846	0.591000	0.81541	.	SLC6A9	-	-	ENSG00000196517		0.607	SLC6A9-001	KNOWN	basic|CCDS	protein_coding	SLC6A9	HGNC	protein_coding	OTTHUMT00000022825.2	70	0.00	0	C	NM_201649	Intron	44476555	44476555	-1	no_errors	ENST00000360584	ensembl	human	known	69_37n	splice_site	33	32.65	16	SNP	1.000	T
SPAG9	9043	genome.wustl.edu	37	17	49083456	49083456	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr17:49083456C>G	ENST00000262013.7	-	11	1622	c.1414G>C	c.(1414-1416)Gag>Cag	p.E472Q	SPAG9_ENST00000510283.1_Missense_Mutation_p.E315Q|SPAG9_ENST00000505279.1_Missense_Mutation_p.E458Q|SPAG9_ENST00000357122.4_Missense_Mutation_p.E458Q	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	472					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TTCCTAAGCTCTTCCTCCAAT	0.438																																						dbGAP											0													254.0	221.0	232.0					17																	49083456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1414G>C	17.37:g.49083456C>G	ENSP00000262013:p.Glu472Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Missense_Mutation	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.E472Q	ENST00000262013.7	37	c.1414	CCDS45740.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551106	0.86127	.	.	ENSG00000008294	ENST00000262013;ENST00000376407;ENST00000357804;ENST00000510283;ENST00000505279;ENST00000357122;ENST00000535445;ENST00000511795	D;D;D;D	0.88664	-2.41;-2.41;-2.41;-2.41	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	D	0.94032	0.8088	M	0.64404	1.975	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.987;0.998;1.0;0.994	D;D;D;D;D;D	0.91635	0.999;0.996;0.944;0.986;0.999;0.918	D	0.93255	0.6638	10	0.56958	D	0.05	-20.334	20.5568	0.99304	0.0:1.0:0.0:0.0	.	458;472;458;472;458;315	O60271-5;O60271-3;O60271-2;O60271;O60271-4;E7ENU2	.;.;.;JIP4_HUMAN;.;.	Q	472;228;214;315;458;458;70;151	ENSP00000262013:E472Q;ENSP00000423165:E315Q;ENSP00000426900:E458Q;ENSP00000349636:E458Q	ENSP00000262013:E472Q	E	-	1	0	SPAG9	46438455	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	7.440000	0.80464	2.861000	0.98227	0.655000	0.94253	GAG	SPAG9	-	NULL	ENSG00000008294		0.438	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	141	0.00	0	C	NM_003971		49083456	49083456	-1	no_errors	ENST00000262013	ensembl	human	known	69_37n	missense	72	17.24	15	SNP	1.000	G
SPAG9	9043	genome.wustl.edu	37	17	49083547	49083547	+	Silent	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr17:49083547C>G	ENST00000262013.7	-	11	1531	c.1323G>C	c.(1321-1323)ctG>ctC	p.L441L	SPAG9_ENST00000510283.1_Silent_p.L284L|SPAG9_ENST00000505279.1_Silent_p.L427L|SPAG9_ENST00000357122.4_Silent_p.L427L	NM_001130528.2	NP_001124000.1	O60271	JIP4_HUMAN	sperm associated antigen 9	441					activation of JUN kinase activity (GO:0007257)|muscle cell differentiation (GO:0042692)|negative regulation of protein homodimerization activity (GO:0090074)|positive regulation of cell migration (GO:0030335)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of neuron differentiation (GO:0045666)|protein homooligomerization (GO:0051260)|retrograde transport, endosome to Golgi (GO:0042147)|spermatogenesis (GO:0007283)|striated muscle cell differentiation (GO:0051146)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				NS(1)|breast(3)|endometrium(3)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)	37			BRCA - Breast invasive adenocarcinoma(22;4.24e-07)			TCTCACAGGTCAGTTCATCCA	0.378																																						dbGAP											0													206.0	182.0	191.0					17																	49083547		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB011088	CCDS11577.1, CCDS45740.1, CCDS58577.1, CCDS58578.1	17q21.33	2013-09-23			ENSG00000008294	ENSG00000008294			14524	protein-coding gene	gene with protein product	"""sperm surface protein"", ""JNK/SAPK-associated protein"", ""JNK interacting protein"", ""sperm specific protein"", ""c-Jun NH2-terminal kinase-associated leucine zipper protein"", ""Max-binding protein"", ""JNK-associated leucine-zipper protein"", ""HLC-4 protein"", ""lung cancer oncogene 4"", ""proliferation-inducing gene 6"", ""cancer/testis antigen 89"""	605430				9480848, 11106729	Standard	NM_003971		Approved	HSS, SYD1, KIAA0516, MGC14967, MGC74461, MGC117291, JLP, PHET, HLC4, PIG6, FLJ13450, FLJ14006, FLJ26141, FLJ34602, CT89	uc002itc.3	O60271	OTTHUMG00000162316	ENST00000262013.7:c.1323G>C	17.37:g.49083547C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U5|A8MSX0|B4DHH2|O60905|Q3KQU8|Q3MKM7|Q86WC7|Q86WC8|Q8IZX7|Q96II0|Q9H811	Silent	SNP	pfam_JNK/Rab-associated_protein-1_N,superfamily_WD40_repeat_dom	p.L441	ENST00000262013.7	37	c.1323	CCDS45740.1	17																																																																																			SPAG9	-	NULL	ENSG00000008294		0.378	SPAG9-001	KNOWN	basic|CCDS	protein_coding	SPAG9	HGNC	protein_coding	OTTHUMT00000368543.2	140	0.00	0	C	NM_003971		49083547	49083547	-1	no_errors	ENST00000262013	ensembl	human	known	69_37n	silent	98	13.27	15	SNP	1.000	G
SUCO	51430	genome.wustl.edu	37	1	172558069	172558069	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:172558069G>C	ENST00000263688.3	+	18	2047	c.1828G>C	c.(1828-1830)Gag>Cag	p.E610Q	SUCO_ENST00000610051.1_Intron|SUCO_ENST00000367723.4_Missense_Mutation_p.E761Q|SUCO_ENST00000608151.1_Missense_Mutation_p.E762Q	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	610					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											ACCCTGGTTTGAGTCAGAGAC	0.408																																						dbGAP											0													101.0	99.0	100.0					1																	172558069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1828G>C	1.37:g.172558069G>C	ENSP00000263688:p.Glu610Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.E762Q	ENST00000263688.3	37	c.2284	CCDS1303.1	1	.	.	.	.	.	.	.	.	.	.	G	15.57	2.872200	0.51695	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.44	5.44	0.79542	.	0.273612	0.40064	N	0.001186	T	0.48537	0.1505	M	0.64997	1.995	0.49798	D	0.999823	B;B;B	0.31318	0.319;0.083;0.168	B;B;B	0.24006	0.05;0.03;0.03	T	0.54510	-0.8283	9	0.48119	T	0.1	-13.8142	17.8296	0.88677	0.0:0.0:1.0:0.0	.	610;762;610	B4DZJ3;Q5H945;Q9UBS9	.;.;OSPT_HUMAN	Q	762;610	.	ENSP00000263688:E610Q	E	+	1	0	C1orf9	170824692	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.236000	0.78154	2.543000	0.85770	0.557000	0.71058	GAG	SUCO	-	NULL	ENSG00000094975		0.408	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCO	HGNC	protein_coding	OTTHUMT00000084273.1	49	0.00	0	G	NM_016227		172558069	172558069	+1	no_errors	ENST00000367723	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	1.000	C
SRGAP2	23380	genome.wustl.edu	37	1	206611447	206611447	+	Splice_Site	SNP	C	C	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:206611447C>A	ENST00000414007.1	+	12	1347	c.1347C>A	c.(1345-1347)gtC>gtA	p.V449V	SRGAP2_ENST00000419187.2_5'UTR			O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	589	F-BAR domain.				actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					TGGCCTGCGTCAGTAAGTACC	0.498																																						dbGAP											0													65.0	64.0	64.0					1																	206611447		1919	4134	6053	-	-	-	SO:0001630	splice_region_variant	0			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.1348+1C>A	1.37:g.206611447C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_RhoGAP_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.H503N	ENST00000414007.1	37	c.1507		1	.	.	.	.	.	.	.	.	.	.	C	13.12	2.142725	0.37825	.	.	ENSG00000163486	ENST00000295713	.	.	.	6.03	1.01	0.19927	.	.	.	.	.	T	0.40222	0.1108	.	.	.	0.47584	D	0.999466	.	.	.	.	.	.	T	0.46442	-0.9191	3	.	.	.	.	7.2468	0.26127	0.0:0.6394:0.1121:0.2485	.	.	.	.	N	503	.	.	H	+	1	0	SRGAP2	204678070	1.000000	0.71417	0.993000	0.49108	0.960000	0.62799	1.743000	0.38258	-0.052000	0.13311	-0.140000	0.14226	CAC	SRGAP2	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000163486		0.498	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	HGNC	protein_coding		67	0.00	0	C	NM_015326	Silent	206611447	206611447	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000295713	ensembl	human	known	69_37n	missense	26	42.22	19	SNP	1.000	A
SUV420H1	51111	genome.wustl.edu	37	11	67925331	67925331	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr11:67925331C>T	ENST00000304363.4	-	11	2835	c.2482G>A	c.(2482-2484)Gat>Aat	p.D828N		NM_017635.3	NP_060105	Q4FZB7	SV421_HUMAN	suppressor of variegation 4-20 homolog 1 (Drosophila)	828					histone H4-K20 trimethylation (GO:0034773)|muscle organ development (GO:0007517)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)|histone-lysine N-methyltransferase activity (GO:0018024)			NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(9)|lung(15)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						GAGGAGGAATCATCTGTACTT	0.448																																						dbGAP											0													115.0	120.0	119.0					11																	67925331		2200	4294	6494	-	-	-	SO:0001583	missense	0			AL512763	CCDS31623.1, CCDS44660.1	11q13.2	2011-07-01			ENSG00000110066	ENSG00000110066		"""Chromatin-modifying enzymes / K-methyltransferases"""	24283	protein-coding gene	gene with protein product		610881				10810093, 11401438	Standard	NM_016028		Approved	CGI-85, KMT5B	uc001onm.1	Q4FZB7	OTTHUMG00000150484	ENST00000304363.4:c.2482G>A	11.37:g.67925331C>T	ENSP00000305899:p.Asp828Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNX7|Q3SX56|Q4V775|Q6P150|Q96E44|Q9BUL0|Q9H022|Q9H2K3|Q9NXV3|Q9Y393	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	p.D828N	ENST00000304363.4	37	c.2482	CCDS31623.1	11	.	.	.	.	.	.	.	.	.	.	C	14.61	2.587261	0.46110	.	.	ENSG00000110066	ENST00000304363	T	0.49432	0.78	5.71	4.74	0.60224	.	0.639491	0.16346	N	0.218426	T	0.33440	0.0863	N	0.14661	0.345	0.80722	D	1	B	0.27559	0.181	B	0.24155	0.051	T	0.16364	-1.0405	10	0.45353	T	0.12	-2.8716	16.172	0.81825	0.0:0.8669:0.1331:0.0	.	828	Q4FZB7	SV421_HUMAN	N	828	ENSP00000305899:D828N	ENSP00000305899:D828N	D	-	1	0	SUV420H1	67681907	0.620000	0.27068	0.091000	0.20842	0.819000	0.46315	2.675000	0.46875	2.710000	0.92621	0.491000	0.48974	GAT	SUV420H1	-	NULL	ENSG00000110066		0.448	SUV420H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H1	HGNC	protein_coding	OTTHUMT00000318319.1	79	0.00	0	C	NM_017635		67925331	67925331	-1	no_errors	ENST00000304363	ensembl	human	known	69_37n	missense	43	30.65	19	SNP	0.958	T
T	6862	genome.wustl.edu	37	6	166571842	166571842	+	Silent	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr6:166571842G>C	ENST00000296946.2	-	9	1737	c.1269C>G	c.(1267-1269)ctC>ctG	p.L423L	T_ENST00000366871.3_Silent_p.L365L	NM_003181.3	NP_003172.1	O15178	BRAC_HUMAN	T, brachyury homolog (mouse)	423					anterior/posterior axis specification, embryo (GO:0008595)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|canonical Wnt signaling pathway (GO:0060070)|determination of heart left/right asymmetry (GO:0061371)|embryonic skeletal system development (GO:0048706)|heart morphogenesis (GO:0003007)|mesoderm development (GO:0007498)|mesoderm migration involved in gastrulation (GO:0007509)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural plate morphogenesis (GO:0001839)|neural tube closure (GO:0001843)|notochord formation (GO:0014028)|penetration of zona pellucida (GO:0007341)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|signal transduction (GO:0007165)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)			autonomic_ganglia(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	39		Prostate(117;4.48e-07)|Ovarian(120;1.78e-06)|Breast(66;2.54e-06)|Lung SC(201;0.0225)|Esophageal squamous(34;0.0559)		OV - Ovarian serous cystadenocarcinoma(33;1.09e-113)|GBM - Glioblastoma multiforme(31;1.51e-108)|BRCA - Breast invasive adenocarcinoma(81;8.45e-09)|LUAD - Lung adenocarcinoma(999;0.0407)		ATGAGGCTATGAGGCGGCCTT	0.632									Chordoma, Familial Clustering of																													dbGAP											0													123.0	129.0	127.0					6																	166571842		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database		AJ001699	CCDS5290.1, CCDS59045.1	6q27	2011-06-13	2001-11-28		ENSG00000164458	ENSG00000164458		"""T-boxes"""	11515	protein-coding gene	gene with protein product		601397	"""T brachyury (mouse) homolog"""			8963900	Standard	NM_003181		Approved		uc003quu.2	O15178	OTTHUMG00000015991	ENST00000296946.2:c.1269C>G	6.37:g.166571842G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E7ERD6|Q4KMP4	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_Brachyury,prints_TF_T-box	p.L423	ENST00000296946.2	37	c.1269	CCDS5290.1	6																																																																																			T	-	NULL	ENSG00000164458		0.632	T-001	KNOWN	basic|appris_principal|CCDS	protein_coding	T	HGNC	protein_coding	OTTHUMT00000043037.2	54	0.00	0	G	NM_003181		166571842	166571842	-1	no_errors	ENST00000296946	ensembl	human	known	69_37n	silent	33	21.43	9	SNP	0.975	C
TAS2R3	50831	genome.wustl.edu	37	7	141463992	141463992	+	Silent	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr7:141463992C>T	ENST00000247879.2	+	1	96	c.34C>T	c.(34-36)Ctg>Ttg	p.L12L	SSBP1_ENST00000465582.1_Intron	NM_016943.2	NP_058639.1	Q9NYW6	TA2R3_HUMAN	taste receptor, type 2, member 3	12					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|sensory perception of taste (GO:0050909)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(5)	14	Melanoma(164;0.0171)					GTTCCTGATTCTGTCTGGCAC	0.453																																						dbGAP											0													226.0	219.0	221.0					7																	141463992		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF227130	CCDS5867.1	7q31.3-q32	2012-08-22			ENSG00000127362	ENSG00000127362		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14910	protein-coding gene	gene with protein product		604868					Standard	NM_016943		Approved	T2R3	uc003vwp.1	Q9NYW6	OTTHUMG00000157637	ENST00000247879.2:c.34C>T	7.37:g.141463992C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1U2|Q645W2|Q75MV6	Silent	SNP	pfam_TAS2_rcpt	p.L12	ENST00000247879.2	37	c.34	CCDS5867.1	7																																																																																			TAS2R3	-	pfam_TAS2_rcpt	ENSG00000127362		0.453	TAS2R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R3	HGNC	protein_coding	OTTHUMT00000349288.1	110	0.00	0	C			141463992	141463992	+1	no_errors	ENST00000247879	ensembl	human	known	69_37n	silent	51	28.17	20	SNP	0.003	T
TRAFD1	10906	genome.wustl.edu	37	12	112583428	112583428	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr12:112583428G>A	ENST00000257604.5	+	7	1506	c.889G>A	c.(889-891)Gag>Aag	p.E297K	TRAFD1_ENST00000412615.2_Missense_Mutation_p.E297K	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1	297					negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						TGAATTTTGTGAGGAGCTCTA	0.413																																						dbGAP											0													257.0	230.0	239.0					12																	112583428		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.889G>A	12.37:g.112583428G>A	ENSP00000257604:p.Glu297Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L6|B4DI89	Missense_Mutation	SNP	superfamily_TRAF-like	p.E297K	ENST00000257604.5	37	c.889	CCDS9160.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.314817	0.95655	.	.	ENSG00000135148	ENST00000412615;ENST00000257604;ENST00000548277	T;T	0.37752	1.18;1.18	6.08	6.08	0.98989	.	0.213182	0.47093	D	0.000246	T	0.64994	0.2649	M	0.78049	2.395	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.65212	-0.6223	10	0.72032	D	0.01	-27.842	20.2672	0.98462	0.0:0.0:1.0:0.0	.	297	O14545	TRAD1_HUMAN	K	297;297;91	ENSP00000396526:E297K;ENSP00000257604:E297K	ENSP00000257604:E297K	E	+	1	0	TRAFD1	111067811	1.000000	0.71417	1.000000	0.80357	0.783000	0.44284	7.664000	0.83830	2.894000	0.99253	0.591000	0.81541	GAG	TRAFD1	-	NULL	ENSG00000135148		0.413	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAFD1	HGNC	protein_coding	OTTHUMT00000405214.1	150	0.00	0	G	NM_006700		112583428	112583428	+1	no_errors	ENST00000257604	ensembl	human	known	69_37n	missense	127	14.19	21	SNP	1.000	A
TRAPPC9	83696	genome.wustl.edu	37	8	141415752	141415752	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr8:141415752A>T	ENST00000438773.2	-	6	1065	c.932T>A	c.(931-933)aTc>aAc	p.I311N	TRAPPC9_ENST00000389327.3_Missense_Mutation_p.I302N|TRAPPC9_ENST00000389328.4_Missense_Mutation_p.I409N	NM_001160372.1	NP_001153844.1	Q96Q05	TPPC9_HUMAN	trafficking protein particle complex 9	311					cell differentiation (GO:0030154)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)				breast(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(16)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	47						AGCACGTCCGATCTCAGTACT	0.403																																						dbGAP											0													141.0	119.0	127.0					8																	141415752		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC006206	CCDS34946.1, CCDS55278.1	8q24.3	2010-10-22			ENSG00000167632	ENSG00000167632		"""Trafficking protein particle complex"""	30832	protein-coding gene	gene with protein product	"""TRAPP 120 kDa subunit"", ""tularik gene 1"""	611966				11572484	Standard	NM_031466		Approved	IKBKBBP, NIBP, KIAA1882, T1, TRS120, MRT13	uc003yvh.2	Q96Q05	OTTHUMG00000164187	ENST00000438773.2:c.932T>A	8.37:g.141415752A>T	ENSP00000405060:p.Ile311Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VTT3|Q658K7|Q6P149|Q6ZQT3|Q7L5C4|Q86Y21|Q96SL2|Q9BQA2	Missense_Mutation	SNP	pfam_TRAPP_II_complex_Trs120	p.I409N	ENST00000438773.2	37	c.1226	CCDS55278.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	14.04|14.04	2.415392|2.415392	0.42817|0.42817	.|.	.|.	ENSG00000167632|ENSG00000167632	ENST00000520857|ENST00000389328;ENST00000389327;ENST00000438773	.|.	.|.	.|.	5.57|5.57	4.42|4.42	0.53409|0.53409	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62011|0.62011	0.2393|0.2393	L|L	0.49350|0.49350	1.555|1.555	0.53688|0.53688	D|D	0.99997|0.99997	.|P;P;D	.|0.53151	.|0.942;0.931;0.958	.|P;B;P	.|0.57425	.|0.82;0.434;0.538	T|T	0.56697|0.56697	-0.7936|-0.7936	5|9	.|0.20519	.|T	.|0.43	.|.	10.6024|10.6024	0.45375|0.45375	0.9231:0.0:0.0768:0.0|0.9231:0.0:0.0768:0.0	.|.	.|311;302;409	.|Q96Q05;Q96Q05-3;Q96Q05-2	.|TPPC9_HUMAN;.;.	E|N	154|409;302;311	.|.	.|ENSP00000373978:I302N	D|I	-|-	3|2	2|0	TRAPPC9|TRAPPC9	141484934|141484934	1.000000|1.000000	0.71417|0.71417	0.012000|0.012000	0.15200|0.15200	0.137000|0.137000	0.21094|0.21094	8.208000|8.208000	0.89748|0.89748	0.952000|0.952000	0.37798|0.37798	0.460000|0.460000	0.39030|0.39030	GAT|ATC	TRAPPC9	-	NULL	ENSG00000167632		0.403	TRAPPC9-002	PUTATIVE	basic|CCDS	protein_coding	TRAPPC9	HGNC	protein_coding	OTTHUMT00000377749.1	91	0.00	0	A	NM_031466		141415752	141415752	-1	no_errors	ENST00000389328	ensembl	human	known	69_37n	missense	86	18.69	20	SNP	0.987	T
TRIM29	23650	genome.wustl.edu	37	11	119998060	119998060	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr11:119998060G>A	ENST00000341846.5	-	3	1539	c.1118C>T	c.(1117-1119)tCt>tTt	p.S373F	TRIM29_ENST00000541857.1_Missense_Mutation_p.S106F|TRIM29_ENST00000529044.1_Missense_Mutation_p.S112F|TRIM29_ENST00000528870.1_5'Flank	NM_012101.3	NP_036233.2	Q14134	TRI29_HUMAN	tripartite motif containing 29	373					negative regulation of protein localization to nucleus (GO:1900181)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|skin(3)|urinary_tract(1)	30		Breast(109;0.00117)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.37e-06)		AAACAACACAGAGTCGCTGAT	0.532																																						dbGAP											0													92.0	85.0	88.0					11																	119998060		2199	4295	6494	-	-	-	SO:0001583	missense	0			AF230388	CCDS8428.1	11q23.3	2011-04-20	2011-01-25		ENSG00000137699	ENSG00000137699		"""Tripartite motif containing / Tripartite motif containing"""	17274	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM29"", ""ataxia-telangiectasia group D-associated protein"""	610658	"""tripartite motif-containing 29"""			11331580	Standard	NM_012101		Approved	ATDC, FLJ36085	uc001pwz.3	Q14134	OTTHUMG00000140377	ENST00000341846.5:c.1118C>T	11.37:g.119998060G>A	ENSP00000343129:p.Ser373Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AA9|Q9BZY7	Missense_Mutation	SNP	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	p.S373F	ENST00000341846.5	37	c.1118	CCDS8428.1	11	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878465	0.72294	.	.	ENSG00000137699	ENST00000341846;ENST00000541857;ENST00000529044	T	0.39787	1.06	5.14	5.14	0.70334	.	0.101478	0.43579	D	0.000543	T	0.50257	0.1605	N	0.19112	0.55	0.49051	D	0.999748	D;D;D	0.76494	0.997;0.997;0.999	D;D;D	0.78314	0.991;0.991;0.942	T	0.47674	-0.9099	9	.	.	.	.	18.6266	0.91342	0.0:0.0:1.0:0.0	.	106;112;373	B7Z8U9;E9PRL4;Q14134	.;.;TRI29_HUMAN	F	373;106;112	ENSP00000343129:S373F	.	S	-	2	0	TRIM29	119503270	1.000000	0.71417	0.949000	0.38748	0.857000	0.48899	6.483000	0.73617	2.412000	0.81896	0.655000	0.94253	TCT	TRIM29	-	NULL	ENSG00000137699		0.532	TRIM29-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM29	HGNC	protein_coding	OTTHUMT00000277108.2	41	0.00	0	G	NM_012101		119998060	119998060	-1	no_errors	ENST00000341846	ensembl	human	known	69_37n	missense	24	36.84	14	SNP	0.996	A
TRIM9	114088	genome.wustl.edu	37	14	51560947	51560947	+	Silent	SNP	G	G	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr14:51560947G>A	ENST00000298355.3	-	1	1832	c.711C>T	c.(709-711)caC>caT	p.H237H	TRIM9_ENST00000338969.5_Silent_p.H237H|TRIM9_ENST00000360392.4_Silent_p.H237H|RP11-1140I5.1_ENST00000554475.1_RNA	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	237					negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					AGTACATGCTGTGGTTCTCCA	0.632																																						dbGAP											0													115.0	92.0	99.0					14																	51560947		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.711C>T	14.37:g.51560947G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Silent	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.H237	ENST00000298355.3	37	c.711	CCDS9703.1	14																																																																																			TRIM9	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box	ENSG00000100505		0.632	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	47	0.00	0	G	NM_015163		51560947	51560947	-1	no_errors	ENST00000338969	ensembl	human	known	69_37n	silent	27	15.62	5	SNP	1.000	A
TRUB2	26995	genome.wustl.edu	37	9	131073254	131073254	+	Silent	SNP	C	C	A			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr9:131073254C>A	ENST00000372890.4	-	7	915	c.582G>T	c.(580-582)gtG>gtT	p.V194V	TRUB2_ENST00000460320.1_5'UTR|TRUB2_ENST00000546104.1_Silent_p.V138V	NM_015679.1	NP_056494.1	O95900	TRUB2_HUMAN	TruB pseudouridine (psi) synthase family member 2	194					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(2)|large_intestine(2)|lung(3)|ovary(1)	8						TCAGGCCTCTCACGGCCATCT	0.592																																						dbGAP											0													137.0	129.0	132.0					9																	131073254		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001956	CCDS6897.1	9q34.11	2014-01-28	2013-09-02		ENSG00000167112	ENSG00000167112			17170	protein-coding gene	gene with protein product		610727	"""TruB pseudouridine (psi) synthase homolog 2 (E. coli)"""			12736709	Standard	NM_015679		Approved	CLONE24922	uc004buq.1	O95900	OTTHUMG00000020741	ENST00000372890.4:c.582G>T	9.37:g.131073254C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7G5	Silent	SNP	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom	p.V194	ENST00000372890.4	37	c.582	CCDS6897.1	9																																																																																			TRUB2	-	pfam_PsdUridine_synth,superfamily_PsdUridine_synth_cat_dom	ENSG00000167112		0.592	TRUB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRUB2	HGNC	protein_coding	OTTHUMT00000054419.1	48	0.00	0	C	NM_015679		131073254	131073254	-1	no_errors	ENST00000372890	ensembl	human	known	69_37n	silent	37	15.91	7	SNP	0.225	A
UNC13C	440279	genome.wustl.edu	37	15	54306457	54306457	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr15:54306457G>C	ENST00000260323.11	+	1	1357	c.1357G>C	c.(1357-1359)Gat>Cat	p.D453H	UNC13C_ENST00000537900.1_Missense_Mutation_p.D453H|UNC13C_ENST00000545554.1_Missense_Mutation_p.D453H	NM_001080534.1	NP_001074003.1	Q8NB66	UN13C_HUMAN	unc-13 homolog C (C. elegans)	453					exocytosis (GO:0006887)|intracellular signal transduction (GO:0035556)|synaptic transmission (GO:0007268)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)			breast(3)|endometrium(5)|kidney(5)|large_intestine(20)|lung(70)|ovary(6)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(4)|urinary_tract(4)	121				GBM - Glioblastoma multiforme(80;0.0789)|all cancers(107;0.124)		TGATGACAGTGATGAAGATCT	0.428																																						dbGAP											0													116.0	112.0	113.0					15																	54306457		1900	4121	6021	-	-	-	SO:0001583	missense	0			AK091491	CCDS45264.1	15q21.3	2012-10-02			ENSG00000137766	ENSG00000137766			23149	protein-coding gene	gene with protein product		614568					Standard	NM_001080534		Approved	Munc13-3, DKFZp547H074	uc021smr.1	Q8NB66	OTTHUMG00000172542	ENST00000260323.11:c.1357G>C	15.37:g.54306457G>C	ENSP00000260323:p.Asp453His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0P613|Q8ND48|Q96NP3	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.D453H	ENST00000260323.11	37	c.1357	CCDS45264.1	15	.	.	.	.	.	.	.	.	.	.	G	16.51	3.143449	0.57044	.	.	ENSG00000137766	ENST00000260323;ENST00000545554;ENST00000537900	D;D;D	0.82711	-1.64;-1.64;-1.64	5.12	5.12	0.69794	.	.	.	.	.	T	0.80281	0.4594	L	0.27053	0.805	0.58432	D	0.999999	P	0.51449	0.945	P	0.48030	0.564	D	0.83467	0.0057	9	0.87932	D	0	.	17.7181	0.88343	0.0:0.0:1.0:0.0	.	453	Q8NB66	UN13C_HUMAN	H	453	ENSP00000260323:D453H;ENSP00000438156:D453H;ENSP00000442569:D453H	ENSP00000260323:D453H	D	+	1	0	UNC13C	52093749	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.652000	0.98499	2.665000	0.90641	0.655000	0.94253	GAT	UNC13C	-	NULL	ENSG00000137766		0.428	UNC13C-001	KNOWN	basic|CCDS	protein_coding	UNC13C	HGNC	protein_coding	OTTHUMT00000419028.3	32	0.00	0	G	NM_173166		54306457	54306457	+1	no_errors	ENST00000260323	ensembl	human	known	69_37n	missense	26	18.75	6	SNP	1.000	C
VAC14	55697	genome.wustl.edu	37	16	70796903	70796903	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr16:70796903G>T	ENST00000261776.5	-	11	1446	c.1186C>A	c.(1186-1188)Cac>Aac	p.H396N	VAC14-AS1_ENST00000562507.1_RNA|VAC14-AS1_ENST00000398177.1_RNA	NM_018052.3	NP_060522.3	Q08AM6	VAC14_HUMAN	Vac14 homolog (S. cerevisiae)	396					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|regulation of lipid kinase activity (GO:0043550)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|PAS complex (GO:0070772)	receptor activity (GO:0004872)			breast(2)|endometrium(2)|kidney(10)|large_intestine(1)|lung(10)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	33		Ovarian(137;0.0699)				CCGTCGAGGTGAAGGGTCACT	0.577																																						dbGAP											0													110.0	85.0	93.0					16																	70796903		2198	4300	6498	-	-	-	SO:0001583	missense	0			AK056433	CCDS10896.1	16q22.1	2010-03-23	2005-02-09		ENSG00000103043	ENSG00000103043			25507	protein-coding gene	gene with protein product		604632	"""Tax1 (human T-cell leukemia virus type I) binding protein 2"""	TAX1BP2		15542851, 12719380	Standard	NM_018052		Approved	FLJ10305, ArPIKfyve	uc002ezm.3	Q08AM6	OTTHUMG00000137583	ENST00000261776.5:c.1186C>A	16.37:g.70796903G>T	ENSP00000261776:p.His396Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ5|B3KSM8|Q13174|Q6IA12|Q7L4Y1|Q9BW96|Q9H6V6	Missense_Mutation	SNP	pfam_DUF3434,pfam_HEAT,superfamily_ARM-type_fold	p.H396N	ENST00000261776.5	37	c.1186	CCDS10896.1	16	.	.	.	.	.	.	.	.	.	.	G	9.945	1.218524	0.22373	.	.	ENSG00000103043	ENST00000261776	T	0.66099	-0.19	5.68	2.3	0.28687	Armadillo-like helical (1);Armadillo-type fold (1);	0.177609	0.64402	N	0.000013	T	0.30135	0.0755	N	0.02181	-0.65	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03597	-1.1021	10	0.25106	T	0.35	-16.5547	8.0426	0.30529	0.0:0.119:0.3371:0.5439	.	396	Q08AM6	VAC14_HUMAN	N	396	ENSP00000261776:H396N	ENSP00000261776:H396N	H	-	1	0	VAC14	69354404	1.000000	0.71417	0.991000	0.47740	0.888000	0.51559	3.267000	0.51577	0.695000	0.31675	0.563000	0.77884	CAC	VAC14	-	superfamily_ARM-type_fold	ENSG00000103043		0.577	VAC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAC14	HGNC	protein_coding	OTTHUMT00000268973.3	32	0.00	0	G	NM_018052		70796903	70796903	-1	no_errors	ENST00000261776	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	0.999	T
ZCCHC6	79670	genome.wustl.edu	37	9	88967818	88967818	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr9:88967818C>G	ENST00000375963.3	-	2	469	c.297G>C	c.(295-297)aaG>aaC	p.K99N	ZCCHC6_ENST00000375947.1_5'Flank|ZCCHC6_ENST00000375960.2_Missense_Mutation_p.K99N|ZCCHC6_ENST00000375961.2_Missense_Mutation_p.K99N|ZCCHC6_ENST00000277141.6_5'UTR	NM_001185059.1|NM_024617.3	NP_001171988.1|NP_078893.2	Q5VYS8	TUT7_HUMAN	zinc finger, CCHC domain containing 6	99					RNA 3'-end processing (GO:0031123)		poly(A) RNA binding (GO:0044822)|RNA uridylyltransferase activity (GO:0050265)|zinc ion binding (GO:0008270)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	46						ACAGCCATCTCTTACTCTGAT	0.413																																						dbGAP											0													195.0	189.0	191.0					9																	88967818		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL832026	CCDS35057.1, CCDS55323.1	9q21	2014-03-05			ENSG00000083223	ENSG00000083223		"""Zinc fingers, CCHC domain containing"""	25817	protein-coding gene	gene with protein product	"""TUTase7"""					11214970	Standard	NM_001185059		Approved	KIAA1711, FLJ13409, PAPD6, TUT7	uc004aoq.3	Q5VYS8	OTTHUMG00000020137	ENST00000375963.3:c.297G>C	9.37:g.88967818C>G	ENSP00000365130:p.Lys99Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9T0|Q5VYS5|Q5VYS7|Q658Z9|Q659A2|Q6MZJ3|Q8N5F0|Q96N57|Q96NE8|Q9C0F2|Q9H8M6	Missense_Mutation	SNP	pfam_PAP_assoc,pfam_Znf_CCHC,superfamily_Znf_CCHC,smart_Znf_U1,smart_Znf_CCHC,pfscan_Znf_CCHC	p.K99N	ENST00000375963.3	37	c.297	CCDS35057.1	9	.	.	.	.	.	.	.	.	.	.	C	17.37	3.372973	0.61624	.	.	ENSG00000083223	ENST00000375960;ENST00000375961;ENST00000375963	T;T;T	0.57595	0.39;0.4;0.44	4.88	2.0	0.26442	.	0.000000	0.64402	D	0.000001	T	0.57636	0.2067	L	0.29908	0.895	0.37233	D	0.905775	D;D;D;D;P	0.89917	0.992;0.992;0.977;1.0;0.906	P;P;P;D;P	0.87578	0.856;0.856;0.787;0.998;0.521	T	0.62124	-0.6920	10	0.87932	D	0	-6.5086	10.6395	0.45584	0.0:0.7946:0.0:0.2054	.	99;99;99;99;99	Q5VYS8-3;Q5VYS8-5;Q5VYS8-2;Q5VYS8-4;Q5VYS8	.;.;.;.;TUT7_HUMAN	N	99	ENSP00000365127:K99N;ENSP00000365128:K99N;ENSP00000365130:K99N	ENSP00000365127:K99N	K	-	3	2	ZCCHC6	88157638	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	2.445000	0.44899	0.246000	0.21394	0.591000	0.81541	AAG	ZCCHC6	-	NULL	ENSG00000083223		0.413	ZCCHC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC6	HGNC	protein_coding	OTTHUMT00000052918.1	124	0.00	0	C	NM_024617		88967818	88967818	-1	no_errors	ENST00000375963	ensembl	human	known	69_37n	missense	91	14.15	15	SNP	1.000	G
ZNF148	7707	genome.wustl.edu	37	3	124952376	124952379	+	Frame_Shift_Del	DEL	CTTA	CTTA	-			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	CTTA	CTTA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr3:124952376_124952379delCTTA	ENST00000360647.4	-	9	1676_1679	c.1191_1194delTAAG	c.(1189-1194)agtaagfs	p.SK397fs	ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000468369.1_Intron|ZNF148_ENST00000544464.1_Intron|ZNF148_ENST00000485866.1_Frame_Shift_Del_p.SK397fs|SLC12A8_ENST00000423114.2_Intron|ZNF148_ENST00000492394.1_Frame_Shift_Del_p.SK397fs|ZNF148_ENST00000484491.1_Frame_Shift_Del_p.SK397fs	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	397					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						TCAGACTTCTCTTACTATTAATTT	0.382																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.1191_1194delTAAG	3.37:g.124952376_124952379delCTTA	ENSP00000353863:p.Ser397fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S397fs	ENST00000360647.4	37	c.1194_1191	CCDS3031.1	3																																																																																			ZNF148	-	NULL	ENSG00000163848		0.382	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF148	HGNC	protein_coding	OTTHUMT00000355452.4	109	0.00	0	CTTA	NM_021964		124952376	124952379	-1	no_errors	ENST00000360647	ensembl	human	known	69_37n	frame_shift_del	53	16.92	11	DEL	1.000:1.000:1.000:0.998	-
ZNF367	195828	genome.wustl.edu	37	9	99160571	99160571	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr9:99160571C>T	ENST00000375256.4	-	2	742	c.446G>A	c.(445-447)aGa>aAa	p.R149K		NM_153695.3	NP_710162.1	Q7RTV3	ZN367_HUMAN	zinc finger protein 367	149					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|endometrium(4)|large_intestine(3)|lung(3)|prostate(1)	12		Acute lymphoblastic leukemia(62;0.0167)				AGTATCTGCTCTGGGCCTACC	0.373																																						dbGAP											0													138.0	138.0	138.0					9																	99160571		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091289	CCDS6718.1	9q22	2008-05-02			ENSG00000165244	ENSG00000165244		"""Zinc fingers, C2H2-type"""	18320	protein-coding gene	gene with protein product		610160					Standard	NM_153695		Approved	FLJ33970	uc004awf.3	Q7RTV3	OTTHUMG00000020295	ENST00000375256.4:c.446G>A	9.37:g.99160571C>T	ENSP00000364405:p.Arg149Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6Q7C8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R149K	ENST00000375256.4	37	c.446	CCDS6718.1	9	.	.	.	.	.	.	.	.	.	.	C	34	5.390626	0.95988	.	.	ENSG00000165244	ENST00000375256	T	0.06218	3.33	5.54	5.54	0.83059	.	0.089312	0.85682	D	0.000000	T	0.19886	0.0478	M	0.64997	1.995	0.80722	D	1	D;D	0.67145	0.996;0.994	D;D	0.76071	0.987;0.97	T	0.05146	-1.0903	10	0.02654	T	1	-14.4675	19.6745	0.95926	0.0:1.0:0.0:0.0	.	149;149	Q7RTV3-2;Q7RTV3	.;ZN367_HUMAN	K	149	ENSP00000364405:R149K	ENSP00000364405:R149K	R	-	2	0	ZNF367	98200392	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.222000	0.78025	2.880000	0.98712	0.650000	0.86243	AGA	ZNF367	-	NULL	ENSG00000165244		0.373	ZNF367-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF367	HGNC	protein_coding	OTTHUMT00000053266.1	72	0.00	0	C			99160571	99160571	-1	no_errors	ENST00000375256	ensembl	human	known	69_37n	missense	79	15.96	15	SNP	1.000	T
ZNF496	84838	genome.wustl.edu	37	1	247464393	247464393	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A209-01A-11D-A17G-09	TCGA-BH-A209-11A-42D-A17G-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	4eaf8116-4733-4865-8e22-5d03887bbc9b	68d5b797-ff7c-41ab-aedf-8a816ed290e2	g.chr1:247464393C>T	ENST00000294753.4	-	9	1656	c.1192G>A	c.(1192-1194)Gag>Aag	p.E398K	ZNF496_ENST00000462139.1_5'UTR|ZNF496_ENST00000366498.2_Missense_Mutation_p.E434K	NM_032752.1	NP_116141.1	Q96IT1	ZN496_HUMAN	zinc finger protein 496	398					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear body (GO:0016604)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	36	all_cancers(71;0.000136)|all_epithelial(71;2.62e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0607)|Lung NSC(105;0.0661)		OV - Ovarian serous cystadenocarcinoma(106;0.00703)			GTCTGCACCTCGCCTCCGGCC	0.647																																						dbGAP											0													37.0	38.0	37.0					1																	247464393		2203	4299	6502	-	-	-	SO:0001583	missense	0			BC007263	CCDS1631.1	1q44	2013-01-09			ENSG00000162714	ENSG00000162714		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	23713	protein-coding gene	gene with protein product		613911				12477932	Standard	NM_032752		Approved	ZKSCAN17, MGC15548, ZSCAN49	uc001ico.3	Q96IT1	OTTHUMG00000041164	ENST00000294753.4:c.1192G>A	1.37:g.247464393C>T	ENSP00000294753:p.Glu398Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBS2	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E434K	ENST00000294753.4	37	c.1300	CCDS1631.1	1	.	.	.	.	.	.	.	.	.	.	C	15.77	2.931553	0.52866	.	.	ENSG00000162714	ENST00000294753;ENST00000366498	T;T	0.06371	3.31;3.33	4.65	3.72	0.42706	.	0.528245	0.17740	N	0.163586	T	0.11879	0.0289	L	0.29908	0.895	0.09310	N	1	D;P	0.89917	1.0;0.912	D;B	0.79108	0.992;0.272	T	0.12091	-1.0561	10	0.40728	T	0.16	-20.6339	6.5611	0.22487	0.0:0.7191:0.1848:0.0961	.	434;398	Q96IT1-2;Q96IT1	.;ZN496_HUMAN	K	398;434	ENSP00000294753:E398K;ENSP00000355454:E434K	ENSP00000294753:E398K	E	-	1	0	ZNF496	245531016	0.398000	0.25279	0.045000	0.18777	0.013000	0.08279	-0.022000	0.12480	1.295000	0.44724	0.655000	0.94253	GAG	ZNF496	-	NULL	ENSG00000162714		0.647	ZNF496-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF496	HGNC	protein_coding	OTTHUMT00000098655.2	16	0.00	0	C	NM_032752		247464393	247464393	-1	no_errors	ENST00000366498	ensembl	human	known	69_37n	missense	15	25.00	5	SNP	0.033	T
