#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APC	324	genome.wustl.edu	37	5	112173676	112173676	+	Silent	SNP	C	C	T	rs80188155		TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr5:112173676C>T	ENST00000457016.1	+	16	2765	c.2385C>T	c.(2383-2385)ctC>ctT	p.L795L	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000508376.2_Silent_p.L795L|APC_ENST00000257430.4_Silent_p.L795L			P25054	APC_HUMAN	adenomatous polyposis coli	795	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		AGCAAAGTCTCTATGGTGATT	0.358		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)											84.0	85.0	85.0					5																	112173676		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.2385C>T	5.37:g.112173676C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Silent	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.L795	ENST00000457016.1	37	c.2385	CCDS4107.1	5																																																																																			APC	-	NULL	ENSG00000134982		0.358	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	27	0.00	0	C	NM_000038		112173676	112173676	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.334	T
BCL2L14	79370	genome.wustl.edu	37	12	12232555	12232555	+	Missense_Mutation	SNP	C	C	G	rs376032131		TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr12:12232555C>G	ENST00000308721.5	+	2	522	c.316C>G	c.(316-318)Cag>Gag	p.Q106E	BCL2L14_ENST00000589718.1_Missense_Mutation_p.Q106E|BCL2L14_ENST00000396367.1_Missense_Mutation_p.Q106E|BCL2L14_ENST00000396369.1_Missense_Mutation_p.Q106E|BCL2L14_ENST00000266434.4_Missense_Mutation_p.Q106E|BCL2L14_ENST00000586576.1_Missense_Mutation_p.Q139E	NM_138723.1	NP_620049.1	Q9BZR8	B2L14_HUMAN	BCL2-like 14 (apoptosis facilitator)	106					apoptotic process (GO:0006915)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|regulation of apoptotic process (GO:0042981)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular organelle (GO:0043229)|membrane (GO:0016020)	protein kinase binding (GO:0019901)			large_intestine(1)|lung(2)|skin(3)	6		Prostate(47;0.0872)		BRCA - Breast invasive adenocarcinoma(232;0.154)		GGAAGATTCGCAGAGCACGCC	0.498																																						dbGAP											0													92.0	86.0	88.0					12																	12232555		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF281254	CCDS8645.1, CCDS8646.1	12p13-p12	2014-03-07			ENSG00000121380	ENSG00000121380			16657	protein-coding gene	gene with protein product		606126				11054413	Standard	NM_030766		Approved	BCLG, BCL-G	uc001rac.3	Q9BZR8	OTTHUMG00000159528	ENST00000308721.5:c.316C>G	12.37:g.12232555C>G	ENSP00000309132:p.Gln106Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAD0|Q96QR5|Q9BZR7	Missense_Mutation	SNP	pfscan_Bcl2-like_apoptosis	p.Q106E	ENST00000308721.5	37	c.316	CCDS8645.1	12	.	.	.	.	.	.	.	.	.	.	C	12.05	1.823014	0.32237	.	.	ENSG00000121380	ENST00000461264;ENST00000308721;ENST00000266434;ENST00000396369;ENST00000396367	.	.	.	3.41	1.45	0.22620	.	4.944600	0.00397	N	0.000054	T	0.47002	0.1422	M	0.65975	2.015	0.09310	N	1	B;B	0.20550	0.046;0.01	B;B	0.15484	0.013;0.006	T	0.14504	-1.0470	8	.	.	.	-1.0745	5.8828	0.18864	0.2227:0.5613:0.216:0.0	.	106;106	Q9BZR8-2;Q9BZR8	.;B2L14_HUMAN	E	109;106;106;106;106	.	.	Q	+	1	0	BCL2L14	12123822	0.003000	0.15002	0.001000	0.08648	0.030000	0.12068	0.319000	0.19522	0.405000	0.25532	0.563000	0.77884	CAG	BCL2L14	-	NULL	ENSG00000121380		0.498	BCL2L14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL2L14	HGNC	protein_coding	OTTHUMT00000355994.3	34	0.00	0	C	NM_030766		12232555	12232555	+1	no_errors	ENST00000308721	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.001	G
BRD1	23774	genome.wustl.edu	37	22	50217038	50217038	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr22:50217038C>T	ENST00000216267.8	-	1	1414	c.928G>A	c.(928-930)Gag>Aag	p.E310K	BRD1_ENST00000457780.2_Missense_Mutation_p.E310K|BRD1_ENST00000342989.5_5'Flank|BRD1_ENST00000459821.1_5'Flank|BRD1_ENST00000404034.1_Missense_Mutation_p.E310K|BRD1_ENST00000542442.1_5'Flank|BRD1_ENST00000404760.1_Missense_Mutation_p.E310K	NM_014577.1	NP_055392.1	O95696	BRD1_HUMAN	bromodomain containing 1	310					histone H3 acetylation (GO:0043966)	MOZ/MORF histone acetyltransferase complex (GO:0070776)|nucleus (GO:0005634)	histone binding (GO:0042393)|zinc ion binding (GO:0008270)			endometrium(6)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|pancreas(1)|prostate(3)|skin(1)	37		all_cancers(38;6.11e-10)|all_epithelial(38;8.06e-09)|all_lung(38;6.64e-05)|Lung NSC(38;0.0011)|Breast(42;0.00235)|Ovarian(80;0.0139)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0369)|BRCA - Breast invasive adenocarcinoma(115;0.21)		TCGATGGGCTCGATGAACACC	0.587																																						dbGAP											0													113.0	99.0	104.0					22																	50217038		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005067	CCDS14080.1	22q13.33	2008-07-01	2002-01-14		ENSG00000100425	ENSG00000100425			1102	protein-coding gene	gene with protein product	"""BR140-like"""	604589	"""bromodomain-containing 1"""			10591208, 10602503	Standard	NM_014577		Approved	BRL, BRPF2	uc003biv.3	O95696	OTTHUMG00000150288	ENST00000216267.8:c.928G>A	22.37:g.50217038C>T	ENSP00000216267:p.Glu310Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ZJA4	Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Bromodomain,pfam_PWWP,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_Bromodomain,smart_PWWP,pfscan_PWWP,pfscan_Znf_PHD-finger,pfscan_Bromodomain,prints_Bromodomain	p.E310K	ENST00000216267.8	37	c.928	CCDS14080.1	22	.	.	.	.	.	.	.	.	.	.	C	25.8	4.671649	0.88348	.	.	ENSG00000100425	ENST00000216267;ENST00000404034;ENST00000404760;ENST00000457780	T;T;T;T	0.15372	2.43;2.43;2.43;2.43	5.27	5.27	0.74061	.	0.000000	0.85682	D	0.000000	T	0.50786	0.1636	M	0.88105	2.93	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.58482	-0.7629	9	.	.	.	.	18.8799	0.92352	0.0:1.0:0.0:0.0	.	310;310;310	Q86X06;O95696;O95696-2	.;BRD1_HUMAN;.	K	310	ENSP00000216267:E310K;ENSP00000384076:E310K;ENSP00000385858:E310K;ENSP00000410042:E310K	.	E	-	1	0	BRD1	48603042	1.000000	0.71417	0.971000	0.41717	0.695000	0.40330	7.316000	0.79007	2.464000	0.83262	0.514000	0.50259	GAG	BRD1	-	superfamily_Znf_FYVE_PHD	ENSG00000100425		0.587	BRD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BRD1	HGNC	protein_coding	OTTHUMT00000317402.1	18	0.00	0	C	NM_014577		50217038	50217038	-1	no_errors	ENST00000216267	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	1.000	T
BRF1	2972	genome.wustl.edu	37	14	105695168	105695168	+	Silent	SNP	C	C	A	rs140779507	byFrequency	TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr14:105695168C>A	ENST00000546474.1	-	7	15736	c.777G>T	c.(775-777)acG>acT	p.T259T	BRF1_ENST00000551787.1_Silent_p.T55T|BRF1_ENST00000446501.2_Silent_p.T21T|BRF1_ENST00000327359.3_Silent_p.T144T|BRF1_ENST00000379932.4_Silent_p.T55T|BRF1_ENST00000392557.4_Silent_p.T55T|BRF1_ENST00000379937.2_Silent_p.T232T|BRF1_ENST00000440513.3_Silent_p.T144T	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	259					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		TCTTCCGCAGCGTGGACTCAC	0.592																																						dbGAP											0													388.0	359.0	369.0					14																	105695168		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.777G>T	14.37:g.105695168C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Missense_Mutation	SNP	pfam_TFIIB_cyclin,superfamily_Cyclin-like,smart_Cyclin-like	p.A113S	ENST00000546474.1	37	c.337	CCDS10001.1	14	.	.	.	.	.	.	.	.	.	.	C	1.119	-0.655957	0.03480	.	.	ENSG00000185024	ENST00000546417	.	.	.	5.15	-9.09	0.00717	.	.	.	.	.	T	0.41834	0.1176	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.45877	-0.9231	4	.	.	.	.	4.4755	0.11733	0.0879:0.203:0.1752:0.5339	.	.	.	.	S	113	.	.	A	-	1	0	BRF1	104766213	0.000000	0.05858	0.238000	0.24106	0.287000	0.27160	-4.135000	0.00288	-2.075000	0.00876	-1.543000	0.00907	GCT	BRF1	-	pfam_TFIIB_cyclin,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000185024		0.592	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF1	HGNC	protein_coding	OTTHUMT00000074548.4	83	0.00	0	C	NM_001519		105695168	105695168	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000546417	ensembl	human	putative	69_37n	missense	46	32.35	22	SNP	0.036	A
CDH1	999	genome.wustl.edu	37	16	68835780	68835781	+	Frame_Shift_Ins	INS	-	-	C	rs115418995		TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr16:68835780_68835781insC	ENST00000261769.5	+	3	562_563	c.371_372insC	c.(370-375)cgccccfs	p.RP124fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.RP124fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	124					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(2)|p.P126fs*89(1)|p.P127fs*41(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		CACCACCACCGCCCCCCGCCCC	0.5			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	4	Unknown(2)|Insertion - Frameshift(1)|Deletion - Frameshift(1)	breast(4)																																								-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.377dupC	16.37:g.68835786_68835786dupC	ENSP00000261769:p.Arg124fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P127fs	ENST00000261769.5	37	c.371_372	CCDS10869.1	16																																																																																			CDH1	-	superfamily_Cadherin-like	ENSG00000039068		0.500	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	61	0.00	0	-	NM_004360		68835780	68835781	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	14	54.84	17	INS	0.005:0.015	C
CH25H	9023	genome.wustl.edu	37	10	90966611	90966611	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr10:90966611G>T	ENST00000371852.2	-	1	460	c.439C>A	c.(439-441)Cac>Aac	p.H147N		NM_003956.3	NP_003947.1	O95992	CH25H_HUMAN	cholesterol 25-hydroxylase	147					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cholesterol metabolic process (GO:0008203)|fatty acid biosynthetic process (GO:0006633)|lipid metabolic process (GO:0006629)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cholesterol 25-hydroxylase activity (GO:0001567)|iron ion binding (GO:0005506)|steroid hydroxylase activity (GO:0008395)			kidney(1)|large_intestine(2)|lung(3)|stomach(1)	7		Colorectal(252;0.0161)		GBM - Glioblastoma multiforme(2;0.000133)		GGCACCTTGTGGTGCAGCAGG	0.597																																						dbGAP											0													94.0	88.0	90.0					10																	90966611		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF059212	CCDS7400.1	10q23	2013-03-04			ENSG00000138135	ENSG00000138135	1.14.99.38	"""Fatty acid hydroxylase domain containing"""	1907	protein-coding gene	gene with protein product		604551				9852097	Standard	NM_003956		Approved		uc001kfz.3	O95992	OTTHUMG00000018705	ENST00000371852.2:c.439C>A	10.37:g.90966611G>T	ENSP00000360918:p.His147Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBY3	Missense_Mutation	SNP	pfam_Fatty_acid_hydroxylase	p.H147N	ENST00000371852.2	37	c.439	CCDS7400.1	10	.	.	.	.	.	.	.	.	.	.	G	27.5	4.841560	0.91197	.	.	ENSG00000138135	ENST00000371852	D	0.96619	-4.07	4.9	4.9	0.64082	Fatty acid hydroxylase (1);	0.000000	0.85682	D	0.000000	D	0.98839	0.9608	H	0.96662	3.86	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.99466	1.0944	10	0.87932	D	0	-39.4377	17.9479	0.89044	0.0:0.0:1.0:0.0	.	147	O95992	CH25H_HUMAN	N	147	ENSP00000360918:H147N	ENSP00000360918:H147N	H	-	1	0	CH25H	90956591	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.614000	0.98353	2.645000	0.89757	0.650000	0.86243	CAC	CH25H	-	pfam_Fatty_acid_hydroxylase	ENSG00000138135		0.597	CH25H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CH25H	HGNC	protein_coding	OTTHUMT00000049291.1	49	0.00	0	G	NM_003956		90966611	90966611	-1	no_errors	ENST00000371852	ensembl	human	known	69_37n	missense	21	41.67	15	SNP	1.000	T
CREB3L4	148327	genome.wustl.edu	37	1	153941846	153941846	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr1:153941846G>A	ENST00000368607.3	+	4	724	c.458G>A	c.(457-459)tGc>tAc	p.C153Y	SLC39A1_ENST00000310483.6_5'Flank|CREB3L4_ENST00000405694.3_Missense_Mutation_p.C6Y|CREB3L4_ENST00000368600.3_Missense_Mutation_p.C133Y|RP11-422P24.10_ENST00000608147.1_RNA|CREB3L4_ENST00000271889.4_Missense_Mutation_p.C153Y|CREB3L4_ENST00000368603.1_Missense_Mutation_p.C153Y|CREB3L4_ENST00000368601.1_Missense_Mutation_p.C153Y	NM_001255978.1|NM_001255980.1|NM_130898.3	NP_001242907.1|NP_001242909.1|NP_570968.1	Q8TEY5	CR3L4_HUMAN	cAMP responsive element binding protein 3-like 4	153					response to unfolded protein (GO:0006986)|spermatogenesis (GO:0007283)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)	p.C153Y(1)		breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(3)	13	all_lung(78;3.05e-32)|Lung NSC(65;3.74e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCTGATTCCTGCATGGTCAGT	0.572																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											133.0	119.0	124.0					1																	153941846		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF394167	CCDS1056.1, CCDS58029.1	1q21.2	2013-01-10			ENSG00000143578	ENSG00000143578		"""basic leucine zipper proteins"""	18854	protein-coding gene	gene with protein product		607138					Standard	NM_130898		Approved	AIbZIP, CREB4, CREB3, hJAL, ATCE1	uc001fdr.3	Q8TEY5	OTTHUMG00000037159	ENST00000368607.3:c.458G>A	1.37:g.153941846G>A	ENSP00000357596:p.Cys153Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV62|Q5T4L0|Q86YW6	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.C153Y	ENST00000368607.3	37	c.458	CCDS1056.1	1	.	.	.	.	.	.	.	.	.	.	G	15.43	2.831080	0.50845	.	.	ENSG00000143578	ENST00000405694;ENST00000449724;ENST00000368607;ENST00000271889;ENST00000368601;ENST00000368603;ENST00000368600;ENST00000431292	D;T;T;T;T;T;T;T	0.81499	-1.5;-0.12;-0.18;-0.18;0.81;-0.18;-0.17;0.24	4.64	4.64	0.57946	.	0.298887	0.36932	N	0.002328	T	0.67487	0.2898	M	0.74881	2.28	0.46774	D	0.999193	B;B	0.30455	0.132;0.28	B;B	0.33568	0.118;0.166	T	0.66524	-0.5902	10	0.07990	T	0.79	.	12.8699	0.57958	0.0:0.0:1.0:0.0	.	133;153	Q5T4L0;Q8TEY5	.;CR3L4_HUMAN	Y	6;133;153;153;153;153;133;153	ENSP00000385104:C6Y;ENSP00000391847:C133Y;ENSP00000357596:C153Y;ENSP00000271889:C153Y;ENSP00000357590:C153Y;ENSP00000357592:C153Y;ENSP00000357589:C133Y;ENSP00000402308:C153Y	ENSP00000271889:C153Y	C	+	2	0	CREB3L4	152208470	1.000000	0.71417	0.751000	0.31187	0.918000	0.54935	3.121000	0.50438	2.410000	0.81850	0.561000	0.74099	TGC	CREB3L4	-	NULL	ENSG00000143578		0.572	CREB3L4-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	CREB3L4	HGNC	protein_coding	OTTHUMT00000090291.1	52	0.00	0	G	NM_130898		153941846	153941846	+1	no_errors	ENST00000271889	ensembl	human	known	69_37n	missense	50	41.18	35	SNP	0.957	A
CHML	1122	genome.wustl.edu	37	1	241798530	241798530	+	Missense_Mutation	SNP	T	T	G			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr1:241798530T>G	ENST00000366553.1	-	1	702	c.539A>C	c.(538-540)aAg>aCg	p.K180T	OPN3_ENST00000469376.1_Intron|OPN3_ENST00000366554.2_Intron|OPN3_ENST00000331838.5_Intron	NM_001821.3	NP_001812.2	P26374	RAE2_HUMAN	choroideremia-like (Rab escort protein 2)	180					intracellular protein transport (GO:0006886)|protein geranylgeranylation (GO:0018344)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(2)|endometrium(1)|kidney(2)|large_intestine(6)|lung(7)|ovary(4)|skin(3)|stomach(1)	26	Ovarian(103;0.103)|all_lung(81;0.23)	all_cancers(173;0.0231)	OV - Ovarian serous cystadenocarcinoma(106;0.0125)			TCCACAATACTTTTCCTTCTC	0.358																																						dbGAP											0													204.0	204.0	204.0					1																	241798530		2203	4300	6503	-	-	-	SO:0001583	missense	0			X64728	CCDS31073.1	1q43	2013-09-19			ENSG00000203668	ENSG00000203668			1941	protein-coding gene	gene with protein product		118825				7981670	Standard	NM_001821		Approved	REP-2	uc001hzd.3	P26374	OTTHUMG00000039690	ENST00000366553.1:c.539A>C	1.37:g.241798530T>G	ENSP00000355511:p.Lys180Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAB9|Q17RE0|Q9H1Y4	Missense_Mutation	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.K180T	ENST00000366553.1	37	c.539	CCDS31073.1	1	.	.	.	.	.	.	.	.	.	.	T	0.053	-1.243666	0.01481	.	.	ENSG00000203668	ENST00000366553	D	0.88664	-2.41	4.46	-0.968	0.10313	.	1.656620	0.03386	N	0.201149	T	0.80502	0.4635	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.14578	0.011	T	0.61936	-0.6960	9	0.45353	T	0.12	-0.0478	0.6177	0.00772	0.1683:0.1962:0.1742:0.4613	.	180	P26374	RAE2_HUMAN	T	180	ENSP00000355511:K180T	ENSP00000355511:K180T	K	-	2	0	CHML	239865153	0.000000	0.05858	0.030000	0.17652	0.020000	0.10135	-0.250000	0.08830	-0.274000	0.09232	0.528000	0.53228	AAG	CHML	-	pirsf_Rab_geranylTrfase_A_euk	ENSG00000203668		0.358	CHML-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHML	HGNC	protein_coding	OTTHUMT00000095712.1	184	0.00	0	T	NM_001821		241798530	241798530	-1	no_errors	ENST00000366553	ensembl	human	known	69_37n	missense	152	26.57	55	SNP	0.075	G
DCAF12L1	139170	genome.wustl.edu	37	X	125686114	125686114	+	Missense_Mutation	SNP	A	A	C			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chrX:125686114A>C	ENST00000371126.1	-	1	720	c.478T>G	c.(478-480)Tcc>Gcc	p.S160A		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	160										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						AGCGTCTTGGAGGGATTCAGC	0.667																																						dbGAP											0													79.0	78.0	78.0					X																	125686114		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.478T>G	X.37:g.125686114A>C	ENSP00000360167:p.Ser160Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYK3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S160A	ENST00000371126.1	37	c.478	CCDS14610.1	X	.	.	.	.	.	.	.	.	.	.	A	17.41	3.382643	0.61845	.	.	ENSG00000198889	ENST00000371126	T	0.47528	0.84	3.63	3.63	0.41609	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.	.	.	.	T	0.63803	0.2542	M	0.74258	2.255	0.34360	D	0.690898	D	0.64830	0.994	D	0.72625	0.978	T	0.73020	-0.4114	9	0.62326	D	0.03	.	7.8636	0.29524	1.0:0.0:0.0:0.0	.	160	Q5VU92	DC121_HUMAN	A	160	ENSP00000360167:S160A	ENSP00000360167:S160A	S	-	1	0	DCAF12L1	125513795	1.000000	0.71417	1.000000	0.80357	0.662000	0.39071	7.706000	0.84615	1.672000	0.50884	0.347000	0.21830	TCC	DCAF12L1	-	superfamily_WD40_repeat_dom	ENSG00000198889		0.667	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	47	0.00	0	A	NM_178470		125686114	125686114	-1	no_errors	ENST00000371126	ensembl	human	known	69_37n	missense	38	37.70	23	SNP	1.000	C
DIP2A	23181	genome.wustl.edu	37	21	47978254	47978254	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr21:47978254G>A	ENST00000417564.2	+	32	3938	c.3917G>A	c.(3916-3918)cGc>cAc	p.R1306H	DIP2A_ENST00000400274.1_Missense_Mutation_p.R1302H|DIP2A_ENST00000318711.7_Missense_Mutation_p.R1307H			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	1306					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		CTGCCGGCCCGCGCCGTAAGC	0.652																																						dbGAP											0													13.0	18.0	16.0					21																	47978254		2041	4175	6216	-	-	-	SO:0001583	missense	0			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.3917G>A	21.37:g.47978254G>A	ENSP00000392066:p.Arg1306His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.R1307H	ENST00000417564.2	37	c.3920	CCDS46655.1	21	.	.	.	.	.	.	.	.	.	.	G	34	5.357581	0.95854	.	.	ENSG00000160305	ENST00000400274;ENST00000318711;ENST00000417564	T;T;T	0.42900	0.96;0.96;0.96	5.2	5.2	0.72013	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.66127	0.2758	M	0.76170	2.325	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.998;0.998	T	0.69650	-0.5088	10	0.66056	D	0.02	-17.4858	17.7235	0.88359	0.0:0.0:1.0:0.0	.	1307;97;1306	E9PER1;Q9NSX6;Q14689	.;.;DIP2A_HUMAN	H	1302;1307;1306	ENSP00000383133:R1302H;ENSP00000323633:R1307H;ENSP00000392066:R1306H	ENSP00000323633:R1307H	R	+	2	0	DIP2A	46802682	1.000000	0.71417	0.214000	0.23707	0.922000	0.55478	9.680000	0.98651	2.430000	0.82344	0.557000	0.71058	CGC	DIP2A	-	pfam_AMP-dep_Synth/Lig	ENSG00000160305		0.652	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	19	0.00	0	G	NM_015151		47978254	47978254	+1	no_errors	ENST00000318711	ensembl	human	known	69_37n	missense	14	22.22	4	SNP	0.996	A
DOC2B	8447	genome.wustl.edu	37	17	6037	6037	+	Silent	SNP	G	G	A	rs550710011		TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr17:6037G>A	ENST00000343572.7	-	6	1053	c.897C>T	c.(895-897)aaC>aaT	p.N299N	AC108004.5_ENST00000583926.1_RNA	NM_003585.3	NP_003576	Q14184	DOC2B_HUMAN	double C2-like domains, beta	299	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.|Mediates interaction with STXBP3. {ECO:0000250}.				calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of insulin secretion (GO:0032024)|positive regulation of vesicle fusion (GO:0031340)|protein localization (GO:0008104)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	calcium-dependent phospholipid binding (GO:0005544)|transporter activity (GO:0005215)			endometrium(2)|ovary(1)	3						CCGAGTAGCCGTTGGCGTCCA	0.657													A|||	1	0.000199681	0.0	0.0	5008	,	,		18116	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													62.0	78.0	73.0					17																	6037		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			D70830	CCDS73934.1	17p13.3	2014-07-16			ENSG00000272636	ENSG00000272636		"""Synaptotagmins"""	2986	protein-coding gene	gene with protein product		604568	"""double C2-like domains, beta-like"""	DOC2BL		7826360	Standard	NM_003585		Approved		uc010vpx.1	Q14184	OTTHUMG00000154415	ENST00000343572.7:c.897C>T	17.37:g.6037G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,prints_C2_dom,pfscan_C2_membr_targeting	p.N299	ENST00000343572.7	37	c.897		17																																																																																			DOC2B	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB	ENSG00000262359		0.657	DOC2B-001	KNOWN	basic|appris_principal	protein_coding	DOC2B	Clone_based_vega_gene	protein_coding	OTTHUMT00000335122.3	31	0.00	0	G	NM_003585		6037	6037	-1	no_errors	ENST00000343572	ensembl	human	known	69_37n	silent	15	28.57	6	SNP	0.942	A
GIT1	28964	genome.wustl.edu	37	17	27903567	27903567	+	Silent	SNP	G	G	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr17:27903567G>A	ENST00000225394.3	-	13	1601	c.1353C>T	c.(1351-1353)agC>agT	p.S451S	GIT1_ENST00000579937.1_Silent_p.S451S|GIT1_ENST00000581348.1_Silent_p.S460S|RP11-68I3.2_ENST00000581474.1_RNA|GIT1_ENST00000394869.3_Silent_p.S460S	NM_014030.3	NP_054749.2	Q9Y2X7	GIT1_HUMAN	G protein-coupled receptor kinase interacting ArfGAP 1	451					regulation of ARF GTPase activity (GO:0032312)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			large_intestine(2)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	9				READ - Rectum adenocarcinoma(3;0.0419)|Colorectal(3;0.069)		GGAGCTCGTCGCTCAGGCTAC	0.627																																					Colon(81;41 1719 20078 35068)	dbGAP											0													81.0	75.0	77.0					17																	27903567		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF124490	CCDS11250.1, CCDS42290.1	17p11.2	2013-01-10	2008-09-05		ENSG00000108262	ENSG00000108262		"""ADP-ribosylation factor GTPase activating proteins"", ""Ankyrin repeat domain containing"""	4272	protein-coding gene	gene with protein product		608434	"""G protein-coupled receptor kinase interactor 1"""			9826657, 10896954	Standard	NM_014030		Approved		uc002heg.2	Q9Y2X7	OTTHUMG00000132730	ENST00000225394.3:c.1353C>T	17.37:g.27903567G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGU9|B4DSV3|Q86SS0|Q9BRJ4	Silent	SNP	pfam_GIT1_C,pfam_GIT_SHD,pfam_ArfGAP,pfam_Ankyrin_rpt,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_ArfGAP,smart_Ankyrin_rpt,smart_GIT_SHD,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_ArfGAP,prints_ArfGAP	p.S460	ENST00000225394.3	37	c.1380	CCDS11250.1	17																																																																																			GIT1	-	NULL	ENSG00000108262		0.627	GIT1-001	KNOWN	basic|CCDS	protein_coding	GIT1	HGNC	protein_coding	OTTHUMT00000256073.1	35	0.00	0	G	NM_014030		27903567	27903567	-1	no_errors	ENST00000394869	ensembl	human	known	69_37n	silent	27	34.15	14	SNP	0.995	A
HOGA1	112817	genome.wustl.edu	37	10	99359502	99359502	+	Silent	SNP	G	G	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr10:99359502G>A	ENST00000370646.4	+	4	895	c.534G>A	c.(532-534)ctG>ctA	p.L178L	PI4K2A_ENST00000555577.1_Intron|PI4K2A_ENST00000370649.3_Intron|HOGA1_ENST00000370647.4_Intron	NM_138413.3	NP_612422.2	Q86XE5	HOGA1_HUMAN	4-hydroxy-2-oxoglutarate aldolase 1	178					4-hydroxyproline catabolic process (GO:0019470)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|oxalate metabolic process (GO:0033609)|pyruvate biosynthetic process (GO:0042866)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	4-hydroxy-2-oxoglutarate aldolase activity (GO:0008700)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(5)|prostate(2)|skin(1)|stomach(1)	14						GGCTGGACCTGCCTGTGGATG	0.617																																						dbGAP											0													81.0	79.0	80.0					10																	99359502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC011916	CCDS7467.1, CCDS44469.1	10q24.1	2010-12-19	2010-12-19	2010-12-19	ENSG00000241935	ENSG00000241935			25155	protein-coding gene	gene with protein product	"""dihydrodipicolinate synthetase homolog 2 (E. coli)"", ""N-acetylneuraminate pyruvate lyase 2 (putative)"""	613597	"""chromosome 10 open reading frame 65"", ""dihydrodipicolinate synthase-like, mitochondrial"""	C10orf65, DHDPSL		20797690	Standard	NM_001134670		Approved	FLJ37472, DHDPS2, NPL2		Q86XE5	OTTHUMG00000018859	ENST00000370646.4:c.534G>A	10.37:g.99359502G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K075|Q5T680|Q5T684|Q711P0|Q8N9F2|Q96EV5	Silent	SNP	pfam_Dihydrodipicolinate_synth-like,prints_Dihydrodipicolinate_synth-like	p.L178	ENST00000370646.4	37	c.534	CCDS7467.1	10																																																																																			HOGA1	-	pfam_Dihydrodipicolinate_synth-like,prints_Dihydrodipicolinate_synth-like	ENSG00000241935		0.617	HOGA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HOGA1	HGNC	protein_coding	OTTHUMT00000049726.1	36	0.00	0	G	NM_138413		99359502	99359502	+1	no_errors	ENST00000370646	ensembl	human	known	69_37n	silent	28	17.65	6	SNP	1.000	A
MYBPC3	4607	genome.wustl.edu	37	11	47373015	47373015	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr11:47373015C>T	ENST00000545968.1	-	2	121	c.67G>A	c.(67-69)Gca>Aca	p.A23T	MYBPC3_ENST00000256993.4_Missense_Mutation_p.A23T|MYBPC3_ENST00000399249.2_Missense_Mutation_p.A23T	NM_000256.3	NP_000247.2	Q14896	MYPC3_HUMAN	myosin binding protein C, cardiac	23					cardiac muscle contraction (GO:0060048)|cell adhesion (GO:0007155)|heart morphogenesis (GO:0003007)|muscle filament sliding (GO:0030049)|myosin filament assembly (GO:0031034)|positive regulation of ATPase activity (GO:0032781)|regulation of heart rate (GO:0002027)|regulation of muscle filament sliding (GO:0032971)|regulation of striated muscle contraction (GO:0006942)|sarcomere organization (GO:0045214)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	A band (GO:0031672)|C zone (GO:0014705)|cytosol (GO:0005829)|sarcomere (GO:0030017)|striated muscle myosin thick filament (GO:0005863)	ATPase activator activity (GO:0001671)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|myosin binding (GO:0017022)|myosin heavy chain binding (GO:0032036)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(2)|central_nervous_system(2)|endometrium(9)|kidney(1)|large_intestine(4)|lung(16)|ovary(3)|prostate(3)|urinary_tract(2)	42				Lung(87;0.176)		GGGCTGCCTGCGGCCACTTCC	0.662																																						dbGAP											0													15.0	18.0	17.0					11																	47373015		2084	4218	6302	-	-	-	SO:0001583	missense	0			X84075	CCDS53621.1	11p11.2	2014-09-17	2001-11-28			ENSG00000134571		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7551	protein-coding gene	gene with protein product		600958	"""myosin-binding protein C, cardiac"""	CMH4		7744002, 8358441	Standard	NM_000256		Approved	MYBP-C, FHC	uc021qis.1	Q14896		ENST00000545968.1:c.67G>A	11.37:g.47373015C>T	ENSP00000442795:p.Ala23Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PL00|Q16410|Q6R2F7|Q9UE27|Q9UM53	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A23T	ENST00000545968.1	37	c.67	CCDS53621.1	11	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075102	0.36566	.	.	ENSG00000134571	ENST00000545968;ENST00000399249;ENST00000256993	T;T;T	0.44083	0.93;0.93;0.93	4.27	2.38	0.29361	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.37892	0.1020	L	0.56124	1.755	0.09310	N	1	D	0.53885	0.963	B	0.41374	0.355	T	0.20907	-1.0261	9	0.87932	D	0	.	10.3208	0.43764	0.0:0.8372:0.0:0.1628	.	23	Q14896	MYPC3_HUMAN	T	23	ENSP00000442795:A23T;ENSP00000382193:A23T;ENSP00000256993:A23T	ENSP00000256993:A23T	A	-	1	0	MYBPC3	47329591	0.000000	0.05858	0.006000	0.13384	0.065000	0.16274	0.814000	0.27239	0.448000	0.26722	0.467000	0.42956	GCA	MYBPC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2	ENSG00000134571		0.662	MYBPC3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYBPC3	HGNC	protein_coding	OTTHUMT00000392271.3	13	0.00	0	C			47373015	47373015	-1	no_errors	ENST00000399249	ensembl	human	known	69_37n	missense	12	25.00	4	SNP	0.019	T
POMT2	29954	genome.wustl.edu	37	14	77767528	77767528	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr14:77767528C>T	ENST00000261534.4	-	6	923	c.721G>A	c.(721-723)Ggg>Agg	p.G241R	POMT2_ENST00000556880.1_5'Flank	NM_013382.5	NP_037514.2	Q9UKY4	POMT2_HUMAN	protein-O-mannosyltransferase 2	241						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	dolichyl-phosphate-mannose-protein mannosyltransferase activity (GO:0004169)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(1)|liver(1)|lung(5)|ovary(1)|prostate(1)|skin(1)	14			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0292)		AACTTGACCCCTAAAGCACCA	0.512											OREG0022837	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													114.0	103.0	106.0					14																	77767528		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF105020	CCDS9857.1	14q24	2014-09-17			ENSG00000009830	ENSG00000009830	2.4.1.109	"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"""	19743	protein-coding gene	gene with protein product		607439				11162531, 12460945	Standard	NM_013382		Approved	LGMD2N	uc001xti.2	Q9UKY4	OTTHUMG00000171556	ENST00000261534.4:c.721G>A	14.37:g.77767528C>T	ENSP00000261534:p.Gly241Arg	Somatic	1178	WXS	Illumina GAIIx	Phase_IV	Q9NSG6|Q9P1W0|Q9P1W2	Missense_Mutation	SNP	pfam_Glyco_trans_39,pfam_MIR,superfamily_MIR,smart_MIR_motif,pfscan_MIR_motif	p.G241R	ENST00000261534.4	37	c.721	CCDS9857.1	14	.	.	.	.	.	.	.	.	.	.	C	27.0	4.789167	0.90367	.	.	ENSG00000009830	ENST00000261534	D	0.85556	-2.0	5.75	5.75	0.90469	Glycosyl transferase, family 39 (1);	0.000000	0.85682	D	0.000000	D	0.93232	0.7844	M	0.85630	2.765	0.80722	D	1	D	0.63880	0.993	D	0.67900	0.954	D	0.93616	0.6943	10	0.87932	D	0	-15.8312	19.9405	0.97159	0.0:1.0:0.0:0.0	.	241	Q9UKY4	POMT2_HUMAN	R	241	ENSP00000261534:G241R	ENSP00000261534:G241R	G	-	1	0	POMT2	76837281	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	5.985000	0.70556	2.708000	0.92522	0.655000	0.94253	GGG	POMT2	-	pfam_Glyco_trans_39	ENSG00000009830		0.512	POMT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMT2	HGNC	protein_coding	OTTHUMT00000414155.1	43	0.00	0	C	NM_013382		77767528	77767528	-1	no_errors	ENST00000261534	ensembl	human	known	69_37n	missense	20	41.18	14	SNP	1.000	T
ROS1	6098	genome.wustl.edu	37	6	117642471	117642471	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr6:117642471G>A	ENST00000368508.3	-	35	5926	c.5728C>T	c.(5728-5730)Cga>Tga	p.R1910*	ROS1_ENST00000368507.3_Nonsense_Mutation_p.R1904*|GOPC_ENST00000467125.1_5'UTR	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	1910					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		GCCAGACCTCGCAGCTCAGCC	0.468			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	dbGAP		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													163.0	154.0	157.0					6																	117642471		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.5728C>T	6.37:g.117642471G>A	ENSP00000357494:p.Arg1910*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15368|Q5TDB5	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.R1910*	ENST00000368508.3	37	c.5728	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	G	43	10.030249	0.99321	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	.	.	.	4.73	2.79	0.32731	.	0.121852	0.35040	N	0.003485	.	.	.	.	.	.	0.49798	D	0.999829	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.6757	0.17747	0.0989:0.0:0.5749:0.3262	.	.	.	.	X	1910;1904	.	ENSP00000357493:R1904X	R	-	1	2	ROS1	117749164	0.873000	0.30073	0.290000	0.24890	0.030000	0.12068	2.025000	0.41059	1.319000	0.45190	-0.136000	0.14681	CGA	ROS1	-	NULL	ENSG00000047936		0.468	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	71	0.00	0	G			117642471	117642471	-1	no_errors	ENST00000368508	ensembl	human	known	69_37n	nonsense	33	15.38	6	SNP	0.587	A
RYR2	6262	genome.wustl.edu	37	1	237813233	237813233	+	Silent	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr1:237813233C>T	ENST00000366574.2	+	50	7886	c.7569C>T	c.(7567-7569)gcC>gcT	p.A2523A	RYR2_ENST00000542537.1_Silent_p.A2507A|RYR2_ENST00000360064.6_Silent_p.A2521A	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2523	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTTGCACAGCCGTCTTGCCAT	0.463																																						dbGAP											0													168.0	163.0	164.0					1																	237813233		2024	4184	6208	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.7569C>T	1.37:g.237813233C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.A2521	ENST00000366574.2	37	c.7563	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.463	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	72	0.00	0	C	NM_001035		237813233	237813233	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	63	19.23	15	SNP	0.816	T
SCGB2A1	4246	genome.wustl.edu	37	11	61977888	61977888	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr11:61977888C>G	ENST00000244930.4	+	2	123	c.59C>G	c.(58-60)tCt>tGt	p.S20C		NM_002407.2	NP_002398.1	O75556	SG2A1_HUMAN	secretoglobin, family 2A, member 1	20					androgen receptor signaling pathway (GO:0030521)	extracellular space (GO:0005615)	protein heterodimerization activity (GO:0046982)			breast(1)|kidney(1)|large_intestine(2)|lung(2)	6						tttCCAGATTCTGGCTGCAAA	0.378																																						dbGAP											0													57.0	62.0	61.0					11																	61977888		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF071219	CCDS8016.1	11q13	2011-12-14	2002-03-22	2002-03-22	ENSG00000124939	ENSG00000124939		"""Secretoglobins"""	7051	protein-coding gene	gene with protein product	"""lipophilin C"", ""mammaglobin B"", ""lacryglobin"""	604398	"""mammaglobin 2"""	MGB2		9806831, 22155607	Standard	NM_002407		Approved	UGB3, LPHC, MGC71973	uc001nta.2	O75556	OTTHUMG00000167506	ENST00000244930.4:c.59C>G	11.37:g.61977888C>G	ENSP00000244930:p.Ser20Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Uteroglobin-like_superfam,superfamily_Secretoglobin	p.S20C	ENST00000244930.4	37	c.59	CCDS8016.1	11	.	.	.	.	.	.	.	.	.	.	C	15.11	2.734620	0.48939	.	.	ENSG00000124939	ENST00000244930	.	.	.	3.54	2.59	0.31030	.	.	.	.	.	T	0.57504	0.2058	.	.	.	0.21147	N	0.999777	D	0.89917	1.0	D	0.68192	0.956	T	0.41787	-0.9489	7	0.87932	D	0	.	8.1655	0.31224	0.2389:0.7611:0.0:0.0	.	20	O75556	SG2A1_HUMAN	C	20	.	ENSP00000244930:S20C	S	+	2	0	SCGB2A1	61734464	0.960000	0.32886	0.837000	0.33122	0.101000	0.19017	0.993000	0.29680	1.011000	0.39340	0.555000	0.69702	TCT	SCGB2A1	-	pfam_Uteroglobin-like_superfam,superfamily_Secretoglobin	ENSG00000124939		0.378	SCGB2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB2A1	HGNC	protein_coding	OTTHUMT00000394857.1	26	0.00	0	C	NM_002407		61977888	61977888	+1	no_errors	ENST00000244930	ensembl	human	known	69_37n	missense	35	20.00	9	SNP	0.874	G
SLC25A47	283600	genome.wustl.edu	37	14	100793545	100793545	+	Silent	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr14:100793545C>T	ENST00000361529.3	+	4	243	c.165C>T	c.(163-165)ggC>ggT	p.G55G	SLC25A47_ENST00000557052.1_5'UTR	NM_207117.2	NP_997000.2	Q6Q0C1	S2547_HUMAN	solute carrier family 25, member 47	55					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(6)|prostate(1)|skin(2)|urinary_tract(1)	13						TCTACCGGGGCCTCTCGCTGC	0.672																																					GBM(11;1289 1351)	dbGAP											0													108.0	114.0	112.0					14																	100793545		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS9959.1	14q32.2	2013-05-22	2010-07-19	2010-07-19	ENSG00000140107	ENSG00000140107		"""Solute carriers"""	20115	protein-coding gene	gene with protein product		609911	"""chromosome 14 open reading frame 68"""	C14orf68			Standard	NM_207117		Approved		uc001yhc.3	Q6Q0C1	OTTHUMG00000171571	ENST00000361529.3:c.165C>T	14.37:g.100793545C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP39|Q68CL2|Q6PZD8|Q86U14	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.G55	ENST00000361529.3	37	c.165	CCDS9959.1	14																																																																																			SLC25A47	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000140107		0.672	SLC25A47-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A47	HGNC	protein_coding	OTTHUMT00000414231.1	44	0.00	0	C			100793545	100793545	+1	no_errors	ENST00000361529	ensembl	human	known	69_37n	silent	31	37.25	19	SNP	0.999	T
TBX3	6926	genome.wustl.edu	37	12	115120616	115120616	+	Splice_Site	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr12:115120616C>T	ENST00000257566.3	-	1	779		c.e1+1		TBX3_ENST00000349155.2_Splice_Site	NM_016569.3	NP_057653.3	O15119	TBX3_HUMAN	T-box 3						anterior/posterior axis specification, embryo (GO:0008595)|atrioventricular bundle cell differentiation (GO:0003167)|blood vessel development (GO:0001568)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cardiac muscle cell fate commitment (GO:0060923)|cell aging (GO:0007569)|cellular senescence (GO:0090398)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|female genitalia development (GO:0030540)|follicle-stimulating hormone secretion (GO:0046884)|forelimb morphogenesis (GO:0035136)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|limbic system development (GO:0021761)|luteinizing hormone secretion (GO:0032275)|male genitalia development (GO:0030539)|mammary gland development (GO:0030879)|mammary placode formation (GO:0060596)|mesoderm morphogenesis (GO:0048332)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epithelial cell differentiation (GO:0030857)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ morphogenesis (GO:0009887)|outflow tract morphogenesis (GO:0003151)|palate development (GO:0060021)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell proliferation (GO:0008284)|positive regulation of stem cell proliferation (GO:2000648)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|sinoatrial node cell development (GO:0060931)|skeletal system development (GO:0001501)|specification of organ position (GO:0010159)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)|ventricular septum morphogenesis (GO:0060412)	nucleus (GO:0005634)	RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(5)|endometrium(1)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	Medulloblastoma(191;0.163)|all_neural(191;0.178)			BRCA - Breast invasive adenocarcinoma(302;0.0574)		CCACTGCTTACCTTCCCGACT	0.537																																						dbGAP											0													47.0	50.0	49.0					12																	115120616		2200	4296	6496	-	-	-	SO:0001630	splice_region_variant	0			BC025258	CCDS9175.1, CCDS9176.1	12q24.21	2013-09-05	2008-07-31		ENSG00000135111	ENSG00000135111		"""T-boxes"""	11602	protein-coding gene	gene with protein product		601621	"""ulnar mammary syndrome"""	UMS		8988164	Standard	NM_005996		Approved	TBX3-ISO, XHL	uc001tvt.1	O15119	OTTHUMG00000169586	ENST00000257566.3:c.389+1G>A	12.37:g.115120616C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TB20|Q9UKF8	Splice_Site	SNP	-	e1+1	ENST00000257566.3	37	c.389+1	CCDS9176.1	12	.	.	.	.	.	.	.	.	.	.	C	18.05	3.537665	0.65085	.	.	ENSG00000135111	ENST00000349155;ENST00000257566;ENST00000361100	.	.	.	5.48	5.48	0.80851	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.6843	0.77396	0.0:0.863:0.137:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TBX3	113604999	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.487000	0.81328	2.566000	0.86566	0.655000	0.94253	.	TBX3	-	-	ENSG00000135111		0.537	TBX3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBX3	HGNC	protein_coding	OTTHUMT00000404947.2	15	0.00	0	C	NM_016569, NM_005996	Intron	115120616	115120616	-1	no_errors	ENST00000257566	ensembl	human	known	69_37n	splice_site	6	53.85	7	SNP	1.000	T
TOP3B	8940	genome.wustl.edu	37	22	22318370	22318370	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr22:22318370G>A	ENST00000398793.2	-	11	1563	c.1129C>T	c.(1129-1131)Cgc>Tgc	p.R377C	TOP3B_ENST00000357179.5_Missense_Mutation_p.R377C|TOP3B_ENST00000413067.2_Missense_Mutation_p.R106C	NM_003935.3	NP_003926.1	O95985	TOP3B_HUMAN	topoisomerase (DNA) III beta	377					chromosome segregation (GO:0007059)|DNA topological change (GO:0006265)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA topoisomerase activity (GO:0003916)|DNA topoisomerase type I activity (GO:0003917)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(4)|lung(9)|ovary(1)	26	Colorectal(54;0.105)			READ - Rectum adenocarcinoma(21;0.145)		TTCCGCGGGCGGTTGATACCT	0.612																																						dbGAP											0													65.0	66.0	66.0					22																	22318370		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF017146	CCDS13797.1	22q11.22	2011-05-24			ENSG00000100038	ENSG00000100038			11993	protein-coding gene	gene with protein product		603582				9786842, 9074928	Standard	XM_005261811		Approved		uc002zvs.3	O95985	OTTHUMG00000167438	ENST00000398793.2:c.1129C>T	22.37:g.22318370G>A	ENSP00000381773:p.Arg377Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0M8Q3|Q9BUP5	Missense_Mutation	SNP	pfam_Topo_IA_cen,pfam_Toprim_domain,superfamily_Topo_IA_core_domain,smart_Toprim_domain,smart_Topo_IA_2,smart_Topo_IA_DNA-bd,prints_Topo_IA	p.R377C	ENST00000398793.2	37	c.1129	CCDS13797.1	22	.	.	.	.	.	.	.	.	.	.	G	17.03	3.285647	0.59867	.	.	ENSG00000100038	ENST00000357179;ENST00000398793;ENST00000413067	T;T;T	0.23348	1.91;1.91;1.91	4.71	3.67	0.42095	DNA topoisomerase, type IA, core domain (1);DNA topoisomerase, type IA, central region, subdomain 3 (1);DNA topoisomerase, type IA, central (1);DNA topoisomerase, type IA, DNA-binding (1);	0.052676	0.85682	D	0.000000	T	0.43389	0.1245	M	0.80332	2.49	0.80722	D	1	D;D	0.69078	0.997;0.997	P;P	0.55303	0.773;0.663	T	0.48328	-0.9045	10	0.72032	D	0.01	.	10.7023	0.45934	0.0:0.1429:0.7091:0.1481	.	377;377	O95985;O95985-2	TOP3B_HUMAN;.	C	377;377;106	ENSP00000349705:R377C;ENSP00000381773:R377C;ENSP00000393118:R106C	ENSP00000349705:R377C	R	-	1	0	TOP3B	20648370	1.000000	0.71417	1.000000	0.80357	0.383000	0.30230	5.966000	0.70395	1.179000	0.42884	0.561000	0.74099	CGC	TOP3B	-	pfam_Topo_IA_cen,superfamily_Topo_IA_core_domain,smart_Topo_IA_DNA-bd	ENSG00000100038		0.612	TOP3B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TOP3B	HGNC	protein_coding	OTTHUMT00000320251.1	32	0.00	0	G	NM_003935		22318370	22318370	-1	no_errors	ENST00000357179	ensembl	human	known	69_37n	missense	42	26.32	15	SNP	1.000	A
TPM2	7169	genome.wustl.edu	37	9	35685029	35685029	+	Intron	SNP	C	C	A			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr9:35685029C>A	ENST00000360958.2	-	6	668				TPM2_ENST00000378292.3_Intron|TPM2_ENST00000378300.5_Intron|TPM2_ENST00000329305.2_Intron	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)						muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			GAGAAGGCGCCATTGCCCAGA	0.612																																						dbGAP											0													77.0	72.0	74.0					9																	35685029		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.564-225G>T	9.37:g.35685029C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	RNA	SNP	-	NULL	ENST00000360958.2	37	NULL	CCDS6587.1	9																																																																																			TPM2	-	-	ENSG00000198467		0.612	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM2	HGNC	protein_coding	OTTHUMT00000052376.1	32	0.00	0	C	NM_003289		35685029	35685029	-1	no_errors	ENST00000471212	ensembl	human	known	69_37n	rna	15	37.50	9	SNP	0.000	A
TTLL4	9654	genome.wustl.edu	37	2	219609846	219609846	+	Missense_Mutation	SNP	T	T	C			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr2:219609846T>C	ENST00000392102.1	+	6	2016	c.1676T>C	c.(1675-1677)aTt>aCt	p.I559T	TTLL4_ENST00000258398.4_Missense_Mutation_p.I559T|TTLL4_ENST00000457313.1_Missense_Mutation_p.I394T|TTLL4_ENST00000442769.1_Missense_Mutation_p.I559T	NM_014640.4	NP_055455.3	Q14679	TTLL4_HUMAN	tubulin tyrosine ligase-like family, member 4	559					protein polyglutamylation (GO:0018095)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ligase activity (GO:0016874)|tubulin binding (GO:0015631)			endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	39		Renal(207;0.0915)		Epithelial(149;5.03e-07)|all cancers(144;0.000106)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0101)		TGTATGGAAATTCTGACCAAA	0.453																																					GBM(172;1818 2053 15407 20943 49753)	dbGAP											0													180.0	173.0	175.0					2																	219609846		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2422.1	2p24.3-p24.1	2013-02-14			ENSG00000135912	ENSG00000135912		"""Tubulin tyrosine ligase-like family"""	28976	protein-coding gene	gene with protein product						11054573	Standard	NM_014640		Approved	KIAA0173	uc002viy.3	Q14679	OTTHUMG00000133081	ENST00000392102.1:c.1676T>C	2.37:g.219609846T>C	ENSP00000375951:p.Ile559Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6V5|Q8WW29	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.I559T	ENST00000392102.1	37	c.1676	CCDS2422.1	2	.	.	.	.	.	.	.	.	.	.	T	9.600	1.128345	0.21041	.	.	ENSG00000135912	ENST00000457313;ENST00000392102;ENST00000442769;ENST00000258398	T;T;T;T	0.04015	3.93;4.17;3.73;4.17	5.3	1.62	0.23740	.	1.939850	0.02186	N	0.060957	T	0.02848	0.0085	N	0.08118	0	0.09310	N	1	B;B;B	0.24092	0.097;0.02;0.097	B;B;B	0.17433	0.016;0.018;0.016	T	0.40942	-0.9536	10	0.11794	T	0.64	.	5.082	0.14661	0.0:0.2665:0.3552:0.3783	.	394;559;559	E9PH58;E7EX20;Q14679	.;.;TTLL4_HUMAN	T	394;559;559;559	ENSP00000393332:I394T;ENSP00000375951:I559T;ENSP00000396555:I559T;ENSP00000258398:I559T	ENSP00000258398:I559T	I	+	2	0	TTLL4	219318090	0.259000	0.24043	0.443000	0.26883	0.851000	0.48451	1.070000	0.30653	0.121000	0.18284	-0.331000	0.08364	ATT	TTLL4	-	NULL	ENSG00000135912		0.453	TTLL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL4	HGNC	protein_coding	OTTHUMT00000256726.1	114	0.00	0	T	NM_014640		219609846	219609846	+1	no_errors	ENST00000258398	ensembl	human	known	69_37n	missense	56	37.08	33	SNP	0.070	C
USH2A	7399	genome.wustl.edu	37	1	216172264	216172264	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A28Q-01A-11D-A16D-09	TCGA-BH-A28Q-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	0698379c-8f4e-460d-b7da-d3f6179dafd7	99e69ff4-d3d5-42b6-b7c2-292e502b9fcf	g.chr1:216172264C>T	ENST00000307340.3	-	34	7008	c.6622G>A	c.(6622-6624)Gtt>Att	p.V2208I	USH2A_ENST00000366943.2_Missense_Mutation_p.V2208I	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2208	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CCAGGTAAAACGTATTGTAGC	0.378										HNSCC(13;0.011)																												dbGAP											0													115.0	114.0	115.0					1																	216172264		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.6622G>A	1.37:g.216172264C>T	ENSP00000305941:p.Val2208Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.V2208I	ENST00000307340.3	37	c.6622	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232272	0.39498	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.53206	0.63;0.63	5.75	2.86	0.33363	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.188680	0.25430	N	0.030721	T	0.27663	0.0680	N	0.08118	0	0.09310	N	0.999999	B	0.15719	0.014	B	0.08055	0.003	T	0.24584	-1.0156	10	0.87932	D	0	.	11.4467	0.50127	0.0639:0.237:0.6991:0.0	.	2208	O75445	USH2A_HUMAN	I	2208	ENSP00000305941:V2208I;ENSP00000355910:V2208I	ENSP00000305941:V2208I	V	-	1	0	USH2A	214238887	1.000000	0.71417	0.003000	0.11579	0.005000	0.04900	4.033000	0.57282	0.351000	0.24027	-0.197000	0.12766	GTT	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.378	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	112	0.00	0	C	NM_007123		216172264	216172264	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	78	28.83	32	SNP	0.392	T
