#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB5	340273	genome.wustl.edu	37	7	20685389	20685389	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:20685389C>T	ENST00000404938.2	+	8	1341	c.689C>T	c.(688-690)tCa>tTa	p.S230L	ABCB5_ENST00000406935.1_5'Flank|ABCB5_ENST00000258738.6_5'Flank|ABCB5_ENST00000443026.2_5'Flank	NM_001163941.1	NP_001157413.1	Q2M3G0	ABCB5_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 5	230	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent (GO:0002485)|antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent (GO:0002489)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|cell differentiation (GO:0030154)|compound eye corneal lens development (GO:0048058)|positive regulation of antigen processing and presentation of peptide antigen via MHC class I (GO:0002591)|regulation of membrane potential (GO:0042391)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|efflux transmembrane transporter activity (GO:0015562)			breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(11)|liver(1)|lung(37)|ovary(1)|pancreas(1)|prostate(1)|skin(10)|upper_aerodigestive_tract(1)	77						ATGGTCATCTCATTGACCAGT	0.403																																						dbGAP											0													125.0	114.0	117.0					7																	20685389		1568	3582	5150	-	-	-	SO:0001583	missense	0			U66692	CCDS5371.1, CCDS55090.1, CCDS55091.1, CCDS55092.1	7p14	2012-03-14			ENSG00000004846	ENSG00000004846		"""ATP binding cassette transporters / subfamily B"""	46	protein-coding gene	gene with protein product	"""P-glycoprotein ABCB5"", ""ATP-binding cassette protein"""	611785				8894702, 12960149	Standard	NM_001163942		Approved	EST422562, ABCB5beta, ABCB5alpha	uc010kuh.3	Q2M3G0	OTTHUMG00000094789	ENST00000404938.2:c.689C>T	7.37:g.20685389C>T	ENSP00000384881:p.Ser230Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D131|A7BKA4|B5MD19|B7WPL1|F8QQP8|F8QQP9|J3KQ04|Q2M3I5|Q5I5Q7|Q5I5Q8|Q6KG50|Q6XFQ5|Q8IXA1	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S230L	ENST00000404938.2	37	c.689	CCDS55090.1	7	.	.	.	.	.	.	.	.	.	.	C	15.42	2.828168	0.50845	.	.	ENSG00000004846	ENST00000404938	D	0.90676	-2.71	4.79	3.91	0.45181	.	.	.	.	.	D	0.92166	0.7516	M	0.68317	2.08	0.80722	D	1	D	0.53151	0.958	P	0.55222	0.771	D	0.91832	0.5476	9	0.49607	T	0.09	.	11.625	0.51139	0.0:0.9131:0.0:0.0869	.	230	A7BKA4	.	L	230	ENSP00000384881:S230L	ENSP00000384881:S230L	S	+	2	0	ABCB5	20651914	0.810000	0.29049	0.997000	0.53966	0.337000	0.28794	3.835000	0.55805	1.628000	0.50416	-0.150000	0.13652	TCA	ABCB5	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000004846		0.403	ABCB5-004	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	ABCB5	HGNC	protein_coding	OTTHUMT00000326736.2	45	0.00	0	C	NM_178559		20685389	20685389	+1	no_errors	ENST00000404938	ensembl	human	putative	69_37n	missense	42	19.23	10	SNP	0.998	T
ABCF2	10061	genome.wustl.edu	37	7	150923404	150923404	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:150923404G>A	ENST00000287844.2	-	2	250	c.141C>T	c.(139-141)ggC>ggT	p.G47G	ABCF2_ENST00000222388.2_Silent_p.G47G	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	47					transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGGTCTCTCTGCCATTGGCCT	0.527																																						dbGAP											0													296.0	291.0	293.0					7																	150923404		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.141C>T	7.37:g.150923404G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60864|Q75MJ0|Q75MJ1|Q96TE8	Silent	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.G47	ENST00000287844.2	37	c.141	CCDS5923.1	7																																																																																			ABCF2	-	NULL	ENSG00000033050		0.527	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	139	0.00	0	G	NM_005692		150923404	150923404	-1	no_errors	ENST00000222388	ensembl	human	known	69_37n	silent	138	17.86	30	SNP	0.241	A
ACACB	32	genome.wustl.edu	37	12	109671748	109671748	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:109671748C>T	ENST00000338432.7	+	31	4364	c.4245C>T	c.(4243-4245)ctC>ctT	p.L1415L	ACACB_ENST00000543201.1_Silent_p.L81L|ACACB_ENST00000377854.5_Silent_p.L1345L|ACACB_ENST00000377848.3_Silent_p.L1415L			O00763	ACACB_HUMAN	acetyl-CoA carboxylase beta	1415					acetyl-CoA metabolic process (GO:0006084)|biotin metabolic process (GO:0006768)|carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|malonyl-CoA biosynthetic process (GO:2001295)|positive regulation of cellular metabolic process (GO:0031325)|protein homotetramerization (GO:0051289)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	acetyl-CoA carboxylase activity (GO:0003989)|ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|metal ion binding (GO:0046872)			NS(1)|breast(2)|endometrium(9)|kidney(5)|large_intestine(20)|lung(40)|ovary(6)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	95					Adenine(DB00173)|Biotin(DB00121)	CTCAGAGCCTCAGAGAAGAGC	0.587																																						dbGAP											0													66.0	59.0	61.0					12																	109671748		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89344	CCDS31898.1	12q24.1	2010-05-07	2010-04-30		ENSG00000076555	ENSG00000076555	6.4.1.2		85	protein-coding gene	gene with protein product	"""acetyl-CoA carboxylase 2"""	601557	"""acetyl-Coenzyme A carboxylase beta"""			8670171	Standard	NM_001093		Approved	HACC275, ACC2, ACCB	uc001toc.3	O00763	OTTHUMG00000169250	ENST00000338432.7:c.4245C>T	12.37:g.109671748C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK36|Q16852|Q1HEC1|Q6KE87|Q6KE89|Q6TY48	Nonsense_Mutation	SNP	pfam_Carboxyl_trans,pfam_AcCoA_COase_cen,pfscan_COA_CT_N,pfscan_COA_CT_C	p.Q82*	ENST00000338432.7	37	c.244	CCDS31898.1	12																																																																																			ACACB	-	pfam_AcCoA_COase_cen	ENSG00000076555		0.587	ACACB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACACB	HGNC	protein_coding	OTTHUMT00000403077.1	52	0.00	0	C	NM_001093		109671748	109671748	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000538526	ensembl	human	known	69_37n	nonsense	43	18.87	10	SNP	0.002	T
ADAM28	10863	genome.wustl.edu	37	8	24187543	24187543	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:24187543G>C	ENST00000265769.4	+	11	1128	c.1018G>C	c.(1018-1020)Gaa>Caa	p.E340Q	ADAM28_ENST00000397649.3_Missense_Mutation_p.E87Q|ADAM28_ENST00000540823.1_Missense_Mutation_p.E107Q|RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|ADAM28_ENST00000518516.1_3'UTR|ADAM28_ENST00000437154.2_Missense_Mutation_p.E340Q|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	340	Peptidase M12B. {ECO:0000255|PROSITE- ProRule:PRU00276}.				spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		AATGGCACATGAAATGGGCCA	0.408																																					NSCLC(193;488 2149 22258 34798 40734)	dbGAP											0													150.0	138.0	142.0					8																	24187543		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.1018G>C	8.37:g.24187543G>C	ENSP00000265769:p.Glu340Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.E340Q	ENST00000265769.4	37	c.1018	CCDS34865.1	8	.	.	.	.	.	.	.	.	.	.	G	24.6	4.544661	0.86022	.	.	ENSG00000042980	ENST00000265769;ENST00000397649;ENST00000540823;ENST00000437154	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	5.86	5.86	0.93980	Metallopeptidase, catalytic domain (1);Peptidase M12B, ADAM/reprolysin (2);	.	.	.	.	T	0.53690	0.1812	M	0.86953	2.85	0.80722	D	1	P;D;D;D	0.89917	0.938;1.0;1.0;0.993	P;D;D;D	0.91635	0.773;0.999;0.999;0.921	T	0.56135	-0.8029	9	0.51188	T	0.08	.	17.671	0.88217	0.0:0.0:1.0:0.0	.	107;340;340;340	B4DDY3;B2RMV5;Q9UKQ2;Q9UKQ2-2	.;.;ADA28_HUMAN;.	Q	340;87;107;340	ENSP00000265769:E340Q;ENSP00000380770:E87Q;ENSP00000443743:E107Q;ENSP00000393699:E340Q	ENSP00000265769:E340Q	E	+	1	0	ADAM28	24243488	1.000000	0.71417	1.000000	0.80357	0.855000	0.48748	8.082000	0.89513	2.778000	0.95560	0.655000	0.94253	GAA	ADAM28	-	pfam_Peptidase_M12B,pfscan_Peptidase_M12B	ENSG00000042980		0.408	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	47	0.00	0	G	NM_021778		24187543	24187543	+1	no_errors	ENST00000265769	ensembl	human	known	69_37n	missense	61	18.42	14	SNP	1.000	C
ADH5	128	genome.wustl.edu	37	4	99997568	99997568	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:99997568C>T	ENST00000296412.8	-	6	750	c.700G>A	c.(700-702)Gag>Aag	p.E234K	ADH5_ENST00000512991.1_5'Flank	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		GCTCCAAACTCTTTGGCCCTT	0.463																																						dbGAP											0													61.0	61.0	61.0					4																	99997568		1951	4169	6120	-	-	-	SO:0001583	missense	0			M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.700G>A	4.37:g.99997568C>T	ENSP00000296412:p.Glu234Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,tigrfam_ADH_3	p.E234K	ENST00000296412.8	37	c.700	CCDS47111.1	4	.	.	.	.	.	.	.	.	.	.	C	12.00	1.806457	0.31961	.	.	ENSG00000197894	ENST00000296412;ENST00000503130	T;T	0.04360	3.64;3.64	4.96	4.96	0.65561	Alcohol dehydrogenase, C-terminal (1);NAD(P)-binding domain (1);	0.100358	0.64402	D	0.000002	T	0.04815	0.0130	N	0.21617	0.685	0.58432	D	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.08055	0.003;0.003;0.003	T	0.49854	-0.8895	9	.	.	.	.	18.7689	0.91883	0.0:1.0:0.0:0.0	.	234;234;234	Q5U043;Q6IRT1;P11766	.;.;ADHX_HUMAN	K	234;221	ENSP00000296412:E234K;ENSP00000427049:E221K	.	E	-	1	0	ADH5	100216591	1.000000	0.71417	0.997000	0.53966	0.986000	0.74619	4.013000	0.57138	2.753000	0.94483	0.555000	0.69702	GAG	ADH5	-	pfam_ADH_C,tigrfam_ADH_3	ENSG00000197894		0.463	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH5	HGNC	protein_coding	OTTHUMT00000364224.1	50	0.00	0	C	NM_000671		99997568	99997568	-1	no_errors	ENST00000296412	ensembl	human	known	69_37n	missense	55	12.70	8	SNP	0.998	T
AFF2	2334	genome.wustl.edu	37	X	148037888	148037888	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:148037888C>T	ENST00000370460.2	+	11	2792	c.2313C>T	c.(2311-2313)atC>atT	p.I771I	AFF2_ENST00000342251.3_Silent_p.I738I|AFF2_ENST00000370457.5_Silent_p.I738I|AFF2_ENST00000286437.5_Silent_p.I412I	NM_001169123.1|NM_002025.3	NP_001162594.1|NP_002016.2	P51816	AFF2_HUMAN	AF4/FMR2 family, member 2	771					brain development (GO:0007420)|learning or memory (GO:0007611)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nuclear speck (GO:0016607)	G-quadruplex RNA binding (GO:0002151)			breast(5)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(29)|liver(2)|lung(39)|ovary(4)|pancreas(5)|prostate(1)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(1)	109	Acute lymphoblastic leukemia(192;6.56e-05)					ACTTATCCATCAGTAATGAAG	0.458																																						dbGAP											0													106.0	94.0	98.0					X																	148037888		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U48436	CCDS14684.1, CCDS55521.1, CCDS76040.1	Xq28	2008-02-05	2005-06-27	2005-06-27	ENSG00000155966	ENSG00000155966			3776	protein-coding gene	gene with protein product		300806	"""fragile X mental retardation 2"""	FMR2			Standard	NM_002025		Approved	FRAXE	uc004fcp.3	P51816	OTTHUMG00000022613	ENST00000370460.2:c.2313C>T	X.37:g.148037888C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTY4|B4DXD5|B7WNQ1|B7ZLD6|B7ZLD9|O43786|O60215|P78407|Q13521|Q14323|Q7Z2F7|Q7Z400|Q9UNA5	Silent	SNP	pfam_TF_AF4/FMR2	p.I771	ENST00000370460.2	37	c.2313	CCDS14684.1	X																																																																																			AFF2	-	pfam_TF_AF4/FMR2	ENSG00000155966		0.458	AFF2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AFF2	HGNC	protein_coding	OTTHUMT00000058673.2	70	0.00	0	C	NM_002025		148037888	148037888	+1	no_errors	ENST00000370460	ensembl	human	known	69_37n	silent	49	19.67	12	SNP	0.341	T
AGFG1	3267	genome.wustl.edu	37	2	228401659	228401659	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:228401659C>T	ENST00000310078.8	+	10	1588	c.1328C>T	c.(1327-1329)tCt>tTt	p.S443F	AGFG1_ENST00000409315.1_Missense_Mutation_p.S422F|AGFG1_ENST00000409979.2_Missense_Mutation_p.S467F|AGFG1_ENST00000373671.3_Missense_Mutation_p.S403F|AGFG1_ENST00000409171.1_Missense_Mutation_p.S443F	NM_001135188.1|NM_001135189.1|NM_004504.4	NP_001128660.1|NP_001128661.1|NP_004495.2	P52594	AGFG1_HUMAN	ArfGAP with FG repeats 1	443					cell differentiation (GO:0030154)|mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|regulation of ARF GTPase activity (GO:0032312)|spermatogenesis (GO:0007283)	cytoplasmic vesicle (GO:0031410)|intracellular membrane-bounded organelle (GO:0043231)|nuclear pore (GO:0005643)	ARF GTPase activator activity (GO:0008060)|DNA binding (GO:0003677)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(2)|ovary(1)|prostate(1)|skin(4)|stomach(1)	18						GCTGGTCCTTCTGTGGCATCT	0.358																																						dbGAP											0													98.0	99.0	98.0					2																	228401659		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2467.1, CCDS46533.1, CCDS46534.1, CCDS46535.1	2q36	2009-11-30	2008-09-22	2008-09-22	ENSG00000173744	ENSG00000173744		"""ADP-ribosylation factor GTPase activating proteins"""	5175	protein-coding gene	gene with protein product		600862	"""HIV-1 Rev binding protein"""	HRB		7637788	Standard	NM_004504		Approved	RIP, RAB	uc002vpd.2	P52594	OTTHUMG00000133186	ENST00000310078.8:c.1328C>T	2.37:g.228401659C>T	ENSP00000312059:p.Ser443Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUL1|E9PHX7|Q15277|Q4VAS0|Q4VAS1|Q4VAS3|Q53QT8|Q53R11	Missense_Mutation	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,pfscan_ArfGAP,prints_ArfGAP	p.S467F	ENST00000310078.8	37	c.1400	CCDS2467.1	2	.	.	.	.	.	.	.	.	.	.	C	18.26	3.583710	0.65992	.	.	ENSG00000173744	ENST00000409979;ENST00000542592;ENST00000310078;ENST00000409315;ENST00000373671;ENST00000409171	T;T;T;T;T	0.25414	1.83;1.86;1.8;1.8;1.86	6.06	6.06	0.98353	.	0.271361	0.38272	N	0.001748	T	0.25791	0.0628	N	0.22421	0.69	0.41711	D	0.989451	P;P;P;B	0.41569	0.755;0.729;0.612;0.412	B;P;B;B	0.45138	0.444;0.471;0.259;0.188	T	0.00998	-1.1486	10	0.28530	T	0.3	.	18.8207	0.92096	0.0:1.0:0.0:0.0	.	403;443;467;443	P52594-2;P52594-3;E9PHX7;P52594	.;.;.;AGFG1_HUMAN	F	467;452;443;422;403;443	ENSP00000387282:S467F;ENSP00000312059:S443F;ENSP00000387154:S422F;ENSP00000362775:S403F;ENSP00000387218:S443F	ENSP00000312059:S443F	S	+	2	0	AGFG1	228109903	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.484000	0.73621	2.885000	0.99019	0.655000	0.94253	TCT	AGFG1	-	NULL	ENSG00000173744		0.358	AGFG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGFG1	HGNC	protein_coding	OTTHUMT00000256895.2	99	0.00	0	C	NM_004504		228401659	228401659	+1	no_errors	ENST00000409979	ensembl	human	known	69_37n	missense	60	21.79	17	SNP	1.000	T
AHCTF1	25909	genome.wustl.edu	37	1	247031055	247031055	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:247031055C>T	ENST00000391829.2	-	25	3270	c.3147G>A	c.(3145-3147)ttG>ttA	p.L1049L	AHCTF1_ENST00000366508.1_Silent_p.L1084L|AHCTF1_ENST00000326225.3_Silent_p.L1058L|AHCTF1_ENST00000470300.1_5'UTR			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1	1049	Disordered. {ECO:0000250}.				cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			CAGATCTTGTCAACACAGTTC	0.363																																					Colon(145;197 1800 4745 15099 26333)	dbGAP											0													118.0	113.0	114.0					1																	247031055		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3147G>A	1.37:g.247031055C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	Silent	SNP	superfamily_Quinonprotein_ADH-like	p.L1058	ENST00000391829.2	37	c.3174		1																																																																																			AHCTF1	-	NULL	ENSG00000153207		0.363	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		104	0.95	1	C	NM_015446		247031055	247031055	-1	no_errors	ENST00000326225	ensembl	human	known	69_37n	silent	85	20.56	22	SNP	1.000	T
AIFM1	9131	genome.wustl.edu	37	X	129290551	129290551	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:129290551G>C	ENST00000287295.3	-	2	363	c.133C>G	c.(133-135)Cct>Gct	p.P45A	AIFM1_ENST00000535724.1_Intron|AIFM1_ENST00000346424.2_Intron|AIFM1_ENST00000319908.3_Intron	NM_001130847.3|NM_004208.3	NP_001124319.1|NP_004199.1	O95831	AIFM1_HUMAN	apoptosis-inducing factor, mitochondrion-associated, 1	45					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|cell redox homeostasis (GO:0045454)|chromosome condensation (GO:0030261)|DNA catabolic process (GO:0006308)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitochondrial respiratory chain complex I assembly (GO:0032981)|neuron apoptotic process (GO:0051402)|neuron differentiation (GO:0030182)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic DNA fragmentation (GO:1902510)	cytosol (GO:0005829)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	DNA binding (GO:0003677)|electron carrier activity (GO:0009055)|FAD binding (GO:0071949)|NAD(P)H oxidase activity (GO:0016174)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(4)|liver(2)|lung(8)|ovary(4)|prostate(2)|urinary_tract(1)	30					Flavin adenine dinucleotide(DB03147)	AGTTCTAGAGGAACATGCCAT	0.358																																						dbGAP											0													202.0	176.0	185.0					X																	129290551		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100928	CCDS14618.1, CCDS14619.1, CCDS48167.1	Xq26.1	2014-01-30	2006-11-16	2006-11-16	ENSG00000156709	ENSG00000156709			8768	protein-coding gene	gene with protein product		300169	"""programmed cell death 8 (apoptosis-inducing factor)"", ""neuropathy, axonal, motor-sensory with deafness and mental retardation (Cowchock syndrome)"""	PDCD8, NAMSD		9989411, 23217327	Standard	NM_004208		Approved	AIF, CMTX4	uc004evg.3	O95831	OTTHUMG00000022392	ENST00000287295.3:c.133C>G	X.37:g.129290551G>C	ENSP00000287295:p.Pro45Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPB4|B1ALN1|B2RB08|D3DTE9|Q1L6K4|Q1L6K6|Q2QKE4|Q5JUZ7|Q6I9X6|Q9Y3I3|Q9Y3I4	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_OxRdtase_NAD-bd_dom,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase	p.P45A	ENST00000287295.3	37	c.133	CCDS14618.1	X	.	.	.	.	.	.	.	.	.	.	G	13.48	2.250741	0.39797	.	.	ENSG00000156709	ENST00000287295	T	0.22743	1.94	5.49	5.49	0.81192	.	0.101407	0.64402	D	0.000006	T	0.19604	0.0471	L	0.56769	1.78	0.80722	D	1	P;P	0.47302	0.893;0.671	B;B	0.37692	0.256;0.134	T	0.08493	-1.0719	10	0.07030	T	0.85	-9.89	16.6129	0.84899	0.0:0.0:1.0:0.0	.	45;45	Q1L6K6;O95831	.;AIFM1_HUMAN	A	45	ENSP00000287295:P45A	ENSP00000287295:P45A	P	-	1	0	AIFM1	129118232	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.853000	0.69496	2.296000	0.77279	0.538000	0.68166	CCT	AIFM1	-	NULL	ENSG00000156709		0.358	AIFM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIFM1	HGNC	protein_coding	OTTHUMT00000058247.2	46	0.00	0	G			129290551	129290551	-1	no_errors	ENST00000287295	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	1.000	C
ALG10	84920	genome.wustl.edu	37	12	34175615	34175615	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:34175615C>T	ENST00000266483.2	+	1	400	c.81C>T	c.(79-81)ttC>ttT	p.F27F	RP11-847H18.2_ENST00000501954.2_RNA|ALG10_ENST00000538927.1_Silent_p.F27F	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase	27					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				TCTCCGCCTTCAGCCGGGCGT	0.597																																						dbGAP											0													177.0	189.0	185.0					12																	34175615		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.81C>T	12.37:g.34175615C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NS98|Q96DU0|Q96SM6	Silent	SNP	pfam_Glycosyltransferase_ALG10,pirsf_Alpha1_2_glucosyltferase_Alg10	p.F27	ENST00000266483.2	37	c.81	CCDS41769.1	12																																																																																			ALG10	-	pirsf_Alpha1_2_glucosyltferase_Alg10	ENSG00000139133		0.597	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALG10	HGNC	protein_coding	OTTHUMT00000403309.1	64	0.00	0	C	NM_032834		34175615	34175615	+1	no_errors	ENST00000266483	ensembl	human	known	69_37n	silent	62	20.51	16	SNP	1.000	T
ALDH1L2	160428	genome.wustl.edu	37	12	105464405	105464405	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:105464405G>C	ENST00000258494.9	-	3	511	c.371C>G	c.(370-372)tCt>tGt	p.S124C	RP11-61E11.1_ENST00000547750.1_RNA|ALDH1L2_ENST00000424857.2_Missense_Mutation_p.S124C	NM_001034173.3	NP_001029345.2	Q3SY69	AL1L2_HUMAN	aldehyde dehydrogenase 1 family, member L2	124	GART.				10-formyltetrahydrofolate catabolic process (GO:0009258)|biosynthetic process (GO:0009058)|one-carbon metabolic process (GO:0006730)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	formyltetrahydrofolate dehydrogenase activity (GO:0016155)|hydroxymethyl-, formyl- and related transferase activity (GO:0016742)|methyltransferase activity (GO:0008168)|oxidoreductase activity, acting on the aldehyde or oxo group of donors, NAD or NADP as acceptor (GO:0016620)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(13)|prostate(2)|skin(3)|stomach(2)	35						ATAAATGATAGAGCCGTGCTT	0.448																																						dbGAP											0													103.0	93.0	97.0					12																	105464405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095827	CCDS31891.1	12q23.3	2014-09-11			ENSG00000136010	ENSG00000136010	1.5.1.6	"""Aldehyde dehydrogenases"""	26777	protein-coding gene	gene with protein product	"""mitochondrial 10-formyltetrahydrofolate dehydrogenase"""	613584				20498374	Standard	NM_001034173		Approved	FLJ38508, mtFDH	uc001tlc.3	Q3SY69	OTTHUMG00000169823	ENST00000258494.9:c.371C>G	12.37:g.105464405G>C	ENSP00000258494:p.Ser124Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SY68|Q68D62|Q6AI55|Q8N922	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,pfam_Formyl_transf_N,pfam_Formyl_trans_C,pfam_Acyl_carrier_prot-like,superfamily_Ald_DH/histidinol_DH,superfamily_Formyl_transf_N,superfamily_Formyl_transferase_C-like,superfamily_Acyl_carrier_prot-like,pirsf_10_FTHF_DH,pfscan_Acyl_carrier_prot-like	p.S124C	ENST00000258494.9	37	c.371	CCDS31891.1	12	.	.	.	.	.	.	.	.	.	.	G	22.8	4.338666	0.81911	.	.	ENSG00000136010	ENST00000258494;ENST00000424857	T;T	0.75821	-0.97;-0.97	5.27	5.27	0.74061	Formyl transferase, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.79851	0.4517	N	0.20881	0.62	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.82647	-0.0354	10	0.87932	D	0	.	19.2583	0.93955	0.0:0.0:1.0:0.0	.	124	Q3SY69	AL1L2_HUMAN	C	124	ENSP00000258494:S124C;ENSP00000389608:S124C	ENSP00000258494:S124C	S	-	2	0	ALDH1L2	103988535	1.000000	0.71417	0.998000	0.56505	0.963000	0.63663	9.822000	0.99363	2.640000	0.89533	0.655000	0.94253	TCT	ALDH1L2	-	pfam_Formyl_transf_N,superfamily_Formyl_transf_N,pirsf_10_FTHF_DH	ENSG00000136010		0.448	ALDH1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1L2	HGNC	protein_coding	OTTHUMT00000406098.1	75	0.00	0	G	XM_090294		105464405	105464405	-1	no_errors	ENST00000258494	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	C
ANKAR	150709	genome.wustl.edu	37	2	190606108	190606108	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:190606108C>T	ENST00000520309.1	+	20	3829	c.3741C>T	c.(3739-3741)atC>atT	p.I1247I	ANKAR_ENST00000431575.2_Silent_p.I1176I|ANKAR_ENST00000438402.2_3'UTR|ANKAR_ENST00000313581.4_Silent_p.I1247I|ANKAR_ENST00000281412.6_3'UTR	NM_144708.3	NP_653309.3	Q7Z5J8	ANKAR_HUMAN	ankyrin and armadillo repeat containing	1247						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|liver(2)|lung(16)|ovary(2)|pancreas(1)|skin(1)|urinary_tract(2)	46			OV - Ovarian serous cystadenocarcinoma(117;0.00156)|Epithelial(96;0.0256)|all cancers(119;0.0744)			GAGCTGGTATCCCAGAAGCAT	0.318																																						dbGAP											0													69.0	70.0	70.0					2																	190606108		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ549812	CCDS33351.1, CCDS33351.2	2q32.2	2013-02-14			ENSG00000151687	ENSG00000151687		"""Ankyrin repeat domain containing"", ""Armadillo repeat containing"""	26350	protein-coding gene	gene with protein product		609803				15110750	Standard	NM_144708		Approved	FLJ25415	uc002uqw.2	Q7Z5J8	OTTHUMG00000154398	ENST00000520309.1:c.3741C>T	2.37:g.190606108C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3ZCS6|Q4G0M2|Q6ZU02	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Armadillo,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Armadillo	p.I1247	ENST00000520309.1	37	c.3741	CCDS33351.2	2																																																																																			ANKAR	-	superfamily_ARM-type_fold,smart_Armadillo	ENSG00000151687		0.318	ANKAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKAR	HGNC	protein_coding	OTTHUMT00000335045.3	29	0.00	0	C	NM_144708		190606108	190606108	+1	no_errors	ENST00000313581	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	1.000	T
ANKRD18A	253650	genome.wustl.edu	37	9	38596034	38596034	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:38596034C>T	ENST00000399703.5	-	9	1677	c.1303G>A	c.(1303-1305)Gaa>Aaa	p.E435K		NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A	435										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						TCCACAATTTCATTGTACTCA	0.353																																						dbGAP											0													176.0	140.0	151.0					9																	38596034		692	1591	2283	-	-	-	SO:0001583	missense	0			AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.1303G>A	9.37:g.38596034C>T	ENSP00000382610:p.Glu435Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	Missense_Mutation	SNP	pfam_DUF3496,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E435K	ENST00000399703.5	37	c.1303	CCDS55311.1	9	.	.	.	.	.	.	.	.	.	.	C	4.927	0.172198	0.09391	.	.	ENSG00000180071	ENST00000399703	T	0.14022	2.54	1.47	-2.95	0.05564	.	.	.	.	.	T	0.09247	0.0228	L	0.41710	1.295	0.09310	N	1	B	0.20459	0.045	B	0.09377	0.004	T	0.30909	-0.9962	9	0.46703	T	0.11	.	4.4296	0.11520	0.0:0.3688:0.2586:0.3726	.	435	Q8IVF6	AN18A_HUMAN	K	435	ENSP00000382610:E435K	ENSP00000382610:E435K	E	-	1	0	ANKRD18A	38586034	0.044000	0.20184	0.000000	0.03702	0.000000	0.00434	0.510000	0.22723	-0.789000	0.04498	-0.539000	0.04255	GAA	ANKRD18A	-	NULL	ENSG00000180071		0.353	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD18A	HGNC	protein_coding	OTTHUMT00000052506.3	139	0.00	0	C			38596034	38596034	-1	no_errors	ENST00000399703	ensembl	human	known	69_37n	missense	110	16.03	21	SNP	0.000	T
ANXA10	11199	genome.wustl.edu	37	4	169083772	169083772	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:169083772G>A	ENST00000359299.3	+	4	475	c.289G>A	c.(289-291)Gag>Aag	p.E97K		NM_007193.4	NP_009124.2	Q9UJ72	ANX10_HUMAN	annexin A10	97						mitochondrion (GO:0005739)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)			endometrium(1)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(2)	16		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.0325)		TGATGCTCATGAGCTCTGGCA	0.493																																						dbGAP											0													107.0	93.0	97.0					4																	169083772		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238979	CCDS34096.1	4q32.3	2008-02-05			ENSG00000109511	ENSG00000109511		"""Annexins"""	534	protein-coding gene	gene with protein product		608008				10458909	Standard	NM_007193		Approved	ANX14	uc003irm.3	Q9UJ72	OTTHUMG00000161275	ENST00000359299.3:c.289G>A	4.37:g.169083772G>A	ENSP00000352248:p.Glu97Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96IQ5|Q9UJV4	Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinX	p.E97K	ENST00000359299.3	37	c.289	CCDS34096.1	4	.	.	.	.	.	.	.	.	.	.	G	24.1	4.491341	0.84962	.	.	ENSG00000109511	ENST00000359299;ENST00000393751	T	0.03358	3.96	5.2	5.2	0.72013	.	0.155389	0.44688	D	0.000434	T	0.09247	0.0228	L	0.45352	1.415	0.46542	D	0.999095	P	0.50819	0.939	P	0.51453	0.67	T	0.01767	-1.1278	10	0.87932	D	0	.	17.8557	0.88762	0.0:0.0:1.0:0.0	.	97	Q9UJ72	ANX10_HUMAN	K	97	ENSP00000352248:E97K	ENSP00000352248:E97K	E	+	1	0	ANXA10	169320347	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	6.901000	0.75693	2.594000	0.87642	0.585000	0.79938	GAG	ANXA10	-	pfam_Annexin_repeat,superfamily_Annexin	ENSG00000109511		0.493	ANXA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA10	HGNC	protein_coding	OTTHUMT00000364348.2	70	0.00	0	G	NM_007193		169083772	169083772	+1	no_errors	ENST00000359299	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	1.000	A
AP1B1	162	genome.wustl.edu	37	22	29727487	29727487	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:29727487G>A	ENST00000405198.1	-	18	2506	c.2475C>T	c.(2473-2475)ttC>ttT	p.F825F	AP1B1_ENST00000356015.2_Silent_p.F818F|AP1B1_ENST00000317368.7_Silent_p.F798F|SNORD125_ENST00000459538.1_RNA|AP1B1_ENST00000357586.2_Silent_p.F825F|AP1B1_ENST00000415447.1_Silent_p.F818F|AP1B1_ENST00000402502.1_Silent_p.F818F|AP1B1_ENST00000472057.1_5'UTR|AP1B1_ENST00000432560.2_Silent_p.F818F			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	825					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						ACAAGGTGCTGAAGTAGAAGA	0.592																																						dbGAP											0													190.0	180.0	183.0					22																	29727487		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.2475C>T	22.37:g.29727487G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Silent	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.F825	ENST00000405198.1	37	c.2475	CCDS13855.1	22																																																																																			AP1B1	-	superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig	ENSG00000100280		0.592	AP1B1-001	KNOWN	basic|CCDS	protein_coding	AP1B1	HGNC	protein_coding	OTTHUMT00000321374.1	54	0.00	0	G	NM_001127		29727487	29727487	-1	no_errors	ENST00000357586	ensembl	human	known	69_37n	silent	52	16.13	10	SNP	1.000	A
AP3M1	26985	genome.wustl.edu	37	10	75898029	75898029	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:75898029C>G	ENST00000355264.4	-	2	420	c.109G>C	c.(109-111)Gag>Cag	p.E37Q	AP3M1_ENST00000372745.1_Missense_Mutation_p.E37Q|AP3M1_ENST00000487653.1_5'UTR	NM_012095.4	NP_036227.1	Q9Y2T2	AP3M1_HUMAN	adaptor-related protein complex 3, mu 1 subunit	37					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|protein targeting to lysosome (GO:0006622)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	Rab GTPase binding (GO:0017137)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(1)|lung(1)|prostate(1)|skin(1)	13	Prostate(51;0.0112)					GCAGCTTTCTCTTGAGCTTCA	0.418																																						dbGAP											0													126.0	116.0	120.0					10																	75898029		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF092092	CCDS7342.1	10q22.1-q22.3	2008-07-07			ENSG00000185009	ENSG00000185009			569	protein-coding gene	gene with protein product		610366				10024875	Standard	NM_207012		Approved		uc001jwh.3	Q9Y2T2	OTTHUMG00000018497	ENST00000355264.4:c.109G>C	10.37:g.75898029C>G	ENSP00000347408:p.Glu37Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JQ12|Q9H5L2	Missense_Mutation	SNP	pfam_Clathrin_mu_C,pfam_AP_mu_sigma_su,superfamily_Clathrin_mu_C,superfamily_Longin-like_dom,pirsf_Clathrin_mu,pfscan_Clathrin_mu_C,prints_Clathrin_mu	p.E37Q	ENST00000355264.4	37	c.109	CCDS7342.1	10	.	.	.	.	.	.	.	.	.	.	C	15.26	2.781556	0.49891	.	.	ENSG00000185009	ENST00000355264;ENST00000372745	T;T	0.76578	-1.03;-1.03	5.82	4.89	0.63831	Longin-like (1);AP complex, mu/sigma subunit (1);	0.000000	0.85682	D	0.000000	T	0.65575	0.2704	N	0.21448	0.665	0.58432	D	0.999998	B;B	0.15141	0.001;0.012	B;B	0.15870	0.004;0.014	T	0.59204	-0.7498	10	0.16896	T	0.51	.	17.0271	0.86450	0.0:0.8734:0.1266:0.0	.	37;37	B4DRN6;Q9Y2T2	.;AP3M1_HUMAN	Q	37	ENSP00000347408:E37Q;ENSP00000361831:E37Q	ENSP00000347408:E37Q	E	-	1	0	AP3M1	75568035	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.487000	0.81328	2.756000	0.94617	0.563000	0.77884	GAG	AP3M1	-	pfam_AP_mu_sigma_su,superfamily_Longin-like_dom,pirsf_Clathrin_mu	ENSG00000185009		0.418	AP3M1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3M1	HGNC	protein_coding	OTTHUMT00000048747.1	54	0.00	0	C			75898029	75898029	-1	no_errors	ENST00000355264	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	1.000	G
APLNR	187	genome.wustl.edu	37	11	57004167	57004167	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:57004167G>C	ENST00000606794.1	-	1	508	c.312C>G	c.(310-312)ctC>ctG	p.L104L		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	104					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GGTAGCTGCTGAGCTTGCAGA	0.607																																						dbGAP											0													75.0	55.0	62.0					11																	57004167		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.312C>G	11.37:g.57004167G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_APJ_rcpt,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_ATII_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.L104	ENST00000606794.1	37	c.312	CCDS7950.1	11																																																																																			APLNR	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_P2_purnocptor,pfscan_GPCR_Rhodpsn_supfam	ENSG00000134817		0.607	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	20	0.00	0	G	NM_005161		57004167	57004167	-1	no_errors	ENST00000257254	ensembl	human	known	69_37n	silent	11	35.29	6	SNP	1.000	C
AR	367	genome.wustl.edu	37	X	66931473	66931473	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:66931473C>T	ENST00000374690.3	+	4	2639	c.2115C>T	c.(2113-2115)ctC>ctT	p.L705L	AR_ENST00000396043.2_Silent_p.L173L|AR_ENST00000396044.3_Silent_p.L705L	NM_000044.3	NP_000035.2	P10275	ANDR_HUMAN	androgen receptor	704	Interaction with KAT7.|Interaction with LPXN.|Ligand-binding.		N -> S (in AIS). {ECO:0000269|PubMed:1480178, ECO:0000269|PubMed:7671849}.|N -> Y (in AIS). {ECO:0000269|PubMed:11744994}.		androgen receptor signaling pathway (GO:0030521)|cell death (GO:0008219)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of integrin biosynthetic process (GO:0045720)|positive regulation of cell proliferation (GO:0008284)|positive regulation of integrin biosynthetic process (GO:0045726)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphorylation (GO:0042327)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|prostate gland development (GO:0030850)|protein oligomerization (GO:0051259)|regulation of establishment of protein localization to plasma membrane (GO:0090003)|sex differentiation (GO:0007548)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transport (GO:0006810)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	androgen binding (GO:0005497)|androgen receptor activity (GO:0004882)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(20)|ovary(3)|prostate(11)|stomach(2)|upper_aerodigestive_tract(3)	67	all_cancers(1;0.173)|Prostate(1;2.27e-16)|all_epithelial(1;0.102)	all_lung(315;1.3e-11)			Bicalutamide(DB01128)|Cyproterone acetate(DB04839)|Danazol(DB01406)|Drospirenone(DB01395)|Drostanolone(DB00858)|Enzalutamide(DB08899)|Fludrocortisone(DB00687)|Fluoxymesterone(DB01185)|Flutamide(DB00499)|Ketoconazole(DB01026)|Levonorgestrel(DB00367)|Methyltestosterone(DB06710)|Nandrolone decanoate(DB08804)|Nandrolone phenpropionate(DB00984)|Nilutamide(DB00665)|Oxandrolone(DB00621)|Spironolactone(DB00421)|Testosterone Propionate(DB01420)|Testosterone(DB00624)	TCTCTAGCCTCAATGAACTGG	0.532									Androgen Insensitivity Syndrome																													dbGAP											0													88.0	68.0	75.0					X																	66931473		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	CAIS, Testicular Feminisation, AIS, Morris syndrome; incl. Reifenstein Syndrome	M20132	CCDS14387.1, CCDS43965.1	Xq12	2013-01-16	2008-08-07		ENSG00000169083	ENSG00000169083		"""Nuclear hormone receptors"""	644	protein-coding gene	gene with protein product	"""testicular feminization"", ""Kennedy disease"""	313700	"""dihydrotestosterone receptor"", ""spinal and bulbar muscular atrophy"""	DHTR, SBMA		3353726, 3377788	Standard	NM_000044		Approved	AIS, NR3C4, SMAX1, HUMARA	uc004dwu.2	P10275	OTTHUMG00000021740	ENST00000374690.3:c.2115C>T	X.37:g.66931473C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUN2|B1AKD7|Q9UD95	Silent	SNP	pfam_Andrgn_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,prints_Andrgn_rcpt,prints_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt	p.L705	ENST00000374690.3	37	c.2115	CCDS14387.1	X																																																																																			AR	-	superfamily_Nucl_hormone_rcpt_ligand-bd	ENSG00000169083		0.532	AR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AR	HGNC	protein_coding	OTTHUMT00000057007.1	59	0.00	0	C	NM_000044		66931473	66931473	+1	no_errors	ENST00000374690	ensembl	human	known	69_37n	silent	44	15.38	8	SNP	0.999	T
ARHGEF11	9826	genome.wustl.edu	37	1	156946799	156946799	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:156946799C>G	ENST00000361409.2	-	7	1300	c.558G>C	c.(556-558)ctG>ctC	p.L186L	ARHGEF11_ENST00000368194.3_Silent_p.L186L	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	186					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTTCCTGCCTCAGCATATTCC	0.433																																						dbGAP											0													170.0	147.0	155.0					1																	156946799		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.558G>C	1.37:g.156946799C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVD0|Q5VY40|Q6PFW2	Silent	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.L186	ENST00000361409.2	37	c.558	CCDS1162.1	1																																																																																			ARHGEF11	-	NULL	ENSG00000132694		0.433	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	71	0.00	0	C	NM_198236		156946799	156946799	-1	no_errors	ENST00000368194	ensembl	human	known	69_37n	silent	70	12.50	10	SNP	1.000	G
ARF1	375	genome.wustl.edu	37	1	228284917	228284917	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:228284917C>G	ENST00000541182.1	+	2	364	c.102C>G	c.(100-102)ctC>ctG	p.L34L	ARF1_ENST00000540651.1_Silent_p.L34L|ARF1_ENST00000478424.1_3'UTR|MIR3620_ENST00000584469.1_RNA|ARF1_ENST00000272102.5_Silent_p.L34L	NM_001024227.1|NM_001024228.1	NP_001019398.1|NP_001019399.1	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	34					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular copper ion homeostasis (GO:0006878)|COPI coating of Golgi vesicle (GO:0048205)|dendritic spine organization (GO:0097061)|GTP catabolic process (GO:0006184)|long term synaptic depression (GO:0060292)|membrane organization (GO:0061024)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|regulation of defense response to virus by virus (GO:0050690)|regulation of receptor internalization (GO:0002090)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)	10		Prostate(94;0.0405)				CCACGATCCTCTACAAGCTTA	0.572																																						dbGAP											0													96.0	84.0	88.0					1																	228284917		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M84326	CCDS1565.1	1q42.13	2014-01-30			ENSG00000143761	ENSG00000143761		"""ADP-ribosylation factors"", ""Endogenous ligands"""	652	protein-coding gene	gene with protein product		103180				1577740	Standard	NM_001658		Approved		uc001hrr.3	P84077	OTTHUMG00000037595	ENST00000541182.1:c.102C>G	1.37:g.228284917C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P10947|P32889	Silent	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L34	ENST00000541182.1	37	c.102	CCDS1565.1	1																																																																																			ARF1	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000143761		0.572	ARF1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF1	HGNC	protein_coding	OTTHUMT00000091650.1	30	0.00	0	C	NM_001024227		228284917	228284917	+1	no_errors	ENST00000272102	ensembl	human	known	69_37n	silent	34	12.82	5	SNP	0.994	G
ARHGEF12	23365	genome.wustl.edu	37	11	120312872	120312872	+	Missense_Mutation	SNP	C	C	G	rs200039833		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:120312872C>G	ENST00000397843.2	+	15	1429	c.1263C>G	c.(1261-1263)atC>atG	p.I421M	ARHGEF12_ENST00000532993.1_Missense_Mutation_p.I318M|ARHGEF12_ENST00000356641.3_Missense_Mutation_p.I402M	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	421	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		CTCGTCGCATCTTCCTTGAGT	0.383			T	MLL	AML																																	dbGAP		Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													142.0	121.0	127.0					11																	120312872		1867	4107	5974	-	-	-	SO:0001583	missense	0			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1263C>G	11.37:g.120312872C>G	ENSP00000380942:p.Ile421Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O15086|Q6P526	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.I402M	ENST00000397843.2	37	c.1206	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	C	17.52	3.411130	0.62399	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	D;D;D	0.82255	-1.59;-1.59;-1.59	5.45	5.45	0.79879	Regulator of G protein signalling superfamily (1);Regulator of G protein signalling-like fold (1);	0.285219	0.24407	N	0.038784	T	0.82153	0.4975	L	0.44542	1.39	0.31071	N	0.713051	B;P;P	0.36222	0.244;0.488;0.544	P;B;B	0.44732	0.459;0.301;0.427	D	0.83591	0.0123	10	0.54805	T	0.06	-0.0464	13.1545	0.59509	0.0:0.9236:0.0:0.0764	.	318;402;421	B4DGW2;Q9NZN5-2;Q9NZN5	.;.;ARHGC_HUMAN	M	421;402;318	ENSP00000380942:I421M;ENSP00000349056:I402M;ENSP00000432984:I318M	ENSP00000349056:I402M	I	+	3	3	ARHGEF12	119818082	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.560000	0.23500	2.706000	0.92434	0.650000	0.86243	ATC	ARHGEF12	-	pfam_Regulat_G_prot_signal-like,superfamily_Regulat_G_prot_signal_superfam	ENSG00000196914		0.383	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	101	0.00	0	C	NM_015313		120312872	120312872	+1	no_errors	ENST00000356641	ensembl	human	known	69_37n	missense	80	26.61	29	SNP	1.000	G
ARHGEF18	23370	genome.wustl.edu	37	19	7511959	7511959	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:7511959G>C	ENST00000359920.6	+	5	1331	c.1078G>C	c.(1078-1080)Gaa>Caa	p.E360Q	CTD-2207O23.3_ENST00000593531.1_Missense_Mutation_p.K317N|ARHGEF18_ENST00000319670.9_Missense_Mutation_p.E202Q	NM_001130955.1	NP_001124427.1	Q6ZSZ5	ARHGI_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 18	360	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transforming growth factor beta receptor signaling pathway (GO:0007179)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|ovary(2)|prostate(2)|stomach(1)|urinary_tract(1)	23		Renal(5;0.0902)				GAGAATGAAAGAAAAGTACGG	0.343																																						dbGAP											0													81.0	79.0	80.0					19																	7511959		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074372	CCDS12177.1, CCDS45946.1	19p13.3	2013-01-10	2009-06-12			ENSG00000104880		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	17090	protein-coding gene	gene with protein product	"""Rho-specific guanine nucleotide exchange factor p114"""		"""rho/rac guanine nucleotide exchange factor (GEF) 18"""			9628581, 11318610	Standard	NM_015318		Approved	P114-RhoGEF, KIAA0521, MGC15913	uc002mgi.3	Q6ZSZ5		ENST00000359920.6:c.1078G>C	19.37:g.7511959G>C	ENSP00000352995:p.Glu360Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV62|B5ME81|O60274|Q6DD92	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.E360Q	ENST00000359920.6	37	c.1078	CCDS45946.1	19	.	.	.	.	.	.	.	.	.	.	G	16.97	3.270004	0.59540	.	.	ENSG00000104880	ENST00000319670;ENST00000359920	T;T	0.63255	-0.03;-0.03	4.85	3.81	0.43845	Dbl homology (DH) domain (5);	0.103986	0.42053	D	0.000772	T	0.45856	0.1363	N	0.20401	0.57	0.53005	D	0.999969	B;B	0.24186	0.08;0.099	B;B	0.25759	0.037;0.063	T	0.36625	-0.9740	10	0.40728	T	0.16	-11.8095	10.908	0.47092	0.0924:0.0:0.9076:0.0	.	202;360	Q6ZSZ5-2;Q6ZSZ5	.;ARHGI_HUMAN	Q	202;360	ENSP00000319200:E202Q;ENSP00000352995:E360Q	ENSP00000319200:E202Q	E	+	1	0	ARHGEF18	7417959	1.000000	0.71417	0.999000	0.59377	0.712000	0.41017	4.642000	0.61383	1.033000	0.39918	0.561000	0.74099	GAA	ARHGEF18	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain	ENSG00000104880		0.343	ARHGEF18-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF18	HGNC	protein_coding	OTTHUMT00000436340.1	78	0.00	0	G	NM_015318		7511959	7511959	+1	no_errors	ENST00000359920	ensembl	human	known	69_37n	missense	53	19.70	13	SNP	1.000	C
ARIH1	25820	genome.wustl.edu	37	15	72874491	72874491	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:72874491C>A	ENST00000379887.4	+	13	1866	c.1552C>A	c.(1552-1554)Ctg>Atg	p.L518M	ARIH1_ENST00000562891.1_3'UTR	NM_005744.3	NP_005735.2	Q9Y4X5	ARI1_HUMAN	ariadne RBR E3 ubiquitin protein ligase 1	518					cytokine-mediated signaling pathway (GO:0019221)|protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ubiquitin ligase complex (GO:0000151)	small conjugating protein ligase activity (GO:0019787)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(4)|large_intestine(3)|lung(4)|prostate(1)|skin(1)	14						CCAAGATTCTCTGCAGGATAT	0.368																																						dbGAP											0													96.0	97.0	97.0					15																	72874491		2198	4297	6495	-	-	-	SO:0001583	missense	0			AF072832	CCDS10244.1	15q24	2013-10-03	2013-10-03		ENSG00000166233	ENSG00000166233			689	protein-coding gene	gene with protein product	"""ariadne, Drosophila, homolog of"""	605624	"""ariadne (Drosophila) homolog, ubiquitin-conjugating enzyme E2-binding protein, 1"", ""ariadne homolog, ubiquitin-conjugating enzyme E2 binding protein, 1 (Drosophila)"""			10521492, 24058416	Standard	NM_005744		Approved	HARI, HHARI, UBCH7BP, ARI	uc002aut.4	Q9Y4X5	OTTHUMG00000133474	ENST00000379887.4:c.1552C>A	15.37:g.72874491C>A	ENSP00000369217:p.Leu518Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6U3|O76026|Q9H3T6|Q9UEN0|Q9UP39	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.L518M	ENST00000379887.4	37	c.1552	CCDS10244.1	15	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177594	0.78564	.	.	ENSG00000166233	ENST00000379887;ENST00000299305	D	0.87571	-2.27	5.54	4.61	0.57282	.	0.000000	0.64402	D	0.000001	D	0.93851	0.8033	M	0.89214	3.015	0.80722	D	1	D	0.89917	1.0	D	0.71656	0.974	D	0.94423	0.7642	10	0.62326	D	0.03	.	14.8201	0.70065	0.0:0.9298:0.0:0.0702	.	518	Q9Y4X5	ARI1_HUMAN	M	518;488	ENSP00000369217:L518M	ENSP00000299305:L488M	L	+	1	2	ARIH1	70661545	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.448000	0.60027	2.621000	0.88768	0.644000	0.83932	CTG	ARIH1	-	NULL	ENSG00000166233		0.368	ARIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH1	HGNC	protein_coding	OTTHUMT00000257350.1	76	0.00	0	C	NM_005744		72874491	72874491	+1	no_errors	ENST00000379887	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	1.000	A
ARL5B	221079	genome.wustl.edu	37	10	18962960	18962960	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:18962960G>A	ENST00000377275.3	+	5	620	c.387G>A	c.(385-387)atG>atA	p.M129I		NM_178815.3	NP_848930.1	Q96KC2	ARL5B_HUMAN	ADP-ribosylation factor-like 5B	129					small GTPase mediated signal transduction (GO:0007264)	intracellular (GO:0005622)	GTP binding (GO:0005525)			lung(1)|ovary(1)	2						AACAGGATATGAAAGGGTGTA	0.378																																						dbGAP											0													125.0	112.0	116.0					10																	18962960		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF494061	CCDS7131.1	10p13	2014-05-09	2005-11-03	2005-11-03	ENSG00000165997	ENSG00000165997		"""ADP-ribosylation factors-like"", ""ADP-ribosylation factors"""	23052	protein-coding gene	gene with protein product		608909	"""ADP-ribosylation factor-like 8"""	ARL8		12853149	Standard	XM_005252400		Approved		uc001iqd.1	Q96KC2	OTTHUMG00000017765	ENST00000377275.3:c.387G>A	10.37:g.18962960G>A	ENSP00000366487:p.Met129Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_MIRO-like,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.M129I	ENST00000377275.3	37	c.387	CCDS7131.1	10	.	.	.	.	.	.	.	.	.	.	G	15.54	2.863394	0.51482	.	.	ENSG00000165997	ENST00000377275	T	0.81415	-1.49	5.72	5.72	0.89469	Small GTP-binding protein domain (1);	0.071725	0.85682	D	0.000000	T	0.63379	0.2506	N	0.03177	-0.4	0.58432	D	0.999999	B	0.02656	0.0	B	0.04013	0.001	T	0.62421	-0.6858	10	0.87932	D	0	-10.4428	14.6986	0.69139	0.0:0.0:0.855:0.145	.	129	Q96KC2	ARL5B_HUMAN	I	129	ENSP00000366487:M129I	ENSP00000366487:M129I	M	+	3	0	ARL5B	19002966	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.578000	0.74032	2.700000	0.92200	0.563000	0.77884	ATG	ARL5B	-	pfam_Small_GTPase_ARF/SAR,pfam_Small_GTPase,pfam_SRP_receptor_beta_su,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000165997		0.378	ARL5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARL5B	HGNC	protein_coding	OTTHUMT00000047078.1	56	0.00	0	G	NM_178815		18962960	18962960	+1	no_errors	ENST00000377275	ensembl	human	known	69_37n	missense	46	23.33	14	SNP	1.000	A
ARMCX3	51566	genome.wustl.edu	37	X	100880812	100880812	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:100880812C>T	ENST00000341189.4	+	5	1709	c.843C>T	c.(841-843)ctC>ctT	p.L281L	ARMCX3_ENST00000537169.1_Silent_p.L281L|RP4-545K15.5_ENST00000564612.1_RNA|ARMCX3-AS1_ENST00000454228.1_RNA|ARMCX3_ENST00000471229.2_Silent_p.L281L	NM_016607.3	NP_057691.1	Q9UH62	ARMX3_HUMAN	armadillo repeat containing, X-linked 3	281					cellular protein localization (GO:0034613)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	integral component of mitochondrial outer membrane (GO:0031307)				endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(2)	11						GGGAACTGCTCAGGGCCCAAG	0.383																																						dbGAP											0													56.0	52.0	53.0					X																	100880812		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AY359079	CCDS14489.1	Xq22.1	2014-03-21			ENSG00000102401	ENSG00000102401		"""Armadillo repeat containing"""	24065	protein-coding gene	gene with protein product		300364				11162520, 11042152, 19304657, 16221301, 22569362	Standard	NM_016607		Approved	ALEX3, GASP6	uc004eia.1	Q9UH62	OTTHUMG00000022035	ENST00000341189.4:c.843C>T	X.37:g.100880812C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HC6|Q7LCF5|Q9NPE4	Silent	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold,pfscan_Armadillo	p.L281	ENST00000341189.4	37	c.843	CCDS14489.1	X																																																																																			ARMCX3	-	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	ENSG00000102401		0.383	ARMCX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARMCX3	HGNC	protein_coding	OTTHUMT00000057568.2	27	0.00	0	C	NM_016607		100880812	100880812	+1	no_errors	ENST00000341189	ensembl	human	known	69_37n	silent	16	20.00	4	SNP	1.000	T
ASAP1	50807	genome.wustl.edu	37	8	131179788	131179788	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:131179788C>T	ENST00000518721.1	-	11	1130	c.903G>A	c.(901-903)caG>caA	p.Q301Q	ASAP1_ENST00000357668.1_Silent_p.Q301Q	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	301					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						TTACTTCTTTCTGATCCAGTT	0.383																																						dbGAP											0													251.0	256.0	254.0					8																	131179788		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.903G>A	8.37:g.131179788C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_ArfGAP,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.E119K	ENST00000518721.1	37	c.355	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	C	9.892	1.204463	0.22205	.	.	ENSG00000153317	ENST00000524124	.	.	.	5.94	5.94	0.96194	.	.	.	.	.	T	0.74604	0.3738	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.71784	-0.4488	4	.	.	.	.	17.8596	0.88777	0.0:1.0:0.0:0.0	.	.	.	.	K	119	.	.	E	-	1	0	ASAP1	131248970	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.257000	0.51500	2.820000	0.97059	0.650000	0.86243	GAA	ASAP1	-	NULL	ENSG00000153317		0.383	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	87	0.00	0	C	NM_018482		131179788	131179788	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000524124	ensembl	human	novel	69_37n	missense	80	16.67	16	SNP	1.000	T
ASGR2	433	genome.wustl.edu	37	17	7017544	7017544	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:7017544G>C	ENST00000380952.2	-	2	280	c.16C>G	c.(16-18)Caa>Gaa	p.Q6E	ASGR2_ENST00000254850.7_Missense_Mutation_p.Q6E|ASGR2_ENST00000355035.5_Missense_Mutation_p.Q6E|ASGR2_ENST00000446679.2_Missense_Mutation_p.Q6E	NM_001181.4|NM_001201352.1|NM_080912.3	NP_001172|NP_001188281.1|NP_550434	P07307	ASGR2_HUMAN	asialoglycoprotein receptor 2	6					bone mineralization (GO:0030282)|cell surface receptor signaling pathway (GO:0007166)|glycoprotein metabolic process (GO:0009100)|lipid homeostasis (GO:0055088)|receptor-mediated endocytosis (GO:0006898)|regulation of protein stability (GO:0031647)	integral component of membrane (GO:0016021)	asialoglycoprotein receptor activity (GO:0004873)|carbohydrate binding (GO:0030246)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(3)|ovary(1)|skin(3)|stomach(4)	18					Antihemophilic Factor(DB00025)	TGGATATCTTGAAAGTCCTTG	0.612																																						dbGAP											0													103.0	88.0	93.0					17																	7017544		2203	4300	6503	-	-	-	SO:0001583	missense	0			M11025	CCDS11088.1, CCDS32544.1, CCDS45598.1	17p	2011-08-30			ENSG00000161944	ENSG00000161944		"""C-type lectin domain containing"""	743	protein-coding gene	gene with protein product		108361				3863106	Standard	NM_080912		Approved	CLEC4H2	uc002ger.3	P07307	OTTHUMG00000102158	ENST00000380952.2:c.16C>G	17.37:g.7017544G>C	ENSP00000370339:p.Gln6Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLV8|A8MT12|D3DTM9|D3DTN0|O00448|Q03969	Missense_Mutation	SNP	pfam_Lectin_N,pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.Q6E	ENST00000380952.2	37	c.16	CCDS32544.1	17	.	.	.	.	.	.	.	.	.	.	G	2.365	-0.345666	0.05208	.	.	ENSG00000161944	ENST00000355035;ENST00000254850;ENST00000380952;ENST00000446679;ENST00000450034	T;T;T;T	0.00958	5.5;5.68;5.5;5.7	3.59	3.59	0.41128	.	0.000000	0.37530	N	0.002051	T	0.01661	0.0053	N	0.24115	0.695	0.29426	N	0.860221	D;D;B;B;B	0.61697	0.979;0.99;0.165;0.165;0.106	D;D;B;B;B	0.74023	0.982;0.979;0.115;0.115;0.105	T	0.45086	-0.9285	10	0.06099	T	0.92	.	11.0976	0.48155	0.0:0.0:1.0:0.0	.	6;6;6;6;6	B4E1D2;P07307-3;P07307;Q7Z4G9;P07307-2	.;.;ASGR2_HUMAN;.;.	E	6	ENSP00000347140:Q6E;ENSP00000254850:Q6E;ENSP00000370339:Q6E;ENSP00000405844:Q6E	ENSP00000254850:Q6E	Q	-	1	0	ASGR2	6958268	0.999000	0.42202	0.936000	0.37596	0.232000	0.25224	3.667000	0.54547	2.330000	0.79161	0.650000	0.86243	CAA	ASGR2	-	NULL	ENSG00000161944		0.612	ASGR2-201	KNOWN	basic|CCDS	protein_coding	ASGR2	HGNC	protein_coding	OTTHUMT00000220003.1	99	0.00	0	G	NM_080914		7017544	7017544	-1	no_errors	ENST00000355035	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	0.951	C
ATAD1	84896	genome.wustl.edu	37	10	89574223	89574223	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:89574223C>T	ENST00000308448.7	-	2	512	c.134G>A	c.(133-135)aGa>aAa	p.R45K	ATAD1_ENST00000541004.1_Missense_Mutation_p.R45K|ATAD1_ENST00000328142.3_Missense_Mutation_p.R45K|ATAD1_ENST00000495903.1_5'UTR	NM_032810.2	NP_116199.2	Q8NBU5	ATAD1_HUMAN	ATPase family, AAA domain containing 1	45					ATP catabolic process (GO:0006200)|learning (GO:0007612)|memory (GO:0007613)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|positive regulation of receptor internalization (GO:0002092)	cell junction (GO:0030054)|membrane (GO:0016020)|mitochondrion (GO:0005739)|peroxisomal membrane (GO:0005778)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			kidney(1)|large_intestine(4)|lung(4)|ovary(1)	10		all_cancers(4;6.78e-12)|Prostate(4;3.56e-12)|all_epithelial(4;5.58e-09)|Melanoma(5;0.0273)|Breast(4;0.0424)|all_hematologic(4;0.0846)|Colorectal(252;0.207)|Glioma(4;0.217)|all_neural(4;0.224)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00131)|GBM - Glioblastoma multiforme(1;1.1e-32)|Lung(2;1.4e-05)|LUSC - Lung squamous cell carcinoma(2;2.69e-05)|Colorectal(12;7.09e-05)|COAD - Colon adenocarcinoma(12;0.000261)|STAD - Stomach adenocarcinoma(243;0.235)		TTTTTGCTTTCTGGTTGGATC	0.343																																						dbGAP											0													153.0	136.0	142.0					10																	89574223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834370	CCDS7386.1	10q23.31	2010-04-21		2007-02-08	ENSG00000138138	ENSG00000138138		"""ATPases / AAA-type"""	25903	protein-coding gene	gene with protein product		614452				12477932	Standard	NM_032810		Approved	FLJ14600	uc001kez.1	Q8NBU5	OTTHUMG00000018685	ENST00000308448.7:c.134G>A	10.37:g.89574223C>T	ENSP00000339017:p.Arg45Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DR26|Q6DKG1|Q6P4B9|Q8N3G1|Q8WYR9|Q969Y3	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase	p.R45K	ENST00000308448.7	37	c.134	CCDS7386.1	10	.	.	.	.	.	.	.	.	.	.	C	16.13	3.037230	0.54896	.	.	ENSG00000138138	ENST00000308448;ENST00000328142;ENST00000541004	D;D;D	0.94897	-3.27;-3.27;-3.55	5.35	5.35	0.76521	.	0.040832	0.85682	D	0.000000	D	0.90164	0.6926	N	0.25094	0.71	0.80722	D	1	B	0.18166	0.026	B	0.19946	0.027	D	0.85446	0.1158	9	.	.	.	-23.0085	19.4335	0.94781	0.0:1.0:0.0:0.0	.	45	Q8NBU5	ATAD1_HUMAN	K	45	ENSP00000339017:R45K;ENSP00000339016:R45K;ENSP00000445500:R45K	.	R	-	2	0	ATAD1	89564203	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.452000	0.80683	2.655000	0.90218	0.655000	0.94253	AGA	ATAD1	-	NULL	ENSG00000138138		0.343	ATAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD1	HGNC	protein_coding	OTTHUMT00000049235.1	82	0.00	0	C	NM_032810		89574223	89574223	-1	no_errors	ENST00000308448	ensembl	human	known	69_37n	missense	91	30.30	40	SNP	1.000	T
ATG7	10533	genome.wustl.edu	37	3	11354835	11354835	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:11354835G>A	ENST00000354449.3	+	6	494	c.469G>A	c.(469-471)Gag>Aag	p.E157K	ATG7_ENST00000446450.2_Intron|ATG7_ENST00000354956.5_Missense_Mutation_p.E157K	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	157					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						CTGTCTTCCAGAGAGTTTACC	0.358																																						dbGAP											0													117.0	109.0	111.0					3																	11354835		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.469G>A	3.37:g.11354835G>A	ENSP00000346437:p.Glu157Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_E1-like_Apg7	p.E157K	ENST00000354449.3	37	c.469	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	G	19.43	3.825811	0.71143	.	.	ENSG00000197548	ENST00000451513;ENST00000354956;ENST00000354449	T;T;T	0.43294	0.95;0.95;0.95	6.03	6.03	0.97812	.	0.124847	0.53938	D	0.000058	T	0.38241	0.1033	L	0.59436	1.845	0.54753	D	0.999983	P;B	0.40834	0.73;0.059	B;B	0.36845	0.234;0.021	T	0.21586	-1.0241	10	0.08599	T	0.76	-20.7706	17.4736	0.87653	0.0:0.0:1.0:0.0	.	157;157	O95352-2;O95352	.;ATG7_HUMAN	K	157	ENSP00000415223:E157K;ENSP00000347042:E157K;ENSP00000346437:E157K	ENSP00000346437:E157K	E	+	1	0	ATG7	11329835	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	8.088000	0.89523	2.861000	0.98227	0.655000	0.94253	GAG	ATG7	-	tigrfam_E1-like_Apg7	ENSG00000197548		0.358	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	110	0.00	0	G	NM_006395		11354835	11354835	+1	no_errors	ENST00000354449	ensembl	human	known	69_37n	missense	82	18.00	18	SNP	1.000	A
ATP11A	23250	genome.wustl.edu	37	13	113532584	113532584	+	Silent	SNP	G	G	A	rs200573559		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:113532584G>A	ENST00000487903.1	+	29	3469	c.3381G>A	c.(3379-3381)caG>caA	p.Q1127Q	ATP11A_ENST00000375645.3_Silent_p.Q1127Q|ATP11A_ENST00000283558.8_Silent_p.Q1127Q|ATP11A_ENST00000375630.2_Intron			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	1127					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				TGCTTTCTCAGACTTCCAGCA	0.562													G|||	1	0.000199681	0.0	0.0	5008	,	,		19888	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													255.0	194.0	214.0					13																	113532584		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.3381G>A	13.37:g.113532584G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXT2	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.Q1127	ENST00000487903.1	37	c.3381	CCDS32011.1	13																																																																																			ATP11A	-	NULL	ENSG00000068650		0.562	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	68	0.00	0	G	NM_015205		113532584	113532584	+1	no_errors	ENST00000283558	ensembl	human	known	69_37n	silent	57	14.93	10	SNP	1.000	A
ATP2B4	493	genome.wustl.edu	37	1	203702398	203702398	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:203702398C>T	ENST00000341360.2	+	20	3754	c.3357C>T	c.(3355-3357)gtC>gtT	p.V1119V	ATP2B4_ENST00000367219.3_Silent_p.V1107V|ATP2B4_ENST00000357681.5_Intron|ATP2B4_ENST00000391954.2_Silent_p.V1083V|ATP2B4_ENST00000367218.3_Silent_p.V1119V			P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1119					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			TTAAGGGAGTCCTAAGGCGAC	0.473																																						dbGAP											0													180.0	163.0	169.0					1																	203702398		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000341360.2:c.3357C>T	1.37:g.203702398C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATP_Ca_trans_C	p.S84F	ENST00000341360.2	37	c.251	CCDS30977.1	1	.	.	.	.	.	.	.	.	.	.	C	9.672	1.146903	0.21288	.	.	ENSG00000058668	ENST00000356729	.	.	.	5.01	2.98	0.34508	.	.	.	.	.	T	0.55893	0.1949	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51647	-0.8679	4	.	.	.	.	7.2917	0.26370	0.3034:0.6187:0.0:0.0778	.	.	.	.	F	84	.	.	S	+	2	0	ATP2B4	201969021	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	1.498000	0.35660	1.286000	0.44565	0.655000	0.94253	TCC	ATP2B4	-	pfam_ATP_Ca_trans_C	ENSG00000058668		0.473	ATP2B4-002	KNOWN	basic|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087463.1	58	0.00	0	C	NM_001001396		203702398	203702398	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000356729	ensembl	human	known	69_37n	missense	92	11.54	12	SNP	1.000	T
AURKB	9212	genome.wustl.edu	37	17	8110613	8110613	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:8110613C>T	ENST00000585124.1	-	5	372	c.279G>A	c.(277-279)ttG>ttA	p.L93L	AURKB_ENST00000578549.1_Intron|AURKB_ENST00000316199.6_Silent_p.L94L|AURKB_ENST00000534871.1_Silent_p.L52L|AURKB_ENST00000535053.1_Silent_p.L94L	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B	93	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						TCTCCCGAGCCAAGTACACGT	0.527																																					NSCLC(134;1161 2470 43664 51568)	dbGAP											0													80.0	71.0	74.0					17																	8110613		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.279G>A	17.37:g.8110613C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.G25S	ENST00000585124.1	37	c.73	CCDS11134.1	17																																																																																			AURKB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000178999		0.527	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AURKB	HGNC	protein_coding	OTTHUMT00000226995.2	59	0.00	0	C	NM_004217		8110613	8110613	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000584972	ensembl	human	novel	69_37n	missense	35	10.26	4	SNP	1.000	T
AWAT2	158835	genome.wustl.edu	37	X	69261801	69261801	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:69261801G>A	ENST00000276101.3	-	7	864	c.859C>T	c.(859-861)Cta>Tta	p.L287L		NM_001002254.1	NP_001002254.1	Q6E213	AWAT2_HUMAN	acyl-CoA wax alcohol acyltransferase 2	287					wax biosynthetic process (GO:0010025)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	long-chain-alcohol O-fatty-acyltransferase activity (GO:0047196)|retinol O-fatty-acyltransferase activity (GO:0050252)			endometrium(3)|large_intestine(3)|lung(2)|ovary(1)	9						GGCATTGGTAGAGGCTCCCCG	0.493																																					NSCLC(80;1334 1436 9350 24214 26427)	dbGAP											0													115.0	89.0	98.0					X																	69261801		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC063698	CCDS35320.1	Xq13.1	2009-02-23	2009-02-23	2009-02-23	ENSG00000147160	ENSG00000147160			23251	protein-coding gene	gene with protein product	"""multifunctional O-acyltransferase"""	300925	"""diacylglycerol O-acyltransferase 2-like 4"""	DGAT2L4		14970677, 16106050, 15671038	Standard	NM_001002254		Approved	MFAT	uc004dxt.1	Q6E213	OTTHUMG00000021763	ENST00000276101.3:c.859C>T	X.37:g.69261801G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEE3|Q6P437	Silent	SNP	pfam_DAGAT	p.L287	ENST00000276101.3	37	c.859	CCDS35320.1	X																																																																																			AWAT2	-	pfam_DAGAT	ENSG00000147160		0.493	AWAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AWAT2	HGNC	protein_coding	OTTHUMT00000358738.1	60	0.00	0	G	NM_001002254		69261801	69261801	-1	no_errors	ENST00000276101	ensembl	human	known	69_37n	silent	59	19.18	14	SNP	0.965	A
BCL2L11	10018	genome.wustl.edu	37	2	111881473	111881473	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:111881473G>A	ENST00000393256.3	+	2	424	c.151G>A	c.(151-153)Gaa>Aaa	p.E51K	BCL2L11_ENST00000308659.8_Intron|BCL2L11_ENST00000393253.2_Intron|BCL2L11_ENST00000405953.1_Intron|BCL2L11_ENST00000357757.2_Missense_Mutation_p.E51K|BCL2L11_ENST00000337565.5_Intron	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	51					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						TCACGGAGGTGAAGGGGACAG	0.627																																						dbGAP											0													47.0	52.0	50.0					2																	111881473		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.151G>A	2.37:g.111881473G>A	ENSP00000376943:p.Glu51Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.E51K	ENST00000393256.3	37	c.151	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562354	0.86335	.	.	ENSG00000153094	ENST00000432179;ENST00000357757;ENST00000393256;ENST00000393252	T;T;T	0.46063	0.88;0.88;0.88	4.83	4.83	0.62350	.	0.314398	0.27558	N	0.018824	T	0.31734	0.0806	N	0.24115	0.695	0.80722	D	1	B;B	0.25609	0.13;0.079	B;B	0.21360	0.034;0.025	T	0.15838	-1.0423	10	0.62326	D	0.03	-2.5358	15.7853	0.78297	0.0:0.0:1.0:0.0	.	51;51	O43521-11;O43521	.;B2L11_HUMAN	K	51	ENSP00000411870:E51K;ENSP00000350398:E51K;ENSP00000376943:E51K	ENSP00000350398:E51K	E	+	1	0	BCL2L11	111597944	1.000000	0.71417	1.000000	0.80357	0.952000	0.60782	3.874000	0.56101	2.406000	0.81754	0.467000	0.42956	GAA	BCL2L11	-	pirsf_Bcl-2-like_11	ENSG00000153094		0.627	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	36	0.00	0	G			111881473	111881473	+1	no_errors	ENST00000393256	ensembl	human	known	69_37n	missense	14	30.00	6	SNP	1.000	A
BIVM	54841	genome.wustl.edu	37	13	103468896	103468896	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:103468896C>T	ENST00000257336.1	+	4	1276	c.597C>T	c.(595-597)ctC>ctT	p.L199L	BIVM-ERCC5_ENST00000602836.1_Nonsense_Mutation_p.Q171*|BIVM_ENST00000419638.1_Silent_p.L199L|BIVM_ENST00000448849.2_5'UTR	NM_017693.3	NP_060163.2	Q86UB2	BIVM_HUMAN	basic, immunoglobulin-like variable motif containing	199						cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)				endometrium(3)|kidney(2)|large_intestine(7)|lung(10)|skin(2)|urinary_tract(1)	25	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.211)					TATTAGACCTCAGACGATGGT	0.303																																						dbGAP											0													117.0	117.0	117.0					13																	103468896		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF411385	CCDS9505.1, CCDS53879.1	13q33.1	2008-05-14			ENSG00000134897	ENSG00000134897			16034	protein-coding gene	gene with protein product						12036287	Standard	NM_017693		Approved	FLJ20159		Q86UB2	OTTHUMG00000017309	ENST00000257336.1:c.597C>T	13.37:g.103468896C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M1J2|Q9NXM4	Silent	SNP	NULL	p.L199	ENST00000257336.1	37	c.597	CCDS9505.1	13																																																																																			BIVM	-	NULL	ENSG00000134897		0.303	BIVM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BIVM	HGNC	protein_coding	OTTHUMT00000045704.2	64	0.00	0	C			103468896	103468896	+1	no_errors	ENST00000257336	ensembl	human	known	69_37n	silent	38	24.00	12	SNP	1.000	T
BPTF	2186	genome.wustl.edu	37	17	65936663	65936663	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:65936663C>T	ENST00000321892.4	+	21	6807	c.6746C>T	c.(6745-6747)tCa>tTa	p.S2249L	BPTF_ENST00000306378.6_Missense_Mutation_p.S2123L|BPTF_ENST00000577770.1_3'UTR|BPTF_ENST00000335221.5_Missense_Mutation_p.S2249L|BPTF_ENST00000424123.3_Missense_Mutation_p.S2110L			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	2249					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGCTTAACTTCAGCAACGTCC	0.512																																						dbGAP											0													121.0	94.0	103.0					17																	65936663		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.6746C>T	17.37:g.65936663C>T	ENSP00000315454:p.Ser2249Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.S2249L	ENST00000321892.4	37	c.6746		17	.	.	.	.	.	.	.	.	.	.	C	13.57	2.276169	0.40294	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.63744	-0.04;0.0;-0.06	5.8	5.8	0.92144	.	.	.	.	.	T	0.50854	0.1640	N	0.19112	0.55	0.09310	N	1	P;B	0.38195	0.622;0.034	B;B	0.33454	0.164;0.022	T	0.52510	-0.8566	9	0.51188	T	0.08	0.0227	20.051	0.97627	0.0:1.0:0.0:0.0	.	2123;2249	Q12830-2;Q12830-4	.;.	L	2123;2249;2249	ENSP00000307208:S2123L;ENSP00000334351:S2249L;ENSP00000315454:S2249L	ENSP00000307208:S2123L	S	+	2	0	BPTF	63367125	0.829000	0.29322	0.286000	0.24833	0.027000	0.11550	5.339000	0.65953	2.740000	0.93945	0.650000	0.86243	TCA	BPTF	-	NULL	ENSG00000171634		0.512	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		43	0.00	0	C	NM_182641, NM_004459		65936663	65936663	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	missense	47	18.64	11	SNP	0.080	T
C12orf5	57103	genome.wustl.edu	37	12	4440468	4440468	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:4440468G>C	ENST00000179259.4	+	2	122	c.55G>C	c.(55-57)Gag>Cag	p.E19Q		NM_020375.2	NP_065108.1	Q9NQ88	TIGAR_HUMAN	chromosome 12 open reading frame 5	19					intestinal epithelial cell development (GO:0060576)|negative regulation of macromitophagy (GO:1901525)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|response to gamma radiation (GO:0010332)|response to xenobiotic stimulus (GO:0009410)	intracellular (GO:0005622)	fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)			endometrium(1)|large_intestine(1)|lung(5)|skin(3)	10			all cancers(3;1.15e-07)|Colorectal(7;0.00165)|OV - Ovarian serous cystadenocarcinoma(31;0.00596)|COAD - Colon adenocarcinoma(12;0.0229)|GBM - Glioblastoma multiforme(3;0.0266)|STAD - Stomach adenocarcinoma(119;0.206)			ATTTAACAAGGAGAAAATAAT	0.358																																					Colon(1;100 192 35375 49454 52532)	dbGAP											0													152.0	153.0	152.0					12																	4440468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ272206	CCDS8525.1	12p13.32	2014-05-29	2009-11-24	2009-11-24	ENSG00000078237	ENSG00000078237	3.1.3.46		1185	protein-coding gene	gene with protein product	"""TP53-induced glycolysis and apoptosis regulator"""	610775				16140933, 16839880, 18945750, 19713938	Standard	NM_020375		Approved	TIGAR	uc001qmp.3	Q9NQ88		ENST00000179259.4:c.55G>C	12.37:g.4440468G>C	ENSP00000179259:p.Glu19Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R840	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1	p.E19Q	ENST00000179259.4	37	c.55	CCDS8525.1	12	.	.	.	.	.	.	.	.	.	.	G	14.90	2.673824	0.47781	.	.	ENSG00000078237	ENST00000179259	T	0.73469	-0.75	5.41	4.5	0.54988	Histidine phosphatase superfamily, clade-1 (2);	0.264965	0.42420	N	0.000712	T	0.69151	0.3079	L	0.39245	1.2	0.46260	D	0.998954	B	0.27932	0.194	B	0.32393	0.145	T	0.67530	-0.5647	10	0.49607	T	0.09	-0.0464	15.6065	0.76676	0.0:0.1385:0.8615:0.0	.	19	Q9NQ88	TIGAR_HUMAN	Q	19	ENSP00000179259:E19Q	ENSP00000179259:E19Q	E	+	1	0	C12orf5	4310729	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.664000	0.61540	1.248000	0.43934	0.585000	0.79938	GAG	C12orf5	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1	ENSG00000078237		0.358	C12orf5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf5	HGNC	protein_coding	OTTHUMT00000398290.1	145	0.00	0	G	NM_020375		4440468	4440468	+1	no_errors	ENST00000179259	ensembl	human	known	69_37n	missense	126	17.65	27	SNP	1.000	C
ATG101	60673	genome.wustl.edu	37	12	52467635	52467635	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:52467635C>G	ENST00000336854.4	+	3	679	c.201C>G	c.(199-201)gtC>gtG	p.V67V	RP11-1100L3.7_ENST00000550301.1_RNA	NM_001098673.1|NM_021934.4	NP_001092143.1|NP_068753.2	Q9BSB4	ATGA1_HUMAN		67					autophagic vacuole assembly (GO:0000045)	pre-autophagosomal structure (GO:0000407)	identical protein binding (GO:0042802)|protein complex binding (GO:0032403)			endometrium(1)|lung(2)|ovary(1)	4				BRCA - Breast invasive adenocarcinoma(357;0.0978)		ATGTGCGTGTCTCTTCTGAGG	0.542																																						dbGAP											0													211.0	149.0	170.0					12																	52467635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000336854.4:c.201C>G	12.37:g.52467635C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAE2|Q9HBN1	Silent	SNP	pfam_ATG101	p.V67	ENST00000336854.4	37	c.201	CCDS8820.1	12																																																																																			C12orf44	-	pfam_ATG101	ENSG00000123395		0.542	C12orf44-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf44	HGNC	protein_coding	OTTHUMT00000405063.1	121	0.00	0	C			52467635	52467635	+1	no_errors	ENST00000336854	ensembl	human	known	69_37n	silent	68	15.00	12	SNP	1.000	G
C1orf68	100129271	genome.wustl.edu	37	1	152692165	152692165	+	Silent	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:152692165G>T	ENST00000368775.2	+	1	168	c.168G>T	c.(166-168)gtG>gtT	p.V56V		NM_001024679.2	NP_001019850.1	Q5T750	XP32_HUMAN	chromosome 1 open reading frame 68	56	Cys-rich.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|lung(2)|prostate(1)|stomach(3)	8						AAACTTATGTGAAGTACCAAG	0.527																																						dbGAP											0													156.0	154.0	155.0					1																	152692165		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AF005081	CCDS44226.1	1q21.3	2014-05-30			ENSG00000198854	ENSG00000198854			29468	protein-coding gene	gene with protein product						11698679	Standard	NM_001024679		Approved	LEP7	uc010pdu.2	Q5T750	OTTHUMG00000012401	ENST00000368775.2:c.168G>T	1.37:g.152692165G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14634	Silent	SNP	NULL	p.V56	ENST00000368775.2	37	c.168	CCDS44226.1	1																																																																																			C1orf68	-	NULL	ENSG00000198854		0.527	C1orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf68	HGNC	protein_coding	OTTHUMT00000034521.2	69	0.00	0	G	NM_001024679		152692165	152692165	+1	no_errors	ENST00000362017	ensembl	human	known	69_37n	silent	62	23.46	19	SNP	0.969	T
C1orf112	55732	genome.wustl.edu	37	1	169796247	169796247	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:169796247A>G	ENST00000286031.6	+	11	1604	c.904A>G	c.(904-906)Ata>Gta	p.I302V	C1orf112_ENST00000359326.4_Missense_Mutation_p.I302V|C1orf112_ENST00000498289.1_3'UTR|C1orf112_ENST00000413811.2_Missense_Mutation_p.I273V	NM_018186.2	NP_060656.2	Q9NSG2	CA112_HUMAN	chromosome 1 open reading frame 112	302										breast(1)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(8)|lung(9)|ovary(1)|skin(1)|stomach(1)	34	all_hematologic(923;0.0922)|Acute lymphoblastic leukemia(37;0.181)					CCAAGAGGAAATAGCAGGTGC	0.423																																						dbGAP											0													127.0	124.0	125.0					1																	169796247		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL354614	CCDS1285.1	1q24.2	2012-06-26			ENSG00000000460	ENSG00000000460			25565	protein-coding gene	gene with protein product						12477932	Standard	NM_018186		Approved	FLJ10706	uc001ggq.3	Q9NSG2	OTTHUMG00000035821	ENST00000286031.6:c.904A>G	1.37:g.169796247A>G	ENSP00000286031:p.Ile302Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFP1|B3KU42|Q3KNQ1|Q9H8L5|Q9NVJ0	Missense_Mutation	SNP	NULL	p.I302V	ENST00000286031.6	37	c.904	CCDS1285.1	1	.	.	.	.	.	.	.	.	.	.	A	15.62	2.888761	0.52014	.	.	ENSG00000000460	ENST00000413811;ENST00000359326;ENST00000286031	T;T;T	0.51574	0.7;0.7;0.7	5.04	2.74	0.32292	.	0.149754	0.64402	N	0.000009	T	0.35770	0.0943	M	0.76574	2.34	0.28147	N	0.929537	B;B;P	0.48640	0.383;0.056;0.913	B;B;P	0.48141	0.107;0.098;0.568	T	0.24333	-1.0163	10	0.62326	D	0.03	-7.1272	7.6776	0.28494	0.8229:0.0:0.1771:0.0	.	273;244;302	B4E0A9;B4DGF2;Q9NSG2	.;.;CA112_HUMAN	V	273;302;302	ENSP00000389257:I273V;ENSP00000352276:I302V;ENSP00000286031:I302V	ENSP00000286031:I302V	I	+	1	0	C1orf112	168062871	1.000000	0.71417	0.984000	0.44739	0.973000	0.67179	3.505000	0.53356	0.355000	0.24131	-0.256000	0.11100	ATA	C1orf112	-	NULL	ENSG00000000460		0.423	C1orf112-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf112	HGNC	protein_coding	OTTHUMT00000087126.3	81	0.00	0	A	NM_018186		169796247	169796247	+1	no_errors	ENST00000286031	ensembl	human	known	69_37n	missense	88	12.00	12	SNP	1.000	G
C2orf16	84226	genome.wustl.edu	37	2	27800937	27800937	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:27800937G>C	ENST00000408964.2	+	1	1549	c.1498G>C	c.(1498-1500)Gag>Cag	p.E500Q		NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	500						extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					TCAATCTGAAGAGGTAATCCT	0.433																																						dbGAP											0													83.0	77.0	79.0					2																	27800937		1903	4124	6027	-	-	-	SO:0001583	missense	0			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.1498G>C	2.37:g.27800937G>C	ENSP00000386190:p.Glu500Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.E500Q	ENST00000408964.2	37	c.1498	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	G	9.167	1.020146	0.19433	.	.	ENSG00000221843	ENST00000408964	T	0.05447	3.44	4.42	0.143	0.14820	.	.	.	.	.	T	0.03959	0.0111	N	0.14661	0.345	0.09310	N	1	B	0.18013	0.025	B	0.13407	0.009	T	0.41342	-0.9514	9	0.46703	T	0.11	.	7.7221	0.28738	0.0963:0.4821:0.4216:0.0	.	500	Q68DN1	CB016_HUMAN	Q	500	ENSP00000386190:E500Q	ENSP00000386190:E500Q	E	+	1	0	C2orf16	27654441	0.001000	0.12720	0.001000	0.08648	0.002000	0.02628	0.491000	0.22419	0.126000	0.18424	-0.253000	0.11424	GAG	C2orf16	-	NULL	ENSG00000221843		0.433	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	54	0.00	0	G	NM_032266		27800937	27800937	+1	no_errors	ENST00000408964	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	0.000	C
C4orf33	132321	genome.wustl.edu	37	4	130023848	130023848	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:130023848G>A	ENST00000281146.5	+	2	804	c.83G>A	c.(82-84)aGa>aAa	p.R28K	C4orf33_ENST00000425929.1_Missense_Mutation_p.R28K|C4orf33_ENST00000502887.1_Missense_Mutation_p.R28K	NM_173487.2	NP_775758.2	Q8N1A6	CD033_HUMAN	chromosome 4 open reading frame 33	28								p.R28K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	10						CCAGGTGACAGAGGAGTGATG	0.433																																						dbGAP											1	Substitution - Missense(1)	endometrium(1)											136.0	132.0	133.0					4																	130023848		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091022	CCDS3741.1	4q28.2	2008-02-05			ENSG00000151470	ENSG00000151470			27025	protein-coding gene	gene with protein product						12477932	Standard	NM_001099783		Approved	FLJ33703	uc010iod.3	Q8N1A6	OTTHUMG00000133347	ENST00000281146.5:c.83G>A	4.37:g.130023848G>A	ENSP00000281146:p.Arg28Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNY2|Q6PJF3|Q8NBC5	Missense_Mutation	SNP	NULL	p.R28K	ENST00000281146.5	37	c.83	CCDS3741.1	4	.	.	.	.	.	.	.	.	.	.	G	0.012	-1.685307	0.00745	.	.	ENSG00000151470	ENST00000281146;ENST00000502887;ENST00000425929;ENST00000508673;ENST00000508622	T;T;T;T;T	0.42513	2.32;2.0;2.32;0.97;0.97	4.59	-0.63	0.11530	.	1.140790	0.06057	N	0.657737	T	0.17746	0.0426	N	0.04959	-0.14	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20605	-1.0270	10	0.06625	T	0.88	-43.5122	5.5207	0.16931	0.3451:0.4079:0.247:0.0	.	28;28	D6RIT3;Q8N1A6	.;CD033_HUMAN	K	28	ENSP00000281146:R28K;ENSP00000427406:R28K;ENSP00000401090:R28K;ENSP00000427096:R28K;ENSP00000427431:R28K	ENSP00000281146:R28K	R	+	2	0	C4orf33	130243298	0.000000	0.05858	0.002000	0.10522	0.066000	0.16364	0.046000	0.14035	-0.277000	0.09193	-0.136000	0.14681	AGA	C4orf33	-	NULL	ENSG00000151470		0.433	C4orf33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C4orf33	HGNC	protein_coding	OTTHUMT00000257177.2	72	0.00	0	G	NM_173487		130023848	130023848	+1	no_errors	ENST00000281146	ensembl	human	known	69_37n	missense	68	17.07	14	SNP	0.001	A
C7orf31	136895	genome.wustl.edu	37	7	25218893	25218893	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:25218893C>G	ENST00000409280.1	-	2	343	c.35G>C	c.(34-36)aGg>aCg	p.R12T	C7orf31_ENST00000283905.3_Missense_Mutation_p.R12T			Q8N865	CG031_HUMAN	chromosome 7 open reading frame 31	12										autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	14						TTCAAGCTCCCTGCAACAGTA	0.507																																						dbGAP											0													100.0	87.0	91.0					7																	25218893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097248	CCDS5394.1	7p15.2	2011-11-24			ENSG00000153790	ENSG00000153790			21722	protein-coding gene	gene with protein product							Standard	NM_138811		Approved		uc003sxn.1	Q8N865	OTTHUMG00000128497	ENST00000409280.1:c.35G>C	7.37:g.25218893C>G	ENSP00000386604:p.Arg12Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D165|Q6MZV8|Q6P989|Q7LE28|Q86XK1|Q8N1H5|Q96BN4	Missense_Mutation	SNP	NULL	p.R12T	ENST00000409280.1	37	c.35	CCDS5394.1	7	.	.	.	.	.	.	.	.	.	.	N	14.16	2.452904	0.43531	.	.	ENSG00000153790	ENST00000409280;ENST00000283905;ENST00000443822;ENST00000415598;ENST00000444434	T;T;T;T;T	0.09073	3.02;3.02;3.02;3.02;3.02	5.45	2.68	0.31781	.	0.165679	0.42821	D	0.000653	T	0.13500	0.0327	M	0.67953	2.075	0.33753	D	0.620906	P	0.44429	0.835	P	0.46917	0.531	T	0.12167	-1.0558	10	0.72032	D	0.01	-47.7852	7.5897	0.28015	0.0:0.7329:0.0:0.2671	.	12	Q8N865	CG031_HUMAN	T	12	ENSP00000386604:R12T;ENSP00000283905:R12T;ENSP00000388472:R12T;ENSP00000391212:R12T;ENSP00000403281:R12T	ENSP00000283905:R12T	R	-	2	0	C7orf31	25185418	0.998000	0.40836	0.965000	0.40720	0.983000	0.72400	0.335000	0.19806	0.286000	0.22352	0.650000	0.86243	AGG	C7orf31	-	NULL	ENSG00000153790		0.507	C7orf31-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C7orf31	HGNC	protein_coding	OTTHUMT00000326929.1	57	0.00	0	C	NM_138811		25218893	25218893	-1	no_errors	ENST00000283905	ensembl	human	known	69_37n	missense	57	19.72	14	SNP	0.931	G
C9	735	genome.wustl.edu	37	5	39306855	39306855	+	Missense_Mutation	SNP	G	G	A	rs121909594		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:39306855G>A	ENST00000263408.4	-	9	1375	c.1280C>T	c.(1279-1281)tCa>tTa	p.S427L		NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	427	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.		S -> T (in dbSNP:rs34421659).		complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			TCTTATGAGTGAAACAACATC	0.398																																						dbGAP											0			GRCh37	CM983960	C9	M	rs121909594						98.0	86.0	90.0					5																	39306855		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.1280C>T	5.37:g.39306855G>A	ENSP00000263408:p.Ser427Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.S427L	ENST00000263408.4	37	c.1280	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	G	23.7	4.451740	0.84209	.	.	ENSG00000113600	ENST00000263408	D	0.83506	-1.73	4.98	4.98	0.66077	Membrane attack complex component/perforin (MACPF) domain (3);	0.437579	0.25037	N	0.033623	D	0.90239	0.6948	M	0.81942	2.565	0.32086	N	0.592567	D	0.63880	0.993	P	0.60789	0.879	D	0.91559	0.5263	10	0.54805	T	0.06	-11.9593	17.1805	0.86853	0.0:0.0:1.0:0.0	.	427	P02748	CO9_HUMAN	L	427	ENSP00000263408:S427L	ENSP00000263408:S427L	S	-	2	0	C9	39342612	0.985000	0.35326	0.150000	0.22450	0.883000	0.51084	4.786000	0.62425	2.577000	0.86979	0.563000	0.77884	TCA	C9	-	pfam_MACPF,smart_MACPF	ENSG00000113600		0.398	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	HGNC	protein_coding	OTTHUMT00000211576.3	52	0.00	0	G			39306855	39306855	-1	no_errors	ENST00000263408	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	0.474	A
C9orf41	138199	genome.wustl.edu	37	9	77599900	77599900	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:77599900G>C	ENST00000376834.3	-	7	1203	c.1051C>G	c.(1051-1053)Ctg>Gtg	p.L351V	C9orf41_ENST00000376837.3_3'UTR|RP11-197P3.4_ENST00000455609.1_RNA	NM_152420.1	NP_689633.1	Q8N4J0	CI041_HUMAN	chromosome 9 open reading frame 41	351										endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|urinary_tract(2)	17						TCATTTGCCAGATTTTCAAAG	0.338																																						dbGAP											0													121.0	115.0	117.0					9																	77599900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098661	CCDS6649.1	9q21.31	2012-03-15			ENSG00000156017	ENSG00000156017			23435	protein-coding gene	gene with protein product						12477932	Standard	NM_152420		Approved	FLJ25795	uc004ajq.3	Q8N4J0	OTTHUMG00000020032	ENST00000376834.3:c.1051C>G	9.37:g.77599900G>C	ENSP00000366030:p.Leu351Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z383|Q8N7C5	Missense_Mutation	SNP	pfam_N2227	p.L351V	ENST00000376834.3	37	c.1051	CCDS6649.1	9	.	.	.	.	.	.	.	.	.	.	G	2.812	-0.246691	0.05867	.	.	ENSG00000156017	ENST00000376834	T	0.03982	3.74	6.17	2.03	0.26663	N2227-like (1);	0.154228	0.53938	N	0.000044	T	0.02727	0.0082	N	0.04508	-0.205	0.80722	D	1	P	0.42409	0.779	P	0.46796	0.527	T	0.59799	-0.7386	10	0.13853	T	0.58	-12.773	5.6288	0.17497	0.6492:0.0:0.2291:0.1217	.	351	Q8N4J0	CI041_HUMAN	V	351	ENSP00000366030:L351V	ENSP00000366030:L351V	L	-	1	2	C9orf41	76789720	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.482000	0.35486	0.572000	0.29383	-0.290000	0.09829	CTG	C9orf41	-	pfam_N2227	ENSG00000156017		0.338	C9orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf41	HGNC	protein_coding	OTTHUMT00000052703.1	101	0.00	0	G	NM_152420		77599900	77599900	-1	no_errors	ENST00000376834	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	0.998	C
CACNA1D	776	genome.wustl.edu	37	3	53810705	53810705	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:53810705C>T	ENST00000350061.5	+	36	4949	c.4438C>T	c.(4438-4440)Cac>Tac	p.H1480Y	CACNA1D_ENST00000422281.2_Missense_Mutation_p.H1465Y|CACNA1D_ENST00000540742.1_Missense_Mutation_p.H372Y|CACNA1D_ENST00000288139.4_Missense_Mutation_p.H1500Y	NM_001128840.1	NP_001122312.1	Q01668	CAC1D_HUMAN	calcium channel, voltage-dependent, L type, alpha 1D subunit	1480	Dihydropyridine binding. {ECO:0000250}.				adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|energy reserve metabolic process (GO:0006112)|membrane depolarization during action potential (GO:0086010)|membrane depolarization during cardiac muscle cell action potential (GO:0086012)|membrane repolarization during SA node cell action potential (GO:0086052)|positive regulation of calcium ion transport (GO:0051928)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of insulin secretion (GO:0050796)|regulation of potassium ion transmembrane transport (GO:1901379)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|ankyrin binding (GO:0030506)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)|voltage-gated calcium channel activity involved in cardiac muscle cell action potential (GO:0086007)|voltage-gated calcium channel activity involved SA node cell action potential (GO:0086059)			breast(3)|central_nervous_system(9)|cervix(2)|endometrium(11)|kidney(7)|large_intestine(13)|liver(1)|lung(29)|ovary(6)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	90				BRCA - Breast invasive adenocarcinoma(193;0.00029)|KIRC - Kidney renal clear cell carcinoma(284;0.0145)|Kidney(284;0.0175)|OV - Ovarian serous cystadenocarcinoma(275;0.0613)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Felodipine(DB01023)|Isradipine(DB00270)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	TTTGGGGCCTCACCATTTAGA	0.398																																						dbGAP											0													112.0	114.0	113.0					3																	53810705		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209171	CCDS2872.1, CCDS46848.1, CCDS46849.1	3p14.3	2012-03-07			ENSG00000157388	ENSG00000157388		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1391	protein-coding gene	gene with protein product		114206		CCHL1A2, CACNL1A2		1664412	Standard	NM_000720		Approved	Cav1.3, CACH3, CACN4	uc003dgu.5	Q01668	OTTHUMG00000158278	ENST00000350061.5:c.4438C>T	3.37:g.53810705C>T	ENSP00000288133:p.His1480Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0FYA3|Q13916|Q13931|Q71UT1|Q9UDC3	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_L_a1su,prints_LVDCC_a1dsu	p.H1500Y	ENST00000350061.5	37	c.4498	CCDS46848.1	3	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753799	0.89753	.	.	ENSG00000157388	ENST00000350061;ENST00000288139;ENST00000422281;ENST00000481478;ENST00000540742	D;D;D;T;T	0.96427	-3.98;-4.01;-4.0;2.98;2.98	5.49	5.49	0.81192	.	0.000000	0.85682	D	0.000000	D	0.98526	0.9508	M	0.89968	3.075	0.80722	D	1	D;D;D;D;D	0.89917	1.0;0.991;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.919;0.999;0.999;0.999	D	0.99421	1.0933	10	0.87932	D	0	.	19.3843	0.94550	0.0:1.0:0.0:0.0	.	1465;372;1173;1480;1500	B0FYA3;F5H313;Q59GD8;Q01668;Q01668-2	.;.;.;CAC1D_HUMAN;.	Y	1480;1500;1465;1173;372	ENSP00000288133:H1480Y;ENSP00000288139:H1500Y;ENSP00000409174:H1465Y;ENSP00000418014:H1173Y;ENSP00000438229:H372Y	ENSP00000288139:H1500Y	H	+	1	0	CACNA1D	53785745	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.818000	0.86416	2.574000	0.86865	0.563000	0.77884	CAC	CACNA1D	-	NULL	ENSG00000157388		0.398	CACNA1D-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA1D	HGNC	protein_coding	OTTHUMT00000350557.1	78	0.00	0	C	NM_000720		53810705	53810705	+1	no_errors	ENST00000288139	ensembl	human	known	69_37n	missense	65	16.67	13	SNP	1.000	T
CAPN12	147968	genome.wustl.edu	37	19	39225014	39225014	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:39225014G>C	ENST00000328867.4	-	16	2068	c.1760C>G	c.(1759-1761)tCc>tGc	p.S587C	CAPN12_ENST00000601953.1_Missense_Mutation_p.S438C	NM_144691.3	NP_653292.2	Q6ZSI9	CAN12_HUMAN	calpain 12	587	Domain IV.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	20	all_cancers(60;2.87e-05)|Ovarian(47;0.0454)		Lung(45;0.00416)|LUSC - Lung squamous cell carcinoma(53;0.00741)			TCTGGGGGTGGAGGTATGGGC	0.592																																						dbGAP											0													63.0	61.0	62.0					19																	39225014		2200	4296	6496	-	-	-	SO:0001583	missense	0			BC014027	CCDS12519.1	19q13.2	2014-08-12			ENSG00000182472	ENSG00000182472		"""EF-hand domain containing"""	13249	protein-coding gene	gene with protein product		608839					Standard	NM_144691		Approved		uc002ojd.1	Q6ZSI9	OTTHUMG00000182525	ENST00000328867.4:c.1760C>G	19.37:g.39225014G>C	ENSP00000331636:p.Ser587Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.S587C	ENST00000328867.4	37	c.1760	CCDS12519.1	19	.	.	.	.	.	.	.	.	.	.	g	8.844	0.942919	0.18281	.	.	ENSG00000182472	ENST00000328867	T	0.31247	1.5	4.92	-1.66	0.08265	EF-hand-like domain (1);	2.417750	0.02366	N	0.077381	T	0.17704	0.0425	N	0.14661	0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.22765	-1.0207	10	0.42905	T	0.14	.	4.1376	0.10178	0.0:0.3602:0.3348:0.305	.	587	Q6ZSI9	CAN12_HUMAN	C	587	ENSP00000331636:S587C	ENSP00000331636:S587C	S	-	2	0	CAPN12	43916854	0.000000	0.05858	0.001000	0.08648	0.007000	0.05969	-1.594000	0.02094	0.159000	0.19401	-1.676000	0.00740	TCC	CAPN12	-	NULL	ENSG00000182472		0.592	CAPN12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN12	HGNC	protein_coding	OTTHUMT00000462151.1	30	0.00	0	G			39225014	39225014	-1	no_errors	ENST00000328867	ensembl	human	known	69_37n	missense	13	35.00	7	SNP	0.000	C
CAPN8	388743	genome.wustl.edu	37	1	223717448	223717448	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:223717448G>C	ENST00000366872.5	-	18	1943	c.1944C>G	c.(1942-1944)atC>atG	p.I648M				A6NHC0	CAN8_HUMAN	calpain 8	670					digestion (GO:0007586)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)	4						TCTCCAGGCGGATCATACAAG	0.582																																						dbGAP											0													97.0	84.0	88.0					1																	223717448		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS73038.1	1q41	2013-01-10	2007-02-21		ENSG00000203697	ENSG00000203697		"""EF-hand domain containing"""	1485	protein-coding gene	gene with protein product			"""calpain 8 (nCL-2)"""			7690035, 8889549	Standard	NM_001143962		Approved	nCL-2	uc009xee.2	A6NHC0	OTTHUMG00000037378	ENST00000366872.5:c.1944C>G	1.37:g.223717448G>C	ENSP00000355837:p.Ile648Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXL2	Missense_Mutation	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.I648M	ENST00000366872.5	37	c.1944		1	.	.	.	.	.	.	.	.	.	.	G	9.045	0.990689	0.18966	.	.	ENSG00000203697	ENST00000430824;ENST00000366872	D;D	0.94758	-3.51;-3.51	5.07	4.12	0.48240	EF-hand-like domain (1);	0.326927	0.31381	N	0.007745	D	0.87645	0.6229	N	0.21545	0.675	0.29377	N	0.863569	B	0.22346	0.068	B	0.16289	0.015	T	0.80850	-0.1198	10	0.44086	T	0.13	.	7.7128	0.28688	0.0864:0.3106:0.6031:0.0	.	670	A6NHC0	CAN8_HUMAN	M	123;648	ENSP00000390294:I123M;ENSP00000355837:I648M	ENSP00000355837:I648M	I	-	3	3	CAPN8	221784071	1.000000	0.71417	0.999000	0.59377	0.892000	0.51952	0.595000	0.24029	2.368000	0.80403	0.460000	0.39030	ATC	CAPN8	-	NULL	ENSG00000203697		0.582	CAPN8-201	KNOWN	basic|appris_principal	protein_coding	CAPN8	HGNC	protein_coding		40	0.00	0	G	NM_001143962		223717448	223717448	-1	no_errors	ENST00000366872	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	C
CASC1	55259	genome.wustl.edu	37	12	25314105	25314105	+	Silent	SNP	G	G	C	rs200382302	byFrequency	TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:25314105G>C	ENST00000320267.9	-	2	111	c.30C>G	c.(28-30)acC>acG	p.T10T	CASC1_ENST00000537577.1_5'UTR|CASC1_ENST00000545133.1_Intron|CASC1_ENST00000354189.5_Silent_p.T74T|CASC1_ENST00000395990.2_5'UTR|CASC1_ENST00000557684.1_5'UTR|CASC1_ENST00000395987.3_Silent_p.T16T	NM_001082973.1	NP_001076442	Q6TDU7	CASC1_HUMAN	cancer susceptibility candidate 1	10										breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(3)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	Acute lymphoblastic leukemia(6;0.00112)|all_hematologic(7;0.00152)|Melanoma(3;0.0301)|Colorectal(261;0.11)		OV - Ovarian serous cystadenocarcinoma(3;7.42e-20)|Epithelial(3;7.58e-16)|all cancers(3;1.07e-13)			GTTCAGCTTTGGTGACTTTCT	0.353																																						dbGAP											0													269.0	250.0	256.0					12																	25314105		1859	4100	5959	-	-	-	SO:0001819	synonymous_variant	0			AK093102	CCDS31759.2, CCDS41762.1, CCDS41763.1, CCDS55810.1, CCDS55811.1	12p12.1	2012-04-17			ENSG00000118307	ENSG00000118307		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	29599	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 54"""					14583591	Standard	NM_018272		Approved	LAS1, FLJ10921, PPP1R54	uc001rgk.3	Q6TDU7	OTTHUMG00000150195	ENST00000320267.9:c.30C>G	12.37:g.25314105G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DNP2|F5H6T6|Q17RL2|Q4G171|Q5U5K5|Q9NV50	Silent	SNP	pfam_Casc1_domain,prints_Casc1	p.T16	ENST00000320267.9	37	c.48	CCDS41762.1	12																																																																																			CASC1	-	NULL	ENSG00000118307		0.353	CASC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASC1	HGNC	protein_coding	OTTHUMT00000316761.1	137	0.00	0	G	NM_018272		25314105	25314105	-1	no_errors	ENST00000395987	ensembl	human	known	69_37n	silent	124	21.02	33	SNP	0.964	C
CAST	831	genome.wustl.edu	37	5	96090380	96090380	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:96090380G>C	ENST00000341926.3	+	20	1558	c.1396G>C	c.(1396-1398)Gac>Cac	p.D466H	CAST_ENST00000508579.1_Missense_Mutation_p.D181H|CAST_ENST00000510756.1_Missense_Mutation_p.D527H|CAST_ENST00000504465.1_Missense_Mutation_p.D394H|CAST_ENST00000515663.1_Missense_Mutation_p.D189H|CAST_ENST00000511782.1_Missense_Mutation_p.D452H|CAST_ENST00000309190.5_Missense_Mutation_p.D444H|CAST_ENST00000508608.1_Missense_Mutation_p.D512H|CAST_ENST00000359176.4_Missense_Mutation_p.D530H|CAST_ENST00000511049.1_Missense_Mutation_p.D452H|CAST_ENST00000509903.1_Missense_Mutation_p.D431H|CAST_ENST00000395812.2_Missense_Mutation_p.D508H|CAST_ENST00000508830.1_Missense_Mutation_p.D549H|CAST_ENST00000348386.3_3'UTR|CAST_ENST00000338252.3_Missense_Mutation_p.D453H|CAST_ENST00000325674.7_Missense_Mutation_p.D514H|CAST_ENST00000395813.1_Missense_Mutation_p.D549H			P20810	ICAL_HUMAN	calpastatin	466					negative regulation of endopeptidase activity (GO:0010951)|negative regulation of type B pancreatic cell apoptotic process (GO:2000675)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	cysteine-type endopeptidase inhibitor activity (GO:0004869)|endopeptidase inhibitor activity (GO:0004866)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(4)|endometrium(2)|kidney(4)|large_intestine(3)|lung(5)|ovary(1)|skin(2)	22		all_cancers(142;5.27e-07)|all_epithelial(76;8.21e-10)|all_lung(232;0.000396)|Lung NSC(167;0.000539)|Ovarian(225;0.024)|Colorectal(57;0.0341)|Breast(839;0.244)		all cancers(79;6.85e-15)		CAAAGAAGAAGACCGTGAAAA	0.343																																						dbGAP											0													102.0	112.0	109.0					5																	96090380		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF327443	CCDS4082.1, CCDS54882.1, CCDS54883.1, CCDS75279.1	5q15	2012-09-20			ENSG00000153113	ENSG00000153113			1515	protein-coding gene	gene with protein product		114090				8340353, 14685690, 15820218	Standard	NM_173060		Approved		uc003klx.3	P20810	OTTHUMG00000128413	ENST00000341926.3:c.1396G>C	5.37:g.96090380G>C	ENSP00000339914:p.Asp466His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z468|G5E946|G5E9D3|O95360|Q05DE8|Q7Z4K0|Q96D08|Q9H1Z5	Missense_Mutation	SNP	pfam_Prot_inh_calpain	p.D549H	ENST00000341926.3	37	c.1645		5	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	16.49|16.49|16.49	3.137386|3.137386|3.137386	0.56936|0.56936|0.56936	.|.|.	.|.|.	ENSG00000153113|ENSG00000153113|ENSG00000153113	ENST00000338252;ENST00000508830;ENST00000395813;ENST00000359176;ENST00000325674;ENST00000395812;ENST00000510756;ENST00000508608;ENST00000341926;ENST00000511049;ENST00000309190;ENST00000510156;ENST00000504465;ENST00000509903;ENST00000511782;ENST00000508579;ENST00000515663|ENST00000437034|ENST00000510500	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T|.|.	0.16597|.|.	2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33;2.33|.|.	5.53|5.53|5.53	4.47|4.47|4.47	0.54385|0.54385|0.54385	.|.|.	0.484183|.|.	0.26010|.|.	N|.|.	0.026890|.|.	T|T|T	0.32852|0.32852|0.32852	0.0843|0.0843|0.0843	N|N|N	0.17922|0.17922|0.17922	0.545|0.545|0.545	0.23962|0.23962|0.23962	N|N|N	0.996334|0.996334|0.996334	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.|.	0.89917|.|.	1.0;0.979;1.0;1.0;0.979;1.0;0.961;0.999;1.0;1.0;0.997;1.0;0.996;1.0;1.0;0.996;1.0|.|.	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D|.|.	0.97110|.|.	1.0;0.93;0.999;0.999;0.928;0.999;0.951;0.988;0.999;0.999;0.981;0.999;0.967;0.999;0.999;0.967;1.0|.|.	T|T|T	0.15549|0.15549|0.15549	-1.0433|-1.0433|-1.0433	10|5|5	0.44086|.|.	T|.|.	0.13|.|.	-7.7218|-7.7218|-7.7218	12.205|12.205|12.205	0.54346|0.54346|0.54346	0.0956:0.0:0.9044:0.0|0.0956:0.0:0.9044:0.0|0.0956:0.0:0.9044:0.0	.|.|.	394;314;512;189;217;189;452;431;444;425;466;514;508;530;527;549;453|.|.	E9PDE4;B7Z8S8;B7Z468;E7EQA0;Q86YM9;E7EPY6;E7EVY3;E9PCH5;G5E946;P20810-4;P20810;P20810-5;G5E9D3;P20810-7;E7ESM9;P20810-6;P20810-2|.|.	.;.;.;.;.;.;.;.;.;.;ICAL_HUMAN;.;.;.;.;.;.|.|.	H|N|T	453;549;549;530;514;508;527;512;466;452;444;466;394;431;452;181;189|217|223	ENSP00000343421:D453H;ENSP00000425721:D549H;ENSP00000379158:D549H;ENSP00000352098:D530H;ENSP00000320319:D514H;ENSP00000379157:D508H;ENSP00000422176:D527H;ENSP00000422677:D512H;ENSP00000339914:D466H;ENSP00000421130:D452H;ENSP00000312523:D444H;ENSP00000422325:D466H;ENSP00000425670:D394H;ENSP00000426946:D431H;ENSP00000423638:D452H;ENSP00000425787:D181H;ENSP00000422929:D189H|.|.	ENSP00000312523:D444H|.|.	D|K|R	+|+|+	1|3|2	0|2|0	CAST|CAST|CAST	96116136|96116136|96116136	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.998000|0.998000|0.998000	0.56505|0.56505|0.56505	0.973000|0.973000|0.973000	0.67179|0.67179|0.67179	2.773000|2.773000|2.773000	0.47686|0.47686|0.47686	2.583000|2.583000|2.583000	0.87209|0.87209|0.87209	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAC|AAG|AGA	CAST	-	pfam_Prot_inh_calpain	ENSG00000153113		0.343	CAST-004	KNOWN	basic	protein_coding	CAST	HGNC	protein_coding	OTTHUMT00000250199.2	82	0.00	0	G	NM_173062		96090380	96090380	+1	no_errors	ENST00000395813	ensembl	human	known	69_37n	missense	71	13.41	11	SNP	0.877	C
CCDC146	57639	genome.wustl.edu	37	7	76903798	76903798	+	Splice_Site	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:76903798G>A	ENST00000285871.4	+	11	1396		c.e11-1		CCDC146_ENST00000415740.2_Splice_Site|CCDC146_ENST00000431197.1_Splice_Site	NM_020879.2	NP_065930.2	Q8IYE0	CC146_HUMAN	coiled-coil domain containing 146											breast(3)|central_nervous_system(3)|endometrium(1)|kidney(4)|large_intestine(7)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(2)	34		all_cancers(73;0.128)|all_lung(88;0.0986)|all_epithelial(88;0.163)|Myeloproliferative disorder(862;0.205)				TTTTTCAAAAGAAAATTATAT	0.279																																						dbGAP											0													17.0	17.0	17.0					7																	76903798		2178	4281	6459	-	-	-	SO:0001630	splice_region_variant	0			BC029458	CCDS34671.1	7q11.23	2011-09-07			ENSG00000135205	ENSG00000135205			29296	protein-coding gene	gene with protein product						10819331	Standard	NM_020879		Approved	KIAA1505	uc003uga.3	Q8IYE0	OTTHUMG00000162595	ENST00000285871.4:c.1270-1G>A	7.37:g.76903798G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8X6|Q9P223	Splice_Site	SNP	-	e10-1	ENST00000285871.4	37	c.1270-1	CCDS34671.1	7	.	.	.	.	.	.	.	.	.	.	G	13.73	2.325566	0.41197	.	.	ENSG00000135205	ENST00000285871;ENST00000431197	.	.	.	5.97	5.97	0.96955	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0275	0.97527	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC007000.1	76741734	1.000000	0.71417	1.000000	0.80357	0.320000	0.28249	6.747000	0.74872	2.833000	0.97629	0.585000	0.79938	.	CCDC146	-	-	ENSG00000135205		0.279	CCDC146-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC146	HGNC	protein_coding	OTTHUMT00000341449.1	22	0.00	0	G	NM_020879	Intron	76903798	76903798	+1	no_errors	ENST00000285871	ensembl	human	known	69_37n	splice_site	24	20.00	6	SNP	1.000	A
CCDC157	550631	genome.wustl.edu	37	22	30768209	30768209	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:30768209C>G	ENST00000405659.1	+	7	1978	c.1269C>G	c.(1267-1269)gtC>gtG	p.V423V	RP1-130H16.16_ENST00000332468.4_RNA|CCDC157_ENST00000338306.3_Silent_p.V423V			Q569K6	CC157_HUMAN	coiled-coil domain containing 157	423										central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|skin(3)|upper_aerodigestive_tract(1)	15						GCCAGCAGGTCTGCTGGGCCA	0.682																																						dbGAP											0													13.0	15.0	14.0					22																	30768209		2189	4291	6480	-	-	-	SO:0001819	synonymous_variant	0			BC018040	CCDS33632.2	22q12.2	2009-03-05			ENSG00000187860	ENSG00000187860			33854	protein-coding gene	gene with protein product							Standard	NM_001017437		Approved		uc011aku.2	Q569K6	OTTHUMG00000151007	ENST00000405659.1:c.1269C>G	22.37:g.30768209C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VD76|Q9BYA4	Silent	SNP	superfamily_Prefoldin,superfamily_t-SNARE	p.V423	ENST00000405659.1	37	c.1269	CCDS33632.2	22																																																																																			CCDC157	-	NULL	ENSG00000187860		0.682	CCDC157-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC157	HGNC	protein_coding	OTTHUMT00000320936.1	23	0.00	0	C	NM_001017437		30768209	30768209	+1	no_errors	ENST00000338306	ensembl	human	known	69_37n	silent	15	37.50	9	SNP	0.984	G
CCDC173	129881	genome.wustl.edu	37	2	170518927	170518927	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:170518927C>T	ENST00000447353.1	-	5	787	c.682G>A	c.(682-684)Gaa>Aaa	p.E228K		NM_001085447.1	NP_001078916.1	Q0VFZ6	CC173_HUMAN	coiled-coil domain containing 173	228																	CTTTCCTCTTCTTCCTCATGT	0.269																																						dbGAP											0													59.0	59.0	59.0					2																	170518927		1790	4055	5845	-	-	-	SO:0001583	missense	0			BC015980, BC117445	CCDS46445.1	2q31.1	2012-08-07	2012-08-07	2012-08-07	ENSG00000154479	ENSG00000154479			25064	protein-coding gene	gene with protein product	"""hypothetical LOC129881"""		"""chromosome 2 open reading frame 77"""	C2orf77		12477932	Standard	NM_001085447		Approved	LOC129881	uc002ufe.2	Q0VFZ6	OTTHUMG00000154116	ENST00000447353.1:c.682G>A	2.37:g.170518927C>T	ENSP00000391504:p.Glu228Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJF6	Missense_Mutation	SNP	NULL	p.E228K	ENST00000447353.1	37	c.682	CCDS46445.1	2	.	.	.	.	.	.	.	.	.	.	C	9.393	1.076101	0.20227	.	.	ENSG00000154479	ENST00000447353;ENST00000421028	T	0.09255	3.0	4.4	3.52	0.40303	.	0.524714	0.20324	N	0.094576	T	0.10680	0.0261	L	0.55103	1.725	0.31884	N	0.618033	B	0.22604	0.072	B	0.25405	0.06	T	0.06445	-1.0826	10	0.28530	T	0.3	.	6.8916	0.24232	0.0:0.7229:0.1776:0.0995	.	228	Q0VFZ6	CB077_HUMAN	K	228;129	ENSP00000391504:E228K	ENSP00000405608:E129K	E	-	1	0	C2orf77	170227173	0.998000	0.40836	0.975000	0.42487	0.596000	0.36781	2.275000	0.43399	1.149000	0.42402	0.655000	0.94253	GAA	CCDC173	-	NULL	ENSG00000154479		0.269	CCDC173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC173	HGNC	protein_coding	OTTHUMT00000333954.2	94	0.00	0	C	NM_001085447		170518927	170518927	-1	no_errors	ENST00000447353	ensembl	human	known	69_37n	missense	99	13.16	15	SNP	0.929	T
CCL23	6368	genome.wustl.edu	37	17	34340801	34340801	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:34340801G>T	ENST00000591423.1	-	3	298	c.234C>A	c.(232-234)tgC>tgA	p.C78*	RP11-104J23.2_ENST00000590149.1_lincRNA|CCL23_ENST00000293280.2_Nonsense_Mutation_p.C95*|RP11-104J23.1_ENST00000588294.1_RNA	NM_145898.1	NP_665905.1	P55773	CCL23_HUMAN	chemokine (C-C motif) ligand 23	78					cell-cell signaling (GO:0007267)|cellular calcium ion homeostasis (GO:0006874)|chemotaxis (GO:0006935)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|monocyte chemotaxis (GO:0002548)|negative regulation of C-C chemokine binding (GO:2001264)|negative regulation of cell proliferation (GO:0008285)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	CCR1 chemokine receptor binding (GO:0031726)|chemokine activity (GO:0008009)|heparin binding (GO:0008201)			large_intestine(2)|liver(1)|lung(2)|prostate(1)	6		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CCGGCTTGGAGCACTCGCTGT	0.532																																						dbGAP											0													105.0	91.0	96.0					17																	34340801		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U58913	CCDS11305.1, CCDS59282.1	17q11.2	2014-05-06	2002-08-22	2002-08-23	ENSG00000167236	ENSG00000274736		"""Chemokine ligands"", ""Endogenous ligands"""	10622	protein-coding gene	gene with protein product		602494	"""small inducible cytokine subfamily A (Cys-Cys), member 23"""	SCYA23		9104803, 10409433	Standard	XR_429910		Approved	Ckb-8, MPIF-1, MIP-3, CKb8	uc002hks.1	P55773	OTTHUMG00000188409	ENST00000591423.1:c.234C>A	17.37:g.34340801G>T	ENSP00000465954:p.Cys78*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKQ3|O00174|O75950|Q52LD4	Nonsense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	p.C95*	ENST00000591423.1	37	c.285	CCDS59282.1	17	.	.	.	.	.	.	.	.	.	.	G	12.55	1.972772	0.34848	.	.	ENSG00000167236	ENST00000293280	.	.	.	3.7	-0.701	0.11269	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	6.2719	0.20959	0.4769:0.0:0.5231:0.0	.	.	.	.	X	95	.	ENSP00000293280:C95X	C	-	3	2	CCL23	31364914	0.997000	0.39634	0.026000	0.17262	0.002000	0.02628	1.494000	0.35616	0.030000	0.15379	-0.409000	0.06214	TGC	CCL23	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom	ENSG00000167236		0.532	CCL23-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCL23	HGNC	protein_coding	OTTHUMT00000450228.1	65	0.00	0	G	NM_005064, NM_145898		34340801	34340801	-1	no_errors	ENST00000293280	ensembl	human	known	69_37n	nonsense	51	19.05	12	SNP	0.053	T
CCT8	10694	genome.wustl.edu	37	21	30428810	30428810	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr21:30428810C>G	ENST00000286788.4	-	15	1839	c.1633G>C	c.(1633-1635)Gac>Cac	p.D545H	CCT8_ENST00000470450.1_5'UTR|CCT8_ENST00000540844.1_Missense_Mutation_p.D472H|CCT8_ENST00000542732.1_Missense_Mutation_p.D526H|AF129075.5_ENST00000457162.2_RNA	NM_006585.2	NP_006576.2	P50990	TCPQ_HUMAN	chaperonin containing TCP1, subunit 8 (theta)	545					'de novo' posttranslational protein folding (GO:0051084)|ATP catabolic process (GO:0006200)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	aggresome (GO:0016235)|cell body (GO:0044297)|centrosome (GO:0005813)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|microtubule (GO:0005874)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(1)|prostate(3)	14						TCATTTTGGTCATCATCCCAG	0.383																																						dbGAP											0													104.0	90.0	95.0					21																	30428810		2203	4298	6501	-	-	-	SO:0001583	missense	0			Z37163	CCDS33528.1, CCDS68180.1	21q21.3	2011-09-02			ENSG00000156261	ENSG00000156261		"""Heat Shock Proteins / Chaperonins"""	1623	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 112"""	C21orf112		7890169	Standard	NM_006585		Approved	Cctq, PRED71	uc002ynb.3	P50990	OTTHUMG00000044595	ENST00000286788.4:c.1633G>C	21.37:g.30428810C>G	ENSP00000286788:p.Asp545His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN54|B4DEM7|B4DQH4|Q4VBP8	Missense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,tigrfam_Chap_CCT_theta	p.D545H	ENST00000286788.4	37	c.1633	CCDS33528.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.5|20.5	3.993999|3.993999	0.74703|0.74703	.|.	.|.	ENSG00000156261|ENSG00000156261	ENST00000389159;ENST00000286788;ENST00000542732;ENST00000540844|ENST00000432178	T;T;T|.	0.75821|.	-0.88;-0.97;2.22|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|.	0.82522|.	0.5055|.	M|M	0.82517|0.82517	2.595|2.595	0.80722|0.80722	D|D	1|1	D;D;D;D;D|.	0.89917|.	0.999;0.999;0.999;1.0;0.999|.	D;D;D;D;D|.	0.85130|.	0.99;0.99;0.994;0.997;0.994|.	T|.	0.82571|.	-0.0391|.	10|.	0.87932|.	D|.	0|.	-21.8857|-21.8857	19.6982|19.6982	0.96039|0.96039	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	472;526;545;544;545|.	B4DQH4;B4DEM7;Q53HU0;G5E9B2;P50990|.	.;.;.;.;TCPQ_HUMAN|.	H|S	544;545;526;472|103	ENSP00000286788:D545H;ENSP00000444984:D526H;ENSP00000442730:D472H|.	ENSP00000286788:D545H|.	D|X	-|-	1|2	0|2	CCT8|CCT8	29350681|29350681	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	7.160000|7.160000	0.77495|0.77495	2.894000|2.894000	0.99253|0.99253	0.655000|0.655000	0.94253|0.94253	GAC|TGA	CCT8	-	NULL	ENSG00000156261		0.383	CCT8-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8	HGNC	protein_coding	OTTHUMT00000171822.1	67	0.00	0	C			30428810	30428810	-1	no_errors	ENST00000286788	ensembl	human	known	69_37n	missense	47	10.91	6	SNP	1.000	G
CD22	933	genome.wustl.edu	37	19	35827138	35827138	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:35827138C>G	ENST00000085219.5	+	4	678	c.612C>G	c.(610-612)ctC>ctG	p.L204L	CD22_ENST00000544992.2_Silent_p.L204L|CD22_ENST00000594250.1_Silent_p.L204L|CD22_ENST00000419549.2_Silent_p.L32L|CD22_ENST00000270311.6_Silent_p.L84L|CD22_ENST00000536635.2_Silent_p.L204L|CD22_ENST00000341773.6_Silent_p.L204L	NM_001771.3	NP_001762.2	P20273	CD22_HUMAN	CD22 molecule	204	Ig-like C2-type 1.				cell adhesion (GO:0007155)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	carbohydrate binding (GO:0030246)			breast(2)|endometrium(2)|kidney(3)|large_intestine(14)|lung(21)|ovary(5)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	54	all_lung(56;9.78e-09)|Lung NSC(56;1.46e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.83e-19)|OV - Ovarian serous cystadenocarcinoma(14;3.19e-18)|all cancers(14;3.41e-16)|LUSC - Lung squamous cell carcinoma(66;0.0417)			GGAGCGAGCTCAAGTTCTCCC	0.562																																					Ovarian(42;1009 1133 23674 26041)	dbGAP											0													85.0	75.0	78.0					19																	35827138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52785	CCDS12457.1, CCDS54247.1, CCDS54248.1, CCDS54249.1, CCDS62634.1	19q13.1	2013-01-29	2006-03-28		ENSG00000012124	ENSG00000012124		"""CD molecules"", ""Sialic acid binding Ig-like lectins"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1643	protein-coding gene	gene with protein product	"""sialic acid binding Ig-like lectin 2"""	107266	"""CD22 antigen"""			8496602, 1691828	Standard	NM_001185099		Approved	SIGLEC-2, SIGLEC2	uc010edt.3	P20273		ENST00000085219.5:c.612C>G	19.37:g.35827138C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	F5GYU4|F5H7U3|O95699|O95701|O95702|O95703|Q01665|Q32M46|Q92872|Q92873|Q9UQA6|Q9UQA7|Q9UQA8|Q9UQA9|Q9UQB0|Q9Y2A6	Silent	SNP	pfam_Immunoglobulin,pfam_Ig_I-set,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L204	ENST00000085219.5	37	c.612	CCDS12457.1	19																																																																																			CD22	-	pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000012124		0.562	CD22-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD22	HGNC	protein_coding	OTTHUMT00000466099.1	47	0.00	0	C	NM_001771		35827138	35827138	+1	no_errors	ENST00000085219	ensembl	human	known	69_37n	silent	48	15.79	9	SNP	0.769	G
CD8B	926	genome.wustl.edu	37	2	87049465	87049465	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:87049465C>G	ENST00000393759.2	-	6	702	c.653G>C	c.(652-654)aGa>aCa	p.R218T	CD8B_ENST00000331469.2_Intron|CD8B_ENST00000393761.2_Intron|CD8B_ENST00000349455.3_Intron	NM_172101.3	NP_742099.1	P10966	CD8B_HUMAN	CD8b molecule	0					immune response (GO:0006955)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell activation (GO:0042110)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	early endosome membrane (GO:0031901)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	coreceptor activity (GO:0015026)|MHC class I protein binding (GO:0042288)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|skin(1)|upper_aerodigestive_tract(1)	13						GTAGTCCATTCTGGAACATTT	0.333																																						dbGAP											0													144.0	142.0	142.0					2																	87049465		1833	4081	5914	-	-	-	SO:0001583	missense	0				CCDS1994.1, CCDS1995.1, CCDS42708.1, CCDS1997.1, CCDS54376.1	2p12	2013-01-11	2006-03-28	2006-03-09	ENSG00000172116	ENSG00000172116		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	1707	protein-coding gene	gene with protein product		186730	"""CD8 antigen, beta polypeptide 1 (p37)"""	CD8B1		1541829	Standard	NM_172213		Approved		uc002srw.3	P10966	OTTHUMG00000130264	ENST00000393759.2:c.653G>C	2.37:g.87049465C>G	ENSP00000377356:p.Arg218Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	P14860|P14861|Q15980|Q496E0|Q496E1|Q496E2|Q9UDB4|Q9UDB5|Q9UDB6|Q9UDB7|Q9UDB8|Q9UDB9|Q9UDC0|Q9UQ55	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.R218T	ENST00000393759.2	37	c.653	CCDS42708.1	2	.	.	.	.	.	.	.	.	.	.	C	2.572	-0.299327	0.05532	.	.	ENSG00000172116	ENST00000393759	.	.	.	3.03	-2.34	0.06704	.	.	.	.	.	T	0.26448	0.0646	.	.	.	0.09310	N	1	B	0.21606	0.058	B	0.14023	0.01	T	0.23368	-1.0190	7	0.87932	D	0	.	4.1324	0.10156	0.0:0.325:0.1867:0.4883	.	218	P10966-2	.	T	218	.	ENSP00000377356:R218T	R	-	2	0	CD8B	86902976	0.004000	0.15560	0.000000	0.03702	0.011000	0.07611	-0.397000	0.07269	-0.617000	0.05664	-0.333000	0.08304	AGA	CD8B	-	NULL	ENSG00000172116		0.333	CD8B-003	KNOWN	basic|CCDS	protein_coding	CD8B	HGNC	protein_coding	OTTHUMT00000252595.1	61	0.00	0	C	NM_172099		87049465	87049465	-1	no_errors	ENST00000393759	ensembl	human	known	69_37n	missense	76	13.64	12	SNP	0.000	G
CDC16	8881	genome.wustl.edu	37	13	115002150	115002150	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:115002150G>C	ENST00000356221.3	+	2	187	c.79G>C	c.(79-81)Gat>Cat	p.D27H	CDC16_ENST00000375310.1_5'UTR|CDC16_ENST00000375312.3_5'UTR|CDC16_ENST00000252458.6_5'UTR|CDC16_ENST00000375308.1_5'UTR|CDC16_ENST00000360383.3_Missense_Mutation_p.D27H|CDC16_ENST00000252457.5_Missense_Mutation_p.D27H			Q13042	CDC16_HUMAN	cell division cycle 16	27					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of mitosis (GO:0007088)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|spindle (GO:0005819)				endometrium(3)|kidney(2)|large_intestine(5)|liver(2)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	Lung NSC(43;0.00299)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0191)|all_epithelial(44;0.00716)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.238)	BRCA - Breast invasive adenocarcinoma(86;0.0886)			ATTTTGGGCAGATAAAGTAGC	0.338																																						dbGAP											0													125.0	126.0	126.0					13																	115002150		2203	4300	6503	-	-	-	SO:0001583	missense	0			U18291	CCDS9542.2	13q34	2013-01-17	2013-01-17		ENSG00000130177	ENSG00000130177		"""Anaphase promoting complex subunits"", ""Tetratricopeptide (TTC) repeat domain containing"""	1720	protein-coding gene	gene with protein product	"""anaphase-promoting complex, subunit 6"""	603461	"""CDC16 (cell division cycle 16, S. cerevisiae, homolog)"", ""CDC16 cell division cycle 16 homolog (S. cerevisiae)"", ""cell division cycle 16 homolog (S. cerevisiae)"""			7736578	Standard	NM_001078645		Approved	APC6, ANAPC6, CUT9	uc001vul.1	Q13042	OTTHUMG00000017402	ENST00000356221.3:c.79G>C	13.37:g.115002150G>C	ENSP00000348554:p.Asp27His	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A365|Q5T8C8|Q96AE6|Q9Y564	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D27H	ENST00000356221.3	37	c.79	CCDS9542.2	13	.	.	.	.	.	.	.	.	.	.	G	26.0	4.697931	0.88830	.	.	ENSG00000130177	ENST00000360383;ENST00000356221;ENST00000252457	T;T;T	0.39787	1.06;1.06;1.06	5.33	5.33	0.75918	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.69886	0.3161	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.996;0.998;0.999	T	0.72350	-0.4320	9	.	.	.	-6.3415	19.212	0.93760	0.0:0.0:1.0:0.0	.	27;27;27;27	B4DK74;Q13042-3;Q13042-2;Q13042	.;.;.;CDC16_HUMAN	H	27	ENSP00000353549:D27H;ENSP00000348554:D27H;ENSP00000252457:D27H	.	D	+	1	0	CDC16	114020252	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.536000	0.90627	2.778000	0.95560	0.655000	0.94253	GAT	CDC16	-	NULL	ENSG00000130177		0.338	CDC16-009	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDC16	HGNC	protein_coding	OTTHUMT00000276737.1	71	0.00	0	G	NM_003903		115002150	115002150	+1	no_errors	ENST00000356221	ensembl	human	known	69_37n	missense	42	14.29	7	SNP	1.000	C
CDH1	999	genome.wustl.edu	37	16	68863661	68863661	+	Frame_Shift_Del	DEL	C	C	-			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:68863661delC	ENST00000261769.5	+	15	2591	c.2400delC	c.(2398-2400)cgcfs	p.R800fs	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Frame_Shift_Del_p.R739fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	800					adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ATCTTCCCCGCCCTGCCAATC	0.522			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0													76.0	69.0	71.0					16																	68863661		2198	4300	6498	-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.2400delC	16.37:g.68863661delC	ENSP00000261769:p.Arg800fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Del	DEL	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P801fs	ENST00000261769.5	37	c.2400	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin_cytoplasmic-dom	ENSG00000039068		0.522	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	32	0.00	0	C	NM_004360		68863661	68863661	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_del	28	12.50	4	DEL	0.975	-
CDH17	1015	genome.wustl.edu	37	8	95189831	95189831	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:95189831G>C	ENST00000027335.3	-	4	393	c.269C>G	c.(268-270)tCt>tGt	p.S90C	CDH17_ENST00000441892.2_Missense_Mutation_p.S90C|CDH17_ENST00000450165.2_Missense_Mutation_p.S90C	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	90	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			ATTGTGAGTAGATCTTGTTTC	0.463																																						dbGAP											0													230.0	218.0	222.0					8																	95189831		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.269C>G	8.37:g.95189831G>C	ENSP00000027335:p.Ser90Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15336|Q2M2E0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.S90C	ENST00000027335.3	37	c.269	CCDS6260.1	8	.	.	.	.	.	.	.	.	.	.	G	11.90	1.775681	0.31411	.	.	ENSG00000079112	ENST00000027335;ENST00000441892;ENST00000450165;ENST00000521491	T;T;T;T	0.62941	-0.01;-0.01;-0.01;-0.01	5.93	5.93	0.95920	Cadherin (3);Cadherin-like (1);	0.115010	0.39274	N	0.001406	T	0.68723	0.3032	M	0.74258	2.255	0.09310	N	1	P;P	0.47841	0.901;0.898	P;B	0.48227	0.571;0.336	T	0.68142	-0.5487	10	0.62326	D	0.03	-20.0323	12.7685	0.57405	0.0:0.0:0.8364:0.1636	.	90;90	E7EN24;Q12864	.;CAD17_HUMAN	C	90	ENSP00000027335:S90C;ENSP00000392811:S90C;ENSP00000401468:S90C;ENSP00000428189:S90C	ENSP00000027335:S90C	S	-	2	0	CDH17	95259007	0.923000	0.31300	0.545000	0.28153	0.059000	0.15707	2.275000	0.43399	2.814000	0.96858	0.563000	0.77884	TCT	CDH17	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000079112		0.463	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	103	0.00	0	G	NM_004063		95189831	95189831	-1	no_errors	ENST00000027335	ensembl	human	known	69_37n	missense	70	16.67	14	SNP	0.218	C
CDH5	1003	genome.wustl.edu	37	16	66424332	66424332	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:66424332G>C	ENST00000341529.3	+	6	956	c.808G>C	c.(808-810)Gac>Cac	p.D270H	CDH5_ENST00000563425.2_Missense_Mutation_p.D270H	NM_001795.3	NP_001786.2	P33151	CADH5_HUMAN	cadherin 5, type 2 (vascular endothelium)	270	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel maturation (GO:0001955)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|negative regulation of cell proliferation (GO:0008285)|regulation of establishment of cell polarity (GO:2000114)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|ion channel binding (GO:0044325)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(3)|kidney(18)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	54		Ovarian(137;0.0955)		OV - Ovarian serous cystadenocarcinoma(108;0.107)	Lenalidomide(DB00480)	CGTGCCTGAAGACACCCGTGT	0.532																																						dbGAP											0													62.0	62.0	62.0					16																	66424332		2201	4300	6501	-	-	-	SO:0001583	missense	0			X79981	CCDS10804.1	16q22.1	2010-01-26	2008-07-25		ENSG00000179776	ENSG00000179776		"""CD molecules"", ""Cadherins / Major cadherins"""	1764	protein-coding gene	gene with protein product	"""VE-cadherin"""	601120	"""cadherin 5, type 2, VE-cadherin (vascular epithelium)"""			2059658	Standard	NM_001795		Approved	7B4, CD144	uc002eom.4	P33151	OTTHUMG00000137495	ENST00000341529.3:c.808G>C	16.37:g.66424332G>C	ENSP00000344115:p.Asp270His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAI5|Q4VAI6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D270H	ENST00000341529.3	37	c.808	CCDS10804.1	16	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229634	0.39399	.	.	ENSG00000179776	ENST00000341529;ENST00000379531	T	0.41065	1.01	5.97	5.97	0.96955	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.67702	0.2921	M	0.89030	3	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	T	0.72849	-0.4168	9	0.87932	D	0	.	11.2235	0.48869	0.0825:0.0:0.9175:0.0	.	270	P33151	CADH5_HUMAN	H	270	ENSP00000344115:D270H	ENSP00000344115:D270H	D	+	1	0	CDH5	64981833	0.990000	0.36364	0.997000	0.53966	0.010000	0.07245	1.233000	0.32648	2.837000	0.97791	0.655000	0.94253	GAC	CDH5	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000179776		0.532	CDH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH5	HGNC	protein_coding	OTTHUMT00000268767.1	59	0.00	0	G	NM_001795		66424332	66424332	+1	no_errors	ENST00000341529	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.970	C
CELSR3	1951	genome.wustl.edu	37	3	48696405	48696405	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:48696405G>A	ENST00000164024.4	-	1	3943	c.3663C>T	c.(3661-3663)gtC>gtT	p.V1221V	CELSR3_ENST00000544264.1_Silent_p.V1221V	NM_001407.2	NP_001398.2	Q9NYQ7	CELR3_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 3	1221	Cadherin 9. {ECO:0000255|PROSITE- ProRule:PRU00043}.				axonal fasciculation (GO:0007413)|cilium assembly (GO:0042384)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of protein localization (GO:0032880)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(9)|prostate(6)|skin(7)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	83				BRCA - Breast invasive adenocarcinoma(193;0.000292)|KIRC - Kidney renal clear cell carcinoma(197;0.00549)|Kidney(197;0.00619)		TGGTCTGGTTGACTACCAGCA	0.592																																						dbGAP											0													66.0	54.0	58.0					3																	48696405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF231023	CCDS2775.1	3p21.31	2014-08-08	2013-02-18		ENSG00000008300	ENSG00000008300		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3230	protein-coding gene	gene with protein product	"""flamingo homolog 1 (Drosophila)"""	604264	"""cadherin EGF LAG seven-pass G-type receptor 3, flamingo (Drosophila) homolog"""	EGFL1		9693030	Standard	NM_001407		Approved	MEGF2, HFMI1, FMI1, CDHF11	uc003cuf.1	Q9NYQ7	OTTHUMG00000133544	ENST00000164024.4:c.3663C>T	3.37:g.48696405G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O75092	Silent	SNP	pfam_Cadherin,pfam_GPCR_2_secretin-like,pfam_Laminin_G,pfam_DUF3497,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.V1221	ENST00000164024.4	37	c.3663	CCDS2775.1	3																																																																																			CELSR3	-	superfamily_Cadherin-like,smart_Cadherin	ENSG00000008300		0.592	CELSR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR3	HGNC	protein_coding	OTTHUMT00000257523.1	60	0.00	0	G	NM_001407		48696405	48696405	-1	no_errors	ENST00000544264	ensembl	human	known	69_37n	silent	38	15.56	7	SNP	1.000	A
CDHR4	389118	genome.wustl.edu	37	3	49834418	49834418	+	Missense_Mutation	SNP	G	G	C	rs528608981		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:49834418G>C	ENST00000412678.2	-	5	551	c.543C>G	c.(541-543)ttC>ttG	p.F181L		NM_001007540.2	NP_001007541.2	A6H8M9	CDHR4_HUMAN	cadherin-related family member 4	181					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|large_intestine(3)|lung(3)	11						CATTGATGGAGAAAGGTCCAG	0.552																																						dbGAP											0													90.0	85.0	87.0					3																	49834418		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46829.1	3p21.31	2011-07-01	2010-01-25	2010-01-25	ENSG00000187492	ENSG00000187492		"""Cadherins / Cadherin-related"""	34527	protein-coding gene	gene with protein product			"""cadherin-like 29"""	CDH29			Standard	NM_001007540		Approved	VLLR9392	uc010hkz.3	A6H8M9	OTTHUMG00000158198	ENST00000412678.2:c.543C>G	3.37:g.49834418G>C	ENSP00000391409:p.Phe181Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXT0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.F181L	ENST00000412678.2	37	c.543	CCDS46829.1	3	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769075	0.69992	.	.	ENSG00000187492	ENST00000412678	T	0.64260	-0.09	5.25	4.37	0.52481	.	.	.	.	.	T	0.67011	0.2848	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.66929	-0.5799	9	0.48119	T	0.1	-13.8517	10.0313	0.42103	0.094:0.0:0.906:0.0	.	181	A6H8M9	CDHR4_HUMAN	L	181	ENSP00000391409:F181L	ENSP00000391409:F181L	F	-	3	2	CDHR4	49809422	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.195000	0.58400	1.364000	0.46038	0.650000	0.86243	TTC	CDHR4	-	NULL	ENSG00000187492		0.552	CDHR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDHR4	HGNC	protein_coding	OTTHUMT00000350387.1	60	0.00	0	G	NM_001007540		49834418	49834418	-1	no_errors	ENST00000412678	ensembl	human	known	69_37n	missense	27	18.18	6	SNP	1.000	C
CEP170	9859	genome.wustl.edu	37	1	243289797	243289797	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:243289797C>G	ENST00000366542.1	-	20	4760	c.4709G>C	c.(4708-4710)aGa>aCa	p.R1570T	CEP170_ENST00000481987.1_Missense_Mutation_p.R306T|CEP170_ENST00000490813.1_Missense_Mutation_p.R279T|CEP170_ENST00000366544.1_Missense_Mutation_p.R1472T|CEP170_ENST00000366543.1_Missense_Mutation_p.R1446T|CEP170_ENST00000468254.1_5'UTR	NM_014812.2	NP_055627.2	Q5SW79	CE170_HUMAN	centrosomal protein 170kDa	1570	Targeting to centrosomes.|Targeting to microtubules.					centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nuclear membrane (GO:0031965)				NS(1)|breast(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	62	all_neural(11;0.101)	all_cancers(173;0.003)	all cancers(7;5.81e-06)|GBM - Glioblastoma multiforme(7;0.000443)|OV - Ovarian serous cystadenocarcinoma(106;0.0101)			GGGGTTGAATCTATTGAAATG	0.428																																						dbGAP											0													36.0	33.0	34.0					1																	243289797		1870	4097	5967	-	-	-	SO:0001583	missense	0			AB022657	CCDS44337.1, CCDS44338.1, CCDS44339.1	1q44	2014-02-20	2006-01-12	2006-01-12	ENSG00000143702	ENSG00000143702			28920	protein-coding gene	gene with protein product	"""KARP 1 binding protein"", ""XRCC5 binding protein"""	613023	"""KIAA0470"""	KIAA0470		15616186	Standard	NM_014812		Approved	KAB, FAM68A	uc021plo.1	Q5SW79	OTTHUMG00000039862	ENST00000366542.1:c.4709G>C	1.37:g.243289797C>G	ENSP00000355500:p.Arg1570Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75058|Q5SW77|Q5SW78|Q7LGA9|Q86W31|Q9UQ08|Q9UQ09	Splice_Site	SNP	-	NULL	ENST00000366542.1	37	c.NULL	CCDS44339.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.50|16.50	3.139696|3.139696	0.56936|0.56936	.|.	.|.	ENSG00000143702|ENSG00000143702	ENST00000336415|ENST00000366542;ENST00000366544;ENST00000366543;ENST00000481987;ENST00000490813	.|T;T;T	.|0.58797	.|0.38;0.31;0.34	4.72|4.72	4.72|4.72	0.59763|0.59763	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.66896|0.66896	0.2836|0.2836	L|L	0.38175|0.38175	1.15|1.15	0.50171|0.50171	D|D	0.999852|0.999852	.|D;D;D	.|0.64830	.|0.992;0.992;0.994	.|D;D;D	.|0.74348	.|0.974;0.974;0.983	T|T	0.65051|0.65051	-0.6262|-0.6262	5|10	.|0.34782	.|T	.|0.22	-14.12|-14.12	17.013|17.013	0.86411|0.86411	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1472;1446;1570	.|Q5SW79-3;Q5SW79-2;Q5SW79	.|.;.;CE170_HUMAN	H|T	1544|1570;1472;1446;306;279	.|ENSP00000355500:R1570T;ENSP00000355502:R1472T;ENSP00000355501:R1446T	.|ENSP00000355500:R1570T	D|R	-|-	1|2	0|0	CEP170|CEP170	241356420|241356420	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.939000|0.939000	0.58152|0.58152	5.313000|5.313000	0.65798|0.65798	2.338000|2.338000	0.79540|0.79540	0.305000|0.305000	0.20034|0.20034	GAT|AGA	CEP170	-	-	ENSG00000143702		0.428	CEP170-003	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	CEP170	HGNC	protein_coding	OTTHUMT00000096178.2	42	0.00	0	C	NM_014812		243289797	243289797	-1	no_errors	ENST00000466495	ensembl	human	known	69_37n	splice_site	35	16.67	7	SNP	1.000	G
CERK	64781	genome.wustl.edu	37	22	47116889	47116889	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:47116889C>G	ENST00000216264.8	-	2	278	c.166G>C	c.(166-168)Gag>Cag	p.E56Q	CERK_ENST00000541677.1_5'UTR	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	56	Required for binding to sulfatide and phosphoinositides.				ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)			cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		GCGATGATCTCAGATACAGGC	0.458																																						dbGAP											0													186.0	169.0	174.0					22																	47116889		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.166G>C	22.37:g.47116889C>G	ENSP00000216264:p.Glu56Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,superfamily_ATP-NAD_kinase_PpnK-typ,smart_Diacylglycerol_kinase_cat_dom	p.E56Q	ENST00000216264.8	37	c.166	CCDS14077.1	22	.	.	.	.	.	.	.	.	.	.	C	18.92	3.725330	0.68959	.	.	ENSG00000100422	ENST00000216264	T	0.27256	1.68	4.97	4.97	0.65823	Pleckstrin homology domain (1);	0.260319	0.36815	N	0.002383	T	0.47619	0.1455	M	0.62723	1.935	0.80722	D	1	D	0.76494	0.999	D	0.68621	0.959	T	0.46624	-0.9178	10	0.59425	D	0.04	-12.2311	15.7345	0.77831	0.0:1.0:0.0:0.0	.	56	Q8TCT0	CERK1_HUMAN	Q	56	ENSP00000216264:E56Q	ENSP00000216264:E56Q	E	-	1	0	CERK	45495553	0.999000	0.42202	0.897000	0.35233	0.585000	0.36419	5.258000	0.65479	2.304000	0.77564	0.557000	0.71058	GAG	CERK	-	NULL	ENSG00000100422		0.458	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERK	HGNC	protein_coding	OTTHUMT00000317924.2	52	0.00	0	C	NM_022766		47116889	47116889	-1	no_errors	ENST00000216264	ensembl	human	known	69_37n	missense	62	10.14	7	SNP	0.986	G
CFTR	1080	genome.wustl.edu	37	7	117171132	117171132	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:117171132G>C	ENST00000003084.6	+	4	585	c.453G>C	c.(451-453)caG>caC	p.Q151H	CFTR_ENST00000454343.1_Missense_Mutation_p.Q151H	NM_000492.3	NP_000483.3	P13569	CFTR_HUMAN	cystic fibrosis transmembrane conductance regulator (ATP-binding cassette sub-family C, member 7)	151	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cellular response to cAMP (GO:0071320)|cellular response to hormone stimulus (GO:0032870)|chloride transmembrane transport (GO:1902476)|cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intracellular pH elevation (GO:0051454)|iodide transport (GO:0015705)|lung development (GO:0030324)|membrane hyperpolarization (GO:0060081)|positive regulation of vasodilation (GO:0045909)|positive regulation of voltage-gated chloride channel activity (GO:1902943)|respiratory gaseous exchange (GO:0007585)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to peptide hormone (GO:0043434)|sperm capacitation (GO:0048240)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)|vasodilation (GO:0042311)|water transport (GO:0006833)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|chloride channel complex (GO:0034707)|cytoplasmic vesicle membrane (GO:0030659)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-binding and phosphorylation-dependent chloride channel activity (GO:0005224)|bicarbonate transmembrane transporter activity (GO:0015106)|channel-conductance-controlling ATPase activity (GO:0005260)|chloride channel activity (GO:0005254)|chloride channel inhibitor activity (GO:0019869)|chloride transmembrane transporter activity (GO:0015108)|enzyme binding (GO:0019899)|PDZ domain binding (GO:0030165)			NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(15)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(9)	69	Lung NSC(10;0.00148)|all_lung(10;0.00171)		STAD - Stomach adenocarcinoma(10;0.000534)		Bumetanide(DB00887)|Crofelemer(DB04941)|Glyburide(DB01016)|Ibuprofen(DB01050)|Ivacaftor(DB08820)	TTGGAATGCAGATGAGAATAG	0.398									Cystic Fibrosis																													dbGAP											0													87.0	74.0	78.0					7																	117171132		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	CF	M28668	CCDS5773.1	7q31-q32	2014-09-17	2006-09-18		ENSG00000001626	ENSG00000001626		"""Ion channels / Chloride channels : Cystic fibrosis transmembrane conductance regulators"", ""ATP binding cassette transporters / subfamily C"""	1884	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family C, member 7"""	602421	"""cystic fibrosis transmembrane conductance regulator, ATP-binding cassette (sub-family C, member 7)"""	CF, ABCC7		2772657	Standard	XM_006715842		Approved	MRP7, ABC35, TNR-CFTR, dJ760C5.1, CFTR/MRP	uc003vjd.3	P13569	OTTHUMG00000023076	ENST00000003084.6:c.453G>C	7.37:g.117171132G>C	ENSP00000003084:p.Gln151His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q20BG8|Q20BH2|Q2I0A1|Q2I102	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,prints_CysFib_conduc_TM,tigrfam_cAMP_cl_channel	p.Q151H	ENST00000003084.6	37	c.453	CCDS5773.1	7	.	.	.	.	.	.	.	.	.	.	G	18.68	3.675079	0.67928	.	.	ENSG00000001626	ENST00000003084;ENST00000454343;ENST00000426809	D;D;D	0.91631	-2.54;-2.54;-2.88	5.73	0.579	0.17397	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.048477	0.85682	D	0.000000	D	0.93609	0.7959	L	0.56769	1.78	0.46654	D	0.999141	D	0.89917	1.0	D	0.91635	0.999	D	0.90649	0.4581	9	.	.	.	-7.8132	10.6265	0.45510	0.5204:0.0:0.4796:0.0	.	151	P13569	CFTR_HUMAN	H	151	ENSP00000003084:Q151H;ENSP00000403677:Q151H;ENSP00000389119:Q151H	.	Q	+	3	2	CFTR	116958368	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	2.480000	0.45206	-0.099000	0.12263	0.555000	0.69702	CAG	CFTR	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1,tigrfam_cAMP_cl_channel	ENSG00000001626		0.398	CFTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CFTR	HGNC	protein_coding	OTTHUMT00000059397.3	46	0.00	0	G	NM_000492		117171132	117171132	+1	no_errors	ENST00000003084	ensembl	human	known	69_37n	missense	59	19.18	14	SNP	0.993	C
CHAMP1	283489	genome.wustl.edu	37	13	115089366	115089366	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:115089366G>C	ENST00000361283.1	+	3	358	c.49G>C	c.(49-51)Gac>Cac	p.D17H		NM_001164144.1|NM_001164145.1|NM_032436.2	NP_001157616.1|NP_001157617.1|NP_115812.1	Q96JM3	CHAP1_HUMAN	chromosome alignment maintaining phosphoprotein 1	17					attachment of spindle microtubules to kinetochore involved in mitotic sister chromatid segregation (GO:0051315)|protein localization to kinetochore (GO:0034501)|protein localization to microtubule (GO:0035372)|sister chromatid biorientation (GO:0031134)	condensed chromosome (GO:0000793)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spindle (GO:0005819)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										TTTGGAGTGTGACCATTGCAG	0.408																																						dbGAP											0													134.0	127.0	129.0					13																	115089366		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074894	CCDS9545.1	13q34	2013-01-07	2011-10-07	2011-10-07	ENSG00000198824	ENSG00000198824		"""Zinc fingers, C2H2-type"""	20311	protein-coding gene	gene with protein product	"""chromosome alignment-maintaining phosphoprotein"""		"""chromosome 13 open reading frame 8"", ""zinc finger protein 828"""	C13orf8, ZNF828		21063390	Standard	NM_032436		Approved	CAMP, CHAMP	uc010ahb.3	Q96JM3	OTTHUMG00000017404	ENST00000361283.1:c.49G>C	13.37:g.115089366G>C	ENSP00000354730:p.Asp17His	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KU06|Q6P181|Q8NC88|Q9BST0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D17H	ENST00000361283.1	37	c.49	CCDS9545.1	13	.	.	.	.	.	.	.	.	.	.	G	24.3	4.519145	0.85495	.	.	ENSG00000198824	ENST00000361283	T	0.01484	4.84	5.83	5.83	0.93111	Zinc finger, C2H2-like (1);	0.201027	0.34110	N	0.004241	T	0.05868	0.0153	L	0.29908	0.895	0.39672	D	0.970771	D	0.76494	0.999	D	0.66351	0.943	T	0.57728	-0.7761	9	.	.	.	-3.2487	20.1184	0.97949	0.0:0.0:1.0:0.0	.	17	Q96JM3	ZN828_HUMAN	H	17	ENSP00000354730:D17H	.	D	+	1	0	ZNF828	114107468	1.000000	0.71417	1.000000	0.80357	0.940000	0.58332	4.483000	0.60264	2.769000	0.95229	0.655000	0.94253	GAC	CHAMP1	-	smart_Znf_C2H2-like	ENSG00000198824		0.408	CHAMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAMP1	HGNC	protein_coding	OTTHUMT00000045977.2	34	0.00	0	G	NM_032436		115089366	115089366	+1	no_errors	ENST00000361283	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	C
CHD2	1106	genome.wustl.edu	37	15	93510679	93510679	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:93510679C>T	ENST00000394196.4	+	17	3193	c.2125C>T	c.(2125-2127)Ctt>Ttt	p.L709F	CHD2_ENST00000557381.1_Missense_Mutation_p.L709F	NM_001271.3	NP_001262.3	O14647	CHD2_HUMAN	chromodomain helicase DNA binding protein 2	709					cellular response to DNA damage stimulus (GO:0006974)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|hematopoietic stem cell differentiation (GO:0060218)|muscle organ development (GO:0007517)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|histone binding (GO:0042393)|poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(5)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	47	Lung NSC(78;0.00976)|all_lung(78;0.016)		BRCA - Breast invasive adenocarcinoma(143;0.0282)|OV - Ovarian serous cystadenocarcinoma(32;0.0814)			GGAGAAATCCCTTCCTGCTAA	0.463																																						dbGAP											0													90.0	84.0	86.0					15																	93510679		2197	4298	6495	-	-	-	SO:0001583	missense	0			AF006514	CCDS10374.2, CCDS45356.1	15q26	2008-07-18			ENSG00000173575	ENSG00000173575			1917	protein-coding gene	gene with protein product		602119				9326634	Standard	NM_001042572		Approved	FLJ38614, DKFZp547I1315, DKFZp781D1727, DKFZp686E01200	uc002bsp.3	O14647	OTTHUMG00000149845	ENST00000394196.4:c.2125C>T	15.37:g.93510679C>T	ENSP00000377747:p.Leu709Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	C6G482|Q96IP5	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,superfamily_Homeodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.L709F	ENST00000394196.4	37	c.2125	CCDS10374.2	15	.	.	.	.	.	.	.	.	.	.	C	27.0	4.795106	0.90453	.	.	ENSG00000173575	ENST00000394196;ENST00000557381	D;D	0.86030	-2.06;-2.06	5.83	5.83	0.93111	SNF2-related (1);	0.000000	0.26719	U	0.022859	D	0.95890	0.8662	H	0.99379	4.54	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.99;0.997	D	0.97064	0.9773	10	0.87932	D	0	-16.7068	13.7511	0.62908	0.0:0.9211:0.0:0.0789	.	709;709	O14647;O14647-2	CHD2_HUMAN;.	F	709	ENSP00000377747:L709F;ENSP00000451366:L709F	ENSP00000377747:L709F	L	+	1	0	CHD2	91311683	0.996000	0.38824	0.995000	0.50966	0.999000	0.98932	3.347000	0.52200	2.761000	0.94854	0.650000	0.86243	CTT	CHD2	-	pfam_SNF2_N	ENSG00000173575		0.463	CHD2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	CHD2	HGNC	protein_coding	OTTHUMT00000313528.3	46	0.00	0	C	NM_001271		93510679	93510679	+1	no_errors	ENST00000557381	ensembl	human	putative	69_37n	missense	26	21.21	7	SNP	1.000	T
CHD3	1107	genome.wustl.edu	37	17	7808967	7808967	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:7808967G>A	ENST00000330494.7	+	27	4317	c.4167G>A	c.(4165-4167)cgG>cgA	p.R1389R	SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000358181.4_Silent_p.R1389R|CHD3_ENST00000380358.4_Silent_p.R1448R	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1389					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				GGCAGCTCCGGAATGAGAAAG	0.577																																						dbGAP											0													38.0	31.0	33.0					17																	7808967		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4167G>A	17.37:g.7808967G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTQ9|E9PG89|Q9Y4I0	Silent	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R1389	ENST00000330494.7	37	c.4167	CCDS32554.1	17																																																																																			CHD3	-	pfam_DUF1086	ENSG00000170004		0.577	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	21	0.00	0	G	NM_001005273		7808967	7808967	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	silent	25	26.47	9	SNP	0.992	A
CHD3	1107	genome.wustl.edu	37	17	7809938	7809938	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:7809938G>A	ENST00000330494.7	+	29	4576	c.4426G>A	c.(4426-4428)Gat>Aat	p.D1476N	SCARNA21_ENST00000517026.1_RNA|CHD3_ENST00000358181.4_Missense_Mutation_p.D1476N|CHD3_ENST00000380358.4_Missense_Mutation_p.D1535N	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3	1476					centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				AACCTTTGCCGATGGGGTCCC	0.567																																						dbGAP											0													104.0	102.0	102.0					17																	7809938		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.4426G>A	17.37:g.7809938G>A	ENSP00000332628:p.Asp1476Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTQ9|E9PG89|Q9Y4I0	Missense_Mutation	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.D1476N	ENST00000330494.7	37	c.4426	CCDS32554.1	17	.	.	.	.	.	.	.	.	.	.	G	21.1	4.090259	0.76756	.	.	ENSG00000170004	ENST00000380358;ENST00000358181;ENST00000330494	D;D;D	0.95103	-3.61;-3.54;-3.53	4.85	4.85	0.62838	Domain of unknown function DUF1086 (1);	0.000000	0.46442	D	0.000282	D	0.97473	0.9173	M	0.85630	2.765	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;0.999;1.0	D;D;D;D	0.87578	0.998;0.994;0.996;0.997	D	0.98214	1.0474	10	0.87932	D	0	-23.5976	18.1655	0.89724	0.0:0.0:1.0:0.0	.	52;1476;1476;1535	B3KWV4;Q12873-2;Q12873;E9PG89	.;.;CHD3_HUMAN;.	N	1535;1476;1476	ENSP00000369716:D1535N;ENSP00000350907:D1476N;ENSP00000332628:D1476N	ENSP00000332628:D1476N	D	+	1	0	CHD3	7750663	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	9.147000	0.94646	2.515000	0.84797	0.491000	0.48974	GAT	CHD3	-	pfam_DUF1086	ENSG00000170004		0.567	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	56	0.00	0	G	NM_001005273		7809938	7809938	+1	no_errors	ENST00000330494	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	1.000	A
CHD4	1108	genome.wustl.edu	37	12	6690968	6690968	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:6690968C>G	ENST00000357008.2	-	31	4691	c.4528G>C	c.(4528-4530)Gaa>Caa	p.E1510Q	CHD4_ENST00000544040.1_Missense_Mutation_p.E1503Q|CHD4_ENST00000544484.1_Missense_Mutation_p.E1535Q|SCARNA11_ENST00000516089.1_RNA|CHD4_ENST00000309577.6_Missense_Mutation_p.E1538Q|RP5-940J5.6_ENST00000501075.2_RNA|CHD4_ENST00000540960.1_5'Flank	NM_001273.2	NP_001264.2	Q14839	CHD4_HUMAN	chromodomain helicase DNA binding protein 4	1510					ATP-dependent chromatin remodeling (GO:0043044)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spindle assembly (GO:0051225)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|RNA polymerase II repressing transcription factor binding (GO:0001103)|zinc ion binding (GO:0008270)			central_nervous_system(2)	2						TTAACATGTTCAAACTCCTGA	0.532																																					Colon(32;586 792 4568 16848 45314)	dbGAP											0													108.0	108.0	108.0					12																	6690968		2203	4300	6503	-	-	-	SO:0001583	missense	0			X86691	CCDS8552.1	12p13	2013-01-28				ENSG00000111642		"""Zinc fingers, PHD-type"""	1919	protein-coding gene	gene with protein product		603277				7575689, 8843877	Standard	XM_006718958		Approved	Mi-2b, Mi2-BETA	uc001qpo.3	Q14839		ENST00000357008.2:c.4528G>C	12.37:g.6690968C>G	ENSP00000349508:p.Glu1510Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IXZ5	Missense_Mutation	SNP	pfam_CHD_C2,pfam_DUF1086,pfam_SNF2_N,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,superfamily_Homeodomain-like,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1538Q	ENST00000357008.2	37	c.4612	CCDS8552.1	12	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202526	0.79127	.	.	ENSG00000111642	ENST00000544484;ENST00000544040;ENST00000309577;ENST00000357008;ENST00000537464	D;D;D;D	0.93712	-3.27;-3.27;-3.27;-3.27	5.76	5.76	0.90799	Domain of unknown function DUF1086 (1);	0.000000	0.85682	D	0.000000	D	0.97195	0.9083	M	0.84511	2.7	0.80722	D	1	D;D;D	0.89917	0.999;1.0;0.989	D;D;D	0.91635	0.997;0.999;0.979	D	0.97352	0.9964	10	0.87932	D	0	-9.5443	19.9813	0.97326	0.0:1.0:0.0:0.0	.	1538;1510;1503	Q14839-2;Q14839;F5GWX5	.;CHD4_HUMAN;.	Q	1535;1503;1538;1510;1484	ENSP00000440392:E1535Q;ENSP00000440542:E1503Q;ENSP00000312419:E1538Q;ENSP00000349508:E1510Q	ENSP00000312419:E1538Q	E	-	1	0	CHD4	6561229	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.792000	0.85828	2.726000	0.93360	0.655000	0.94253	GAA	CHD4	-	pfam_DUF1086	ENSG00000111642		0.532	CHD4-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD4	HGNC	protein_coding		85	0.00	0	C	NM_001273		6690968	6690968	-1	no_errors	ENST00000309577	ensembl	human	known	69_37n	missense	71	13.41	11	SNP	1.000	G
CHRM2	1129	genome.wustl.edu	37	7	136699711	136699711	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:136699711C>T	ENST00000445907.2	+	3	627	c.99C>T	c.(97-99)ctC>ctT	p.L33L	CHRM2_ENST00000401861.1_Silent_p.L33L|hsa-mir-490_ENST00000598184.1_RNA|CHRM2_ENST00000320658.5_Silent_p.L33L|CHRM2_ENST00000453373.1_Silent_p.L33L|CHRM2_ENST00000397608.3_Silent_p.L33L|hsa-mir-490_ENST00000425981.2_RNA|CHRM2_ENST00000402486.3_Silent_p.L33L|hsa-mir-490_ENST00000597642.1_RNA|hsa-mir-490_ENST00000439694.1_RNA|hsa-mir-490_ENST00000592183.1_RNA|hsa-mir-490_ENST00000593789.1_RNA|hsa-mir-490_ENST00000586239.1_RNA	NM_001006627.1|NM_001006629.1	NP_001006628.1|NP_001006630.1	P08172	ACM2_HUMAN	cholinergic receptor, muscarinic 2	33					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|nervous system development (GO:0007399)|phospholipase C-activating G-protein coupled acetylcholine receptor signaling pathway (GO:0007207)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|regulation of heart contraction (GO:0008016)|response to virus (GO:0009615)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	G-protein coupled acetylcholine receptor activity (GO:0016907)			central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(13)|liver(1)|lung(29)|ovary(4)|pancreas(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	68					Aclidinium(DB08897)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Anisotropine Methylbromide(DB00517)|Aripiprazole(DB01238)|Atropine(DB00572)|Bethanechol(DB01019)|Brompheniramine(DB00835)|Carbachol(DB00411)|Chlorprothixene(DB01239)|Cinnarizine(DB00568)|Clozapine(DB00363)|Cocaine(DB00907)|Cryptenamine(DB00785)|Cyproheptadine(DB00434)|Darifenacin(DB00496)|Desipramine(DB01151)|Dicyclomine(DB00804)|Dimetindene(DB08801)|Diphenidol(DB01231)|Disopyramide(DB00280)|Doxacurium chloride(DB01135)|Doxepin(DB01142)|Ethopropazine(DB00392)|Fesoterodine(DB06702)|Flavoxate(DB01148)|Gallamine Triethiodide(DB00483)|Glycopyrrolate(DB00986)|Homatropine Methylbromide(DB00725)|Hyoscyamine(DB00424)|Imipramine(DB00458)|Ipratropium bromide(DB00332)|Ketamine(DB01221)|Loxapine(DB00408)|Maprotiline(DB00934)|Methotrimeprazine(DB01403)|Methylscopolamine bromide(DB00462)|Metixene(DB00340)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicardipine(DB00622)|Nortriptyline(DB00540)|Olanzapine(DB00334)|Oxybutynin(DB01062)|Oxyphencyclimine(DB00383)|Pancuronium(DB01337)|Paroxetine(DB00715)|Pethidine(DB00454)|Pilocarpine(DB01085)|Pipecuronium(DB01338)|Procyclidine(DB00387)|Promazine(DB00420)|Promethazine(DB01069)|Propiomazine(DB00777)|Quetiapine(DB01224)|Rocuronium(DB00728)|Scopolamine(DB00747)|Solifenacin(DB01591)|Succinylcholine(DB00202)|Tiotropium(DB01409)|Tolterodine(DB01036)|Triflupromazine(DB00508)|Trihexyphenidyl(DB00376)|Trimipramine(DB00726)|Tropicamide(DB00809)|Ziprasidone(DB00246)	CTGGATCCCTCAGTTTGGTGA	0.423																																						dbGAP											0													139.0	127.0	131.0					7																	136699711		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5843.1	7q35-q36	2014-09-17			ENSG00000181072	ENSG00000181072		"""Cholinergic receptors"", ""GPCR / Class A : Cholinergic receptors, muscarinic"""	1951	protein-coding gene	gene with protein product	"""acetylcholine receptor, muscarinic 2"""	118493					Standard	NM_000739		Approved		uc003vtl.1	P08172	OTTHUMG00000155658	ENST00000445907.2:c.99C>T	7.37:g.136699711C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBK6|Q9P1X9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Musac_M2_rcpt,prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	p.L33	ENST00000445907.2	37	c.99	CCDS5843.1	7																																																																																			CHRM2	-	prints_Musac_rcpt,prints_7TM_GPCR_Rhodpsn	ENSG00000181072		0.423	CHRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRM2	HGNC	protein_coding	OTTHUMT00000341010.1	99	0.00	0	C			136699711	136699711	+1	no_errors	ENST00000320658	ensembl	human	known	69_37n	silent	74	16.85	15	SNP	1.000	T
CHUK	1147	genome.wustl.edu	37	10	101985685	101985685	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:101985685C>T	ENST00000370397.7	-	2	281	c.195G>A	c.(193-195)atG>atA	p.M65I		NM_001278.3	NP_001269.3	O15111	IKKA_HUMAN	conserved helix-loop-helix ubiquitous kinase	65	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				anatomical structure morphogenesis (GO:0009653)|cellular response to tumor necrosis factor (GO:0071356)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|I-kappaB phosphorylation (GO:0007252)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lactation (GO:0007595)|mammary gland alveolus development (GO:0060749)|mammary gland epithelial cell proliferation (GO:0033598)|morphogenesis of an epithelial sheet (GO:0002011)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoclast differentiation (GO:0030316)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|protein phosphorylation (GO:0006468)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to hydroperoxide (GO:0033194)|response to lipopolysaccharide (GO:0032496)|response to toxic substance (GO:0009636)|response to virus (GO:0009615)|Rho protein signal transduction (GO:0007266)|skeletal muscle contraction (GO:0003009)|striated muscle cell differentiation (GO:0051146)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|IkappaB kinase complex (GO:0008385)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	ATP binding (GO:0005524)|IkappaB kinase activity (GO:0008384)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|scaffold protein binding (GO:0097110)			breast(1)|central_nervous_system(2)|endometrium(2)|large_intestine(9)|lung(8)|ovary(2)|prostate(1)|skin(1)|stomach(1)	27		Colorectal(252;0.117)		Epithelial(162;2.05e-10)|all cancers(201;1.91e-08)	Acetylcysteine(DB06151)|Aminosalicylic Acid(DB00233)|Mesalazine(DB00244)|Sulfasalazine(DB00795)	CTTACTTCTTCATAATCTGGA	0.423																																					Ovarian(159;52 1904 10536 35305 37148)	dbGAP											0													229.0	200.0	210.0					10																	101985685		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF009225	CCDS7488.1	10q24-q25	2008-08-01			ENSG00000213341	ENSG00000213341			1974	protein-coding gene	gene with protein product		600664		TCF16		7558004, 16902410	Standard	XR_246062		Approved	IKK1, IKK-alpha, IkBKA, NFKBIKA, IKKA	uc001kqp.3	O15111	OTTHUMG00000018899	ENST00000370397.7:c.195G>A	10.37:g.101985685C>T	ENSP00000359424:p.Met65Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O14666|Q13132|Q5W0I4|Q92467	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IKKbetaNEMObind,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.M65I	ENST00000370397.7	37	c.195	CCDS7488.1	10	.	.	.	.	.	.	.	.	.	.	C	25.1	4.601918	0.87055	.	.	ENSG00000213341	ENST00000370397	T	0.25414	1.8	5.46	5.46	0.80206	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.33818	0.0876	M	0.62209	1.925	0.80722	D	1	P	0.34462	0.454	B	0.38156	0.266	T	0.13098	-1.0522	10	0.62326	D	0.03	-15.701	16.7818	0.85564	0.0:1.0:0.0:0.0	.	65	O15111	IKKA_HUMAN	I	65	ENSP00000359424:M65I	ENSP00000359424:M65I	M	-	3	0	CHUK	101975675	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.052000	0.76634	2.559000	0.86315	0.563000	0.77884	ATG	CHUK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000213341		0.423	CHUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHUK	HGNC	protein_coding	OTTHUMT00000049836.1	127	0.00	0	C	NM_001278		101985685	101985685	-1	no_errors	ENST00000370397	ensembl	human	known	69_37n	missense	93	14.68	16	SNP	1.000	T
CLDN6	9074	genome.wustl.edu	37	16	3065372	3065372	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:3065372C>G	ENST00000396925.1	-	3	1079	c.651G>C	c.(649-651)aaG>aaC	p.K217N	CLDN6_ENST00000328796.4_Missense_Mutation_p.K217N|CLDN6_ENST00000572154.1_Intron			P56747	CLD6_HUMAN	claudin 6	217					calcium-independent cell-cell adhesion (GO:0016338)|cell-cell junction organization (GO:0045216)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	identical protein binding (GO:0042802)|structural molecule activity (GO:0005198)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	10						AGACGTAATTCTTGGTAGGGT	0.617																																						dbGAP											0													52.0	57.0	55.0					16																	3065372		2198	4300	6498	-	-	-	SO:0001583	missense	0			AJ249735	CCDS10488.1	16p13.3	2008-08-01			ENSG00000184697	ENSG00000184697		"""Claudins"""	2048	protein-coding gene	gene with protein product		615798				9892664, 18234789	Standard	NM_021195		Approved		uc002csu.4	P56747	OTTHUMG00000128999	ENST00000396925.1:c.651G>C	16.37:g.3065372C>G	ENSP00000380131:p.Lys217Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQP9|D3DUA5	Missense_Mutation	SNP	pfam_PMP22/EMP/MP20/Claudin,prints_Claudin,prints_Claudin6	p.K217N	ENST00000396925.1	37	c.651	CCDS10488.1	16	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485870	0.44147	.	.	ENSG00000184697	ENST00000396925;ENST00000328796	D;D	0.85171	-1.95;-1.95	4.77	3.8	0.43715	.	0.059210	0.64402	D	0.000003	T	0.70439	0.3224	N	0.08118	0	0.38263	D	0.941949	B	0.29862	0.259	B	0.29524	0.103	T	0.70861	-0.4757	10	0.37606	T	0.19	.	12.3145	0.54948	0.1707:0.8293:0.0:0.0	.	217	P56747	CLD6_HUMAN	N	217	ENSP00000380131:K217N;ENSP00000328674:K217N	ENSP00000328674:K217N	K	-	3	2	CLDN6	3005373	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	2.381000	0.44336	1.348000	0.45733	0.561000	0.74099	AAG	CLDN6	-	prints_Claudin6	ENSG00000184697		0.617	CLDN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLDN6	HGNC	protein_coding	OTTHUMT00000250988.1	27	0.00	0	C	NM_021195		3065372	3065372	-1	no_errors	ENST00000328796	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	G
CLEC18C	283971	genome.wustl.edu	37	16	70208876	70208876	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:70208876C>T	ENST00000569347.2	+	2	405	c.151C>T	c.(151-153)Ctc>Ttc	p.L51F	CLEC18C_ENST00000314151.8_Missense_Mutation_p.L51F|CLEC18C_ENST00000541793.2_Missense_Mutation_p.L51F|CLEC18C_ENST00000536907.2_Missense_Mutation_p.L51F|RP11-296I10.3_ENST00000566989.1_RNA|RP11-296I10.3_ENST00000502126.1_RNA|CLEC18C_ENST00000561612.1_3'UTR	NM_173619.2	NP_775890.2	Q8NCF0	CL18C_HUMAN	C-type lectin domain family 18, member C	51						extracellular region (GO:0005576)	carbohydrate binding (GO:0030246)			endometrium(3)|large_intestine(6)|lung(1)	10						GAGTTTCTTGCTCCTCTCCCT	0.647																																						dbGAP											0													37.0	37.0	37.0					16																	70208876		1840	3683	5523	-	-	-	SO:0001583	missense	0			AL833339	CCDS32473.1	16q22.1	2010-04-27	2009-03-10	2009-03-10		ENSG00000157335		"""C-type lectin domain containing"""	28538	protein-coding gene	gene with protein product						12477932	Standard	XM_005255906		Approved	MGC34761		Q8NCF0		ENST00000569347.2:c.151C>T	16.37:g.70208876C>T	ENSP00000455920:p.Leu51Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IUW8	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_CAP_domain,superfamily_CAP_domain,superfamily_C-type_lectin_fold,smart_Allrgn_V5/Tpx1,smart_EGF-like,smart_C-type_lectin,pfscan_EG-like_dom,pfscan_C-type_lectin,prints_Allrgn_V5/Tpx1	p.L51F	ENST00000569347.2	37	c.151	CCDS32473.1	16	.	.	.	.	.	.	.	.	.	.	c	11.62	1.693421	0.30052	.	.	ENSG00000157335	ENST00000541793;ENST00000314151;ENST00000433156;ENST00000539438;ENST00000536907	T;T;T	0.09630	2.96;2.96;2.96	4.43	3.44	0.39384	CAP domain (2);	0.170248	0.39475	N	0.001353	T	0.13114	0.0318	L	0.32530	0.975	0.30104	N	0.807216	D	0.56035	0.974	P	0.51135	0.66	T	0.02339	-1.1174	10	0.66056	D	0.02	.	9.5885	0.39532	0.2192:0.7808:0.0:0.0	.	51	Q8NCF0	CL18C_HUMAN	F	51	ENSP00000444875:L51F;ENSP00000326538:L51F;ENSP00000444726:L51F	ENSP00000326538:L51F	L	+	1	0	CLEC18C	68766377	1.000000	0.71417	0.993000	0.49108	0.482000	0.33219	1.418000	0.34782	0.903000	0.36546	0.457000	0.33378	CTC	CLEC18C	-	superfamily_CAP_domain,smart_Allrgn_V5/Tpx1	ENSG00000157335		0.647	CLEC18C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CLEC18C	HGNC	protein_coding	OTTHUMT00000434588.2	35	0.00	0	C	NM_173619		70208876	70208876	+1	no_errors	ENST00000314151	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	1.000	T
CLK3	1198	genome.wustl.edu	37	15	74922117	74922117	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:74922117G>C	ENST00000395066.3	+	13	2271	c.1810G>C	c.(1810-1812)Gac>Cac	p.D604H	CLK3_ENST00000348245.3_3'UTR|CLK3_ENST00000345005.4_Missense_Mutation_p.D456H|CLK3_ENST00000352989.5_Missense_Mutation_p.D433H	NM_001130028.1	NP_001123500.1	P49761	CLK3_HUMAN	CDC-like kinase 3	604	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of RNA splicing (GO:0043484)	cytoplasmic vesicle (GO:0031410)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|prostate(2)|stomach(2)|urinary_tract(1)	15						GTTAGAATTTGACCCTGCCCA	0.592																																					Ovarian(133;694 1754 28950 29027 31859)	dbGAP											0													79.0	60.0	66.0					15																	74922117		2197	4296	6493	-	-	-	SO:0001583	missense	0			L29220	CCDS10265.1, CCDS45304.1	15q24	2008-05-02			ENSG00000179335	ENSG00000179335		"""CDC-like kinases"""	2071	protein-coding gene	gene with protein product		602990				7990150, 9856501	Standard	NM_003992		Approved	clk3	uc010uln.2	P49761	OTTHUMG00000141320	ENST00000395066.3:c.1810G>C	15.37:g.74922117G>C	ENSP00000378505:p.Asp604His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW59|Q53Y48|Q9BRS3|Q9BUJ7	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D604H	ENST00000395066.3	37	c.1810	CCDS45304.1	15	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863564	0.71949	.	.	ENSG00000179335	ENST00000345005;ENST00000395066;ENST00000454830;ENST00000352989	T;T	0.27720	1.65;1.65	5.23	5.23	0.72850	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.201344	0.39146	N	0.001446	T	0.60183	0.2249	M	0.89414	3.03	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.988;0.988;0.99	T	0.67090	-0.5758	10	0.87932	D	0	.	11.8424	0.52361	0.0811:0.0:0.9189:0.0	.	604;309;383;433	P49761;B3KVF3;B3KUU7;G5E959	CLK3_HUMAN;.;.;.	H	456;456;604;433	ENSP00000344112:D456H;ENSP00000323106:D433H	ENSP00000344112:D456H	D	+	1	0	CLK3	72709170	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.817000	0.86213	2.457000	0.83068	0.561000	0.74099	GAC	CLK3	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000179335		0.592	CLK3-003	KNOWN	basic|CCDS	protein_coding	CLK3	HGNC	protein_coding	OTTHUMT00000390442.3	53	0.00	0	G			74922117	74922117	+1	no_errors	ENST00000395066	ensembl	human	known	69_37n	missense	37	26.00	13	SNP	1.000	C
CLSTN2	64084	genome.wustl.edu	37	3	139894828	139894828	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:139894828C>T	ENST00000458420.3	+	2	335	c.145C>T	c.(145-147)Cat>Tat	p.H49Y		NM_022131.2	NP_071414.2	Q9H4D0	CSTN2_HUMAN	calsyntenin 2	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|liver(1)|lung(42)|pancreas(2)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	87						GACTTCATATCATGGAGTCAT	0.388										HNSCC(16;0.037)																											GBM(45;858 913 3709 36904 37282)	dbGAP											0													106.0	105.0	105.0					3																	139894828		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ278018	CCDS3112.1	3q23	2011-07-01			ENSG00000158258	ENSG00000158258		"""Cadherins / Cadherin-related"""	17448	protein-coding gene	gene with protein product	"""cadherin-related family member 13"""	611323				12498782	Standard	NM_022131		Approved	CSTN2, CS2, FLJ39113, CDHR13	uc003etn.3	Q9H4D0	OTTHUMG00000160139	ENST00000458420.3:c.145C>T	3.37:g.139894828C>T	ENSP00000402460:p.His49Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCW5|D3DNF4|Q3SX54|Q3ZB76|Q5UE56|Q96HZ2|Q9BSS0	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.H49Y	ENST00000458420.3	37	c.145	CCDS3112.1	3	.	.	.	.	.	.	.	.	.	.	C	21.7	4.184074	0.78677	.	.	ENSG00000158258	ENST00000458420	T	0.47528	0.84	5.6	4.71	0.59529	Cadherin (3);Cadherin-like (1);	0.077693	0.48286	D	0.000195	T	0.53110	0.1776	M	0.74258	2.255	0.48511	D	0.999661	D	0.55385	0.971	P	0.46049	0.502	T	0.57063	-0.7875	10	0.35671	T	0.21	1.0194	14.5895	0.68354	0.0:0.8529:0.1471:0.0	.	49	Q9H4D0	CSTN2_HUMAN	Y	49	ENSP00000402460:H49Y	ENSP00000402460:H49Y	H	+	1	0	CLSTN2	141377518	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.887000	0.75616	1.467000	0.48044	0.650000	0.86243	CAT	CLSTN2	-	superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000158258		0.388	CLSTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN2	HGNC	protein_coding	OTTHUMT00000359393.3	61	0.00	0	C	NM_022131		139894828	139894828	+1	no_errors	ENST00000458420	ensembl	human	known	69_37n	missense	69	12.66	10	SNP	1.000	T
COA1	55744	genome.wustl.edu	37	7	43684885	43684885	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:43684885C>T	ENST00000395879.1	-	3	1910	c.229G>A	c.(229-231)Gac>Aac	p.D77N	COA1_ENST00000310564.6_Missense_Mutation_p.D77N|COA1_ENST00000395880.3_Missense_Mutation_p.D77N|COA1_ENST00000223336.6_Missense_Mutation_p.D77N			Q9GZY4	COA1_HUMAN	cytochrome c oxidase assembly factor 1 homolog (S. cerevisiae)	77					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrial respiratory chain complex IV assembly (GO:0033617)	cytoplasm (GO:0005737)|integral component of mitochondrial inner membrane (GO:0031305)|mitochondrion (GO:0005739)											TTTTCCCTGTCGATGAGCTTG	0.532																																						dbGAP											0													97.0	75.0	83.0					7																	43684885		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001665	CCDS5471.1	7p13	2012-12-05	2012-10-15	2012-06-25	ENSG00000106603	ENSG00000106603		"""Mitochondrial respiratory chain complex assembly factors"""	21868	protein-coding gene	gene with protein product		614769	"""chromosome 7 open reading frame 44"""	C7orf44		22356826	Standard	NM_018224		Approved	FLJ10803, MITRAC15	uc003tin.2	Q9GZY4	OTTHUMG00000128949	ENST00000395879.1:c.229G>A	7.37:g.43684885C>T	ENSP00000379218:p.Asp77Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU8|A8KAH8|Q9HAB7|Q9NVD2	Missense_Mutation	SNP	NULL	p.D77N	ENST00000395879.1	37	c.229	CCDS5471.1	7	.	.	.	.	.	.	.	.	.	.	C	16.22	3.062941	0.55432	.	.	ENSG00000106603	ENST00000395879;ENST00000310564;ENST00000395880;ENST00000223336;ENST00000415798;ENST00000431651	T;T;T;T;T;T	0.30714	1.52;1.52;1.52;1.52;1.52;1.52	4.63	2.45	0.29901	.	0.161988	0.52532	N	0.000075	T	0.43700	0.1259	L	0.61387	1.9	0.09310	N	1	D	0.69078	0.997	D	0.63033	0.91	T	0.19745	-1.0296	10	0.59425	D	0.04	-4.5322	6.7432	0.23447	0.0:0.7301:0.0:0.2699	.	77	Q9GZY4	CG044_HUMAN	N	77	ENSP00000379218:D77N;ENSP00000312100:D77N;ENSP00000379219:D77N;ENSP00000223336:D77N;ENSP00000405582:D77N;ENSP00000417046:D77N	ENSP00000223336:D77N	D	-	1	0	C7orf44	43651410	0.770000	0.28543	0.003000	0.11579	0.001000	0.01503	0.792000	0.26929	0.442000	0.26555	0.650000	0.86243	GAC	COA1	-	NULL	ENSG00000106603		0.532	COA1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	COA1	HGNC	protein_coding	OTTHUMT00000313664.1	41	0.00	0	C	NM_018224		43684885	43684885	-1	no_errors	ENST00000223336	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	0.014	T
COL12A1	1303	genome.wustl.edu	37	6	75851861	75851861	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:75851861G>A	ENST00000322507.8	-	27	5153	c.4844C>T	c.(4843-4845)tCa>tTa	p.S1615L	COL12A1_ENST00000483888.2_Missense_Mutation_p.S1615L|COL12A1_ENST00000416123.2_Missense_Mutation_p.S1615L|COL12A1_ENST00000345356.6_Missense_Mutation_p.S451L	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1615	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						GCTGGTCTCTGATCTGTCCAC	0.473																																						dbGAP											0													206.0	200.0	202.0					6																	75851861		2123	4249	6372	-	-	-	SO:0001583	missense	0			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.4844C>T	6.37:g.75851861G>A	ENSP00000325146:p.Ser1615Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.S1615L	ENST00000322507.8	37	c.4844	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	12.11	1.838936	0.32513	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000345356;ENST00000416123;ENST00000483888	T;T;T;T	0.59224	0.28;0.28;0.28;0.28	6.16	6.16	0.99307	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.442916	0.22693	N	0.056794	T	0.36635	0.0974	L	0.51853	1.615	0.24662	N	0.99346	B;B	0.14012	0.004;0.009	B;B	0.16289	0.009;0.015	T	0.05354	-1.0890	10	0.34782	T	0.22	.	14.3908	0.66978	0.075:0.0:0.925:0.0	.	451;1615	Q99715-2;Q99715	.;COCA1_HUMAN	L	1615;1615;451;1615;1615	ENSP00000325146:S1615L;ENSP00000305147:S451L;ENSP00000412864:S1615L;ENSP00000421216:S1615L	ENSP00000325146:S1615L	S	-	2	0	COL12A1	75908581	0.990000	0.36364	0.905000	0.35620	0.567000	0.35839	2.455000	0.44988	2.937000	0.99478	0.650000	0.86243	TCA	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000111799		0.473	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	90	0.00	0	G	NM_004370		75851861	75851861	-1	no_errors	ENST00000322507	ensembl	human	known	69_37n	missense	59	25.32	20	SNP	0.667	A
COL17A1	1308	genome.wustl.edu	37	10	105793003	105793003	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:105793003G>A	ENST00000353479.5	-	53	4577	c.4287C>T	c.(4285-4287)ttC>ttT	p.F1429F	COL17A1_ENST00000369733.3_Silent_p.F1347F	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	1429	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		TACTTTGGAAGAAGTCCATGA	0.592																																						dbGAP											0													108.0	81.0	90.0					10																	105793003		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.4287C>T	10.37:g.105793003G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Silent	SNP	pfam_Collagen	p.F1429	ENST00000353479.5	37	c.4287	CCDS7554.1	10																																																																																			COL17A1	-	NULL	ENSG00000065618		0.592	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	63	0.00	0	G	NM_130778, NM_000494		105793003	105793003	-1	no_errors	ENST00000353479	ensembl	human	known	69_37n	silent	41	22.64	12	SNP	1.000	A
COL17A1	1308	genome.wustl.edu	37	10	105836095	105836095	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:105836095C>G	ENST00000353479.5	-	5	585	c.295G>C	c.(295-297)Gaa>Caa	p.E99Q	COL17A1_ENST00000393211.3_Missense_Mutation_p.E99Q|COL17A1_ENST00000369733.3_Missense_Mutation_p.E99Q	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	99	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		GTTTTCCTTTCAAAGGTTGAG	0.517																																						dbGAP											0													199.0	196.0	197.0					10																	105836095		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.295G>C	10.37:g.105836095C>G	ENSP00000340937:p.Glu99Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.E99Q	ENST00000353479.5	37	c.295	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	C	18.29	3.591347	0.66219	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	T;T;T	0.40756	1.02;1.02;1.02	5.61	5.61	0.85477	.	0.000000	0.46442	D	0.000289	T	0.66076	0.2753	M	0.71581	2.175	0.52099	D	0.999949	D;D;D	0.76494	0.992;0.999;0.998	P;D;P	0.81914	0.801;0.995;0.863	T	0.67875	-0.5557	10	0.72032	D	0.01	-14.6108	19.2325	0.93846	0.0:1.0:0.0:0.0	.	99;99;99	Q9UMD9-2;A2A2Y8;Q9UMD9	.;.;COHA1_HUMAN	Q	99	ENSP00000340937:E99Q;ENSP00000358748:E99Q;ENSP00000376905:E99Q	ENSP00000340937:E99Q	E	-	1	0	COL17A1	105826085	1.000000	0.71417	0.992000	0.48379	0.740000	0.42216	4.914000	0.63348	2.642000	0.89623	0.561000	0.74099	GAA	COL17A1	-	NULL	ENSG00000065618		0.517	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	87	0.00	0	C	NM_130778, NM_000494		105836095	105836095	-1	no_errors	ENST00000353479	ensembl	human	known	69_37n	missense	67	16.25	13	SNP	1.000	G
COL5A1	1289	genome.wustl.edu	37	9	137650106	137650106	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:137650106C>T	ENST00000371817.3	+	18	2313	c.1899C>T	c.(1897-1899)gaC>gaT	p.D633D		NM_000093.3|NM_001278074.1	NP_000084.3|NP_001265003.1	P20908	CO5A1_HUMAN	collagen, type V, alpha 1	633	Triple-helical region.				axon guidance (GO:0007411)|blood vessel development (GO:0001568)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular fibril organization (GO:0043206)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|eye morphogenesis (GO:0048592)|heart morphogenesis (GO:0003007)|integrin biosynthetic process (GO:0045112)|negative regulation of endodermal cell differentiation (GO:1903225)|regulation of cellular component organization (GO:0051128)|skin development (GO:0043588)|tendon development (GO:0035989)|wound healing, spreading of epidermal cells (GO:0035313)	basement membrane (GO:0005604)|collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)|integrin binding (GO:0005178)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)|proteoglycan binding (GO:0043394)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(26)|liver(2)|lung(36)|ovary(4)|pancreas(4)|prostate(5)|skin(10)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	115		Myeloproliferative disorder(178;0.0341)		all cancers(34;2.28e-08)|OV - Ovarian serous cystadenocarcinoma(145;6.03e-08)|Epithelial(140;6.4e-08)|GBM - Glioblastoma multiforme(294;0.131)		GGGGTTTCGACGGCCTGGCTG	0.627																																						dbGAP											0													124.0	108.0	113.0					9																	137650106		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D90279	CCDS6982.1, CCDS75932.1	9q34.2-q34.3	2014-09-17			ENSG00000130635	ENSG00000130635		"""Collagens"""	2209	protein-coding gene	gene with protein product	"""alpha 1 type V collagen"""	120215				1572660	Standard	NM_001278074		Approved		uc031tfl.1	P20908	OTTHUMG00000020891	ENST00000371817.3:c.1899C>T	9.37:g.137650106C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15094|Q5SUX4	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.D633	ENST00000371817.3	37	c.1899	CCDS6982.1	9																																																																																			COL5A1	-	pfam_Collagen	ENSG00000130635		0.627	COL5A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A1	HGNC	protein_coding	OTTHUMT00000054954.2	79	0.00	0	C	NM_000093		137650106	137650106	+1	no_errors	ENST00000371817	ensembl	human	known	69_37n	silent	45	11.76	6	SNP	0.837	T
COPA	1314	genome.wustl.edu	37	1	160279994	160279994	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:160279994G>A	ENST00000241704.7	-	12	1360	c.1131C>T	c.(1129-1131)gtC>gtT	p.V377V	COPA_ENST00000368069.3_Silent_p.V377V	NM_001098398.1|NM_004371.3	NP_001091868.1|NP_004362.2	P53621	COPA_HUMAN	coatomer protein complex, subunit alpha	377					COPI coating of Golgi vesicle (GO:0048205)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|pancreatic juice secretion (GO:0030157)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(2)|lung(25)|ovary(1)|prostate(3)|skin(1)|stomach(1)|urinary_tract(2)	46	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			TACAAAGCAGGACTGCATTTT	0.398																																						dbGAP											0													134.0	137.0	136.0					1																	160279994		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U24105	CCDS1202.1, CCDS41424.1	1q23.2	2014-01-30			ENSG00000122218	ENSG00000122218		"""WD repeat domain containing"", ""Endogenous ligands"""	2230	protein-coding gene	gene with protein product	"""proxenin"", ""xenin"""	601924				8647451	Standard	NM_004371		Approved	HEP-COP	uc001fvv.4	P53621	OTTHUMG00000033111	ENST00000241704.7:c.1131C>T	1.37:g.160279994G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T201|Q8IXZ9	Silent	SNP	pfam_Coatomer_asu_C,pfam_Coatomer_WD-assoc_reg,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Coatomer_asu,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V377	ENST00000241704.7	37	c.1131	CCDS1202.1	1																																																																																			COPA	-	pfam_Coatomer_WD-assoc_reg,pirsf_Coatomer_asu	ENSG00000122218		0.398	COPA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	COPA	HGNC	protein_coding	OTTHUMT00000080638.1	77	0.00	0	G	NM_004371		160279994	160279994	-1	no_errors	ENST00000368069	ensembl	human	known	69_37n	silent	98	15.52	18	SNP	1.000	A
CPSF1	29894	genome.wustl.edu	37	8	145619108	145619108	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:145619108G>A	ENST00000349769.3	-	35	4099	c.4005C>T	c.(4003-4005)atC>atT	p.I1335I	MIR939_ENST00000401314.1_RNA|CPSF1_ENST00000531727.1_5'UTR	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1335					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CAAACCACGTGATGTGCTTAT	0.632																																					NSCLC(133;1088 1848 27708 34777 35269)	dbGAP											0													89.0	84.0	86.0					8																	145619108		2196	4300	6496	-	-	-	SO:0001819	synonymous_variant	0			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.4005C>T	8.37:g.145619108G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.I1335	ENST00000349769.3	37	c.4005	CCDS34966.1	8																																																																																			CPSF1	-	pfam_Cleavage/polyA-sp_fac_asu_C	ENSG00000071894		0.632	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	54	0.00	0	G	NM_013291		145619108	145619108	-1	no_errors	ENST00000349769	ensembl	human	known	69_37n	silent	69	10.39	8	SNP	1.000	A
CPSF2	53981	genome.wustl.edu	37	14	92608685	92608685	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:92608685C>T	ENST00000298875.4	+	8	1124	c.839C>T	c.(838-840)tCt>tTt	p.S280F		NM_017437.2	NP_059133.1	Q9P2I0	CPSF2_HUMAN	cleavage and polyadenylation specific factor 2, 100kDa	280					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	RNA binding (GO:0003723)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	24		all_cancers(154;0.0766)		COAD - Colon adenocarcinoma(157;0.222)		GTGGAGTTTTCTAAGTCCCAG	0.388																																					Ovarian(78;28 1788 18702 44111)	dbGAP											0													209.0	200.0	203.0					14																	92608685		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037788	CCDS9902.1	14q31.1	2008-07-28	2002-08-29			ENSG00000165934			2325	protein-coding gene	gene with protein product		606028	"""cleavage and polyadenylation specific factor 2, 100kD subunit"""			7969155, 11124543	Standard	NM_017437		Approved	KIAA1367	uc001yah.2	Q9P2I0		ENST00000298875.4:c.839C>T	14.37:g.92608685C>T	ENSP00000298875:p.Ser280Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KME1|Q6NSJ1|Q9H3W7	Missense_Mutation	SNP	pfam_Beta_Casp,pfam_RMMBL,pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.S280F	ENST00000298875.4	37	c.839	CCDS9902.1	14	.	.	.	.	.	.	.	.	.	.	C	32	5.143121	0.94560	.	.	ENSG00000165934	ENST00000298875	T	0.41400	1.0	5.5	5.5	0.81552	Beta-Casp domain (1);	0.000000	0.85682	D	0.000000	T	0.43299	0.1241	N	0.12569	0.235	0.80722	D	1	D	0.54601	0.967	P	0.56648	0.803	T	0.41305	-0.9516	10	0.38643	T	0.18	.	19.4	0.94625	0.0:1.0:0.0:0.0	.	280	Q9P2I0	CPSF2_HUMAN	F	280	ENSP00000298875:S280F	ENSP00000298875:S280F	S	+	2	0	CPSF2	91678438	1.000000	0.71417	0.996000	0.52242	0.982000	0.71751	7.723000	0.84788	2.575000	0.86900	0.563000	0.77884	TCT	CPSF2	-	pfam_Beta_Casp	ENSG00000165934		0.388	CPSF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF2	HGNC	protein_coding	OTTHUMT00000412123.1	102	0.00	0	C			92608685	92608685	+1	no_errors	ENST00000298875	ensembl	human	known	69_37n	missense	79	16.84	16	SNP	1.000	T
CPSF3	51692	genome.wustl.edu	37	2	9570957	9570957	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:9570957C>G	ENST00000238112.3	+	4	495	c.289C>G	c.(289-291)Cat>Gat	p.H97D	CPSF3_ENST00000460593.1_Missense_Mutation_p.H60D	NM_016207.3	NP_057291.1	Q9UKF6	CPSF3_HUMAN	cleavage and polyadenylation specific factor 3, 73kDa	97					gene expression (GO:0010467)|histone mRNA 3'-end processing (GO:0006398)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	5'-3' exonuclease activity (GO:0008409)|endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)	all_cancers(51;2.39e-25)|all_epithelial(98;8.75e-19)|Lung NSC(108;2.38e-06)|Ovarian(717;0.0308)		all cancers(51;2.2e-40)|Epithelial(75;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(76;4.35e-21)|STAD - Stomach adenocarcinoma(1183;0.00644)		ATTTATGACTCATGCCACAAA	0.358																																					Colon(194;1259 2048 3845 5218 19985)	dbGAP											0													128.0	137.0	134.0					2																	9570957		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF171877	CCDS1664.1	2p25.1	2009-01-06	2002-08-29		ENSG00000119203	ENSG00000119203			2326	protein-coding gene	gene with protein product		606029	"""cleavage and polyadenylation specific factor 3, 73kD subunit"""			8929409	Standard	NM_016207		Approved	CPSF-73, CPSF73, YSH1	uc002qzo.2	Q9UKF6	OTTHUMG00000090415	ENST00000238112.3:c.289C>G	2.37:g.9570957C>G	ENSP00000238112:p.His97Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O14769|Q53RS2|Q96F36	Missense_Mutation	SNP	pfam_CPSF73-100_C,pfam_Beta_Casp,pfam_Beta-lactamas-like,pfam_RMMBL,smart_Beta-lactamas-like	p.H97D	ENST00000238112.3	37	c.289	CCDS1664.1	2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.589509	0.86851	.	.	ENSG00000119203	ENST00000238112;ENST00000475482;ENST00000427001;ENST00000460593	T;T;T	0.46451	0.87;0.87;0.87	5.65	5.65	0.86999	Beta-lactamase-like (2);	0.000000	0.85682	D	0.000000	T	0.68256	0.2981	M	0.81341	2.54	0.80722	D	1	D;D	0.58970	0.984;0.958	P;D	0.68621	0.703;0.959	T	0.71167	-0.4672	10	0.72032	D	0.01	-27.5969	19.7341	0.96195	0.0:1.0:0.0:0.0	.	97;97	E7ER23;Q9UKF6	.;CPSF3_HUMAN	D	97;60;97;60	ENSP00000238112:H97D;ENSP00000419744:H60D;ENSP00000418957:H60D	ENSP00000238112:H97D	H	+	1	0	CPSF3	9488408	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	7.734000	0.84928	2.672000	0.90937	0.650000	0.86243	CAT	CPSF3	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000119203		0.358	CPSF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3	HGNC	protein_coding	OTTHUMT00000206843.1	98	0.00	0	C	NM_016207		9570957	9570957	+1	no_errors	ENST00000238112	ensembl	human	known	69_37n	missense	65	17.72	14	SNP	1.000	G
CRLF3	51379	genome.wustl.edu	37	17	29112973	29112973	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:29112973G>C	ENST00000324238.6	-	7	1160	c.1036C>G	c.(1036-1038)Ctg>Gtg	p.L346V	CRLF3_ENST00000544695.1_Missense_Mutation_p.L230V|CRLF3_ENST00000577725.1_Intron	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	346					G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				TCCCGCTGCAGAGAGTCATAT	0.368																																					Pancreas(30;346 881 29244 33464 41299)	dbGAP											0													184.0	164.0	171.0					17																	29112973		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.1036C>G	17.37:g.29112973G>C	ENSP00000318804:p.Leu346Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.L346V	ENST00000324238.6	37	c.1036	CCDS32607.1	17	.	.	.	.	.	.	.	.	.	.	G	18.22	3.575516	0.65878	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.62498	0.02;0.02	4.96	1.86	0.25419	.	0.200019	0.44285	D	0.000461	T	0.66567	0.2802	L	0.49778	1.585	0.53005	D	0.999963	D	0.60160	0.987	P	0.59171	0.853	T	0.65721	-0.6099	10	0.87932	D	0	-10.0568	9.2327	0.37448	0.2979:0.0:0.7021:0.0	.	346	Q8IUI8	CRLF3_HUMAN	V	346;230	ENSP00000318804:L346V;ENSP00000444188:L230V	ENSP00000318804:L346V	L	-	1	2	CRLF3	26137099	0.996000	0.38824	0.998000	0.56505	0.969000	0.65631	1.700000	0.37815	0.238000	0.21222	-0.141000	0.14075	CTG	CRLF3	-	NULL	ENSG00000176390		0.368	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRLF3	HGNC	protein_coding	OTTHUMT00000444354.1	99	0.00	0	G			29112973	29112973	-1	no_errors	ENST00000324238	ensembl	human	known	69_37n	missense	121	22.44	35	SNP	0.994	C
CTNND1	1500	genome.wustl.edu	37	11	57569455	57569455	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:57569455G>A	ENST00000399050.4	+	7	1743	c.1207G>A	c.(1207-1209)Gac>Aac	p.D403N	CTNND1_ENST00000533667.1_Missense_Mutation_p.D80N|CTNND1_ENST00000415361.2_Missense_Mutation_p.D302N|CTNND1_ENST00000426142.2_Missense_Mutation_p.D302N|CTNND1_ENST00000530748.1_Missense_Mutation_p.D349N|CTNND1_ENST00000532844.1_Missense_Mutation_p.D349N|CTNND1_ENST00000524630.1_Missense_Mutation_p.D403N|CTNND1_ENST00000428599.2_Missense_Mutation_p.D403N|CTNND1_ENST00000532787.1_Missense_Mutation_p.D302N|CTNND1_ENST00000526772.1_Missense_Mutation_p.D80N|CTNND1_ENST00000526938.1_Missense_Mutation_p.D403N|CTNND1_ENST00000532463.1_Missense_Mutation_p.D302N|CTNND1_ENST00000529919.1_Missense_Mutation_p.D403N|CTNND1_ENST00000532245.1_Missense_Mutation_p.D302N|CTNND1_ENST00000530094.1_Missense_Mutation_p.D302N|CTNND1_ENST00000528621.1_Missense_Mutation_p.D349N|CTNND1_ENST00000399039.4_Missense_Mutation_p.D403N|CTNND1_ENST00000361391.6_Missense_Mutation_p.D403N|CTNND1_ENST00000529986.1_Missense_Mutation_p.D302N|CTNND1_ENST00000526357.1_Missense_Mutation_p.D349N|CTNND1_ENST00000529526.1_Missense_Mutation_p.D349N|CTNND1_ENST00000531014.1_Missense_Mutation_p.D80N|CTNND1_ENST00000529873.1_Missense_Mutation_p.D349N|CTNND1_ENST00000360682.6_Missense_Mutation_p.D403N|CTNND1_ENST00000361332.4_Missense_Mutation_p.D403N|CTNND1_ENST00000358694.6_Missense_Mutation_p.D403N|CTNND1_ENST00000525902.1_Missense_Mutation_p.D80N|CTNND1_ENST00000534579.1_Missense_Mutation_p.D349N|CTNND1_ENST00000528232.1_Missense_Mutation_p.D302N|CTNND1_ENST00000532649.1_Missense_Mutation_p.D349N|CTNND1_ENST00000361796.4_Missense_Mutation_p.D403N|CTNND1_ENST00000527467.1_Missense_Mutation_p.D80N	NM_001085458.1	NP_001078927.1	O60716	CTND1_HUMAN	catenin (cadherin-associated protein), delta 1	403					adherens junction organization (GO:0034332)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|regulation of transcription, DNA-templated (GO:0006355)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|midbody (GO:0030496)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synapse (GO:0045202)|zonula adherens (GO:0005915)	cadherin binding (GO:0045296)|receptor binding (GO:0005102)			breast(5)|endometrium(8)|kidney(4)|large_intestine(7)|liver(2)|lung(16)|ovary(1)|upper_aerodigestive_tract(2)	45		all_epithelial(135;0.155)				GGTGAAGACTGACGTGCGGAA	0.512																																						dbGAP											0													129.0	130.0	130.0					11																	57569455		2024	4190	6214	-	-	-	SO:0001583	missense	0			AB002382	CCDS44604.1, CCDS44605.1, CCDS44606.1, CCDS44607.1, CCDS44608.1, CCDS44609.1, CCDS53632.1, CCDS53633.1, CCDS53634.1, CCDS55763.1, CCDS55764.1, CCDS55765.1, CCDS55766.1, CCDS55767.1, CCDS73290.1	11q12.1	2013-02-14				ENSG00000198561		"""Armadillo repeat containing"""	2515	protein-coding gene	gene with protein product		601045		CTNND		8808291	Standard	NM_001085460		Approved	KIAA0384, p120, p120cas, p120ctn	uc001nmc.4	O60716		ENST00000399050.4:c.1207G>A	11.37:g.57569455G>A	ENSP00000382004:p.Asp403Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K939|O15088|O60713|O60714|O60715|O60935|Q6DHZ7|Q6RBX8|Q9UP71|Q9UP72|Q9UP73	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.D403N	ENST00000399050.4	37	c.1207	CCDS44604.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.322533	0.95708	.	.	ENSG00000198561	ENST00000524630;ENST00000529919;ENST00000399039;ENST00000533189;ENST00000360682;ENST00000361796;ENST00000529526;ENST00000426142;ENST00000399050;ENST00000361391;ENST00000361332;ENST00000532463;ENST00000529986;ENST00000358694;ENST00000532787;ENST00000533667;ENST00000532649;ENST00000528621;ENST00000530748;ENST00000428599;ENST00000527467;ENST00000528232;ENST00000531014;ENST00000526772;ENST00000529873;ENST00000525902;ENST00000532844;ENST00000526357;ENST00000530094;ENST00000415361;ENST00000532245;ENST00000534579;ENST00000526938	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69175	-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38;-0.38	5.28	5.28	0.74379	Armadillo-like helical (1);Armadillo-type fold (1);	0.156269	0.56097	D	0.000026	T	0.68531	0.3011	L	0.29908	0.895	0.54753	D	0.999985	P;P;P;P;P;P;P;P;P	0.43938	0.787;0.787;0.822;0.787;0.787;0.787;0.609;0.787;0.822	B;P;P;P;P;P;B;P;P	0.51055	0.403;0.526;0.657;0.526;0.526;0.526;0.326;0.526;0.538	T	0.72191	-0.4365	10	0.87932	D	0	-15.4668	18.891	0.92403	0.0:0.0:1.0:0.0	.	403;403;403;302;349;349;403;403;403	O60716-3;O60716-2;O60716;O60716-18;O60716-14;O60716-10;O60716-5;F8WA43;C9JZR2	.;.;CTND1_HUMAN;.;.;.;.;.;.	N	403;403;403;80;403;403;349;302;403;403;403;302;302;403;302;80;349;349;349;403;80;302;80;80;349;80;349;349;302;302;302;349;403	ENSP00000436543:D403N;ENSP00000434808:D403N;ENSP00000381996:D403N;ENSP00000435242:D80N;ENSP00000353902:D403N;ENSP00000354907:D403N;ENSP00000436323:D349N;ENSP00000409930:D302N;ENSP00000382004:D403N;ENSP00000354785:D403N;ENSP00000354823:D403N;ENSP00000432075:D302N;ENSP00000437156:D302N;ENSP00000351527:D403N;ENSP00000434949:D302N;ENSP00000437051:D80N;ENSP00000435379:D349N;ENSP00000432243:D349N;ENSP00000436744:D349N;ENSP00000413586:D403N;ENSP00000434900:D80N;ENSP00000435266:D302N;ENSP00000432623:D80N;ENSP00000433158:D80N;ENSP00000435494:D349N;ENSP00000434672:D80N;ENSP00000433276:D349N;ENSP00000433334:D349N;ENSP00000437327:D302N;ENSP00000403518:D302N;ENSP00000434017:D302N;ENSP00000435789:D349N;ENSP00000432041:D403N	ENSP00000351527:D403N	D	+	1	0	CTNND1	57326031	1.000000	0.71417	0.951000	0.38953	0.995000	0.86356	9.222000	0.95196	2.618000	0.88619	0.557000	0.71058	GAC	CTNND1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo	ENSG00000198561		0.512	CTNND1-006	KNOWN	basic|CCDS	protein_coding	CTNND1	HGNC	protein_coding	OTTHUMT00000393944.1	49	0.00	0	G	NM_001331		57569455	57569455	+1	no_errors	ENST00000399050	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	0.998	A
CYP7B1	9420	genome.wustl.edu	37	8	65528639	65528639	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:65528639G>C	ENST00000310193.3	-	3	632	c.459C>G	c.(457-459)ctC>ctG	p.L153L	CYP7B1_ENST00000523954.1_5'Flank	NM_004820.3	NP_004811.1	O75881	CP7B1_HUMAN	cytochrome P450, family 7, subfamily B, polypeptide 1	153					bile acid biosynthetic process (GO:0006699)|bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|cholesterol metabolic process (GO:0008203)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|positive regulation of epithelial cell proliferation (GO:0050679)|prostate gland epithelium morphogenesis (GO:0060740)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	25-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(11)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28		all_cancers(86;0.217)|Lung NSC(129;0.0521)|all_lung(136;0.0906)|all_epithelial(80;0.215)				TGCTTTCCAAGAGTATGTCCA	0.393																																						dbGAP											0													71.0	68.0	69.0					8																	65528639		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF029403	CCDS6180.1	8q21.3	2008-07-04	2003-01-14		ENSG00000172817	ENSG00000172817		"""Cytochrome P450s"""	2652	protein-coding gene	gene with protein product		603711	"""cytochrome P450, subfamily VIIB (oxysterol 7 alpha-hydroxylase), polypeptide 1"", ""spastic paraplegia 5A (autosomal recessive)"""	SPG5A		9802883, 18252231	Standard	NM_004820		Approved		uc003xvj.2	O75881	OTTHUMG00000164387	ENST00000310193.3:c.459C>G	8.37:g.65528639G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN07|Q9UNF5	Silent	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I,prints_Cyt_P450	p.L153	ENST00000310193.3	37	c.459	CCDS6180.1	8																																																																																			CYP7B1	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000172817		0.393	CYP7B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP7B1	HGNC	protein_coding	OTTHUMT00000378550.1	36	0.00	0	G			65528639	65528639	-1	no_errors	ENST00000310193	ensembl	human	known	69_37n	silent	21	34.38	11	SNP	0.049	C
CYHR1	50626	genome.wustl.edu	37	8	145677767	145677767	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:145677767G>C	ENST00000438911.2	-	4	805	c.672C>G	c.(670-672)ctC>ctG	p.L224L	CYHR1_ENST00000530374.1_Silent_p.L266L	NM_138496.1	NP_612505.1	Q6ZMK1	CYHR1_HUMAN	cysteine/histidine-rich 1	224						cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)	zinc ion binding (GO:0008270)			haematopoietic_and_lymphoid_tissue(2)|lung(3)|ovary(2)	7	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.1e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			TCTCGAAGCTGAGCAGGCTGA	0.622																																						dbGAP											0													155.0	120.0	131.0					8																	145677767		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB007965	CCDS6426.1, CCDS47943.1	8q24	2004-12-07	2005-07-24		ENSG00000187954	ENSG00000187954			17806	protein-coding gene	gene with protein product			"""cysteine and histidine rich 1"""			10745073	Standard	NM_138496		Approved	CHRP, KIAA0496, MGC13010	uc003zcv.2	Q6ZMK1	OTTHUMG00000165171	ENST00000438911.2:c.672C>G	8.37:g.145677767G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSX0|D3DWM3|Q9BSF6|Q9BSU6	Silent	SNP	superfamily_TRAF-like,pfscan_Znf_TRAF	p.L224	ENST00000438911.2	37	c.672	CCDS47943.1	8																																																																																			CYHR1	-	NULL	ENSG00000187954		0.622	CYHR1-001	KNOWN	basic|CCDS	protein_coding	CYHR1	HGNC	protein_coding	OTTHUMT00000382438.1	58	0.00	0	G	NM_032687		145677767	145677767	-1	no_errors	ENST00000438911	ensembl	human	known	69_37n	silent	33	13.16	5	SNP	1.000	C
DCLK2	166614	genome.wustl.edu	37	4	151153941	151153941	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:151153941C>T	ENST00000296550.7	+	10	2281	c.1527C>T	c.(1525-1527)ctC>ctT	p.L509L	DCLK2_ENST00000302176.8_Silent_p.L526L|DCLK2_ENST00000506325.1_Silent_p.L508L	NM_001040260.3	NP_001035350.2	Q8N568	DCLK2_HUMAN	doublecortin-like kinase 2	509	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(1)|prostate(1)|skin(1)	26	all_hematologic(180;0.151)					TCCATGGCCTCAGCATCGTGC	0.458																																					GBM(195;186 2215 13375 16801 37459)	dbGAP											0													255.0	220.0	232.0					4																	151153941		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC032726	CCDS34076.1, CCDS47142.1, CCDS47142.2	4q31.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000170390	ENSG00000170390			19002	protein-coding gene	gene with protein product		613166	"""doublecortin and CaM kinase-like 2"""	DCAMKL2		12477932	Standard	NM_001040260		Approved	MGC45428, DCDC3, DCDC3B, DCK2	uc003ilo.4	Q8N568	OTTHUMG00000161444	ENST00000296550.7:c.1527C>T	4.37:g.151153941C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J5Q9|Q59GC8|Q8N399	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Doublecortin_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Doublecortin_dom,pfscan_Prot_kinase_cat_dom	p.L526	ENST00000296550.7	37	c.1578	CCDS34076.1	4																																																																																			DCLK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000170390		0.458	DCLK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCLK2	HGNC	protein_coding	OTTHUMT00000364952.1	62	0.00	0	C	NM_001040260		151153941	151153941	+1	no_errors	ENST00000302176	ensembl	human	known	69_37n	silent	76	16.48	15	SNP	1.000	T
DDX1	1653	genome.wustl.edu	37	2	15758356	15758356	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:15758356C>T	ENST00000381341.2	+	17	1557	c.1168C>T	c.(1168-1170)Cag>Tag	p.Q390*	DDX1_ENST00000233084.3_Nonsense_Mutation_p.Q390*			Q92499	DDX1_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 1	390	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.|Necessary for interaction with RELA.				ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|multicellular organismal development (GO:0007275)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translational initiation (GO:0006446)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|spliceosomal complex assembly (GO:0000245)|transcription, DNA-templated (GO:0006351)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)	cleavage body (GO:0071920)|cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|tRNA-splicing ligase complex (GO:0072669)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA/RNA helicase activity (GO:0033677)|double-stranded RNA binding (GO:0003725)|exonuclease activity (GO:0004527)|nuclease activity (GO:0004518)|poly(A) binding (GO:0008143)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|transcription cofactor activity (GO:0003712)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(13)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.197)	all_epithelial(98;2.96e-07)|Acute lymphoblastic leukemia(84;4.24e-05)|Ovarian(717;0.0694)	GBM - Glioblastoma multiforme(3;0.00969)	Epithelial(75;4.35e-05)|OV - Ovarian serous cystadenocarcinoma(76;0.133)		GATGCACAATCAGATTCCTCA	0.303																																						dbGAP											0													126.0	145.0	139.0					2																	15758356		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X70649	CCDS1686.1	2p24	2012-02-23	2012-02-23		ENSG00000079785	ENSG00000079785		"""DEAD-boxes"""	2734	protein-coding gene	gene with protein product		601257	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 1"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 1"""			1552844, 19058135	Standard	NM_004939		Approved	DBP-RB	uc002rce.4	Q92499	OTTHUMG00000090593	ENST00000381341.2:c.1168C>T	2.37:g.15758356C>T	ENSP00000370745:p.Gln390*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DME8|B4DPN6	Nonsense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_SPRY_rcpt,pfam_Helicase_C,superfamily_ConA-like_lec_gl,smart_Helicase_ATP-bd,smart_SPla/RYanodine_receptor_subgr,smart_Helicase_C,pfscan_B30.2/SPRY,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q390*	ENST00000381341.2	37	c.1168	CCDS1686.1	2	.	.	.	.	.	.	.	.	.	.	C	42	9.402016	0.99159	.	.	ENSG00000079785	ENST00000381341;ENST00000233084;ENST00000543614	.	.	.	6.17	5.3	0.74995	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-16.4651	15.565	0.76284	0.0:0.9345:0.0:0.0655	.	.	.	.	X	390;390;374	.	ENSP00000233084:Q390X	Q	+	1	0	DDX1	15675807	1.000000	0.71417	0.927000	0.36925	0.931000	0.56810	5.642000	0.67888	1.636000	0.50526	-0.136000	0.14681	CAG	DDX1	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000079785		0.303	DDX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX1	HGNC	protein_coding	OTTHUMT00000207141.2	80	0.00	0	C	NM_004939		15758356	15758356	+1	no_errors	ENST00000233084	ensembl	human	known	69_37n	nonsense	72	17.24	15	SNP	1.000	T
DDX4	54514	genome.wustl.edu	37	5	55081583	55081583	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:55081583C>T	ENST00000505374.1	+	13	840	c.748C>T	c.(748-750)Cct>Tct	p.P250S	DDX4_ENST00000353507.5_Missense_Mutation_p.P216S|DDX4_ENST00000511853.1_Missense_Mutation_p.P101S|DDX4_ENST00000354991.5_Missense_Mutation_p.P216S|DDX4_ENST00000514278.2_Missense_Mutation_p.P230S	NM_024415.2	NP_077726.1	Q9NQI0	DDX4_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 4	250					male meiosis I (GO:0007141)|multicellular organismal development (GO:0007275)|regulation of protein localization (GO:0032880)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pi-body (GO:0071546)|piP-body (GO:0071547)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|nucleic acid binding (GO:0003676)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	24		Lung NSC(810;6.93e-05)|all_neural(839;0.00409)|Prostate(74;0.0107)|Breast(144;0.0544)|Ovarian(174;0.223)				CATACCCCCTCCTCCACCTGA	0.378																																						dbGAP											0													85.0	72.0	77.0					5																	55081583		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF262962	CCDS3969.1, CCDS47208.1, CCDS54854.1, CCDS54855.1	5p15.2-p13.1	2008-02-05	2003-06-13		ENSG00000152670	ENSG00000152670		"""DEAD-boxes"""	18700	protein-coding gene	gene with protein product		605281	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 4"""			10920202, 11850529	Standard	NM_001142549		Approved	VASA	uc003jqg.4	Q9NQI0	OTTHUMG00000097044	ENST00000505374.1:c.748C>T	5.37:g.55081583C>T	ENSP00000424838:p.Pro250Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8Q2|B3KSF4|D6RDK4|E9PCD8|Q5M7Z3|Q86VX0|Q9NT92|Q9NYB1	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.P250S	ENST00000505374.1	37	c.748	CCDS3969.1	5	.	.	.	.	.	.	.	.	.	.	C	15.35	2.808981	0.50421	.	.	ENSG00000152670	ENST00000353507;ENST00000514278;ENST00000505374;ENST00000506511;ENST00000354991;ENST00000511853	T;T;T;T;T;T	0.20738	2.08;2.06;2.05;3.57;2.08;2.08	5.29	4.41	0.53225	.	0.285365	0.34338	N	0.004046	T	0.24736	0.0600	L	0.51914	1.62	0.41337	D	0.987275	B;B;B;P	0.41420	0.057;0.07;0.063;0.749	B;B;B;B	0.40982	0.06;0.021;0.06;0.345	T	0.04053	-1.0981	10	0.59425	D	0.04	-14.9967	15.9105	0.79470	0.0:0.8645:0.1355:0.0	.	230;101;216;250	D6RDK4;E9PCD8;Q9NQI0-2;Q9NQI0	.;.;.;DDX4_HUMAN	S	216;230;250;230;216;101	ENSP00000334167:P216S;ENSP00000425359:P230S;ENSP00000424838:P250S;ENSP00000427167:P230S;ENSP00000347087:P216S;ENSP00000423123:P101S	ENSP00000334167:P216S	P	+	1	0	DDX4	55117340	0.987000	0.35691	0.990000	0.47175	0.883000	0.51084	2.247000	0.43151	1.207000	0.43291	0.655000	0.94253	CCT	DDX4	-	NULL	ENSG00000152670		0.378	DDX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX4	HGNC	protein_coding	OTTHUMT00000214147.2	49	0.00	0	C	NM_024415		55081583	55081583	+1	no_errors	ENST00000505374	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	0.979	T
DEPDC5	9681	genome.wustl.edu	37	22	32239673	32239673	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:32239673C>G	ENST00000382112.3	+	28	2719	c.2649C>G	c.(2647-2649)ctC>ctG	p.L883L	DEPDC5_ENST00000400248.2_Silent_p.L883L|DEPDC5_ENST00000266091.3_Silent_p.L892L|DEPDC5_ENST00000400249.2_Silent_p.L883L|DEPDC5_ENST00000400246.1_Silent_p.L892L|DEPDC5_ENST00000535622.1_Silent_p.L814L|DEPDC5_ENST00000382105.2_Silent_p.L814L|DEPDC5_ENST00000382111.2_Silent_p.L892L	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	892					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						CCTACAGCCTCTGTCCTTCCC	0.468																																						dbGAP											0													121.0	117.0	118.0					22																	32239673		1904	4128	6032	-	-	-	SO:0001819	synonymous_variant	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.2649C>G	22.37:g.32239673C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.L290V	ENST00000382112.3	37	c.868	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	C	9.420	1.082877	0.20309	.	.	ENSG00000100150	ENST00000433147	T	0.21932	1.98	5.81	-0.605	0.11623	.	0.000000	0.85682	D	0.000000	T	0.24774	0.0601	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.03524	-1.1028	7	0.23302	T	0.38	.	13.6029	0.62031	0.0:0.2343:0.6876:0.0781	.	.	.	.	V	290	ENSP00000410544:L290V	ENSP00000410544:L290V	L	+	1	2	DEPDC5	30569673	1.000000	0.71417	0.999000	0.59377	0.989000	0.77384	1.143000	0.31553	0.066000	0.16515	-0.142000	0.14014	CTG	DEPDC5	-	NULL	ENSG00000100150		0.468	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	62	0.00	0	C	NM_014662		32239673	32239673	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000433147	ensembl	human	putative	69_37n	missense	47	21.67	13	SNP	0.993	G
DIXDC1	85458	genome.wustl.edu	37	11	111866817	111866817	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:111866817C>T	ENST00000440460.2	+	18	1997	c.1700C>T	c.(1699-1701)tCa>tTa	p.S567L	DIXDC1_ENST00000389821.4_3'UTR|DIXDC1_ENST00000315253.5_Missense_Mutation_p.S356L	NM_001037954.2	NP_001033043.1	Q155Q3	DIXC1_HUMAN	DIX domain containing 1	568					camera-type eye development (GO:0043010)|cell cycle (GO:0007049)|cerebellar cortex development (GO:0021695)|cerebral cortex radially oriented cell migration (GO:0021799)|forebrain development (GO:0030900)|forebrain ventricular zone progenitor cell division (GO:0021869)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of axonogenesis (GO:0050772)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of JNK cascade (GO:0046330)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of JNK cascade (GO:0046328)|regulation of microtubule cytoskeleton organization (GO:0070507)|Wnt signaling pathway (GO:0016055)	axon terminus (GO:0043679)|cell cortex (GO:0005938)|cell junction (GO:0030054)|cytosol (GO:0005829)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	gamma-tubulin binding (GO:0043015)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)			cervix(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)	17		all_cancers(61;7.58e-15)|all_epithelial(67;5.42e-09)|Melanoma(852;1.91e-06)|all_hematologic(158;0.000405)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0112)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)		Epithelial(105;2.99e-07)|BRCA - Breast invasive adenocarcinoma(274;6.72e-07)|all cancers(92;6.25e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.0548)		CGGGTCAAGTCACCCAGAACT	0.418																																						dbGAP											0													68.0	67.0	67.0					11																	111866817		1837	4082	5919	-	-	-	SO:0001583	missense	0			AB051522	CCDS60957.1, CCDS73381.1, CCDS73382.1	11q23.1	2014-03-20			ENSG00000150764	ENSG00000150764			23695	protein-coding gene	gene with protein product		610493				12792787	Standard	NM_001037954		Approved	KIAA1735, Dixin	uc001pmm.3	Q155Q3	OTTHUMG00000166912	ENST00000440460.2:c.1700C>T	11.37:g.111866817C>T	ENSP00000394352:p.Ser567Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A5D8|E9PRV4|Q6P2J8|Q6PIK4|Q86SR7|Q8IVY4|Q96N69|Q9C0C8	Missense_Mutation	SNP	pfam_DIX,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_DIX,pfscan_CH-domain,pfscan_DIX	p.S567L	ENST00000440460.2	37	c.1700		11	.	.	.	.	.	.	.	.	.	.	C	16.03	3.007934	0.54361	.	.	ENSG00000150764	ENST00000440460;ENST00000315253	T;T	0.72942	-0.7;0.71	5.41	3.55	0.40652	.	0.410909	0.27951	N	0.017198	T	0.67720	0.2923	.	.	.	0.44309	D	0.997186	D;B;B	0.56968	0.978;0.13;0.1	P;B;B	0.48063	0.565;0.11;0.034	T	0.65063	-0.6259	9	0.37606	T	0.19	-16.3087	9.4684	0.38826	0.0:0.7848:0.0:0.2152	.	233;356;568	B4DH68;E7EQ17;Q155Q3	.;.;DIXC1_HUMAN	L	567;356	ENSP00000394352:S567L;ENSP00000314068:S356L	ENSP00000314068:S356L	S	+	2	0	DIXDC1	111372027	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	1.901000	0.39838	0.854000	0.35336	0.591000	0.81541	TCA	DIXDC1	-	NULL	ENSG00000150764		0.418	DIXDC1-202	KNOWN	basic|appris_principal	protein_coding	DIXDC1	HGNC	protein_coding		65	0.00	0	C	NM_001037954		111866817	111866817	+1	no_errors	ENST00000440460	ensembl	human	known	69_37n	missense	55	21.13	15	SNP	1.000	T
DMRTB1	63948	genome.wustl.edu	37	1	53930486	53930486	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:53930486G>A	ENST00000371445.3	+	3	982	c.927G>A	c.(925-927)ctG>ctA	p.L309L		NM_033067.1	NP_149056.1	Q96MA1	DMRTB_HUMAN	DMRT-like family B with proline-rich C-terminal, 1	309					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(3)|lung(5)|ovary(1)|skin(1)	10						CTTTCTCACTGACCGTCCTGT	0.597																																						dbGAP											0													126.0	125.0	125.0					1																	53930486		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ291671	CCDS581.1	1p32	2008-08-29			ENSG00000143006	ENSG00000143006			13913	protein-coding gene	gene with protein product		614805					Standard	NM_033067		Approved		uc001cvq.1	Q96MA1	OTTHUMG00000008080	ENST00000371445.3:c.927G>A	1.37:g.53930486G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96SD2	Silent	SNP	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.L309	ENST00000371445.3	37	c.927	CCDS581.1	1	.	.	.	.	.	.	.	.	.	.	G	6.081	0.383248	0.11524	.	.	ENSG00000143006	ENST00000431335	.	.	.	3.95	-0.2	0.13216	.	.	.	.	.	T	0.61788	0.2375	.	.	.	0.42084	D	0.991261	.	.	.	.	.	.	T	0.62229	-0.6898	5	0.87932	D	0	-26.1011	7.7453	0.28864	0.0:0.2919:0.4078:0.3003	.	.	.	.	N	140	.	ENSP00000395130:D140N	D	+	1	0	DMRTB1	53703074	0.872000	0.30054	0.116000	0.21606	0.184000	0.23303	1.445000	0.35079	-0.016000	0.14127	0.462000	0.41574	GAC	DMRTB1	-	NULL	ENSG00000143006		0.597	DMRTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRTB1	HGNC	protein_coding	OTTHUMT00000022110.1	65	0.00	0	G			53930486	53930486	+1	no_errors	ENST00000371445	ensembl	human	known	69_37n	silent	55	11.29	7	SNP	0.471	A
DNAH11	8701	genome.wustl.edu	37	7	21818683	21818683	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:21818683G>A	ENST00000409508.3	+	57	9475	c.9444G>A	c.(9442-9444)gtG>gtA	p.V3148V	DNAH11_ENST00000328843.6_Silent_p.V3155V	NM_001277115.1	NP_001264044.1	Q96DT5	DYH11_HUMAN	dynein, axonemal, heavy chain 11	3155	Stalk. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(13)|central_nervous_system(3)|cervix(4)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(50)|lung(101)|ovary(10)|pancreas(4)|prostate(7)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	230						CGGAGAAAGTGAGCCGGGAAA	0.468									Kartagener syndrome																													dbGAP											0													66.0	64.0	65.0					7																	21818683		1916	4141	6057	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	U83569	CCDS64602.1	7p21	2008-07-18	2006-09-04					"""Axonemal dyneins"""	2942	protein-coding gene	gene with protein product	"""dynein, ciliary, heavy chain 11"", ""dynein, heavy chain beta-like"""	603339	"""dynein, axonemal, heavy polypeptide 11"""			9256245	Standard	NM_001277115		Approved	Dnahc11, DPL11, CILD7, DNAHC11, DNAHBL, DNHBL	uc031swp.1	Q96DT5		ENST00000409508.3:c.9444G>A	7.37:g.21818683G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UJ82	Silent	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.V3155	ENST00000409508.3	37	c.9465		7																																																																																			DNAH11	-	NULL	ENSG00000105877		0.468	DNAH11-001	KNOWN	basic|appris_candidate	protein_coding	DNAH11	HGNC	protein_coding	OTTHUMT00000326582.6	68	0.00	0	G	NM_003777		21818683	21818683	+1	no_errors	ENST00000328843	ensembl	human	known	69_37n	silent	31	18.42	7	SNP	1.000	A
DNAH17	8632	genome.wustl.edu	37	17	76459075	76459075	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:76459075C>T	ENST00000585328.1	-	57	9134	c.9010G>A	c.(9010-9012)Gag>Aag	p.E3004K	DNAH17_ENST00000586052.1_5'UTR|DNAH17_ENST00000389840.5_Missense_Mutation_p.E2995K	NM_173628.3	NP_775899.3	Q9UFH2	DYH17_HUMAN	dynein, axonemal, heavy chain 17	2995					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(7)|central_nervous_system(5)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(8)|lung(37)|ovary(8)|prostate(7)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	116			BRCA - Breast invasive adenocarcinoma(99;0.00294)|OV - Ovarian serous cystadenocarcinoma(97;0.0656)			TAGCGCCTCTCAGTAGCCAGG	0.498																																						dbGAP											0													177.0	139.0	152.0					17																	76459075		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ000522		17q25.3	2012-04-19	2006-09-04		ENSG00000187775	ENSG00000187775		"""Axonemal dyneins"""	2946	protein-coding gene	gene with protein product		610063	"""dynein, axonemal, heavy polypeptide 17"", ""dynein, axonemal, heavy chain like 1"", ""dynein, axonemal, heavy like 1"""	DNAHL1		9545504	Standard	NM_173628		Approved	DNEL2, FLJ40457	uc010dhp.2	Q9UFH2		ENST00000585328.1:c.9010G>A	17.37:g.76459075C>T	ENSP00000465516:p.Glu3004Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00431|O15206|Q2M2Y1|Q6ZRQ2|Q8N7Q7	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_HR1_rho-bd	p.E2995K	ENST00000585328.1	37	c.8983		17	.	.	.	.	.	.	.	.	.	.	C	33	5.256455	0.95336	.	.	ENSG00000187775	ENST00000300671;ENST00000389840	T	0.55588	0.51	5.07	5.07	0.68467	.	0.000000	0.64402	D	0.000016	T	0.78515	0.4295	M	0.91972	3.26	0.53688	D	0.999972	D	0.76494	0.999	D	0.72625	0.978	T	0.82345	-0.0503	10	0.46703	T	0.11	.	18.4592	0.90732	0.0:1.0:0.0:0.0	.	3004	E7EUM8	.	K	3004;2995	ENSP00000374490:E2995K	ENSP00000300671:E3004K	E	-	1	0	DNAH17	73970670	1.000000	0.71417	0.901000	0.35422	0.872000	0.50106	7.387000	0.79785	2.361000	0.80049	0.555000	0.69702	GAG	DNAH17	-	NULL	ENSG00000187775		0.498	DNAH17-001	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	DNAH17	HGNC	protein_coding	OTTHUMT00000318962.2	109	0.00	0	C	NM_173628		76459075	76459075	-1	no_errors	ENST00000389840	ensembl	human	known	69_37n	missense	58	21.62	16	SNP	1.000	T
DNAI1	27019	genome.wustl.edu	37	9	34493197	34493197	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:34493197G>A	ENST00000242317.4	+	9	858	c.687G>A	c.(685-687)gaG>gaA	p.E229E	DNAI1_ENST00000488369.1_3'UTR	NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	229					cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		CCTAGTGGGAGATCTATGATG	0.443									Kartagener syndrome																													dbGAP											0													108.0	107.0	108.0					9																	34493197		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.687G>A	9.37:g.34493197G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E229	ENST00000242317.4	37	c.687	CCDS6557.1	9																																																																																			DNAI1	-	NULL	ENSG00000122735		0.443	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	HGNC	protein_coding	OTTHUMT00000052192.1	36	0.00	0	G			34493197	34493197	+1	no_errors	ENST00000242317	ensembl	human	known	69_37n	silent	30	18.92	7	SNP	1.000	A
DPP4	1803	genome.wustl.edu	37	2	162873352	162873352	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:162873352G>A	ENST00000360534.3	-	18	2053	c.1493C>T	c.(1492-1494)tCa>tTa	p.S498L	DPP4_ENST00000491591.1_5'UTR	NM_001935.3	NP_001926.2	P27487	DPP4_HUMAN	dipeptidyl-peptidase 4	498					cell adhesion (GO:0007155)|endothelial cell migration (GO:0043542)|negative regulation of extracellular matrix disassembly (GO:0010716)|positive regulation of cell proliferation (GO:0008284)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to hypoxia (GO:0001666)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|invadopodium membrane (GO:0071438)|lamellipodium (GO:0030027)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dipeptidyl-peptidase activity (GO:0008239)|identical protein binding (GO:0042802)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(21)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	48					Alogliptin(DB06203)|Atorvastatin(DB01076)|Linagliptin(DB08882)|Liraglutide(DB06655)|Saxagliptin(DB06335)|Sitagliptin(DB01261)|Vildagliptin(DB04876)	ATCCAAAGCTGAATTGTCTTC	0.358																																						dbGAP											0													82.0	83.0	83.0					2																	162873352		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74777	CCDS2216.1	2q24.2	2013-09-19	2008-08-01		ENSG00000197635	ENSG00000197635	3.4.14.5	"""CD molecules"""	3009	protein-coding gene	gene with protein product		102720	"""dipeptidylpeptidase IV (CD26, adenosine deaminase complexing protein 2)"", ""adenosine deaminase complexing protein 2"""	CD26, ADCP2		8101391	Standard	NM_001935		Approved	DPPIV	uc002ubz.3	P27487	OTTHUMG00000132056	ENST00000360534.3:c.1493C>T	2.37:g.162873352G>A	ENSP00000353731:p.Ser498Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TN1	Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.S498L	ENST00000360534.3	37	c.1493	CCDS2216.1	2	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761769	0.49468	.	.	ENSG00000197635	ENST00000360534	D	0.96200	-3.94	5.61	5.61	0.85477	.	0.324951	0.32134	N	0.006534	D	0.92296	0.7556	L	0.53729	1.69	0.30928	N	0.727226	B	0.13145	0.007	B	0.09377	0.004	D	0.86368	0.1721	10	0.30078	T	0.28	-19.6165	9.1789	0.37129	0.0731:0.0:0.7805:0.1464	.	498	P27487	DPP4_HUMAN	L	498	ENSP00000353731:S498L	ENSP00000353731:S498L	S	-	2	0	DPP4	162581598	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	2.419000	0.44671	2.804000	0.96469	0.650000	0.86243	TCA	DPP4	-	NULL	ENSG00000197635		0.358	DPP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPP4	HGNC	protein_coding	OTTHUMT00000255079.2	74	0.00	0	G			162873352	162873352	-1	no_errors	ENST00000360534	ensembl	human	known	69_37n	missense	52	24.64	17	SNP	0.999	A
DSG2	1829	genome.wustl.edu	37	18	29122609	29122609	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr18:29122609G>C	ENST00000261590.8	+	14	2337	c.2128G>C	c.(2128-2130)Gag>Cag	p.E710Q	RP11-75N4.2_ENST00000583706.1_RNA	NM_001943.3	NP_001934.2	Q14126	DSG2_HUMAN	desmoglein 2	710					apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|homophilic cell adhesion (GO:0007156)|maternal process involved in female pregnancy (GO:0060135)|regulation of heart rate by cardiac conduction (GO:0086091)|response to progesterone (GO:0032570)|ventricular cardiac muscle cell action potential (GO:0086005)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(6)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(17)|ovary(2)|prostate(4)|skin(2)|urinary_tract(1)	49			OV - Ovarian serous cystadenocarcinoma(10;0.0068)			AGGGCAACATGAGATGTCCGA	0.512																																						dbGAP											0													114.0	117.0	116.0					18																	29122609		2021	4195	6216	-	-	-	SO:0001583	missense	0			Z26317	CCDS42423.1	18q12.1	2014-09-17				ENSG00000046604		"""Cadherins / Major cadherins"""	3049	protein-coding gene	gene with protein product		125671				1612610	Standard	NM_001943		Approved	CDHF5	uc002kwu.4	Q14126		ENST00000261590.8:c.2128G>C	18.37:g.29122609G>C	ENSP00000261590:p.Glu710Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KKU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.E710Q	ENST00000261590.8	37	c.2128	CCDS42423.1	18	.	.	.	.	.	.	.	.	.	.	G	7.737	0.700459	0.15106	.	.	ENSG00000046604	ENST00000261590	T	0.59638	0.25	5.86	2.76	0.32466	.	1.070070	0.07179	N	0.853742	T	0.35711	0.0941	N	0.19112	0.55	0.09310	N	1	P	0.34462	0.454	B	0.32805	0.153	T	0.25745	-1.0123	10	0.13108	T	0.6	.	2.7501	0.05277	0.4322:0.0:0.3644:0.2035	.	710	Q14126	DSG2_HUMAN	Q	710	ENSP00000261590:E710Q	ENSP00000261590:E710Q	E	+	1	0	DSG2	27376607	0.028000	0.19301	0.008000	0.14137	0.008000	0.06430	2.609000	0.46317	0.831000	0.34780	0.655000	0.94253	GAG	DSG2	-	NULL	ENSG00000046604		0.512	DSG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG2	HGNC	protein_coding	OTTHUMT00000447506.1	76	0.00	0	G	NM_001943		29122609	29122609	+1	no_errors	ENST00000261590	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.000	C
DSP	1832	genome.wustl.edu	37	6	7579712	7579712	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:7579712C>G	ENST00000379802.3	+	23	3630	c.3289C>G	c.(3289-3291)Cta>Gta	p.L1097V	DSP_ENST00000418664.2_Missense_Mutation_p.L1097V	NM_004415.2	NP_004406.2	P15924	DESP_HUMAN	desmoplakin	1097	Central fibrous rod domain.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|desmosome organization (GO:0002934)|epidermis development (GO:0008544)|intermediate filament organization (GO:0045109)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein localization to adherens junction (GO:0071896)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular compact myocardium morphogenesis (GO:0003223)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cornified envelope (GO:0001533)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)|protein kinase C binding (GO:0005080)|scaffold protein binding (GO:0097110)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			biliary_tract(1)|breast(6)|central_nervous_system(7)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(16)|liver(2)|lung(27)|ovary(4)|prostate(1)|skin(8)|stomach(3)|upper_aerodigestive_tract(7)|urinary_tract(5)	101	Ovarian(93;0.0584)	all_hematologic(90;0.236)		OV - Ovarian serous cystadenocarcinoma(45;0.000508)		TAAGCAAAATCTAGACAAGTG	0.458																																						dbGAP											0													102.0	102.0	102.0					6																	7579712		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05211	CCDS4501.1, CCDS47368.1	6p24.3	2014-09-17	2003-05-20		ENSG00000096696	ENSG00000096696			3052	protein-coding gene	gene with protein product		125647	"""desmoplakin (DPI, DPII)"""			1889810	Standard	NM_004415		Approved	KPPS2, PPKS2, DPI, DPII	uc003mxp.1	P15924	OTTHUMG00000014212	ENST00000379802.3:c.3289C>G	6.37:g.7579712C>G	ENSP00000369129:p.Leu1097Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTT2|D7RX09|O75993|Q14189|Q9UHN4	Missense_Mutation	SNP	pfam_Plectin_repeat,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.L1097V	ENST00000379802.3	37	c.3289	CCDS4501.1	6	.	.	.	.	.	.	.	.	.	.	C	19.68	3.873047	0.72180	.	.	ENSG00000096696	ENST00000379802;ENST00000418664;ENST00000397483	D;D	0.94931	-3.56;-3.56	5.25	5.25	0.73442	.	0.000000	0.45606	D	0.000349	D	0.92909	0.7744	L	0.32530	0.975	0.46458	D	0.999059	D;D	0.69078	0.993;0.997	D;D	0.76071	0.987;0.978	D	0.91809	0.5458	10	0.33940	T	0.23	.	9.5652	0.39394	0.0:0.8438:0.0:0.1562	.	1144;1097	Q4LE79;P15924	.;DESP_HUMAN	V	1097;1097;902	ENSP00000369129:L1097V;ENSP00000396591:L1097V	ENSP00000369129:L1097V	L	+	1	2	DSP	7524711	1.000000	0.71417	0.973000	0.42090	0.996000	0.88848	4.081000	0.57627	2.450000	0.82876	0.555000	0.69702	CTA	DSP	-	NULL	ENSG00000096696		0.458	DSP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSP	HGNC	protein_coding	OTTHUMT00000039786.2	46	0.00	0	C	NM_004415		7579712	7579712	+1	no_errors	ENST00000379802	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	G
EBF2	64641	genome.wustl.edu	37	8	25718703	25718703	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:25718703G>C	ENST00000520164.1	-	13	1741	c.1204C>G	c.(1204-1206)Ctc>Gtc	p.L402V	EBF2_ENST00000535548.1_Missense_Mutation_p.L133V|EBF2_ENST00000408929.3_Missense_Mutation_p.L254V	NM_022659.3	NP_073150.2	Q9HAK2	COE2_HUMAN	early B-cell factor 2	402					adipose tissue development (GO:0060612)|brown fat cell differentiation (GO:0050873)|cell fate determination (GO:0001709)|positive regulation of chromatin binding (GO:0035563)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(3)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	39		all_cancers(63;0.0989)|Ovarian(32;2.74e-05)|all_epithelial(46;0.0608)|Prostate(55;0.0845)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0277)|Epithelial(17;3.29e-10)|Colorectal(74;0.00383)|COAD - Colon adenocarcinoma(73;0.00738)		ACGCTGTAGAGAGCTTCAGCA	0.502																																					Esophageal Squamous(166;1018 1046 3854 8328 13429 13634 14071 26624 32918)	dbGAP											0													113.0	122.0	119.0					8																	25718703		2035	4181	6216	-	-	-	SO:0001583	missense	0			AK021562, AK001144	CCDS43726.1	8p21.1	2007-07-26			ENSG00000221818	ENSG00000221818			19090	protein-coding gene	gene with protein product		609934				9151732	Standard	NM_022659		Approved	FLJ11500, COE2	uc003xes.2	Q9HAK2	OTTHUMG00000163838	ENST00000520164.1:c.1204C>G	8.37:g.25718703G>C	ENSP00000430241:p.Leu402Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJM4|A6NMF7|F5H645|Q66VZ3|Q6DK36|Q6IS86|Q6ISA4	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	p.L402V	ENST00000520164.1	37	c.1204	CCDS43726.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269980	0.80469	.	.	ENSG00000221818	ENST00000520164;ENST00000408929;ENST00000535548	T;T;T	0.52526	0.66;0.66;0.66	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	T	0.68970	0.3059	M	0.84433	2.695	0.80722	D	1	D	0.63046	0.992	P	0.60012	0.867	T	0.68281	-0.5450	10	0.25106	T	0.35	-1.4012	18.9368	0.92589	0.0:0.0:1.0:0.0	.	402	Q9HAK2	COE2_HUMAN	V	402;254;133	ENSP00000430241:L402V;ENSP00000386178:L254V;ENSP00000437909:L133V	ENSP00000386178:L254V	L	-	1	0	EBF2	25774620	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	5.656000	0.67988	2.476000	0.83614	0.655000	0.94253	CTC	EBF2	-	NULL	ENSG00000221818		0.502	EBF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBF2	HGNC	protein_coding	OTTHUMT00000375886.2	89	0.00	0	G	NM_022659		25718703	25718703	-1	no_errors	ENST00000520164	ensembl	human	known	69_37n	missense	70	11.25	9	SNP	1.000	C
EFCAB6	64800	genome.wustl.edu	37	22	44079664	44079664	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:44079664G>C	ENST00000262726.7	-	12	1467	c.1214C>G	c.(1213-1215)tCt>tGt	p.S405C	EFCAB6_ENST00000358439.4_Intron|EFCAB6_ENST00000396231.2_Missense_Mutation_p.S253C	NM_022785.3	NP_073622.2	Q5THR3	EFCB6_HUMAN	EF-hand calcium binding domain 6	405	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(16)|lung(25)|ovary(4)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68		Ovarian(80;0.0247)|all_neural(38;0.025)				CAGTGACGCAGAGTGATCTTC	0.363																																						dbGAP											0													304.0	271.0	282.0					22																	44079664		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z82201	CCDS14049.1, CCDS14050.1	22q13.2	2013-01-10			ENSG00000186976	ENSG00000186976		"""EF-hand domain containing"""	24204	protein-coding gene	gene with protein product						11258795, 12612053	Standard	NM_022785		Approved	FLJ23588, DJBP, HSCBCIP1, KIAA1672, dJ185D5.1	uc003bdy.2	Q5THR3	OTTHUMG00000150522	ENST00000262726.7:c.1214C>G	22.37:g.44079664G>C	ENSP00000262726:p.Ser405Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P6|A8K8Y3|B0QYI4|B0QYI6|Q5U5T6|Q9BY88|Q9H5C4|Q9NSF5	Missense_Mutation	SNP	pfam_EF_hand_Ca-bd_contain_6,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S405C	ENST00000262726.7	37	c.1214	CCDS14049.1	22	.	.	.	.	.	.	.	.	.	.	G	0.908	-0.720108	0.03182	.	.	ENSG00000186976	ENST00000396231;ENST00000262726	T;T	0.15139	2.45;2.46	4.69	-9.38	0.00623	.	1.841340	0.03167	N	0.170229	T	0.17704	0.0425	L	0.36672	1.1	0.09310	N	1	D;P	0.57899	0.981;0.833	P;B	0.53062	0.717;0.428	T	0.58036	-0.7707	10	0.39692	T	0.17	0.2368	3.6806	0.08309	0.2604:0.2091:0.425:0.1055	.	405;405	Q5THR3-6;Q5THR3	.;EFCB6_HUMAN	C	253;405	ENSP00000379533:S253C;ENSP00000262726:S405C	ENSP00000262726:S405C	S	-	2	0	EFCAB6	42410997	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-4.414000	0.00237	-6.753000	0.00002	-4.064000	0.00012	TCT	EFCAB6	-	NULL	ENSG00000186976		0.363	EFCAB6-010	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB6	HGNC	protein_coding	OTTHUMT00000353176.1	126	0.00	0	G	NM_022785		44079664	44079664	-1	no_errors	ENST00000262726	ensembl	human	known	69_37n	missense	132	12.00	18	SNP	0.000	C
EIF1AX	1964	genome.wustl.edu	37	X	20150342	20150342	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:20150342C>T	ENST00000379607.5	-	5	498	c.295G>A	c.(295-297)Gaa>Aaa	p.E99K	EIF1AX_ENST00000379593.1_Missense_Mutation_p.E71K	NM_001412.3	NP_001403.1	P47813	IF1AX_HUMAN	eukaryotic translation initiation factor 1A, X-linked	99					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|translation (GO:0006412)|translational initiation (GO:0006413)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)|translation factor activity, nucleic acid binding (GO:0008135)|translation initiation factor activity (GO:0003743)			endometrium(2)|lung(1)|ovary(1)|prostate(1)	5						CTTCTAGCTTCGTCTGCATTG	0.328																																						dbGAP											0													104.0	85.0	91.0					X																	20150342		2203	4300	6503	-	-	-	SO:0001583	missense	0			L18960	CCDS14196.1	Xp22.13	2014-02-19	2002-11-28	2004-05-26	ENSG00000173674	ENSG00000173674			3250	protein-coding gene	gene with protein product		300186	"""eukaryotic translation initiation factor 1A, X chromosome"""	EIF4C, EIF1A		8106356, 9381176	Standard	NM_001412		Approved	eIF-1A, eIF-4C	uc004czt.3	P47813	OTTHUMG00000022704	ENST00000379607.5:c.295G>A	X.37:g.20150342C>T	ENSP00000368927:p.Glu99Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5U5|Q0VGC2|Q5JPS5|Q5JPS6	Missense_Mutation	SNP	pfam_RNA-binding_domain_S1_IF1,superfamily_NA-bd_OB-fold-like,smart_TIF_eIF-1A,pfscan_RNA-binding_domain_S1_IF1,tigrfam_TIF_eIF-1A	p.E99K	ENST00000379607.5	37	c.295	CCDS14196.1	X	.	.	.	.	.	.	.	.	.	.	c	33	5.194095	0.94960	.	.	ENSG00000173674	ENST00000379607;ENST00000379593	T;T	0.50813	0.73;0.73	5.0	5.0	0.66597	Nucleic acid-binding, OB-fold-like (1);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.77164	0.4090	M	0.93507	3.425	0.58432	D	0.999998	D	0.89917	1.0	D	0.83275	0.996	D	0.84341	0.0527	9	0.72032	D	0.01	.	17.1737	0.86836	0.0:1.0:0.0:0.0	.	99	P47813	IF1AX_HUMAN	K	99;71	ENSP00000368927:E99K;ENSP00000368912:E71K	ENSP00000368912:E71K	E	-	1	0	EIF1AX	20060263	1.000000	0.71417	1.000000	0.80357	0.859000	0.49053	7.317000	0.79018	2.077000	0.62373	0.591000	0.81541	GAA	EIF1AX	-	superfamily_NA-bd_OB-fold-like,smart_TIF_eIF-1A,tigrfam_TIF_eIF-1A	ENSG00000173674		0.328	EIF1AX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1AX	HGNC	protein_coding	OTTHUMT00000058913.1	53	0.00	0	C			20150342	20150342	-1	no_errors	ENST00000379607	ensembl	human	known	69_37n	missense	61	14.08	10	SNP	1.000	T
EIF2B4	8890	genome.wustl.edu	37	2	27592329	27592329	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:27592329C>G	ENST00000347454.4	-	3	334	c.163G>C	c.(163-165)Ggg>Cgg	p.G55R	EIF2B4_ENST00000451130.2_Missense_Mutation_p.G76R|SNX17_ENST00000537606.1_5'Flank|SNX17_ENST00000543024.1_5'Flank|SNX17_ENST00000233575.2_5'Flank|AC074117.10_ENST00000412749.1_RNA|EIF2B4_ENST00000493344.2_Missense_Mutation_p.G76R|SNX17_ENST00000542478.1_5'Flank|EIF2B4_ENST00000445933.2_Missense_Mutation_p.G55R	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	55					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTTCTGCCCCCTTTTCTTCC	0.517																																						dbGAP											0													234.0	193.0	207.0					2																	27592329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.163G>C	2.37:g.27592329C>G	ENSP00000233552:p.Gly55Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	pfam_IF-2B-related	p.G55R	ENST00000347454.4	37	c.163	CCDS33164.1	2	.	.	.	.	.	.	.	.	.	.	C	21.0	4.081679	0.76528	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	T;D;D;T	0.94184	0.98;-3.37;-3.37;0.98	4.87	4.87	0.63330	.	0.202214	0.51477	D	0.000093	D	0.93396	0.7894	L	0.41236	1.265	0.47511	D	0.999442	D;D;D;P;D	0.61697	0.99;0.973;0.973;0.954;0.985	P;P;P;P;P	0.62184	0.899;0.656;0.656;0.454;0.811	D	0.92434	0.5956	10	0.46703	T	0.11	-11.053	10.5867	0.45286	0.192:0.808:0.0:0.0	.	49;53;55;55;76	Q59FC8;F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;.;EI2BD_HUMAN;.	R	55;53;55;76;76	ENSP00000233552:G55R;ENSP00000394397:G55R;ENSP00000394869:G76R;ENSP00000429323:G76R	ENSP00000233552:G55R	G	-	1	0	EIF2B4	27445833	1.000000	0.71417	0.995000	0.50966	0.963000	0.63663	3.304000	0.51866	2.533000	0.85409	0.561000	0.74099	GGG	EIF2B4	-	NULL	ENSG00000115211		0.517	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	HGNC	protein_coding	OTTHUMT00000324448.1	122	0.00	0	C			27592329	27592329	-1	no_errors	ENST00000347454	ensembl	human	known	69_37n	missense	105	17.32	22	SNP	0.947	G
AGO1	26523	genome.wustl.edu	37	1	36372627	36372627	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:36372627G>C	ENST00000373204.4	+	12	1702	c.1489G>C	c.(1489-1491)Gac>Cac	p.D497H	AGO1_ENST00000373206.1_Missense_Mutation_p.D422H	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	497					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										ACAGGGGGCAGACAGCGTGGA	0.532																																						dbGAP											0													133.0	109.0	117.0					1																	36372627		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.1489G>C	1.37:g.36372627G>C	ENSP00000362300:p.Asp497His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TA57|Q6P4S0	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.D497H	ENST00000373204.4	37	c.1489	CCDS398.1	1	.	.	.	.	.	.	.	.	.	.	G	29.3	4.992217	0.93167	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.12039	2.72;2.72	5.58	5.58	0.84498	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.43545	0.1252	M	0.88310	2.945	0.80722	D	1	P	0.49358	0.923	P	0.58266	0.836	T	0.49380	-0.8946	10	0.87932	D	0	-25.3486	19.5797	0.95461	0.0:0.0:1.0:0.0	.	497	Q9UL18	AGO1_HUMAN	H	422;497	ENSP00000362302:D422H;ENSP00000362300:D497H	ENSP00000362300:D497H	D	+	1	0	EIF2C1	36145214	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.771000	0.98977	2.623000	0.88846	0.650000	0.86243	GAC	EIF2C1	-	superfamily_RNaseH-like_dom	ENSG00000092847		0.532	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C1	HGNC	protein_coding	OTTHUMT00000019337.3	61	0.00	0	G			36372627	36372627	+1	no_errors	ENST00000373204	ensembl	human	known	69_37n	missense	35	22.22	10	SNP	1.000	C
ELF1	1997	genome.wustl.edu	37	13	41517154	41517154	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:41517154G>A	ENST00000239882.3	-	7	1054	c.740C>T	c.(739-741)tCc>tTc	p.S247F	ELF1_ENST00000498824.1_5'UTR|ELF1_ENST00000442101.1_Missense_Mutation_p.S223F	NM_172373.3	NP_758961.1	P32519	ELF1_HUMAN	E74-like factor 1 (ets domain transcription factor)	247					cell differentiation (GO:0030154)|negative regulation of T cell receptor signaling pathway (GO:0050860)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine production (GO:0001817)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	37		Lung NSC(96;8.3e-05)|Prostate(109;0.0233)|Breast(139;0.0296)|Lung SC(185;0.0367)		all cancers(112;1.87e-08)|Epithelial(112;8.45e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000202)|GBM - Glioblastoma multiforme(144;0.00266)|BRCA - Breast invasive adenocarcinoma(63;0.072)		CCACAACCTGGACACTGCTTT	0.423																																						dbGAP											0													110.0	101.0	104.0					13																	41517154		2203	4300	6503	-	-	-	SO:0001583	missense	0			M82882	CCDS9374.1	13q13	2008-07-18			ENSG00000120690	ENSG00000120690			3316	protein-coding gene	gene with protein product		189973				1545787	Standard	NM_001145353		Approved		uc001uxs.3	P32519	OTTHUMG00000016783	ENST00000239882.3:c.740C>T	13.37:g.41517154G>A	ENSP00000239882:p.Ser247Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2I5|E9PDQ9|Q8N6F6|Q9UDE1	Missense_Mutation	SNP	pfam_TF_Elf_N,pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.S247F	ENST00000239882.3	37	c.740	CCDS9374.1	13	.	.	.	.	.	.	.	.	.	.	G	29.6	5.022889	0.93462	.	.	ENSG00000120690	ENST00000442101;ENST00000239882	T;T	0.57752	0.38;0.38	5.67	5.67	0.87782	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.057953	0.64402	D	0.000001	T	0.75295	0.3830	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.77498	-0.2565	10	0.87932	D	0	.	19.7493	0.96261	0.0:0.0:1.0:0.0	.	223;247	E9PDQ9;P32519	.;ELF1_HUMAN	F	223;247	ENSP00000405580:S223F;ENSP00000239882:S247F	ENSP00000239882:S247F	S	-	2	0	ELF1	40415154	1.000000	0.71417	0.997000	0.53966	0.974000	0.67602	9.869000	0.99810	2.663000	0.90544	0.655000	0.94253	TCC	ELF1	-	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	ENSG00000120690		0.423	ELF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ELF1	HGNC	protein_coding	OTTHUMT00000044654.3	56	0.00	0	G	NM_172373		41517154	41517154	-1	no_errors	ENST00000239882	ensembl	human	known	69_37n	missense	48	18.64	11	SNP	1.000	A
ENDOU	8909	genome.wustl.edu	37	12	48119180	48119180	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:48119180G>A	ENST00000422538.3	-	1	139	c.17C>T	c.(16-18)tCc>tTc	p.S6F	ENDOU_ENST00000229003.3_Missense_Mutation_p.S6F|RP1-197B17.3_ENST00000547799.1_lincRNA|ENDOU_ENST00000545824.2_Missense_Mutation_p.S6F	NM_001172439.1	NP_001165910.1	P21128	ENDOU_HUMAN	endonuclease, polyU-specific	6					female pregnancy (GO:0007565)|immune response (GO:0006955)|proteolysis (GO:0006508)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	endoribonuclease activity (GO:0004521)|growth factor activity (GO:0008083)|manganese ion binding (GO:0030145)|polysaccharide binding (GO:0030247)|RNA binding (GO:0003723)|scavenger receptor activity (GO:0005044)|serine-type peptidase activity (GO:0008236)			autonomic_ganglia(1)|endometrium(2)|large_intestine(4)|lung(2)|ovary(3)|pancreas(1)|stomach(1)	14						CAATACCAGGGAGATGCAGGC	0.572																																						dbGAP											0													87.0	76.0	80.0					12																	48119180		2203	4300	6503	-	-	-	SO:0001583	missense	0			M32402	CCDS8754.1, CCDS53784.1, CCDS53785.1	12q13.1	2011-08-31			ENSG00000111405	ENSG00000111405		"""Serine peptidases / Serine peptidases"""	14369	protein-coding gene	gene with protein product		606720				2350438, 1710108, 15755742, 18936097	Standard	NM_006025		Approved	PP11, P11, PRSS26	uc001rpu.2	P21128	OTTHUMG00000169670	ENST00000422538.3:c.17C>T	12.37:g.48119180G>A	ENSP00000397679:p.Ser6Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBJ3|B3KQS7|B7Z6E1|Q2NKJ4	Missense_Mutation	SNP	pfam_Endoribonuclease_XendoU,pfam_Somatomedin_B_dom,smart_Somatomedin_B_dom,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.S6F	ENST00000422538.3	37	c.17	CCDS53785.1	12	.	.	.	.	.	.	.	.	.	.	G	9.451	1.090700	0.20471	.	.	ENSG00000111405	ENST00000229003;ENST00000422538;ENST00000545824	T;T	0.42900	0.96;1.47	6.04	4.02	0.46733	.	1.076220	0.07123	N	0.844225	T	0.25382	0.0617	N	0.08118	0	0.19575	N	0.999961	B;B;B	0.18863	0.019;0.031;0.014	B;B;B	0.21151	0.032;0.033;0.029	T	0.15292	-1.0442	10	0.87932	D	0	-12.6871	5.9293	0.19130	0.2499:0.0:0.7501:0.0	.	6;6;6	P21128-3;P21128;P21128-2	.;ENDOU_HUMAN;.	F	6	ENSP00000229003:S6F;ENSP00000397679:S6F	ENSP00000229003:S6F	S	-	2	0	ENDOU	46405447	0.999000	0.42202	0.103000	0.21229	0.247000	0.25773	1.979000	0.40608	1.574000	0.49760	0.563000	0.77884	TCC	ENDOU	-	NULL	ENSG00000111405		0.572	ENDOU-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ENDOU	HGNC	protein_coding	OTTHUMT00000405352.1	69	0.00	0	G	NM_006025.2		48119180	48119180	-1	no_errors	ENST00000229003	ensembl	human	known	69_37n	missense	55	14.06	9	SNP	0.034	A
EPG5	57724	genome.wustl.edu	37	18	43490681	43490681	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr18:43490681C>T	ENST00000282041.5	-	23	4044	c.4010G>A	c.(4009-4011)aGa>aAa	p.R1337K	EPG5_ENST00000585906.1_5'UTR	NM_020964.2	NP_066015.2	Q9HCE0	EPG5_HUMAN	ectopic P-granules autophagy protein 5 homolog (C. elegans)	1337					autophagic vacuole maturation (GO:0097352)|autophagy (GO:0006914)|endocytic recycling (GO:0032456)					NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(22)|lung(35)|ovary(2)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	95						AAAAAACCTTCTTCCAATACA	0.398											OREG0024952	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													72.0	69.0	70.0					18																	43490681		1871	4108	5979	-	-	-	SO:0001583	missense	0			AK023817	CCDS11926.2	18q12.3	2011-03-02	2011-03-02	2011-03-02	ENSG00000152223	ENSG00000152223			29331	protein-coding gene	gene with protein product		615068	"""KIAA1632"""	KIAA1632		10997877, 20550938	Standard	XM_005258323		Approved	hEPG5	uc002lbm.3	Q9HCE0	OTTHUMG00000132626	ENST00000282041.5:c.4010G>A	18.37:g.43490681C>T	ENSP00000282041:p.Arg1337Lys	Somatic	916	WXS	Illumina GAIIx	Phase_IV	A2BDF3|Q9H8C8	Missense_Mutation	SNP	NULL	p.R1337K	ENST00000282041.5	37	c.4010	CCDS11926.2	18	.	.	.	.	.	.	.	.	.	.	C	16.12	3.033618	0.54896	.	.	ENSG00000152223	ENST00000282041;ENST00000308403	D	0.89681	-2.55	5.22	5.22	0.72569	.	0.093468	0.40728	N	0.001031	T	0.81479	0.4831	L	0.34521	1.04	0.48571	D	0.999679	B;B	0.26081	0.141;0.141	B;B	0.22753	0.041;0.041	T	0.76705	-0.2861	10	0.31617	T	0.26	-14.8147	9.5168	0.39111	0.0:0.8431:0.0:0.1569	.	1337;1337	Q9HCE0-2;Q9HCE0	.;EPG5_HUMAN	K	1337;212	ENSP00000282041:R1337K	ENSP00000282041:R1337K	R	-	2	0	EPG5	41744679	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.926000	0.40084	2.443000	0.82685	0.655000	0.94253	AGA	EPG5	-	NULL	ENSG00000152223		0.398	EPG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPG5	HGNC	protein_coding	OTTHUMT00000445081.1	30	0.00	0	C	NM_020964		43490681	43490681	-1	no_errors	ENST00000282041	ensembl	human	known	69_37n	missense	24	25.00	8	SNP	1.000	T
EPHB1	2047	genome.wustl.edu	37	3	134851668	134851668	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:134851668C>T	ENST00000398015.3	+	5	1444	c.1074C>T	c.(1072-1074)atC>atT	p.I358I	EPHB1_ENST00000493838.1_5'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	358	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CCTACAACATCATCTGCAAAA	0.592																																						dbGAP											0													47.0	52.0	50.0					3																	134851668		2173	4269	6442	-	-	-	SO:0001819	synonymous_variant	0			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.1074C>T	3.37:g.134851668C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Silent	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.I358	ENST00000398015.3	37	c.1074	CCDS46921.1	3																																																																																			EPHB1	-	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000154928		0.592	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	27	0.00	0	C	NM_004441		134851668	134851668	+1	no_errors	ENST00000398015	ensembl	human	known	69_37n	silent	21	25.00	7	SNP	0.999	T
EVC2	132884	genome.wustl.edu	37	4	5642323	5642323	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:5642323C>G	ENST00000344408.5	-	10	1441	c.1388G>C	c.(1387-1389)aGa>aCa	p.R463T	EVC2_ENST00000310917.2_Missense_Mutation_p.R383T|EVC2_ENST00000344938.1_Missense_Mutation_p.R463T	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	463					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						CATCTTCTTTCTTGTTTCCAG	0.443																																						dbGAP											0													391.0	344.0	360.0					4																	5642323		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.1388G>C	4.37:g.5642323C>G	ENSP00000342144:p.Arg463Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Missense_Mutation	SNP	pfam_EVC2-like	p.R463T	ENST00000344408.5	37	c.1388	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	C	17.66	3.444843	0.63178	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	D;D;D	0.81996	-1.56;-1.56;-1.56	4.11	3.26	0.37387	.	0.215635	0.39146	N	0.001444	D	0.87565	0.6209	M	0.74258	2.255	0.36996	D	0.895016	D	0.61080	0.989	P	0.58780	0.845	D	0.88642	0.3176	10	0.46703	T	0.11	-6.0876	11.4882	0.50367	0.0:0.9094:0.0:0.0906	.	463	Q86UK5	LBN_HUMAN	T	463;383;463	ENSP00000339954:R463T;ENSP00000311683:R383T;ENSP00000342144:R463T	ENSP00000311683:R383T	R	-	2	0	EVC2	5693224	0.215000	0.23574	0.654000	0.29608	0.812000	0.45895	1.626000	0.37039	0.819000	0.34492	0.591000	0.81541	AGA	EVC2	-	pfam_EVC2-like	ENSG00000173040		0.443	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	88	0.00	0	C	NM_147127		5642323	5642323	-1	no_errors	ENST00000344408	ensembl	human	known	69_37n	missense	120	18.37	27	SNP	0.994	G
F8	2157	genome.wustl.edu	37	X	154065914	154065914	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:154065914C>G	ENST00000360256.4	-	26	7214	c.7014G>C	c.(7012-7014)ctG>ctC	p.L2338L	SMIM9_ENST00000478043.1_5'Flank|F8_ENST00000330287.6_Silent_p.L203L	NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	2338	F5/8 type C 2. {ECO:0000255|PROSITE- ProRule:PRU00081}.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	CCTCCATCCTCAGGGCAATCT	0.592																																						dbGAP											0													72.0	54.0	60.0					X																	154065914		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.7014G>C	X.37:g.154065914C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.L2338	ENST00000360256.4	37	c.7014	CCDS35457.1	X																																																																																			F8	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	ENSG00000185010		0.592	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	67	0.00	0	C			154065914	154065914	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	silent	37	26.00	13	SNP	1.000	G
FADS1	3992	genome.wustl.edu	37	11	61578478	61578478	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:61578478G>C	ENST00000350997.7	-	4	986	c.754C>G	c.(754-756)Ctg>Gtg	p.L252V	FADS2_ENST00000574708.1_Intron|FADS1_ENST00000542506.1_Missense_Mutation_p.L111V|FADS1_ENST00000433932.1_Missense_Mutation_p.L111V	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	195					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	TGATGTAGCAGATGGTTCCAC	0.547																																						dbGAP											0													73.0	80.0	78.0					11																	61578478		2049	4209	6258	-	-	-	SO:0001583	missense	0				CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.754C>G	11.37:g.61578478G>C	ENSP00000322229:p.Leu252Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5,superfamily_Cyt_B5,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5,prints_Cyt_B5	p.L252V	ENST00000350997.7	37	c.754	CCDS8011.2	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.314|1.314	-0.601439|-0.601439	0.03744|0.03744	.|.	.|.	ENSG00000149485|ENSG00000149485	ENST00000491310|ENST00000543488;ENST00000350997;ENST00000412725;ENST00000433932;ENST00000542506;ENST00000540767;ENST00000545245;ENST00000545405;ENST00000421879;ENST00000544696	.|T;T;T;T;T;T;T;T	.|0.50813	.|2.32;2.32;2.32;2.32;2.32;2.32;2.32;0.73	5.04|5.04	0.983|0.983	0.19767|0.19767	.|Fatty acid desaturase, type 1 (1);	.|0.849555	.|0.09509	.|N	.|0.792529	T|T	0.28764|0.28764	0.0713|0.0713	N|N	0.21448|0.21448	0.665|0.665	0.23293|0.23293	N|N	0.997967|0.997967	.|B	.|0.13594	.|0.008	.|B	.|0.19148	.|0.024	T|T	0.25537|0.25537	-1.0129|-1.0129	5|10	.|0.19590	.|T	.|0.45	-13.2252|-13.2252	4.647|4.647	0.12577|0.12577	0.4503:0.1577:0.3919:0.0|0.4503:0.1577:0.3919:0.0	.|.	.|195	.|O60427	.|FADS1_HUMAN	M|V	164|128;252;111;111;111;111;111;111;111;111	.|ENSP00000322229:L252V;ENSP00000405087:L111V;ENSP00000441403:L111V;ENSP00000441871:L111V;ENSP00000442170:L111V;ENSP00000440652:L111V;ENSP00000416043:L111V;ENSP00000443037:L111V	.|ENSP00000322229:L252V	I|L	-|-	3|1	3|2	FADS1|FADS1	61335054|61335054	0.970000|0.970000	0.33590|0.33590	0.910000|0.910000	0.35882|0.35882	0.025000|0.025000	0.11179|0.11179	0.391000|0.391000	0.20784|0.20784	0.256000|0.256000	0.21614|0.21614	-0.300000|-0.300000	0.09419|0.09419	ATC|CTG	FADS1	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase	ENSG00000149485		0.547	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	HGNC	protein_coding	OTTHUMT00000347648.2	37	0.00	0	G	NM_013402		61578478	61578478	-1	no_errors	ENST00000350997	ensembl	human	known	69_37n	missense	29	25.64	10	SNP	0.858	C
FAM13B	51306	genome.wustl.edu	37	5	137342812	137342812	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:137342812C>G	ENST00000033079.3	-	7	1166	c.715G>C	c.(715-717)Gag>Cag	p.E239Q	FAM13B_ENST00000425075.2_Missense_Mutation_p.E121Q|FAM13B_ENST00000420893.2_Missense_Mutation_p.E239Q	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	239	Glu-rich.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						TCATCTTCCTCTTCTTCCTCA	0.323																																						dbGAP											0													110.0	97.0	101.0					5																	137342812		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.715G>C	5.37:g.137342812C>G	ENSP00000033079:p.Glu239Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E239Q	ENST00000033079.3	37	c.715	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	C	15.65	2.895125	0.52121	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.24723	2.99;1.84;3.0	5.39	4.53	0.55603	.	0.117112	0.56097	D	0.000023	T	0.35913	0.0948	L	0.38531	1.155	0.22684	N	0.99886	D;B;D	0.71674	0.998;0.241;0.997	D;B;D	0.80764	0.994;0.136;0.986	T	0.18493	-1.0335	10	0.13470	T	0.59	-9.5328	12.3742	0.55271	0.0:0.9214:0.0:0.0786	.	121;239;239	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	Q	239;121;239	ENSP00000033079:E239Q;ENSP00000394669:E121Q;ENSP00000388521:E239Q	ENSP00000033079:E239Q	E	-	1	0	FAM13B	137370711	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.623000	0.61247	1.280000	0.44463	0.536000	0.68110	GAG	FAM13B	-	NULL	ENSG00000031003		0.323	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	98	0.00	0	C			137342812	137342812	-1	no_errors	ENST00000033079	ensembl	human	known	69_37n	missense	116	12.78	17	SNP	1.000	G
FAM13C	220965	genome.wustl.edu	37	10	61029684	61029684	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:61029684G>A	ENST00000373868.2	-	7	865	c.778C>T	c.(778-780)Cca>Tca	p.P260S	FAM13C_ENST00000422313.2_Missense_Mutation_p.P260S|FAM13C_ENST00000468840.2_Missense_Mutation_p.P177S|FAM13C_ENST00000277705.6_Missense_Mutation_p.P281S|FAM13C_ENST00000373867.3_Missense_Mutation_p.P177S|FAM13C_ENST00000435852.2_Missense_Mutation_p.P260S|FAM13C_ENST00000442566.3_Missense_Mutation_p.P281S|FAM13C_ENST00000419214.2_Missense_Mutation_p.P260S	NM_198215.3	NP_937858.2	Q8NE31	FA13C_HUMAN	family with sequence similarity 13, member C	260										NS(1)|breast(2)|endometrium(3)|kidney(2)|large_intestine(8)|lung(19)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GTGCTGGGTGGAGATGGGGCT	0.428																																						dbGAP											0													76.0	70.0	72.0					10																	61029684		2203	4300	6503	-	-	-	SO:0001583	missense	0			U79304	CCDS31207.1, CCDS44406.1, CCDS7255.1, CCDS53538.1	10q21	2009-09-15	2009-01-20	2009-01-20	ENSG00000148541	ENSG00000148541			19371	protein-coding gene	gene with protein product			"""family with sequence similarity 13, member C1"""	FAM13C1			Standard	NM_001001971		Approved		uc001jkn.3	Q8NE31	OTTHUMG00000018277	ENST00000373868.2:c.778C>T	10.37:g.61029684G>A	ENSP00000362975:p.Pro260Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZB77|Q5T631|Q6P2M3|Q99787	Missense_Mutation	SNP	NULL	p.P260S	ENST00000373868.2	37	c.778	CCDS7255.1	10	.	.	.	.	.	.	.	.	.	.	G	18.51	3.639117	0.67244	.	.	ENSG00000148541	ENST00000373867;ENST00000373868;ENST00000442566;ENST00000277705;ENST00000419214;ENST00000468840;ENST00000435852;ENST00000422313;ENST00000468696	T;T;T;T;T;T;T;T;T	0.75477	-0.94;-0.94;-0.94;-0.94;0.47;-0.94;-0.94;-0.94;-0.94	5.64	5.64	0.86602	.	0.000000	0.64402	D	0.000001	D	0.82641	0.5081	L	0.45422	1.42	0.53688	D	0.99997	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	0.999;1.0;1.0;0.999;0.999	T	0.80279	-0.1449	10	0.36615	T	0.2	-11.3484	19.7156	0.96119	0.0:0.0:1.0:0.0	.	260;177;260;260;260	B7Z2K3;B7ZB77;Q8NE31-2;Q8NE31-3;Q8NE31	.;.;.;.;FA13C_HUMAN	S	177;260;281;281;260;177;260;260;38	ENSP00000362974:P177S;ENSP00000362975:P260S;ENSP00000395661:P281S;ENSP00000277705:P281S;ENSP00000391993:P260S;ENSP00000423896:P177S;ENSP00000392302:P260S;ENSP00000400241:P260S;ENSP00000445068:P38S	ENSP00000277705:P281S	P	-	1	0	FAM13C	60699690	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.139000	0.77314	2.658000	0.90341	0.655000	0.94253	CCA	FAM13C	-	NULL	ENSG00000148541		0.428	FAM13C-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM13C	HGNC	protein_coding	OTTHUMT00000048162.2	62	0.00	0	G			61029684	61029684	-1	no_errors	ENST00000373868	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	A
FAM178A	55719	genome.wustl.edu	37	10	102676867	102676867	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:102676867C>T	ENST00000238961.4	+	3	1267	c.725C>T	c.(724-726)tCt>tTt	p.S242F	FAM178A_ENST00000370269.3_Missense_Mutation_p.S242F|FAM178A_ENST00000370271.3_Missense_Mutation_p.S242F	NM_018121.3	NP_060591.3	Q8IX21	F178A_HUMAN	family with sequence similarity 178, member A	242						chromatin (GO:0000785)|extracellular space (GO:0005615)|nucleus (GO:0005634)											TCACTAGCTTCTTACTGCAGA	0.478																																						dbGAP											0													61.0	63.0	62.0					10																	102676867		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF460991	CCDS7500.1, CCDS44470.1, CCDS65918.1	10q24.31	2008-07-18	2008-07-18	2008-07-18	ENSG00000119906	ENSG00000119906			17814	protein-coding gene	gene with protein product		610348	"""chromosome 10 open reading frame 6"""	C10orf6		12459258	Standard	NM_018121		Approved	FLJ10512, FLJ25012	uc001krs.3	Q8IX21	OTTHUMG00000018919	ENST00000238961.4:c.725C>T	10.37:g.102676867C>T	ENSP00000238961:p.Ser242Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K950|B1AL17|Q5W0L8|Q6GMU6|Q9NPE8	Missense_Mutation	SNP	NULL	p.S242F	ENST00000238961.4	37	c.725	CCDS7500.1	10	.	.	.	.	.	.	.	.	.	.	C	17.61	3.431407	0.62844	.	.	ENSG00000119906	ENST00000370271;ENST00000238961;ENST00000370269	T;T;T	0.56275	0.47;1.13;1.12	5.8	3.93	0.45458	.	0.257363	0.28388	N	0.015529	T	0.55000	0.1893	N	0.24115	0.695	0.35819	D	0.824484	B;B;D	0.76494	0.024;0.024;0.999	B;B;D	0.83275	0.025;0.025;0.996	T	0.64989	-0.6277	10	0.87932	D	0	-4.5688	7.9072	0.29769	0.1616:0.7571:0.0:0.0814	.	242;242;242	Q8IX21;B1AL17;B1AL16	F178A_HUMAN;.;.	F	242	ENSP00000359294:S242F;ENSP00000238961:S242F;ENSP00000359292:S242F	ENSP00000238961:S242F	S	+	2	0	FAM178A	102666857	0.982000	0.34865	1.000000	0.80357	0.923000	0.55619	1.505000	0.35736	1.437000	0.47472	-0.188000	0.12872	TCT	FAM178A	-	NULL	ENSG00000119906		0.478	FAM178A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM178A	HGNC	protein_coding	OTTHUMT00000049897.3	33	0.00	0	C			102676867	102676867	+1	no_errors	ENST00000370269	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	0.996	T
FAM26E	254228	genome.wustl.edu	37	6	116832997	116832997	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:116832997G>C	ENST00000368599.3	+	1	189	c.138G>C	c.(136-138)gaG>gaC	p.E46D	TRAPPC3L_ENST00000356128.4_Intron|TRAPPC3L_ENST00000368602.3_Intron	NM_153711.2	NP_714922.1	Q8N5C1	FA26E_HUMAN	family with sequence similarity 26, member E	46					ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)	7		all_cancers(87;0.0608)|all_epithelial(87;0.05)|Colorectal(196;0.234)		GBM - Glioblastoma multiforme(226;0.0242)|all cancers(137;0.0419)|OV - Ovarian serous cystadenocarcinoma(136;0.0671)|Epithelial(106;0.212)		GCAGCACTGAGAATATGACCT	0.488																																						dbGAP											0													132.0	127.0	129.0					6																	116832997		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC032556	CCDS5108.1	6q22.31	2008-02-05	2007-03-19	2007-03-19	ENSG00000178033	ENSG00000178033			21568	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 188"""	C6orf188			Standard	NM_153711		Approved	dJ493F7.3, MGC45451	uc003pwy.3	Q8N5C1	OTTHUMG00000015442	ENST00000368599.3:c.138G>C	6.37:g.116832997G>C	ENSP00000357588:p.Glu46Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDJ9|B3KSR3	Missense_Mutation	SNP	NULL	p.E46D	ENST00000368599.3	37	c.138	CCDS5108.1	6	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680138	0.29783	.	.	ENSG00000178033	ENST00000368599	T	0.18016	2.24	5.5	2.58	0.30949	.	0.151595	0.64402	D	0.000011	T	0.06050	0.0157	L	0.57536	1.79	0.41436	D	0.987898	P	0.34587	0.458	B	0.31869	0.137	T	0.13229	-1.0517	10	0.35671	T	0.21	-13.4539	3.684	0.08321	0.2544:0.2017:0.5439:0.0	.	46	Q8N5C1	FA26E_HUMAN	D	46	ENSP00000357588:E46D	ENSP00000357588:E46D	E	+	3	2	FAM26E	116939690	1.000000	0.71417	0.994000	0.49952	0.979000	0.70002	2.198000	0.42705	1.453000	0.47775	0.561000	0.74099	GAG	FAM26E	-	NULL	ENSG00000178033		0.488	FAM26E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM26E	HGNC	protein_coding	OTTHUMT00000041956.1	52	0.00	0	G	NM_153711		116832997	116832997	+1	no_errors	ENST00000368599	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	1.000	C
FAT2	2196	genome.wustl.edu	37	5	150945893	150945893	+	Missense_Mutation	SNP	G	G	A	rs145872989		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:150945893G>A	ENST00000261800.5	-	1	2612	c.2600C>T	c.(2599-2601)tCc>tTc	p.S867F		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	867	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGGTGGAGGGAGAACTTCTC	0.552																																						dbGAP											0													104.0	99.0	101.0					5																	150945893		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.2600C>T	5.37:g.150945893G>A	ENSP00000261800:p.Ser867Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S867F	ENST00000261800.5	37	c.2600	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	G	15.68	2.904121	0.52333	.	.	ENSG00000086570	ENST00000261800	T	0.54279	0.58	5.67	5.67	0.87782	Cadherin (4);Cadherin-like (1);	0.091750	0.48767	D	0.000175	T	0.72366	0.3451	M	0.72479	2.2	0.34725	D	0.729099	D	0.69078	0.997	D	0.67103	0.949	T	0.78445	-0.2201	10	0.54805	T	0.06	.	19.7824	0.96422	0.0:0.0:1.0:0.0	.	867	Q9NYQ8	FAT2_HUMAN	F	867	ENSP00000261800:S867F	ENSP00000261800:S867F	S	-	2	0	FAT2	150926086	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.631000	0.46502	2.677000	0.91161	0.561000	0.74099	TCC	FAT2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.552	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	45	0.00	0	G	NM_001447		150945893	150945893	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	missense	60	11.76	8	SNP	0.997	A
FAT2	2196	genome.wustl.edu	37	5	150946822	150946822	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:150946822C>G	ENST00000261800.5	-	1	1683	c.1671G>C	c.(1669-1671)ttG>ttC	p.L557F		NM_001447.2	NP_001438.1	Q9NYQ8	FAT2_HUMAN	FAT atypical cadherin 2	557	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				epithelial cell migration (GO:0010631)|homophilic cell adhesion (GO:0007156)	cell-cell adherens junction (GO:0005913)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(6)|breast(3)|central_nervous_system(3)|cervix(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(61)|liver(1)|lung(60)|ovary(6)|prostate(5)|skin(5)|stomach(2)|upper_aerodigestive_tract(11)|urinary_tract(1)	196		Medulloblastoma(196;0.0912)|all_hematologic(541;0.104)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GGTTGTCATTCAAGTTCCTGA	0.458																																						dbGAP											0													63.0	71.0	68.0					5																	150946822		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF231022	CCDS4317.1	5q33.1	2014-07-21	2013-05-31		ENSG00000086570	ENSG00000086570		"""Cadherins / Cadherin-related"""	3596	protein-coding gene	gene with protein product	"""cadherin-related family member 9"""	604269	"""FAT tumor suppressor (Drosophila) homolog 2"", ""FAT tumor suppressor homolog 2 (Drosophila)"""			9693030	Standard	NM_001447		Approved	MEGF1, CDHF8, HFAT2, CDHR9	uc003lue.4	Q9NYQ8	OTTHUMG00000130126	ENST00000261800.5:c.1671G>C	5.37:g.150946822C>G	ENSP00000261800:p.Leu557Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75091|Q9NSR7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,superfamily_Cadherin-like,superfamily_ConA-like_lec_gl,smart_Cadherin,smart_Laminin_G,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.L557F	ENST00000261800.5	37	c.1671	CCDS4317.1	5	.	.	.	.	.	.	.	.	.	.	C	15.09	2.729793	0.48833	.	.	ENSG00000086570	ENST00000261800	T	0.40225	1.04	5.22	1.88	0.25563	Cadherin (3);Cadherin-like (1);	0.150532	0.30028	N	0.010581	T	0.44393	0.1291	L	0.53729	1.69	0.38159	D	0.938979	D	0.60575	0.988	P	0.51657	0.676	T	0.46470	-0.9189	10	0.56958	D	0.05	.	8.3083	0.32055	0.0:0.4668:0.4032:0.13	.	557	Q9NYQ8	FAT2_HUMAN	F	557	ENSP00000261800:L557F	ENSP00000261800:L557F	L	-	3	2	FAT2	150927015	0.965000	0.33210	0.965000	0.40720	0.986000	0.74619	0.003000	0.13083	0.478000	0.27488	0.655000	0.94253	TTG	FAT2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000086570		0.458	FAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT2	HGNC	protein_coding	OTTHUMT00000252434.1	25	0.00	0	C	NM_001447		150946822	150946822	-1	no_errors	ENST00000261800	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.992	G
FBXO22	26263	genome.wustl.edu	37	15	76225245	76225245	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:76225245G>C	ENST00000308275.3	+	7	1119	c.1014G>C	c.(1012-1014)ggG>ggC	p.G338G	FBXO22_ENST00000540507.1_Silent_p.G234G	NM_147188.2	NP_671717.1	Q8NEZ5	FBX22_HUMAN	F-box protein 22	338					cellular protein modification process (GO:0006464)|cellular response to starvation (GO:0009267)|nucleocytoplasmic transport (GO:0006913)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein polyubiquitination (GO:0000209)|regulation of skeletal muscle fiber development (GO:0048742)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ubiquitin-protein transferase activity (GO:0004842)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GAGCCAAGGGGAATGTTGAGG	0.468																																						dbGAP											0													231.0	218.0	223.0					15																	76225245		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			AF174602	CCDS10287.1, CCDS45310.1	15q23	2008-10-03	2004-06-15		ENSG00000167196	ENSG00000167196		"""F-boxes /  ""other"""""	13593	protein-coding gene	gene with protein product	"""FIST domain containing 1"""	609096	"""F-box only protein 22"""			10531035, 10531037, 17855421	Standard	NM_147188		Approved	FBX22, FISTC1	uc002bbk.3	Q8NEZ5	OTTHUMG00000142841	ENST00000308275.3:c.1014G>C	15.37:g.76225245G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0D2P8|Q6PIL5|Q8IXW3|Q9H824|Q9UKC0	Silent	SNP	pfam_FIST_C_domain,pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like	p.G338	ENST00000308275.3	37	c.1014	CCDS10287.1	15																																																																																			FBXO22	-	pfam_FIST_C_domain	ENSG00000167196		0.468	FBXO22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO22	HGNC	protein_coding	OTTHUMT00000286477.2	191	0.00	0	G	NM_147188		76225245	76225245	+1	no_errors	ENST00000308275	ensembl	human	known	69_37n	silent	120	18.92	28	SNP	0.003	C
FBXO33	254170	genome.wustl.edu	37	14	39870578	39870578	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:39870578C>T	ENST00000298097.7	-	3	1535	c.1198G>A	c.(1198-1200)Gat>Aat	p.D400N	FBXO33_ENST00000554190.1_Intron	NM_203301.3	NP_976046.1	Q7Z6M2	FBX33_HUMAN	F-box protein 33	400					protein ubiquitination (GO:0016567)					endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|urinary_tract(1)	9	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00121)|Epithelial(34;0.169)	GBM - Glioblastoma multiforme(112;0.0425)		ATATAGCTATCAAAATGAATC	0.353																																						dbGAP											0													104.0	99.0	100.0					14																	39870578		2203	4300	6503	-	-	-	SO:0001583	missense	0			BI460761	CCDS9677.1	14q13.3	2004-08-24	2004-06-15		ENSG00000165355	ENSG00000165355		"""F-boxes /  ""other"""""	19833	protein-coding gene	gene with protein product		609103	"""F-box only protein 33"""				Standard	NM_203301		Approved	Fbx33	uc001wvk.3	Q7Z6M2	OTTHUMG00000140257	ENST00000298097.7:c.1198G>A	14.37:g.39870578C>T	ENSP00000298097:p.Asp400Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PIR2|Q86TR2|Q86YE0	Missense_Mutation	SNP	pfam_F-box_dom_cyclin-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like	p.D400N	ENST00000298097.7	37	c.1198	CCDS9677.1	14	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003806	0.74932	.	.	ENSG00000165355	ENST00000298097	T	0.32988	1.43	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	T	0.52419	0.1733	L	0.51422	1.61	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.36016	-0.9765	9	.	.	.	-4.9373	19.9635	0.97259	0.0:1.0:0.0:0.0	.	400	Q7Z6M2	FBX33_HUMAN	N	400	ENSP00000298097:D400N	.	D	-	1	0	FBXO33	38940329	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.151000	0.77411	2.714000	0.92807	0.591000	0.81541	GAT	FBXO33	-	NULL	ENSG00000165355		0.353	FBXO33-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO33	HGNC	protein_coding	OTTHUMT00000276769.2	92	0.00	0	C			39870578	39870578	-1	no_errors	ENST00000298097	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	1.000	T
FBXW7	55294	genome.wustl.edu	37	4	153250865	153250865	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:153250865C>G	ENST00000281708.4	-	8	2424	c.1195G>C	c.(1195-1197)Gat>Cat	p.D399H	FBXW7_ENST00000603841.1_Missense_Mutation_p.D399H|FBXW7_ENST00000296555.5_Missense_Mutation_p.D281H|FBXW7_ENST00000393956.3_Missense_Mutation_p.D223H|FBXW7_ENST00000263981.5_Missense_Mutation_p.D319H|FBXW7_ENST00000603548.1_Missense_Mutation_p.D399H	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	399					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				GTGTTGTCATCAGAACCACTA	0.358			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																	dbGAP		Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	1	Unknown(1)	haematopoietic_and_lymphoid_tissue(1)											115.0	104.0	108.0					4																	153250865		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1195G>C	4.37:g.153250865C>G	ENSP00000281708:p.Asp399His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D399H	ENST00000281708.4	37	c.1195	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	25.3	4.626369	0.87560	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.61040	0.14;0.14;0.14;0.14	5.99	5.99	0.97316	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.75391	0.3843	L	0.58583	1.82	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.75241	-0.3387	10	0.87932	D	0	-21.8446	20.5373	0.99239	0.0:1.0:0.0:0.0	.	223;399;281;319	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	H	399;281;319;223	ENSP00000281708:D399H;ENSP00000296555:D281H;ENSP00000263981:D319H;ENSP00000377528:D223H	ENSP00000263981:D319H	D	-	1	0	FBXW7	153470315	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.815000	0.86186	2.857000	0.98124	0.650000	0.86243	GAT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000109670		0.358	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	60	0.00	0	C			153250865	153250865	-1	no_errors	ENST00000281708	ensembl	human	known	69_37n	missense	45	19.64	11	SNP	1.000	G
FCGBP	8857	genome.wustl.edu	37	19	40366143	40366143	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:40366143G>A	ENST00000221347.6	-	30	14098	c.14091C>T	c.(14089-14091)gaC>gaT	p.D4697D		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	4697						extracellular vesicular exosome (GO:0070062)		p.D4697D(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			CTTGGCAGGCGTCCAGCAAGC	0.716																																						dbGAP											1	Substitution - coding silent(1)	large_intestine(1)											17.0	24.0	22.0					19																	40366143		2096	4123	6219	-	-	-	SO:0001819	synonymous_variant	0			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.14091C>T	19.37:g.40366143G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,smart_VWF_C,smart_VWC_out	p.D4697	ENST00000221347.6	37	c.14091	CCDS12546.1	19																																																																																			FCGBP	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich	ENSG00000090920		0.716	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	29	0.00	0	G	NM_003890		40366143	40366143	-1	no_errors	ENST00000221347	ensembl	human	known	69_37n	silent	13	35.00	7	SNP	0.988	A
FGF17	8822	genome.wustl.edu	37	8	21903693	21903693	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:21903693G>C	ENST00000359441.3	+	3	644	c.141G>C	c.(139-141)ctG>ctC	p.L47L	FGF17_ENST00000521709.1_3'UTR|FGF17_ENST00000518533.1_Silent_p.L36L	NM_003867.2	NP_003858.1	O60258	FGF17_HUMAN	fibroblast growth factor 17	47					cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell proliferation (GO:0008284)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	growth factor activity (GO:0008083)|type 1 fibroblast growth factor receptor binding (GO:0005105)|type 2 fibroblast growth factor receptor binding (GO:0005111)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|skin(1)	8				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		CCGACCAGCTGAGCAGGCGGC	0.597																																						dbGAP											0													78.0	76.0	77.0					8																	21903693		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB009249	CCDS6019.1	8p21.3	2005-10-30			ENSG00000158815	ENSG00000158815			3673	protein-coding gene	gene with protein product		603725				9514906, 9751161	Standard	XM_005273675		Approved	FGF-13	uc003xag.3	O60258	OTTHUMG00000097051	ENST00000359441.3:c.141G>C	8.37:g.21903693G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZLG4|Q2M2W1	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	p.L47	ENST00000359441.3	37	c.141	CCDS6019.1	8																																																																																			FGF17	-	superfamily_Cytokine_IL1-like	ENSG00000158815		0.597	FGF17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF17	HGNC	protein_coding	OTTHUMT00000214154.2	21	0.00	0	G	NM_003867		21903693	21903693	+1	no_errors	ENST00000359441	ensembl	human	known	69_37n	silent	22	18.52	5	SNP	1.000	C
FGF5	2250	genome.wustl.edu	37	4	81196118	81196118	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:81196118C>T	ENST00000312465.7	+	2	637	c.411C>T	c.(409-411)ttC>ttT	p.F137F	FGF5_ENST00000456523.3_Intron|FGF5_ENST00000503413.1_3'UTR	NM_004464.3	NP_004455.2	P12034	FGF5_HUMAN	fibroblast growth factor 5	137					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell differentiation (GO:0010001)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|signal transduction involved in regulation of gene expression (GO:0023019)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	fibroblast growth factor receptor binding (GO:0005104)			breast(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	22						GAGGAGTTTTCAGCAACAAAT	0.333																																						dbGAP											0													91.0	93.0	93.0					4																	81196118		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M23534	CCDS3586.1, CCDS34021.1	4q21	2014-01-30			ENSG00000138675	ENSG00000138675		"""Endogenous ligands"""	3683	protein-coding gene	gene with protein product		165190				3211147, 2577873	Standard	NM_001291812		Approved		uc003hmd.3	P12034	OTTHUMG00000130288	ENST00000312465.7:c.411C>T	4.37:g.81196118C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R554|O75846|Q3Y8M3|Q8NF90	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_GF_heparin-bd,prints_IL1_HBGF	p.F137	ENST00000312465.7	37	c.411	CCDS34021.1	4																																																																																			FGF5	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,prints_IL1_HBGF	ENSG00000138675		0.333	FGF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF5	HGNC	protein_coding	OTTHUMT00000252627.2	97	0.00	0	C			81196118	81196118	+1	no_errors	ENST00000312465	ensembl	human	known	69_37n	silent	92	11.54	12	SNP	1.000	T
FIBCD1	84929	genome.wustl.edu	37	9	133779645	133779645	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:133779645C>G	ENST00000372338.4	-	7	1434	c.1192G>C	c.(1192-1194)Gag>Cag	p.E398Q	FIBCD1_ENST00000253018.4_Intron|FIBCD1_ENST00000448616.1_Missense_Mutation_p.E398Q|FIBCD1_ENST00000372337.2_Missense_Mutation_p.E240Q	NM_032843.4	NP_116232.3	Q8N539	FBCD1_HUMAN	fibrinogen C domain containing 1	398	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.					integral component of membrane (GO:0016021)|membrane (GO:0016020)	chitin binding (GO:0008061)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(2)|prostate(5)|urinary_tract(1)	12	all_hematologic(7;0.0028)			OV - Ovarian serous cystadenocarcinoma(145;3.52e-05)|Epithelial(140;0.00019)		CAGTTGTTCTCTGAATGGTCG	0.642																																						dbGAP											0													176.0	142.0	153.0					9																	133779645		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027716	CCDS6937.1	9q34.2	2013-02-06			ENSG00000130720	ENSG00000130720		"""Fibrinogen C domain containing"""	25922	protein-coding gene	gene with protein product		613357				12975309	Standard	NM_001145106		Approved	FLJ14810	uc004bzz.3	Q8N539	OTTHUMG00000020814	ENST00000372338.4:c.1192G>C	9.37:g.133779645C>G	ENSP00000361413:p.Glu398Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A3KFK0|Q6UXK6|Q96SJ7	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.E398Q	ENST00000372338.4	37	c.1192	CCDS6937.1	9	.	.	.	.	.	.	.	.	.	.	C	20.8	4.045634	0.75846	.	.	ENSG00000130720	ENST00000448616;ENST00000372338;ENST00000372337	T;T;T	0.76968	-1.06;-1.06;-1.06	4.64	3.71	0.42584	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);Fibrinogen, alpha/beta/gamma chain, C-terminal globular, subdomain 2 (1);	0.102148	0.64402	D	0.000003	T	0.71484	0.3345	L	0.31752	0.955	0.54753	D	0.999984	P	0.41498	0.752	P	0.47705	0.555	T	0.64668	-0.6353	10	0.17832	T	0.49	.	12.4314	0.55575	0.1695:0.8305:0.0:0.0	.	398	Q8N539	FBCD1_HUMAN	Q	398;398;240	ENSP00000414501:E398Q;ENSP00000361413:E398Q;ENSP00000361412:E240Q	ENSP00000361412:E240Q	E	-	1	0	FIBCD1	132769466	1.000000	0.71417	0.990000	0.47175	0.713000	0.41058	7.776000	0.85560	0.887000	0.36136	0.555000	0.69702	GAG	FIBCD1	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000130720		0.642	FIBCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIBCD1	HGNC	protein_coding	OTTHUMT00000054687.2	43	0.00	0	C	NM_032843		133779645	133779645	-1	no_errors	ENST00000372338	ensembl	human	known	69_37n	missense	21	34.38	11	SNP	1.000	G
FIBP	9158	genome.wustl.edu	37	11	65651446	65651446	+	Nonstop_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:65651446C>G	ENST00000338369.2	-	10	1206	c.1094G>C	c.(1093-1095)tGa>tCa	p.*365S	FIBP_ENST00000357519.4_Nonstop_Mutation_p.*358S|FIBP_ENST00000426652.2_5'Flank|FIBP_ENST00000533045.1_3'UTR	NM_198897.1	NP_942600.1	O43427	FIBP_HUMAN	fibroblast growth factor (acidic) intracellular binding protein	0					fibroblast growth factor receptor signaling pathway (GO:0008543)|platelet aggregation (GO:0070527)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)			endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|urinary_tract(1)	10				READ - Rectum adenocarcinoma(159;0.166)		GGAGGCACCTCAGTCATGATA	0.602											OREG0021089	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													66.0	60.0	62.0					11																	65651446		2200	4296	6496	-	-	-	SO:0001578	stop_lost	0			AF010187	CCDS8118.1, CCDS8119.1	11q13.1	2006-06-15			ENSG00000172500	ENSG00000172500			3705	protein-coding gene	gene with protein product		608296				9806903	Standard	NM_004214		Approved	FGFIBP	uc001ogd.3	O43427	OTTHUMG00000166846	ENST00000338369.2:c.1094G>C	11.37:g.65651446C>G		Somatic	1085	WXS	Illumina GAIIx	Phase_IV	A8K0J7|Q27Q85|Q6IBQ3|Q9HD65	Nonstop_Mutation	SNP	pfam_FIBP	p.*365S	ENST00000338369.2	37	c.1094	CCDS8119.1	11	.	.	.	.	.	.	.	.	.	.	C	21.2	4.117851	0.77323	.	.	ENSG00000172500	ENST00000338369;ENST00000357519	.	.	.	4.83	-0.25	0.13007	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5815	0.33632	0.0:0.5882:0.0:0.4118	.	.	.	.	S	365;358	.	.	X	-	2	2	FIBP	65408022	1.000000	0.71417	0.742000	0.31022	0.912000	0.54170	0.960000	0.29253	-0.259000	0.09432	0.555000	0.69702	TGA	FIBP	-	NULL	ENSG00000172500		0.602	FIBP-001	KNOWN	basic|CCDS	protein_coding	FIBP	HGNC	protein_coding	OTTHUMT00000391575.2	27	0.00	0	C	NM_198897		65651446	65651446	-1	no_errors	ENST00000338369	ensembl	human	known	69_37n	nonstop	26	21.21	7	SNP	0.998	G
FLNA	2316	genome.wustl.edu	37	X	153590634	153590634	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:153590634C>T	ENST00000369850.3	-	18	2868	c.2632G>A	c.(2632-2634)Gag>Aag	p.E878K	FLNA_ENST00000422373.1_Missense_Mutation_p.E878K|FLNA_ENST00000360319.4_Missense_Mutation_p.E878K|FLNA_ENST00000344736.4_Missense_Mutation_p.E878K	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	878					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAGGGCCCTCGGCCTTCACC	0.652																																						dbGAP											0													66.0	69.0	68.0					X																	153590634		2075	4181	6256	-	-	-	SO:0001583	missense	0			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.2632G>A	X.37:g.153590634C>T	ENSP00000358866:p.Glu878Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E878K	ENST00000369850.3	37	c.2632	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	25.8	4.679311	0.88542	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.84730	-1.89;-1.89;-1.89;-1.89	4.91	4.91	0.64330	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.070934	0.53938	D	0.000056	D	0.90484	0.7019	L	0.53617	1.68	0.80722	D	1	P;D	0.76494	0.928;0.999	B;D	0.73708	0.38;0.981	D	0.91378	0.5125	10	0.62326	D	0.03	.	17.5374	0.87835	0.0:1.0:0.0:0.0	.	878;878	P21333-2;P21333	.;FLNA_HUMAN	K	878;851;878;878;878	ENSP00000353467:E878K;ENSP00000416926:E878K;ENSP00000358866:E878K;ENSP00000358863:E878K	ENSP00000358863:E878K	E	-	1	0	FLNA	153243828	1.000000	0.71417	0.900000	0.35374	0.922000	0.55478	7.715000	0.84713	2.156000	0.67533	0.529000	0.55759	GAG	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000196924		0.652	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	33	0.00	0	C			153590634	153590634	-1	no_errors	ENST00000369850	ensembl	human	known	69_37n	missense	27	30.77	12	SNP	1.000	T
FOXA1	3169	genome.wustl.edu	37	14	38061240	38061240	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:38061240G>A	ENST00000250448.2	-	2	810	c.749C>T	c.(748-750)tCc>tTc	p.S250F	FOXA1_ENST00000545425.2_5'UTR|FOXA1_ENST00000540786.1_Missense_Mutation_p.S217F	NM_004496.3	NP_004487.2	P55317	FOXA1_HUMAN	forkhead box A1	250					anatomical structure formation involved in morphogenesis (GO:0048646)|chromatin remodeling (GO:0006338)|dorsal/ventral neural tube patterning (GO:0021904)|epithelial cell maturation involved in prostate gland development (GO:0060743)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|epithelial-mesenchymal signaling involved in prostate gland development (GO:0060738)|glucose homeostasis (GO:0042593)|hormone metabolic process (GO:0042445)|lung epithelial cell differentiation (GO:0060487)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate specification (GO:0048665)|positive regulation of cell-cell adhesion mediated by cadherin (GO:2000049)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smoothened signaling pathway (GO:0045880)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prostate gland epithelium morphogenesis (GO:0060740)|prostate gland stromal morphogenesis (GO:0060741)|response to estradiol (GO:0032355)|secretory columnal luminar epithelial cell differentiation involved in prostate glandular acinus development (GO:0060528)	microvillus (GO:0005902)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(1)|large_intestine(2)|lung(3)|prostate(12)	19	Breast(36;0.0954)|Esophageal squamous(585;0.164)|Hepatocellular(127;0.213)		Lung(238;5.41e-07)|LUAD - Lung adenocarcinoma(48;2.48e-05)|Epithelial(34;0.0454)|LUSC - Lung squamous cell carcinoma(13;0.0917)|all cancers(34;0.0925)|BRCA - Breast invasive adenocarcinoma(188;0.239)	GBM - Glioblastoma multiforme(112;0.0222)		CATGTTGCCGGAGTCCGGGTG	0.677																																						dbGAP											0													29.0	28.0	29.0					14																	38061240		2203	4300	6503	-	-	-	SO:0001583	missense	0			U39840	CCDS9665.1	14q12-q13	2008-04-10		2002-09-20	ENSG00000129514	ENSG00000129514		"""Forkhead boxes"""	5021	protein-coding gene	gene with protein product		602294	"""hepatocyte nuclear factor 3, alpha"""	HNF3A		9119385, 8652662	Standard	NM_004496		Approved		uc001wuf.4	P55317	OTTHUMG00000140253	ENST00000250448.2:c.749C>T	14.37:g.38061240G>A	ENSP00000250448:p.Ser250Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9H6|B7ZAP5|Q9H2A0	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S250F	ENST00000250448.2	37	c.749	CCDS9665.1	14	.	.	.	.	.	.	.	.	.	.	G	24.0	4.480686	0.84747	.	.	ENSG00000129514	ENST00000250448;ENST00000540786	D;D	0.95788	-3.81;-3.81	3.88	3.88	0.44766	Winged helix-turn-helix transcription repressor DNA-binding (1);Transcription factor, fork head (3);	0.000000	0.85682	D	0.000000	D	0.96269	0.8783	L	0.42632	1.34	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96852	0.9626	10	0.87932	D	0	.	14.7467	0.69494	0.0:0.0:1.0:0.0	.	250	P55317	FOXA1_HUMAN	F	250;217	ENSP00000250448:S250F;ENSP00000440178:S217F	ENSP00000250448:S250F	S	-	2	0	FOXA1	37130991	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.596000	0.82721	1.996000	0.58369	0.400000	0.26472	TCC	FOXA1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000129514		0.677	FOXA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA1	HGNC	protein_coding	OTTHUMT00000276735.1	21	0.00	0	G			38061240	38061240	-1	no_errors	ENST00000250448	ensembl	human	known	69_37n	missense	8	38.46	5	SNP	1.000	A
FOXL1	2300	genome.wustl.edu	37	16	86612425	86612425	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:86612425C>T	ENST00000320241.3	+	1	311	c.96C>T	c.(94-96)ttC>ttT	p.F32F		NM_005250.2	NP_005241.1	Q12952	FOXL1_HUMAN	forkhead box L1	32					heart development (GO:0007507)|multicellular organismal development (GO:0007275)|organ morphogenesis (GO:0009887)|Peyer's patch morphogenesis (GO:0061146)|proteoglycan biosynthetic process (GO:0030166)|regulation of Wnt signaling pathway (GO:0030111)|transcription, DNA-templated (GO:0006351)|visceral mesoderm-endoderm interaction involved in midgut development (GO:0007495)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(5)|large_intestine(2)|lung(2)|prostate(3)|skin(1)|urinary_tract(1)	15						CTCTGGCCTTCGCCCCCGCGG	0.692																																					NSCLC(163;308 2020 10889 11476 18208)	dbGAP											0													28.0	34.0	32.0					16																	86612425		2198	4292	6490	-	-	-	SO:0001819	synonymous_variant	0			AF315075	CCDS10959.1	16q24	2014-07-15			ENSG00000176678	ENSG00000176678		"""Forkhead boxes"""	3817	protein-coding gene	gene with protein product		603252		FKHL11		7957066	Standard	NM_005250		Approved	FREAC7, FKH6	uc002fjr.3	Q12952	OTTHUMG00000137653	ENST00000320241.3:c.96C>T	16.37:g.86612425C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RR1|Q9H242	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.F32	ENST00000320241.3	37	c.96	CCDS10959.1	16																																																																																			FOXL1	-	NULL	ENSG00000176678		0.692	FOXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXL1	HGNC	protein_coding	OTTHUMT00000269105.2	22	0.00	0	C	NM_005250		86612425	86612425	+1	no_errors	ENST00000320241	ensembl	human	known	69_37n	silent	8	33.33	4	SNP	0.998	T
FRMD1	79981	genome.wustl.edu	37	6	168468077	168468077	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:168468077G>A	ENST00000283309.6	-	3	418	c.354C>T	c.(352-354)ttC>ttT	p.F118F	FRMD1_ENST00000537786.1_5'UTR|FRMD1_ENST00000440994.2_Silent_p.F50F|FRMD1_ENST00000432403.1_5'Flank	NM_024919.3	NP_079195.3	Q8N878	FRMD1_HUMAN	FERM domain containing 1	118	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.					cytoskeleton (GO:0005856)				endometrium(3)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|urinary_tract(1)	19		Breast(66;1.07e-05)|Ovarian(120;0.0728)		Epithelial(4;7.7e-30)|OV - Ovarian serous cystadenocarcinoma(33;5.82e-22)|BRCA - Breast invasive adenocarcinoma(4;1.38e-10)|GBM - Glioblastoma multiforme(31;0.000756)		AATCTTTTGAGAAGTACTTGC	0.478																																					GBM(50;8 1094 9538 34399)|Ovarian(80;676 1857 8675 49015)	dbGAP											0													91.0	108.0	103.0					6																	168468077		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5306.1, CCDS47518.1	6q27	2008-10-23			ENSG00000153303	ENSG00000153303			21240	protein-coding gene	gene with protein product							Standard	NM_001122841		Approved	FLJ00181, DKFZp434O0117, FLJ40260, FLJ22615, bA164L23.1	uc003qwo.4	Q8N878	OTTHUMG00000016037	ENST00000283309.6:c.354C>T	6.37:g.168468077G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV8|B3KUM6|Q5SZU7|Q9UFB0	Silent	SNP	pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.F118	ENST00000283309.6	37	c.354	CCDS5306.1	6																																																																																			FRMD1	-	pfam_FERM_N,smart_Band_41_domain,pfscan_FERM_domain	ENSG00000153303		0.478	FRMD1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD1	HGNC	protein_coding	OTTHUMT00000362513.2	45	0.00	0	G	NM_024919		168468077	168468077	-1	no_errors	ENST00000283309	ensembl	human	known	69_37n	silent	43	15.38	8	SNP	0.998	A
FST	10468	genome.wustl.edu	37	5	52778852	52778852	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:52778852C>T	ENST00000256759.3	+	2	611	c.228C>T	c.(226-228)ttC>ttT	p.F76F	FST_ENST00000396947.3_Silent_p.F76F	NM_013409.2	NP_037541.1	P19883	FST_HUMAN	follistatin	76	TB.				BMP signaling pathway (GO:0030509)|female gonad development (GO:0008585)|gamete generation (GO:0007276)|hair follicle morphogenesis (GO:0031069)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinocyte proliferation (GO:0043616)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of cell differentiation (GO:0045596)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|odontogenesis of dentin-containing tooth (GO:0042475)|pattern specification process (GO:0007389)|positive regulation of hair follicle development (GO:0051798)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)	activin binding (GO:0048185)|signal transducer activity (GO:0004871)			breast(1)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|urinary_tract(1)	15		Ovarian(174;1.78e-06)|Lung NSC(810;3.55e-06)|Breast(144;4.08e-05)				ACACACTCTTCAAGTGGATGA	0.577											OREG0016608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													73.0	73.0	73.0					5																	52778852		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M19481	CCDS3959.1, CCDS43315.1	5q11.2	2008-02-05			ENSG00000134363	ENSG00000134363			3971	protein-coding gene	gene with protein product		136470				10411917, 3380788	Standard	NM_006350		Approved	FS	uc003jpd.3	P19883	OTTHUMG00000131183	ENST00000256759.3:c.228C>T	5.37:g.52778852C>T		Somatic	987	WXS	Illumina GAIIx	Phase_IV	B5BU94|Q9BTH0	Silent	SNP	pfam_Kazal-type_dom,pfam_Prot_inh_Kazal,pfam_Follistatin/Osteonectin_EGF,superfamily_TB_dom,smart_Fol_N,smart_Prot_inh_Kazal	p.F76	ENST00000256759.3	37	c.228	CCDS3959.1	5																																																																																			FST	-	NULL	ENSG00000134363		0.577	FST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FST	HGNC	protein_coding	OTTHUMT00000253906.1	30	0.00	0	C	NM_013409		52778852	52778852	+1	no_errors	ENST00000256759	ensembl	human	known	69_37n	silent	32	21.95	9	SNP	1.000	T
FUT8	2530	genome.wustl.edu	37	14	66136187	66136187	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:66136187G>C	ENST00000360689.5	+	7	2551	c.824G>C	c.(823-825)gGa>gCa	p.G275A	FUT8_ENST00000358307.2_Missense_Mutation_p.G146A|FUT8_ENST00000417683.1_Missense_Mutation_p.W10C|FUT8_ENST00000394586.2_Missense_Mutation_p.G275A|FUT8_ENST00000554765.1_3'UTR|FUT8_ENST00000557164.1_Missense_Mutation_p.G112A|FUT8_ENST00000394585.1_Missense_Mutation_p.G275A	NM_004480.4|NM_178155.2	NP_004471.4|NP_835368.1	Q9BYC5	FUT8_HUMAN	fucosyltransferase 8 (alpha (1,6) fucosyltransferase)	275	GT23. {ECO:0000255|PROSITE- ProRule:PRU00992}.				cell migration (GO:0016477)|cellular protein metabolic process (GO:0044267)|GDP-L-fucose metabolic process (GO:0046368)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|L-fucose catabolic process (GO:0042355)|N-glycan fucosylation (GO:0036071)|N-glycan processing (GO:0006491)|oligosaccharide biosynthetic process (GO:0009312)|post-translational protein modification (GO:0043687)|protein glycosylation in Golgi (GO:0033578)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|receptor metabolic process (GO:0043112)|respiratory gaseous exchange (GO:0007585)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycoprotein 6-alpha-L-fucosyltransferase activity (GO:0008424)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(12)|ovary(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)	22				all cancers(60;0.00109)|OV - Ovarian serous cystadenocarcinoma(108;0.00242)|BRCA - Breast invasive adenocarcinoma(234;0.0114)		ATCTCCACTGGACACTGGTCA	0.453																																						dbGAP											0													117.0	107.0	110.0					14																	66136187		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB049740	CCDS9775.1, CCDS9776.1, CCDS9776.2	14q24.3	2013-02-26			ENSG00000033170	ENSG00000033170		"""Fucosyltransferases"""	4019	protein-coding gene	gene with protein product		602589				9368041	Standard	NM_178155		Approved		uc001xio.3	Q9BYC5	OTTHUMG00000142818	ENST00000360689.5:c.824G>C	14.37:g.66136187G>C	ENSP00000353910:p.Gly275Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFS7|G3V5N0|O00235|Q8IUA5|Q9BYC6|Q9P2U5|Q9P2U6	Missense_Mutation	SNP	superfamily_SH3_domain,smart_SH3_domain,pirsf_Alpha1_6FUT_euk	p.G275A	ENST00000360689.5	37	c.824	CCDS9775.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.43|10.43	1.347506|1.347506	0.24426|0.24426	.|.	.|.	ENSG00000033170|ENSG00000033170	ENST00000360689;ENST00000394586;ENST00000557164;ENST00000394585;ENST00000358307|ENST00000417683	D;D;D;D;D|T	0.87029|0.42131	-2.2;-2.2;-2.2;-2.2;-2.2|0.98	5.85|5.85	5.85|5.85	0.93711|0.93711	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.39627|0.39627	0.1085|0.1085	L|L	0.38838|0.38838	1.175|1.175	0.58432|0.58432	D|D	0.999999|0.999999	B;P|P	0.37997|0.35700	0.107;0.614|0.516	B;B|B	0.30495|0.36959	0.031;0.116|0.237	T|T	0.32561|0.32561	-0.9902|-0.9902	10|9	0.09338|0.87932	T|D	0.73|0	-17.1687|-17.1687	17.6669|17.6669	0.88205|0.88205	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	146;275|10	G3XAD2;Q9BYC5|Q8IUA5	.;FUT8_HUMAN|.	A|C	275;275;112;275;146|10	ENSP00000353910:G275A;ENSP00000378087:G275A;ENSP00000452433:G112A;ENSP00000378086:G275A;ENSP00000351057:G146A|ENSP00000396770:W10C	ENSP00000345865:G275A|ENSP00000396770:W10C	G|W	+|+	2|3	0|0	FUT8|FUT8	65205940|65205940	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	9.869000|9.869000	0.99810|0.99810	2.768000|2.768000	0.95171|0.95171	0.655000|0.655000	0.94253|0.94253	GGA|TGG	FUT8	-	pirsf_Alpha1_6FUT_euk	ENSG00000033170		0.453	FUT8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUT8	HGNC	protein_coding	OTTHUMT00000286406.1	64	0.00	0	G	NM_004480		66136187	66136187	+1	no_errors	ENST00000360689	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	1.000	C
G3BP2	9908	genome.wustl.edu	37	4	76570845	76570845	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:76570845C>G	ENST00000359707.4	-	12	2003	c.1218G>C	c.(1216-1218)gaG>gaC	p.E406D	G3BP2_ENST00000395719.3_Missense_Mutation_p.E406D|G3BP2_ENST00000357854.3_Missense_Mutation_p.E373D	NM_203505.2	NP_987101.1	Q9UN86	G3BP2_HUMAN	GTPase activating protein (SH3 domain) binding protein 2	406	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cytoplasmic sequestering of NF-kappaB (GO:0007253)|mRNA transport (GO:0051028)|Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|receptor signaling complex scaffold activity (GO:0030159)			breast(3)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|upper_aerodigestive_tract(3)|urinary_tract(2)	27			Lung(101;0.0973)|LUSC - Lung squamous cell carcinoma(112;0.122)			TTGTTTTTTTCTCTTCCACAT	0.433																																						dbGAP											0													211.0	178.0	189.0					4																	76570845		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB014560	CCDS3571.1, CCDS3572.1	4q21.1	2013-02-12	2006-11-01		ENSG00000138757	ENSG00000138757		"""RNA binding motif (RRM) containing"""	30291	protein-coding gene	gene with protein product	"""Ras-GTPase activating protein SH3 domain-binding protein 2"""					9734811, 9575347	Standard	NM_203504		Approved	KIAA0660	uc003his.3	Q9UN86	OTTHUMG00000130097	ENST00000359707.4:c.1218G>C	4.37:g.76570845C>G	ENSP00000352738:p.Glu406Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6X1|O60606|O75149|Q9UPA1	Missense_Mutation	SNP	pfam_NTF2,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Nuclear_transport_factor_2_euk	p.E406D	ENST00000359707.4	37	c.1218	CCDS3571.1	4	.	.	.	.	.	.	.	.	.	.	C	15.01	2.707317	0.48412	.	.	ENSG00000138757	ENST00000395719;ENST00000359707;ENST00000357854	D;D;D	0.85629	-2.01;-2.01;-2.01	6.17	6.17	0.99709	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	D	0.93403	0.7896	M	0.89601	3.045	0.80722	D	1	D;P	0.61697	0.99;0.864	D;P	0.70935	0.971;0.515	D	0.93926	0.7210	10	0.87932	D	0	.	14.9567	0.71120	0.0:0.9326:0.0:0.0674	.	373;406	Q9UN86-2;Q9UN86	.;G3BP2_HUMAN	D	406;406;373	ENSP00000379069:E406D;ENSP00000352738:E406D;ENSP00000350518:E373D	ENSP00000350518:E373D	E	-	3	2	G3BP2	76789869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.733000	0.55029	2.941000	0.99782	0.655000	0.94253	GAG	G3BP2	-	pfscan_RRM_dom	ENSG00000138757		0.433	G3BP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	G3BP2	HGNC	protein_coding	OTTHUMT00000252399.2	150	0.00	0	C	NM_012297		76570845	76570845	-1	no_errors	ENST00000359707	ensembl	human	known	69_37n	missense	137	11.61	18	SNP	1.000	G
GALNT8	26290	genome.wustl.edu	37	12	4848374	4848374	+	Silent	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:4848374C>A	ENST00000252318.2	+	3	892	c.555C>A	c.(553-555)gtC>gtA	p.V185V	RP11-234B24.6_ENST00000544741.2_3'UTR	NM_017417.1	NP_059113.1	Q9NY28	GALT8_HUMAN	polypeptide N-acetylgalactosaminyltransferase 8	185	Catalytic subdomain A.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(4)|skin(2)|urinary_tract(1)	35						CCCTCAGTGTCATTCTCATAT	0.398																																					Colon(108;631 1558 7270 20097 39846)	dbGAP											0													131.0	117.0	122.0					12																	4848374		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ271385	CCDS8533.1	12p13.32	2014-03-13	2014-03-13		ENSG00000130035	ENSG00000130035	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4130	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 8"""	606250	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 8 (GalNAc-T8)"""			10767557	Standard	NM_017417		Approved	GALNAC-T8	uc001qne.1	Q9NY28	OTTHUMG00000166188	ENST00000252318.2:c.555C>A	12.37:g.4848374C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU02	Silent	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.V185	ENST00000252318.2	37	c.555	CCDS8533.1	12																																																																																			GALNT8	-	pfam_Glyco_trans_2	ENSG00000130035		0.398	GALNT8-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GALNT8	HGNC	protein_coding	OTTHUMT00000388277.2	94	0.00	0	C	NM_017417		4848374	4848374	+1	no_errors	ENST00000252318	ensembl	human	known	69_37n	silent	57	16.18	11	SNP	0.925	A
GAPVD1	26130	genome.wustl.edu	37	9	128099860	128099860	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:128099860C>G	ENST00000495955.1	+	17	3157	c.2867C>G	c.(2866-2868)tCa>tGa	p.S956*	GAPVD1_ENST00000297933.6_Nonsense_Mutation_p.S956*|GAPVD1_ENST00000394083.2_Nonsense_Mutation_p.S935*|GAPVD1_ENST00000394104.2_Nonsense_Mutation_p.S956*|GAPVD1_ENST00000470056.1_Nonsense_Mutation_p.S956*|GAPVD1_ENST00000265956.4_Nonsense_Mutation_p.S930*|GAPVD1_ENST00000312123.9_Nonsense_Mutation_p.S935*|GAPVD1_ENST00000394105.2_Nonsense_Mutation_p.S983*			Q14C86	GAPD1_HUMAN	GTPase activating protein and VPS9 domains 1	956					endocytosis (GO:0006897)|positive regulation of GTPase activity (GO:0043547)|regulation of protein transport (GO:0051223)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)	GTPase activating protein binding (GO:0032794)|GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)			central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						AAGGACTCCTCAAGAGGAGAG	0.448																																						dbGAP											0													59.0	60.0	59.0					9																	128099860		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0				CCDS65130.1, CCDS65131.1, CCDS65132.1	9q34.11	2008-02-05			ENSG00000165219	ENSG00000165219			23375	protein-coding gene	gene with protein product		611714					Standard	XM_005251901		Approved	DKFZP434C212, KIAA1521	uc004bpr.3	Q14C86	OTTHUMG00000020678	ENST00000495955.1:c.2867C>G	9.37:g.128099860C>G	ENSP00000419063:p.Ser956*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYK3|B0QZ62|B0QZ63|B0QZ64|Q14C76|Q2Q1W1|Q8ND92|Q8WU86|Q96CZ4|Q9NXQ1|Q9P207|Q9Y4N0	Nonsense_Mutation	SNP	pfam_RasGAP,pfam_VPS9,superfamily_Rho_GTPase_activation_prot,smart_VPS9_subgr,pfscan_VPS9,pfscan_RasGAP	p.S983*	ENST00000495955.1	37	c.2948		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	42|42	9.237350|9.237350	0.99110|0.99110	.|.	.|.	ENSG00000165219|ENSG00000165219	ENST00000431329|ENST00000470056;ENST00000394105;ENST00000394104;ENST00000265956;ENST00000394083;ENST00000495955;ENST00000467750;ENST00000297933;ENST00000312123	.|.	.|.	.|.	6.17|6.17	4.04|4.04	0.47022|0.47022	.|.	.|0.216310	.|0.43260	.|D	.|0.000582	T|.	0.67040|.	0.2851|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.76621|.	-0.2892|.	3|.	.|0.51188	.|T	.|0.08	.|.	13.6319|13.6319	0.62200|0.62200	0.0:0.8549:0.0:0.1451|0.0:0.8549:0.0:0.1451	.|.	.|.	.|.	.|.	E|X	793|956;983;956;930;935;956;956;956;935	.|.	.|ENSP00000265956:S930X	Q|S	+|+	1|2	0|0	GAPVD1|GAPVD1	127139681|127139681	0.991000|0.991000	0.36638|0.36638	0.990000|0.990000	0.47175|0.47175	0.998000|0.998000	0.95712|0.95712	2.605000|2.605000	0.46283|0.46283	1.627000|1.627000	0.50400|0.50400	0.655000|0.655000	0.94253|0.94253	CAA|TCA	GAPVD1	-	NULL	ENSG00000165219		0.448	GAPVD1-014	KNOWN	alternative_5_UTR|basic	protein_coding	GAPVD1	HGNC	protein_coding	OTTHUMT00000355644.1	37	0.00	0	C			128099860	128099860	+1	no_errors	ENST00000394105	ensembl	human	known	69_37n	nonsense	38	13.64	6	SNP	0.960	G
GATA3	2625	genome.wustl.edu	37	10	8105964	8105964	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:8105964G>A	ENST00000346208.3	+	4	1239	c.784G>A	c.(784-786)Gag>Aag	p.E262K	GATA3_ENST00000461472.1_Intron|GATA3_ENST00000379328.3_Missense_Mutation_p.E263K			P23771	GATA3_HUMAN	GATA binding protein 3	262					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.E263K(1)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						AGAAGGCAGGGAGTGTGTGAA	0.537			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	1	Substitution - Missense(1)	skin(1)											170.0	118.0	135.0					10																	8105964		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.784G>A	10.37:g.8105964G>A	ENSP00000341619:p.Glu262Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.E263K	ENST00000346208.3	37	c.787	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	G	36	5.885219	0.97068	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99674	-6.36;-6.36	5.39	5.39	0.77823	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (3);	0.000000	0.85682	D	0.000000	D	0.99732	0.9895	M	0.86953	2.85	0.80722	D	1	D;D	0.76494	0.995;0.999	D;D	0.80764	0.976;0.994	D	0.97549	1.0091	10	0.87932	D	0	-5.7736	19.165	0.93553	0.0:0.0:1.0:0.0	.	262;263	P23771;P23771-2	GATA3_HUMAN;.	K	263;262	ENSP00000368632:E263K;ENSP00000341619:E262K	ENSP00000341619:E262K	E	+	1	0	GATA3	8145970	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.519000	0.84933	0.655000	0.94253	GAG	GATA3	-	smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000107485		0.537	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	69	0.00	0	G	NM_001002295		8105964	8105964	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	missense	76	13.64	12	SNP	1.000	A
GATA3	2625	genome.wustl.edu	37	10	8106058	8106058	+	Missense_Mutation	SNP	T	T	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:8106058T>A	ENST00000346208.3	+	4	1333	c.878T>A	c.(877-879)aTg>aAg	p.M293K	GATA3_ENST00000461472.1_Intron|GATA3_ENST00000379328.3_Missense_Mutation_p.M294K			P23771	GATA3_HUMAN	GATA binding protein 3	293	Flexible linker.				anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.M294K(2)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						TATCACAAAATGAACGGACAG	0.572			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	2	Substitution - Missense(2)	breast(2)											118.0	106.0	110.0					10																	8106058		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.878T>A	10.37:g.8106058T>A	ENSP00000341619:p.Met293Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Missense_Mutation	SNP	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.M294K	ENST00000346208.3	37	c.881	CCDS7083.1	10	.	.	.	.	.	.	.	.	.	.	T	28.8	4.954454	0.92726	.	.	ENSG00000107485	ENST00000379328;ENST00000346208	D;D	0.99150	-5.49;-5.49	5.59	5.59	0.84812	Zinc finger, NHR/GATA-type (1);Zinc finger, GATA-type (4);	0.000000	0.85682	D	0.000000	D	0.98134	0.9384	N	0.11673	0.155	0.80722	D	1	D;P	0.89917	1.0;0.723	D;P	0.91635	0.999;0.692	D	0.99945	1.1461	10	0.87932	D	0	-15.2486	15.7811	0.78260	0.0:0.0:0.0:1.0	.	293;294	P23771;P23771-2	GATA3_HUMAN;.	K	294;293	ENSP00000368632:M294K;ENSP00000341619:M293K	ENSP00000341619:M293K	M	+	2	0	GATA3	8146064	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	8.040000	0.89188	2.123000	0.65237	0.533000	0.62120	ATG	GATA3	-	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	ENSG00000107485		0.572	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	55	0.00	0	T	NM_001002295		8106058	8106058	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	A
GBP1	2633	genome.wustl.edu	37	1	89524633	89524633	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:89524633G>A	ENST00000370473.4	-	5	741	c.522C>T	c.(520-522)ttC>ttT	p.F174F		NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible	174	GB1/RHD3-type G.|GTPase domain (Globular).				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		AGTCTGGGAAGAAGCTCACAA	0.473																																						dbGAP											0													177.0	156.0	163.0					1																	89524633		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.522C>T	1.37:g.89524633G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT26|Q5T8M1	Silent	SNP	pfam_Guanylate-bd_C,pfam_Guanylate-bd_N,superfamily_Guanylate-bd_C	p.F174	ENST00000370473.4	37	c.522	CCDS718.1	1																																																																																			GBP1	-	pfam_Guanylate-bd_N	ENSG00000117228		0.473	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	95	0.00	0	G	NM_002053		89524633	89524633	-1	no_errors	ENST00000370473	ensembl	human	known	69_37n	silent	73	19.57	18	SNP	1.000	A
GGTLC1	92086	genome.wustl.edu	37	20	23966755	23966755	+	Nonsense_Mutation	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr20:23966755C>A	ENST00000335694.4	-	3	466	c.262G>T	c.(262-264)Gag>Tag	p.E88*	GGTLC1_ENST00000286890.4_Nonsense_Mutation_p.E88*|GGTLC1_ENST00000278765.4_Nonsense_Mutation_p.E88*	NM_178311.2	NP_842563.1	Q9BX51	GGTL1_HUMAN	gamma-glutamyltransferase light chain 1	88					glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)	anchored component of external side of plasma membrane (GO:0031362)	gamma-glutamyltransferase activity (GO:0003840)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	15						ACCCCAAACTCGTTGGTGATG	0.607																																						dbGAP											0													115.0	128.0	124.0					20																	23966755		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AL133466	CCDS13163.1	20p11.21	2010-07-14	2008-03-10	2008-03-10	ENSG00000149435	ENSG00000149435		"""Gamma-glutamyltransferases"""	16437	protein-coding gene	gene with protein product		612338	"""gamma-glutamyltransferase-like activity 4"", ""gamma-glutamyltransferase-like activity 3"""	GGTLA4, GGTLA3		10843999, 18357469	Standard	NM_178311		Approved	dJ831C21.2, dJ831C21.1	uc002wtu.3	Q9BX51	OTTHUMG00000032095	ENST00000335694.4:c.262G>T	20.37:g.23966755C>A	ENSP00000337587:p.Glu88*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW43|Q08246	Nonsense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.E88*	ENST00000335694.4	37	c.262	CCDS13163.1	20	.	.	.	.	.	.	.	.	.	.	c	17.92	3.507689	0.64410	.	.	ENSG00000149435	ENST00000286890;ENST00000278765;ENST00000335694	.	.	.	0.844	0.844	0.18943	.	0.413761	0.24820	N	0.035327	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.18710	T	0.47	-12.9383	7.477	0.27382	0.0:0.9999:0.0:1.0E-4	.	.	.	.	X	88	.	ENSP00000278765:E88X	E	-	1	0	GGTLC1	23914755	0.983000	0.35010	0.063000	0.19743	0.069000	0.16628	2.377000	0.44300	0.088000	0.17205	0.089000	0.15464	GAG	GGTLC1	-	pfam_GGT_peptidase	ENSG00000149435		0.607	GGTLC1-006	KNOWN	basic|appris_principal|CCDS	protein_coding	GGTLC1	HGNC	protein_coding	OTTHUMT00000078366.2	77	0.00	0	C	NM_178311.2		23966755	23966755	-1	no_errors	ENST00000278765	ensembl	human	known	69_37n	nonsense	57	12.31	8	SNP	0.999	A
GJD4	219770	genome.wustl.edu	37	10	35896912	35896912	+	Silent	SNP	C	C	T	rs142132151		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:35896912C>T	ENST00000321660.1	+	2	629	c.471C>T	c.(469-471)ttC>ttT	p.F157F	RP11-425A6.5_ENST00000609313.1_RNA	NM_153368.2	NP_699199.2	Q96KN9	CXD4_HUMAN	gap junction protein, delta 4, 40.1kDa	157					cell communication (GO:0007154)|regulation of satellite cell activation involved in skeletal muscle regeneration (GO:0014717)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|large_intestine(6)|lung(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	16						AGGCAGCCTTCGGGGCCTTGC	0.677																																						dbGAP											0													15.0	18.0	17.0					10																	35896912		2197	4294	6491	-	-	-	SO:0001819	synonymous_variant	0			AJ414564	CCDS7191.1	10p11.22	2007-11-27			ENSG00000177291	ENSG00000177291		"""Ion channels / Gap junction proteins (connexins)"""	23296	protein-coding gene	gene with protein product	"""connexin 40.1"""	611922				12477932	Standard	NM_153368		Approved	CX40.1, FLJ90023	uc001iyy.1	Q96KN9	OTTHUMG00000017957	ENST00000321660.1:c.471C>T	10.37:g.35896912C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N2R7	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.F157	ENST00000321660.1	37	c.471	CCDS7191.1	10																																																																																			GJD4	-	pfam_Connexin_CCC,prints_Connexin	ENSG00000177291		0.677	GJD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJD4	HGNC	protein_coding	OTTHUMT00000047576.1	11	0.00	0	C	NM_153368		35896912	35896912	+1	no_errors	ENST00000321660	ensembl	human	known	69_37n	silent	7	36.36	4	SNP	0.043	T
GLCCI1	113263	genome.wustl.edu	37	7	8095167	8095167	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:8095167C>T	ENST00000223145.5	+	4	1358	c.801C>T	c.(799-801)atC>atT	p.I267I	GLCCI1_ENST00000474269.1_3'UTR	NM_138426.3	NP_612435.1	Q86VQ1	GLCI1_HUMAN	glucocorticoid induced transcript 1	267						cytoplasm (GO:0005737)				endometrium(4)|large_intestine(4)|lung(13)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	25		Ovarian(82;0.0608)		UCEC - Uterine corpus endometrioid carcinoma (126;0.206)		ATATAACAATCAGTCACACTC	0.398																																						dbGAP											0													208.0	174.0	186.0					7																	8095167		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC050291	CCDS34601.1	7p22.2	2008-08-18			ENSG00000106415	ENSG00000106415			18713	protein-coding gene	gene with protein product		614283					Standard	NM_138426		Approved	GIG18, FAM117C, TSSN1	uc003srk.4	Q86VQ1	OTTHUMG00000151984	ENST00000223145.5:c.801C>T	7.37:g.8095167C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D103|Q96FD0	Nonsense_Mutation	SNP	NULL	p.Q11*	ENST00000223145.5	37	c.31	CCDS34601.1	7																																																																																			GLCCI1	-	NULL	ENSG00000106415		0.398	GLCCI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLCCI1	HGNC	protein_coding	OTTHUMT00000324672.1	67	0.00	0	C	NM_138426		8095167	8095167	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000438949	ensembl	human	known	69_37n	nonsense	64	21.95	18	SNP	1.000	T
GLDC	2731	genome.wustl.edu	37	9	6644674	6644674	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:6644674C>T	ENST00000321612.6	-	2	424	c.274G>A	c.(274-276)Gag>Aag	p.E92K	RP11-390F4.6_ENST00000413145.1_lincRNA	NM_000170.2	NP_000161.2	P23378	GCSP_HUMAN	glycine dehydrogenase (decarboxylating)	92					glycine catabolic process (GO:0006546)	mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|glycine dehydrogenase (decarboxylating) activity (GO:0004375)|lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)			cervix(1)|endometrium(2)|large_intestine(5)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Acute lymphoblastic leukemia(23;0.161)		GBM - Glioblastoma multiforme(50;0.0421)|Lung(218;0.134)	Glycine(DB00145)	ACCGTCTTCTCGATCAATTCA	0.453																																						dbGAP											0													76.0	73.0	74.0					9																	6644674		2203	4300	6503	-	-	-	SO:0001583	missense	0			D90239	CCDS34987.1	9p22	2014-09-17	2006-05-22		ENSG00000178445	ENSG00000178445	1.4.4.2		4313	protein-coding gene	gene with protein product	"""glycine cleavage system protein P"", ""glycine decarboxylase"""	238300	"""glycine dehydrogenase (decarboxylating; glycine decarboxylase, glycine cleavage system protein P)"""			1993704, 1996985	Standard	NM_000170		Approved	GCSP, NKH	uc003zkc.3	P23378	OTTHUMG00000019524	ENST00000321612.6:c.274G>A	9.37:g.6644674C>T	ENSP00000370737:p.Glu92Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M2F8	Missense_Mutation	SNP	pfam_GDC-P_N,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	p.E92K	ENST00000321612.6	37	c.274	CCDS34987.1	9	.	.	.	.	.	.	.	.	.	.	C	20.2	3.946713	0.73672	.	.	ENSG00000178445	ENST00000321612	D	0.95554	-3.74	4.73	4.73	0.59995	Glycine cleavage system P-protein, N-terminal (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.054597	0.64402	D	0.000001	D	0.92189	0.7523	L	0.37561	1.115	0.80722	D	1	P	0.35348	0.496	B	0.31245	0.126	D	0.92555	0.6053	10	0.59425	D	0.04	-15.7143	17.6738	0.88225	0.0:1.0:0.0:0.0	.	92	P23378	GCSP_HUMAN	K	92	ENSP00000370737:E92K	ENSP00000370737:E92K	E	-	1	0	GLDC	6634674	1.000000	0.71417	0.999000	0.59377	0.961000	0.63080	6.621000	0.74228	2.353000	0.79882	0.462000	0.41574	GAG	GLDC	-	pfam_GDC-P_N,superfamily_PyrdxlP-dep_Trfase_major_dom,tigrfam_GDC_P_homo	ENSG00000178445		0.453	GLDC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLDC	HGNC	protein_coding	OTTHUMT00000051674.2	49	0.00	0	C	NM_000170		6644674	6644674	-1	no_errors	ENST00000321612	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	1.000	T
GLE1	2733	genome.wustl.edu	37	9	131271192	131271192	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:131271192C>T	ENST00000309971.4	+	2	243	c.137C>T	c.(136-138)tCt>tTt	p.S46F	GLE1_ENST00000372770.4_Missense_Mutation_p.S46F|GLE1_ENST00000539582.1_5'UTR	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	46					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						CCCAAGCTATCTTCTTATTCT	0.448																																						dbGAP											0													159.0	149.0	152.0					9																	131271192		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.137C>T	9.37:g.131271192C>T	ENSP00000308622:p.Ser46Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Missense_Mutation	SNP	pfam_GLE1	p.S46F	ENST00000309971.4	37	c.137	CCDS35154.1	9	.	.	.	.	.	.	.	.	.	.	C	16.33	3.093858	0.56075	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	T;T	0.77098	-1.07;-0.68	5.47	5.47	0.80525	.	0.051226	0.85682	D	0.000000	T	0.78597	0.4308	M	0.70275	2.135	0.80722	D	1	B;B	0.22003	0.037;0.063	B;B	0.25614	0.028;0.062	T	0.77101	-0.2712	10	0.87932	D	0	-12.2037	16.0807	0.81003	0.0:1.0:0.0:0.0	.	46;46	Q53GS7;Q53GS7-2	GLE1_HUMAN;.	F	46	ENSP00000308622:S46F;ENSP00000361856:S46F	ENSP00000308622:S46F	S	+	2	0	GLE1	130311013	0.982000	0.34865	0.726000	0.30738	0.980000	0.70556	4.460000	0.60108	2.582000	0.87167	0.455000	0.32223	TCT	GLE1	-	NULL	ENSG00000119392		0.448	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLE1	HGNC	protein_coding	OTTHUMT00000054456.1	88	0.00	0	C	NM_001003722		131271192	131271192	+1	no_errors	ENST00000309971	ensembl	human	known	69_37n	missense	85	15.00	15	SNP	0.637	T
GLI3	2737	genome.wustl.edu	37	7	42017206	42017206	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:42017206G>A	ENST00000395925.3	-	12	1847	c.1763C>T	c.(1762-1764)tCa>tTa	p.S588L	GLI3_ENST00000479210.1_5'UTR	NM_000168.5	NP_000159.3	P10071	GLI3_HUMAN	GLI family zinc finger 3	588					anterior semicircular canal development (GO:0060873)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|axon guidance (GO:0007411)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye morphogenesis (GO:0048593)|cell differentiation involved in kidney development (GO:0061005)|cerebral cortex radial glia guided migration (GO:0021801)|developmental growth (GO:0048589)|embryonic digestive tract development (GO:0048566)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic digit morphogenesis (GO:0042733)|embryonic skeletal system morphogenesis (GO:0048704)|forebrain dorsal/ventral pattern formation (GO:0021798)|forebrain radial glial cell differentiation (GO:0021861)|frontal suture morphogenesis (GO:0060364)|heart development (GO:0007507)|hindgut morphogenesis (GO:0007442)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|lambdoid suture morphogenesis (GO:0060366)|lateral ganglionic eminence cell proliferation (GO:0022018)|lateral semicircular canal development (GO:0060875)|limb morphogenesis (GO:0035108)|lung development (GO:0030324)|mammary gland specification (GO:0060594)|melanocyte differentiation (GO:0030318)|metanephros development (GO:0001656)|negative regulation of alpha-beta T cell differentiation (GO:0046639)|negative regulation of apoptotic process (GO:0043066)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative thymic T cell selection (GO:0045060)|nose morphogenesis (GO:0043585)|odontogenesis of dentin-containing tooth (GO:0042475)|oligodendrocyte differentiation (GO:0048709)|optic nerve morphogenesis (GO:0021631)|palate development (GO:0060021)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein processing (GO:0016485)|proximal/distal pattern formation (GO:0009954)|response to estrogen (GO:0043627)|sagittal suture morphogenesis (GO:0060367)|smoothened signaling pathway (GO:0007224)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)|smoothened signaling pathway involved in spinal cord motor neuron cell fate specification (GO:0021776)|smoothened signaling pathway involved in ventral spinal cord interneuron specification (GO:0021775)|T cell differentiation in thymus (GO:0033077)|thymocyte apoptotic process (GO:0070242)|tongue development (GO:0043586)|transcription, DNA-templated (GO:0006351)|wound healing (GO:0042060)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|primary cilium (GO:0072372)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|histone acetyltransferase binding (GO:0035035)|histone deacetylase binding (GO:0042826)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(2)|biliary_tract(1)|breast(4)|central_nervous_system(2)|endometrium(12)|kidney(7)|large_intestine(25)|lung(49)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	112						AGAGGCATTTGAGAAAGCCTT	0.458									Pallister-Hall syndrome;Greig Cephalopolysyndactyly		OREG0018015	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													241.0	197.0	212.0					7																	42017206		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	;		CCDS5465.1	7p13	2013-01-25	2009-03-05		ENSG00000106571	ENSG00000106571		"""Zinc fingers, C2H2-type"""	4319	protein-coding gene	gene with protein product	"""zinc finger protein GLI3"", ""oncogene GLI3"", ""DNA-binding protein"""	165240	"""Greig cephalopolysyndactyly syndrome"", ""GLI-Kruppel family member GLI3"", ""glioma-associated oncogene family zinc finger 3"""	GCPS, PHS		2118997	Standard	NM_000168		Approved	PAP-A, PAPA, PAPA1, PAPB, ACLS, PPDIV	uc011kbh.2	P10071	OTTHUMG00000023630	ENST00000395925.3:c.1763C>T	7.37:g.42017206G>A	ENSP00000379258:p.Ser588Leu	Somatic	905	WXS	Illumina GAIIx	Phase_IV	A4D1W1|O75219|Q17RW4|Q75MT0|Q75MU9|Q9UDT5|Q9UJ39	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S588L	ENST00000395925.3	37	c.1763	CCDS5465.1	7	.	.	.	.	.	.	.	.	.	.	G	33	5.221086	0.95139	.	.	ENSG00000106571	ENST00000395925	T	0.53640	0.61	5.82	5.82	0.92795	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.62925	0.2468	L	0.37507	1.11	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.63875	-0.6538	10	0.87932	D	0	.	20.1092	0.97906	0.0:0.0:1.0:0.0	.	588	P10071	GLI3_HUMAN	L	588	ENSP00000379258:S588L	ENSP00000379258:S588L	S	-	2	0	GLI3	41983731	1.000000	0.71417	0.964000	0.40570	0.812000	0.45895	9.807000	0.99171	2.745000	0.94114	0.655000	0.94253	TCA	GLI3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000106571		0.458	GLI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLI3	HGNC	protein_coding	OTTHUMT00000250806.3	132	0.00	0	G	NM_000168		42017206	42017206	-1	no_errors	ENST00000395925	ensembl	human	known	69_37n	missense	86	14.00	14	SNP	1.000	A
GOLGA3	2802	genome.wustl.edu	37	12	133354347	133354347	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:133354347G>C	ENST00000450791.2	-	18	3810	c.3627C>G	c.(3625-3627)ttC>ttG	p.F1209L	GOLGA3_ENST00000456883.2_Missense_Mutation_p.F1209L|GOLGA3_ENST00000204726.3_Missense_Mutation_p.F1209L			Q08378	GOGA3_HUMAN	golgin A3	1209					intra-Golgi vesicle-mediated transport (GO:0006891)	cytosol (GO:0005829)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extrinsic component of Golgi membrane (GO:0090498)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	transporter activity (GO:0005215)			breast(1)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0176)|Lung NSC(355;0.204)		OV - Ovarian serous cystadenocarcinoma(86;2.27e-08)|Epithelial(86;3.34e-07)|all cancers(50;9.4e-06)		AGGCCGCCTTGAAGTGGCGGC	0.612																																						dbGAP											0													47.0	43.0	44.0					12																	133354347		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF485338	CCDS9281.1, CCDS53846.1	12q24.33	2010-02-12	2010-02-12		ENSG00000090615	ENSG00000090615			4426	protein-coding gene	gene with protein product	"""SY2/SY10 protein"", ""Golgi complex-associated protein of 170 kD"""	602581	"""golgi autoantigen, golgin subfamily a, 3"""			8315394, 15829563	Standard	NM_001172557		Approved	golgin-160, GCP170, MEA-2	uc001ukz.1	Q08378	OTTHUMG00000168023	ENST00000450791.2:c.3627C>G	12.37:g.133354347G>C	ENSP00000410378:p.Phe1209Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKX6|O43241|Q6P9C7|Q86XW3|Q8TDA9|Q8WZA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.F1209L	ENST00000450791.2	37	c.3627	CCDS9281.1	12	.	.	.	.	.	.	.	.	.	.	G	12.05	1.821406	0.32237	.	.	ENSG00000090615	ENST00000204726;ENST00000450791;ENST00000456883	T;T;T	0.22743	1.94;1.94;1.95	5.59	-6.37	0.01963	.	0.153324	0.64402	N	0.000013	T	0.13372	0.0324	L	0.54323	1.7	0.80722	D	1	P;P	0.45531	0.86;0.814	B;B	0.41412	0.352;0.356	T	0.48281	-0.9049	10	0.08599	T	0.76	.	9.1948	0.37222	0.4781:0.0918:0.4301:0.0	.	1209;1209	Q08378-2;Q08378	.;GOGA3_HUMAN	L	1209	ENSP00000204726:F1209L;ENSP00000410378:F1209L;ENSP00000409303:F1209L	ENSP00000204726:F1209L	F	-	3	2	GOLGA3	131864420	1.000000	0.71417	0.398000	0.26321	0.871000	0.50021	1.102000	0.31050	-1.962000	0.01014	-0.254000	0.11334	TTC	GOLGA3	-	NULL	ENSG00000090615		0.612	GOLGA3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA3	HGNC	protein_coding	OTTHUMT00000397569.2	35	0.00	0	G	NM_005895		133354347	133354347	-1	no_errors	ENST00000204726	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.985	C
GPR144	347088	genome.wustl.edu	37	9	127220513	127220513	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:127220513G>C	ENST00000334810.1	+	9	1683	c.1683G>C	c.(1681-1683)caG>caC	p.Q561H				Q7Z7M1	GP144_HUMAN	G protein-coupled receptor 144	561					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)	4						ACAGGGTGCAGAGGTGAGTAG	0.647																																						dbGAP											0													47.0	55.0	52.0					9																	127220513		692	1591	2283	-	-	-	SO:0001583	missense	0			AY278562		9q34.11	2014-08-08			ENSG00000180264	ENSG00000180264		"""-"", ""GPCR / Class B : Orphans"""	18651	protein-coding gene	gene with protein product							Standard	XM_006710216		Approved	PGR24	uc010mwn.3	Q7Z7M1	OTTHUMG00000020652	ENST00000334810.1:c.1683G>C	9.37:g.127220513G>C	ENSP00000335156:p.Gln561His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SL4|Q8NH12	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_Pentaxin,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_C-type_lectin_fold,smart_Pentaxin,smart_GPS_dom,prints_Pentaxin,prints_GPCR_2_secretin-like,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Q561H	ENST00000334810.1	37	c.1683	CCDS48016.1	9	.	.	.	.	.	.	.	.	.	.	G	15.24	2.776069	0.49786	.	.	ENSG00000180264	ENST00000334810;ENST00000439837	T	0.51817	0.69	4.64	2.75	0.32379	.	.	.	.	.	T	0.41949	0.1181	M	0.61703	1.905	0.28037	N	0.933903	B	0.25441	0.126	B	0.19391	0.025	T	0.34950	-0.9808	9	0.40728	T	0.16	.	7.7678	0.28991	0.2101:0.0:0.7898:0.0	.	561	Q7Z7M1	GP144_HUMAN	H	561;292	ENSP00000335156:Q561H	ENSP00000335156:Q561H	Q	+	3	2	GPR144	126260334	1.000000	0.71417	0.993000	0.49108	0.628000	0.37860	3.181000	0.50903	1.066000	0.40716	0.561000	0.74099	CAG	GPR144	-	NULL	ENSG00000180264		0.647	GPR144-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR144	HGNC	protein_coding	OTTHUMT00000054026.2	20	0.00	0	G	NM_182611		127220513	127220513	+1	no_errors	ENST00000334810	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	0.998	C
GPR39	2863	genome.wustl.edu	37	2	133174900	133174900	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:133174900C>G	ENST00000329321.3	+	1	754	c.285C>G	c.(283-285)atC>atG	p.I95M		NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	95					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						ACAGCATCATCTGGAATCCCC	0.557																																						dbGAP											0													220.0	200.0	207.0					2																	133174900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.285C>G	2.37:g.133174900C>G	ENSP00000327417:p.Ile95Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC12|B6V9G4|Q08AS2|Q53R01	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.I95M	ENST00000329321.3	37	c.285	CCDS2170.1	2	.	.	.	.	.	.	.	.	.	.	C	15.82	2.946169	0.53079	.	.	ENSG00000183840	ENST00000329321	T	0.72394	-0.65	5.2	4.31	0.51392	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.76990	0.4065	L	0.49640	1.575	0.44711	D	0.9977	D	0.89917	1.0	D	0.97110	1.0	T	0.75827	-0.3180	10	0.45353	T	0.12	.	8.1168	0.30948	0.1301:0.727:0.0:0.1429	.	95	O43194	GPR39_HUMAN	M	95	ENSP00000327417:I95M	ENSP00000327417:I95M	I	+	3	3	GPR39	132891370	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	1.435000	0.34969	1.403000	0.46800	0.549000	0.68633	ATC	GPR39	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000183840		0.557	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	69	0.00	0	C			133174900	133174900	+1	no_errors	ENST00000329321	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	1.000	G
GPR39	2863	genome.wustl.edu	37	2	133402801	133402801	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:133402801C>T	ENST00000329321.3	+	2	1453	c.984C>T	c.(982-984)ttC>ttT	p.F328F	GPR39_ENST00000470071.1_3'UTR|LYPD1_ENST00000397463.2_3'UTR	NM_001508.2	NP_001499.1	O43194	GPR39_HUMAN	G protein-coupled receptor 39	328					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TCCTCCCCTTCTCGGAGACGT	0.602																																						dbGAP											0													120.0	97.0	105.0					2																	133402801		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034633	CCDS2170.1	2q21-q22	2012-08-21			ENSG00000183840	ENSG00000183840		"""GPCR / Class A : Orphans"""	4496	protein-coding gene	gene with protein product		602886				9441746	Standard	NM_001508		Approved		uc002ttl.3	O43194	OTTHUMG00000131679	ENST00000329321.3:c.984C>T	2.37:g.133402801C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC12|B6V9G4|Q08AS2|Q53R01	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.F328	ENST00000329321.3	37	c.984	CCDS2170.1	2																																																																																			GPR39	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000183840		0.602	GPR39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR39	HGNC	protein_coding	OTTHUMT00000254582.1	30	0.00	0	C			133402801	133402801	+1	no_errors	ENST00000329321	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.999	T
GPR98	84059	genome.wustl.edu	37	5	90002097	90002097	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:90002097G>T	ENST00000405460.2	+	38	8712	c.8616G>T	c.(8614-8616)aaG>aaT	p.K2872N		NM_032119.3	NP_115495.3	Q8WXG9	GPR98_HUMAN	G protein-coupled receptor 98	2872	Calx-beta 20. {ECO:0000255}.				detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|G-protein coupled receptor signaling pathway (GO:0007186)|inner ear receptor stereocilium organization (GO:0060122)|maintenance of organ identity (GO:0048496)|nervous system development (GO:0007399)|neurological system process (GO:0050877)|neuropeptide signaling pathway (GO:0007218)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|visual perception (GO:0007601)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|stereocilia ankle link complex (GO:0002142)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(4)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(3)|kidney(18)|large_intestine(46)|liver(2)|lung(80)|ovary(12)|pancreas(5)|prostate(1)|skin(50)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(6)	269		all_cancers(142;1.05e-09)|all_epithelial(76;1.81e-12)|all_lung(232;5.41e-06)|Lung NSC(167;1.72e-05)|Ovarian(174;0.00948)|Colorectal(57;0.133)|Breast(839;0.192)		OV - Ovarian serous cystadenocarcinoma(54;7.01e-30)|Epithelial(54;6.79e-25)|all cancers(79;1.88e-20)		TGAGTCTGAAGAACCAAACAG	0.378																																						dbGAP											0													73.0	74.0	73.0					5																	90002097		1864	4102	5966	-	-	-	SO:0001583	missense	0			AB014586	CCDS47246.1	5q13	2014-08-08	2006-05-26	2006-05-26	ENSG00000164199	ENSG00000164199		"""-"", ""GPCR / Class B : Orphans"""	17416	protein-coding gene	gene with protein product		602851	"""monogenic, audiogenic seizure susceptibility 1 homolog (mouse)"""	USH2C, MASS1		10976914, 14740321	Standard	NM_032119		Approved	DKFZp761P0710, KIAA0686, FEB4, VLGR1b	uc003kju.3	Q8WXG9	OTTHUMG00000162668	ENST00000405460.2:c.8616G>T	5.37:g.90002097G>T	ENSP00000384582:p.Lys2872Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O75171|Q8TF58|Q9H0X5|Q9UL61	Missense_Mutation	SNP	pfam_Calx_beta,pfam_EPTP,pfam_GPCR_2_secretin-like,pfam_GPS_dom,superfamily_ConA-like_lec_gl,superfamily_Gal_Oxase/kelch_b-propeller,smart_Calx_beta,pfscan_EAR,pfscan_GPS_dom,pfscan_GPCR_2-like	p.K2872N	ENST00000405460.2	37	c.8616	CCDS47246.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.43|14.43	2.532878|2.532878	0.45073|0.45073	.|.	.|.	ENSG00000164199|ENSG00000164199	ENST00000405460;ENST00000296619|ENST00000509621	T|.	0.26660|.	1.72|.	5.49|5.49	2.39|2.39	0.29439|0.29439	Na-Ca exchanger/integrin-beta4 (1);|.	0.580338|.	0.19175|.	N|.	0.120834|.	T|T	0.43612|0.43612	0.1255|0.1255	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	P;P|.	0.45768|.	0.866;0.775|.	P;P|.	0.51453|.	0.67;0.67|.	T|T	0.28202|0.28202	-1.0051|-1.0051	10|5	0.56958|.	D|.	0.05|.	.|.	1.9867|1.9867	0.03438|0.03438	0.1983:0.1412:0.4966:0.1639|0.1983:0.1412:0.4966:0.1639	.|.	2872;2872|.	E7ETI5;Q8WXG9|.	.;GPR98_HUMAN|.	N|I	2872|438	ENSP00000384582:K2872N|.	ENSP00000296619:K2872N|.	K|R	+|+	3|2	2|0	GPR98|GPR98	90037853|90037853	1.000000|1.000000	0.71417|0.71417	0.995000|0.995000	0.50966|0.50966	0.974000|0.974000	0.67602|0.67602	1.595000|1.595000	0.36708|0.36708	0.586000|0.586000	0.29626|0.29626	0.557000|0.557000	0.71058|0.71058	AAG|AGA	GPR98	-	smart_Calx_beta	ENSG00000164199		0.378	GPR98-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR98	HGNC	protein_coding	OTTHUMT00000369993.2	60	0.00	0	G	NM_032119		90002097	90002097	+1	no_errors	ENST00000405460	ensembl	human	known	69_37n	missense	66	14.29	11	SNP	0.999	T
GREB1	9687	genome.wustl.edu	37	2	11752669	11752669	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:11752669G>T	ENST00000381486.2	+	19	3355	c.3055G>T	c.(3055-3057)Gag>Tag	p.E1019*	GREB1_ENST00000396123.1_Nonsense_Mutation_p.E17*|GREB1_ENST00000234142.5_Nonsense_Mutation_p.E1019*	NM_014668.3	NP_055483.2	Q4ZG55	GREB1_HUMAN	growth regulation by estrogen in breast cancer 1	1019						integral component of membrane (GO:0016021)				breast(3)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)	30	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.115)|OV - Ovarian serous cystadenocarcinoma(76;0.186)		GACTTACTTGGAGCTGGAGGG	0.552																																					Ovarian(39;850 945 2785 23371 33093)	dbGAP											0													138.0	138.0	138.0					2																	11752669		1973	4154	6127	-	-	-	SO:0001587	stop_gained	0				CCDS33146.1, CCDS33147.1, CCDS42655.1	2p25.1	2010-02-17	2009-09-10		ENSG00000196208	ENSG00000196208			24885	protein-coding gene	gene with protein product	"""gene regulated by estrogen in breast cancer"""	611736				11103799	Standard	NM_014668		Approved	KIAA0575	uc002rbk.1	Q4ZG55	OTTHUMG00000141276	ENST00000381486.2:c.3055G>T	2.37:g.11752669G>T	ENSP00000370896:p.Glu1019*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD0|A6NKN0|B5MDA9|O60321|Q7Z5S2|Q9H2Q6|Q9H2Q7|Q9H2Q8	Nonsense_Mutation	SNP	NULL	p.E1019*	ENST00000381486.2	37	c.3055	CCDS42655.1	2	.	.	.	.	.	.	.	.	.	.	G	46	12.293649	0.99654	.	.	ENSG00000196208	ENST00000381486;ENST00000234142;ENST00000396123	.	.	.	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-17.7329	19.8101	0.96543	0.0:0.0:1.0:0.0	.	.	.	.	X	1019;1019;17	.	ENSP00000234142:E1019X	E	+	1	0	GREB1	11670120	1.000000	0.71417	0.998000	0.56505	0.907000	0.53573	9.073000	0.93992	2.696000	0.92011	0.655000	0.94253	GAG	GREB1	-	NULL	ENSG00000196208		0.552	GREB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GREB1	HGNC	protein_coding	OTTHUMT00000280490.1	95	0.00	0	G	NM_014668		11752669	11752669	+1	no_errors	ENST00000234142	ensembl	human	known	69_37n	nonsense	86	16.35	17	SNP	1.000	T
GRIA1	2890	genome.wustl.edu	37	5	153149727	153149727	+	Splice_Site	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:153149727G>C	ENST00000285900.5	+	13	2365		c.e13-1		GRIA1_ENST00000340592.5_Splice_Site|GRIA1_ENST00000448073.4_Splice_Site|GRIA1_ENST00000518783.1_Splice_Site|GRIA1_ENST00000521843.2_Splice_Site|GRIA1_ENST00000518142.1_Splice_Site	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1						ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	GTCCCTACCAGAGGTCTAAAA	0.458																																						dbGAP											0													149.0	146.0	147.0					5																	153149727		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2023-1G>C	5.37:g.153149727G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Splice_Site	SNP	-	e13-1	ENST00000285900.5	37	c.2053-1	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	G	20.7	4.031797	0.75504	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000537037;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	.	.	.	5.41	5.41	0.78517	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1724	0.89751	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	GRIA1	153129920	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	9.640000	0.98453	2.525000	0.85131	0.655000	0.94253	.	GRIA1	-	-	ENSG00000155511		0.458	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	78	0.00	0	G		Intron	153149727	153149727	+1	no_errors	ENST00000448073	ensembl	human	known	69_37n	splice_site	97	13.39	15	SNP	1.000	C
GRIN2A	2903	genome.wustl.edu	37	16	9858521	9858521	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:9858521C>T	ENST00000396573.2	-	14	3189	c.2880G>A	c.(2878-2880)atG>atA	p.M960I	GRIN2A_ENST00000396575.2_Missense_Mutation_p.M960I|GRIN2A_ENST00000404927.2_Missense_Mutation_p.M960I|GRIN2A_ENST00000562109.1_Missense_Mutation_p.M960I|GRIN2A_ENST00000330684.3_Missense_Mutation_p.M960I|GRIN2A_ENST00000535259.1_Missense_Mutation_p.M803I	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	960					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GGAGTTCGTTCATGTTGTCTC	0.443																																						dbGAP											0													183.0	160.0	168.0					16																	9858521		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.2880G>A	16.37:g.9858521C>T	ENSP00000379818:p.Met960Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.M960I	ENST00000396573.2	37	c.2880	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	0.130	-1.114353	0.01799	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000535259;ENST00000330684;ENST00000396575	T;T;T;T;T	0.08720	3.11;3.07;3.06;3.11;3.11	5.43	5.43	0.79202	Glutamate [NMDA] receptor, epsilon subunit, C-terminal (1);	0.226724	0.51477	D	0.000092	T	0.05640	0.0148	N	0.20401	0.57	0.26510	N	0.974614	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.002;0.001	T	0.34354	-0.9832	9	.	.	.	.	9.9033	0.41362	0.0:0.8451:0.0:0.1549	.	803;960;960	F5GZ52;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	I	960;960;803;960;960	ENSP00000379818:M960I;ENSP00000385872:M960I;ENSP00000441572:M803I;ENSP00000332549:M960I;ENSP00000379820:M960I	.	M	-	3	0	GRIN2A	9766022	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	1.099000	0.31013	2.547000	0.85894	0.655000	0.94253	ATG	GRIN2A	-	pfam_NMDAR2_C	ENSG00000183454		0.443	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	60	0.00	0	C			9858521	9858521	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	59	13.04	9	SNP	1.000	T
GRIP1	23426	genome.wustl.edu	37	12	66765534	66765534	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:66765534C>T	ENST00000398016.3	-	22	2864	c.2796G>A	c.(2794-2796)ctG>ctA	p.L932L	GRIP1_ENST00000286445.7_Silent_p.L969L|GRIP1_ENST00000359742.4_Silent_p.L984L	NM_021150.3	NP_066973.2	Q96DT0	LEG12_HUMAN	glutamate receptor interacting protein 1	0					intrinsic apoptotic signaling pathway (GO:0097193)	nucleus (GO:0005634)	lactose binding (GO:0030395)			NS(3)|breast(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(19)|ovary(2)|prostate(2)|skin(1)	50			GBM - Glioblastoma multiforme(2;0.00069)	GBM - Glioblastoma multiforme(28;0.0933)		TCATTTTTCTCAGGGTTACTG	0.507																																						dbGAP											0													177.0	181.0	180.0					12																	66765534		1977	4167	6144	-	-	-	SO:0001819	synonymous_variant	0			AJ133439	CCDS41807.1	12q13.13	2008-05-02			ENSG00000155974	ENSG00000155974			18708	protein-coding gene	gene with protein product		604597				10197531	Standard	NM_021150		Approved		uc001stk.3	Q9Y3R0	OTTHUMG00000169019	ENST00000398016.3:c.2796G>A	12.37:g.66765534C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9N2|G5E970|Q96DS9|Q96PR9|Q9H258|Q9H259|Q9NZ02	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L984	ENST00000398016.3	37	c.2952	CCDS41807.1	12																																																																																			GRIP1	-	superfamily_PDZ	ENSG00000155974		0.507	GRIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP1	HGNC	protein_coding	OTTHUMT00000401975.2	54	0.00	0	C			66765534	66765534	-1	no_errors	ENST00000359742	ensembl	human	known	69_37n	silent	67	16.25	13	SNP	1.000	T
GRK4	2868	genome.wustl.edu	37	4	2986304	2986304	+	Silent	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:2986304C>A	ENST00000398052.4	+	2	460	c.117C>A	c.(115-117)gtC>gtA	p.V39V	GRK4_ENST00000504933.1_Silent_p.V39V|GRK4_ENST00000345167.6_Intron|GRK4_ENST00000398051.4_Intron	NM_182982.2	NP_892027.2	P32298	GRK4_HUMAN	G protein-coupled receptor kinase 4	39	N-terminal.				G-protein coupled receptor internalization (GO:0002031)|receptor internalization (GO:0031623)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|signal transduction (GO:0007165)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)|rhodopsin kinase activity (GO:0050254)			lung(1)|upper_aerodigestive_tract(1)	2				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		TGCCTCCTGTCAGCCAGTGCA	0.403																																						dbGAP											0													96.0	82.0	87.0					4																	2986304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33946.1, CCDS33947.1, CCDS47002.1, CCDS68656.1	4p16.3	2008-02-05	2004-02-04	2004-02-06	ENSG00000125388	ENSG00000125388			4543	protein-coding gene	gene with protein product		137026	"""G protein-coupled receptor kinase 2-like (Drosophila)"""	GPRK2L		1338872	Standard	NM_182982		Approved	GPRK4	uc003ggn.1	P32298	OTTHUMG00000159914	ENST00000398052.4:c.117C>A	4.37:g.2986304C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00641|O00642|Q13293|Q13294|Q13295|Q14453|Q14725|Q15313|Q15314|Q15315|Q15316|Q17RH6|Q53EQ8	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom,prints_GPCR_kinase	p.V39	ENST00000398052.4	37	c.117	CCDS33946.1	4																																																																																			GRK4	-	superfamily_Regulat_G_prot_signal_superfam	ENSG00000125388		0.403	GRK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRK4	HGNC	protein_coding	OTTHUMT00000358176.2	26	0.00	0	C	NM_005307		2986304	2986304	+1	no_errors	ENST00000398052	ensembl	human	known	69_37n	silent	17	26.09	6	SNP	0.970	A
GUCA1C	9626	genome.wustl.edu	37	3	108672495	108672495	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:108672495C>T	ENST00000261047.3	-	1	247	c.115G>A	c.(115-117)Gaa>Aaa	p.E39K	GUCA1C_ENST00000393963.3_Missense_Mutation_p.E39K|GUCA1C_ENST00000471108.1_Missense_Mutation_p.E39K	NM_005459.3	NP_005450.3	O95843	GUC1C_HUMAN	guanylate cyclase activator 1C	39	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				phototransduction, visible light (GO:0007603)|positive regulation of guanylate cyclase activity (GO:0031284)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|visual perception (GO:0007601)	photoreceptor disc membrane (GO:0097381)	calcium ion binding (GO:0005509)|calcium sensitive guanylate cyclase activator activity (GO:0008048)			endometrium(2)|large_intestine(1)|liver(1)|lung(8)|pancreas(1)|skin(1)	14						GTCTTAAATTCATGTAGTGTT	0.388																																					NSCLC(157;1360 1999 30631 40189 44208)	dbGAP											0													171.0	175.0	174.0					3																	108672495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF110002	CCDS2954.1	3q13.1	2013-01-10			ENSG00000138472	ENSG00000138472		"""EF-hand domain containing"""	4680	protein-coding gene	gene with protein product	"""guanylyl cyclase-activating protein 3"""	605128				10037746, 11860507	Standard	NM_005459		Approved	GCAP3	uc003dxj.2	O95843	OTTHUMG00000159204	ENST00000261047.3:c.115G>A	3.37:g.108672495C>T	ENSP00000261047:p.Glu39Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95844|Q9UNM0	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Recoverin	p.E39K	ENST00000261047.3	37	c.115	CCDS2954.1	3	.	.	.	.	.	.	.	.	.	.	C	22.8	4.337967	0.81911	.	.	ENSG00000138472	ENST00000393963;ENST00000261047;ENST00000471108	T;T;T	0.75704	-0.96;-0.96;-0.96	5.35	3.54	0.40534	EF-hand-like domain (1);	0.100687	0.64402	D	0.000002	D	0.86188	0.5873	M	0.87381	2.88	0.40257	D	0.978139	D;P	0.89917	1.0;0.925	D;B	0.97110	1.0;0.25	D	0.87130	0.2196	10	0.87932	D	0	.	10.5382	0.45018	0.0:0.838:0.0:0.162	.	39;39	C9JNI2;O95843	.;GUC1C_HUMAN	K	39	ENSP00000377535:E39K;ENSP00000261047:E39K;ENSP00000417761:E39K	ENSP00000261047:E39K	E	-	1	0	GUCA1C	110155185	1.000000	0.71417	0.022000	0.16811	0.993000	0.82548	5.304000	0.65744	0.741000	0.32674	0.650000	0.86243	GAA	GUCA1C	-	NULL	ENSG00000138472		0.388	GUCA1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA1C	HGNC	protein_coding	OTTHUMT00000353819.1	70	0.00	0	C	NM_005459		108672495	108672495	-1	no_errors	ENST00000261047	ensembl	human	known	69_37n	missense	81	14.74	14	SNP	1.000	T
GUCA2B	2981	genome.wustl.edu	37	1	42619187	42619187	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:42619187G>A	ENST00000372581.1	+	1	96	c.66G>A	c.(64-66)caG>caA	p.Q22Q		NM_007102.2	NP_009033.1	Q16661	GUC2B_HUMAN	guanylate cyclase activator 2B (uroguanylin)	22					body fluid secretion (GO:0007589)|cGMP biosynthetic process (GO:0006182)|excretion (GO:0007588)|negative regulation of blood pressure (GO:0045776)|positive regulation of guanylate cyclase activity (GO:0031284)	extracellular vesicular exosome (GO:0070062)	calcium sensitive guanylate cyclase activator activity (GO:0008048)			breast(1)|large_intestine(2)	3	Ovarian(52;0.01)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				TGCTGCTGCAGAGCACACAGT	0.662																																						dbGAP											0													73.0	58.0	63.0					1																	42619187		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC069301	CCDS464.1	1p34-p33	2014-01-30			ENSG00000044012	ENSG00000044012		"""Endogenous ligands"""	4683	protein-coding gene	gene with protein product	"""prepro-uroguanylin"""	601271				8605041, 9268639	Standard	NM_007102		Approved		uc001chc.1	Q16661	OTTHUMG00000007024	ENST00000372581.1:c.66G>A	1.37:g.42619187G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LV0	Silent	SNP	pfam_Guanylin,superfamily_Guanylin,pirsf_Guanylin,prints_Guanylin	p.Q22	ENST00000372581.1	37	c.66	CCDS464.1	1																																																																																			GUCA2B	-	pfam_Guanylin,pirsf_Guanylin,prints_Guanylin	ENSG00000044012		0.662	GUCA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUCA2B	HGNC	protein_coding	OTTHUMT00000018307.1	35	0.00	0	G	NM_007102		42619187	42619187	+1	no_errors	ENST00000372581	ensembl	human	known	69_37n	silent	24	17.24	5	SNP	0.984	A
HAAO	23498	genome.wustl.edu	37	2	43015732	43015732	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:43015732G>C	ENST00000294973.6	-	2	151	c.96C>G	c.(94-96)ctC>ctG	p.L32L		NM_012205.2	NP_036337.2			3-hydroxyanthranilate 3,4-dioxygenase											breast(2)|cervix(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|urinary_tract(2)	11						ACATGACTTTGAGCTGCTCCT	0.582																																						dbGAP											0													192.0	151.0	165.0					2																	43015732		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z29481	CCDS33187.1	2p	2008-02-05			ENSG00000162882	ENSG00000162882	1.13.11.6		4796	protein-coding gene	gene with protein product		604521				7514594	Standard	NM_012205		Approved		uc002rst.4	P46952	OTTHUMG00000152348	ENST00000294973.6:c.96C>G	2.37:g.43015732G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_3hydroanth_dOase,pfam_Cupin_2,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	p.L32	ENST00000294973.6	37	c.96	CCDS33187.1	2																																																																																			HAAO	-	pfam_3hydroanth_dOase,superfamily_RmlC_Cupin,pirsf_3hydroanth_dOase_met,tigrfam_3hydroanth_dOase	ENSG00000162882		0.582	HAAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAAO	HGNC	protein_coding	OTTHUMT00000325948.2	74	0.00	0	G			43015732	43015732	-1	no_errors	ENST00000294973	ensembl	human	known	69_37n	silent	75	19.35	18	SNP	1.000	C
HARBI1	283254	genome.wustl.edu	37	11	46625236	46625236	+	Silent	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:46625236G>T	ENST00000326737.3	-	3	1141	c.894C>A	c.(892-894)ctC>ctA	p.L298L		NM_173811.3	NP_776172.1	Q96MB7	HARB1_HUMAN	harbinger transposase derived 1	298						centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nuclease activity (GO:0004518)			large_intestine(1)|prostate(1)|upper_aerodigestive_tract(1)	3						AGATGTTGTGGAGGACACAAC	0.562																																						dbGAP											0													84.0	77.0	80.0					11																	46625236		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AK057237	CCDS7920.1	11p11.2	2008-07-10	2008-07-01	2008-07-01	ENSG00000180423	ENSG00000180423			26522	protein-coding gene	gene with protein product		615086	"""chromosome 11 open reading frame 77"""	C11orf77		15169610, 18339812	Standard	NM_173811		Approved	FLJ32675	uc001ncy.3	Q96MB7	OTTHUMG00000166537	ENST00000326737.3:c.894C>A	11.37:g.46625236G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQP9	Silent	SNP	pfam_HARBI1_nuclease_put	p.L298	ENST00000326737.3	37	c.894	CCDS7920.1	11																																																																																			HARBI1	-	pfam_HARBI1_nuclease_put	ENSG00000180423		0.562	HARBI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HARBI1	HGNC	protein_coding	OTTHUMT00000390291.1	70	0.00	0	G	NM_173811		46625236	46625236	-1	no_errors	ENST00000326737	ensembl	human	known	69_37n	silent	44	24.14	14	SNP	1.000	T
HCRTR1	3061	genome.wustl.edu	37	1	32092459	32092459	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:32092459C>T	ENST00000373706.5	+	7	1309	c.1156C>T	c.(1156-1158)Ctg>Ttg	p.L386L	HCRTR1_ENST00000468521.1_Intron|HCRTR1_ENST00000403528.2_Silent_p.L386L|HCRTR1_ENST00000373705.1_Intron			O43613	OX1R_HUMAN	hypocretin (orexin) receptor 1	386					feeding behavior (GO:0007631)|neuropeptide signaling pathway (GO:0007218)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|orexin receptor activity (GO:0016499)|peptide hormone binding (GO:0017046)	p.L386V(1)		breast(2)|large_intestine(1)|lung(2)|ovary(1)|prostate(1)	7		Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Breast(348;0.116)		STAD - Stomach adenocarcinoma(196;0.053)		CTGCGGCTCTCTGAAGGCCCC	0.582																																						dbGAP											1	Substitution - Missense(1)	breast(1)											102.0	107.0	105.0					1																	32092459		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF041243	CCDS344.1	1p33	2012-08-08			ENSG00000121764	ENSG00000121764		"""GPCR / Class A : Hypocretin (orexin) receptors"""	4848	protein-coding gene	gene with protein product		602392				9491897	Standard	NM_001525		Approved	OX1R	uc009vtx.2	O43613	OTTHUMG00000003876	ENST00000373706.5:c.1156C>T	1.37:g.32092459C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3A6|Q9HBV6	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Orexin_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Orexin_rcpt_1,prints_NPY_rcpt	p.L386	ENST00000373706.5	37	c.1156	CCDS344.1	1																																																																																			HCRTR1	-	NULL	ENSG00000121764		0.582	HCRTR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCRTR1	HGNC	protein_coding	OTTHUMT00000011042.1	26	0.00	0	C	NM_001525		32092459	32092459	+1	no_errors	ENST00000373706	ensembl	human	known	69_37n	silent	27	22.86	8	SNP	1.000	T
HEATR4	399671	genome.wustl.edu	37	14	73969631	73969631	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:73969631C>G	ENST00000553558.1	-	11	2394	c.2073G>C	c.(2071-2073)atG>atC	p.M691I	HEATR4_ENST00000334988.2_Missense_Mutation_p.M691I|HEATR4_ENST00000560393.1_Missense_Mutation_p.M644I	NM_001220484.1	NP_001207413.1	Q86WZ0	HEAT4_HUMAN	HEAT repeat containing 4	691										breast(3)|endometrium(2)|kidney(2)|large_intestine(7)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00386)|OV - Ovarian serous cystadenocarcinoma(108;0.0719)		TCCCGAGGCTCATTTGCCCAA	0.463																																						dbGAP											0													155.0	136.0	142.0					14																	73969631		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047590	CCDS9815.1, CCDS9815.2	14q24.3	2013-09-20			ENSG00000187105	ENSG00000187105			16761	protein-coding gene	gene with protein product						15489334	Standard	NM_203309		Approved	MGC48595	uc021rwf.2	Q86WZ0	OTTHUMG00000171602	ENST00000553558.1:c.2073G>C	14.37:g.73969631C>G	ENSP00000450444:p.Met691Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7V9|E9KL41	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.M691I	ENST00000553558.1	37	c.2073	CCDS9815.2	14	.	.	.	.	.	.	.	.	.	.	C	11.18	1.562551	0.27915	.	.	ENSG00000187105	ENST00000553558;ENST00000334988	T	0.10099	2.91	5.33	4.44	0.53790	Armadillo-like helical (1);Armadillo-type fold (1);	0.185700	0.38217	N	0.001780	T	0.08935	0.0221	L	0.44542	1.39	0.26792	N	0.969389	B	0.17465	0.022	B	0.12837	0.008	T	0.28554	-1.0040	10	0.20519	T	0.43	-7.5222	7.6079	0.28113	0.0:0.7456:0.1657:0.0886	.	691	Q86WZ0	HEAT4_HUMAN	I	691;644	ENSP00000450444:M691I	ENSP00000335447:M644I	M	-	3	0	HEATR4	73039384	0.994000	0.37717	0.999000	0.59377	0.450000	0.32258	2.255000	0.43222	1.253000	0.44018	0.455000	0.32223	ATG	HEATR4	-	superfamily_ARM-type_fold	ENSG00000187105		0.463	HEATR4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	HEATR4	HGNC	protein_coding	OTTHUMT00000414422.2	51	0.00	0	C	NM_203309		73969631	73969631	-1	no_errors	ENST00000334988	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	0.997	G
HES1	3280	genome.wustl.edu	37	3	193854434	193854434	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:193854434G>A	ENST00000232424.3	+	2	373	c.137G>A	c.(136-138)cGa>cAa	p.R46Q		NM_005524.3	NP_005515.1	P30042	ES1_HUMAN	hes family bHLH transcription factor 1	0						mitochondrion (GO:0005739)				endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(1)	6	all_cancers(143;7.3e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;3.65e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;1.48e-05)		GAGAAAAGACGAAGAGCAAGA	0.408																																						dbGAP											0													66.0	72.0	70.0					3																	193854434		2203	4300	6503	-	-	-	SO:0001583	missense	0			L19314	CCDS3305.1	3q28-q29	2013-10-17	2013-10-17	2003-01-10	ENSG00000114315	ENSG00000114315		"""Basic helix-loop-helix proteins"""	5192	protein-coding gene	gene with protein product		139605	"""hairy homolog (Drosophila)"", ""hairy and enhancer of split 1, (Drosophila)"""	HRY		8020957	Standard	NM_005524		Approved	FLJ20408, HES-1, Hes1, bHLHb39	uc003ftq.2	Q14469	OTTHUMG00000155984	ENST00000232424.3:c.137G>A	3.37:g.193854434G>A	ENSP00000232424:p.Arg46Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFJ6|A6NJY7|O00650|O00660|O15011|O15012|P55346|P78474|Q92505|Q92507	Missense_Mutation	SNP	pfam_Orange,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.R46Q	ENST00000232424.3	37	c.137	CCDS3305.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.247165	0.95305	.	.	ENSG00000114315	ENST00000232424	D	0.99722	-6.53	5.57	5.57	0.84162	Helix-loop-helix DNA-binding (5);	0.052913	0.64402	D	0.000001	D	0.99857	0.9933	H	0.98238	4.18	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.983;1.0	D	0.96645	0.9477	10	0.87932	D	0	-26.2485	18.1225	0.89576	0.0:0.0:1.0:0.0	.	46;46	B4DU36;Q14469	.;HES1_HUMAN	Q	46	ENSP00000232424:R46Q	ENSP00000232424:R46Q	R	+	2	0	HES1	195337128	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.562000	0.98145	2.625000	0.88918	0.655000	0.94253	CGA	HES1	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000114315		0.408	HES1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HES1	HGNC	protein_coding	OTTHUMT00000342632.1	72	0.00	0	G			193854434	193854434	+1	no_errors	ENST00000232424	ensembl	human	known	69_37n	missense	30	23.08	9	SNP	1.000	A
HEYL	26508	genome.wustl.edu	37	1	40098333	40098333	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:40098333C>T	ENST00000372852.3	-	2	454	c.135G>A	c.(133-135)aaG>aaA	p.K45K	HEYL_ENST00000535435.1_Silent_p.K17K|RP1-144F13.3_ENST00000424418.1_RNA	NM_014571.3	NP_055386	Q9NQ87	HEYL_HUMAN	hes-related family bHLH transcription factor with YRPW motif-like	45	Transcriptional repression and interaction with NCOR1 and SIN3A. {ECO:0000250}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				atrioventricular valve morphogenesis (GO:0003181)|cardiac epithelial to mesenchymal transition (GO:0060317)|cardiac ventricle morphogenesis (GO:0003208)|cellular response to BMP stimulus (GO:0071773)|endocardial cushion morphogenesis (GO:0003203)|epithelial to mesenchymal transition involved in endocardial cushion formation (GO:0003198)|glomerulus development (GO:0032835)|mesenchymal cell development (GO:0014031)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|proximal tubule development (GO:0072014)|pulmonary valve morphogenesis (GO:0003184)|skeletal muscle cell differentiation (GO:0035914)|ventricular septum morphogenesis (GO:0060412)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	AF-1 domain binding (GO:0050683)|microsatellite binding (GO:0035939)|protein binding transcription factor activity (GO:0000988)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|large_intestine(2)|lung(2)|ovary(1)	7	Lung NSC(20;3.81e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.1e-18)|Epithelial(16;2.77e-17)|all cancers(16;5.64e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			CTCTGTGTTTCTTCCTGGCTT	0.577																																						dbGAP											0													166.0	173.0	170.0					1																	40098333		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006087	CCDS439.1	1p34.3	2013-10-17	2013-10-17		ENSG00000163909	ENSG00000163909		"""Basic helix-loop-helix proteins"""	4882	protein-coding gene	gene with protein product	"""hairy/enhancer-of-split related with YRPW motif 3"""	609034	"""hairy/enhancer-of-split related with YRPW motif-like"""			10415358, 10860664	Standard	NM_014571		Approved	bHLHb33, HEY3, HESR3	uc001cdp.3	Q9NQ87	OTTHUMG00000000458	ENST00000372852.3:c.135G>A	1.37:g.40098333C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TG99	Silent	SNP	pfam_HLH_DNA-bd,pfam_Orange,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_Orange_subgr,pfscan_Orange,pfscan_HLH_DNA-bd	p.K45	ENST00000372852.3	37	c.135	CCDS439.1	1																																																																																			HEYL	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000163909		0.577	HEYL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEYL	HGNC	protein_coding	OTTHUMT00000001179.2	90	0.00	0	C	NM_014571		40098333	40098333	-1	no_errors	ENST00000372852	ensembl	human	known	69_37n	silent	42	21.82	12	SNP	1.000	T
HHLA1	10086	genome.wustl.edu	37	8	133088304	133088304	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:133088304G>A	ENST00000414222.1	-	13	1312	c.1313C>T	c.(1312-1314)tCa>tTa	p.S438L	OC90_ENST00000262283.5_Missense_Mutation_p.S180L|HHLA1_ENST00000434736.2_Missense_Mutation_p.S474L	NM_001145095.1	NP_001138567.1	C9JL84	HHLA1_HUMAN	HERV-H LTR-associating 1	438						extracellular region (GO:0005576)				endometrium(6)|kidney(1)|lung(2)|skin(1)|stomach(2)	12						GTACTTACTTGAAACTTGATG	0.448																																						dbGAP											0													147.0	138.0	141.0					8																	133088304		692	1591	2283	-	-	-	SO:0001583	missense	0			AF110315		8q24	2011-03-01			ENSG00000132297	ENSG00000132297			4904	protein-coding gene	gene with protein product		604109		PLA2L		10329003	Standard	NM_001145095		Approved		uc011liy.1	C9JL84	OTTHUMG00000140390	ENST00000414222.1:c.1313C>T	8.37:g.133088304G>A	ENSP00000388322:p.Ser438Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S438L	ENST00000414222.1	37	c.1313		8	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439438	0.43326	.	.	ENSG00000258417;ENSG00000132297;ENSG00000132297	ENST00000262283;ENST00000414222;ENST00000434736	T	0.41758	0.99	4.1	3.21	0.36854	.	.	.	.	.	T	0.49423	0.1556	L	0.34521	1.04	0.21762	N	0.999559	D;D	0.67145	0.992;0.996	P;D	0.66847	0.838;0.947	T	0.29336	-1.0015	9	0.59425	D	0.04	1.6521	9.9174	0.41444	0.0:0.2071:0.7929:0.0	.	438;295	C9JL84;C9JL84-2	HHLA1_HUMAN;.	L	180;438;474	ENSP00000262283:S180L	ENSP00000388322:S438L	S	-	2	0	RP11-240B13.2;HHLA1	133157486	0.982000	0.34865	0.443000	0.26883	0.153000	0.21895	2.363000	0.44178	1.294000	0.44707	0.563000	0.77884	TCA	HHLA1	-	NULL	ENSG00000132297		0.448	HHLA1-201	KNOWN	basic|appris_principal	protein_coding	HHLA1	HGNC	protein_coding		73	0.00	0	G	XR_017860		133088304	133088304	-1	no_errors	ENST00000414222	ensembl	human	known	69_37n	missense	43	15.69	8	SNP	0.560	A
HIRA	7290	genome.wustl.edu	37	22	19346930	19346930	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:19346930C>T	ENST00000263208.5	-	18	2419	c.2163G>A	c.(2161-2163)ctG>ctA	p.L721L	HIRA_ENST00000340170.4_Intron|HIRA_ENST00000541063.1_Silent_p.L677L|HIRA_ENST00000546308.1_Silent_p.L677L	NM_003325.3	NP_003316.3	P54198	HIRA_HUMAN	histone cell cycle regulator	721	Interaction with CCNA1.|Interaction with PAX3. {ECO:0000250}.|Interaction with histone H2B.				anatomical structure morphogenesis (GO:0009653)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|gastrulation (GO:0007369)|muscle cell differentiation (GO:0042692)|osteoblast differentiation (GO:0001649)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|ovary(2)|prostate(1)|skin(1)	37	Colorectal(54;0.0993)					GGTTGCACTTCAGGCGGCTCA	0.602																																						dbGAP											0													160.0	133.0	142.0					22																	19346930		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X75296	CCDS13759.1	22q11.2	2013-05-03	2013-05-03		ENSG00000100084	ENSG00000100084		"""WD repeat domain containing"""	4916	protein-coding gene	gene with protein product	"""DiGeorge critical region gene 1"""	600237	"""HIR (histone cell cycle regulation defective) homolog A (S. cerevisiae)"", ""HIR histone cell cycle regulation defective homolog A (S. cerevisiae)"""	TUPLE1		8111380, 7633437, 9731536	Standard	NM_003325		Approved	DGCR1, TUP1	uc002zpf.1	P54198	OTTHUMG00000150134	ENST00000263208.5:c.2163G>A	22.37:g.19346930C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q05BU9|Q8IXN2	Silent	SNP	pfam_Hira,pfam_WD40_repeat,pfam_HIRA_B_motif,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L721	ENST00000263208.5	37	c.2163	CCDS13759.1	22																																																																																			HIRA	-	NULL	ENSG00000100084		0.602	HIRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIRA	HGNC	protein_coding	OTTHUMT00000316488.2	93	0.00	0	C	NM_003325		19346930	19346930	-1	no_errors	ENST00000263208	ensembl	human	known	69_37n	silent	92	18.58	21	SNP	0.995	T
HIST2H3D	653604	genome.wustl.edu	37	1	149784945	149784945	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:149784945C>G	ENST00000331491.1	-	1	291	c.292G>C	c.(292-294)Gag>Cag	p.E98Q	HIST2H2BF_ENST00000369167.1_5'Flank|HIST2H2BF_ENST00000427880.2_5'Flank|HIST2H2BF_ENST00000545683.1_5'Flank|HIST2H2BF_ENST00000469483.1_5'Flank|RP11-196G18.21_ENST00000420462.1_RNA	NM_001123375.2	NP_001116847.1	Q71DI3	H32_HUMAN	histone cluster 2, H3d	98					blood coagulation (GO:0007596)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			biliary_tract(1)|endometrium(1)|large_intestine(1)|liver(1)|lung(3)	7						AGGTAGGCCTCGCTGGCCTCC	0.642																																						dbGAP											0													21.0	24.0	23.0					1																	149784945		1559	3540	5099	-	-	-	SO:0001583	missense	0			AL591493	CCDS41388.1	1q21.2	2012-03-08	2006-10-11		ENSG00000183598	ENSG00000183598		"""Histones / Replication-dependent"""	25311	protein-coding gene	gene with protein product			"""histone 2, H3d"""				Standard	NM_001123375		Approved		uc010pbl.2	Q71DI3	OTTHUMG00000012092	ENST00000331491.1:c.292G>C	1.37:g.149784945C>G	ENSP00000333277:p.Glu98Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2BDF6|A6NFS4|Q6B053	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E98Q	ENST00000331491.1	37	c.292	CCDS41388.1	1	.	.	.	.	.	.	.	.	.	.	C	17.71	3.456023	0.63401	.	.	ENSG00000183598	ENST00000331491	T	0.78481	-1.18	4.1	3.18	0.36537	.	0.000000	0.53938	U	0.000046	T	0.77452	0.4132	.	.	.	0.50039	D	0.999849	.	.	.	.	.	.	T	0.80365	-0.1413	7	0.87932	D	0	.	10.8541	0.46789	0.0:0.9049:0.0:0.0951	.	.	.	.	Q	98	ENSP00000333277:E98Q	ENSP00000333277:E98Q	E	-	1	0	HIST2H3D	148051569	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.337000	0.52120	1.080000	0.41073	0.436000	0.28706	GAG	HIST2H3D	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000183598		0.642	HIST2H3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST2H3D	HGNC	protein_coding	OTTHUMT00000033452.1	46	0.00	0	C	NM_001123375		149784945	149784945	-1	no_errors	ENST00000331491	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	1.000	G
HMCN1	83872	genome.wustl.edu	37	1	186106009	186106009	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:186106009G>C	ENST00000271588.4	+	87	13751	c.13522G>C	c.(13522-13524)Gaa>Caa	p.E4508Q	HMCN1_ENST00000367492.2_Missense_Mutation_p.E4508Q	NM_031935.2	NP_114141.2	Q96RW7	HMCN1_HUMAN	hemicentin 1	4508	Ig-like C2-type 44.				response to stimulus (GO:0050896)|visual perception (GO:0007601)	basement membrane (GO:0005604)|cell cortex (GO:0005938)|cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			NS(2)|autonomic_ganglia(1)|breast(10)|central_nervous_system(2)|cervix(1)|endometrium(28)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(58)|liver(3)|lung(101)|ovary(23)|pancreas(4)|prostate(20)|skin(8)|stomach(1)|upper_aerodigestive_tract(11)|urinary_tract(18)	308						CTCTGAATTTGAATGTGTTGC	0.433																																						dbGAP											0													128.0	127.0	127.0					1																	186106009		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF156100	CCDS30956.1	1q25.3-q31.1	2013-01-11			ENSG00000143341	ENSG00000143341		"""Fibulins"", ""Immunoglobulin superfamily / I-set domain containing"""	19194	protein-coding gene	gene with protein product	"""fibulin 6"""	608548	"""age-related macular degeneration 1 (senile macular degeneration)"""	ARMD1		11222143	Standard	NM_031935		Approved	FBLN6, FIBL6, FIBL-6	uc001grq.1	Q96RW7	OTTHUMG00000059337	ENST00000271588.4:c.13522G>C	1.37:g.186106009G>C	ENSP00000271588:p.Glu4508Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGE3|Q5TYR7|Q96DN3|Q96DN8|Q96SC3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_G2_nidogen/fibulin_G2F,pfam_EGF-like_Ca-bd,pfam_Thrombospondin_1_rpt,superfamily_Green_fluorescent_prot-like,superfamily_Thrombospondin_1_rpt,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Thrombospondin_1_rpt,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.E4508Q	ENST00000271588.4	37	c.13522	CCDS30956.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.947873	0.73787	.	.	ENSG00000143341	ENST00000271588;ENST00000367492	T;T	0.68479	-0.33;-0.33	5.19	5.19	0.71726	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.044083	0.85682	D	0.000000	T	0.69387	0.3105	N	0.17594	0.5	0.58432	D	0.999995	D	0.76494	0.999	D	0.83275	0.996	T	0.64567	-0.6377	10	0.15499	T	0.54	.	19.08	0.93178	0.0:0.0:1.0:0.0	.	4508	Q96RW7	HMCN1_HUMAN	Q	4508	ENSP00000271588:E4508Q;ENSP00000356462:E4508Q	ENSP00000271588:E4508Q	E	+	1	0	HMCN1	184372632	1.000000	0.71417	1.000000	0.80357	0.869000	0.49853	5.098000	0.64548	2.587000	0.87381	0.655000	0.94253	GAA	HMCN1	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	ENSG00000143341		0.433	HMCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMCN1	HGNC	protein_coding	OTTHUMT00000131848.1	51	0.00	0	G	NM_031935		186106009	186106009	+1	no_errors	ENST00000271588	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	1.000	C
HMGN2P46	283651	genome.wustl.edu	37	15	45839312	45839312	+	RNA	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:45839312G>A	ENST00000409454.1	+	0	682							Q86SG4	DPCA2_HUMAN	high mobility group nucleosomal binding domain 2 pseudogene 46																		tttgttctctgaccagaggtt	0.502																																						dbGAP											0													45.0	37.0	40.0					15																	45839312		1322	2307	3629	-	-	-			0			AK096745		15q15.1	2013-09-18	2011-04-05	2010-12-07	ENSG00000179362	ENSG00000179362		"""High mobility group / Nucleosome binding pseudogenes"""	26817	pseudogene	pseudogene		611314	"""chromosome 15 open reading frame 21"", ""high-mobility group nucleosomal binding domain 2 pseudogene 46"""	C15orf21		15027122, 12727900, 24043589	Standard	NR_022014		Approved	FLJ39426, D-PCa-2	uc001zvn.2	Q86SG4	OTTHUMG00000153087		15.37:g.45839312G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q495B5|Q86SH8|Q8N8I5	RNA	SNP	-	NULL	ENST00000409454.1	37	NULL		15																																																																																			HMGN2P46	-	-	ENSG00000179362		0.502	HMGN2P46-002	KNOWN	basic	processed_transcript	HMGN2P46	HGNC	pseudogene	OTTHUMT00000329443.1	33	0.00	0	G	NR_022014		45839312	45839312	+1	no_errors	ENST00000313559	ensembl	human	known	69_37n	rna	12	58.62	17	SNP	0.081	A
HNRNPA1	3178	genome.wustl.edu	37	12	54676905	54676905	+	Missense_Mutation	SNP	G	G	C	rs571296677		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:54676905G>C	ENST00000340913.6	+	8	847	c.794G>C	c.(793-795)aGa>aCa	p.R265T	HNRNPA1_ENST00000547276.1_Intron|HNRNPA1_ENST00000546500.1_Intron|HNRNPA1_ENST00000330752.8_Intron|RP11-968A15.8_ENST00000553061.1_RNA	NM_002136.2|NM_031157.2	NP_002127.1|NP_112420.1	P09651	ROA1_HUMAN	heterogeneous nuclear ribonucleoprotein A1	265	Gly-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|mRNA transport (GO:0051028)|nuclear export (GO:0051168)|nuclear import (GO:0051170)|RNA export from nucleus (GO:0006405)|RNA splicing (GO:0008380)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)|single-stranded RNA binding (GO:0003727)			endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	20						GGAGGAAGCAGAGGCTATGGA	0.498																																					Colon(83;502 1289 8436 16406 24870)	dbGAP											0													63.0	67.0	66.0					12																	54676905		2014	4167	6181	-	-	-	SO:0001583	missense	0			BC009600	CCDS41793.1, CCDS44909.1	12q13.1	2013-10-11		2007-08-16	ENSG00000135486	ENSG00000135486		"""RNA binding motif (RRM) containing"""	5031	protein-coding gene	gene with protein product		164017		HNRPA1		1733858	Standard	XR_245923		Approved	hnRNPA1, hnRNP-A1	uc001sfl.3	P09651		ENST00000340913.6:c.794G>C	12.37:g.54676905G>C	ENSP00000341826:p.Arg265Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4Z8|Q3MIB7|Q6PJZ7	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R265T	ENST00000340913.6	37	c.794	CCDS44909.1	12	.	.	.	.	.	.	.	.	.	.	G	13.32	2.201904	0.38905	.	.	ENSG00000135486	ENST00000340913	D	0.84146	-1.81	3.87	3.87	0.44632	.	.	.	.	.	D	0.87325	0.6149	L	0.48642	1.525	0.80722	D	1	P	0.51653	0.947	D	0.67231	0.95	T	0.82402	-0.0475	9	0.10636	T	0.68	.	14.1269	0.65228	0.0:0.0:1.0:0.0	.	265	P09651	ROA1_HUMAN	T	265	ENSP00000341826:R265T	ENSP00000341826:R265T	R	+	2	0	HNRNPA1	52963172	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	7.527000	0.81931	2.468000	0.83385	0.305000	0.20034	AGA	HNRNPA1	-	NULL	ENSG00000135486		0.498	HNRNPA1-002	KNOWN	basic|CCDS	protein_coding	HNRNPA1	HGNC	protein_coding	OTTHUMT00000405480.1	121	0.00	0	G	NM_031157		54676905	54676905	+1	no_errors	ENST00000340913	ensembl	human	known	69_37n	missense	95	15.93	18	SNP	1.000	C
HUWE1	10075	genome.wustl.edu	37	X	53570803	53570803	+	Splice_Site	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:53570803G>A	ENST00000342160.3	-	72	11835	c.11378C>T	c.(11377-11379)aCg>aTg	p.T3793M	HUWE1_ENST00000262854.6_Splice_Site_p.T3793M|HUWE1_ENST00000474288.1_5'UTR			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	3793					base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						CATGCTAACCGTTGCTGCTTG	0.527																																						dbGAP											0													101.0	60.0	74.0					X																	53570803		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.11379+1C>T	X.37:g.53570803G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.T3793M	ENST00000342160.3	37	c.11378	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	g	11.01	1.514267	0.27123	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.37915	1.17;1.17	4.93	4.93	0.64822	.	2.316170	0.01628	N	0.023409	T	0.55178	0.1904	L	0.29908	0.895	0.46185	D	0.998915	P;D	0.89917	0.714;1.0	B;D	0.80764	0.22;0.994	T	0.25257	-1.0137	10	0.33940	T	0.23	.	16.1273	0.81404	0.0:0.0:1.0:0.0	.	3793;3777	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	M	3793	ENSP00000340648:T3793M;ENSP00000262854:T3793M	ENSP00000262854:T3793M	T	-	2	0	HUWE1	53587528	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.048000	0.71046	2.057000	0.61298	0.534000	0.68092	ACG	HUWE1	-	NULL	ENSG00000086758		0.527	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	40	0.00	0	G	XM_497119	Missense_Mutation	53570803	53570803	-1	no_errors	ENST00000262854	ensembl	human	known	69_37n	missense	63	12.50	9	SNP	1.000	A
HYDIN	54768	genome.wustl.edu	37	16	71163612	71163612	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:71163612C>T	ENST00000393567.2	-	9	1308	c.1158G>A	c.(1156-1158)gcG>gcA	p.A386A	HYDIN_ENST00000288168.10_Silent_p.A403A|HYDIN_ENST00000321489.5_Silent_p.A386A|HYDIN_ENST00000448089.2_Silent_p.A386A|HYDIN_ENST00000393550.2_Silent_p.A386A|HYDIN_ENST00000541601.1_Silent_p.A403A|HYDIN_ENST00000538248.1_Silent_p.A413A|HYDIN_ENST00000448691.1_Silent_p.A386A	NM_001270974.1	NP_001257903.1	Q4G0P3	HYDIN_HUMAN	HYDIN, axonemal central pair apparatus protein	386					cilium assembly (GO:0042384)|cilium movement (GO:0003341)|epithelial cell development (GO:0002064)|trachea development (GO:0060438)|ventricular system development (GO:0021591)	cell projection (GO:0042995)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(12)|ovary(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	43		Ovarian(137;0.0654)				TCCTCTGATTCGCAAAGGTTC	0.448																																						dbGAP											0													64.0	64.0	64.0					16																	71163612		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AK074472	CCDS10897.1, CCDS56004.1, CCDS56005.1, CCDS59269.1	16q22.2	2014-02-05	2012-01-06		ENSG00000157423	ENSG00000157423		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	19368	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 31"""	610812	"""hydrocephalus inducing"", ""hydrocephalus inducing homolog (mouse)"""			12719380, 23022101	Standard	NM_001198542		Approved	DKFZp434D0513, KIAA1864, PPP1R31, CILD5	uc031qwy.1	Q4G0P3	OTTHUMG00000137584	ENST00000393567.2:c.1158G>A	16.37:g.71163612C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC70|A6NLZ0|B4DQY4|B4DRN4|F5H6V3|Q8N3H8|Q8N3P6|Q8TC08|Q96JG3|Q96SS4|Q9H5U3|Q9H9B8|Q9NTI0|Q9UBE5	Silent	SNP	superfamily_PapD-like	p.A386	ENST00000393567.2	37	c.1158	CCDS59269.1	16																																																																																			HYDIN	-	NULL	ENSG00000157423		0.448	HYDIN-001	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	HYDIN	HGNC	protein_coding	OTTHUMT00000398624.3	59	0.00	0	C			71163612	71163612	-1	no_errors	ENST00000316490	ensembl	human	known	69_37n	silent	40	20.00	10	SNP	0.997	T
IGF2BP2	10644	genome.wustl.edu	37	3	185375096	185375096	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:185375096C>T	ENST00000382199.2	-	12	1459	c.1364G>A	c.(1363-1365)aGa>aAa	p.R455K	IGF2BP2_ENST00000421047.2_Missense_Mutation_p.R398K|IGF2BP2_ENST00000457616.2_Missense_Mutation_p.R461K|IGF2BP2_ENST00000346192.3_Missense_Mutation_p.R412K|IGF2BP2_ENST00000494906.1_5'UTR	NM_006548.4	NP_006539.3	Q9Y6M1	IF2B2_HUMAN	insulin-like growth factor 2 mRNA binding protein 2	455	KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|translation regulator activity (GO:0045182)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)|skin(3)	20	all_cancers(143;5.84e-11)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(80;7.41e-21)			TCCGGCGAATCTCGCCAGCTG	0.592																																						dbGAP											0													65.0	59.0	61.0					3																	185375096		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC021290	CCDS3273.2, CCDS33903.1	3q27.2	2013-02-12			ENSG00000073792	ENSG00000073792		"""RNA binding motif (RRM) containing"""	28867	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 2"""	608289				10190901, 9891060	Standard	NM_001007225		Approved	IMP-2	uc003fpo.3	Q9Y6M1	OTTHUMG00000074025	ENST00000382199.2:c.1364G>A	3.37:g.185375096C>T	ENSP00000371634:p.Arg455Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0A4Z0|B3FTN2|B3FTN3|B3FTN4	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.R455K	ENST00000382199.2	37	c.1364	CCDS3273.2	3	.	.	.	.	.	.	.	.	.	.	C	19.82	3.898795	0.72639	.	.	ENSG00000073792	ENST00000382199;ENST00000421047;ENST00000457616;ENST00000346192	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.22	5.22	0.72569	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.052608	0.64402	D	0.000001	T	0.28896	0.0717	L	0.33485	1.01	0.49915	D	0.999833	B;B;B;B;B;B	0.33171	0.238;0.107;0.4;0.4;0.026;0.066	B;B;B;B;B;B	0.35470	0.108;0.093;0.203;0.203;0.032;0.106	T	0.05178	-1.0901	10	0.44086	T	0.13	-8.9089	17.9191	0.88961	0.0:1.0:0.0:0.0	.	349;392;398;461;412;455	Q9Y6M1-5;Q9Y6M1-3;Q9Y6M1-4;F8W930;Q9Y6M1-1;Q9Y6M1	.;.;.;.;.;IF2B2_HUMAN	K	455;398;461;412	ENSP00000371634:R455K;ENSP00000413787:R398K;ENSP00000410242:R461K;ENSP00000320204:R412K	ENSP00000320204:R412K	R	-	2	0	IGF2BP2	186857790	0.847000	0.29606	0.273000	0.24645	0.995000	0.86356	6.011000	0.70760	2.586000	0.87340	0.655000	0.94253	AGA	IGF2BP2	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000073792		0.592	IGF2BP2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGF2BP2	HGNC	protein_coding	OTTHUMT00000157087.2	38	0.00	0	C	NM_006548		185375096	185375096	-1	no_errors	ENST00000382199	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	0.990	T
IGF2R	3482	genome.wustl.edu	37	6	160445709	160445709	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:160445709C>G	ENST00000356956.1	+	5	767	c.619C>G	c.(619-621)Cta>Gta	p.L207V		NM_000876.2	NP_000867	P11717	MPRI_HUMAN	insulin-like growth factor 2 receptor	207					insulin-like growth factor receptor signaling pathway (GO:0048009)|liver development (GO:0001889)|organ regeneration (GO:0031100)|positive regulation of apoptotic process (GO:0043065)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|response to retinoic acid (GO:0032526)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|clathrin coat (GO:0030118)|endocytic vesicle (GO:0030139)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)|nuclear envelope lumen (GO:0005641)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network transport vesicle (GO:0030140)	G-protein coupled receptor activity (GO:0004930)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|insulin-like growth factor-activated receptor activity (GO:0005010)|mannose binding (GO:0005537)|phosphoprotein binding (GO:0051219)|receptor activity (GO:0004872)|retinoic acid binding (GO:0001972)|transporter activity (GO:0005215)			breast(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(27)|lung(31)|ovary(3)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	95		Breast(66;0.000777)|Ovarian(120;0.0305)		OV - Ovarian serous cystadenocarcinoma(65;2.45e-17)|BRCA - Breast invasive adenocarcinoma(81;1.09e-05)	Mecasermin(DB01277)	GGACACTTCTCTATTCATCAA	0.443																																						dbGAP											0													176.0	156.0	163.0					6																	160445709		2203	4300	6503	-	-	-	SO:0001583	missense	0			J03528	CCDS5273.1	6q25.3	2014-09-16			ENSG00000197081	ENSG00000197081		"""CD molecules"""	5467	protein-coding gene	gene with protein product	"""cation-independent mannose-6 phosphate receptor"""	147280					Standard	NM_000876		Approved	CD222, MPRI, MPR1, CIMPR, M6P-R	uc003qta.3	P11717	OTTHUMG00000015945	ENST00000356956.1:c.619C>G	6.37:g.160445709C>G	ENSP00000349437:p.Leu207Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z7G9|Q96PT5	Missense_Mutation	SNP	pfam_CIMR,pfam_FN_type2_col-bd,superfamily_Man6P_isomerase_rcpt-bd_dom,superfamily_Kringle-like,smart_FN_type2_col-bd,pfscan_FN_type2_col-bd	p.L207V	ENST00000356956.1	37	c.619	CCDS5273.1	6	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342419	0.61073	.	.	ENSG00000197081	ENST00000356956	T	0.02158	4.42	5.58	3.55	0.40652	Mannose-6-phosphate receptor, binding (1);	0.058669	0.64402	D	0.000001	T	0.05731	0.0150	M	0.87038	2.855	0.34233	D	0.676796	D	0.61080	0.989	P	0.60886	0.88	T	0.10730	-1.0617	10	0.40728	T	0.16	-2.5733	11.2372	0.48946	0.0:0.7566:0.0:0.2434	.	207	P11717	MPRI_HUMAN	V	207	ENSP00000349437:L207V	ENSP00000349437:L207V	L	+	1	2	IGF2R	160365699	0.952000	0.32445	0.792000	0.32020	0.596000	0.36781	1.773000	0.38563	1.364000	0.46038	0.456000	0.33151	CTA	IGF2R	-	pfam_CIMR,superfamily_Man6P_isomerase_rcpt-bd_dom	ENSG00000197081		0.443	IGF2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2R	HGNC	protein_coding	OTTHUMT00000042931.1	91	0.00	0	C	NM_000876		160445709	160445709	+1	no_errors	ENST00000356956	ensembl	human	known	69_37n	missense	71	20.22	18	SNP	0.998	G
IGHG2	3501	genome.wustl.edu	37	14	106110068	106110068	+	RNA	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:106110068C>T	ENST00000390545.2	-	0	549							P01859	IGHG2_HUMAN	immunoglobulin heavy constant gamma 2 (G2m marker)						complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	antigen binding (GO:0003823)										ACGGTGAGGACGCTGACCACA	0.577																																						dbGAP											0													241.0	226.0	231.0					14																	106110068		2188	4276	6464	-	-	-			0			J00230		14q32.33	2012-10-02			ENSG00000211893	ENSG00000211893		"""Immunoglobulins / IGH locus"""	5526	other	immunoglobulin gene		147110					Standard	NG_001019		Approved			P01859	OTTHUMG00000152482		14.37:g.106110068C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NE66	Missense_Mutation	SNP	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	p.V184I	ENST00000390545.2	37	c.550		14																																																																																			IGHG2	-	pfam_Ig_C1-set,pfam_CD80_C2-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000211893		0.577	IGHG2-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_principal	IG_C_gene	IGHG2	HGNC	IG_C_gene	OTTHUMT00000326391.1	126	0.00	0	C	NG_001019		106110068	106110068	-1	no_start_codon	ENST00000390545	ensembl	human	known	69_37n	missense	80	14.89	14	SNP	0.002	T
IKBIP	121457	genome.wustl.edu	37	12	99020541	99020541	+	Intron	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:99020541C>G	ENST00000342502.2	-	2	709				IKBIP_ENST00000299157.4_Missense_Mutation_p.E101Q|IKBIP_ENST00000420861.1_Intron|IKBIP_ENST00000393042.3_Intron	NM_201612.2	NP_963906.1	Q70UQ0	IKIP_HUMAN	IKBKB interacting protein						response to X-ray (GO:0010165)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|kidney(1)|large_intestine(1)|lung(1)|prostate(2)	6						TCAGTAGACTCAAGCTGCATT	0.388																																						dbGAP											0													71.0	69.0	70.0					12																	99020541		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			AJ539425	CCDS9067.1, CCDS9068.1, CCDS41822.1	12q23.1	2010-02-17			ENSG00000166130	ENSG00000166130			26430	protein-coding gene	gene with protein product	"""I kappa B kinase interacting protein"""	609861				15389287	Standard	NM_153687		Approved	FLJ31051, IKIP	uc001tfx.4	Q70UQ0	OTTHUMG00000170213	ENST00000342502.2:c.297+7532G>C	12.37:g.99020541C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZWH4|Q70UP9|Q86V91|Q96ND2	Missense_Mutation	SNP	NULL	p.E101Q	ENST00000342502.2	37	c.301	CCDS9067.1	12	.	.	.	.	.	.	.	.	.	.	C	13.15	2.152572	0.38021	.	.	ENSG00000166130	ENST00000299157	T	0.53206	0.63	5.82	5.82	0.92795	.	0.686003	0.15243	N	0.272774	T	0.46541	0.1398	.	.	.	0.80722	D	1	P	0.50617	0.937	P	0.46850	0.529	T	0.17684	-1.0361	9	0.27082	T	0.32	-13.8107	13.3203	0.60428	0.0:0.928:0.0:0.072	.	101	Q70UQ0-4	.	Q	101	ENSP00000299157:E101Q	ENSP00000299157:E101Q	E	-	1	0	IKBIP	97544672	1.000000	0.71417	1.000000	0.80357	0.889000	0.51656	4.915000	0.63355	2.748000	0.94277	0.655000	0.94253	GAG	IKBIP	-	NULL	ENSG00000166130		0.388	IKBIP-003	KNOWN	basic|CCDS	protein_coding	IKBIP	HGNC	protein_coding	OTTHUMT00000408003.2	18	0.00	0	C	NM_153687		99020541	99020541	-1	no_errors	ENST00000299157	ensembl	human	known	69_37n	missense	18	30.77	8	SNP	1.000	G
IL16	3603	genome.wustl.edu	37	15	81571975	81571975	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:81571975C>G	ENST00000302987.4	+	7	941	c.941C>G	c.(940-942)tCt>tGt	p.S314C	IL16_ENST00000394660.2_Missense_Mutation_p.S314C			Q14005	IL16_HUMAN	interleukin 16	314	Interaction with GRIN2A.				immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|leukocyte chemotaxis (GO:0030595)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(3)|skin(3)|stomach(1)|urinary_tract(1)	57						AGCCACCTGTCTCCCCCACTG	0.617																																						dbGAP											0													37.0	40.0	39.0					15																	81571975		1968	4152	6120	-	-	-	SO:0001583	missense	0			U82972	CCDS10317.1, CCDS42069.1, CCDS53966.1	15q26.3	2011-07-14	2011-07-14		ENSG00000172349	ENSG00000172349		"""Interleukins and interleukin receptors"""	5980	protein-coding gene	gene with protein product	"""prointerleukin 16"", ""lymphocyte chemoattractant factor"""	603035	"""interleukin 16 (lymphocyte chemoattractant factor)"""			9144227	Standard	NM_004513		Approved	LCF, IL-16, prIL-16, HsT19289, FLJ42735, FLJ16806	uc021ssh.1	Q14005	OTTHUMG00000144186	ENST00000302987.4:c.941C>G	15.37:g.81571975C>G	ENSP00000302935:p.Ser314Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM20|A8MU65|B5TY35|B9EGR6|H3BVH5|Q16435|Q6VVE6|Q6ZMQ7|Q9UP18	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,prints_Interleukin-16	p.S314C	ENST00000302987.4	37	c.941	CCDS42069.1	15	.	.	.	.	.	.	.	.	.	.	C	18.11	3.549965	0.65311	.	.	ENSG00000172349	ENST00000394655;ENST00000394660;ENST00000355368;ENST00000302987	T;T	0.13420	2.59;2.59	4.95	4.01	0.46588	PDZ/DHR/GLGF (1);	0.000000	0.44688	D	0.000431	T	0.24547	0.0595	M	0.65975	2.015	0.80722	D	1	P;P	0.45126	0.767;0.851	B;P	0.47402	0.344;0.546	T	0.05305	-1.0893	10	0.87932	D	0	.	15.2713	0.73705	0.0:0.8592:0.1408:0.0	.	314;314	Q14005;Q14005-2	IL16_HUMAN;.	C	314;314;146;314	ENSP00000378155:S314C;ENSP00000302935:S314C	ENSP00000302935:S314C	S	+	2	0	IL16	79359030	0.987000	0.35691	0.828000	0.32881	0.950000	0.60333	3.145000	0.50623	1.258000	0.44101	0.585000	0.79938	TCT	IL16	-	superfamily_PDZ	ENSG00000172349		0.617	IL16-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL16	HGNC	protein_coding	OTTHUMT00000303952.1	33	0.00	0	C	NM_172217		81571975	81571975	+1	no_errors	ENST00000302987	ensembl	human	known	69_37n	missense	17	32.00	8	SNP	0.886	G
IMMT	10989	genome.wustl.edu	37	2	86371534	86371534	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:86371534G>A	ENST00000410111.3	-	15	2521	c.2134C>T	c.(2134-2136)Cag>Tag	p.Q712*	IMMT_ENST00000442664.2_Nonsense_Mutation_p.Q711*|IMMT_ENST00000409051.2_Nonsense_Mutation_p.Q665*|IMMT_ENST00000254636.5_Nonsense_Mutation_p.Q613*|IMMT_ENST00000449247.2_Nonsense_Mutation_p.Q701*	NM_001100169.1|NM_001100170.1|NM_006839.2	NP_001093639.1|NP_001093640.1|NP_006830.2	Q16891	MIC60_HUMAN	inner membrane protein, mitochondrial	712					mitochondrial calcium ion homeostasis (GO:0051560)|response to cold (GO:0009409)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						CCCTTCAGCTGATTGACAAAC	0.463																																						dbGAP											0													106.0	101.0	103.0					2																	86371534		1976	4167	6143	-	-	-	SO:0001587	stop_gained	0			D21094	CCDS46355.1, CCDS46356.1, CCDS46357.1	2p11.2	2011-10-04	2010-04-29		ENSG00000132305	ENSG00000132305			6047	protein-coding gene	gene with protein product	"""mitofilin"", ""mitochondrial inner membrane organizing system 2"""	600378	"""inner membrane protein, mitochondrial (mitofilin)"""			9168817, 8039717	Standard	NM_001100169		Approved	P87, P89, HMP, MINOS2	uc002sqz.4	Q16891	OTTHUMG00000153170	ENST00000410111.3:c.2134C>T	2.37:g.86371534G>A	ENSP00000387262:p.Gln712*	Somatic		WXS	Illumina GAIIx	Phase_IV	B1H0U5|B2R5N6|Q14539|Q15092|Q68D41|Q69HW5|Q6IBL0|Q7Z3X1|Q8TAJ5|Q9P0V2	Nonsense_Mutation	SNP	pfam_Mt-IM_prot_Mitofilin	p.Q712*	ENST00000410111.3	37	c.2134	CCDS46355.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	36|36	5.824808|5.824808	0.96989|0.96989	.|.	.|.	ENSG00000132305|ENSG00000132305	ENST00000254636;ENST00000449247;ENST00000410111;ENST00000442664;ENST00000409051;ENST00000545283;ENST00000377310;ENST00000398211;ENST00000409715|ENST00000419070	.|.	.|.	.|.	5.49|5.49	5.49|5.49	0.81192|0.81192	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	.|T	.|0.75568	.|0.3867	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72620	.|-0.4238	.|4	0.05721|.	T|.	0.95|.	-14.6814|-14.6814	19.6359|19.6359	0.95733|0.95733	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|.	.|.	.|.	X|L	613;701;712;711;665;701;680;326;613|566	.|.	ENSP00000254636:Q613X|.	Q|S	-|-	1|2	0|0	IMMT|IMMT	86225045|86225045	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.674000|7.674000	0.83992|0.83992	2.878000|2.878000	0.98634|0.98634	0.650000|0.650000	0.86243|0.86243	CAG|TCA	IMMT	-	pfam_Mt-IM_prot_Mitofilin	ENSG00000132305		0.463	IMMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IMMT	HGNC	protein_coding	OTTHUMT00000329909.2	76	0.00	0	G	NM_006839		86371534	86371534	-1	no_errors	ENST00000410111	ensembl	human	known	69_37n	nonsense	71	25.26	24	SNP	1.000	A
IQUB	154865	genome.wustl.edu	37	7	123109376	123109376	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:123109376G>A	ENST00000466202.1	-	9	2049	c.1473C>T	c.(1471-1473)ttC>ttT	p.F491F	IQUB_ENST00000434450.1_Silent_p.F491F|IQUB_ENST00000324698.6_Silent_p.F491F	NM_001282855.1	NP_001269784.1	Q8NA54	IQUB_HUMAN	IQ motif and ubiquitin domain containing	491					cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	acrosomal vesicle (GO:0001669)|motile cilium (GO:0031514)				breast(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(18)|ovary(3)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)	45						CTCTGATGGTGAACTGCGTAT	0.348																																						dbGAP											0													147.0	136.0	140.0					7																	123109376		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093153	CCDS5787.1	7q31.32	2010-03-19			ENSG00000164675	ENSG00000164675			21995	protein-coding gene	gene with protein product							Standard	NM_178827		Approved	FLJ35834	uc003vko.3	Q8NA54	OTTHUMG00000157347	ENST00000466202.1:c.1473C>T	7.37:g.123109376G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D0X0|Q49AL6|Q4G189|Q5BJD9|Q6NUH6|Q8N9Y2	Silent	SNP	pfam_Ubiquitin,pfscan_Ubiquitin_supergroup	p.F491	ENST00000466202.1	37	c.1473	CCDS5787.1	7																																																																																			IQUB	-	NULL	ENSG00000164675		0.348	IQUB-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IQUB	HGNC	protein_coding	OTTHUMT00000348529.1	120	0.00	0	G	NM_178827		123109376	123109376	-1	no_errors	ENST00000324698	ensembl	human	known	69_37n	silent	110	10.48	13	SNP	1.000	A
ITGA2B	3674	genome.wustl.edu	37	17	42453698	42453698	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:42453698C>G	ENST00000262407.5	-	23	2357	c.2326G>C	c.(2326-2328)Gag>Cag	p.E776Q	ITGA2B_ENST00000353281.4_Missense_Mutation_p.E776Q	NM_000419.3	NP_000410.2	P08514	ITA2B_HUMAN	integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41)	776					axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of leukocyte migration (GO:0002687)	blood microparticle (GO:0072562)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|platelet alpha granule membrane (GO:0031092)	extracellular matrix binding (GO:0050840)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			biliary_tract(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(8)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.191)	Abciximab(DB00054)|Tirofiban(DB00775)	ACTTGGGCCTCTGCCCGGACC	0.617											OREG0024460	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													94.0	108.0	103.0					17																	42453698		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32665.1	17q21.32	2014-09-17	2006-02-22			ENSG00000005961		"""CD molecules"", ""Integrins"""	6138	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 93"""	607759	"""integrin, alpha 2b (platelet glycoprotein IIb of IIb/IIIa complex, antigen CD41B)"""	GP2B			Standard	NM_000419		Approved	CD41B, CD41, PPP1R93	uc002igt.1	P08514		ENST00000262407.5:c.2326G>C	17.37:g.42453698C>G	ENSP00000262407:p.Glu776Gln	Somatic	908	WXS	Illumina GAIIx	Phase_IV	B2RCY8|O95366|Q14443|Q17R67	Missense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,prints_Integrin_alpha	p.E776Q	ENST00000262407.5	37	c.2326	CCDS32665.1	17	.	.	.	.	.	.	.	.	.	.	C	14.23	2.472793	0.43942	.	.	ENSG00000005961	ENST00000262407;ENST00000353281	T;T	0.52983	0.64;0.64	4.33	2.18	0.27775	Integrin alpha-2 (1);	0.510684	0.14406	U	0.321581	T	0.34048	0.0884	L	0.37897	1.145	0.18873	N	0.999986	P;P	0.49559	0.925;0.858	B;B	0.43575	0.38;0.424	T	0.10086	-1.0645	10	0.14252	T	0.57	.	7.8028	0.29185	0.0:0.776:0.0:0.224	.	374;776	Q59FA8;P08514	.;ITA2B_HUMAN	Q	776	ENSP00000262407:E776Q;ENSP00000340536:E776Q	ENSP00000262407:E776Q	E	-	1	0	ITGA2B	39809224	0.000000	0.05858	0.150000	0.22450	0.709000	0.40893	0.119000	0.15626	1.040000	0.40099	0.462000	0.41574	GAG	ITGA2B	-	pfam_Integrin_alpha-2	ENSG00000005961		0.617	ITGA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA2B	HGNC	protein_coding	OTTHUMT00000439823.1	60	0.00	0	C			42453698	42453698	-1	no_errors	ENST00000262407	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.126	G
KCND3	3752	genome.wustl.edu	37	1	112318791	112318791	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:112318791C>T	ENST00000315987.2	-	8	2355	c.1876G>A	c.(1876-1878)Gag>Aag	p.E626K	KCND3_ENST00000369697.1_Missense_Mutation_p.E607K|KCND3_ENST00000302127.4_Missense_Mutation_p.E607K	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	626					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CTTTCCCCCTCTGGGGTTAGC	0.557																																						dbGAP											0													100.0	93.0	95.0					1																	112318791		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1876G>A	1.37:g.112318791C>T	ENSP00000319591:p.Glu626Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.E626K	ENST00000315987.2	37	c.1876	CCDS843.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.596544	0.86953	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97138	-4.24;-4.26;-4.24	5.76	5.76	0.90799	.	0.140578	0.64402	D	0.000006	D	0.94611	0.8263	L	0.46157	1.445	0.80722	D	1	P;P	0.48911	0.917;0.917	B;B	0.41917	0.285;0.37	D	0.94830	0.7995	10	0.56958	D	0.05	.	19.5688	0.95404	0.0:1.0:0.0:0.0	.	607;626	Q14D71;Q9UK17	.;KCND3_HUMAN	K	607;626;607	ENSP00000358711:E607K;ENSP00000319591:E626K;ENSP00000306923:E607K	ENSP00000306923:E607K	E	-	1	0	KCND3	112120314	1.000000	0.71417	0.935000	0.37517	0.992000	0.81027	5.722000	0.68485	2.732000	0.93576	0.655000	0.94253	GAG	KCND3	-	NULL	ENSG00000171385		0.557	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1	60	0.00	0	C	NM_172198		112318791	112318791	-1	no_errors	ENST00000315987	ensembl	human	known	69_37n	missense	57	20.83	15	SNP	1.000	T
KCNS2	3788	genome.wustl.edu	37	8	99440631	99440631	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:99440631G>A	ENST00000287042.4	+	2	774	c.424G>A	c.(424-426)Gag>Aag	p.E142K	KCNS2_ENST00000521839.1_Missense_Mutation_p.E142K	NM_020697.2	NP_065748.1	Q9ULS6	KCNS2_HUMAN	potassium voltage-gated channel, delayed-rectifier, subfamily S, member 2	142					protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)			autonomic_ganglia(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	31	Breast(36;2.4e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.0448)			GAGTGACCAGGAGAGCACCAC	0.582																																					Pancreas(138;844 2489 9202 24627)	dbGAP											0													98.0	107.0	104.0					8																	99440631		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032970	CCDS6279.1	8q22	2011-07-05			ENSG00000156486	ENSG00000156486		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6301	protein-coding gene	gene with protein product		602906				9305895, 16382104	Standard	NM_020697		Approved	Kv9.2	uc003yin.3	Q9ULS6	OTTHUMG00000044337	ENST00000287042.4:c.424G>A	8.37:g.99440631G>A	ENSP00000287042:p.Glu142Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAN1	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv2	p.E142K	ENST00000287042.4	37	c.424	CCDS6279.1	8	.	.	.	.	.	.	.	.	.	.	G	13.26	2.185502	0.38609	.	.	ENSG00000156486	ENST00000287042;ENST00000521839	D;D	0.96651	-4.08;-4.08	5.31	5.31	0.75309	.	0.457213	0.22179	N	0.063536	D	0.90933	0.7150	N	0.22421	0.69	0.36574	D	0.873136	B	0.25105	0.118	B	0.24006	0.05	D	0.88192	0.2878	10	0.08837	T	0.75	.	12.3465	0.55124	0.0775:0.0:0.9225:0.0	.	142	Q9ULS6	KCNS2_HUMAN	K	142	ENSP00000287042:E142K;ENSP00000430712:E142K	ENSP00000287042:E142K	E	+	1	0	KCNS2	99509807	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.984000	0.88150	2.470000	0.83445	0.563000	0.77884	GAG	KCNS2	-	NULL	ENSG00000156486		0.582	KCNS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNS2	HGNC	protein_coding	OTTHUMT00000103134.1	46	0.00	0	G	NM_020697		99440631	99440631	+1	no_errors	ENST00000287042	ensembl	human	known	69_37n	missense	38	13.64	6	SNP	1.000	A
KCNQ3	3786	genome.wustl.edu	37	8	133142088	133142088	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:133142088C>T	ENST00000388996.4	-	15	2460	c.2040G>A	c.(2038-2040)ttG>ttA	p.L680L	KCNQ3_ENST00000519445.1_Silent_p.L668L|KCNQ3_ENST00000521134.1_Silent_p.L560L	NM_004519.3	NP_004510.1	O43525	KCNQ3_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 3	680					axon guidance (GO:0007411)|membrane hyperpolarization (GO:0060081)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	axon initial segment (GO:0043194)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	70	Esophageal squamous(12;0.00507)|Ovarian(258;0.00579)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000311)		Amitriptyline(DB00321)|Diclofenac(DB00586)|Ezogabine(DB04953)|Meclofenamic acid(DB00939)	TGATGGTTTTCAAATCGGAAT	0.527																																						dbGAP											0													138.0	117.0	124.0					8																	133142088		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB208890	CCDS34943.1, CCDS56554.1	8q24	2012-07-05			ENSG00000184156	ENSG00000184156		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6297	protein-coding gene	gene with protein product		602232		EBN2		9425900, 16382104	Standard	NM_004519		Approved	Kv7.3	uc003ytj.3	O43525	OTTHUMG00000137472	ENST00000388996.4:c.2040G>A	8.37:g.133142088C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCT8|B4DJY4|E7EQ89	Silent	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ankyrin-G_BS,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ3,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.L680	ENST00000388996.4	37	c.2040	CCDS34943.1	8																																																																																			KCNQ3	-	NULL	ENSG00000184156		0.527	KCNQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ3	HGNC	protein_coding	OTTHUMT00000268621.2	27	0.00	0	C	NM_004519		133142088	133142088	-1	no_errors	ENST00000388996	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.999	T
KIAA0195	9772	genome.wustl.edu	37	17	73484157	73484157	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:73484157G>C	ENST00000314256.7	+	6	948	c.554G>C	c.(553-555)gGa>gCa	p.G185A	KIAA0195_ENST00000583795.1_3'UTR|KIAA0195_ENST00000375248.5_Missense_Mutation_p.G195A|KIAA0195_ENST00000579208.1_Intron	NM_014738.4	NP_055553.3	Q12767	K0195_HUMAN	KIAA0195	185						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(2)|endometrium(5)|kidney(2)|large_intestine(7)|lung(17)|ovary(5)|skin(2)|stomach(1)|urinary_tract(1)	42	all_cancers(13;3.15e-09)|all_epithelial(9;5.94e-10)|Breast(9;1.85e-09)|all_lung(278;0.246)		all cancers(21;5.01e-07)|Epithelial(20;5e-06)|Lung(188;0.0809)|LUSC - Lung squamous cell carcinoma(166;0.154)			CTGGTTGAAGGAGACATCATA	0.552																																						dbGAP											0													134.0	105.0	115.0					17																	73484157		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32732.1	17q25.1	2012-03-01			ENSG00000177728	ENSG00000177728			28983	protein-coding gene	gene with protein product						8724849	Standard	NM_014738		Approved	TMEM94	uc002jnz.4	Q12767		ENST00000314256.7:c.554G>C	17.37:g.73484157G>C	ENSP00000313885:p.Gly185Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	O75536|Q86XF1	Missense_Mutation	SNP	pfam_ATPase_P-typ_cation-transptr_C	p.G185A	ENST00000314256.7	37	c.554	CCDS32732.1	17	.	.	.	.	.	.	.	.	.	.	G	23.9	4.473727	0.84640	.	.	ENSG00000177728	ENST00000314256;ENST00000375248	T;T	0.61742	0.09;0.08	5.43	5.43	0.79202	.	0.054946	0.64402	D	0.000001	T	0.66886	0.2835	M	0.73598	2.24	0.80722	D	1	P;P	0.52316	0.925;0.952	P;P	0.47162	0.54;0.452	T	0.72776	-0.4191	10	0.72032	D	0.01	-12.6139	18.8475	0.92213	0.0:0.0:1.0:0.0	.	195;185	C9JL75;Q12767	.;K0195_HUMAN	A	185;195	ENSP00000313885:G185A;ENSP00000364397:G195A	ENSP00000313885:G185A	G	+	2	0	KIAA0195	70995752	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.372000	0.97165	2.560000	0.86352	0.561000	0.74099	GGA	KIAA0195	-	NULL	ENSG00000177728		0.552	KIAA0195-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0195	HGNC	protein_coding	OTTHUMT00000447303.1	55	0.00	0	G	NM_014738		73484157	73484157	+1	no_errors	ENST00000314256	ensembl	human	known	69_37n	missense	54	20.59	14	SNP	1.000	C
KIAA1109	84162	genome.wustl.edu	37	4	123277097	123277097	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:123277097G>A	ENST00000264501.4	+	83	14825	c.14452G>A	c.(14452-14454)Gac>Aac	p.D4818N	KIAA1109_ENST00000388738.3_Missense_Mutation_p.D4818N			Q2LD37	K1109_HUMAN	KIAA1109	4818					regulation of cell growth (GO:0001558)|regulation of epithelial cell differentiation (GO:0030856)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(7)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(6)|large_intestine(33)|liver(4)|lung(74)|ovary(9)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(6)|urinary_tract(3)	172						GATGCAGCTTGACTTTAAATC	0.363																																						dbGAP											0													143.0	135.0	137.0					4																	123277097		1863	4102	5965	-	-	-	SO:0001583	missense	0			AL137384	CCDS43267.1	4q28.1	2012-07-09			ENSG00000138688	ENSG00000138688			26953	protein-coding gene	gene with protein product	"""fragile site-associated"""	611565				16386706	Standard	NM_015312		Approved	FLJ21404, FSA, KIAA1371, Tweek	uc003ieh.3	Q2LD37	OTTHUMG00000150116	ENST00000264501.4:c.14452G>A	4.37:g.123277097G>A	ENSP00000264501:p.Asp4818Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W598|Q5CZA9|Q6ZS70|Q6ZV75|Q86XA5|Q8WVD8|Q9H742|Q9NT48|Q9NTC3|Q9NTI4|Q9P2H6|Q9UPP3	Missense_Mutation	SNP	pfam_Fragile_site-assoc_C	p.D4818N	ENST00000264501.4	37	c.14452	CCDS43267.1	4	.	.	.	.	.	.	.	.	.	.	G	23.7	4.443974	0.83993	.	.	ENSG00000138688	ENST00000264501;ENST00000388738;ENST00000438707;ENST00000431755	T;T;T	0.41758	0.99;0.99;0.99	5.76	5.76	0.90799	Fragile site-associated protein, C-terminal (1);	0.202178	0.50627	D	0.000108	T	0.42154	0.1190	L	0.29908	0.895	0.80722	D	1	P;P	0.43231	0.557;0.801	B;P	0.46629	0.167;0.522	T	0.05937	-1.0855	10	0.24483	T	0.36	.	19.9607	0.97248	0.0:0.0:1.0:0.0	.	4817;4818	Q2LD37-4;Q2LD37	.;K1109_HUMAN	N	4818;4818;1487;419	ENSP00000264501:D4818N;ENSP00000373390:D4818N;ENSP00000410874:D1487N	ENSP00000264501:D4818N	D	+	1	0	KIAA1109	123496547	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.523000	0.73787	2.728000	0.93425	0.591000	0.81541	GAC	KIAA1109	-	pfam_Fragile_site-assoc_C	ENSG00000138688		0.363	KIAA1109-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1109	HGNC	protein_coding	OTTHUMT00000316415.1	81	0.00	0	G	NM_020797		123277097	123277097	+1	no_errors	ENST00000264501	ensembl	human	known	69_37n	missense	75	11.76	10	SNP	1.000	A
KIAA1407	57577	genome.wustl.edu	37	3	113755607	113755607	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:113755607C>G	ENST00000295878.3	-	5	588	c.442G>C	c.(442-444)Gag>Cag	p.E148Q	KIAA1407_ENST00000545063.1_5'UTR	NM_020817.1	NP_065868.1	Q8NCU4	K1407_HUMAN	KIAA1407	148										endometrium(9)|large_intestine(7)|lung(19)|ovary(2)|pancreas(1)|prostate(1)|urinary_tract(1)	40						GTACTTTCCTCTTCTTCCTCC	0.318																																						dbGAP											0													95.0	89.0	91.0					3																	113755607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF509494	CCDS2977.1	3q13.31	2005-01-10			ENSG00000163617	ENSG00000163617			29272	protein-coding gene	gene with protein product						10718198	Standard	NM_020817		Approved		uc003eax.3	Q8NCU4	OTTHUMG00000159337	ENST00000295878.3:c.442G>C	3.37:g.113755607C>G	ENSP00000295878:p.Glu148Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYL1|Q9P2E0	Missense_Mutation	SNP	NULL	p.E148Q	ENST00000295878.3	37	c.442	CCDS2977.1	3	.	.	.	.	.	.	.	.	.	.	C	14.90	2.674482	0.47781	.	.	ENSG00000163617	ENST00000295878;ENST00000491000;ENST00000483766	T;T	0.48522	1.4;0.81	5.28	5.28	0.74379	.	0.267757	0.34178	N	0.004187	T	0.49626	0.1568	L	0.56769	1.78	0.80722	D	1	D;D;D	0.61080	0.989;0.96;0.98	P;P;P	0.55923	0.787;0.663;0.663	T	0.53408	-0.8443	10	0.27785	T	0.31	.	2.5992	0.04862	0.1613:0.5356:0.1551:0.148	.	135;24;148	C9JA89;B4DIZ9;Q8NCU4	.;.;K1407_HUMAN	Q	148;135;112	ENSP00000295878:E148Q;ENSP00000418099:E135Q	ENSP00000295878:E148Q	E	-	1	0	KIAA1407	115238297	0.310000	0.24527	1.000000	0.80357	0.999000	0.98932	0.547000	0.23299	2.734000	0.93682	0.650000	0.86243	GAG	KIAA1407	-	NULL	ENSG00000163617		0.318	KIAA1407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1407	HGNC	protein_coding	OTTHUMT00000354724.2	113	0.00	0	C	NM_020817		113755607	113755607	-1	no_errors	ENST00000295878	ensembl	human	known	69_37n	missense	114	15.56	21	SNP	0.998	G
KIAA1731	85459	genome.wustl.edu	37	11	93456347	93456347	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:93456347C>G	ENST00000325212.6	+	21	6250	c.6088C>G	c.(6088-6090)Ctg>Gtg	p.L2030V	SCARNA9_ENST00000364329.1_RNA|KIAA1731_ENST00000531700.1_Missense_Mutation_p.L210V|SCARNA9_ENST00000362805.1_RNA|KIAA1731_ENST00000411936.1_Missense_Mutation_p.L2030V|SCARNA9_ENST00000530422.1_RNA|KIAA1731_ENST00000344196.4_Missense_Mutation_p.L210V			Q9C0D2	K1731_HUMAN	KIAA1731	2030						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TCATAAATCTCTGTTGCCTGC	0.363																																						dbGAP											0													89.0	77.0	81.0					11																	93456347		692	1591	2283	-	-	-	SO:0001583	missense	0			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.6088C>G	11.37:g.93456347C>G	ENSP00000316681:p.Leu2030Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.L2030V	ENST00000325212.6	37	c.6088	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	C	3.110	-0.182879	0.06340	.	.	ENSG00000166004	ENST00000325212;ENST00000411936;ENST00000344196;ENST00000531700;ENST00000531404	T;T	0.19250	2.16;2.16	4.14	0.149	0.14863	.	.	.	.	.	T	0.13415	0.0325	L	0.40543	1.245	0.09310	N	1	B;B;B	0.22909	0.077;0.077;0.077	B;B;B	0.19391	0.025;0.025;0.025	T	0.31503	-0.9941	9	0.39692	T	0.17	.	1.2408	0.01962	0.172:0.4412:0.187:0.1998	.	2030;2030;210	Q9C0D2;Q9C0D2-3;Q9C0D2-2	K1731_HUMAN;.;.	V	2030;2030;210;210;42	ENSP00000316681:L2030V;ENSP00000406505:L2030V	ENSP00000316681:L2030V	L	+	1	2	KIAA1731	93095995	0.000000	0.05858	0.001000	0.08648	0.076000	0.17211	0.339000	0.19875	0.031000	0.15407	-0.136000	0.14681	CTG	KIAA1731	-	NULL	ENSG00000166004		0.363	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	46	0.00	0	C	NM_033395		93456347	93456347	+1	no_errors	ENST00000411936	ensembl	human	known	69_37n	missense	23	28.12	9	SNP	0.002	G
CIPC	85457	genome.wustl.edu	37	14	77576159	77576159	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:77576159G>A	ENST00000361786.2	+	3	458	c.141G>A	c.(139-141)ggG>ggA	p.G47G	KIAA1737_ENST00000555437.1_Intron|RP11-463C8.4_ENST00000557752.1_Intron|KIAA1737_ENST00000555611.1_Silent_p.G47G	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		47					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		CACCAGATGGGAGCTCGGAAT	0.537																																						dbGAP											0													96.0	97.0	97.0					14																	77576159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0																														ENST00000361786.2:c.141G>A	14.37:g.77576159G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCI1|Q8N389|Q8NDZ1	Silent	SNP	NULL	p.G47	ENST00000361786.2	37	c.141	CCDS9855.1	14																																																																																			KIAA1737	-	NULL	ENSG00000198894		0.537	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1737	HGNC	protein_coding	OTTHUMT00000414278.1	34	0.00	0	G			77576159	77576159	+1	no_errors	ENST00000361786	ensembl	human	known	69_37n	silent	23	17.86	5	SNP	1.000	A
CIPC	85457	genome.wustl.edu	37	14	77579894	77579894	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:77579894G>A	ENST00000361786.2	+	4	750	c.433G>A	c.(433-435)Gag>Aag	p.E145K	KIAA1737_ENST00000555437.1_3'UTR|RP11-463C8.4_ENST00000557752.1_Intron	NM_033426.2	NP_219494.2	Q9C0C6	CIPC_HUMAN		145					negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				endometrium(2)|lung(4)|prostate(3)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0284)		TCACACTGGTGAGAAAAAGTC	0.507																																						dbGAP											0													132.0	122.0	126.0					14																	77579894		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000361786.2:c.433G>A	14.37:g.77579894G>A	ENSP00000355319:p.Glu145Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCI1|Q8N389|Q8NDZ1	Missense_Mutation	SNP	NULL	p.E145K	ENST00000361786.2	37	c.433	CCDS9855.1	14	.	.	.	.	.	.	.	.	.	.	G	9.134	1.012034	0.19277	.	.	ENSG00000198894	ENST00000361786;ENST00000557115;ENST00000554447	T;T;T	0.49139	1.41;0.79;0.8	5.6	5.6	0.85130	.	0.767098	0.13387	N	0.391688	T	0.34978	0.0916	L	0.36672	1.1	0.53005	D	0.999969	B;B	0.20052	0.041;0.005	B;B	0.20955	0.032;0.013	T	0.17806	-1.0357	10	0.18710	T	0.47	-8.4499	6.9742	0.24666	0.0898:0.0:0.7354:0.1747	.	145;47	Q9C0C6;B3KU75	K1737_HUMAN;.	K	145	ENSP00000355319:E145K;ENSP00000452589:E145K;ENSP00000452380:E145K	ENSP00000355319:E145K	E	+	1	0	KIAA1737	76649647	0.998000	0.40836	0.879000	0.34478	0.164000	0.22412	3.145000	0.50623	2.643000	0.89663	0.455000	0.32223	GAG	KIAA1737	-	NULL	ENSG00000198894		0.507	KIAA1737-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1737	HGNC	protein_coding	OTTHUMT00000414278.1	45	0.00	0	G			77579894	77579894	+1	no_errors	ENST00000361786	ensembl	human	known	69_37n	missense	49	25.37	17	SNP	0.628	A
KIF14	9928	genome.wustl.edu	37	1	200569198	200569198	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:200569198G>C	ENST00000367350.4	-	13	2782	c.2344C>G	c.(2344-2346)Caa>Gaa	p.Q782E		NM_014875.2	NP_055690.1	Q15058	KIF14_HUMAN	kinesin family member 14	782					ATP catabolic process (GO:0006200)|cytoskeleton-dependent intracellular transport (GO:0030705)|establishment of protein localization (GO:0045184)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|negative regulation of integrin activation (GO:0033624)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of Rap protein signal transduction (GO:0032487)|substrate adhesion-dependent cell spreading (GO:0034446)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|PDZ domain binding (GO:0030165)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(8)|kidney(8)|large_intestine(15)|lung(13)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	61						TTTGTTTCTTGAAGTTTTCTT	0.284																																						dbGAP											0													35.0	37.0	37.0					1																	200569198		2166	4267	6433	-	-	-	SO:0001583	missense	0			D26361	CCDS30963.1	1q32.1	2008-03-03			ENSG00000118193	ENSG00000118193		"""Kinesins"""	19181	protein-coding gene	gene with protein product		611279				7584044	Standard	NM_014875		Approved	KIAA0042	uc010ppk.1	Q15058	OTTHUMG00000035723	ENST00000367350.4:c.2344C>G	1.37:g.200569198G>C	ENSP00000356319:p.Gln782Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CI8|Q4G0A5|Q5T1W3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q782E	ENST00000367350.4	37	c.2344	CCDS30963.1	1	.	.	.	.	.	.	.	.	.	.	G	5.949	0.359015	0.11239	.	.	ENSG00000118193	ENST00000367350	T	0.69685	-0.42	5.18	4.25	0.50352	.	0.121827	0.53938	N	0.000046	T	0.36963	0.0986	N	0.02721	-0.515	0.30526	N	0.767974	B	0.11235	0.004	B	0.08055	0.003	T	0.26950	-1.0088	10	0.02654	T	1	.	13.0563	0.58982	0.0:0.386:0.614:0.0	.	782	Q15058	KIF14_HUMAN	E	782	ENSP00000356319:Q782E	ENSP00000356319:Q782E	Q	-	1	0	KIF14	198835821	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.476000	0.53143	1.144000	0.42321	0.650000	0.86243	CAA	KIF14	-	NULL	ENSG00000118193		0.284	KIF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF14	HGNC	protein_coding	OTTHUMT00000086878.1	58	0.00	0	G	NM_014875		200569198	200569198	-1	no_errors	ENST00000367350	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	0.997	C
KIAA1804	84451	genome.wustl.edu	37	1	233490734	233490734	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:233490734G>A	ENST00000366624.3	+	4	1549	c.1288G>A	c.(1288-1290)Gat>Aat	p.D430N	MLK4_ENST00000366623.3_Missense_Mutation_p.D430N	NM_032435.2	NP_115811.2																					ACAAATGTTTGATGAGTTGAG	0.353																																						dbGAP											0													69.0	66.0	67.0					1																	233490734		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000366624.3:c.1288G>A	1.37:g.233490734G>A	ENSP00000355583:p.Asp430Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.D430N	ENST00000366624.3	37	c.1288	CCDS1598.1	1	.	.	.	.	.	.	.	.	.	.	G	15.87	2.959933	0.53400	.	.	ENSG00000143674	ENST00000366623;ENST00000366624	T;T	0.76839	-0.88;-1.05	5.44	4.52	0.55395	.	0.205218	0.41294	D	0.000905	T	0.69360	0.3102	L	0.42245	1.32	0.80722	D	1	B;B	0.11235	0.004;0.002	B;B	0.15052	0.012;0.012	T	0.66244	-0.5972	10	0.48119	T	0.1	.	10.2901	0.43590	0.1717:0.0:0.8283:0.0	.	430;430	Q5TCX8;Q5TCX8-2	M3KL4_HUMAN;.	N	430	ENSP00000355582:D430N;ENSP00000355583:D430N	ENSP00000355582:D430N	D	+	1	0	RP5-862P8.2	231557357	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	4.396000	0.59684	1.507000	0.48752	0.655000	0.94253	GAT	RP5-862P8.2	-	pirsf_MAPKKK9/10/11	ENSG00000143674		0.353	MLK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1804	Clone_based_vega_gene	protein_coding	OTTHUMT00000092495.1	37	0.00	0	G			233490734	233490734	+1	no_errors	ENST00000366624	ensembl	human	known	69_37n	missense	24	21.88	7	SNP	1.000	A
KIF1A	547	genome.wustl.edu	37	2	241710399	241710399	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:241710399C>G	ENST00000320389.7	-	14	1461	c.1303G>C	c.(1303-1305)Gaa>Caa	p.E435Q	KIF1A_ENST00000498729.2_Missense_Mutation_p.E444Q	NM_004321.6	NP_004312.2	Q12756	KIF1A_HUMAN	kinesin family member 1A	435					anterograde axon cargo transport (GO:0008089)|ATP catabolic process (GO:0006200)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			NS(1)|central_nervous_system(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(25)|ovary(1)|prostate(5)|skin(2)|urinary_tract(1)	66		all_epithelial(40;1.35e-15)|Breast(86;2.14e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0295)|all_neural(83;0.0459)|Lung NSC(271;0.0942)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;6.12e-30)|all cancers(36;3.46e-27)|OV - Ovarian serous cystadenocarcinoma(60;1.38e-14)|Kidney(56;5e-09)|KIRC - Kidney renal clear cell carcinoma(57;5e-08)|BRCA - Breast invasive adenocarcinoma(100;5.87e-06)|Lung(119;0.00209)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Colorectal(34;0.0282)|COAD - Colon adenocarcinoma(134;0.176)		TTCAGTCTTTCAATGGCCTCC	0.657																																						dbGAP											0													45.0	53.0	50.0					2																	241710399		2036	4201	6237	-	-	-	SO:0001583	missense	0			AF004425	CCDS46561.1, CCDS58757.1	2q37.2	2014-09-17	2004-01-09	2004-01-14	ENSG00000130294	ENSG00000130294		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	888	protein-coding gene	gene with protein product		601255	"""axonal transport of synaptic vesicles"", ""chromosome 2 open reading frame 20"", ""spastic paraplegia 30 (autosomal recessive)"""	ATSV, C2orf20, SPG30		7539720, 10323250, 22258533	Standard	NM_001244008		Approved	UNC104	uc010fzk.3	Q12756	OTTHUMG00000151940	ENST00000320389.7:c.1303G>C	2.37:g.241710399C>G	ENSP00000322791:p.Glu435Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1S5|F5H045|O95068|Q13355|Q14752|Q2NKJ6|Q4LE42|Q53T78|Q59GH1|Q63Z40|Q6P1R9|Q7KZ57	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_Kinesin-like,pfam_Pleckstrin_homology,pfam_KIF1B,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,smart_Pleckstrin_homology,prints_Kinesin_motor_dom,pfscan_FHA_dom,pfscan_Pleckstrin_homology,pfscan_Kinesin_motor_dom	p.E444Q	ENST00000320389.7	37	c.1330	CCDS46561.1	2	.	.	.	.	.	.	.	.	.	.	C	19.62	3.861101	0.71949	.	.	ENSG00000130294	ENST00000320389;ENST00000498729;ENST00000373308;ENST00000404283	T;T;T	0.76968	-0.85;-1.01;-1.06	4.11	4.11	0.48088	.	0.057026	0.64402	U	0.000002	D	0.87087	0.6090	M	0.75884	2.315	0.80722	D	1	D;D;D	0.89917	0.98;0.998;1.0	P;D;D	0.71870	0.876;0.954;0.975	D	0.89263	0.3599	10	0.72032	D	0.01	.	16.3652	0.83317	0.0:1.0:0.0:0.0	.	444;444;435	F5H045;Q12756-2;Q12756	.;.;KIF1A_HUMAN	Q	435;444;444;444	ENSP00000322791:E435Q;ENSP00000438388:E444Q;ENSP00000384231:E444Q	ENSP00000322791:E435Q	E	-	1	0	KIF1A	241359072	1.000000	0.71417	0.989000	0.46669	0.824000	0.46624	7.589000	0.82641	1.848000	0.53677	0.555000	0.69702	GAA	KIF1A	-	NULL	ENSG00000130294		0.657	KIF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF1A	HGNC	protein_coding	OTTHUMT00000324536.3	37	0.00	0	C	NM_138483		241710399	241710399	-1	no_errors	ENST00000498729	ensembl	human	known	69_37n	missense	30	26.83	11	SNP	1.000	G
KIF21B	23046	genome.wustl.edu	37	1	200960101	200960101	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:200960101G>C	ENST00000422435.2	-	18	2947	c.2631C>G	c.(2629-2631)atC>atG	p.I877M	KIF21B_ENST00000332129.2_Missense_Mutation_p.I877M|KIF21B_ENST00000461742.2_Missense_Mutation_p.I877M|KIF21B_ENST00000360529.5_Missense_Mutation_p.I877M	NM_001252100.1	NP_001239029.1	O75037	KI21B_HUMAN	kinesin family member 21B	877					ATP catabolic process (GO:0006200)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	cytoplasm (GO:0005737)|kinesin complex (GO:0005871)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(15)|kidney(4)|large_intestine(8)|liver(1)|lung(27)|ovary(3)|pancreas(1)|prostate(5)|skin(8)|stomach(2)|urinary_tract(2)	83						AGAAGTGGTTGATTTTGCGGT	0.637																																						dbGAP											0													97.0	98.0	98.0					1																	200960101		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC031927	CCDS30965.1, CCDS58054.1, CCDS58055.1, CCDS58056.1	1q32.1	2013-01-10			ENSG00000116852	ENSG00000116852		"""Kinesins"", ""WD repeat domain containing"""	29442	protein-coding gene	gene with protein product		608322				9455484	Standard	NM_001252100		Approved	DKFZP434J212, KIAA0449	uc001gvs.2	O75037	OTTHUMG00000035787	ENST00000422435.2:c.2631C>G	1.37:g.200960101G>C	ENSP00000411831:p.Ile877Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP62|B7ZMI0|Q5T4J3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,smart_WD40_repeat,pfscan_Kinesin_motor_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Kinesin_motor_dom	p.I877M	ENST00000422435.2	37	c.2631	CCDS58056.1	1	.	.	.	.	.	.	.	.	.	.	G	8.556	0.876673	0.17395	.	.	ENSG00000116852	ENST00000332129;ENST00000360529;ENST00000461742;ENST00000422435;ENST00000539858	T;T;T;T	0.71579	-0.23;-0.54;-0.58;-0.27	4.65	3.74	0.42951	.	0.124187	0.53938	D	0.000058	T	0.60379	0.2264	L	0.29908	0.895	0.36409	D	0.86358	P;P;P;P	0.51653	0.947;0.855;0.855;0.911	P;B;B;B	0.47744	0.556;0.212;0.212;0.382	T	0.63541	-0.6614	9	.	.	.	.	7.5699	0.27900	0.0851:0.0:0.7528:0.1621	.	877;877;877;877	B7ZMI0;B2RP62;O75037;O75037-2	.;.;KI21B_HUMAN;.	M	877	ENSP00000328494:I877M;ENSP00000353724:I877M;ENSP00000433808:I877M;ENSP00000411831:I877M	.	I	-	3	3	KIF21B	199226724	1.000000	0.71417	0.998000	0.56505	0.008000	0.06430	3.381000	0.52455	1.076000	0.40961	-0.254000	0.11334	ATC	KIF21B	-	NULL	ENSG00000116852		0.637	KIF21B-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIF21B	HGNC	protein_coding	OTTHUMT00000382635.1	39	0.00	0	G	XM_371332		200960101	200960101	-1	no_errors	ENST00000422435	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	C
KIF4A	24137	genome.wustl.edu	37	X	69563755	69563755	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:69563755G>A	ENST00000374403.3	+	13	1436	c.1354G>A	c.(1354-1356)Gag>Aag	p.E452K	KIF4A_ENST00000374388.3_Missense_Mutation_p.E452K	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	452					anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						AAAGCTAGTGGAGACTTTGGA	0.398																																						dbGAP											0													48.0	43.0	45.0					X																	69563755		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.1354G>A	X.37:g.69563755G>A	ENSP00000363524:p.Glu452Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E452K	ENST00000374403.3	37	c.1354	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	15.06	2.722630	0.48728	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.70045	-0.45;-0.4	5.12	5.12	0.69794	.	0.101572	0.43110	D	0.000601	T	0.59542	0.2201	L	0.47016	1.485	0.46954	D	0.999267	B;B	0.23937	0.094;0.02	B;B	0.21151	0.024;0.033	T	0.55354	-0.8154	10	0.20519	T	0.43	.	16.1175	0.81319	0.0:0.0:1.0:0.0	.	452;452	O95239;O95239-2	KIF4A_HUMAN;.	K	452	ENSP00000363509:E452K;ENSP00000363524:E452K	ENSP00000363509:E452K	E	+	1	0	KIF4A	69480480	1.000000	0.71417	0.199000	0.23439	0.904000	0.53231	5.010000	0.64004	2.369000	0.80426	0.600000	0.82982	GAG	KIF4A	-	NULL	ENSG00000090889		0.398	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	51	0.00	0	G	NM_012310		69563755	69563755	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	0.972	A
KLC1	3831	genome.wustl.edu	37	14	104145801	104145801	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:104145801G>C	ENST00000348520.6	+	13	1888	c.1569G>C	c.(1567-1569)gaG>gaC	p.E523D	RP11-73M18.2_ENST00000472726.2_Missense_Mutation_p.E695D|KLC1_ENST00000452929.2_Missense_Mutation_p.E523D|KLC1_ENST00000557575.1_Missense_Mutation_p.E523D|KLC1_ENST00000553286.1_Missense_Mutation_p.E523D|KLC1_ENST00000347839.6_Missense_Mutation_p.E523D|KLC1_ENST00000389744.4_Missense_Mutation_p.E523D|KLC1_ENST00000246489.7_Missense_Mutation_p.E523D|KLC1_ENST00000555836.1_Missense_Mutation_p.E523D|KLC1_ENST00000380038.3_Missense_Mutation_p.E548D|RP11-894P9.1_ENST00000498989.2_RNA|KLC1_ENST00000445352.4_Missense_Mutation_p.E521D|KLC1_ENST00000557450.1_Missense_Mutation_p.E523D|KLC1_ENST00000334553.6_Missense_Mutation_p.E523D|KLC1_ENST00000554280.1_Missense_Mutation_p.E523D	NM_182923.3	NP_891553.2	Q07866	KLC1_HUMAN	kinesin light chain 1	523					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|stress granule disassembly (GO:0035617)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|growth cone (GO:0030426)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)|motor activity (GO:0003774)		KLC1/ALK(2)	NS(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(2)|prostate(1)|urinary_tract(1)	12		Melanoma(154;0.155)|all_epithelial(191;0.19)				GGAGCCGTGAGAGCCTCAACG	0.562																																						dbGAP											0													172.0	134.0	147.0					14																	104145801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF267530	CCDS32165.1, CCDS41996.1, CCDS45168.1	14q32.3	2013-01-10	2007-03-09	2007-03-09	ENSG00000126214	ENSG00000126214		"""Tetratricopeptide (TTC) repeat domain containing"""	6387	protein-coding gene	gene with protein product		600025	"""kinesin 2 60/70kDa"", ""kinesin 2"""	KNS2		8274221, 11106729	Standard	NM_005552		Approved	KNS2A, KLC, hKLC1S, hKLC1N, hKLC1P, hKLC1G, hKLC1R, hKLC1J, hKLC1B	uc010tyf.2	Q07866	OTTHUMG00000169227	ENST00000348520.6:c.1569G>C	14.37:g.104145801G>C	ENSP00000341154:p.Glu523Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF62|F8VTM4|Q7RTM2|Q7RTM3|Q7RTM5|Q7RTP9|Q7RTQ3|Q7RTQ5|Q7RTQ6|Q86SF5|Q86TF5|Q86V74|Q86V75|Q86V76|Q86V77|Q86V78|Q86V79|Q96H62	Missense_Mutation	SNP	pfam_Rabaptin_Rab5-bd_dom,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Kinesin_light	p.E523D	ENST00000348520.6	37	c.1569	CCDS41996.1	14	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	15.31|15.31|15.31	2.796915|2.796915|2.796915	0.50208|0.50208|0.50208	.|.|.	.|.|.	ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000126214;ENSG00000256500|ENSG00000126214|ENSG00000126214	ENST00000348520;ENST00000443396;ENST00000380038;ENST00000389744;ENST00000557575;ENST00000553286;ENST00000347839;ENST00000555836;ENST00000334553;ENST00000246489;ENST00000557450;ENST00000554280;ENST00000452929;ENST00000445352;ENST00000472726|ENST00000537046;ENST00000535194|ENST00000553325;ENST00000553436;ENST00000555856	T;D;T;T;T;T;T;T;T;D;T;T;D;T|T|.	0.84730|0.54071|.	-1.13;-1.89;-1.12;-1.12;-1.12;-1.13;-1.12;-1.11;-1.12;-1.76;-1.13;-1.12;-1.75;-0.39|0.59|.	5.94|5.94|5.94	3.81|3.81|3.81	0.43845|0.43845|0.43845	.|.|.	0.000000|0.000000|.	0.85682|0.85682|.	D|D|.	0.000000|0.000000|.	T|T|T	0.50837|0.50837|0.50837	0.1639|0.1639|0.1639	L|L|L	0.29908|0.29908|0.29908	0.895|0.895|0.895	0.54753|0.54753|0.54753	D|D|D	0.999986|0.999986|0.999986	B;B;B;B;B;P;B|.|.	0.35401|.|.	0.002;0.005;0.003;0.001;0.007;0.499;0.0|.|.	B;B;B;B;B;B;B|.|.	0.34652|.|.	0.004;0.018;0.005;0.005;0.005;0.187;0.001|.|.	T|T|T	0.44544|0.44544|0.44544	-0.9321|-0.9321|-0.9321	10|8|5	0.41790|0.23302|.	T|T|.	0.15|0.38|.	-20.1222|-20.1222|-20.1222	11.3436|11.3436|11.3436	0.49548|0.49548|0.49548	0.2606:0.0:0.7394:0.0|0.2606:0.0:0.7394:0.0|0.2606:0.0:0.7394:0.0	.|.|.	523;548;695;523;523;523;521|.|.	F8VTM4;F8W6L3;E7EVH7;Q07866-4;Q07866-6;Q07866;G5E9S8|.|.	.;.;.;.;.;KLC1_HUMAN;.|.|.	D|Q|T	523;523;548;523;523;523;523;523;523;523;523;523;523;521;695|154;23|103;99;122	ENSP00000341154:E523D;ENSP00000369377:E548D;ENSP00000374394:E523D;ENSP00000450617:E523D;ENSP00000452487:E523D;ENSP00000334618:E523D;ENSP00000452481:E523D;ENSP00000334523:E523D;ENSP00000246489:E523D;ENSP00000450648:E523D;ENSP00000451242:E523D;ENSP00000414982:E523D;ENSP00000412693:E521D;ENSP00000439065:E695D|ENSP00000441347:E154Q|.	ENSP00000246489:E523D|ENSP00000442554:E81Q|.	E|E|R	+|+|+	3|1|2	2|0|0	KLC1;RP11-73M18.2|KLC1|KLC1	103215554|103215554|103215554	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.971000|0.971000|0.971000	0.66376|0.66376|0.66376	0.986000|0.986000|0.986000	0.29590|0.29590|0.29590	1.526000|1.526000|1.526000	0.49068|0.49068|0.49068	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|GAG|AGA	KLC1	-	NULL	ENSG00000126214		0.562	KLC1-001	KNOWN	basic|CCDS	protein_coding	KLC1	HGNC	protein_coding	OTTHUMT00000402947.2	75	0.00	0	G	NM_005552		104145801	104145801	+1	no_errors	ENST00000334553	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	1.000	C
KLHL13	90293	genome.wustl.edu	37	X	117054217	117054217	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:117054217G>C	ENST00000262820.3	-	3	1266	c.357C>G	c.(355-357)ttC>ttG	p.F119L	KLHL13_ENST00000545703.1_Missense_Mutation_p.F77L|KLHL13_ENST00000540167.1_Missense_Mutation_p.F103L|KLHL13_ENST00000469946.1_Missense_Mutation_p.F68L|KLHL13_ENST00000371876.1_Missense_Mutation_p.F68L|KLHL13_ENST00000539496.1_Missense_Mutation_p.F122L|KLHL13_ENST00000371878.1_Missense_Mutation_p.F68L|KLHL13_ENST00000541812.1_Missense_Mutation_p.F103L|KLHL13_ENST00000371882.1_Missense_Mutation_p.F68L	NM_033495.3	NP_277030.2	Q9P2N7	KLH13_HUMAN	kelch-like family member 13	119	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.				cytokinesis (GO:0000910)|mitotic nuclear division (GO:0007067)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)				NS(1)|breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(9)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	34						ACATAGCCTTGAAGTAATCAC	0.373																																						dbGAP											0													171.0	142.0	152.0					X																	117054217		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037730	CCDS14571.1, CCDS55479.1, CCDS55480.1, CCDS55481.1	Xq23-q24	2013-01-30	2013-01-30	2004-02-18	ENSG00000003096	ENSG00000003096		"""Kelch-like"", ""BTB/POZ domain containing"""	22931	protein-coding gene	gene with protein product		300655	"""BTB and kelch domain containing 2, KIAA1309"", ""kelch-like 13 (Drosophila)"""	BKLHD2, KIAA1309		10718198	Standard	NM_033495		Approved	FLJ10262	uc011mtp.2	Q9P2N7	OTTHUMG00000022252	ENST00000262820.3:c.357C>G	X.37:g.117054217G>C	ENSP00000262820:p.Phe119Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KV78|B3KWM7|B7Z3S9|B7Z5P2|B7Z802|D3DWH6|Q6P2E3|Q96QI7|Q9UDN9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.F122L	ENST00000262820.3	37	c.366	CCDS14571.1	X	.	.	.	.	.	.	.	.	.	.	g	23.2	4.393305	0.83011	.	.	ENSG00000003096	ENST00000371882;ENST00000371876;ENST00000371878;ENST00000447671;ENST00000541812;ENST00000540167;ENST00000539496;ENST00000262820;ENST00000545703;ENST00000469946	D;D;D;D;D;D;D;D;D;D	0.84944	-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92;-1.92	4.99	4.99	0.66335	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.000000	0.85682	D	0.000000	D	0.91761	0.7394	M	0.84219	2.685	0.58432	D	0.999999	D;P;D;D	0.71674	0.98;0.923;0.994;0.998	D;P;D;D	0.79108	0.943;0.47;0.976;0.992	D	0.92491	0.6000	10	0.87932	D	0	.	11.0025	0.47614	0.0873:0.0:0.9127:0.0	.	103;122;113;119	Q9P2N7-3;Q9P2N7-5;Q9P2N7-4;Q9P2N7	.;.;.;KLH13_HUMAN	L	68;68;68;68;103;103;122;119;77;68	ENSP00000360949:F68L;ENSP00000360943:F68L;ENSP00000360945:F68L;ENSP00000412640:F68L;ENSP00000444450:F103L;ENSP00000441029:F103L;ENSP00000443191:F122L;ENSP00000262820:F119L;ENSP00000440707:F77L;ENSP00000419803:F68L	ENSP00000262820:F119L	F	-	3	2	KLHL13	116938245	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.884000	0.63135	2.293000	0.77203	0.540000	0.68198	TTC	KLHL13	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000003096		0.373	KLHL13-201	KNOWN	basic|CCDS	protein_coding	KLHL13	HGNC	protein_coding		58	0.00	0	G	NM_033495		117054217	117054217	-1	no_errors	ENST00000539496	ensembl	human	known	69_37n	missense	49	22.22	14	SNP	1.000	C
KRT35	3886	genome.wustl.edu	37	17	39637140	39637140	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:39637140G>A	ENST00000393989.1	-	1	252	c.210C>T	c.(208-210)ctC>ctT	p.L70L	KRT35_ENST00000246639.2_Silent_p.L40L	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	70	Head.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				CAGGGAGGCAGAGAGCAGGGA	0.617																																						dbGAP											0													34.0	40.0	38.0					17																	39637140		2131	4251	6382	-	-	-	SO:0001819	synonymous_variant	0			X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.210C>T	17.37:g.39637140G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O76012|Q92651	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.L70	ENST00000393989.1	37	c.210	CCDS11394.2	17																																																																																			KRT35	-	NULL	ENSG00000197079		0.617	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT35	HGNC	protein_coding		33	0.00	0	G	NM_002280		39637140	39637140	-1	no_errors	ENST00000393989	ensembl	human	known	69_37n	silent	40	14.89	7	SNP	0.007	A
L3MBTL3	84456	genome.wustl.edu	37	6	130407294	130407294	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:130407294C>T	ENST00000529410.1	+	18	1896	c.1417C>T	c.(1417-1419)Cat>Tat	p.H473Y	L3MBTL3_ENST00000368136.2_Missense_Mutation_p.H473Y|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.H448Y|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.H473Y|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.H448Y|L3MBTL3_ENST00000526019.1_Missense_Mutation_p.H448Y			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	473					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		GAAACCTCCTCATGGATTCCA	0.383																																						dbGAP											0													103.0	119.0	113.0					6																	130407294		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1417C>T	6.37:g.130407294C>T	ENSP00000431962:p.His473Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.H473Y	ENST00000529410.1	37	c.1417	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366714	0.82463	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.46	5.46	0.80206	.	0.000000	0.85682	D	0.000000	T	0.64918	0.2642	M	0.88105	2.93	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.988	T	0.69844	-0.5035	10	0.52906	T	0.07	.	16.2233	0.82274	0.0:1.0:0.0:0.0	.	448;473	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	Y	473;448;473;448;448;473	ENSP00000431962:H473Y;ENSP00000437185:H448Y;ENSP00000354526:H473Y;ENSP00000357121:H448Y;ENSP00000436706:H448Y;ENSP00000357118:H473Y	ENSP00000354526:H473Y	H	+	1	0	L3MBTL3	130448987	1.000000	0.71417	0.995000	0.50966	0.935000	0.57460	6.803000	0.75180	2.574000	0.86865	0.557000	0.71058	CAT	L3MBTL3	-	smart_Mbt,pfscan_Mbt	ENSG00000198945		0.383	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	67	0.00	0	C	XM_027074		130407294	130407294	+1	no_errors	ENST00000361794	ensembl	human	known	69_37n	missense	70	10.26	8	SNP	1.000	T
LAMA1	284217	genome.wustl.edu	37	18	6992681	6992681	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr18:6992681C>T	ENST00000389658.3	-	36	5140	c.5047G>A	c.(5047-5049)Gaa>Aaa	p.E1683K		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1683	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGGAAATCTTCATCCAAAGTC	0.353																																						dbGAP											0													132.0	130.0	131.0					18																	6992681		2203	4300	6503	-	-	-	SO:0001583	missense	0			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5047G>A	18.37:g.6992681C>T	ENSP00000374309:p.Glu1683Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E1683K	ENST00000389658.3	37	c.5047	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	0.257	-1.002255	0.02128	.	.	ENSG00000101680	ENST00000389658	T	0.11277	2.79	5.56	1.18	0.20946	Laminin I (1);	1.081980	0.07036	N	0.829345	T	0.09818	0.0241	L	0.44542	1.39	0.09310	N	1	B	0.19445	0.036	B	0.19148	0.024	T	0.42882	-0.9425	10	0.20519	T	0.43	.	6.9994	0.24801	0.0:0.5103:0.119:0.3706	.	1683	P25391	LAMA1_HUMAN	K	1683	ENSP00000374309:E1683K	ENSP00000374309:E1683K	E	-	1	0	LAMA1	6982681	0.000000	0.05858	0.035000	0.18076	0.063000	0.16089	-0.127000	0.10547	0.302000	0.22762	0.467000	0.42956	GAA	LAMA1	-	pfam_Laminin_I	ENSG00000101680		0.353	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	71	0.00	0	C	NM_005559		6992681	6992681	-1	no_errors	ENST00000389658	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	0.000	T
LAMB2	3913	genome.wustl.edu	37	3	49169564	49169564	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:49169564G>A	ENST00000418109.1	-	5	608	c.444C>T	c.(442-444)ctC>ctT	p.L148L	LAMB2_ENST00000305544.4_Silent_p.L148L	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	148	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		AGGTCATAATGAGGTGTGTGA	0.552																																						dbGAP											0													89.0	86.0	87.0					3																	49169564		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.444C>T	3.37:g.49169564G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16321	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L148	ENST00000418109.1	37	c.444	CCDS2789.1	3																																																																																			LAMB2	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000172037		0.552	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	60	0.00	0	G	NM_002292		49169564	49169564	-1	no_errors	ENST00000305544	ensembl	human	known	69_37n	silent	26	16.13	5	SNP	0.997	A
LARP4	113251	genome.wustl.edu	37	12	50860767	50860767	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:50860767C>T	ENST00000398473.2	+	13	1521	c.1409C>T	c.(1408-1410)tCa>tTa	p.S470L	LARP4_ENST00000518444.1_Missense_Mutation_p.S469L|LARP4_ENST00000429001.3_Missense_Mutation_p.S476L|LARP4_ENST00000293618.8_Missense_Mutation_p.S399L|LARP4_ENST00000347328.5_Missense_Mutation_p.S399L	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	470					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						ACAGCTGAATCAAAGGCTCCA	0.403																																						dbGAP											0													125.0	113.0	117.0					12																	50860767		1854	4098	5952	-	-	-	SO:0001583	missense	0			AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1409C>T	12.37:g.50860767C>T	ENSP00000381490:p.Ser470Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.S476L	ENST00000398473.2	37	c.1427	CCDS41782.1	12	.	.	.	.	.	.	.	.	.	.	C	14.68	2.608139	0.46527	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000518444;ENST00000520064;ENST00000347328	T;T;T;T;T	0.27720	1.65;1.65;1.65;1.65;1.65	4.99	4.09	0.47781	.	0.307754	0.23549	N	0.046985	T	0.15219	0.0367	N	0.08118	0	0.30279	N	0.791543	B;B;B;B;B;B	0.18461	0.014;0.014;0.015;0.009;0.008;0.028	B;B;B;B;B;B	0.15870	0.012;0.014;0.003;0.006;0.005;0.008	T	0.10543	-1.0625	10	0.25751	T	0.34	.	10.4886	0.44737	0.0:0.8468:0.0:0.1532	.	371;469;399;399;470;476	Q71RC2-2;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;LARP4_HUMAN;.	L	399;476;470;469;371;399	ENSP00000293618:S399L;ENSP00000415464:S476L;ENSP00000381490:S470L;ENSP00000429077:S469L;ENSP00000340901:S399L	ENSP00000293618:S399L	S	+	2	0	LARP4	49147034	1.000000	0.71417	1.000000	0.80357	0.920000	0.55202	2.037000	0.41174	1.418000	0.47098	0.455000	0.32223	TCA	LARP4	-	NULL	ENSG00000161813		0.403	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP4	HGNC	protein_coding	OTTHUMT00000374981.1	96	0.00	0	C	NM_052879		50860767	50860767	+1	no_errors	ENST00000429001	ensembl	human	known	69_37n	missense	47	24.19	15	SNP	1.000	T
LGALS1	3956	genome.wustl.edu	37	22	38074659	38074659	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:38074659G>C	ENST00000215909.5	+	3	354	c.259G>C	c.(259-261)Gag>Cag	p.E87Q	LGALS1_ENST00000489315.1_3'UTR	NM_002305.3	NP_002296.1	P09382	LEG1_HUMAN	lectin, galactoside-binding, soluble, 1	87	Galectin. {ECO:0000255|PROSITE- ProRule:PRU00639}.				apoptotic process (GO:0006915)|cellular response to glucose stimulus (GO:0071333)|cellular response to organic cyclic compound (GO:0071407)|multicellular organismal response to stress (GO:0033555)|myoblast differentiation (GO:0045445)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of neuron projection development (GO:0010977)|plasma cell differentiation (GO:0002317)|positive regulation of erythrocyte aggregation (GO:0034120)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	galactoside binding (GO:0016936)|lactose binding (GO:0030395)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(1)|lung(1)	3	Melanoma(58;0.0574)					AAGTGTTGCAGAGGTGGGCTG	0.672																																					Pancreas(23;406 890 14304 26016)	dbGAP											0													22.0	20.0	20.0					22																	38074659		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS13954.1	22q13.1	2014-01-30	2008-07-25		ENSG00000100097	ENSG00000100097		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6561	protein-coding gene	gene with protein product	"""galectin 1"""	150570				1988031, 12271131	Standard	NM_002305		Approved	GBP	uc003atn.3	P09382	OTTHUMG00000150661	ENST00000215909.5:c.259G>C	22.37:g.38074659G>C	ENSP00000215909:p.Glu87Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5E8|Q9UDK5	Missense_Mutation	SNP	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	p.E87Q	ENST00000215909.5	37	c.259	CCDS13954.1	22	.	.	.	.	.	.	.	.	.	.	G	11.68	1.709883	0.30322	.	.	ENSG00000100097	ENST00000215909	T	0.47528	0.84	5.7	5.7	0.88788	Concanavalin A-like lectin/glucanase (1);Galectin, carbohydrate recognition domain (4);Concanavalin A-like lectin/glucanase, subgroup (1);	0.229581	0.44902	D	0.000404	T	0.47303	0.1438	L	0.42686	1.345	0.43439	D	0.995618	B	0.27013	0.166	B	0.37692	0.256	T	0.42882	-0.9425	10	0.45353	T	0.12	-2.7637	13.3767	0.60743	0.0:0.0:0.8425:0.1575	.	87	P09382	LEG1_HUMAN	Q	87	ENSP00000215909:E87Q	ENSP00000215909:E87Q	E	+	1	0	LGALS1	36404605	1.000000	0.71417	0.961000	0.40146	0.020000	0.10135	3.675000	0.54605	2.695000	0.91970	0.544000	0.68410	GAG	LGALS1	-	pfam_Galectin_CRD,superfamily_ConA-like_lec_gl,smart_Galectin_CRD	ENSG00000100097		0.672	LGALS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS1	HGNC	protein_coding	OTTHUMT00000319482.1	16	0.00	0	G	NM_002305		38074659	38074659	+1	no_errors	ENST00000215909	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	0.971	C
LIN7B	64130	genome.wustl.edu	37	19	49619635	49619635	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:49619635C>T	ENST00000221459.2	+	4	388	c.344C>T	c.(343-345)tCg>tTg	p.S115L	LIN7B_ENST00000391864.3_Intron	NM_022165.2	NP_071448.1	Q9HAP6	LIN7B_HUMAN	lin-7 homolog B (C. elegans)	115	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				exocytosis (GO:0006887)|neurotransmitter secretion (GO:0007269)|protein transport (GO:0015031)	neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	protein domain specific binding (GO:0019904)			central_nervous_system(1)|endometrium(1)|prostate(1)	3		all_lung(116;3.16e-06)|Lung NSC(112;6.25e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;5e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000191)|GBM - Glioblastoma multiforme(486;0.00449)|Epithelial(262;0.01)		GAGCAAAACTCGCCCATCTAC	0.597																																						dbGAP											0													84.0	71.0	75.0					19																	49619635		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF311862	CCDS12757.1	19q13.3	2008-07-17			ENSG00000104863	ENSG00000104863			17788	protein-coding gene	gene with protein product		612331				10341223	Standard	XR_243950		Approved	MALS-2, LIN-7B, VELI2	uc002pmp.3	Q9HAP6	OTTHUMG00000134288	ENST00000221459.2:c.344C>T	19.37:g.49619635C>T	ENSP00000221459:p.Ser115Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_PDZ,pfam_L27_C,superfamily_PDZ,smart_L27,smart_PDZ,pirsf_Lin-7_homologue,pfscan_L27,pfscan_PDZ	p.S115L	ENST00000221459.2	37	c.344	CCDS12757.1	19	.	.	.	.	.	.	.	.	.	.	C	18.94	3.729239	0.69074	.	.	ENSG00000104863	ENST00000221459	T	0.27104	1.69	3.92	3.92	0.45320	PDZ/DHR/GLGF (4);	0.000000	0.64402	D	0.000006	T	0.33265	0.0857	N	0.25647	0.755	0.80722	D	1	D	0.61080	0.989	P	0.60415	0.874	T	0.09487	-1.0672	10	0.45353	T	0.12	-17.1533	15.2307	0.73386	0.0:1.0:0.0:0.0	.	115	Q9HAP6	LIN7B_HUMAN	L	115	ENSP00000221459:S115L	ENSP00000221459:S115L	S	+	2	0	LIN7B	54311447	1.000000	0.71417	0.936000	0.37596	0.982000	0.71751	7.542000	0.82095	2.184000	0.69523	0.561000	0.74099	TCG	LIN7B	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_Lin-7_homologue,pfscan_PDZ	ENSG00000104863		0.597	LIN7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN7B	HGNC	protein_coding	OTTHUMT00000258980.1	37	0.00	0	C	NM_022165		49619635	49619635	+1	no_errors	ENST00000221459	ensembl	human	known	69_37n	missense	23	17.86	5	SNP	1.000	T
LINGO2	158038	genome.wustl.edu	37	9	27950141	27950141	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:27950141G>A	ENST00000379992.2	-	6	978	c.529C>T	c.(529-531)Ctt>Ttt	p.L177F	LINGO2_ENST00000308675.3_Missense_Mutation_p.L177F	NM_152570.2	NP_689783.1	Q7L985	LIGO2_HUMAN	leucine rich repeat and Ig domain containing 2	177						integral component of membrane (GO:0016021)				autonomic_ganglia(1)|breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	44	Melanoma(11;0.242)	all_neural(11;2.78e-09)		UCEC - Uterine corpus endometrioid carcinoma (5;0.0818)|GBM - Glioblastoma multiforme(2;1.31e-34)|all cancers(2;2.37e-25)|Lung(2;7.48e-08)|LUSC - Lung squamous cell carcinoma(38;5.09e-07)|KIRC - Kidney renal clear cell carcinoma(2;0.0465)|Kidney(2;0.0604)		TCCAAGCTAAGAAGCCCACTG	0.473																																						dbGAP											0													59.0	59.0	59.0					9																	27950141		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL353746	CCDS6524.1	9p21.2	2013-01-11	2007-02-01	2007-02-01	ENSG00000174482	ENSG00000174482		"""Immunoglobulin superfamily / I-set domain containing"""	21207	protein-coding gene	gene with protein product		609793	"""leucine rich repeat neuronal 6C"""	LRRN6C		14686891	Standard	NM_152570		Approved	LERN3	uc003zqu.2	Q7L985	OTTHUMG00000019721	ENST00000379992.2:c.529C>T	9.37:g.27950141G>A	ENSP00000369328:p.Leu177Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K7|B2RPM5|Q6ZMD0	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,pfam_LRR-contain_N,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L177F	ENST00000379992.2	37	c.529	CCDS6524.1	9	.	.	.	.	.	.	.	.	.	.	G	7.506	0.653768	0.14580	.	.	ENSG00000174482	ENST00000379992;ENST00000308675	T;T	0.79940	-1.32;-1.32	6.17	3.36	0.38483	.	0.231137	0.36374	N	0.002636	T	0.69133	0.3077	L	0.37750	1.13	0.44570	D	0.997531	P	0.43973	0.823	B	0.40864	0.342	T	0.62324	-0.6878	9	.	.	.	.	7.2543	0.26166	0.1941:0.1217:0.6841:0.0	.	177	Q7L985	LIGO2_HUMAN	F	177	ENSP00000369328:L177F;ENSP00000310126:L177F	.	L	-	1	0	LINGO2	27940141	0.996000	0.38824	0.996000	0.52242	0.925000	0.55904	2.565000	0.45939	0.478000	0.27488	0.655000	0.94253	CTT	LINGO2	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000174482		0.473	LINGO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LINGO2	HGNC	protein_coding	OTTHUMT00000051978.2	25	0.00	0	G	NM_152570		27950141	27950141	-1	no_errors	ENST00000308675	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	0.996	A
LPHN3	23284	genome.wustl.edu	37	4	62800719	62800719	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:62800719C>T	ENST00000514591.1	+	13	2399	c.2070C>T	c.(2068-2070)gtC>gtT	p.V690V	LPHN3_ENST00000504896.1_Silent_p.V690V|LPHN3_ENST00000506700.1_Silent_p.V690V|LPHN3_ENST00000506746.1_Silent_p.V758V|LPHN3_ENST00000509896.1_Silent_p.V758V|LPHN3_ENST00000545650.1_Silent_p.V690V|LPHN3_ENST00000514157.1_Silent_p.V690V|LPHN3_ENST00000507625.1_Silent_p.V758V|LPHN3_ENST00000512091.2_Silent_p.V690V|LPHN3_ENST00000507164.1_Silent_p.V758V|LPHN3_ENST00000508693.1_Silent_p.V758V|LPHN3_ENST00000514996.1_Silent_p.V690V|LPHN3_ENST00000511324.1_Silent_p.V758V|LPHN3_ENST00000506720.1_Silent_p.V758V|LPHN3_ENST00000508078.1_3'UTR|LPHN3_ENST00000508946.1_Silent_p.V690V			Q9HAR2	LPHN3_HUMAN	latrophilin 3	677					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(21)|lung(73)|ovary(1)|pancreas(1)|prostate(6)|upper_aerodigestive_tract(1)	125						CTGACATTGTCAGGGAGAATA	0.433																																						dbGAP											0													99.0	98.0	98.0					4																	62800719		1980	4172	6152	-	-	-	SO:0001819	synonymous_variant	0			AB018311	CCDS54768.1	4q13.1	2014-08-08				ENSG00000150471		"""-"", ""GPCR / Class B : Orphans"""	20974	protein-coding gene	gene with protein product						10994649	Standard	NM_015236		Approved	KIAA0768, LEC3	uc010ihh.3	Q9HAR2		ENST00000514591.1:c.2070C>T	4.37:g.62800719C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE04|O94867|Q9NWK5	Nonsense_Mutation	SNP	pfam_GPCR_2_latrophilin_rcpt_C,pfam_DUF3497,pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,prints_GPCR_2_secretin-like,prints_GPCR_2_latrophilin,pfscan_GPS_dom,pfscan_GPCR_2-like	p.Q148*	ENST00000514591.1	37	c.442	CCDS54768.1	4	.	.	.	.	.	.	.	.	.	.	C	6.786	0.514024	0.12944	.	.	ENSG00000150471	ENST00000502815	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.1805	0.81895	0.0:0.8671:0.1329:0.0	.	.	.	.	X	148	.	.	Q	+	1	0	LPHN3	62483314	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	1.145000	0.31577	2.937000	0.99478	0.650000	0.86243	CAG	LPHN3	-	pfam_DUF3497	ENSG00000150471		0.433	LPHN3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPHN3	HGNC	protein_coding	OTTHUMT00000361765.1	74	0.00	0	C			62800719	62800719	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000502815	ensembl	human	known	69_37n	nonsense	55	14.06	9	SNP	1.000	T
LPO	4025	genome.wustl.edu	37	17	56321413	56321413	+	Silent	SNP	C	C	T	rs549382833	byFrequency	TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:56321413C>T	ENST00000262290.4	+	3	451	c.135C>T	c.(133-135)gtC>gtT	p.V45V	LPO_ENST00000582328.1_Intron|LPO_ENST00000543544.1_Intron|LPO_ENST00000421678.2_Intron	NM_006151.2	NP_006142.1	P22079	PERL_HUMAN	lactoperoxidase	45					defense response to bacterium (GO:0042742)|detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|hydrogen peroxide catabolic process (GO:0042744)|response to oxidative stress (GO:0006979)|thiocyanate metabolic process (GO:0018969)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|thiocyanate peroxidase activity (GO:0036393)			breast(5)|cervix(1)|endometrium(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	30						AGGTCCAAGTCAACAAGGCCT	0.557													C|||	3	0.000599042	0.0	0.0	5008	,	,		15456	0.003		0.0	False		,,,				2504	0.0					dbGAP											0													155.0	114.0	128.0					17																	56321413		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M58151	CCDS32689.1, CCDS54149.1	17q23.1	2008-02-05				ENSG00000167419	1.11.1.7		6678	protein-coding gene	gene with protein product		150205				2222811, 8964511	Standard	NM_006151		Approved	SPO	uc002ivt.3	P22079		ENST00000262290.4:c.135C>T	17.37:g.56321413C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5JUY4|E7EMJ3|Q13408|Q3KNQ2	Silent	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.V45	ENST00000262290.4	37	c.135	CCDS32689.1	17																																																																																			LPO	-	NULL	ENSG00000167419		0.557	LPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LPO	HGNC	protein_coding	OTTHUMT00000443961.1	42	0.00	0	C			56321413	56321413	+1	no_errors	ENST00000262290	ensembl	human	known	69_37n	silent	31	16.22	6	SNP	1.000	T
LRPPRC	10128	genome.wustl.edu	37	2	44161331	44161331	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:44161331C>T	ENST00000260665.7	-	25	2791	c.2734G>A	c.(2734-2736)Gag>Aag	p.E912K		NM_133259.3	NP_573566.2	P42704	LPPRC_HUMAN	leucine-rich pentatricopeptide repeat containing	912					mitochondrion transport along microtubule (GO:0047497)|mRNA transport (GO:0051028)|negative regulation of mitochondrial RNA catabolic process (GO:0000961)|regulation of mitochondrial translation (GO:0070129)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome (GO:0000794)|cytoskeleton (GO:0005856)|membrane (GO:0016020)|microtubule (GO:0005874)|mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|ribonucleoprotein complex (GO:0030529)	beta-tubulin binding (GO:0048487)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			breast(3)|endometrium(3)|kidney(5)|large_intestine(9)|lung(15)|ovary(2)|prostate(2)|skin(2)	41		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				AATCACACCTCAATGATCTTC	0.333																																						dbGAP											0													88.0	83.0	84.0					2																	44161331		2203	4300	6503	-	-	-	SO:0001583	missense	0			M92439	CCDS33189.1	2p21	2012-02-24	2012-02-24		ENSG00000138095	ENSG00000138095			15714	protein-coding gene	gene with protein product		607544	"""Leigh syndrome, French-Canadian type (cytochrome oxidase deficiency)"""	LSFC		8012652, 8619474, 22045337	Standard	NM_133259		Approved	GP130, LRP130	uc002rtr.2	P42704	OTTHUMG00000152782	ENST00000260665.7:c.2734G>A	2.37:g.44161331C>T	ENSP00000260665:p.Glu912Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJE3|A8K1V1|Q53PC0|Q53QN7|Q6ZUD8|Q7Z7A6|Q96D84	Missense_Mutation	SNP	pfam_Pentatricopeptide_repeat,tigrfam_Pentatricopeptide_repeat	p.E912K	ENST00000260665.7	37	c.2734	CCDS33189.1	2	.	.	.	.	.	.	.	.	.	.	C	27.8	4.865957	0.91511	.	.	ENSG00000138095	ENST00000465633;ENST00000260665	T	0.61158	0.13	5.5	5.5	0.81552	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.75332	0.3835	M	0.76838	2.35	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.996	T	0.70110	-0.4962	10	0.10636	T	0.68	-7.2746	19.3927	0.94590	0.0:1.0:0.0:0.0	.	812;912	F5H4J6;P42704	.;LPPRC_HUMAN	K	812;912	ENSP00000260665:E912K	ENSP00000260665:E912K	E	-	1	0	LRPPRC	44014835	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.431000	0.80335	2.593000	0.87608	0.491000	0.48974	GAG	LRPPRC	-	NULL	ENSG00000138095		0.333	LRPPRC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRPPRC	HGNC	protein_coding	OTTHUMT00000327823.1	86	0.00	0	C	NM_133259		44161331	44161331	-1	no_errors	ENST00000260665	ensembl	human	known	69_37n	missense	71	19.32	17	SNP	1.000	T
LRRC8C	84230	genome.wustl.edu	37	1	90178302	90178302	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:90178302G>C	ENST00000370454.4	+	3	428	c.173G>C	c.(172-174)aGa>aCa	p.R58T	RP11-302M6.4_ENST00000370453.5_Intron|LRRC8C_ENST00000479252.1_Intron	NM_032270.4	NP_115646	Q8TDW0	LRC8C_HUMAN	leucine rich repeat containing 8 family, member C	58					fat cell differentiation (GO:0045444)|ion transport (GO:0006811)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|urinary_tract(1)	28		all_lung(203;0.126)		all cancers(265;0.00756)|Epithelial(280;0.0313)		CTTCCGAAAAGAGTGCAGCCT	0.428																																						dbGAP											0													85.0	83.0	83.0					1																	90178302		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS725.1	1p22.2	2011-02-10			ENSG00000171488	ENSG00000171488			25075	protein-coding gene	gene with protein product	"""hypothetical protein AD158"""	612889				11230166	Standard	NM_032270		Approved	AD158	uc001dnl.4	Q8TDW0	OTTHUMG00000010305	ENST00000370454.4:c.173G>C	1.37:g.90178302G>C	ENSP00000359483:p.Arg58Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXS9|Q29RV6|Q9H075	Missense_Mutation	SNP	pfam_LRR_protein-8_N,pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.R58T	ENST00000370454.4	37	c.173	CCDS725.1	1	.	.	.	.	.	.	.	.	.	.	G	12.50	1.958028	0.34565	.	.	ENSG00000171488	ENST00000370454	T	0.23552	1.9	5.78	4.82	0.62117	Leucine-rich repeat-containing protein 8, N-terminal (1);	0.120303	0.52532	D	0.000075	T	0.15435	0.0372	L	0.44542	1.39	0.42367	D	0.99243	B	0.06786	0.001	B	0.10450	0.005	T	0.02126	-1.1209	10	0.48119	T	0.1	.	18.4661	0.90755	0.0:0.1275:0.8725:0.0	.	58	Q8TDW0	LRC8C_HUMAN	T	58	ENSP00000359483:R58T	ENSP00000359483:R58T	R	+	2	0	LRRC8C	89950890	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.833000	0.62766	2.724000	0.93272	0.655000	0.94253	AGA	LRRC8C	-	pfam_LRR_protein-8_N	ENSG00000171488		0.428	LRRC8C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC8C	HGNC	protein_coding	OTTHUMT00000028435.2	31	0.00	0	G	NM_032270		90178302	90178302	+1	no_errors	ENST00000370454	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.998	C
LRRN1	57633	genome.wustl.edu	37	3	3886976	3886976	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:3886976G>A	ENST00000319331.3	+	2	1412	c.651G>A	c.(649-651)ttG>ttA	p.L217L	SUMF1_ENST00000534863.1_Intron	NM_020873.5	NP_065924.3	Q6UXK5	LRRN1_HUMAN	leucine rich repeat neuronal 1	217						integral component of membrane (GO:0016021)				NS(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)|skin(1)|urinary_tract(2)	26				Epithelial(13;0.000886)|all cancers(10;0.0032)|OV - Ovarian serous cystadenocarcinoma(96;0.00608)|STAD - Stomach adenocarcinoma(44;0.0617)		TCGCAAATTTGAGAAGCTTAG	0.423																																						dbGAP											0													129.0	138.0	135.0					3																	3886976		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB040930	CCDS33685.1	3p26.2	2013-01-11			ENSG00000175928	ENSG00000175928		"""Immunoglobulin superfamily / I-set domain containing"""	20980	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 3"""					10819331	Standard	NM_020873		Approved	FIGLER3	uc003bpt.4	Q6UXK5	OTTHUMG00000154934	ENST00000319331.3:c.651G>A	3.37:g.3886976G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LID5|Q8IYV5|Q9H8V1|Q9P231	Silent	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L217	ENST00000319331.3	37	c.651	CCDS33685.1	3																																																																																			LRRN1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000175928		0.423	LRRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRN1	HGNC	protein_coding	OTTHUMT00000337704.2	44	0.00	0	G	NM_020873		3886976	3886976	+1	no_errors	ENST00000319331	ensembl	human	known	69_37n	silent	37	21.28	10	SNP	1.000	A
LRRN2	10446	genome.wustl.edu	37	1	204587686	204587686	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:204587686C>T	ENST00000367175.1	-	1	3647	c.1435G>A	c.(1435-1437)Gag>Aag	p.E479K	LRRN2_ENST00000367177.3_Missense_Mutation_p.E479K|RP11-430C7.4_ENST00000453895.1_RNA|LRRN2_ENST00000367176.3_Missense_Mutation_p.E479K|LRRN2_ENST00000496057.1_5'Flank			O75325	LRRN2_HUMAN	leucine rich repeat neuronal 2	479	Ig-like C2-type.				cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|liver(1)|lung(22)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	38	all_cancers(21;0.0519)|Breast(84;0.112)|Prostate(682;0.19)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)			AGGGTCCCCTCGGGGTACACC	0.637																																						dbGAP											0													52.0	52.0	52.0					1																	204587686		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF030435	CCDS1448.1	1q32.1	2013-01-11	2007-01-31	2007-01-31	ENSG00000170382	ENSG00000170382		"""Immunoglobulin superfamily / I-set domain containing"""	16914	protein-coding gene	gene with protein product	"""leucine rich and ankyrin repeats 1"", ""fibronectin type III, immunoglobulin and leucine rich repeat domain 7"""	605492	"""leucine rich repeat neuronal 5"""	LRRN5		9662332	Standard	NM_006338		Approved	GAC1, LRANK1, FIGLER7	uc001hbf.1	O75325	OTTHUMG00000035989	ENST00000367175.1:c.1435G>A	1.37:g.204587686C>T	ENSP00000356143:p.Glu479Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R624|Q5T0Y0|Q6UXM0|Q8N182	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E479K	ENST00000367175.1	37	c.1435	CCDS1448.1	1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.733903	0.89482	.	.	ENSG00000170382	ENST00000367176;ENST00000367177;ENST00000367175	T;T;T	0.67171	-0.25;-0.25;-0.25	5.53	5.53	0.82687	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.43747	D	0.000540	T	0.79873	0.4521	L	0.55834	1.745	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.80630	-0.1297	10	0.66056	D	0.02	.	19.0525	0.93051	0.0:1.0:0.0:0.0	.	479	O75325	LRRN2_HUMAN	K	479	ENSP00000356144:E479K;ENSP00000356145:E479K;ENSP00000356143:E479K	ENSP00000356143:E479K	E	-	1	0	LRRN2	202854309	1.000000	0.71417	0.966000	0.40874	0.996000	0.88848	7.751000	0.85126	2.604000	0.88044	0.591000	0.81541	GAG	LRRN2	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000170382		0.637	LRRN2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LRRN2	HGNC	protein_coding	OTTHUMT00000089894.1	46	0.00	0	C	NM_006338		204587686	204587686	-1	no_errors	ENST00000367175	ensembl	human	known	69_37n	missense	22	21.43	6	SNP	1.000	T
LSP1	4046	genome.wustl.edu	37	11	1905529	1905529	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:1905529C>A	ENST00000311604.3	+	6	786	c.611C>A	c.(610-612)tCc>tAc	p.S204Y	LSP1_ENST00000485341.1_3'UTR|LSP1_ENST00000406638.2_Missense_Mutation_p.S142Y|LSP1_ENST00000381775.1_Missense_Mutation_p.S332Y|LSP1_ENST00000405957.2_Missense_Mutation_p.S142Y	NM_002339.2	NP_002330.1	P33241	LSP1_HUMAN	lymphocyte-specific protein 1	204					cellular component movement (GO:0006928)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)	actin cytoskeleton (GO:0015629)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|signal transducer activity (GO:0004871)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(9)|prostate(1)|skin(1)	16		all_epithelial(84;0.000138)|Breast(177;0.000962)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|Lung(200;0.0729)|LUSC - Lung squamous cell carcinoma(625;0.0856)		AGGACCGAGTCCCTAAACCGC	0.557																																						dbGAP											0													83.0	78.0	80.0					11																	1905529		2202	4299	6501	-	-	-	SO:0001583	missense	0			M33552	CCDS31334.1, CCDS31335.1, CCDS58110.1	11p15.5	2008-02-05			ENSG00000130592	ENSG00000130592			6707	protein-coding gene	gene with protein product		153432				2174784	Standard	NM_001242932		Approved	WP34	uc001luj.3	P33241	OTTHUMG00000012252	ENST00000311604.3:c.611C>A	11.37:g.1905529C>A	ENSP00000308383:p.Ser204Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPP1|B3KRR6|E9PBV6|E9PFP3|Q16096|Q53H48|Q6FHM3|Q9BUY8	Missense_Mutation	SNP	pfam_Caldesmon_LSP,prints_Lymphspecific	p.S204Y	ENST00000311604.3	37	c.611	CCDS31334.1	11	.	.	.	.	.	.	.	.	.	.	.	14.49	2.550561	0.45383	.	.	ENSG00000130592	ENST00000311604;ENST00000381775;ENST00000405957;ENST00000457279;ENST00000406638;ENST00000417766;ENST00000432093	T;T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93;0.93	3.13	2.18	0.27775	.	0.000000	0.36703	U	0.002455	T	0.51890	0.1701	L	0.53249	1.67	0.30691	N	0.751289	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.989	T	0.51779	-0.8662	10	0.15952	T	0.53	-15.9879	10.2867	0.43570	0.0:0.6108:0.3892:0.0	.	332;204	E9PFP3;P33241	.;LSP1_HUMAN	Y	204;332;142;195;142;142;142	ENSP00000308383:S204Y;ENSP00000371194:S332Y;ENSP00000383932:S142Y;ENSP00000400346:S195Y;ENSP00000384022:S142Y;ENSP00000416363:S142Y;ENSP00000412405:S142Y	ENSP00000308383:S204Y	S	+	2	0	LSP1	1862105	0.993000	0.37304	1.000000	0.80357	0.701000	0.40568	1.304000	0.33482	0.614000	0.30107	0.205000	0.17691	TCC	LSP1	-	pfam_Caldesmon_LSP,prints_Lymphspecific	ENSG00000130592		0.557	LSP1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	LSP1	HGNC	protein_coding	OTTHUMT00000034045.3	76	0.00	0	C	NM_002339		1905529	1905529	+1	no_errors	ENST00000311604	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	A
LYRM7	90624	genome.wustl.edu	37	5	130535233	130535233	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:130535233C>G	ENST00000379380.4	+	5	465	c.254C>G	c.(253-255)cCt>cGt	p.P85R	LYRM7_ENST00000507584.1_Missense_Mutation_p.L58V|LYRM7_ENST00000510516.1_Missense_Mutation_p.P34R	NM_181705.2	NP_859056.2	Q5U5X0	LYRM7_HUMAN	LYR motif containing 7	85						mitochondrion (GO:0005739)				upper_aerodigestive_tract(1)	1		all_cancers(142;0.0377)|Breast(839;0.198)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)			GAACTGGTCCCTAGGAAAGAC	0.308																																						dbGAP											0													54.0	54.0	54.0					5																	130535233		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC047079	CCDS4148.1	5q31.1	2013-05-24	2012-10-23	2006-10-17	ENSG00000186687	ENSG00000186687		"""LYR motif containing"""	28072	protein-coding gene	gene with protein product		615831	"""chromosome 5 open reading frame 31"", ""Lyrm7 homolog (mouse)"""	C5orf31		23168492	Standard	NM_181705		Approved	FLJ20796, MZM1L	uc003kvg.1	Q5U5X0	OTTHUMG00000128994	ENST00000379380.4:c.254C>G	5.37:g.130535233C>G	ENSP00000368688:p.Pro85Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPQ9|Q86Y68	Missense_Mutation	SNP	pfam_Complex1_LYR	p.P85R	ENST00000379380.4	37	c.254	CCDS4148.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.30|19.30	3.800749|3.800749	0.70567|0.70567	.|.	.|.	ENSG00000186687|ENSG00000186687	ENST00000507584|ENST00000379380;ENST00000510516	T|.	0.68479|.	-0.33|.	4.81|4.81	4.81|4.81	0.61882|0.61882	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.53706|0.53706	0.1813|0.1813	M|M	0.61703|0.61703	1.905|1.905	0.19575|0.19575	N|N	0.999968|0.999968	.|D	.|0.57899	.|0.981	.|P	.|0.55161	.|0.77	T|T	0.50693|0.50693	-0.8798|-0.8798	7|9	0.42905|0.62326	T|D	0.14|0.03	-8.6582|-8.6582	13.5763|13.5763	0.61877|0.61877	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|85	.|Q5U5X0	.|LYRM7_HUMAN	V|R	58|85;34	ENSP00000423991:L58V|.	ENSP00000423991:L58V|ENSP00000368688:P85R	L|P	+|+	1|2	2|0	LYRM7|LYRM7	130563132|130563132	0.993000|0.993000	0.37304|0.37304	1.000000|1.000000	0.80357|0.80357	0.983000|0.983000	0.72400|0.72400	2.162000|2.162000	0.42367|0.42367	2.669000|2.669000	0.90835|0.90835	0.655000|0.655000	0.94253|0.94253	CTA|CCT	LYRM7	-	NULL	ENSG00000186687		0.308	LYRM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYRM7	HGNC	protein_coding	OTTHUMT00000250983.1	32	0.00	0	C	NM_181705		130535233	130535233	+1	no_errors	ENST00000379380	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	G
MACF1	23499	genome.wustl.edu	37	1	39757591	39757591	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:39757591G>C	ENST00000372915.3	+	15	1897	c.1810G>C	c.(1810-1812)Gag>Cag	p.E604Q	MACF1_ENST00000361689.2_Missense_Mutation_p.E604Q|MACF1_ENST00000545844.1_Missense_Mutation_p.E604Q|MACF1_ENST00000539005.1_Missense_Mutation_p.E604Q|MACF1_ENST00000567887.1_Missense_Mutation_p.E636Q|MACF1_ENST00000317713.7_Missense_Mutation_p.E604Q|MACF1_ENST00000564288.1_Missense_Mutation_p.E599Q			Q9UPN3	MACF1_HUMAN	microtubule-actin crosslinking factor 1	604					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|Golgi to plasma membrane protein transport (GO:0043001)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of epithelial cell migration (GO:0010632)|regulation of focal adhesion assembly (GO:0051893)|regulation of microtubule-based process (GO:0032886)|Wnt signaling pathway (GO:0016055)|wound healing (GO:0042060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|poly(A) RNA binding (GO:0044822)			breast(11)|central_nervous_system(5)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(36)|lung(78)|ovary(12)|prostate(2)|skin(9)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(10)	203	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATGAAACTGGAGCGAGCAGA	0.448																																						dbGAP											0													63.0	59.0	60.0					1																	39757591		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007934	CCDS435.1	1p32-p31	2013-01-10			ENSG00000127603	ENSG00000127603		"""EF-hand domain containing"""	13664	protein-coding gene	gene with protein product	"""actin cross-linking factor"", ""620 kDa actin binding protein"", ""macrophin 1"", ""trabeculin-alpha"", ""actin cross-linking family protein 7"""	608271				7635207, 10529403	Standard	NM_012090		Approved	KIAA0465, ACF7, ABP620, KIAA1251, MACF, FLJ45612, FLJ46776	uc031pmc.1	Q9UPN3	OTTHUMG00000007754	ENST00000372915.3:c.1810G>C	1.37:g.39757591G>C	ENSP00000362006:p.Glu604Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALC5|E9PJT0|O75053|Q5VW20|Q8WXY1|Q8WXY2|Q96PK2|Q9H540|Q9UKP0|Q9ULG9	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.E604Q	ENST00000372915.3	37	c.1810		1	.	.	.	.	.	.	.	.	.	.	G	27.1	4.798873	0.90538	.	.	ENSG00000127603	ENST00000545844;ENST00000372915;ENST00000361689;ENST00000317713;ENST00000539005;ENST00000524432;ENST00000530262;ENST00000372900	D;D;D;D;D;D;D	0.94758	-3.51;-3.51;-3.51;-3.51;-3.51;-3.51;-3.51	5.91	5.91	0.95273	.	.	.	.	.	D	0.96210	0.8764	L	0.60455	1.87	0.80722	D	1	B;D	0.62365	0.002;0.991	B;D	0.64237	0.006;0.923	D	0.94030	0.7300	9	0.22706	T	0.39	.	20.2896	0.98541	0.0:0.0:1.0:0.0	.	604;569	F8W8Q1;Q9UPN3-3	.;.	Q	604;604;604;604;604;562;753;764	ENSP00000439537:E604Q;ENSP00000362006:E604Q;ENSP00000354573:E604Q;ENSP00000313438:E604Q;ENSP00000444364:E604Q;ENSP00000435070:E562Q;ENSP00000437059:E753Q	ENSP00000313438:E604Q	E	+	1	0	MACF1	39530178	1.000000	0.71417	0.982000	0.44146	0.796000	0.44982	7.919000	0.87513	2.794000	0.96219	0.655000	0.94253	GAG	MACF1	-	smart_Spectrin/alpha-actinin	ENSG00000127603		0.448	MACF1-028	NOVEL	not_organism_supported|basic|appris_candidate|exp_conf	protein_coding	MACF1	HGNC	protein_coding	OTTHUMT00000392096.1	32	0.00	0	G	NM_033044		39757591	39757591	+1	no_errors	ENST00000317713	ensembl	human	known	69_37n	missense	33	10.81	4	SNP	1.000	C
MAMDC4	158056	genome.wustl.edu	37	9	139751636	139751636	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:139751636G>C	ENST00000317446.2	+	17	2042	c.1992G>C	c.(1990-1992)atG>atC	p.M664I	MAMDC4_ENST00000445819.1_Missense_Mutation_p.M743I|MAMDC4_ENST00000485732.1_3'UTR	NM_206920.2	NP_996803.2			MAM domain containing 4											breast(4)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	19	all_cancers(76;0.0763)|all_epithelial(76;0.198)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;1.52e-05)|Epithelial(140;0.000171)		GCCTAGCCATGAGACGGGAAG	0.667																																						dbGAP											0													36.0	33.0	34.0					9																	139751636		2192	4299	6491	-	-	-	SO:0001583	missense	0			AL834531	CCDS7010.1	9q34.3	2013-10-21			ENSG00000177943	ENSG00000177943			24083	protein-coding gene	gene with protein product	"""apical early endosomal glycoprotein precursor"", ""endotubin"""					7829488	Standard	NM_206920		Approved	AEGP, DKFZp434M1411	uc004cjs.3	Q6UXC1	OTTHUMG00000020951	ENST00000317446.2:c.1992G>C	9.37:g.139751636G>C	ENSP00000319388:p.Met664Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MAM_dom,pfam_LDrepeatLR_classA_rpt,superfamily_ConA-like_lec_gl,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_MAM_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_MAM_dom	p.M743I	ENST00000317446.2	37	c.2229	CCDS7010.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	6.791|6.791	0.514889|0.514889	0.12944|0.12944	.|.	.|.	ENSG00000177943|ENSG00000177943	ENST00000413647|ENST00000317446;ENST00000445819	.|T;T	.|0.01902	.|4.57;4.57	4.72|4.72	3.8|3.8	0.43715|0.43715	.|Concanavalin A-like lectin/glucanase (1);MAM domain (3);	.|0.623414	.|0.14992	.|N	.|0.286634	T|T	0.01523|0.01523	0.0049|0.0049	N|N	0.12471|0.12471	0.22|0.22	0.09310|0.09310	N|N	1|1	.|B;B	.|0.31153	.|0.31;0.162	.|B;B	.|0.29942	.|0.109;0.046	T|T	0.50988|0.50988	-0.8762|-0.8762	5|10	.|0.22706	.|T	.|0.39	-7.1761|-7.1761	8.0426|8.0426	0.30529|0.30529	0.0866:0.0:0.7541:0.1593|0.0866:0.0:0.7541:0.1593	.|.	.|743;664	.|Q6UXC1;Q6UXC1-2	.|AEGP_HUMAN;.	Q|I	729|664;743	.|ENSP00000319388:M664I;ENSP00000411339:M743I	.|ENSP00000319388:M664I	E|M	+|+	1|3	0|0	MAMDC4|MAMDC4	138871457|138871457	0.966000|0.966000	0.33281|0.33281	0.080000|0.080000	0.20451|0.20451	0.564000|0.564000	0.35744|0.35744	2.371000|2.371000	0.44248|0.44248	2.313000|2.313000	0.78055|0.78055	0.561000|0.561000	0.74099|0.74099	GAG|ATG	MAMDC4	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000177943		0.667	MAMDC4-005	KNOWN	basic|CCDS	protein_coding	MAMDC4	HGNC	protein_coding	OTTHUMT00000254642.3	16	0.00	0	G	NM_206920		139751636	139751636	+1	no_errors	ENST00000445819	ensembl	human	known	69_37n	missense	15	21.05	4	SNP	0.018	C
MAMLD1	10046	genome.wustl.edu	37	X	149639115	149639115	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:149639115C>T	ENST00000370401.2	+	4	1580	c.1270C>T	c.(1270-1272)Cag>Tag	p.Q424*	MAMLD1_ENST00000262858.5_Nonsense_Mutation_p.Q424*|MAMLD1_ENST00000426613.2_Nonsense_Mutation_p.Q399*|MAMLD1_ENST00000455522.2_5'Flank|MAMLD1_ENST00000432680.2_Nonsense_Mutation_p.Q399*			Q13495	MAMD1_HUMAN	mastermind-like domain containing 1	424					male gonad development (GO:0008584)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				breast(1)|endometrium(4)|kidney(3)|large_intestine(12)|lung(14)|ovary(1)|prostate(2)	37	Acute lymphoblastic leukemia(192;6.56e-05)					GTTCGGCCCTCAGAGCTCCAT	0.617																																						dbGAP											0													106.0	103.0	104.0					X																	149639115		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U46023	CCDS14693.2, CCDS55525.1, CCDS55526.1	Xq28	2008-02-05	2008-01-03	2008-01-03	ENSG00000013619	ENSG00000013619			2568	protein-coding gene	gene with protein product		300120	"""chromosome X open reading frame 6"""	CXorf6		9169146, 17086185, 18162467	Standard	NM_001177465		Approved	CG1, F18	uc011mxu.2	Q13495	OTTHUMG00000024157	ENST00000370401.2:c.1270C>T	X.37:g.149639115C>T	ENSP00000359428:p.Gln424*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCQ4|B4DG93|B9EGA5	Nonsense_Mutation	SNP	NULL	p.Q399*	ENST00000370401.2	37	c.1195	CCDS14693.2	X	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708846	0.68615	.	.	ENSG00000013619	ENST00000445612;ENST00000370401;ENST00000432680;ENST00000262858;ENST00000426613	.	.	.	5.58	4.71	0.59529	.	0.200740	0.35936	N	0.002888	.	.	.	.	.	.	0.58432	D	0.999998	.	.	.	.	.	.	.	.	.	.	.	.	.	-10.4527	15.0626	0.71967	0.1431:0.8569:0.0:0.0	.	.	.	.	X	386;424;399;424;399	.	.	Q	+	1	0	MAMLD1	149389773	1.000000	0.71417	0.639000	0.29394	0.017000	0.09413	5.953000	0.70290	1.117000	0.41842	-0.224000	0.12420	CAG	MAMLD1	-	NULL	ENSG00000013619		0.617	MAMLD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAMLD1	HGNC	protein_coding	OTTHUMT00000060844.2	14	0.00	0	C	NM_005491		149639115	149639115	+1	no_errors	ENST00000432680	ensembl	human	known	69_37n	nonsense	6	57.14	8	SNP	0.360	T
MASP1	5648	genome.wustl.edu	37	3	186954290	186954290	+	Intron	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:186954290C>T	ENST00000337774.5	-	10	1693				MASP1_ENST00000392472.2_Missense_Mutation_p.E344K|MASP1_ENST00000495249.1_Intron|MASP1_ENST00000296280.6_Missense_Mutation_p.E457K	NM_001879.5	NP_001870.3	P48740	MASP1_HUMAN	mannan-binding lectin serine peptidase 1 (C4/C2 activating component of Ra-reactive factor)						complement activation (GO:0006956)|complement activation, lectin pathway (GO:0001867)|innate immune response (GO:0045087)|negative regulation of complement activation (GO:0045916)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|peptidase activity (GO:0008233)|protein homodimerization activity (GO:0042803)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(12)|liver(2)|lung(27)|ovary(2)|pancreas(1)|prostate(3)|urinary_tract(1)	60	all_cancers(143;5.33e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;3.49e-18)	GBM - Glioblastoma multiforme(93;0.0366)		AGGCCAGGCTCAGCATTTCGG	0.597																																						dbGAP											0													99.0	100.0	100.0					3																	186954290		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			D28593	CCDS33907.1, CCDS33908.1, CCDS33909.1	3q27-q28	2014-09-17	2005-08-17		ENSG00000127241	ENSG00000127241		"""Serine peptidases / Serine peptidases"""	6901	protein-coding gene	gene with protein product		600521	"""mannan-binding lectin serine protease 1 (C4/C2 activating component of Ra-reactive factor)"""	CRARF, PRSS5		8018603, 8240317	Standard	NR_033519		Approved	MASP	uc003fri.3	P48740	OTTHUMG00000156461	ENST00000337774.5:c.1303+4978G>A	3.37:g.186954290C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K542|A8K6M1|B4E2L7|O95570|Q68D21|Q8IUV8|Q96RS4|Q9UF09	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EGF-like_Ca-bd,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_CUB,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6	p.E457K	ENST00000337774.5	37	c.1369	CCDS33907.1	3	.	.	.	.	.	.	.	.	.	.	C	10.04	1.240482	0.22711	.	.	ENSG00000127241	ENST00000296280;ENST00000392472;ENST00000541896	D;D	0.88509	-2.39;-2.39	6.07	6.07	0.98685	.	0.279246	0.39834	N	0.001250	T	0.76248	0.3961	N	0.03294	-0.36	0.80722	D	1	B;B	0.18741	0.03;0.013	B;B	0.21708	0.036;0.036	T	0.72478	-0.4281	10	0.02654	T	1	.	19.6321	0.95713	0.0:1.0:0.0:0.0	.	344;457	P48740-4;P48740-2	.;.	K	457;344;344	ENSP00000296280:E457K;ENSP00000376264:E344K	ENSP00000296280:E457K	E	-	1	0	MASP1	188436984	0.998000	0.40836	0.976000	0.42696	0.827000	0.46813	3.724000	0.54962	2.884000	0.98904	0.655000	0.94253	GAG	MASP1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6	ENSG00000127241		0.597	MASP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MASP1	HGNC	protein_coding	OTTHUMT00000344262.1	29	0.00	0	C	NM_001879		186954290	186954290	-1	no_errors	ENST00000296280	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.995	T
MBTD1	54799	genome.wustl.edu	37	17	49270242	49270242	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:49270242C>T	ENST00000586178.1	-	15	1934	c.1591G>A	c.(1591-1593)Gaa>Aaa	p.E531K	MBTD1_ENST00000415868.1_Missense_Mutation_p.E531K|MBTD1_ENST00000376381.2_3'UTR	NM_017643.2	NP_060113.2	Q05BQ5	MBTD1_HUMAN	mbt domain containing 1	531					chromatin modification (GO:0016568)|embryonic skeletal system development (GO:0048706)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)|urinary_tract(1)	12			BRCA - Breast invasive adenocarcinoma(22;1.54e-08)			TCATACTCTTCTTCCCATCCA	0.438																																						dbGAP											0													175.0	159.0	164.0					17																	49270242		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000062	CCDS11581.2	17q24.1	2003-01-15			ENSG00000011258	ENSG00000011258			19866	protein-coding gene	gene with protein product							Standard	NM_017643		Approved	SA49P01, FLJ20055	uc002itr.4	Q05BQ5	OTTHUMG00000150442	ENST00000586178.1:c.1591G>A	17.37:g.49270242C>T	ENSP00000468304:p.Glu531Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZVU7|Q9NXU1	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.E531K	ENST00000586178.1	37	c.1591	CCDS11581.2	17	.	.	.	.	.	.	.	.	.	.	C	25.1	4.603837	0.87157	.	.	ENSG00000011258	ENST00000405860;ENST00000415868	T	0.30448	1.53	5.89	5.89	0.94794	.	0.145674	0.64402	D	0.000011	T	0.28665	0.0710	L	0.37897	1.145	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.001	T	0.04693	-1.0933	10	0.21540	T	0.41	.	20.2435	0.98387	0.0:1.0:0.0:0.0	.	531;367	Q05BQ5;Q05BQ5-3	MBTD1_HUMAN;.	K	531	ENSP00000403946:E531K	ENSP00000386072:E531K	E	-	1	0	MBTD1	46625241	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.776000	0.85560	2.784000	0.95788	0.650000	0.86243	GAA	MBTD1	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000011258		0.438	MBTD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBTD1	HGNC	protein_coding	OTTHUMT00000318124.1	82	0.00	0	C			49270242	49270242	-1	no_errors	ENST00000415868	ensembl	human	known	69_37n	missense	60	15.49	11	SNP	1.000	T
MCM2	4171	genome.wustl.edu	37	3	127325047	127325047	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:127325047G>T	ENST00000265056.7	+	5	1004	c.760G>T	c.(760-762)Gag>Tag	p.E254*		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	254	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						GGCACCGGCGGAGCTGCTGCA	0.602																																						dbGAP											0													136.0	120.0	125.0					3																	127325047		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.760G>T	3.37:g.127325047G>T	ENSP00000265056:p.Glu254*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_MCM_2,pfam_Mg_chelatse_chII,pfam_ATPase_AAA-3,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_2,prints_MCM_DNA-dep_ATPase	p.E254*	ENST00000265056.7	37	c.760	CCDS3043.1	3	.	.	.	.	.	.	.	.	.	.	G	21.7	4.187101	0.78789	.	.	ENSG00000073111	ENST00000265056;ENST00000539922;ENST00000543142	.	.	.	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-38.5315	18.5425	0.91033	0.0:0.0:1.0:0.0	.	.	.	.	X	254;158;235	.	ENSP00000265056:E254X	E	+	1	0	MCM2	128807737	1.000000	0.71417	0.936000	0.37596	0.053000	0.15095	9.842000	0.99487	2.363000	0.80096	0.591000	0.81541	GAG	MCM2	-	superfamily_NA-bd_OB-fold-like	ENSG00000073111		0.602	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM2	HGNC	protein_coding	OTTHUMT00000356612.1	59	0.00	0	G			127325047	127325047	+1	no_errors	ENST00000265056	ensembl	human	known	69_37n	nonsense	34	10.26	4	SNP	1.000	T
MCM7	4176	genome.wustl.edu	37	7	99694960	99694960	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:99694960G>A	ENST00000303887.5	-	10	1810	c.1165C>T	c.(1165-1167)Cag>Tag	p.Q389*	MCM7_ENST00000354230.3_Nonsense_Mutation_p.Q213*|MCM7_ENST00000343023.6_Intron	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	389	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GACAGGAGCTGAGACTTGGCC	0.522																																						dbGAP											0													117.0	98.0	104.0					7																	99694960		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1165C>T	7.37:g.99694960G>A	ENSP00000307288:p.Gln389*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.Q389*	ENST00000303887.5	37	c.1165	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	G	45	11.519165	0.99571	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	.	.	.	4.97	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.2455	15.7858	0.78300	0.0:0.0:1.0:0.0	.	.	.	.	X	389;326;282;213	.	ENSP00000307288:Q389X	Q	-	1	0	MCM7	99532896	1.000000	0.71417	1.000000	0.80357	0.548000	0.35241	7.445000	0.80570	2.576000	0.86940	0.655000	0.94253	CAG	MCM7	-	pfam_MCM_DNA-dep_ATPase,pfam_ATPase_dyneun-rel_AAA,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase	ENSG00000166508		0.522	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	74	0.00	0	G			99694960	99694960	-1	no_errors	ENST00000303887	ensembl	human	known	69_37n	nonsense	52	10.34	6	SNP	1.000	A
MCPH1	79648	genome.wustl.edu	37	8	6302903	6302903	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:6302903G>A	ENST00000344683.5	+	8	1736	c.1660G>A	c.(1660-1662)Gaa>Aaa	p.E554K	MCPH1_ENST00000522905.1_Missense_Mutation_p.E506K|MCPH1_ENST00000519480.1_Missense_Mutation_p.E554K	NM_024596.3	NP_078872	Q8NEM0	MCPH1_HUMAN	microcephalin 1	554					cerebral cortex development (GO:0021987)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleoplasm (GO:0005654)	identical protein binding (GO:0042802)		AGPAT5/MCPH1(2)	central_nervous_system(1)|large_intestine(4)|skin(1)	6		Hepatocellular(245;0.0663)		Colorectal(4;0.0505)		AGAAATGAAAGAAGCGGTTGG	0.428																																					Colon(95;1448 1467 8277 34473 35819)	dbGAP											0													70.0	67.0	68.0					8																	6302903		1872	4106	5978	-	-	-	SO:0001583	missense	0			AK022909	CCDS43689.1, CCDS55190.1, CCDS55191.1	8p23.1	2012-11-26	2007-11-26		ENSG00000147316	ENSG00000147316			6954	protein-coding gene	gene with protein product	"""BRCT-repeat inhibitor of TERT expression 1"""	607117	"""microcephaly, primary autosomal recessive 1"""			9683597, 17925396	Standard	NM_024596		Approved	FLJ12847, BRIT1	uc003wqi.3	Q8NEM0	OTTHUMG00000163618	ENST00000344683.5:c.1660G>A	8.37:g.6302903G>A	ENSP00000342924:p.Glu554Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWW2|E9PGU5|E9PH63|Q66GU1|Q9H9C7	Missense_Mutation	SNP	pfam_Microcephalin,pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pfscan_BRCT_dom	p.E554K	ENST00000344683.5	37	c.1660	CCDS43689.1	8	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195705	0.58126	.	.	ENSG00000147316	ENST00000344683;ENST00000519480;ENST00000522905	T;T;T	0.13420	2.59;2.59;2.59	5.34	2.48	0.30137	.	0.880522	0.10074	N	0.719366	T	0.30008	0.0751	M	0.65498	2.005	0.09310	N	1	D;D;D	0.76494	0.999;0.987;0.998	D;D;D	0.83275	0.996;0.964;0.965	T	0.11616	-1.0580	10	0.41790	T	0.15	-5.9305	4.0795	0.09919	0.0872:0.1602:0.5865:0.166	.	506;554;554	E9PH63;Q8NEM0;E9PGU5	.;MCPH1_HUMAN;.	K	554;554;506	ENSP00000342924:E554K;ENSP00000430962:E554K;ENSP00000430768:E506K	ENSP00000342924:E554K	E	+	1	0	MCPH1	6290311	0.006000	0.16342	0.000000	0.03702	0.021000	0.10359	0.980000	0.29513	0.299000	0.22661	-0.181000	0.13052	GAA	MCPH1	-	pfam_Microcephalin	ENSG00000147316		0.428	MCPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCPH1	HGNC	protein_coding	OTTHUMT00000374532.2	26	0.00	0	G	NM_024596		6302903	6302903	+1	no_errors	ENST00000344683	ensembl	human	known	69_37n	missense	17	22.73	5	SNP	0.002	A
MDN1	23195	genome.wustl.edu	37	6	90366470	90366470	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:90366470C>G	ENST00000369393.3	-	91	15349	c.15234G>C	c.(15232-15234)tcG>tcC	p.S5078S	MDN1_ENST00000428876.1_Silent_p.S5078S			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	5078					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		CAATGAAATTCGATTCATGGC	0.458																																						dbGAP											0													261.0	233.0	242.0					6																	90366470		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.15234G>C	6.37:g.90366470C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15019|Q5T794	Silent	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.S5078	ENST00000369393.3	37	c.15234	CCDS5024.1	6																																																																																			MDN1	-	pirsf_Midasin	ENSG00000112159		0.458	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	80	0.00	0	C			90366470	90366470	-1	no_errors	ENST00000369393	ensembl	human	known	69_37n	silent	75	12.79	11	SNP	0.373	G
MED1	5469	genome.wustl.edu	37	17	37566462	37566462	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:37566462G>T	ENST00000300651.6	-	17	2235	c.2012C>A	c.(2011-2013)tCc>tAc	p.S671Y	MED1_ENST00000394287.3_Intron	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GCCGGAAGAGGAGTTCTGCCT	0.473										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)	dbGAP											0													92.0	94.0	94.0					17																	37566462		2203	4300	6503	-	-	-	SO:0001583	missense	0			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.2012C>A	17.37:g.37566462G>T	ENSP00000300651:p.Ser671Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.S671Y	ENST00000300651.6	37	c.2012	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	G	16.36	3.101645	0.56183	.	.	ENSG00000125686	ENST00000300651	T	0.59772	0.24	5.59	5.59	0.84812	.	.	.	.	.	T	0.67306	0.2879	L	0.27053	0.805	0.58432	D	0.999999	D	0.65815	0.995	D	0.72982	0.979	T	0.70695	-0.4801	9	0.87932	D	0	-6.1165	19.593	0.95523	0.0:0.0:1.0:0.0	.	671	Q15648	MED1_HUMAN	Y	671	ENSP00000300651:S671Y	ENSP00000300651:S671Y	S	-	2	0	MED1	34819988	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.827000	0.99397	2.629000	0.89072	0.561000	0.74099	TCC	MED1	-	NULL	ENSG00000125686		0.473	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	42	0.00	0	G	NM_004774		37566462	37566462	-1	no_errors	ENST00000300651	ensembl	human	known	69_37n	missense	37	13.95	6	SNP	1.000	T
MED15	51586	genome.wustl.edu	37	22	20939276	20939276	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:20939276G>C	ENST00000263205.7	+	15	2007	c.1938G>C	c.(1936-1938)atG>atC	p.M646I	MED15_ENST00000292733.7_Missense_Mutation_p.M606I|MED15_ENST00000542773.1_3'UTR|MED15_ENST00000382974.2_Missense_Mutation_p.M535I|MED15_ENST00000406969.1_Missense_Mutation_p.M580I|MED15_ENST00000541476.1_Missense_Mutation_p.M580I|MED15_ENST00000425759.2_Missense_Mutation_p.M495I	NM_001003891.1	NP_001003891.1	Q96RN5	MED15_HUMAN	mediator complex subunit 15	646					gene expression (GO:0010467)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA polymerase II transcription cofactor activity (GO:0001104)			central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	25	all_cancers(11;2.07e-24)|Melanoma(16;0.000465)|Ovarian(15;0.00167)|Colorectal(54;0.0221)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)|Epithelial(17;0.209)			TTCCAGCCATGACCGCCATTC	0.632																																						dbGAP											0													133.0	125.0	128.0					22																	20939276		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056191	CCDS13781.1, CCDS33602.1, CCDS74824.1	22q11.2	2007-07-30	2007-07-30	2007-07-30	ENSG00000099917	ENSG00000099917			14248	protein-coding gene	gene with protein product		607372	"""trinucleotide repeat containing 7"", ""PC2 (positive cofactor 2, multiprotein complex) glutamine/Q-rich-associated protein"""	TNRC7, PCQAP		11024300, 11414760, 15175163	Standard	XM_005261632		Approved	TIG-1, CAG7A, Arc105	uc002zsp.3	Q96RN5	OTTHUMG00000150810	ENST00000263205.7:c.1938G>C	22.37:g.20939276G>C	ENSP00000263205:p.Met646Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DX31|D3DX32|O15413|Q6IC31|Q8NF16|Q96CT0|Q96IH7|Q9P1T3	Missense_Mutation	SNP	pfam_Mediator_Med15_met	p.M646I	ENST00000263205.7	37	c.1938	CCDS33602.1	22	.	.	.	.	.	.	.	.	.	.	G	18.74	3.687499	0.68157	.	.	ENSG00000099917	ENST00000425759;ENST00000292733;ENST00000263205;ENST00000406969;ENST00000382974;ENST00000541476;ENST00000542312	.	.	.	4.72	4.72	0.59763	Mediator complex, subunit Med15, metazoa (1);	0.000000	0.85682	D	0.000000	T	0.75525	0.3861	M	0.61703	1.905	0.80722	D	1	B;P;D;P;B;P	0.54964	0.053;0.925;0.969;0.908;0.119;0.925	B;D;D;D;B;D	0.70227	0.111;0.954;0.968;0.922;0.14;0.954	T	0.76280	-0.3017	9	0.46703	T	0.11	.	15.183	0.72975	0.0:0.0:1.0:0.0	.	576;625;262;580;606;646	B4DGD6;Q6PKB8;B3KWF1;G3V1P5;Q96RN5-2;Q96RN5	.;.;.;.;.;MED15_HUMAN	I	495;606;646;580;535;580;576	.	ENSP00000263205:M646I	M	+	3	0	MED15	19269276	1.000000	0.71417	0.996000	0.52242	0.989000	0.77384	9.316000	0.96319	2.180000	0.69256	0.561000	0.74099	ATG	MED15	-	pfam_Mediator_Med15_met	ENSG00000099917		0.632	MED15-004	KNOWN	basic|CCDS	protein_coding	MED15	HGNC	protein_coding	OTTHUMT00000320177.2	64	0.00	0	G	NM_015889		20939276	20939276	+1	no_errors	ENST00000263205	ensembl	human	known	69_37n	missense	54	27.03	20	SNP	1.000	C
METTL25	84190	genome.wustl.edu	37	12	82792682	82792682	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:82792682G>C	ENST00000248306.3	+	4	709	c.640G>C	c.(640-642)Gag>Cag	p.E214Q	METTL25_ENST00000547357.1_3'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	214							methyltransferase activity (GO:0008168)										TCATGGAGCTGAGGAGAGAAA	0.368																																						dbGAP											0													52.0	51.0	51.0					12																	82792682		2203	4298	6501	-	-	-	SO:0001583	missense	0			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.640G>C	12.37:g.82792682G>C	ENSP00000248306:p.Glu214Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H5Y3	Missense_Mutation	SNP	NULL	p.E214Q	ENST00000248306.3	37	c.640	CCDS9024.1	12	.	.	.	.	.	.	.	.	.	.	G	10.19	1.283179	0.23392	.	.	ENSG00000127720	ENST00000248306;ENST00000548200	T;T	0.22743	1.94;1.94	5.43	-2.81	0.05805	.	0.487635	0.25663	N	0.029123	T	0.11196	0.0273	L	0.39020	1.185	0.22424	N	0.999111	B	0.22800	0.075	B	0.20955	0.032	T	0.39292	-0.9621	10	0.10111	T	0.7	-0.8296	8.0254	0.30434	0.4929:0.3829:0.1242:0.0	.	214	Q8N6Q8	CL026_HUMAN	Q	214	ENSP00000248306:E214Q;ENSP00000446878:E214Q	ENSP00000248306:E214Q	E	+	1	0	C12orf26	81316813	0.981000	0.34729	0.740000	0.30986	0.889000	0.51656	0.857000	0.27831	-0.288000	0.09051	0.585000	0.79938	GAG	METTL25	-	NULL	ENSG00000127720		0.368	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL25	HGNC	protein_coding	OTTHUMT00000408192.1	37	0.00	0	G	NM_032230		82792682	82792682	+1	no_errors	ENST00000248306	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	0.960	C
MLPH	79083	genome.wustl.edu	37	2	238449572	238449572	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:238449572C>T	ENST00000264605.3	+	11	1712	c.1418C>T	c.(1417-1419)gCc>gTc	p.A473V	MLPH_ENST00000468178.1_3'UTR|MLPH_ENST00000445024.2_Missense_Mutation_p.A473V|MLPH_ENST00000338530.4_Missense_Mutation_p.A445V|MLPH_ENST00000410032.1_Missense_Mutation_p.A330V|MLPH_ENST00000409373.1_Intron	NM_024101.5	NP_077006.1	Q9BV36	MELPH_HUMAN	melanophilin	473					melanocyte differentiation (GO:0030318)|melanosome localization (GO:0032400)|protein targeting (GO:0006605)	cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|microtubule plus-end (GO:0035371)|stress fiber (GO:0001725)	metal ion binding (GO:0046872)			NS(1)|breast(3)|cervix(1)|endometrium(3)|large_intestine(2)|lung(11)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	25		Breast(86;0.000381)|Renal(207;0.000966)|Ovarian(221;0.0695)|all_hematologic(139;0.095)|all_lung(227;0.17)|Melanoma(123;0.203)		Epithelial(121;1.17e-21)|OV - Ovarian serous cystadenocarcinoma(60;1.02e-10)|Kidney(56;4.23e-09)|KIRC - Kidney renal clear cell carcinoma(57;1.15e-07)|BRCA - Breast invasive adenocarcinoma(100;0.000439)|Lung(119;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0316)		GCAGTGACGGCCTCAGAAGTC	0.587																																						dbGAP											0													57.0	48.0	51.0					2																	238449572		2197	4298	6495	-	-	-	SO:0001583	missense	0			AY358857	CCDS2518.1, CCDS42836.1, CCDS63172.1, CCDS63173.1	2q37.2	2014-09-17			ENSG00000115648	ENSG00000115648			29643	protein-coding gene	gene with protein product		606526				11980908, 11504925	Standard	NM_024101		Approved	l1Rk3, l(1)-3Rk, Slac-2a, ln, exophilin-3	uc002vwt.3	Q9BV36	OTTHUMG00000133298	ENST00000264605.3:c.1418C>T	2.37:g.238449572C>T	ENSP00000264605:p.Ala473Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSS2|B4DKW7|G5E9G5|Q9HA71	Missense_Mutation	SNP	pfam_Myelin-assoc_OBP,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.A473V	ENST00000264605.3	37	c.1418	CCDS2518.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.704|6.704	0.498611|0.498611	0.12762|0.12762	.|.	.|.	ENSG00000115648|ENSG00000115648	ENST00000410032;ENST00000264605;ENST00000445024;ENST00000338530;ENST00000437893;ENST00000434770|ENST00000436965	T;T;T;T;T;T|.	0.37058|.	1.22;1.22;1.22;1.22;1.22;1.22|.	5.13|5.13	4.26|4.26	0.50523|0.50523	Myelin-associated oligodendrocytic basic protein (MOBP) (1);|.	0.149746|.	0.43747|.	D|.	0.000533|.	T|T	0.39306|0.39306	0.1073|0.1073	L|L	0.45285|0.45285	1.41|1.41	0.09310|0.09310	N|N	1|1	B;B;B;B;B;P|.	0.40970|.	0.039;0.281;0.235;0.171;0.205;0.734|.	B;B;B;B;B;B|.	0.38020|.	0.017;0.263;0.166;0.088;0.2;0.203|.	T|T	0.23797|0.23797	-1.0178|-1.0178	10|5	0.49607|.	T|.	0.09|.	-20.2412|-20.2412	8.0974|8.0974	0.30837|0.30837	0.0:0.817:0.0:0.183|0.0:0.817:0.0:0.183	.|.	134;473;329;445;473;330|.	Q53QV8;B4DKW7;Q6UWC1;Q9BV36-2;Q9BV36;G5E9G5|.	.;.;.;.;MELPH_HUMAN;.|.	V|S	330;473;473;445;233;22|194	ENSP00000386338:A330V;ENSP00000264605:A473V;ENSP00000414849:A473V;ENSP00000341845:A445V;ENSP00000412438:A233V;ENSP00000399081:A22V|.	ENSP00000264605:A473V|.	A|P	+|+	2|1	0|0	MLPH|MLPH	238114311|238114311	0.856000|0.856000	0.29760|0.29760	0.023000|0.023000	0.16930|0.16930	0.044000|0.044000	0.14063|0.14063	1.360000|1.360000	0.34125|0.34125	1.166000|1.166000	0.42689|0.42689	-0.137000|-0.137000	0.14449|0.14449	GCC|CCT	MLPH	-	pfam_Myelin-assoc_OBP	ENSG00000115648		0.587	MLPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLPH	HGNC	protein_coding	OTTHUMT00000257083.2	58	0.00	0	C	NM_024101		238449572	238449572	+1	no_errors	ENST00000264605	ensembl	human	known	69_37n	missense	36	12.20	5	SNP	0.042	T
MLX	6945	genome.wustl.edu	37	17	40722134	40722134	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:40722134C>T	ENST00000246912.4	+	7	826	c.773C>T	c.(772-774)tCa>tTa	p.S258L	MLX_ENST00000346833.4_Missense_Mutation_p.S174L|MLX_ENST00000435881.2_Missense_Mutation_p.S204L	NM_170607.2	NP_733752.1	Q9UH92	MLX_HUMAN	MLX, MAX dimerization protein	258					energy reserve metabolic process (GO:0006112)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleocytoplasmic transport (GO:0006913)|positive regulation of cellular metabolic process (GO:0031325)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(3)|large_intestine(4)|lung(1)|ovary(1)|urinary_tract(1)	10		all_cancers(22;4.26e-05)|Breast(137;0.000153)|all_epithelial(22;0.00148)		BRCA - Breast invasive adenocarcinoma(366;0.129)		GCCTCCATCTCAGTGGCCAGC	0.552																																					GBM(121;657 1601 4665 24731 34640)	dbGAP											0													126.0	105.0	112.0					17																	40722134		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF213668	CCDS11430.1, CCDS42341.1, CCDS45687.1	17q21.1	2013-05-21	2012-11-15	2005-02-11		ENSG00000108788		"""MAX dimerization proteins"", ""Basic helix-loop-helix proteins"""	11645	protein-coding gene	gene with protein product		602976	"""transcription factor-like 4"", ""MAX-like protein X"""	TCFL4		8973301	Standard	NM_170607		Approved	MAD7, MXD7, bHLHd13	uc002iag.3	Q9UH92		ENST00000246912.4:c.773C>T	17.37:g.40722134C>T	ENSP00000246912:p.Ser258Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2J3|B2RAV8|B2RD73|Q53XM6|Q96FL2|Q9H2V0|Q9H2V1|Q9H2V2|Q9NXN3	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.S258L	ENST00000246912.4	37	c.773	CCDS11430.1	17	.	.	.	.	.	.	.	.	.	.	C	35	5.451618	0.96205	.	.	ENSG00000108788	ENST00000346833;ENST00000246912;ENST00000435881	T;D;D	0.84070	-1.48;-1.8;-1.54	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	D	0.88955	0.6578	M	0.77486	2.375	0.80722	D	1	D;P;P	0.53885	0.963;0.885;0.889	P;B;P	0.52189	0.692;0.358;0.66	D	0.89801	0.3975	10	0.72032	D	0.01	-10.1475	19.877	0.96880	0.0:1.0:0.0:0.0	.	174;258;204	Q9UH92-2;Q9UH92;Q9UH92-3	.;MLX_HUMAN;.	L	174;258;204	ENSP00000320913:S174L;ENSP00000246912:S258L;ENSP00000416627:S204L	ENSP00000246912:S258L	S	+	2	0	MLX	37975660	1.000000	0.71417	0.962000	0.40283	0.779000	0.44077	7.809000	0.86057	2.709000	0.92574	0.561000	0.74099	TCA	MLX	-	NULL	ENSG00000108788		0.552	MLX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MLX	HGNC	protein_coding	OTTHUMT00000450415.1	71	0.00	0	C	NM_170607		40722134	40722134	+1	no_errors	ENST00000246912	ensembl	human	known	69_37n	missense	53	14.52	9	SNP	1.000	T
MMD2	221938	genome.wustl.edu	37	7	4959833	4959833	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:4959833G>A	ENST00000404774.3	-	3	453	c.259C>T	c.(259-261)Cac>Tac	p.H87Y	MMD2_ENST00000401401.3_Missense_Mutation_p.H87Y|MMD2_ENST00000406755.1_Missense_Mutation_p.H87Y	NM_001100600.1	NP_001094070.1	Q8IY49	PAQRA_HUMAN	monocyte to macrophage differentiation-associated 2	87						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(11)	14		Ovarian(82;0.0175)		UCEC - Uterine corpus endometrioid carcinoma (126;0.097)|OV - Ovarian serous cystadenocarcinoma(56;3.4e-14)		GAGATGGTGTGAAACACAGTG	0.652																																						dbGAP											0													28.0	31.0	30.0					7																	4959833		1970	4130	6100	-	-	-	SO:0001583	missense	0			BC037881	CCDS47529.1, CCDS47530.1, CCDS59047.1	7p22	2004-06-23			ENSG00000136297	ENSG00000136297			30133	protein-coding gene	gene with protein product		614581				12477932	Standard	NM_198403		Approved	PAQR10	uc003sno.4	Q8IY49	OTTHUMG00000151844	ENST00000404774.3:c.259C>T	7.37:g.4959833G>A	ENSP00000384690:p.His87Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MBW4|Q6NVU5|Q6TCH0	Missense_Mutation	SNP	pfam_HlyIII-related	p.H87Y	ENST00000404774.3	37	c.259	CCDS47529.1	7	.	.	.	.	.	.	.	.	.	.	G	23.9	4.476308	0.84640	.	.	ENSG00000136297	ENST00000404774;ENST00000406755;ENST00000401401	T;T;T	0.68765	-0.35;-0.35;-0.35	4.34	4.34	0.51931	.	0.000000	0.85682	D	0.000000	D	0.86418	0.5928	H	0.94503	3.545	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90682	0.4606	10	0.87932	D	0	-33.0315	16.0267	0.80550	0.0:0.0:1.0:0.0	.	87;87;87	B5MBW4;Q8IY49;Q8IY49-2	.;PAQRA_HUMAN;.	Y	87	ENSP00000384690:H87Y;ENSP00000385963:H87Y;ENSP00000384141:H87Y	ENSP00000384141:H87Y	H	-	1	0	MMD2	4926359	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	9.004000	0.93583	2.232000	0.73038	0.561000	0.74099	CAC	MMD2	-	pfam_HlyIII-related	ENSG00000136297		0.652	MMD2-001	KNOWN	basic|CCDS	protein_coding	MMD2	HGNC	protein_coding	OTTHUMT00000324136.1	24	0.00	0	G	NM_198403		4959833	4959833	-1	no_errors	ENST00000404774	ensembl	human	known	69_37n	missense	8	42.86	6	SNP	1.000	A
MRAP	56246	genome.wustl.edu	37	21	33679048	33679048	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr21:33679048G>A	ENST00000399784.2	+	4	391	c.204G>A	c.(202-204)atG>atA	p.M68I	MRAP_ENST00000497833.1_3'UTR|MRAP_ENST00000303645.5_Missense_Mutation_p.M68I|AP000266.7_ENST00000450936.1_RNA|MRAP_ENST00000339944.4_Missense_Mutation_p.M68I|MRAP_ENST00000399786.3_Missense_Mutation_p.M68I	NM_178817.3	NP_848932.1	Q8TCY5	MRAP_HUMAN	melanocortin 2 receptor accessory protein	68					brown fat cell differentiation (GO:0050873)|positive regulation of cAMP biosynthetic process (GO:0030819)|protein localization to cell surface (GO:0034394)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	corticotropin hormone receptor binding (GO:0031780)|type 1 melanocortin receptor binding (GO:0070996)|type 3 melanocortin receptor binding (GO:0031781)|type 4 melanocortin receptor binding (GO:0031782)|type 5 melanocortin receptor binding (GO:0031783)			endometrium(1)|large_intestine(2)|lung(3)	6						CCCCGCAGATGAGGTGGGTAA	0.557																																						dbGAP											0													114.0	80.0	92.0					21																	33679048		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF454915	CCDS13612.1, CCDS13613.1	21q22.1	2005-10-30	2005-02-01	2005-02-07	ENSG00000170262	ENSG00000170262			1304	protein-coding gene	gene with protein product		609196	"""chromosome 21 open reading frame 61"""	C21orf61		12036298, 15654338	Standard	NM_178817		Approved	B27, FALP	uc002ypj.3	Q8TCY5	OTTHUMG00000085309	ENST00000399784.2:c.204G>A	21.37:g.33679048G>A	ENSP00000382684:p.Met68Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5EBR3|Q8TDB7|Q8WXC1|Q8WXC2	Missense_Mutation	SNP	NULL	p.M68I	ENST00000399784.2	37	c.204	CCDS13613.1	21	.	.	.	.	.	.	.	.	.	.	G	12.73	2.025420	0.35701	.	.	ENSG00000170262	ENST00000399784;ENST00000399786;ENST00000303645;ENST00000339944	D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97	5.66	-3.68	0.04463	.	1.548120	0.03801	N	0.264554	T	0.70228	0.3200	N	0.19112	0.55	0.09310	N	0.999996	B;B	0.11235	0.001;0.004	B;B	0.06405	0.001;0.002	T	0.56086	-0.8037	10	0.12430	T;T	0.62;0.62	-0.4256	5.6964	0.17857	0.3589:0.3816:0.2595:0.0	.	68;68	Q8TCY5-2;Q8TCY5	.;MRAP_HUMAN	I	68	ENSP00000382684:M68I;ENSP00000382686:M68I;ENSP00000306697:M68I;ENSP00000343661:M68I	ENSP00000306697:M68I;ENSP00000306697:M68I	M	+	3	0	MRAP	32600919	0.000000	0.05858	0.009000	0.14445	0.015000	0.08874	-1.899000	0.01600	-0.283000	0.09115	0.655000	0.94253	ATG	MRAP	-	NULL	ENSG00000170262		0.557	MRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRAP	HGNC	protein_coding	OTTHUMT00000193092.1	55	0.00	0	G	NM_178817		33679048	33679048	+1	no_errors	ENST00000303645	ensembl	human	known	69_37n	missense	61	19.74	15	SNP	0.004	A
MRPL48	51642	genome.wustl.edu	37	11	73536836	73536836	+	Missense_Mutation	SNP	G	G	A	rs112678863		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:73536836G>A	ENST00000310614.7	+	4	852	c.196G>A	c.(196-198)Gaa>Aaa	p.E66K	MRPL48_ENST00000535529.1_Missense_Mutation_p.E48K|MRPL48_ENST00000398483.3_5'UTR|MRPL48_ENST00000411840.2_5'UTR|MRPL48_ENST00000542303.1_Missense_Mutation_p.E66K	NM_016055.5	NP_057139.1	Q96GC5	RM48_HUMAN	mitochondrial ribosomal protein L48	66						mitochondrial ribosome (GO:0005761)				kidney(1)	1						AATTAAAGCAGAAGAGGTAAC	0.403																																						dbGAP											0													33.0	31.0	32.0					11																	73536836		1844	4076	5920	-	-	-	SO:0001583	missense	0			AF151876	CCDS44676.1	11q13.4	2012-09-13			ENSG00000175581	ENSG00000175581		"""Mitochondrial ribosomal proteins / large subunits"""	16653	protein-coding gene	gene with protein product		611853				10810093	Standard	NM_016055		Approved	CGI-118	uc001ouh.4	Q96GC5	OTTHUMG00000168048	ENST00000310614.7:c.196G>A	11.37:g.73536836G>A	ENSP00000308717:p.Glu66Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DN34|Q49AK7|Q4U2Q4|Q9P091|Q9Y5J0	Missense_Mutation	SNP	pfam_Ribosomal_S10,superfamily_Ribosomal_S10	p.E66K	ENST00000310614.7	37	c.196	CCDS44676.1	11	.	.	.	.	.	.	.	.	.	.	G	14.28	2.489541	0.44249	.	.	ENSG00000175581	ENST00000310614;ENST00000535529;ENST00000542303	T;T	0.46063	0.88;0.88	5.55	-1.6	0.08426	.	0.596389	0.17514	N	0.171500	T	0.38295	0.1035	L	0.53249	1.67	0.09310	N	1	B;B	0.34181	0.44;0.265	B;B	0.30646	0.118;0.054	T	0.39820	-0.9595	10	0.44086	T	0.13	-41.2037	19.7519	0.96271	0.0:0.2629:0.7371:0.0	.	48;66	B4DN34;Q96GC5	.;RM48_HUMAN	K	66;48;66	ENSP00000308717:E66K;ENSP00000443685:E66K	ENSP00000308717:E66K	E	+	1	0	MRPL48	73214484	0.000000	0.05858	0.003000	0.11579	0.924000	0.55760	-0.110000	0.10824	-0.102000	0.12197	-0.353000	0.07706	GAA	MRPL48	-	NULL	ENSG00000175581		0.403	MRPL48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL48	HGNC	protein_coding	OTTHUMT00000397733.1	42	0.00	0	G	NM_016055		73536836	73536836	+1	no_errors	ENST00000310614	ensembl	human	known	69_37n	missense	39	25.00	13	SNP	0.000	A
MTDH	92140	genome.wustl.edu	37	8	98736890	98736890	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:98736890G>A	ENST00000336273.3	+	12	2069	c.1741G>A	c.(1741-1743)Gaa>Aaa	p.E581K	MTDH_ENST00000519934.1_Missense_Mutation_p.E525K	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	581				E -> D (in Ref. 4; AAX84832). {ECO:0000305}.	lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			AGCCAGACGAGAAACGTGAAA	0.333																																						dbGAP											0													77.0	80.0	79.0					8																	98736890		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.1741G>A	8.37:g.98736890G>A	ENSP00000338235:p.Glu581Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	NULL	p.E581K	ENST00000336273.3	37	c.1741	CCDS6274.1	8	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552005	0.65311	.	.	ENSG00000147649	ENST00000336273;ENST00000519934	T;T	0.66280	-0.16;-0.2	5.64	5.64	0.86602	.	0.099352	0.64402	D	0.000002	T	0.64349	0.2590	N	0.08118	0	0.58432	D	0.999995	D	0.71674	0.998	D	0.80764	0.994	T	0.72567	-0.4254	10	0.72032	D	0.01	-13.994	17.8745	0.88821	0.0:0.0:1.0:0.0	.	581	Q86UE4	LYRIC_HUMAN	K	581;525	ENSP00000338235:E581K;ENSP00000428168:E525K	ENSP00000338235:E581K	E	+	1	0	MTDH	98806066	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.761000	0.74945	2.660000	0.90430	0.655000	0.94253	GAA	MTDH	-	NULL	ENSG00000147649		0.333	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTDH	HGNC	protein_coding	OTTHUMT00000379772.2	106	0.00	0	G			98736890	98736890	+1	no_errors	ENST00000336273	ensembl	human	known	69_37n	missense	59	23.38	18	SNP	1.000	A
MTERF2	80298	genome.wustl.edu	37	12	107371808	107371808	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:107371808C>G	ENST00000552029.1	-	2	2753	c.685G>C	c.(685-687)Gaa>Caa	p.E229Q	C12orf23_ENST00000551237.1_Intron|MTERFD3_ENST00000392830.2_Missense_Mutation_p.E229Q|MTERFD3_ENST00000240050.4_Missense_Mutation_p.E229Q			Q49AM1	MTEF2_HUMAN		229					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	transcription regulatory region DNA binding (GO:0044212)			breast(1)|kidney(1)|large_intestine(2)|lung(3)	7						TCTAGTGTTTCCTTTATAGCT	0.383																																						dbGAP											0													50.0	57.0	54.0					12																	107371808		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000552029.1:c.685G>C	12.37:g.107371808C>G	ENSP00000447651:p.Glu229Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53HM2|Q9H4L6|Q9H7Y9	Missense_Mutation	SNP	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	p.E229Q	ENST00000552029.1	37	c.685	CCDS9111.1	12	.	.	.	.	.	.	.	.	.	.	C	10.33	1.319392	0.23994	.	.	ENSG00000120832	ENST00000392830;ENST00000240050;ENST00000552029	T;T;T	0.13196	2.61;2.61;2.61	5.81	2.96	0.34315	.	0.700302	0.15142	N	0.278227	T	0.13927	0.0337	L	0.57536	1.79	0.31919	N	0.613633	B	0.16166	0.016	B	0.21546	0.035	T	0.07328	-1.0778	10	0.33940	T	0.23	-1.1031	6.875	0.24141	0.0:0.6728:0.1256:0.2016	.	229	Q49AM1	MTER3_HUMAN	Q	229	ENSP00000376575:E229Q;ENSP00000240050:E229Q;ENSP00000447651:E229Q	ENSP00000240050:E229Q	E	-	1	0	MTERFD3	105895938	0.984000	0.35163	0.394000	0.26270	0.964000	0.63967	2.036000	0.41165	0.794000	0.33899	0.460000	0.39030	GAA	MTERFD3	-	pfam_Mit_transcrip_term-rel,smart_Mit_transcrip_term-rel	ENSG00000120832		0.383	MTERFD3-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MTERFD3	HGNC	protein_coding	OTTHUMT00000406835.1	32	0.00	0	C			107371808	107371808	-1	no_errors	ENST00000240050	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9049091	9049091	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:9049091G>C	ENST00000397910.4	-	5	32743	c.32540C>G	c.(32539-32541)tCa>tGa	p.S10847*		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	10849	Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						TGTGGTGTCTGATTTACTATG	0.493																																						dbGAP											0													125.0	113.0	117.0					19																	9049091		1939	4139	6078	-	-	-	SO:0001587	stop_gained	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.32540C>G	19.37:g.9049091G>C	ENSP00000381008:p.Ser10847*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.S10847*	ENST00000397910.4	37	c.32540	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	g	60	49.639897	0.99987	.	.	ENSG00000181143	ENST00000397910	.	.	.	2.73	-0.752	0.11072	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.3157	0.15854	0.4326:0.0:0.5674:0.0	.	.	.	.	X	10847	.	ENSP00000381008:S10847X	S	-	2	0	MUC16	8910091	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-0.747000	0.04823	-0.071000	0.12886	-0.452000	0.05504	TCA	MUC16	-	NULL	ENSG00000181143		0.493	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	75	0.00	0	G	NM_024690		9049091	9049091	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	nonsense	48	15.52	9	SNP	0.000	C
MYO5A	4644	genome.wustl.edu	37	15	52667644	52667644	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:52667644G>A	ENST00000399231.3	-	20	2677	c.2434C>T	c.(2434-2436)Ctg>Ttg	p.L812L	MYO5A_ENST00000553916.1_Silent_p.L812L|MYO5A_ENST00000358212.6_Silent_p.L812L|MYO5A_ENST00000399233.2_Silent_p.L812L|MYO5A_ENST00000356338.6_Silent_p.L812L	NM_000259.3	NP_000250	Q9Y4I1	MYO5A_HUMAN	myosin VA (heavy chain 12, myoxin)	812	IQ 2. {ECO:0000255|PROSITE- ProRule:PRU00116}.				actin filament-based movement (GO:0030048)|anagen (GO:0042640)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|endoplasmic reticulum localization (GO:0051643)|exocytosis (GO:0006887)|insulin secretion (GO:0030073)|locomotion involved in locomotory behavior (GO:0031987)|long-chain fatty acid biosynthetic process (GO:0042759)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome transport (GO:0032402)|membrane organization (GO:0061024)|myelination (GO:0042552)|odontogenesis (GO:0042476)|post-Golgi vesicle-mediated transport (GO:0006892)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031585)|secretory granule localization (GO:0032252)|synapse organization (GO:0050808)|synaptic transmission (GO:0007268)|transport (GO:0006810)|vesicle transport along actin filament (GO:0030050)|vesicle-mediated transport (GO:0016192)|visual perception (GO:0007601)	actomyosin (GO:0042641)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|insulin-responsive compartment (GO:0032593)|intermediate filament (GO:0005882)|melanosome (GO:0042470)|membrane (GO:0016020)|microtubule plus-end (GO:0035371)|myosin complex (GO:0016459)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|photoreceptor outer segment (GO:0001750)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|microfilament motor activity (GO:0000146)|poly(A) RNA binding (GO:0044822)|Rab GTPase binding (GO:0017137)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(12)|lung(19)|ovary(3)|skin(3)|stomach(1)	57				all cancers(107;0.0085)|Colorectal(133;0.077)|READ - Rectum adenocarcinoma(133;0.196)		GTTCTGCGCAGAAACTTAGCA	0.408																																						dbGAP											0													80.0	75.0	77.0					15																	52667644		1907	4118	6025	-	-	-	SO:0001819	synonymous_variant	0				CCDS42037.1, CCDS45262.1	15q21	2014-09-17	2006-09-29		ENSG00000197535	ENSG00000197535		"""Myosins / Myosin superfamily : Class V"""	7602	protein-coding gene	gene with protein product	"""myosin, heavy polypeptide kinase"", ""myosin heavy chain 12"", ""myoxin"", ""myosin V"""	160777	"""myosin VA (heavy polypeptide 12, myoxin)"""	MYH12		8188282, 8022818	Standard	NM_000259		Approved	MYO5, GS1, MYR12	uc002aby.2	Q9Y4I1	OTTHUMG00000137383	ENST00000399231.3:c.2434C>T	15.37:g.52667644G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MZC5|O60653|Q07902|Q16249|Q9UE30|Q9UE31	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Skp1_comp_dimer,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L812	ENST00000399231.3	37	c.2434	CCDS42037.1	15																																																																																			MYO5A	-	pfscan_IQ_motif_EF-hand-BS	ENSG00000197535		0.408	MYO5A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYO5A	HGNC	protein_coding	OTTHUMT00000268102.1	68	0.00	0	G	NM_000259		52667644	52667644	-1	no_errors	ENST00000358212	ensembl	human	known	69_37n	silent	54	15.62	10	SNP	1.000	A
MYOM2	9172	genome.wustl.edu	37	8	2064059	2064059	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:2064059C>G	ENST00000262113.4	+	27	3516	c.3375C>G	c.(3373-3375)ctC>ctG	p.L1125L	MYOM2_ENST00000523438.1_Silent_p.L550L	NM_003970.2	NP_003961.2	P54296	MYOM2_HUMAN	myomesin 2	1125					muscle contraction (GO:0006936)	M band (GO:0031430)|mitochondrion (GO:0005739)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			autonomic_ganglia(2)|breast(4)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(11)|kidney(2)|large_intestine(17)|lung(39)|ovary(5)|prostate(1)|skin(10)|upper_aerodigestive_tract(3)	104		Ovarian(12;0.0572)|Colorectal(14;0.0844)|Hepatocellular(245;0.217)		BRCA - Breast invasive adenocarcinoma(11;1.85e-05)|Colorectal(4;0.0101)|READ - Rectum adenocarcinoma(4;0.148)|COAD - Colon adenocarcinoma(4;0.179)		AAGAATTTCTCAGGAAACAAG	0.403																																						dbGAP											0													43.0	44.0	43.0					8																	2064059		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5957.1	8p23.3	2014-06-06	2012-10-17		ENSG00000036448	ENSG00000036448		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7614	protein-coding gene	gene with protein product		603509	"""myomesin (M-protein) 2 (165kD)"", ""myomesin (M-protein) 2, 165kDa"""				Standard	XM_006716237		Approved		uc003wpx.4	P54296	OTTHUMG00000129175	ENST00000262113.4:c.3375C>G	8.37:g.2064059C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3Y2	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L1125	ENST00000262113.4	37	c.3375	CCDS5957.1	8																																																																																			MYOM2	-	NULL	ENSG00000036448		0.403	MYOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOM2	HGNC	protein_coding	OTTHUMT00000251249.1	49	0.00	0	C	NM_003970		2064059	2064059	+1	no_errors	ENST00000262113	ensembl	human	known	69_37n	silent	45	19.64	11	SNP	1.000	G
MZB1	51237	genome.wustl.edu	37	5	138723536	138723536	+	Missense_Mutation	SNP	C	C	A	rs372851416		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:138723536C>A	ENST00000302125.8	-	4	545	c.488G>T	c.(487-489)cGa>cTa	p.R163L	MZB1_ENST00000412103.2_Missense_Mutation_p.R71L	NM_016459.3	NP_057543.2	Q8WU39	MZB1_HUMAN	marginal zone B and B1 cell-specific protein	163					apoptotic process (GO:0006915)|integrin activation (GO:0033622)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|positive regulation of cell proliferation (GO:0008284)|positive regulation of immunoglobulin biosynthetic process (GO:0002642)|regulation of B cell proliferation (GO:0030888)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)											CAGAGCCCCTCGGCCTTGTTG	0.592																																						dbGAP											0													69.0	72.0	71.0					5																	138723536		1875	4104	5979	-	-	-	SO:0001583	missense	0			AF151024	CCDS47273.1	5q31.2	2012-09-27	2012-09-19		ENSG00000170476	ENSG00000170476			30125	protein-coding gene	gene with protein product	"""plasma cell-induced ER protein 1"", ""proapoptotic caspase adaptor protein"", ""mesenteric oestrogen-dependent adipose gene- 7"""	609447				22573353, 12573802, 11350957, 21093319, 21688198	Standard	NM_016459		Approved	PACAP, MGC29506, HSPC190, pERp1, MEDA-7	uc003lei.3	Q8WU39	OTTHUMG00000163390	ENST00000302125.8:c.488G>T	5.37:g.138723536C>A	ENSP00000303920:p.Arg163Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D2IYS0|Q7Z6N2|Q96RL5|Q9P0T3	Missense_Mutation	SNP	NULL	p.R71L	ENST00000302125.8	37	c.212	CCDS47273.1	5	.	.	.	.	.	.	.	.	.	.	C	5.774	0.327225	0.10900	.	.	ENSG00000170476	ENST00000302125;ENST00000412103	T	0.36520	1.25	4.7	-9.41	0.00613	.	.	.	.	.	T	0.25975	0.0633	L	0.40543	1.245	0.22918	N	0.998569	B;B;P	0.36282	0.174;0.275;0.546	B;B;B	0.30105	0.1;0.099;0.111	T	0.08269	-1.0730	9	0.33141	T	0.24	5.077	20.244	0.98389	0.0:0.7964:0.0:0.2036	.	163;71;163	D2IYS0;Q8WU39-3;Q8WU39	.;.;PERP1_HUMAN	L	163;71	ENSP00000303920:R163L	ENSP00000303920:R163L	R	-	2	0	RP11-1280I22.1	138751435	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-3.898000	0.00339	-2.142000	0.00804	-1.360000	0.01215	CGA	RP11-1280I22.1	-	NULL	ENSG00000170476		0.592	MZB1-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MZB1	Clone_based_vega_gene	protein_coding	OTTHUMT00000373055.1	45	0.00	0	C	NM_016459		138723536	138723536	-1	no_errors	ENST00000412103	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	0.000	A
NBEA	26960	genome.wustl.edu	37	13	35756527	35756527	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:35756527C>T	ENST00000400445.3	+	29	5227	c.4693C>T	c.(4693-4695)Ctg>Ttg	p.L1565L	NBEA_ENST00000540320.1_Silent_p.L1565L|NBEA_ENST00000379939.2_Silent_p.L1562L|NBEA_ENST00000310336.4_Silent_p.L1565L	NM_015678.4	NP_056493.3	Q8NFP9	NBEA_HUMAN	neurobeachin	1565					protein localization (GO:0008104)	cytosol (GO:0005829)|endomembrane system (GO:0012505)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)				NS(1)|breast(1)|endometrium(14)|kidney(4)|large_intestine(29)|lung(40)|ovary(9)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	108		Breast(139;0.0141)|Lung SC(185;0.0548)|Prostate(109;0.207)		all cancers(112;1.93e-08)|Epithelial(112;1.62e-07)|BRCA - Breast invasive adenocarcinoma(63;0.00033)|OV - Ovarian serous cystadenocarcinoma(117;0.00109)|KIRC - Kidney renal clear cell carcinoma(186;0.00575)|Kidney(163;0.00656)|GBM - Glioblastoma multiforme(144;0.191)|Lung(94;0.199)		GTTCTTAGCTCTGGCTGTTGT	0.378																																						dbGAP											0													134.0	125.0	128.0					13																	35756527		1835	4079	5914	-	-	-	SO:0001819	synonymous_variant	0			AF467288	CCDS45026.1, CCDS55894.1	13q13	2014-09-17			ENSG00000172915	ENSG00000172915		"""A-kinase anchor proteins"", ""WD repeat domain containing"""	7648	protein-coding gene	gene with protein product		604889				10501977	Standard	NM_015678		Approved	KIAA1544, BCL8B, FLJ10197	uc021ric.1	Q8NFP9	OTTHUMG00000016724	ENST00000400445.3:c.4693C>T	13.37:g.35756527C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2H9|Q5T320|Q9HCM8|Q9NSU1|Q9NW98|Q9Y6J1	Silent	SNP	pfam_BEACH_dom,pfam_DUF1088,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_ConA-like_lec_gl,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat_dom	p.L1565	ENST00000400445.3	37	c.4693	CCDS45026.1	13																																																																																			NBEA	-	NULL	ENSG00000172915		0.378	NBEA-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NBEA	HGNC	protein_coding		95	0.00	0	C	NM_015678		35756527	35756527	+1	no_errors	ENST00000310336	ensembl	human	known	69_37n	silent	54	26.03	19	SNP	0.914	T
NCSTN	23385	genome.wustl.edu	37	1	160323980	160323980	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:160323980C>T	ENST00000294785.5	+	11	1377	c.1252C>T	c.(1252-1254)Cag>Tag	p.Q418*	NCSTN_ENST00000535857.1_Nonsense_Mutation_p.Q280*|NCSTN_ENST00000392212.4_Nonsense_Mutation_p.Q398*|NCSTN_ENST00000368063.1_Nonsense_Mutation_p.Q398*|NCSTN_ENST00000368065.4_Nonsense_Mutation_p.Q160*|NCSTN_ENST00000459963.1_3'UTR	NM_015331.2	NP_056146.1	Q92542	NICA_HUMAN	nicastrin	418					amyloid precursor protein catabolic process (GO:0042987)|apoptotic signaling pathway (GO:0097190)|beta-amyloid metabolic process (GO:0050435)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of apoptotic process (GO:0043065)|positive regulation of catalytic activity (GO:0043085)|protein processing (GO:0016485)|proteolysis (GO:0006508)|T cell proliferation (GO:0042098)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)	endopeptidase activity (GO:0004175)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(2)	34	all_cancers(52;8.15e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GAGGCCAAATCAGTCCCAGCC	0.552																																						dbGAP											0													165.0	129.0	141.0					1																	160323980		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF240468	CCDS1203.1	1q22-q23	2014-09-17			ENSG00000162736	ENSG00000162736			17091	protein-coding gene	gene with protein product		605254				9039502, 10993067	Standard	XM_005245053		Approved	KIAA0253, APH2	uc001fvx.3	Q92542	OTTHUMG00000033110	ENST00000294785.5:c.1252C>T	1.37:g.160323980C>T	ENSP00000294785:p.Gln418*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T207|Q5T208|Q86VV5	Nonsense_Mutation	SNP	pfam_Nicastrin	p.Q418*	ENST00000294785.5	37	c.1252	CCDS1203.1	1	.	.	.	.	.	.	.	.	.	.	C	17.29	3.351230	0.61183	.	.	ENSG00000162736	ENST00000294785;ENST00000368063;ENST00000535857;ENST00000368067;ENST00000392212;ENST00000368065;ENST00000424754	.	.	.	5.3	1.24	0.21308	.	0.953835	0.08869	N	0.881772	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05833	T	0.94	0.0609	6.424	0.21760	0.0:0.5857:0.1248:0.2895	.	.	.	.	X	418;398;280;125;398;160;162	.	ENSP00000294785:Q418X	Q	+	1	0	NCSTN	158590604	0.037000	0.19845	0.139000	0.22197	0.986000	0.74619	1.177000	0.31969	0.239000	0.21243	0.655000	0.94253	CAG	NCSTN	-	pfam_Nicastrin	ENSG00000162736		0.552	NCSTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCSTN	HGNC	protein_coding	OTTHUMT00000080622.1	103	0.00	0	C	NM_015331		160323980	160323980	+1	no_errors	ENST00000294785	ensembl	human	known	69_37n	nonsense	74	15.91	14	SNP	0.000	T
NDRG4	65009	genome.wustl.edu	37	16	58537830	58537830	+	Intron	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:58537830C>T	ENST00000570248.1	+	2	233				NDRG4_ENST00000562999.1_Intron|NDRG4_ENST00000394279.2_Intron|NDRG4_ENST00000394282.4_Intron|NDRG4_ENST00000356752.4_Intron|NDRG4_ENST00000563022.1_3'UTR|NDRG4_ENST00000569923.1_Intron|NDRG4_ENST00000566192.1_Intron|NDRG4_ENST00000258187.5_Intron|NDRG4_ENST00000568640.1_Intron|NDRG4_ENST00000563799.1_Silent_p.V50V	NM_001242835.1	NP_001229764.1	Q9ULP0	NDRG4_HUMAN	NDRG family member 4						cell differentiation (GO:0030154)|cell growth (GO:0016049)|response to stress (GO:0006950)	cytoplasm (GO:0005737)				breast(1)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	11						CAGCCTCAGTCAGCCCTCCTC	0.652																																						dbGAP											0													60.0	48.0	52.0					16																	58537830		2198	4300	6498	-	-	-	SO:0001627	intron_variant	0			AB044947	CCDS10797.1, CCDS45500.1, CCDS55999.1, CCDS58465.1, CCDS58466.1, CCDS58467.1	16q21-q22.3	2008-07-04			ENSG00000103034	ENSG00000103034			14466	protein-coding gene	gene with protein product		614463				11352569, 16408304	Standard	NM_020465		Approved	KIAA1180, SMAP-8	uc002enk.3	Q9ULP0	OTTHUMG00000133485	ENST00000570248.1:c.127+23C>T	16.37:g.58537830C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KNU2|B4DK66|B4DSW5|H7C600|Q6ZNE7|Q6ZTI7|Q96PL9|Q9GZM1|Q9GZN3|Q9GZX0	Silent	SNP	pfam_Ndr	p.V50	ENST00000570248.1	37	c.150	CCDS58466.1	16																																																																																			NDRG4	-	NULL	ENSG00000103034		0.652	NDRG4-009	KNOWN	basic|CCDS	protein_coding	NDRG4	HGNC	protein_coding	OTTHUMT00000422671.2	25	0.00	0	C			58537830	58537830	+1	no_errors	ENST00000563799	ensembl	human	known	69_37n	silent	16	33.33	8	SNP	0.000	T
NFKBIL1	4795	genome.wustl.edu	37	6	31525610	31525610	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:31525610C>T	ENST00000376148.4	+	3	654	c.540C>T	c.(538-540)gtC>gtT	p.V180V	NFKBIL1_ENST00000376145.4_Intron	NM_005007.3	NP_004998.3	Q9UBC1	IKBL1_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 1	180					cellular response to lipopolysaccharide (GO:0071222)|cytoplasmic sequestering of transcription factor (GO:0042994)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of tumor necrosis factor production (GO:0032720)	cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)				breast(1)|endometrium(2)|large_intestine(1)|lung(2)|skin(1)	7						GGCAGGAAGTCATGGGGAGGT	0.562																																						dbGAP											0													89.0	65.0	73.0					6																	31525610		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X77909	CCDS4700.1, CCDS47399.1, CCDS47400.1	6p21.3	2010-02-17			ENSG00000204498	ENSG00000204498			7800	protein-coding gene	gene with protein product		601022		NFKBIL		8081366	Standard	NM_005007		Approved	IKBL	uc003nub.3	Q9UBC1	OTTHUMG00000031038	ENST00000376148.4:c.540C>T	6.37:g.31525610C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NL91|B4DUW1|Q14625|Q5HYU4|Q5RJ72|Q5ST96|Q5STV4|Q5STV5|Q9UBX4	Silent	SNP	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom	p.V180	ENST00000376148.4	37	c.540	CCDS4700.1	6																																																																																			NFKBIL1	-	NULL	ENSG00000204498		0.562	NFKBIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIL1	HGNC	protein_coding	OTTHUMT00000076036.3	35	0.00	0	C	NM_005007		31525610	31525610	+1	no_errors	ENST00000376148	ensembl	human	known	69_37n	silent	23	14.81	4	SNP	0.979	T
NHLRC2	374354	genome.wustl.edu	37	10	115639357	115639357	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:115639357G>A	ENST00000369301.3	+	4	1024	c.812G>A	c.(811-813)gGa>gAa	p.G271E		NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	271										breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		AGAAAAGATGGAATATTTTCA	0.318																																						dbGAP											0													36.0	39.0	38.0					10																	115639357		2202	4287	6489	-	-	-	SO:0001583	missense	0			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.812G>A	10.37:g.115639357G>A	ENSP00000358307:p.Gly271Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1H1|Q8N5A6	Missense_Mutation	SNP	pfam_NHL_repeat,superfamily_Thioredoxin-like_fold,pfscan_NHL_repeat_subgr	p.G271E	ENST00000369301.3	37	c.812	CCDS7585.1	10	.	.	.	.	.	.	.	.	.	.	G	29.3	4.997947	0.93227	.	.	ENSG00000196865	ENST00000369301	T	0.74632	-0.86	5.65	5.65	0.86999	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.93035	0.7783	H	0.99626	4.665	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95883	0.8900	10	0.72032	D	0.01	-16.3862	17.9129	0.88939	0.0:0.0:1.0:0.0	.	271	Q8NBF2	NHLC2_HUMAN	E	271	ENSP00000358307:G271E	ENSP00000358307:G271E	G	+	2	0	NHLRC2	115629347	1.000000	0.71417	0.985000	0.45067	0.972000	0.66771	9.748000	0.98867	2.663000	0.90544	0.455000	0.32223	GGA	NHLRC2	-	NULL	ENSG00000196865		0.318	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	HGNC	protein_coding	OTTHUMT00000050446.1	29	0.00	0	G	NM_198514		115639357	115639357	+1	no_errors	ENST00000369301	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	A
B4GALNT3	283358	genome.wustl.edu	37	12	674406	674406	+	IGR	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:674406G>C	ENST00000266383.5	+	0	5068				NINJ2_ENST00000542920.1_Missense_Mutation_p.L106V|NINJ2_ENST00000305108.4_Missense_Mutation_p.L188V|NINJ2_ENST00000397265.3_Missense_Mutation_p.L135V|NINJ2_ENST00000537416.1_5'Flank	NM_173593.3	NP_775864.3	Q6L9W6	B4GN3_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 3						metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	26	all_cancers(10;0.0158)|all_epithelial(11;0.0274)|Ovarian(42;0.0512)|all_lung(10;0.154)|Lung NSC(10;0.215)		OV - Ovarian serous cystadenocarcinoma(31;0.00018)|BRCA - Breast invasive adenocarcinoma(9;0.0262)			TGCATTCAGAGAGGATTCCTT	0.572																																						dbGAP											0													47.0	43.0	44.0					12																	674406		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			AB089940	CCDS8504.1	12p13.33	2013-02-19			ENSG00000139044	ENSG00000139044	2.4.1.-	"""Beta 4-glycosyltransferases"""	24137	protein-coding gene	gene with protein product		612220				12966086	Standard	NM_173593		Approved	B4GalNac-T3, FLJ16224, FLJ40362	uc001qii.1	Q6L9W6	OTTHUMG00000129283		12.37:g.674406G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZNC1|Q8N7T6	Missense_Mutation	SNP	pfam_Ninjurin	p.L188V	ENST00000266383.5	37	c.562	CCDS8504.1	12	.	.	.	.	.	.	.	.	.	.	G	8.039	0.763521	0.15914	.	.	ENSG00000171840	ENST00000305108;ENST00000397265;ENST00000542920	T;T;T	0.51817	0.69;0.89;0.93	5.18	-1.01	0.10169	.	0.365256	0.23587	N	0.046593	T	0.28001	0.0690	L	0.36672	1.1	0.09310	N	1	B	0.11235	0.004	B	0.09377	0.004	T	0.14309	-1.0477	10	0.59425	D	0.04	-2.8701	0.7116	0.00925	0.3051:0.3311:0.1851:0.1786	.	142	Q9NZG7	NINJ2_HUMAN	V	188;135;106	ENSP00000307552:L188V;ENSP00000380435:L135V;ENSP00000438831:L106V	ENSP00000307552:L188V	L	-	1	0	NINJ2	544667	0.005000	0.15991	0.002000	0.10522	0.013000	0.08279	-0.037000	0.12164	-0.066000	0.12998	-0.339000	0.08088	CTC	NINJ2	-	NULL	ENSG00000171840		0.572	B4GALNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NINJ2	HGNC	protein_coding	OTTHUMT00000251406.2	28	0.00	0	G	NM_173593		674406	674406	-1	no_errors	ENST00000305108	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	0.000	C
NOTCH2	4853	genome.wustl.edu	37	1	120493424	120493424	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:120493424G>A	ENST00000256646.2	-	15	2621	c.2402C>T	c.(2401-2403)tCa>tTa	p.S801L		NM_024408.3	NP_077719.2	Q04721	NOTC2_HUMAN	notch 2	801	EGF-like 21; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				apoptotic process (GO:0006915)|atrial septum morphogenesis (GO:0060413)|bone remodeling (GO:0046849)|cell cycle arrest (GO:0007050)|cell fate determination (GO:0001709)|cell growth (GO:0016049)|ciliary body morphogenesis (GO:0061073)|determination of left/right symmetry (GO:0007368)|embryonic limb morphogenesis (GO:0030326)|gene expression (GO:0010467)|hemopoiesis (GO:0030097)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|inflammatory response to antigenic stimulus (GO:0002437)|interleukin-4 secretion (GO:0072602)|intracellular receptor signaling pathway (GO:0030522)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch receptor processing (GO:0007220)|Notch signaling involved in heart development (GO:0061314)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|placenta blood vessel development (GO:0060674)|positive regulation of apoptotic process (GO:0043065)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of cell proliferation (GO:0008284)|positive regulation of Ras protein signal transduction (GO:0046579)|pulmonary valve morphogenesis (GO:0003184)|regulation of transcription, DNA-templated (GO:0006355)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cell surface (GO:0009986)|cilium (GO:0005929)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|ligand-activated RNA polymerase II transcription factor binding transcription factor activity (GO:0038049)|receptor activity (GO:0004872)			breast(4)|central_nervous_system(6)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(9)|kidney(9)|large_intestine(19)|liver(1)|lung(57)|ovary(4)|pancreas(1)|prostate(7)|skin(24)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	158	all_neural(166;0.153)	all_lung(203;1.96e-06)|Lung NSC(69;1.47e-05)|all_epithelial(167;0.000809)		Lung(183;0.0242)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCATGGATTTGAGGCACATTC	0.448			"""N, F, Mis"""		"""marginal zone lymphoma, DLBCL"""				Alagille Syndrome																													dbGAP		Dom	yes		1	1p13-p11	4853	Notch homolog 2		L	0													216.0	190.0	198.0					1																	120493424		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	ALGS1, ALGS2.Alagille-Watson syndrome	AF315356	CCDS908.1	1p13-p11	2013-01-10	2010-06-24		ENSG00000134250	ENSG00000134250		"""Ankyrin repeat domain containing"""	7882	protein-coding gene	gene with protein product		600275	"""Notch (Drosophila) homolog 2"", ""Notch homolog 2 (Drosophila)"""			7698746	Standard	NM_001200001		Approved		uc001eik.3	Q04721	OTTHUMG00000012177	ENST00000256646.2:c.2402C>T	1.37:g.120493424G>A	ENSP00000256646:p.Ser801Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3X7|Q99734|Q9H240	Missense_Mutation	SNP	pirsf_Notch,pfam_EGF-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_NOD_dom,pfam_DUF3454_notch,pfam_Notch_NODP_dom,pfam_EGF_extracell,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,prints_Notch_2,prints_Notch_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom	p.S801L	ENST00000256646.2	37	c.2402	CCDS908.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.471530	0.96274	.	.	ENSG00000134250	ENST00000256646;ENST00000539617	D	0.91843	-2.92	6.06	6.06	0.98353	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.000000	0.31834	U	0.006995	D	0.96430	0.8835	M	0.87682	2.9	0.80722	D	1	P;B;D	0.89917	0.863;0.019;1.0	P;B;D	0.87578	0.627;0.022;0.998	D	0.96100	0.9068	10	0.62326	D	0.03	.	18.1147	0.89549	0.0:0.0:1.0:0.0	.	762;801;801	D2WEZ3;Q6IQ50;Q04721	.;.;NOTC2_HUMAN	L	801;762	ENSP00000256646:S801L	ENSP00000256646:S801L	S	-	2	0	NOTCH2	120294947	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.153000	0.94687	2.882000	0.98803	0.655000	0.94253	TCA	NOTCH2	-	pirsf_Notch,pfam_EGF-like_dom,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000134250		0.448	NOTCH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH2	HGNC	protein_coding	OTTHUMT00000033679.1	60	0.00	0	G	NM_024408		120493424	120493424	-1	no_errors	ENST00000256646	ensembl	human	known	69_37n	missense	54	21.74	15	SNP	1.000	A
NPC1	4864	genome.wustl.edu	37	18	21152054	21152054	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr18:21152054G>C	ENST00000269228.5	-	3	825	c.271C>G	c.(271-273)Cta>Gta	p.L91V	NPC1_ENST00000540608.1_Intron	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	91					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					AGAAACTGTAGAGGCAGCTGC	0.453																																						dbGAP											0													55.0	49.0	51.0					18																	21152054		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.271C>G	18.37:g.21152054G>C	ENSP00000269228:p.Leu91Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DET3|Q9P130	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD,tigrfam_NP_C_type	p.L91V	ENST00000269228.5	37	c.271	CCDS11878.1	18	.	.	.	.	.	.	.	.	.	.	G	10.10	1.256802	0.22965	.	.	ENSG00000141458	ENST00000269228	D	0.90324	-2.65	6.07	5.19	0.71726	.	0.000000	0.85682	D	0.000000	D	0.85261	0.5656	L	0.41906	1.305	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.79897	-0.1609	10	0.29301	T	0.29	-16.5682	10.9014	0.47054	0.1436:0.0:0.8564:0.0	.	91	O15118	NPC1_HUMAN	V	91	ENSP00000269228:L91V	ENSP00000269228:L91V	L	-	1	2	NPC1	19406052	1.000000	0.71417	0.990000	0.47175	0.952000	0.60782	4.032000	0.57274	1.575000	0.49775	0.650000	0.86243	CTA	NPC1	-	tigrfam_NP_C_type	ENSG00000141458		0.453	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC1	HGNC	protein_coding	OTTHUMT00000254823.2	49	0.00	0	G	NM_000271		21152054	21152054	-1	no_errors	ENST00000269228	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	0.998	C
NRSN1	140767	genome.wustl.edu	37	6	24134607	24134607	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:24134607G>A	ENST00000378491.4	+	3	353	c.52G>A	c.(52-54)Gag>Aag	p.E18K	NRSN1_ENST00000378475.1_Missense_Mutation_p.E18K|NRSN1_ENST00000378478.1_Missense_Mutation_p.E18K	NM_080723.4	NP_542454.3			neurensin 1											breast(1)|endometrium(2)|large_intestine(2)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	22						GGCTGCAGCTGAGGGTGGTTA	0.522																																						dbGAP											0													125.0	115.0	118.0					6																	24134607		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF418980	CCDS4549.1	6p22.1	2008-02-05	2006-07-04	2006-07-04	ENSG00000152954	ENSG00000152954			17881	protein-coding gene	gene with protein product			"""vesicular membrane protein p24"""	VMP		12463420	Standard	NM_080723		Approved	p24	uc010jpq.1	Q8IZ57	OTTHUMG00000016406	ENST00000378491.4:c.52G>A	6.37:g.24134607G>A	ENSP00000367752:p.Glu18Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E18K	ENST00000378491.4	37	c.52	CCDS4549.1	6	.	.	.	.	.	.	.	.	.	.	G	17.43	3.388496	0.61956	.	.	ENSG00000152954	ENST00000378491;ENST00000378478;ENST00000378477;ENST00000378475	T;T;T	0.25749	2.12;1.78;1.78	5.85	4.98	0.66077	.	0.370764	0.33438	N	0.004910	T	0.12135	0.0295	L	0.36672	1.1	0.42527	D	0.993026	B	0.20887	0.049	B	0.21151	0.033	T	0.03354	-1.1045	10	0.59425	D	0.04	-0.4258	14.9226	0.70851	0.0684:0.0:0.9316:0.0	.	18	Q8IZ57	NRSN1_HUMAN	K	18	ENSP00000367752:E18K;ENSP00000367739:E18K;ENSP00000367736:E18K	ENSP00000367736:E18K	E	+	1	0	NRSN1	24242586	1.000000	0.71417	0.921000	0.36526	0.423000	0.31445	3.623000	0.54224	1.490000	0.48466	0.655000	0.94253	GAG	NRSN1	-	NULL	ENSG00000152954		0.522	NRSN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRSN1	HGNC	protein_coding	OTTHUMT00000043866.1	65	0.00	0	G	NM_080723		24134607	24134607	+1	no_errors	ENST00000378491	ensembl	human	known	69_37n	missense	57	13.64	9	SNP	0.957	A
NUDT9	53343	genome.wustl.edu	37	4	88370351	88370351	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:88370351C>G	ENST00000302174.4	+	5	912	c.588C>G	c.(586-588)atC>atG	p.I196M	NUDT9_ENST00000473942.1_Missense_Mutation_p.I146M|NUDT9_ENST00000515371.1_3'UTR	NM_024047.4	NP_076952.1	Q9BW91	NUDT9_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 9	196	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.				ADP catabolic process (GO:0046032)|IDP catabolic process (GO:0046709)|nucleobase-containing small molecule catabolic process (GO:0034656)|nucleobase-containing small molecule metabolic process (GO:0055086)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|mitochondrial matrix (GO:0005759)	adenosine-diphosphatase activity (GO:0043262)|ADP-ribose diphosphatase activity (GO:0047631)|ADP-sugar diphosphatase activity (GO:0019144)			endometrium(1)|large_intestine(4)|lung(6)	11		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.000937)		GGAAGCATATCTTACAATTTG	0.328																																						dbGAP											0													104.0	105.0	104.0					4																	88370351		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY026252	CCDS3620.1, CCDS3621.1	4q22.1	2008-08-29			ENSG00000170502	ENSG00000170502		"""Nudix motif containing"""	8056	protein-coding gene	gene with protein product		606022				11385575, 12427752	Standard	NM_024047		Approved	MGC3037	uc003hqq.3	Q9BW91	OTTHUMG00000130591	ENST00000302174.4:c.588C>G	4.37:g.88370351C>G	ENSP00000303575:p.Ile196Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NBN1|Q8NCB9|Q8NG25	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.I196M	ENST00000302174.4	37	c.588	CCDS3620.1	4	.	.	.	.	.	.	.	.	.	.	C	16.70	3.196930	0.58126	.	.	ENSG00000170502	ENST00000302174;ENST00000512216;ENST00000473942;ENST00000440591	T;T;T;T	0.13901	2.55;2.55;2.55;2.55	5.18	4.33	0.51752	NUDIX hydrolase domain (1);NUDIX hydrolase domain-like (1);	0.159171	0.56097	D	0.000032	T	0.27027	0.0662	L	0.39467	1.215	0.47698	D	0.999499	P;D	0.89917	0.918;1.0	P;D	0.79784	0.831;0.993	T	0.01413	-1.1361	10	0.87932	D	0	-5.419	11.7983	0.52112	0.0:0.9174:0.0:0.0826	.	196;196	Q96KB3;Q9BW91	.;NUDT9_HUMAN	M	196;146;146;164	ENSP00000303575:I196M;ENSP00000424702:I146M;ENSP00000421811:I146M;ENSP00000410270:I164M	ENSP00000303575:I196M	I	+	3	3	NUDT9	88589375	0.956000	0.32656	1.000000	0.80357	0.956000	0.61745	0.031000	0.13710	1.311000	0.45024	0.563000	0.77884	ATC	NUDT9	-	superfamily_NUDIX_hydrolase_dom-like	ENSG00000170502		0.328	NUDT9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT9	HGNC	protein_coding	OTTHUMT00000253035.2	77	0.00	0	C			88370351	88370351	+1	no_errors	ENST00000302174	ensembl	human	known	69_37n	missense	46	26.56	17	SNP	1.000	G
NYAP2	57624	genome.wustl.edu	37	2	226446894	226446894	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:226446894G>C	ENST00000272907.6	+	4	1174	c.761G>C	c.(760-762)aGa>aCa	p.R254T	NYAP2_ENST00000409269.2_Intron	NM_020864.1	NP_065915.1	Q9P242	NYAP2_HUMAN	neuronal tyrosine-phosphorylated phosphoinositide-3-kinase adaptor 2	254					neuron projection morphogenesis (GO:0048812)|phosphatidylinositol 3-kinase signaling (GO:0014065)												AACATTCTCAGAGACTTCAGG	0.587																																						dbGAP											0													127.0	133.0	131.0					2																	226446894		2002	4162	6164	-	-	-	SO:0001583	missense	0			AB040919	CCDS46529.1	2q36.3	2011-11-30	2011-11-30	2011-11-30	ENSG00000144460	ENSG00000144460			29291	protein-coding gene	gene with protein product		615478	"""KIAA1486"""	KIAA1486		10819331, 21946561	Standard	NM_020864		Approved		uc002voe.2	Q9P242	OTTHUMG00000153450	ENST00000272907.6:c.761G>C	2.37:g.226446894G>C	ENSP00000272907:p.Arg254Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRN4|Q96NL2	Missense_Mutation	SNP	NULL	p.R254T	ENST00000272907.6	37	c.761	CCDS46529.1	2	.	.	.	.	.	.	.	.	.	.	G	28.5	4.924624	0.92319	.	.	ENSG00000144460	ENST00000272907	T	0.49720	0.77	5.94	5.94	0.96194	.	0.111342	0.64402	D	0.000011	T	0.69548	0.3123	M	0.65975	2.015	0.80722	D	1	D	0.69078	0.997	D	0.79784	0.993	T	0.68907	-0.5285	10	0.62326	D	0.03	-25.5583	20.3736	0.98901	0.0:0.0:1.0:0.0	.	254	Q9P242	K1486_HUMAN	T	254	ENSP00000272907:R254T	ENSP00000272907:R254T	R	+	2	0	KIAA1486	226155138	1.000000	0.71417	0.972000	0.41901	0.998000	0.95712	7.500000	0.81588	2.820000	0.97059	0.650000	0.86243	AGA	NYAP2	-	NULL	ENSG00000144460		0.587	NYAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NYAP2	HGNC	protein_coding	OTTHUMT00000331258.1	33	0.00	0	G	NM_020864		226446894	226446894	+1	no_errors	ENST00000272907	ensembl	human	known	69_37n	missense	30	14.29	5	SNP	1.000	C
OAS3	4940	genome.wustl.edu	37	12	113382293	113382293	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:113382293C>T	ENST00000228928.7	+	3	652	c.473C>T	c.(472-474)tCc>tTc	p.S158F	OAS3_ENST00000546638.1_3'UTR|OAS3_ENST00000548514.1_Missense_Mutation_p.S158F|RP1-71H24.1_ENST00000552784.1_RNA	NM_006187.2	NP_006178.2	Q9Y6K5	OAS3_HUMAN	2'-5'-oligoadenylate synthetase 3, 100kDa	158	OAS domain 1.				cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|nucleobase-containing compound metabolic process (GO:0006139)|regulation of ribonuclease activity (GO:0060700)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	2'-5'-oligoadenylate synthetase activity (GO:0001730)|ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|skin(2)	27						CAGGCCGGCTCCGGCGTCAAA	0.627																																						dbGAP											0													46.0	50.0	48.0					12																	113382293		2088	4232	6320	-	-	-	SO:0001583	missense	0			AF063613	CCDS44981.1	12q24.2	2008-05-02	2002-08-29			ENSG00000111331			8088	protein-coding gene	gene with protein product		603351	"""2'-5'-oligoadenylate synthetase 3 (100 kD)"""			9790745	Standard	NM_006187		Approved		uc001tug.3	Q9Y6K5	OTTHUMG00000169795	ENST00000228928.7:c.473C>T	12.37:g.113382293C>T	ENSP00000228928:p.Ser158Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2HJ14|Q9H3P5	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Nucleotidyltransferase,pfscan_2-5-oligoadenylate_synth_N	p.S158F	ENST00000228928.7	37	c.473	CCDS44981.1	12	.	.	.	.	.	.	.	.	.	.	C	10.95	1.495341	0.26774	.	.	ENSG00000111331	ENST00000228928;ENST00000548514;ENST00000323881	T;T	0.08370	3.1;3.1	3.4	2.47	0.30058	.	.	.	.	.	T	0.20536	0.0494	M	0.64170	1.965	0.09310	N	0.999995	P;D	0.60160	0.736;0.987	B;D	0.64144	0.282;0.922	T	0.03933	-1.0991	9	0.66056	D	0.02	.	7.8245	0.29307	0.2487:0.7513:0.0:0.0	.	158;158	Q9Y6K5;F8VS35	OAS3_HUMAN;.	F	158	ENSP00000228928:S158F;ENSP00000448388:S158F	ENSP00000228928:S158F	S	+	2	0	OAS3	111866676	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.147000	0.10234	0.713000	0.32060	0.655000	0.94253	TCC	OAS3	-	NULL	ENSG00000111331		0.627	OAS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OAS3	HGNC	protein_coding	OTTHUMT00000405920.1	33	0.00	0	C			113382293	113382293	+1	no_errors	ENST00000228928	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	0.000	T
OBSCN	84033	genome.wustl.edu	37	1	228521392	228521392	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:228521392C>G	ENST00000422127.1	+	59	16009	c.15965C>G	c.(15964-15966)tCc>tGc	p.S5322C	OBSCN_ENST00000570156.2_Missense_Mutation_p.S6279C|OBSCN_ENST00000366709.4_Missense_Mutation_p.S2441C|OBSCN_ENST00000284548.11_Missense_Mutation_p.S5322C|OBSCN_ENST00000366707.4_Missense_Mutation_p.S2956C	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5322	Ig-like 50.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GAGATCATCTCCGTCACCCGG	0.582																																						dbGAP											0													50.0	58.0	55.0					1																	228521392		2092	4234	6326	-	-	-	SO:0001583	missense	0			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15965C>G	1.37:g.228521392C>G	ENSP00000409493:p.Ser5322Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.S5322C	ENST00000422127.1	37	c.15965	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	14.25	2.479104	0.44044	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	5.86	3.86	0.44501	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.356811	0.25394	N	0.030990	T	0.57475	0.2056	M	0.80847	2.515	0.09310	N	1	D;D	0.63880	0.993;0.992	P;P	0.60173	0.87;0.794	T	0.51702	-0.8672	10	0.62326	D	0.03	.	6.9965	0.24784	0.3632:0.5472:0.0:0.0896	.	5322;5322	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	C	5322;5322;2956;2441	ENSP00000284548:S5322C;ENSP00000409493:S5322C;ENSP00000355668:S2956C;ENSP00000355670:S2441C	ENSP00000284548:S5322C	S	+	2	0	OBSCN	226588015	0.881000	0.30235	0.009000	0.14445	0.000000	0.00434	4.414000	0.59802	1.485000	0.48380	-0.136000	0.14681	TCC	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub2,smart_Ig_sub,pfscan_Ig-like	ENSG00000154358		0.582	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		39	0.00	0	C	NM_052843		228521392	228521392	+1	no_errors	ENST00000422127	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.094	G
OLFM4	10562	genome.wustl.edu	37	13	53608510	53608510	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:53608510G>A	ENST00000219022.2	+	2	310	c.232G>A	c.(232-234)Gat>Aat	p.D78N		NM_006418.4	NP_006409.3	Q6UX06	OLFM4_HUMAN	olfactomedin 4	78					cell adhesion (GO:0007155)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of immune response (GO:0050777)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein homooligomerization (GO:0051260)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|specific granule (GO:0042581)	cadherin binding (GO:0045296)|catalytic activity (GO:0003824)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(4)|kidney(4)|large_intestine(5)|lung(20)|skin(3)|urinary_tract(1)	39		Breast(56;0.000776)|Lung NSC(96;0.000814)|Hepatocellular(98;0.065)|Prostate(109;0.0771)|all_neural(104;0.173)		GBM - Glioblastoma multiforme(99;3.13e-08)		CGGCTCCGTGGATGACCGTGG	0.473																																						dbGAP											0													143.0	123.0	130.0					13																	53608510		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358567	CCDS9440.1	13q14	2004-06-25			ENSG00000102837	ENSG00000102837			17190	protein-coding gene	gene with protein product		614061					Standard	NM_006418		Approved	OlfD, GW112, GC1	uc001vhl.3	Q6UX06	OTTHUMG00000016981	ENST00000219022.2:c.232G>A	13.37:g.53608510G>A	ENSP00000219022:p.Asp78Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O95362|Q5VWG0|Q86T22	Missense_Mutation	SNP	pfam_Olfac-like,superfamily_Quinoprot_gluc/sorb_DH,smart_Olfac-like,pfscan_Olfac-like	p.D78N	ENST00000219022.2	37	c.232	CCDS9440.1	13	.	.	.	.	.	.	.	.	.	.	G	12.94	2.088370	0.36855	.	.	ENSG00000102837	ENST00000219022	D	0.92647	-3.08	5.28	3.51	0.40186	.	0.177185	0.48767	N	0.000176	D	0.89220	0.6653	M	0.64567	1.98	0.40781	D	0.983171	B	0.20261	0.043	B	0.21917	0.037	D	0.86253	0.1650	10	0.42905	T	0.14	.	9.5196	0.39126	0.1655:0.0:0.8345:0.0	.	78	Q6UX06	OLFM4_HUMAN	N	78	ENSP00000219022:D78N	ENSP00000219022:D78N	D	+	1	0	OLFM4	52506511	0.966000	0.33281	0.432000	0.26747	0.448000	0.32197	0.411000	0.21115	1.350000	0.45770	0.655000	0.94253	GAT	OLFM4	-	NULL	ENSG00000102837		0.473	OLFM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLFM4	HGNC	protein_coding	OTTHUMT00000045112.2	117	0.00	0	G	NM_006418		53608510	53608510	+1	no_errors	ENST00000219022	ensembl	human	known	69_37n	missense	79	10.99	10	SNP	0.990	A
OPALIN	93377	genome.wustl.edu	37	10	98109475	98109475	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:98109475C>T	ENST00000371172.3	-	4	586	c.181G>A	c.(181-183)Gag>Aag	p.E61K	OPALIN_ENST00000419479.1_Missense_Mutation_p.E51K|OPALIN_ENST00000393870.2_Missense_Mutation_p.E50K|OPALIN_ENST00000393871.1_Missense_Mutation_p.E38K|OPALIN_ENST00000536387.1_Missense_Mutation_p.E51K	NM_001284326.1|NM_001284327.1|NM_033207.3	NP_001271255.1|NP_001271256.1|NP_149984.1	Q96PE5	OPALI_HUMAN	oligodendrocytic myelin paranodal and inner loop protein	61						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(5)|prostate(2)	9						TCCATGGCCTCAATGCTGCTT	0.498																																						dbGAP											0													99.0	95.0	97.0					10																	98109475		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF367761	CCDS7448.1, CCDS41556.1, CCDS44466.1, CCDS60602.1, CCDS73172.1, CCDS73173.1	10q23-q24	2010-11-23	2008-05-01	2008-05-01	ENSG00000197430	ENSG00000197430			20707	protein-coding gene	gene with protein product			"""transmembrane protein 10"""	TMEM10		11814680, 17442045	Standard	NM_001284324		Approved	TMP10, HTMP10	uc001kmj.3	Q96PE5	OTTHUMG00000018831	ENST00000371172.3:c.181G>A	10.37:g.98109475C>T	ENSP00000360214:p.Glu61Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MX69|A8MYG4|B4DK96|B4DKH0|Q5W102	Missense_Mutation	SNP	NULL	p.E61K	ENST00000371172.3	37	c.181	CCDS7448.1	10	.	.	.	.	.	.	.	.	.	.	C	19.19	3.780159	0.70222	.	.	ENSG00000197430	ENST00000371172;ENST00000393871;ENST00000419479;ENST00000393870;ENST00000536387	.	.	.	5.35	3.5	0.40072	.	0.753320	0.12205	N	0.489902	T	0.29256	0.0728	L	0.34521	1.04	0.09310	N	1	P;P;P	0.46142	0.634;0.873;0.763	B;B;B	0.42361	0.298;0.298;0.385	T	0.10268	-1.0637	9	0.72032	D	0.01	-3.0457	7.9752	0.30151	0.0:0.8177:0.0:0.1823	.	38;61;51	A8MYG4;Q96PE5;B4DK96	.;OPALI_HUMAN;.	K	61;38;51;50;51	.	ENSP00000360214:E61K	E	-	1	0	OPALIN	98099465	0.052000	0.20516	0.003000	0.11579	0.961000	0.63080	1.177000	0.31969	0.938000	0.37419	0.655000	0.94253	GAG	OPALIN	-	NULL	ENSG00000197430		0.498	OPALIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPALIN	HGNC	protein_coding	OTTHUMT00000049606.1	53	0.00	0	C	NM_033207		98109475	98109475	-1	no_errors	ENST00000371172	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	0.004	T
OR13C4	138804	genome.wustl.edu	37	9	107288965	107288965	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:107288965G>A	ENST00000277216.3	-	1	525	c.526C>T	c.(526-528)Cat>Tat	p.H176Y		NM_001001919.1	NP_001001919.1	Q8NGS5	O13C4_HUMAN	olfactory receptor, family 13, subfamily C, member 4	176						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|large_intestine(2)|lung(14)|skin(1)	18						CATAAGAAATGATTAATAATA	0.378																																						dbGAP											0													98.0	98.0	98.0					9																	107288965		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35088.1	9q31.1	2013-09-24			ENSG00000148136	ENSG00000148136		"""GPCR / Class A : Olfactory receptors"""	14722	protein-coding gene	gene with protein product							Standard	NM_001001919		Approved		uc011lvn.2	Q8NGS5	OTTHUMG00000020407	ENST00000277216.3:c.526C>T	9.37:g.107288965G>A	ENSP00000277216:p.His176Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF51|Q96R41	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H176Y	ENST00000277216.3	37	c.526	CCDS35088.1	9	.	.	.	.	.	.	.	.	.	.	G	10.53	1.374721	0.24857	.	.	ENSG00000148136	ENST00000277216;ENST00000545903	T	0.00183	8.6	3.9	2.0	0.26442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.48286	U	0.000188	T	0.00384	0.0012	M	0.82923	2.615	0.09310	N	1	P	0.41546	0.754	P	0.53102	0.718	T	0.24621	-1.0155	10	0.72032	D	0.01	.	4.7639	0.13123	0.3864:0.0:0.6136:0.0	.	176	Q8NGS5	O13C4_HUMAN	Y	176;205	ENSP00000277216:H176Y	ENSP00000277216:H176Y	H	-	1	0	OR13C4	106328786	0.013000	0.17824	0.926000	0.36857	0.895000	0.52256	0.354000	0.20146	0.934000	0.37316	0.585000	0.79938	CAT	OR13C4	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000148136		0.378	OR13C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C4	HGNC	protein_coding	OTTHUMT00000053478.1	55	0.00	0	G			107288965	107288965	-1	no_errors	ENST00000277216	ensembl	human	known	69_37n	missense	24	29.41	10	SNP	0.015	A
OR2L13	284521	genome.wustl.edu	37	1	248262773	248262773	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:248262773C>T	ENST00000358120.2	+	2	241	c.96C>T	c.(94-96)ctC>ctT	p.L32L	OR2L13_ENST00000366478.2_Silent_p.L32L			Q8N349	OR2LD_HUMAN	olfactory receptor, family 2, subfamily L, member 13	32						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(32)|ovary(1)|skin(3)|upper_aerodigestive_tract(1)	59	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0132)			TTATCATCCTCATATTCTTTC	0.448																																						dbGAP											0													187.0	185.0	186.0					1																	248262773		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC028158	CCDS1637.1	1q44	2012-08-09			ENSG00000196071	ENSG00000196071		"""GPCR / Class A : Olfactory receptors"""	19578	protein-coding gene	gene with protein product				OR2L14			Standard	NM_175911		Approved		uc001ids.3	Q8N349	OTTHUMG00000040446	ENST00000358120.2:c.96C>T	1.37:g.248262773C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUR5	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L32	ENST00000358120.2	37	c.96	CCDS1637.1	1																																																																																			OR2L13	-	prints_7TM_GPCR_Rhodpsn	ENSG00000196071		0.448	OR2L13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L13	HGNC	protein_coding	OTTHUMT00000097342.1	112	0.00	0	C	NM_175911		248262773	248262773	+1	no_errors	ENST00000358120	ensembl	human	known	69_37n	silent	132	12.00	18	SNP	0.000	T
OR14I1	401994	genome.wustl.edu	37	1	248844944	248844944	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:248844944G>C	ENST00000342623.3	-	1	685	c.662C>G	c.(661-663)tCa>tGa	p.S221*		NM_001004734.1	NP_001004734.1	A6ND48	O14I1_HUMAN	olfactory receptor, family 14, subfamily I, member 1	221						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(4)|large_intestine(2)|lung(24)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)	35						GAGCACCGTTGAGAAGATTTG	0.483																																						dbGAP											0													79.0	84.0	82.0					1																	248844944		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS31125.1	1q44	2012-08-09	2008-04-02	2008-04-02	ENSG00000189181	ENSG00000189181		"""GPCR / Class A : Olfactory receptors"""	19575	protein-coding gene	gene with protein product			"""olfactory receptor, family 5, subfamily BU, member 1"""	OR5BU1P, OR5BU1			Standard	NM_001004734		Approved		uc001ieu.1	A6ND48	OTTHUMG00000040378	ENST00000342623.3:c.662C>G	1.37:g.248844944G>C	ENSP00000339726:p.Ser221*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt	p.S221*	ENST00000342623.3	37	c.662	CCDS31125.1	1	.	.	.	.	.	.	.	.	.	.	.	16.83	3.231357	0.58777	.	.	ENSG00000189181	ENST00000342623	.	.	.	3.49	0.687	0.18020	.	0.685260	0.12028	N	0.506290	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	.	2.0529	0.03574	0.1188:0.3366:0.3571:0.1875	.	.	.	.	X	221	.	ENSP00000339726:S221X	S	-	2	0	OR14I1	246911567	0.000000	0.05858	0.000000	0.03702	0.287000	0.27160	-2.650000	0.00858	-0.089000	0.12484	0.543000	0.68304	TCA	OR14I1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000189181		0.483	OR14I1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR14I1	HGNC	protein_coding	OTTHUMT00000097128.1	35	0.00	0	G	NM_001004734		248844944	248844944	-1	no_errors	ENST00000342623	ensembl	human	known	69_37n	nonsense	27	18.18	6	SNP	0.000	C
OR51T1	401665	genome.wustl.edu	37	11	4903218	4903218	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:4903218C>G	ENST00000322049.1	+	1	89	c.89C>G	c.(88-90)tCc>tGc	p.S30C	OR51T1_ENST00000380378.1_Missense_Mutation_p.S57C|MMP26_ENST00000477339.1_Intron|MMP26_ENST00000380390.1_Intron			Q8NGJ9	O51T1_HUMAN	olfactory receptor, family 51, subfamily T, member 1	30						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	34		Medulloblastoma(188;0.0075)|all_neural(188;0.0577)|Breast(177;0.086)		Epithelial(150;4.77e-12)|BRCA - Breast invasive adenocarcinoma(625;0.00435)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTCTGGATCTCCATTCCAGTC	0.453																																						dbGAP											0													208.0	170.0	183.0					11																	4903218		2201	4298	6499	-	-	-	SO:0001583	missense	0			BK004283	CCDS31363.1	11p15.4	2012-08-09			ENSG00000176900	ENSG00000176900		"""GPCR / Class A : Olfactory receptors"""	15205	protein-coding gene	gene with protein product							Standard	NM_001004759		Approved		uc010qyp.2	Q8NGJ9	OTTHUMG00000066507	ENST00000322049.1:c.89C>G	11.37:g.4903218C>G	ENSP00000322679:p.Ser30Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFH9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S57C	ENST00000322049.1	37	c.170		11	.	.	.	.	.	.	.	.	.	.	C	18.26	3.584505	0.65992	.	.	ENSG00000176900	ENST00000380378;ENST00000322049	T;T	0.00325	8.1;8.1	4.48	4.48	0.54585	.	0.000000	0.39985	N	0.001216	T	0.00754	0.0025	M	0.88310	2.945	0.36920	D	0.89132	D	0.76494	0.999	D	0.79784	0.993	T	0.62186	-0.6907	10	0.72032	D	0.01	.	11.8514	0.52413	0.0:0.8229:0.177:0.0	.	30	Q8NGJ9	O51T1_HUMAN	C	57;30	ENSP00000369738:S57C;ENSP00000322679:S30C	ENSP00000322679:S30C	S	+	2	0	OR51T1	4859794	.	.	1.000000	0.80357	0.979000	0.70002	.	.	2.336000	0.79503	0.484000	0.47621	TCC	OR51T1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000176900		0.453	OR51T1-001	KNOWN	basic|appris_candidate	protein_coding	OR51T1	HGNC	protein_coding	OTTHUMT00000142180.1	90	0.00	0	C	NM_001004759		4903218	4903218	+1	no_errors	ENST00000380378	ensembl	human	known	69_37n	missense	87	14.71	15	SNP	1.000	G
OR56B1	387748	genome.wustl.edu	37	11	5757883	5757883	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:5757883C>G	ENST00000317121.3	+	1	203	c.137C>G	c.(136-138)tCa>tGa	p.S46*	TRIM5_ENST00000380027.1_Intron	NM_001005180.2	NP_001005180.1	Q8NGI3	O56B1_HUMAN	olfactory receptor, family 56, subfamily B, member 1	46						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(7)|prostate(1)|skin(1)	13		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.086)		Epithelial(150;1.74e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.184)		CTGTATCTCTCAGCACTTGCT	0.507																																						dbGAP											0													175.0	161.0	166.0					11																	5757883		2201	4297	6498	-	-	-	SO:0001587	stop_gained	0			BK004386	CCDS31395.1	11p15.4	2012-08-09		2004-03-10	ENSG00000181023	ENSG00000181023		"""GPCR / Class A : Olfactory receptors"""	15245	protein-coding gene	gene with protein product				OR56B1P			Standard	NM_001005180		Approved		uc001mbt.2	Q8NGI3	OTTHUMG00000066891	ENST00000317121.3:c.137C>G	11.37:g.5757883C>G	ENSP00000322939:p.Ser46*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNY6|B3KV42|Q6IF76	Nonsense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S46*	ENST00000317121.3	37	c.137	CCDS31395.1	11	.	.	.	.	.	.	.	.	.	.	C	11.40	1.627949	0.28978	.	.	ENSG00000181023	ENST00000317121	.	.	.	5.91	-0.519	0.11939	.	0.983825	0.08246	U	0.975368	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-0.0254	10.059	0.42263	0.0:0.4454:0.0:0.5546	.	.	.	.	X	46	.	ENSP00000322939:S46X	S	+	2	0	OR56B1	5714459	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-3.631000	0.00409	-0.097000	0.12307	0.655000	0.94253	TCA	OR56B1	-	prints_7TM_GPCR_Rhodpsn	ENSG00000181023		0.507	OR56B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR56B1	HGNC	protein_coding	OTTHUMT00000143354.1	121	0.00	0	C	NM_001005180		5757883	5757883	+1	no_errors	ENST00000317121	ensembl	human	known	69_37n	nonsense	110	19.71	27	SNP	0.000	G
OR5J2	282775	genome.wustl.edu	37	11	55945014	55945014	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:55945014G>C	ENST00000312298.1	+	1	921	c.921G>C	c.(919-921)atG>atC	p.M307I		NM_001005492.1	NP_001005492.1	Q8NH18	OR5J2_HUMAN	olfactory receptor, family 5, subfamily J, member 2	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(30)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|stomach(1)	44	Esophageal squamous(21;0.00693)					CCATAGAAATGAAACATTTCC	0.383																																						dbGAP											0													54.0	62.0	59.0					11																	55945014		2187	4293	6480	-	-	-	SO:0001583	missense	0			AB065595	CCDS31522.1	11q11	2012-08-09			ENSG00000174957	ENSG00000174957		"""GPCR / Class A : Olfactory receptors"""	19612	protein-coding gene	gene with protein product							Standard	NM_001005492		Approved		uc010rjb.2	Q8NH18	OTTHUMG00000166835	ENST00000312298.1:c.921G>C	11.37:g.55945014G>C	ENSP00000310788:p.Met307Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEU5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	p.M307I	ENST00000312298.1	37	c.921	CCDS31522.1	11	.	.	.	.	.	.	.	.	.	.	G	1.599	-0.527008	0.04141	.	.	ENSG00000174957	ENST00000312298	T	0.36699	1.24	3.86	-1.99	0.07457	.	0.960810	0.08611	N	0.919959	T	0.17450	0.0419	N	0.05306	-0.075	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.26916	-1.0089	10	0.52906	T	0.07	.	8.6713	0.34152	0.0:0.3086:0.4586:0.2328	.	307	Q8NH18	OR5J2_HUMAN	I	307	ENSP00000310788:M307I	ENSP00000310788:M307I	M	+	3	0	OR5J2	55701590	0.000000	0.05858	0.004000	0.12327	0.010000	0.07245	-0.573000	0.05874	-0.081000	0.12662	-0.272000	0.10252	ATG	OR5J2	-	NULL	ENSG00000174957		0.383	OR5J2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5J2	HGNC	protein_coding	OTTHUMT00000391544.1	42	0.00	0	G	NM_001005492		55945014	55945014	+1	no_errors	ENST00000312298	ensembl	human	known	69_37n	missense	27	27.03	10	SNP	0.014	C
OR5A2	219981	genome.wustl.edu	37	11	59189855	59189855	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:59189855G>C	ENST00000302040.4	-	1	594	c.572C>G	c.(571-573)tCt>tGt	p.S191C		NM_001001954.1	NP_001001954.1	Q8NGI9	OR5A2_HUMAN	olfactory receptor, family 5, subfamily A, member 2	191						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|liver(1)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	21						GAAGGTATCAGAGCAGGACAG	0.463																																						dbGAP											0													105.0	91.0	95.0					11																	59189855		2201	4295	6496	-	-	-	SO:0001583	missense	0			AB065805	CCDS31560.1	11q12.1	2012-08-09			ENSG00000172324	ENSG00000172324		"""GPCR / Class A : Olfactory receptors"""	15249	protein-coding gene	gene with protein product							Standard	NM_001001954		Approved		uc010rkt.2	Q8NGI9	OTTHUMG00000167419	ENST00000302040.4:c.572C>G	11.37:g.59189855G>C	ENSP00000303834:p.Ser191Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH21|Q6IFF4|Q96RB0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S191C	ENST00000302040.4	37	c.572	CCDS31560.1	11	.	.	.	.	.	.	.	.	.	.	G	20.4	3.991612	0.74703	.	.	ENSG00000172324	ENST00000302040	T	0.00262	8.4	5.32	4.38	0.52667	GPCR, rhodopsin-like superfamily (1);	0.000000	0.34959	U	0.003543	T	0.00815	0.0027	H	0.94503	3.545	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.13656	-1.0501	10	0.87932	D	0	.	12.4861	0.55874	0.0:0.323:0.677:0.0	.	191	Q8NGI9	OR5A2_HUMAN	C	191	ENSP00000303834:S191C	ENSP00000303834:S191C	S	-	2	0	OR5A2	58946431	0.010000	0.17322	0.037000	0.18230	0.982000	0.71751	1.529000	0.35996	1.330000	0.45394	0.585000	0.79938	TCT	OR5A2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000172324		0.463	OR5A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5A2	HGNC	protein_coding	OTTHUMT00000394552.1	57	0.00	0	G	NM_001001954		59189855	59189855	-1	no_errors	ENST00000302040	ensembl	human	known	69_37n	missense	29	30.95	13	SNP	0.013	C
OR6B1	135946	genome.wustl.edu	37	7	143701593	143701593	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:143701593C>A	ENST00000408922.2	+	1	572	c.504C>A	c.(502-504)ttC>ttA	p.F168L		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	168						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					GCCTCAGCTTCTGTGGTCCCA	0.502																																						dbGAP											0													103.0	101.0	101.0					7																	143701593		2107	4257	6364	-	-	-	SO:0001583	missense	0				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.504C>A	7.37:g.143701593C>A	ENSP00000386151:p.Phe168Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G2|B9EH47|Q6IFP6|Q96R38	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F168L	ENST00000408922.2	37	c.504	CCDS43667.1	7	.	.	.	.	.	.	.	.	.	.	C	17.82	3.482420	0.63962	.	.	ENSG00000221813	ENST00000408922	T	0.00018	9.07	5.26	2.54	0.30619	GPCR, rhodopsin-like superfamily (1);	0.000000	0.38959	U	0.001513	T	0.00300	0.0009	M	0.76433	2.335	0.33559	D	0.597093	D	0.71674	0.998	D	0.85130	0.997	T	0.65150	-0.6238	10	0.46703	T	0.11	.	7.0713	0.25179	0.0:0.6537:0.0:0.3463	.	168	O95007	OR6B1_HUMAN	L	168	ENSP00000386151:F168L	ENSP00000386151:F168L	F	+	3	2	OR6B1	143332526	0.981000	0.34729	1.000000	0.80357	0.979000	0.70002	0.469000	0.22067	0.391000	0.25143	-0.136000	0.14681	TTC	OR6B1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221813		0.502	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B1	HGNC	protein_coding	OTTHUMT00000349566.1	34	0.00	0	C			143701593	143701593	+1	no_errors	ENST00000408922	ensembl	human	known	69_37n	missense	23	39.47	15	SNP	0.735	A
OR6B1	135946	genome.wustl.edu	37	7	143701938	143701938	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:143701938C>T	ENST00000408922.2	+	1	917	c.849C>T	c.(847-849)ctC>ctT	p.L283L		NM_001005281.1	NP_001005281.1	O95007	OR6B1_HUMAN	olfactory receptor, family 6, subfamily B, member 1	283						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|large_intestine(3)|lung(15)|ovary(2)|skin(2)|urinary_tract(1)	27	Melanoma(164;0.0783)					CTCCTTCTCTCAACCCTTTCA	0.418																																						dbGAP											0													87.0	81.0	83.0					7																	143701938		1900	4116	6016	-	-	-	SO:0001819	synonymous_variant	0				CCDS43667.1	7q33-q35	2012-08-09			ENSG00000221813	ENSG00000221813		"""GPCR / Class A : Olfactory receptors"""	8354	protein-coding gene	gene with protein product							Standard	NM_001005281		Approved	OR7-3	uc003wdt.1	O95007	OTTHUMG00000157765	ENST00000408922.2:c.849C>T	7.37:g.143701938C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2G2|B9EH47|Q6IFP6|Q96R38	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.L283	ENST00000408922.2	37	c.849	CCDS43667.1	7																																																																																			OR6B1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221813		0.418	OR6B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B1	HGNC	protein_coding	OTTHUMT00000349566.1	23	0.00	0	C			143701938	143701938	+1	no_errors	ENST00000408922	ensembl	human	known	69_37n	silent	17	29.17	7	SNP	0.969	T
OR6C76	390326	genome.wustl.edu	37	12	55820956	55820957	+	Frame_Shift_Ins	INS	-	-	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:55820956_55820957insA	ENST00000328314.3	+	1	919_920	c.919_920insA	c.(919-921)cacfs	p.H307fs		NM_001005183.1	NP_001005183.1	A6NM76	O6C76_HUMAN	olfactory receptor, family 6, subfamily C, member 76	307						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|prostate(1)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						AAAGATTTCCCACAAAAAAAAA	0.337																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0				CCDS31823.1	12q13.2	2013-09-23			ENSG00000185821	ENSG00000185821		"""GPCR / Class A : Olfactory receptors"""	31305	protein-coding gene	gene with protein product							Standard	NM_001005183		Approved		uc010spm.2	A6NM76	OTTHUMG00000169956	ENST00000328314.3:c.920dupA	12.37:g.55820957_55820957dupA	ENSP00000328402:p.His307fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Ins	INS	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.H307fs	ENST00000328314.3	37	c.919_920	CCDS31823.1	12																																																																																			OR6C76	-	NULL	ENSG00000185821		0.337	OR6C76-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C76	HGNC	protein_coding	OTTHUMT00000406675.1	9	0.00	0	-	NM_001005183		55820956	55820957	+1	no_errors	ENST00000328314	ensembl	human	known	69_37n	frame_shift_ins	3	40.00	2	INS	0.001:0.001	A
ORC1	4998	genome.wustl.edu	37	1	52854969	52854969	+	Missense_Mutation	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:52854969C>A	ENST00000371568.3	-	7	1325	c.1107G>T	c.(1105-1107)caG>caT	p.Q369H	ORC1_ENST00000371566.1_Missense_Mutation_p.Q369H	NM_001190818.1|NM_001190819.1|NM_004153.3	NP_001177747.1|NP_001177748.1|NP_004144.2	Q13415	ORC1_HUMAN	origin recognition complex, subunit 1	369					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear origin of replication recognition complex (GO:0005664)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)			breast(1)|cervix(2)|endometrium(4)|kidney(4)|large_intestine(9)|lung(9)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37						TCGCTTCATTCTGGGCTTTTG	0.483																																						dbGAP											0													177.0	146.0	156.0					1																	52854969		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS566.1	1p32	2010-10-12	2010-10-12	2010-10-12	ENSG00000085840	ENSG00000085840		"""ATPases / AAA-type"""	8487	protein-coding gene	gene with protein product	"""origin recognition complex, subunit 1, S. cerevisiae, homolog-like"", ""origin recognition complex 1"", ""replication control protein 1"""	601902	"""origin recognition complex, subunit 1 (yeast homolog)-like"", ""origin recognition complex, subunit 1-like (yeast)"", ""origin recognition complex, subunit 1 homolog (S. cerevisiae)"""	ORC1L		8884289	Standard	NM_004153		Approved	HSORC1, PARC1	uc001ctu.3	Q13415	OTTHUMG00000008104	ENST00000371568.3:c.1107G>T	1.37:g.52854969C>A	ENSP00000360623:p.Gln369His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ34|Q13471|Q5T0F5	Missense_Mutation	SNP	pfam_BAH_dom,pfam_ATPase_AAA_core,pfam_Cdc6_C_dom,pfam_DUF2075,smart_BAH_dom,smart_AAA+_ATPase,pfscan_BAH_dom	p.Q369H	ENST00000371568.3	37	c.1107	CCDS566.1	1	.	.	.	.	.	.	.	.	.	.	C	0.312	-0.967337	0.02232	.	.	ENSG00000085840	ENST00000371568;ENST00000371566	T;T	0.41400	1.0;1.0	4.41	1.32	0.21799	.	0.606791	0.18522	N	0.138743	T	0.27313	0.0670	L	0.41079	1.255	0.09310	N	1	B;B	0.11235	0.004;0.002	B;B	0.08055	0.003;0.002	T	0.14282	-1.0478	10	0.26408	T	0.33	-0.0498	4.5906	0.12304	0.0:0.5317:0.2606:0.2078	.	369;369	B7Z8H0;Q13415	.;ORC1_HUMAN	H	369	ENSP00000360623:Q369H;ENSP00000360621:Q369H	ENSP00000360621:Q369H	Q	-	3	2	ORC1	52627557	0.018000	0.18449	0.009000	0.14445	0.003000	0.03518	0.244000	0.18124	0.293000	0.22520	-0.136000	0.14681	CAG	ORC1	-	NULL	ENSG00000085840		0.483	ORC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC1	HGNC	protein_coding	OTTHUMT00000022202.1	82	0.00	0	C	NM_004153		52854969	52854969	-1	no_errors	ENST00000371566	ensembl	human	known	69_37n	missense	76	15.56	14	SNP	0.015	A
OSBPL8	114882	genome.wustl.edu	37	12	76749731	76749731	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:76749731C>G	ENST00000261183.3	-	24	3087	c.2608G>C	c.(2608-2610)Gac>Cac	p.D870H	OSBPL8_ENST00000393250.4_Missense_Mutation_p.D828H|OSBPL8_ENST00000393249.2_Missense_Mutation_p.D828H	NM_020841.4	NP_065892.1	Q9BZF1	OSBL8_HUMAN	oxysterol binding protein-like 8	870					fat cell differentiation (GO:0045444)|lipid transport (GO:0006869)|negative regulation of cell migration (GO:0030336)|negative regulation of sequestering of triglyceride (GO:0010891)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of protein kinase B signaling (GO:0051897)|protein localization to nuclear pore (GO:0090204)	membrane (GO:0016020)|nuclear membrane (GO:0031965)	cholesterol binding (GO:0015485)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|lung(14)|ovary(2)	28						ATGAAGTAGTCTTTTTGTTGC	0.323																																						dbGAP											0													89.0	91.0	90.0					12																	76749731		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF392452	CCDS31862.1, CCDS41814.1	12q14	2013-01-10				ENSG00000091039		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16396	protein-coding gene	gene with protein product		606736				1735225, 17991739	Standard	NM_020841		Approved	OSBP10, ORP8, MST120, MSTP120	uc001sye.1	Q9BZF1		ENST00000261183.3:c.2608G>C	12.37:g.76749731C>G	ENSP00000261183:p.Asp870His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T2|E9PE66|E9PE68|Q52LQ3|Q68D75|Q8WXP8|Q9P277	Missense_Mutation	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.D870H	ENST00000261183.3	37	c.2608	CCDS31862.1	12	.	.	.	.	.	.	.	.	.	.	C	11.60	1.686724	0.29962	.	.	ENSG00000091039	ENST00000393249;ENST00000261183;ENST00000446075;ENST00000393250	T;T;T	0.30448	1.54;1.53;1.54	6.06	6.06	0.98353	.	2.308210	0.00932	N	0.002729	T	0.26195	0.0639	N	0.11560	0.145	0.44702	D	0.99769	B	0.06786	0.001	B	0.06405	0.002	T	0.03325	-1.1048	10	0.32370	T	0.25	-8.2239	16.3127	0.82898	0.0:0.8328:0.1672:0.0	.	870	Q9BZF1	OSBL8_HUMAN	H	828;870;855;828	ENSP00000376939:D828H;ENSP00000261183:D870H;ENSP00000376940:D828H	ENSP00000261183:D870H	D	-	1	0	OSBPL8	75273862	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.326000	0.59241	2.882000	0.98803	0.655000	0.94253	GAC	OSBPL8	-	NULL	ENSG00000091039		0.323	OSBPL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OSBPL8	HGNC	protein_coding	OTTHUMT00000406357.1	64	0.00	0	C	NM_020841		76749731	76749731	-1	no_errors	ENST00000261183	ensembl	human	known	69_37n	missense	38	25.49	13	SNP	1.000	G
P2RY10	27334	genome.wustl.edu	37	X	78216688	78216688	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:78216688C>T	ENST00000171757.2	+	4	951	c.671C>T	c.(670-672)tCc>tTc	p.S224F	P2RY10_ENST00000544091.1_Missense_Mutation_p.S224F	NM_014499.2	NP_055314.1	O00398	P2Y10_HUMAN	purinergic receptor P2Y, G-protein coupled, 10	224						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled purinergic nucleotide receptor activity (GO:0045028)			breast(2)|central_nervous_system(1)|endometrium(3)|large_intestine(9)|lung(22)|ovary(3)|skin(2)	42						ACTACTATATCCTTGAGACAG	0.483																																						dbGAP											0													126.0	103.0	111.0					X																	78216688		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000545	CCDS14442.1	Xq21.1	2012-08-23			ENSG00000078589	ENSG00000078589		"""Purinergic receptors"", ""GPCR / Class A : Purinergic receptors, P2Y"""	19906	protein-coding gene	gene with protein product		300529				11004484, 9755289	Standard	NM_014499		Approved	P2Y10	uc004edf.3	O00398	OTTHUMG00000021896	ENST00000171757.2:c.671C>T	X.37:g.78216688C>T	ENSP00000171757:p.Ser224Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTE5|Q4VBN7|Q86V16	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor	p.S224F	ENST00000171757.2	37	c.671	CCDS14442.1	X	.	.	.	.	.	.	.	.	.	.	C	17.14	3.312836	0.60414	.	.	ENSG00000078589	ENST00000544091;ENST00000171757	T;T	0.38077	1.16;1.16	4.82	4.82	0.62117	GPCR, rhodopsin-like superfamily (1);	0.404996	0.25774	N	0.028393	T	0.53753	0.1816	M	0.73319	2.225	0.37322	D	0.909598	D	0.56035	0.974	P	0.61328	0.887	T	0.63148	-0.6702	10	0.72032	D	0.01	.	10.8593	0.46817	0.1879:0.812:0.0:0.0	.	224	O00398	P2Y10_HUMAN	F	224	ENSP00000443138:S224F;ENSP00000171757:S224F	ENSP00000171757:S224F	S	+	2	0	P2RY10	78103344	0.936000	0.31750	0.980000	0.43619	0.926000	0.56050	2.606000	0.46291	2.231000	0.72958	0.540000	0.68198	TCC	P2RY10	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000078589		0.483	P2RY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RY10	HGNC	protein_coding	OTTHUMT00000057323.1	83	0.00	0	C			78216688	78216688	+1	no_errors	ENST00000171757	ensembl	human	known	69_37n	missense	61	16.22	12	SNP	0.676	T
P4HA3	283208	genome.wustl.edu	37	11	74013501	74013501	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:74013501C>G	ENST00000331597.4	-	3	525	c.480G>C	c.(478-480)caG>caC	p.Q160H	P4HA3_ENST00000427714.2_Missense_Mutation_p.Q160H	NM_182904.3	NP_878907.1	Q7Z4N8	P4HA3_HUMAN	prolyl 4-hydroxylase, alpha polypeptide III	160						endoplasmic reticulum (GO:0005783)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)|procollagen-proline 4-dioxygenase activity (GO:0004656)			NS(1)|biliary_tract(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(1)	15	Breast(11;2.31e-05)					CAGTGACTCTCTGAAAGACAC	0.542																																						dbGAP											0													129.0	128.0	128.0					11																	74013501		2200	4293	6493	-	-	-	SO:0001583	missense	0			AY327887	CCDS8230.1, CCDS73347.1	11q13	2008-12-09	2008-12-09			ENSG00000149380			30135	protein-coding gene	gene with protein product	"""collagen prolyl 4-hydroxylase alpha(III)"""	608987	"""procollagen-proline, 2-oxoglutarate 4-dioxygenase (proline 4-hydroxylase), alpha polypeptide III"""			14500733	Standard	XM_005273924		Approved	C-P4Halpha(III)	uc001ouz.3	Q7Z4N8		ENST00000331597.4:c.480G>C	11.37:g.74013501C>G	ENSP00000332170:p.Gln160His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV13|B4DUD3|Q5EBL3|Q5JPA9	Missense_Mutation	SNP	pfam_Pro_4_hyd_alph_N,pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.Q160H	ENST00000331597.4	37	c.480	CCDS8230.1	11	.	.	.	.	.	.	.	.	.	.	C	15.64	2.893507	0.52121	.	.	ENSG00000149380	ENST00000331597;ENST00000427714	T;T	0.56611	0.48;0.45	4.96	4.05	0.47172	Prolyl 4-hydroxylase alpha-subunit, N-terminal (1);	0.114616	0.64402	D	0.000010	T	0.63200	0.2491	L	0.56769	1.78	0.45541	D	0.99849	D;B	0.76494	0.999;0.137	D;B	0.72338	0.977;0.115	T	0.61569	-0.7036	10	0.38643	T	0.18	-23.8174	7.8916	0.29682	0.0:0.8164:0.0:0.1836	.	160;160	B4DUD3;Q7Z4N8	.;P4HA3_HUMAN	H	160	ENSP00000332170:Q160H;ENSP00000401749:Q160H	ENSP00000332170:Q160H	Q	-	3	2	P4HA3	73691149	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.403000	0.44530	1.449000	0.47699	-0.244000	0.11960	CAG	P4HA3	-	pfam_Pro_4_hyd_alph_N	ENSG00000149380		0.542	P4HA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P4HA3	HGNC	protein_coding	OTTHUMT00000382988.1	56	0.00	0	C	NM_182904		74013501	74013501	-1	no_errors	ENST00000331597	ensembl	human	known	69_37n	missense	31	20.51	8	SNP	1.000	G
PADI3	51702	genome.wustl.edu	37	1	17609485	17609485	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:17609485C>G	ENST00000375460.3	+	16	1946	c.1906C>G	c.(1906-1908)Cca>Gca	p.P636A		NM_016233.2	NP_057317.2	Q9ULW8	PADI3_HUMAN	peptidyl arginine deiminase, type III	636					protein citrullination (GO:0018101)	cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|liver(2)|lung(10)|ovary(2)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	32		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;1.17e-05)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.00656)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	TGACTTCACTCCATACCACAT	0.577																																						dbGAP											0													115.0	96.0	102.0					1																	17609485		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB026831	CCDS179.1	1p36.13	2008-02-05			ENSG00000142619	ENSG00000142619	3.5.3.15	"""Peptidyl arginine deiminases"""	18337	protein-coding gene	gene with protein product		606755				11069618	Standard	NM_016233		Approved	PDI3	uc001bai.3	Q9ULW8	OTTHUMG00000002373	ENST00000375460.3:c.1906C>G	1.37:g.17609485C>G	ENSP00000364609:p.Pro636Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q58EY7|Q70SX5	Missense_Mutation	SNP	pfam_PAD_C,pfam_Prot_Arg_deaminase_cen_dom,pfam_PAD_N,superfamily_Prot_Arg_deaminase_cen_dom,superfamily_Cupredoxin,pirsf_Protein-arginine_deiminase_sub	p.P636A	ENST00000375460.3	37	c.1906	CCDS179.1	1	.	.	.	.	.	.	.	.	.	.	c	5.831	0.337586	0.11013	.	.	ENSG00000142619	ENST00000375460	T	0.19250	2.16	5.0	2.12	0.27331	Protein-arginine deiminase, C-terminal (1);	0.195689	0.46442	D	0.000291	T	0.09247	0.0228	N	0.16130	0.375	0.33354	D	0.571472	B	0.23735	0.09	B	0.27608	0.081	T	0.21314	-1.0249	10	0.13853	T	0.58	-12.5378	3.3422	0.07123	0.1758:0.481:0.0:0.3432	.	636	Q9ULW8	PADI3_HUMAN	A	636	ENSP00000364609:P636A	ENSP00000364609:P636A	P	+	1	0	PADI3	17482072	0.084000	0.21492	0.107000	0.21349	0.949000	0.60115	0.528000	0.23002	0.526000	0.28541	0.561000	0.74099	CCA	PADI3	-	pfam_PAD_C,pirsf_Protein-arginine_deiminase_sub	ENSG00000142619		0.577	PADI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PADI3	HGNC	protein_coding	OTTHUMT00000006805.1	38	0.00	0	C			17609485	17609485	+1	no_errors	ENST00000375460	ensembl	human	known	69_37n	missense	38	15.56	7	SNP	0.981	G
PAEP	5047	genome.wustl.edu	37	9	138454685	138454685	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:138454685G>C	ENST00000479141.1	+	3	300	c.256G>C	c.(256-258)Gag>Cag	p.E86Q	PAEP_ENST00000371766.2_Missense_Mutation_p.E86Q|PAEP_ENST00000277508.5_Missense_Mutation_p.E86Q	NM_002571.2	NP_002562.2	P09466	PAEP_HUMAN	progestagen-associated endometrial protein	86					multicellular organismal development (GO:0007275)|transport (GO:0006810)	extracellular region (GO:0005576)	small molecule binding (GO:0036094)			cervix(1)|endometrium(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	6				OV - Ovarian serous cystadenocarcinoma(145;3.39e-07)|Epithelial(140;1.11e-06)|all cancers(34;2.04e-05)		CAGCTGTGTTGAGAAGAAGGT	0.502																																						dbGAP											0													213.0	203.0	207.0					9																	138454685		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35173.1	9q34	2011-11-15	2008-07-31		ENSG00000122133	ENSG00000122133		"""Lipocalins"""	8573	protein-coding gene	gene with protein product	"""glycodelin-A"", ""glycodelin-S"", ""glycodelin-F"", ""progesterone-associated endometrial protein"", ""glycodelin"", ""PP14 protein (placental protein 14)"", ""pregnancy-associated endometrial alpha-2-globulin"", ""alpha uterine protein"""	173310				3320533, 2016092	Standard	XM_005263405		Approved	PEP, PP14, GdA, GdS, GdF, PAEG, GD, MGC138509, MGC142288	uc004cgd.1	P09466	OTTHUMG00000020914	ENST00000479141.1:c.256G>C	9.37:g.138454685G>C	ENSP00000417898:p.Glu86Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T6T1|Q9UG92	Missense_Mutation	SNP	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like,prints_Blactoglobulin,prints_Lipocalin	p.E86Q	ENST00000479141.1	37	c.256	CCDS35173.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.21|10.21	1.287298|1.287298	0.23478|0.23478	.|.	.|.	ENSG00000122133|ENSG00000122133	ENST00000479141;ENST00000371767;ENST00000371766;ENST00000277508;ENST00000418284|ENST00000433563;ENST00000454923	T;T;T;T|.	0.09163|.	3.01;3.01;3.01;3.01|.	1.46|1.46	-0.84|-0.84	0.10755|0.10755	Calycin-like (1);Lipocalin/cytosolic fatty-acid binding protein domain (1);Calycin (1);|.	.|.	.|.	.|.	.|.	T|.	0.33059|.	0.0850|.	L|L	0.48877|0.48877	1.53|1.53	0.09310|0.09310	N|N	1|1	D;P;D;D;P|.	0.69078|.	0.968;0.844;0.975;0.997;0.844|.	P;P;D;D;P|.	0.79108|.	0.859;0.615;0.982;0.992;0.615|.	T|.	0.30327|.	-0.9982|.	9|.	0.32370|.	T|.	0.25|.	.|.	2.5496|2.5496	0.04745|0.04745	0.2299:0.3208:0.4492:0.0|0.2299:0.3208:0.4492:0.0	.|.	64;68;86;64;86|.	P09466-2;B2R4F9;A6XNE0;E9PH67;P09466|.	.;.;.;.;PAEP_HUMAN|.	Q|S	86;64;86;86;38|49;31	ENSP00000417898:E86Q;ENSP00000360831:E86Q;ENSP00000277508:E86Q;ENSP00000401933:E38Q|.	ENSP00000277508:E86Q|.	E|X	+|+	1|2	0|2	PAEP|PAEP	137594506|137594506	0.024000|0.024000	0.19004|0.19004	0.000000|0.000000	0.03702|0.03702	0.624000|0.624000	0.37722|0.37722	-0.000000|-0.000000	0.12993|0.12993	-0.245000|-0.245000	0.09625|0.09625	0.467000|0.467000	0.42956|0.42956	GAG|TGA	PAEP	-	pfam_Lipocln_cytosolic_FA-bd_dom,superfamily_Calycin-like	ENSG00000122133		0.502	PAEP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAEP	HGNC	protein_coding	OTTHUMT00000055010.1	59	0.00	0	G	NM_001018049		138454685	138454685	+1	no_errors	ENST00000277508	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.000	C
PAGE2B	389860	genome.wustl.edu	37	X	55102533	55102533	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:55102533C>T	ENST00000374971.1	+	2	111	c.59C>T	c.(58-60)tCt>tTt	p.S20F	PAGE2B_ENST00000374974.3_Missense_Mutation_p.S20F	NM_001015038.1	NP_001015038.1	Q5JRK9	GGEE3_HUMAN	P antigen family, member 2B	20										lung(3)	3						GACCAAGAGTCTTCCCAGCCA	0.358																																						dbGAP											0													123.0	104.0	110.0					X																	55102533		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS35304.1	Xp11.22	2009-06-17			ENSG00000238269	ENSG00000238269			31805	protein-coding gene	gene with protein product							Standard	NM_001015038		Approved	CT16.5	uc004due.4	Q5JRK9	OTTHUMG00000021645	ENST00000374971.1:c.59C>T	X.37:g.55102533C>T	ENSP00000364110:p.Ser20Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L414	Missense_Mutation	SNP	pfam_GAGE	p.S20F	ENST00000374971.1	37	c.59	CCDS35304.1	X	.	.	.	.	.	.	.	.	.	.	c	6.265	0.417069	0.11870	.	.	ENSG00000238269	ENST00000374974;ENST00000374971;ENST00000453343	T;T	0.10960	2.82;2.82	1.29	1.29	0.21616	.	.	.	.	.	T	0.11367	0.0277	M	0.73217	2.22	0.09310	N	1	B	0.02656	0.0	B	0.08055	0.003	T	0.32188	-0.9916	9	0.21014	T	0.42	.	5.5924	0.17309	0.0:1.0:0.0:0.0	.	20	Q5JRK9	GGEE3_HUMAN	F	20	ENSP00000364113:S20F;ENSP00000364110:S20F	ENSP00000364110:S20F	S	+	2	0	PAGE2B	55119258	0.000000	0.05858	0.002000	0.10522	0.082000	0.17680	0.012000	0.13287	0.946000	0.37632	0.287000	0.19450	TCT	PAGE2B	-	pfam_GAGE	ENSG00000238269		0.358	PAGE2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAGE2B	HGNC	protein_coding	OTTHUMT00000056849.1	151	0.66	1	C	XM_372224		55102533	55102533	+1	no_errors	ENST00000374971	ensembl	human	known	69_37n	missense	95	18.80	22	SNP	0.002	T
PAPOLG	64895	genome.wustl.edu	37	2	60987417	60987417	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:60987417G>T	ENST00000238714.3	+	2	415	c.166G>T	c.(166-168)Gaa>Taa	p.E56*		NM_022894.3	NP_075045.2	Q9BWT3	PAPOG_HUMAN	poly(A) polymerase gamma	56					mRNA polyadenylation (GO:0006378)|RNA polyadenylation (GO:0043631)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(6)|liver(1)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	35	all_hematologic(2;0.0797)		LUSC - Lung squamous cell carcinoma(5;1.19e-07)|Lung(5;2.86e-06)|Epithelial(17;0.0768)			AGATGAGGAAGAATTGAACCA	0.333																																					GBM(183;1497 2932 21839 46797)	dbGAP											0													76.0	76.0	76.0					2																	60987417		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AC012498	CCDS1863.1	2p16.1	2008-02-08			ENSG00000115421	ENSG00000115421	2.7.7.19		14982	protein-coding gene	gene with protein product							Standard	NM_022894		Approved	FLJ12972	uc002sai.3	Q9BWT3	OTTHUMG00000129419	ENST00000238714.3:c.166G>T	2.37:g.60987417G>T	ENSP00000238714:p.Glu56*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBH4|Q59G05|Q969N1|Q9H8L2|Q9HAD0	Nonsense_Mutation	SNP	pfam_PolA_pol_cen_dom,pfam_PolA_pol_RNA-bd_dom,pfam_Nucleotidyltransferase,superfamily_NuclTrfase_I_C,pirsf_PolyA_polymerase	p.E56*	ENST00000238714.3	37	c.166	CCDS1863.1	2	.	.	.	.	.	.	.	.	.	.	G	40	7.926883	0.98565	.	.	ENSG00000115421	ENST00000238714	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	0.8984	19.5165	0.95167	0.0:0.0:1.0:0.0	.	.	.	.	X	56	.	ENSP00000238714:E56X	E	+	1	0	PAPOLG	60840921	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.625000	0.98406	2.716000	0.92895	0.563000	0.77884	GAA	PAPOLG	-	pfam_PolA_pol_cen_dom,pirsf_PolyA_polymerase	ENSG00000115421		0.333	PAPOLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPOLG	HGNC	protein_coding	OTTHUMT00000251577.3	44	0.00	0	G	NM_022894		60987417	60987417	+1	no_errors	ENST00000238714	ensembl	human	known	69_37n	nonsense	28	30.00	12	SNP	1.000	T
PARD3B	117583	genome.wustl.edu	37	2	206166199	206166199	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:206166199G>C	ENST00000406610.2	+	18	2611	c.2404G>C	c.(2404-2406)Gat>Cat	p.D802H	PARD3B_ENST00000358768.2_Missense_Mutation_p.D740H|PARD3B_ENST00000462231.1_Missense_Mutation_p.D802H|PARD3B_ENST00000349953.3_Missense_Mutation_p.D802H|PARD3B_ENST00000351153.1_Missense_Mutation_p.D733H	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	802					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		CGGTCTGTCTGATAAGAGCTC	0.443																																						dbGAP											0													91.0	90.0	90.0					2																	206166199		1851	4100	5951	-	-	-	SO:0001583	missense	0			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2404G>C	2.37:g.206166199G>C	ENSP00000385848:p.Asp802His	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D802H	ENST00000406610.2	37	c.2404		2	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935586	0.73442	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000351153;ENST00000349953	T;T;T;T	0.32515	1.48;1.48;1.45;1.48	5.87	5.87	0.94306	.	0.062472	0.64402	D	0.000008	T	0.55386	0.1917	L	0.59436	1.845	0.45183	D	0.99819	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.999;0.998;0.991;0.998	T	0.50642	-0.8804	10	0.54805	T	0.06	.	20.1991	0.98252	0.0:0.0:1.0:0.0	.	733;802;733;740;802	Q8TEW8-3;Q8TEW8;E9PE87;Q8TEW8-2;Q8TEW8-5	.;PAR3L_HUMAN;.;.;.	H	802;740;733;802	ENSP00000385848:D802H;ENSP00000351618:D740H;ENSP00000317261:D733H;ENSP00000340280:D802H	ENSP00000340280:D802H	D	+	1	0	PARD3B	205874444	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.778000	0.75043	2.775000	0.95449	0.650000	0.86243	GAT	PARD3B	-	NULL	ENSG00000116117		0.443	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	HGNC	protein_coding	OTTHUMT00000335992.1	37	0.00	0	G	NM_057177		206166199	206166199	+1	no_errors	ENST00000406610	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
PARP4	143	genome.wustl.edu	37	13	25021263	25021263	+	Missense_Mutation	SNP	T	T	C	rs77269056		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:25021263T>C	ENST00000381989.3	-	26	3281	c.3176A>G	c.(3175-3177)cAg>cGg	p.Q1059R		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1059					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ATTGAGTTGCTGCCATTTGAC	0.483																																						dbGAP											0													68.0	64.0	66.0					13																	25021263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3176A>G	13.37:g.25021263T>C	ENSP00000371419:p.Gln1059Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.Q1059R	ENST00000381989.3	37	c.3176	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738796	0.49045	.	.	ENSG00000102699	ENST00000381989	T	0.01918	4.56	4.71	4.71	0.59529	.	0.121088	0.56097	D	0.000023	T	0.08582	0.0213	M	0.76328	2.33	0.38495	D	0.948071	D	0.69078	0.997	P	0.60789	0.879	T	0.01053	-1.1467	10	0.87932	D	0	-17.7634	7.9397	0.29950	0.1828:0.0:0.0:0.8172	.	1059	Q9UKK3	PARP4_HUMAN	R	1059	ENSP00000371419:Q1059R	ENSP00000371419:Q1059R	Q	-	2	0	PARP4	23919263	1.000000	0.71417	0.999000	0.59377	0.339000	0.28857	4.391000	0.59652	2.113000	0.64589	0.524000	0.50904	CAG	PARP4	-	NULL	ENSG00000102699		0.483	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	32	0.00	0	T	NM_006437		25021263	25021263	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	42	10.64	5	SNP	1.000	C
PCDHB2	56133	genome.wustl.edu	37	5	140474807	140474807	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:140474807C>G	ENST00000194155.4	+	1	581	c.433C>G	c.(433-435)Cca>Gca	p.P145A		NM_018936.2	NP_061759.1	Q9Y5E7	PCDB2_HUMAN	protocadherin beta 2	145	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(22)|lung(24)|ovary(3)|pancreas(1)|prostate(3)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	71			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TTTGAAAATTCCAGAAAGTAT	0.398																																						dbGAP											0													28.0	31.0	30.0					5																	140474807		2195	4298	6493	-	-	-	SO:0001583	missense	0			AF152495	CCDS4244.1	5q31	2010-01-26			ENSG00000112852	ENSG00000112852		"""Cadherins / Protocadherins : Clustered"""	8687	other	protocadherin		606328				10380929	Standard	NM_018936		Approved	PCDH-BETA2	uc003lil.3	Q9Y5E7	OTTHUMG00000129606	ENST00000194155.4:c.433C>G	5.37:g.140474807C>G	ENSP00000194155:p.Pro145Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMU1	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P145A	ENST00000194155.4	37	c.433	CCDS4244.1	5	.	.	.	.	.	.	.	.	.	.	C	1.302	-0.604582	0.03717	.	.	ENSG00000112852	ENST00000194155	T	0.54071	0.59	5.14	-2.2	0.06994	Cadherin (3);Cadherin-like (1);	.	.	.	.	T	0.34571	0.0902	L	0.38692	1.165	0.09310	N	1	B	0.26744	0.158	B	0.28553	0.091	T	0.30937	-0.9961	9	0.11485	T	0.65	.	6.5367	0.22357	0.2447:0.514:0.0:0.2413	.	145	Q9Y5E7	PCDB2_HUMAN	A	145	ENSP00000194155:P145A	ENSP00000194155:P145A	P	+	1	0	PCDHB2	140454991	0.000000	0.05858	0.581000	0.28614	0.000000	0.00434	-2.299000	0.01139	-0.166000	0.10890	-0.982000	0.02568	CCA	PCDHB2	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000112852		0.398	PCDHB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB2	HGNC	protein_coding	OTTHUMT00000251801.2	19	0.00	0	C	NM_018936		140474807	140474807	+1	no_errors	ENST00000194155	ensembl	human	known	69_37n	missense	13	23.53	4	SNP	0.000	G
PCDHB6	56130	genome.wustl.edu	37	5	140530263	140530263	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:140530263C>T	ENST00000231136.1	+	1	425	c.425C>T	c.(424-426)tCa>tTa	p.S142L	PCDHB6_ENST00000543635.1_Missense_Mutation_p.S6L	NM_018939.2	NP_061762.1	Q9Y5E3	PCDB6_HUMAN	protocadherin beta 6	142	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			cervix(1)|endometrium(14)|kidney(6)|large_intestine(16)|liver(1)|lung(33)|ovary(1)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	84			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CTGAAAATATCAGAAATTACT	0.463																																						dbGAP											0													78.0	87.0	84.0					5																	140530263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152499	CCDS4248.1	5q31	2010-01-26			ENSG00000113211	ENSG00000113211		"""Cadherins / Protocadherins : Clustered"""	8691	other	protocadherin		606332				10380929	Standard	NM_018939		Approved	PCDH-BETA6	uc003lir.3	Q9Y5E3	OTTHUMG00000129623	ENST00000231136.1:c.425C>T	5.37:g.140530263C>T	ENSP00000231136:p.Ser142Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8R9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S142L	ENST00000231136.1	37	c.425	CCDS4248.1	5	.	.	.	.	.	.	.	.	.	.	C	3.530	-0.096003	0.07010	.	.	ENSG00000113211	ENST00000543635;ENST00000231136	T;T	0.70045	-0.45;2.08	4.85	3.98	0.46160	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.49115	0.1538	N	0.20401	0.57	0.09310	N	1	B	0.11235	0.004	B	0.17979	0.02	T	0.32561	-0.9902	9	0.22706	T	0.39	.	8.9813	0.35966	0.0:0.7648:0.0:0.2352	.	142	Q9Y5E3	PCDB6_HUMAN	L	6;142	ENSP00000438466:S6L;ENSP00000231136:S142L	ENSP00000231136:S142L	S	+	2	0	PCDHB6	140510447	0.000000	0.05858	0.997000	0.53966	0.207000	0.24258	0.264000	0.18497	1.167000	0.42706	0.561000	0.74099	TCA	PCDHB6	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000113211		0.463	PCDHB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB6	HGNC	protein_coding	OTTHUMT00000251818.2	39	0.00	0	C	NM_018939		140530263	140530263	+1	no_errors	ENST00000231136	ensembl	human	known	69_37n	missense	29	19.44	7	SNP	0.237	T
PCDHGA4	56111	genome.wustl.edu	37	5	140737104	140737104	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:140737104C>T	ENST00000571252.1	+	1	2337	c.2337C>T	c.(2335-2337)ctC>ctT	p.L779L	PCDHGA1_ENST00000517417.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB2_ENST00000522605.1_5'Flank	NM_018917.2	NP_061740	Q9Y5G9	PCDG4_HUMAN	protocadherin gamma subfamily A, 4	779					homophilic cell adhesion (GO:0007156)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|lung(3)	5			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CAGACACGCTCATCAGCCGGG	0.507																																						dbGAP											0													72.0	80.0	77.0					5																	140737104		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF152511	CCDS58979.1, CCDS58979.2, CCDS75331.1	5q31	2010-01-26						"""Cadherins / Protocadherins : Clustered"""	8702	other	protocadherin		606291				10380929	Standard	NM_018917		Approved	PCDH-GAMMA-A4		Q9Y5G9		ENST00000571252.1:c.2337C>T	5.37:g.140737104C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5D3	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.L779	ENST00000571252.1	37	c.2337	CCDS58979.1	5																																																																																			PCDHGA4	-	NULL	ENSG00000262576		0.507	PCDHGA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA4	HGNC	protein_coding	OTTHUMT00000437959.1	40	0.00	0	C	NM_018917		140737104	140737104	+1	no_errors	ENST00000571252	ensembl	human	known	69_37n	silent	49	18.33	11	SNP	0.999	T
PCYT1A	5130	genome.wustl.edu	37	3	195968822	195968822	+	Silent	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:195968822G>T	ENST00000292823.2	-	8	877	c.705C>A	c.(703-705)atC>atA	p.I235I	PCYT1A_ENST00000419333.1_Silent_p.I235I|PCYT1A_ENST00000431016.1_Silent_p.I235I	NM_005017.2	NP_005008.2	P49585	PCY1A_HUMAN	phosphate cytidylyltransferase 1, choline, alpha	235	Amphipathic. {ECO:0000255}.				CDP-choline pathway (GO:0006657)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|glycogen granule (GO:0042587)	choline-phosphate cytidylyltransferase activity (GO:0004105)|lipid binding (GO:0008289)			cervix(1)|endometrium(3)|large_intestine(8)|lung(5)|ovary(1)	18	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;1.28e-24)|all cancers(36;1.01e-22)|OV - Ovarian serous cystadenocarcinoma(49;3.88e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00259)	Choline(DB00122)|Lamivudine(DB00709)	AACTCACGTTGATAAAGCTGA	0.507																																						dbGAP											0													126.0	98.0	107.0					3																	195968822		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L28957	CCDS3315.1	3q29	2010-07-19	2005-09-05		ENSG00000161217	ENSG00000161217	2.7.7.15		8754	protein-coding gene	gene with protein product	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	123695	"""phosphate cytidylyltransferase 1, choline, alpha isoform"""	PCYT1		7918629	Standard	NM_005017		Approved	CT, CTPCT	uc003fwg.3	P49585	OTTHUMG00000155670	ENST00000292823.2:c.705C>A	3.37:g.195968822G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A9LYK9|D3DXB1|Q86Y88	Silent	SNP	pfam_Cytidylyltransf,superfamily_NA-bd_OB-fold-like,tigrfam_Cyt_trans-rel	p.I235	ENST00000292823.2	37	c.705	CCDS3315.1	3																																																																																			PCYT1A	-	superfamily_NA-bd_OB-fold-like	ENSG00000161217		0.507	PCYT1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYT1A	HGNC	protein_coding	OTTHUMT00000341147.1	38	0.00	0	G	NM_005017		195968822	195968822	-1	no_errors	ENST00000292823	ensembl	human	known	69_37n	silent	28	22.22	8	SNP	1.000	T
PDGFRB	5159	genome.wustl.edu	37	5	149495436	149495436	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:149495436C>T	ENST00000261799.4	-	23	3680	c.3211G>A	c.(3211-3213)Gag>Aag	p.E1071K	CSF1R_ENST00000286301.3_5'Flank	NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	1071					adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)			breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	GGCTCTGGCTCTGGTTCGTCC	0.627			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																	dbGAP		Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	0													29.0	32.0	31.0					5																	149495436		2203	4299	6502	-	-	-	SO:0001583	missense	0			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.3211G>A	5.37:g.149495436C>T	ENSP00000261799:p.Glu1071Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5A957|Q8N5L4	Missense_Mutation	SNP	pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_VEGFR_rcpt_N,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E1071K	ENST00000261799.4	37	c.3211	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	C	27.5	4.833531	0.91036	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	T	0.76060	-0.99	5.62	4.72	0.59763	.	0.332212	0.21508	N	0.073407	T	0.57961	0.2089	N	0.08118	0	0.33528	D	0.593285	B;B	0.30793	0.141;0.295	B;B	0.28553	0.091;0.091	T	0.68224	-0.5465	10	0.72032	D	0.01	.	16.2448	0.82436	0.0:0.8668:0.1332:0.0	.	1071;1071	A8KAM8;P09619	.;PGFRB_HUMAN	K	1071;741	ENSP00000261799:E1071K	ENSP00000261799:E1071K	E	-	1	0	PDGFRB	149475629	0.979000	0.34478	0.978000	0.43139	0.606000	0.37113	4.803000	0.62546	1.319000	0.45190	0.462000	0.41574	GAG	PDGFRB	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt	ENSG00000113721		0.627	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1	80	0.00	0	C	NM_002609		149495436	149495436	-1	no_errors	ENST00000261799	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	0.953	T
PDRG1	81572	genome.wustl.edu	37	20	30538178	30538178	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr20:30538178C>G	ENST00000202017.4	-	2	230	c.100G>C	c.(100-102)Gac>Cac	p.D34H		NM_030815.2	NP_110442.1	Q9NUG6	PDRG1_HUMAN	p53 and DNA-damage regulated 1	34					protein folding (GO:0006457)	cytoplasm (GO:0005737)|prefoldin complex (GO:0016272)				endometrium(2)|kidney(1)|large_intestine(2)|lung(1)|skin(1)|stomach(1)	8			Colorectal(19;0.00306)|COAD - Colon adenocarcinoma(19;0.0347)			CTTTTAGTGTCCAGGTCCACA	0.527																																						dbGAP											0													83.0	81.0	81.0					20																	30538178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL031658	CCDS13194.1	20q11.21	2009-06-12	2009-06-12	2004-10-07	ENSG00000088356	ENSG00000088356			16119	protein-coding gene	gene with protein product		610789	"""chromosome 20 open reading frame 126"""	C20orf126		14562055	Standard	NM_030815		Approved	dJ310O13.3	uc002wxd.3	Q9NUG6	OTTHUMG00000032196	ENST00000202017.4:c.100G>C	20.37:g.30538178C>G	ENSP00000202017:p.Asp34His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R511|Q96GP3|Q9BUW8	Missense_Mutation	SNP	pfam_PFD_beta-like,superfamily_Prefoldin	p.D34H	ENST00000202017.4	37	c.100	CCDS13194.1	20	.	.	.	.	.	.	.	.	.	.	C	18.66	3.672584	0.67928	.	.	ENSG00000088356	ENST00000202017	T	0.44482	0.92	4.18	4.18	0.49190	Prefoldin beta-like (1);	0.046565	0.85682	D	0.000000	T	0.62744	0.2453	M	0.80422	2.495	0.80722	D	1	D	0.65815	0.995	D	0.65573	0.936	T	0.68236	-0.5462	10	0.87932	D	0	-19.3009	12.2028	0.54335	0.0:1.0:0.0:0.0	.	34	Q9NUG6	PDRG1_HUMAN	H	34	ENSP00000202017:D34H	ENSP00000202017:D34H	D	-	1	0	PDRG1	30001839	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.957000	0.56730	2.302000	0.77476	0.563000	0.77884	GAC	PDRG1	-	pfam_PFD_beta-like,superfamily_Prefoldin	ENSG00000088356		0.527	PDRG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDRG1	HGNC	protein_coding	OTTHUMT00000078593.2	44	0.00	0	C	NM_030815		30538178	30538178	-1	no_errors	ENST00000202017	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	G
PFAS	5198	genome.wustl.edu	37	17	8158418	8158418	+	Missense_Mutation	SNP	C	C	T	rs199968776		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:8158418C>T	ENST00000314666.6	+	4	485	c.352C>T	c.(352-354)Cgt>Tgt	p.R118C	PFAS_ENST00000545834.1_5'UTR	NM_012393.2	NP_036525.1	O15067	PUR4_HUMAN	phosphoribosylformylglycinamidine synthase	118					'de novo' IMP biosynthetic process (GO:0006189)|glutamine metabolic process (GO:0006541)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|phosphoribosylformylglycinamidine synthase activity (GO:0004642)			central_nervous_system(3)|endometrium(8)|kidney(2)|large_intestine(2)|lung(9)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)	35					L-Glutamine(DB00130)	GCCTGTGGATCGTGTGGAGAC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		17229	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													73.0	58.0	63.0					17																	8158418		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002359	CCDS11136.1	17p13.1	2008-07-31	2008-07-31		ENSG00000178921	ENSG00000178921	6.3.5.3		8863	protein-coding gene	gene with protein product	"""FGAR amidotransferase"""	602133				8110788	Standard	NM_012393		Approved	PURL, FGARAT, KIAA0361	uc002gkr.3	O15067	OTTHUMG00000108188	ENST00000314666.6:c.352C>T	17.37:g.8158418C>T	ENSP00000313490:p.Arg118Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V8	Missense_Mutation	SNP	pfam_AIR_synth_C,pfam_AIR_synth,superfamily_PurM_N-like,superfamily_AIR_synth_C,tigrfam_PRibForGlyAmidine_synth	p.R118C	ENST00000314666.6	37	c.352	CCDS11136.1	17	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	25.0	4.597652	0.87055	.	.	ENSG00000178921	ENST00000314666	T	0.67171	-0.25	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.83220	0.5207	M	0.88512	2.96	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.85726	0.1328	10	0.87932	D	0	-12.5103	11.9349	0.52868	0.1737:0.8262:0.0:0.0	.	118	O15067	PUR4_HUMAN	C	118	ENSP00000313490:R118C	ENSP00000313490:R118C	R	+	1	0	PFAS	8099143	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	3.645000	0.54389	2.662000	0.90505	0.561000	0.74099	CGT	PFAS	-	tigrfam_PRibForGlyAmidine_synth	ENSG00000178921		0.577	PFAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFAS	HGNC	protein_coding	OTTHUMT00000226994.2	35	0.00	0	C			8158418	8158418	+1	no_errors	ENST00000314666	ensembl	human	known	69_37n	missense	19	26.92	7	SNP	0.997	T
PGAP2	27315	genome.wustl.edu	37	11	3845314	3845314	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:3845314G>A	ENST00000463452.2	+	3	450	c.367G>A	c.(367-369)Gag>Aag	p.E123K	PGAP2_ENST00000493547.2_Missense_Mutation_p.E123K|PGAP2_ENST00000396986.2_Missense_Mutation_p.E180K|AC090587.2_ENST00000507938.1_RNA|PGAP2_ENST00000532017.1_3'UTR|PGAP2_ENST00000396991.2_Missense_Mutation_p.E184K|PGAP2_ENST00000278243.4_Missense_Mutation_p.E184K|PGAP2_ENST00000396993.4_Missense_Mutation_p.G76E|PGAP2_ENST00000300730.6_Missense_Mutation_p.E180K|PGAP2_ENST00000496834.2_5'UTR|PGAP2_ENST00000479072.1_5'UTR|PGAP2_ENST00000465307.2_Missense_Mutation_p.G126E	NM_001256240.1	NP_001243169.1	Q9UHJ9	PGAP2_HUMAN	post-GPI attachment to proteins 2	123					GPI anchor biosynthetic process (GO:0006506)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|signal transduction in response to DNA damage (GO:0042770)	endoplasmic reticulum membrane (GO:0005789)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			NS(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|urinary_tract(1)	11						CAATGTCGTGGAGAACCTCGC	0.607																																						dbGAP											0													94.0	81.0	85.0					11																	3845314		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF159615	CCDS7747.1, CCDS44523.1, CCDS58112.1, CCDS58113.1, CCDS73244.1, CCDS73245.1	11p15.4	2014-01-31			ENSG00000148985	ENSG00000148985			17893	protein-coding gene	gene with protein product	"""FGF receptor activating protein 1"", ""cell wall biogenesis 43 N-terminal homolog (S. cerevisiae)"""	615187	"""mental retardation, non-syndromic, autosomal recessive, 21"""	MRT21		10585768, 16407401, 23561846	Standard	NM_014489		Approved	FRAG1, CWH43-N	uc010qxw.3	Q9UHJ9	OTTHUMG00000012238	ENST00000463452.2:c.367G>A	11.37:g.3845314G>A	ENSP00000435223:p.Glu123Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PJG5|H7BXL9|Q6UC77|Q96G66|Q9UF01|Q9Y4N1	Nonsense_Mutation	SNP	pfam_Frag1/DRAM/Sfk1	p.W153*	ENST00000463452.2	37	c.459	CCDS58112.1	11	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	9.174|9.174|9.174	1.021863|1.021863|1.021863	0.19433|0.19433|0.19433	.|.|.	.|.|.	ENSG00000148985|ENSG00000148985|ENSG00000148985	ENST00000396986;ENST00000300730;ENST00000396991;ENST00000464261;ENST00000493547;ENST00000278243;ENST00000463452;ENST00000469307|ENST00000396993;ENST00000532523;ENST00000465307|ENST00000459679;ENST00000464906	T;T;T;T;T;T;T;T|.|.	0.44881|.|.	0.91;0.91;0.91;0.91;0.91;0.91;0.91;0.91|.|.	5.7|5.7|5.7	3.8|3.8|3.8	0.43715|0.43715|0.43715	.|.|.	0.000000|.|.	0.85682|.|.	D|.|.	0.000000|.|.	T|T|.	0.76176|0.76176|.	0.3951|0.3951|.	M|M|M	0.90542|0.90542|0.90542	3.125|3.125|3.125	0.58432|0.58432|0.58432	D|D|D	0.999998|0.999998|0.999998	D;D;D;D;D|B;B|.	0.89917|0.30634|.	1.0;1.0;1.0;0.959;1.0|0.288;0.041|.	D;D;D;P;D|B;B|.	0.97110|0.32533|.	1.0;1.0;1.0;0.732;1.0|0.147;0.023|.	T|T|.	0.76044|0.76044|.	-0.3103|-0.3103|.	10|8|.	0.62326|0.87932|.	D|D|.	0.03|0|.	-15.5347|-15.5347|-15.5347	7.0415|7.0415|7.0415	0.25023|0.25023|0.25023	0.0874:0.0:0.741:0.1716|0.0874:0.0:0.741:0.1716|0.0874:0.0:0.741:0.1716	.|.|.	180;123;184;123;123|126;76|.	A8MYS5;Q9UHJ9-3;Q9UHJ9;E9PJG5;Q9UHJ9-2|B7Z2X5;A8MZF5|.	.;.;PGAP2_HUMAN;.;.|.;.|.	K|E|X	180;180;184;153;123;184;123;123|76;141;126|153;213	ENSP00000380183:E180K;ENSP00000300730:E180K;ENSP00000380188:E184K;ENSP00000434088:E153K;ENSP00000431851:E123K;ENSP00000278243:E184K;ENSP00000435223:E123K;ENSP00000434507:E123K|.|.	ENSP00000278243:E184K|ENSP00000380190:G76E|.	E|G|W	+|+|+	1|2|3	0|0|0	PGAP2|PGAP2|PGAP2	3801890|3801890|3801890	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	0.607000|0.607000|0.607000	0.28956|0.28956|0.28956	0.330000|0.330000|0.330000	0.28571|0.28571|0.28571	8.850000|8.850000|8.850000	0.92190|0.92190|0.92190	0.724000|0.724000|0.724000	0.32296|0.32296|0.32296	0.650000|0.650000|0.650000	0.86243|0.86243|0.86243	GAG|GGA|TGG	PGAP2	-	pfam_Frag1/DRAM/Sfk1	ENSG00000148985		0.607	PGAP2-049	KNOWN	basic|CCDS	protein_coding	PGAP2	HGNC	protein_coding	OTTHUMT00000383260.1	53	0.00	0	G			3845314	3845314	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000459679	ensembl	human	putative	69_37n	nonsense	57	19.72	14	SNP	0.979	A
PGD	5226	genome.wustl.edu	37	1	10473184	10473184	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:10473184C>G	ENST00000270776.8	+	8	758	c.720C>G	c.(718-720)ctC>ctG	p.L240L	PGD_ENST00000541529.1_Silent_p.L218L|PGD_ENST00000538557.1_Silent_p.L227L	NM_002631.2	NP_002622.2	P52209	6PGD_HUMAN	phosphogluconate dehydrogenase	240					carbohydrate metabolic process (GO:0005975)|D-gluconate metabolic process (GO:0019521)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	NADP binding (GO:0050661)|phosphogluconate dehydrogenase (decarboxylating) activity (GO:0004616)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(3)|upper_aerodigestive_tract(1)	14	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.19e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.14e-07)|COAD - Colon adenocarcinoma(227;7.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000294)|Kidney(185;0.000728)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(132;0.00832)|READ - Rectum adenocarcinoma(331;0.0487)	Dacarbazine(DB00851)|Furosemide(DB00695)|Gadopentetate dimeglumine(DB00789)|Ketotifen(DB00920)|Meloxicam(DB00814)|Methotrexate(DB00563)|Ritodrine(DB00867)	CCAATATTCTCAAGTTCCAAG	0.512																																						dbGAP											0													84.0	80.0	81.0					1																	10473184		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC000368	CCDS113.1	1p36.22	2012-10-02			ENSG00000142657	ENSG00000142657	1.1.1.43		8891	protein-coding gene	gene with protein product		172200					Standard	NM_002631		Approved		uc001arc.3	P52209	OTTHUMG00000001905	ENST00000270776.8:c.720C>G	1.37:g.10473184C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Y9|B4DQJ8|Q9BWD8	Missense_Mutation	SNP	pfam_6PGDH_C,pfam_6PGDH_NADP-bd,superfamily_6-PGluconate_DH_C-like	p.Q215E	ENST00000270776.8	37	c.643	CCDS113.1	1																																																																																			PGD	-	pfam_6PGDH_C,superfamily_6-PGluconate_DH_C-like	ENSG00000142657		0.512	PGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGD	HGNC	protein_coding	OTTHUMT00000005398.1	38	0.00	0	C	NM_002631		10473184	10473184	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000460189	ensembl	human	novel	69_37n	missense	45	13.46	7	SNP	1.000	G
PHKA2	5256	genome.wustl.edu	37	X	18954233	18954233	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:18954233G>A	ENST00000379942.4	-	11	1742	c.1077C>T	c.(1075-1077)ctC>ctT	p.L359L		NM_000292.2	NP_000283.1	P46019	KPB2_HUMAN	phosphorylase kinase, alpha 2 (liver)	359					carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphorylase kinase complex (GO:0005964)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|biliary_tract(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(12)|lung(23)|ovary(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	61	Hepatocellular(33;0.183)					TGCCTCTGATGAGTATTCCCT	0.557																																						dbGAP											0													108.0	75.0	86.0					X																	18954233		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14190.1	Xp22.2-p22.1	2009-07-10			ENSG00000044446	ENSG00000044446	2.7.11.19		8926	protein-coding gene	gene with protein product		300798		PHK, PYK		2387090	Standard	NM_000292		Approved		uc004cyv.4	P46019	OTTHUMG00000021222	ENST00000379942.4:c.1077C>T	X.37:g.18954233G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1T1|Q6LAJ5|Q7Z6W0|Q96CR3|Q9UDA1	Silent	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.L359	ENST00000379942.4	37	c.1077	CCDS14190.1	X																																																																																			PHKA2	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	ENSG00000044446		0.557	PHKA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHKA2	HGNC	protein_coding	OTTHUMT00000055960.1	78	0.00	0	G	NM_000292		18954233	18954233	-1	no_errors	ENST00000379942	ensembl	human	known	69_37n	silent	55	24.66	18	SNP	0.952	A
PIGL	9487	genome.wustl.edu	37	17	16221195	16221195	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:16221195C>T	ENST00000225609.5	+	6	650	c.633C>T	c.(631-633)ctC>ctT	p.L211L	PIGL_ENST00000395844.4_Nonsense_Mutation_p.Q201*|PIGL_ENST00000581006.1_Intron	NM_004278.3	NP_004269.1	Q9Y2B2	PIGL_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class L	211					C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	N-acetylglucosaminylphosphatidylinositol deacetylase activity (GO:0000225)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11				UCEC - Uterine corpus endometrioid carcinoma (92;0.0934)		TCTTCGTGCTCAACAGCAAAG	0.547																																						dbGAP											0													165.0	130.0	142.0					17																	16221195		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB017165	CCDS11176.1	17p12-p11.2	2013-02-26	2006-06-28		ENSG00000108474	ENSG00000108474	3.5.1.89	"""Phosphatidylinositol glycan anchor biosynthesis"""	8966	protein-coding gene	gene with protein product	"""N-acetylglucosaminylphosphatidylinositol deacetylase"""	605947	"""phosphatidylinositol glycan, class L"""			10085243	Standard	NM_004278		Approved		uc002gpv.3	Q9Y2B2	OTTHUMG00000059346	ENST00000225609.5:c.633C>T	17.37:g.16221195C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA67|B4DYN4	Nonsense_Mutation	SNP	pfam_GlcNAc_PIno_de-acetylase,superfamily_LmbE-like_dom	p.Q201*	ENST00000225609.5	37	c.601	CCDS11176.1	17	.	.	.	.	.	.	.	.	.	.	C	13.51	2.259053	0.39896	.	.	ENSG00000108474	ENST00000395844	.	.	.	6.02	2.45	0.29901	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	-22.1643	8.2232	0.31554	0.0:0.5928:0.3076:0.0996	.	.	.	.	X	201	.	ENSP00000379185:Q201X	Q	+	1	0	PIGL	16161920	0.915000	0.31059	0.972000	0.41901	0.174000	0.22865	0.324000	0.19610	0.747000	0.32809	0.655000	0.94253	CAA	PIGL	-	NULL	ENSG00000108474		0.547	PIGL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIGL	HGNC	protein_coding	OTTHUMT00000131881.1	55	0.00	0	C			16221195	16221195	+1	no_errors	ENST00000395844	ensembl	human	novel	69_37n	nonsense	47	11.32	6	SNP	0.885	T
PIK3CA	5290	genome.wustl.edu	37	3	178952090	178952090	+	Missense_Mutation	SNP	G	G	C	rs121913277		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:178952090G>C	ENST00000263967.3	+	21	3302	c.3145G>C	c.(3145-3147)Ggt>Cgt	p.G1049R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1049	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		G -> S (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.G1049R(27)|p.G1049S(13)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGCACATCATGGTGGCTGGAC	0.378		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	40	Substitution - Missense(40)	breast(12)|endometrium(7)|lung(4)|thyroid(3)|large_intestine(3)|central_nervous_system(3)|upper_aerodigestive_tract(2)|urinary_tract(2)|kidney(2)|ovary(1)|pancreas(1)											98.0	88.0	91.0					3																	178952090		1919	4132	6051	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3145G>C	3.37:g.178952090G>C	ENSP00000263967:p.Gly1049Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.G1049R	ENST00000263967.3	37	c.3145	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697316	0.30142	.	.	ENSG00000121879	ENST00000263967	T	0.80824	-1.42	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.78084	0.4228	L	0.48642	1.525	0.80722	D	1	B	0.30914	0.3	B	0.28916	0.096	T	0.73668	-0.3910	10	0.41790	T	0.15	-16.0151	20.6721	0.99693	0.0:0.0:1.0:0.0	.	1049	P42336	PK3CA_HUMAN	R	1049	ENSP00000263967:G1049R	ENSP00000263967:G1049R	G	+	1	0	PIK3CA	180434784	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.367000	0.97148	2.894000	0.99253	0.591000	0.81541	GGT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	40	0.00	0	G			178952090	178952090	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	C
PKHD1L1	93035	genome.wustl.edu	37	8	110461570	110461570	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:110461570G>T	ENST00000378402.5	+	40	6133	c.6029G>T	c.(6028-6030)aGc>aTc	p.S2010I		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2010	IPT/TIG 13.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TCACTAGGGAGCTTTGGTGGG	0.328										HNSCC(38;0.096)																												dbGAP											0													42.0	40.0	40.0					8																	110461570		1803	4064	5867	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6029G>T	8.37:g.110461570G>T	ENSP00000367655:p.Ser2010Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.S2010I	ENST00000378402.5	37	c.6029	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	22.1	4.244055	0.79912	.	.	ENSG00000205038	ENST00000378402	T	0.78481	-1.18	5.26	5.26	0.73747	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.053665	0.64402	D	0.000001	D	0.88340	0.6410	M	0.80183	2.485	0.39362	D	0.965943	D	0.76494	0.999	D	0.76575	0.988	D	0.90336	0.4355	10	0.72032	D	0.01	.	16.353	0.83224	0.0:0.0:1.0:0.0	.	2010	Q86WI1	PKHL1_HUMAN	I	2010	ENSP00000367655:S2010I	ENSP00000367655:S2010I	S	+	2	0	PKHD1L1	110530746	1.000000	0.71417	1.000000	0.80357	0.827000	0.46813	7.095000	0.76952	2.465000	0.83290	0.591000	0.81541	AGC	PKHD1L1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000205038		0.328	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	59	0.00	0	G	NM_177531		110461570	110461570	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	55	16.67	11	SNP	1.000	T
PKHD1L1	93035	genome.wustl.edu	37	8	110477340	110477340	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:110477340C>G	ENST00000378402.5	+	49	8383	c.8279C>G	c.(8278-8280)tCt>tGt	p.S2760C		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2760					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			ACATCCATCTCTGGAGTTTGT	0.483										HNSCC(38;0.096)																												dbGAP											0													132.0	132.0	132.0					8																	110477340		1926	4132	6058	-	-	-	SO:0001583	missense	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.8279C>G	8.37:g.110477340C>G	ENSP00000367655:p.Ser2760Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.S2760C	ENST00000378402.5	37	c.8279	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	C	12.93	2.086267	0.36855	.	.	ENSG00000205038	ENST00000378402	D	0.86432	-2.12	5.83	4.85	0.62838	.	0.425328	0.24793	N	0.035541	T	0.70422	0.3222	N	0.03608	-0.345	0.21579	N	0.999636	B	0.10296	0.003	B	0.12156	0.007	T	0.57528	-0.7796	10	0.33141	T	0.24	.	9.425	0.38574	0.0:0.8732:0.0:0.1268	.	2760	Q86WI1	PKHL1_HUMAN	C	2760	ENSP00000367655:S2760C	ENSP00000367655:S2760C	S	+	2	0	PKHD1L1	110546516	0.982000	0.34865	1.000000	0.80357	0.994000	0.84299	2.332000	0.43903	2.757000	0.94681	0.563000	0.77884	TCT	PKHD1L1	-	NULL	ENSG00000205038		0.483	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	53	0.00	0	C	NM_177531		110477340	110477340	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	missense	33	25.00	11	SNP	1.000	G
PLA2G7	7941	genome.wustl.edu	37	6	46677151	46677151	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:46677151G>C	ENST00000274793.7	-	9	978	c.782C>G	c.(781-783)tCt>tGt	p.S261C	PLA2G7_ENST00000537365.1_Missense_Mutation_p.S261C	NM_005084.3	NP_005075.3	Q13093	PAFA_HUMAN	phospholipase A2, group VII (platelet-activating factor acetylhydrolase, plasma)	261					cellular protein metabolic process (GO:0044267)|lipid catabolic process (GO:0016042)|lipid oxidation (GO:0034440)|low-density lipoprotein particle remodeling (GO:0034374)|plasma lipoprotein particle oxidation (GO:0034441)|positive regulation of inflammatory response (GO:0050729)|positive regulation of monocyte chemotaxis (GO:0090026)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|low-density lipoprotein particle (GO:0034362)	1-alkyl-2-acetylglycerophosphocholine esterase activity (GO:0003847)|calcium-independent phospholipase A2 activity (GO:0047499)|phospholipid binding (GO:0005543)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|skin(1)|soft_tissue(1)	14			Lung(136;0.192)			CCTATCAATAGAGTCCTATTT	0.323																																						dbGAP											0													73.0	74.0	73.0					6																	46677151		2202	4295	6497	-	-	-	SO:0001583	missense	0			U20157	CCDS4917.1	6p21.2-p12	2008-09-19			ENSG00000146070	ENSG00000146070	3.1.1.4		9040	protein-coding gene	gene with protein product		601690				7700381, 8624782	Standard	NM_005084		Approved	PAFAH, LDL-PLA2	uc021zae.1	Q13093	OTTHUMG00000014789	ENST00000274793.7:c.782C>G	6.37:g.46677151G>C	ENSP00000274793:p.Ser261Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5HTT5|Q15692|Q5VTT1|Q8IVA2	Missense_Mutation	SNP	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	p.S261C	ENST00000274793.7	37	c.782	CCDS4917.1	6	.	.	.	.	.	.	.	.	.	.	G	16.52	3.146507	0.57044	.	.	ENSG00000146070	ENST00000274793;ENST00000537365	T;T	0.43688	0.94;0.94	6.03	6.03	0.97812	.	0.155605	0.64402	D	0.000013	T	0.62490	0.2432	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71414	0.973;0.973	T	0.59490	-0.7445	10	0.42905	T	0.14	.	20.1672	0.98154	0.0:0.0:1.0:0.0	.	261;261	A8K2W6;Q13093	.;PAFA_HUMAN	C	261	ENSP00000274793:S261C;ENSP00000445666:S261C	ENSP00000274793:S261C	S	-	2	0	PLA2G7	46785110	1.000000	0.71417	0.342000	0.25602	0.022000	0.10575	5.551000	0.67274	2.861000	0.98227	0.655000	0.94253	TCT	PLA2G7	-	pfam_PAF_acetylhydro,pirsf_Ac_Ohase_PAF	ENSG00000146070		0.323	PLA2G7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G7	HGNC	protein_coding	OTTHUMT00000040802.1	62	0.00	0	G			46677151	46677151	-1	no_errors	ENST00000274793	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.999	C
PLA2R1	22925	genome.wustl.edu	37	2	160803360	160803360	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:160803360C>G	ENST00000283243.7	-	27	4125	c.3919G>C	c.(3919-3921)Ggt>Cgt	p.G1307R	PLA2R1_ENST00000392771.1_Missense_Mutation_p.G1307R|PLA2R1_ENST00000460710.1_5'Flank	NM_001195641.1|NM_007366.4	NP_001182570.1|NP_031392.3	Q13018	PLA2R_HUMAN	phospholipase A2 receptor 1, 180kDa	1307	C-type lectin 8. {ECO:0000255|PROSITE- ProRule:PRU00040}.				cytokine production (GO:0001816)|negative regulation of arachidonic acid secretion (GO:1900139)|negative regulation of phospholipase A2 activity (GO:1900138)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of arachidonic acid secretion (GO:0090238)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|reactive oxygen species metabolic process (GO:0072593)|receptor-mediated endocytosis (GO:0006898)|replicative senescence (GO:0090399)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	carbohydrate binding (GO:0030246)|phospholipase binding (GO:0043274)|receptor activity (GO:0004872)		PLA2R1/RBMS1(2)	central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(17)|lung(20)|ovary(1)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)	60						ACAGAAGAACCAAAAGCAAAC	0.358																																						dbGAP											0													156.0	158.0	157.0					2																	160803360		2203	4300	6503	-	-	-	SO:0001583	missense	0			U17033	CCDS33309.1, CCDS42767.1	2q23-q24	2011-08-30	2002-08-29		ENSG00000153246	ENSG00000153246		"""C-type lectin domain containing"""	9042	protein-coding gene	gene with protein product		604939	"""phospholipase A2 receptor 1, 180kD"""			7721806, 7925459	Standard	NM_007366		Approved	PLA2G1R, PLA2IR, PLA2-R, CLEC13C	uc002ube.2	Q13018	OTTHUMG00000154087	ENST00000283243.7:c.3919G>C	2.37:g.160803360C>G	ENSP00000283243:p.Gly1307Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTU9|D3DPB1|Q13019|Q15095|Q53R45|Q53RR7	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_FN_type2_col-bd,superfamily_C-type_lectin_fold,superfamily_Ricin_B_lectin,superfamily_Kringle-like,smart_Ricin_B_lectin,smart_FN_type2_col-bd,smart_C-type_lectin,pfscan_FN_type2_col-bd,pfscan_C-type_lectin,pfscan_Ricin_B_lectin	p.G1307R	ENST00000283243.7	37	c.3919	CCDS33309.1	2	.	.	.	.	.	.	.	.	.	.	C	8.809	0.934674	0.18206	.	.	ENSG00000153246	ENST00000283243;ENST00000392771	T;T	0.18016	2.24;3.07	5.52	0.976	0.19727	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	0.365309	0.26847	N	0.022190	T	0.12433	0.0302	L	0.50919	1.6	0.09310	N	0.999991	B;B;B	0.14805	0.0;0.011;0.009	B;B;B	0.19946	0.005;0.021;0.027	T	0.30563	-0.9974	10	0.14656	T	0.56	.	6.1596	0.20356	0.0:0.5084:0.2599:0.2317	.	1307;1307;1307	B7ZML4;Q13018-2;Q13018	.;.;PLA2R_HUMAN	R	1307	ENSP00000283243:G1307R;ENSP00000376524:G1307R	ENSP00000283243:G1307R	G	-	1	0	PLA2R1	160511606	0.346000	0.24844	0.118000	0.21660	0.509000	0.34042	0.391000	0.20784	0.623000	0.30267	0.650000	0.86243	GGT	PLA2R1	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	ENSG00000153246		0.358	PLA2R1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2R1	HGNC	protein_coding	OTTHUMT00000333820.1	112	0.00	0	C			160803360	160803360	-1	no_errors	ENST00000283243	ensembl	human	known	69_37n	missense	66	14.29	11	SNP	0.193	G
PLK2	10769	genome.wustl.edu	37	5	57750794	57750794	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:57750794G>A	ENST00000274289.3	-	13	2110	c.1810C>T	c.(1810-1812)Cag>Tag	p.Q604*	PLK2_ENST00000502671.1_Intron	NM_001252226.1|NM_006622.3	NP_001239155.1|NP_006613.2	Q9NYY3	PLK2_HUMAN	polo-like kinase 2	604					G1/S transition of mitotic cell cycle (GO:0000082)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|mitotic cell cycle checkpoint (GO:0007093)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein phosphorylation (GO:0006468)|Rap protein signal transduction (GO:0032486)|Ras protein signal transduction (GO:0007265)|regulation of centriole replication (GO:0046599)|regulation of synaptic plasticity (GO:0048167)	centriole (GO:0005814)|centrosome (GO:0005813)|dendrite (GO:0030425)|intracellular (GO:0005622)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(7)|large_intestine(7)|lung(5)|ovary(3)|prostate(2)|skin(2)	26		all_cancers(5;1.76e-12)|all_epithelial(5;2.09e-13)|all_lung(5;6.64e-05)|Lung NSC(5;0.000127)|Prostate(74;0.055)|Breast(144;0.0602)|Ovarian(174;0.182)		OV - Ovarian serous cystadenocarcinoma(10;7.03e-37)		TTTAGCCACTGAAGGAGGTAG	0.433																																						dbGAP											0													200.0	204.0	203.0					5																	57750794		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS3974.1, CCDS75250.1	5q12.1-q13.2	2013-01-18	2010-06-24		ENSG00000145632	ENSG00000145632			19699	protein-coding gene	gene with protein product	"""serum-inducible kinase"""	607023	"""polo-like kinase 2 (Drosophila)"""				Standard	NM_006622		Approved	SNK	uc003jrn.3	Q9NYY3	OTTHUMG00000097047	ENST00000274289.3:c.1810C>T	5.37:g.57750794G>A	ENSP00000274289:p.Gln604*	Somatic		WXS	Illumina GAIIx	Phase_IV	O60679|Q96CV7|Q9UE61	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_POLO_box_duplicated_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.Q604*	ENST00000274289.3	37	c.1810	CCDS3974.1	5	.	.	.	.	.	.	.	.	.	.	G	40	8.180347	0.98693	.	.	ENSG00000145632	ENST00000274289	.	.	.	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.48119	T	0.1	-19.9784	20.5182	0.99214	0.0:0.0:1.0:0.0	.	.	.	.	X	604	.	ENSP00000274289:Q604X	Q	-	1	0	PLK2	57786551	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.476000	0.97823	2.860000	0.98153	0.655000	0.94253	CAG	PLK2	-	NULL	ENSG00000145632		0.433	PLK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK2	HGNC	protein_coding	OTTHUMT00000214150.1	63	0.00	0	G	NM_006622		57750794	57750794	-1	no_errors	ENST00000274289	ensembl	human	known	69_37n	nonsense	57	16.18	11	SNP	1.000	A
PLXNB2	23654	genome.wustl.edu	37	22	50718176	50718176	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:50718176G>C	ENST00000449103.1	-	27	4412	c.4272C>G	c.(4270-4272)ctC>ctG	p.L1424L	PLXNB2_ENST00000359337.4_Silent_p.L1424L			O15031	PLXB2_HUMAN	plexin B2	1424					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.L1467L(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGGCCTTGAAGAGCTTGTACA	0.632																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											136.0	146.0	143.0					22																	50718176		1906	4112	6018	-	-	-	SO:0001819	synonymous_variant	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.4272C>G	22.37:g.50718176G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.L1424	ENST00000449103.1	37	c.4272	CCDS43035.1	22																																																																																			PLXNB2	-	pfam_Plexin_cytoplasmic_RasGAP_dom,superfamily_Rho_GTPase_activation_prot	ENSG00000196576		0.632	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	50	0.00	0	G	NM_012401		50718176	50718176	-1	no_errors	ENST00000359337	ensembl	human	known	69_37n	silent	56	13.85	9	SNP	0.980	C
PNLIP	5406	genome.wustl.edu	37	10	118306857	118306857	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:118306857G>T	ENST00000369221.2	+	3	126	c.98G>T	c.(97-99)tGg>tTg	p.W33L	PNLIP_ENST00000470562.1_3'UTR	NM_000936.2	NP_000927.1	P16233	LIPP_HUMAN	pancreatic lipase	33					intestinal cholesterol absorption (GO:0030299)|lipid catabolic process (GO:0016042)|lipid digestion (GO:0044241)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)	metal ion binding (GO:0046872)|triglyceride lipase activity (GO:0004806)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(4)|upper_aerodigestive_tract(1)	43				all cancers(201;0.0131)	Glycerol Phenylbutyrate(DB08909)|Orlistat(DB01083)	GACTCCCCATGGTCAGGAATT	0.423																																						dbGAP											0													92.0	89.0	90.0					10																	118306857		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC014309	CCDS7594.1	10q25.3	2012-07-31			ENSG00000175535	ENSG00000175535	3.1.1.3		9155	protein-coding gene	gene with protein product		246600				1783385	Standard	NM_000936		Approved	PL	uc001lcm.3	P16233	OTTHUMG00000019103	ENST00000369221.2:c.98G>T	10.37:g.118306857G>T	ENSP00000358223:p.Trp33Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VSQ2	Missense_Mutation	SNP	pfam_Lipase_N,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pirsf_Lipoprotein_lipase_LIPH,pfscan_LipOase_LH2,prints_Lipase,prints_Lipase_panc	p.W33L	ENST00000369221.2	37	c.98	CCDS7594.1	10	.	.	.	.	.	.	.	.	.	.	G	15.10	2.733621	0.48939	.	.	ENSG00000175535	ENST00000369221	D	0.90261	-2.64	5.12	4.2	0.49525	Lipase, N-terminal (1);	0.177366	0.41294	D	0.000911	D	0.95411	0.8510	M	0.87758	2.905	0.58432	D	0.999993	D	0.89917	1.0	D	0.75020	0.985	D	0.95925	0.8934	10	0.72032	D	0.01	.	13.944	0.64073	0.0:0.0:0.8467:0.1533	.	33	P16233	LIPP_HUMAN	L	33	ENSP00000358223:W33L	ENSP00000358223:W33L	W	+	2	0	PNLIP	118296847	1.000000	0.71417	0.971000	0.41717	0.239000	0.25481	5.567000	0.67378	1.366000	0.46076	0.591000	0.81541	TGG	PNLIP	-	pfam_Lipase_N,pirsf_Lipoprotein_lipase_LIPH,prints_Lipase_panc	ENSG00000175535		0.423	PNLIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNLIP	HGNC	protein_coding	OTTHUMT00000050524.1	38	0.00	0	G	NM_000936		118306857	118306857	+1	no_errors	ENST00000369221	ensembl	human	known	69_37n	missense	19	17.39	4	SNP	1.000	T
POGLUT1	56983	genome.wustl.edu	37	3	119187826	119187826	+	5'UTR	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:119187826C>T	ENST00000295588.4	+	0	42					NM_152305.2	NP_689518.1	Q8NBL1	PGLT1_HUMAN	protein O-glucosyltransferase 1						cardiovascular system development (GO:0072358)|Notch signaling pathway (GO:0007219)|protein O-linked glycosylation (GO:0006493)|regulation of Notch signaling pathway (GO:0008593)	endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	glucosyltransferase activity (GO:0046527)|protein xylosyltransferase activity (GO:0030158)|UDP-glucosyltransferase activity (GO:0035251)			autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|prostate(1)	16						GGCCGCGCTTCCGCCAGCGCC	0.706																																						dbGAP											0													22.0	21.0	21.0					3																	119187826		2194	4272	6466	-	-	-	SO:0001623	5_prime_UTR_variant	0			BC030614	CCDS2988.1	3q13.33	2010-09-29	2010-09-29	2010-09-29	ENSG00000163389	ENSG00000163389			22954	protein-coding gene	gene with protein product	"""KDELC family like 1"""	615618	"""chromosome 3 open reading frame 9"", ""KTEL (Lys-Tyr-Glu-Leu) containing 1"""	C3orf9, KTELC1		16524674	Standard	NM_152305		Approved	MDS010, MGC32995, 9630046K23Rik, MDSRP, hCLP46, KDELCL1, Rumi	uc003ecm.3	Q8NBL1	OTTHUMG00000159379	ENST00000295588.4:c.-43C>T	3.37:g.119187826C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD13|Q53GJ4|Q8N2T1	Missense_Mutation	SNP	pfam_LipoPS_modifying	p.S6F	ENST00000295588.4	37	c.17	CCDS2988.1	3	.	.	.	.	.	.	.	.	.	.	C	13.63	2.294280	0.40594	.	.	ENSG00000163389	ENST00000476573	.	.	.	4.44	1.66	0.24008	.	.	.	.	.	T	0.53769	0.1817	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.42015	-0.9476	4	.	.	.	.	6.3354	0.21292	0.0:0.684:0.0:0.316	.	.	.	.	F	6	.	.	S	+	2	0	POGLUT1	120670516	0.021000	0.18746	0.987000	0.45799	0.858000	0.48976	0.087000	0.14958	0.233000	0.21120	-0.140000	0.14226	TCC	POGLUT1	-	NULL	ENSG00000163389		0.706	POGLUT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POGLUT1	HGNC	protein_coding	OTTHUMT00000355034.2	24	0.00	0	C	NM_152305		119187826	119187826	+1	no_start_codon:pseudogene:no_stop_codon	ENST00000476573	ensembl	human	putative	69_37n	missense	14	22.22	4	SNP	0.995	T
POLA1	5422	genome.wustl.edu	37	X	24735567	24735567	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:24735567G>C	ENST00000379059.3	+	9	864	c.849G>C	c.(847-849)gtG>gtC	p.V283V	POLA1_ENST00000379068.3_Silent_p.V289V	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	283					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	CAGAGGAAGTGAAACAAGAGG	0.473																																						dbGAP											0													112.0	105.0	108.0					X																	24735567		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.849G>C	X.37:g.24735567G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UQ7	Silent	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.V289	ENST00000379059.3	37	c.867	CCDS14214.1	X																																																																																			POLA1	-	tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.473	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	93	0.00	0	G	NM_016937		24735567	24735567	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	silent	67	16.25	13	SNP	0.173	C
POLDIP3	84271	genome.wustl.edu	37	22	42981866	42981866	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:42981866C>T	ENST00000252115.5	-	9	1301	c.1197G>A	c.(1195-1197)ctG>ctA	p.L399L	POLDIP3_ENST00000451060.2_3'UTR|POLDIP3_ENST00000339677.6_Intron|POLDIP3_ENST00000491021.1_5'Flank|POLDIP3_ENST00000348657.2_Silent_p.L370L	NM_032311.3	NP_115687.2	Q9BY77	PDIP3_HUMAN	polymerase (DNA-directed), delta interacting protein 3	399					poly(A)+ mRNA export from nucleus (GO:0016973)|positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	16						AGAGTGCCTTCAGGATGGTGT	0.587																																					Ovarian(52;967 1128 5875 19997 42537)	dbGAP											0													94.0	90.0	91.0					22																	42981866		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS14038.1, CCDS14039.1, CCDS74873.1	22q13.31	2013-02-12			ENSG00000100227	ENSG00000100227		"""RNA binding motif (RRM) containing"""	23782	protein-coding gene	gene with protein product		611520				12522211	Standard	NM_032311		Approved	PDIP46, KIAA1649	uc003bcu.3	Q9BY77	OTTHUMG00000150887	ENST00000252115.5:c.1197G>A	22.37:g.42981866C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F8|A8K6V9|Q009A7|Q5H972|Q6PGN6|Q7Z6Z0|Q9NSP5|Q9NSP6	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L399	ENST00000252115.5	37	c.1197	CCDS14038.1	22																																																																																			POLDIP3	-	NULL	ENSG00000100227		0.587	POLDIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLDIP3	HGNC	protein_coding	OTTHUMT00000320433.1	42	0.00	0	C	NM_032311		42981866	42981866	-1	no_errors	ENST00000252115	ensembl	human	known	69_37n	silent	47	17.54	10	SNP	1.000	T
POMGNT1	55624	genome.wustl.edu	37	1	46662733	46662733	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:46662733C>T	ENST00000371984.3	-	3	301	c.144G>A	c.(142-144)ctG>ctA	p.L48L	POMGNT1_ENST00000535522.1_Silent_p.L26L|POMGNT1_ENST00000396420.3_Silent_p.L48L|POMGNT1_ENST00000371986.3_Silent_p.L48L|POMGNT1_ENST00000371992.1_Silent_p.L48L	NM_017739.3	NP_060209	Q8WZA1	PMGT1_HUMAN	protein O-linked mannose N-acetylglucosaminyltransferase 1 (beta 1,2-)	48					protein O-linked glycosylation (GO:0006493)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)			breast(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(3)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(166;0.155)					TGACAGTCACCAGCAGGAAAA	0.537																																						dbGAP											0													162.0	170.0	167.0					1																	46662733		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS531.1, CCDS57995.1	1p34.1	2014-09-17	2013-07-31		ENSG00000085998	ENSG00000085998	2.4.1.-	"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	19139	protein-coding gene	gene with protein product	"""protein O-mannose beta-1,2-N-acetylglucosaminyltransferase"""	606822	"""muscle-eye-brain disease"", ""protein O-linked mannose beta1,2-N-acetylglucosaminyltransferase"""	MEB		11742540, 12788071	Standard	NM_017739		Approved	FLJ20277, MGAT1.2, LGMD2O	uc001cpg.3	Q8WZA1	OTTHUMG00000007604	ENST00000371984.3:c.144G>A	1.37:g.46662733C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ16|Q5VST2|Q5VST3|Q9BV55|Q9H9L8|Q9NXF9|Q9NYF7	Silent	SNP	pfam_Glyco_trans_13	p.L48	ENST00000371984.3	37	c.144	CCDS531.1	1																																																																																			POMGNT1	-	NULL	ENSG00000085998		0.537	POMGNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMGNT1	HGNC	protein_coding	OTTHUMT00000020146.1	34	0.00	0	C	NM_017739		46662733	46662733	-1	no_errors	ENST00000371986	ensembl	human	known	69_37n	silent	32	20.00	8	SNP	1.000	T
POTEI	653269	genome.wustl.edu	37	2	131266543	131266543	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:131266543G>C	ENST00000451531.2	-	1	696	c.266C>G	c.(265-267)tCc>tGc	p.S89C		NM_001277406.1	NP_001264335.1	P0CG38	POTEI_HUMAN	POTE ankyrin domain family, member I	89					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				lung(11)	11						CTTCATAGCGGAGTCGTCGTG	0.622																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS59431.1	2q21.1	2013-01-10			ENSG00000196834	ENSG00000196834		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37093	protein-coding gene	gene with protein product						16364570	Standard	NM_001277406		Approved	POTE2beta	uc031rpa.1	P0CG38	OTTHUMG00000153925	ENST00000451531.2:c.266C>G	2.37:g.131266543G>C	ENSP00000392718:p.Ser89Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S89C	ENST00000451531.2	37	c.266	CCDS59431.1	2	.	.	.	.	.	.	.	.	.	.	.	9.893	1.204682	0.22205	.	.	ENSG00000196834	ENST00000451531	T	0.78924	-1.22	0.7	-0.484	0.12071	.	.	.	.	.	T	0.75781	0.3896	L	0.61218	1.895	0.09310	N	1	.	.	.	.	.	.	T	0.67393	-0.5682	6	0.87932	D	0	.	.	.	.	.	.	.	.	C	89	ENSP00000392718:S89C	ENSP00000392718:S89C	S	-	2	0	POTEI	130983013	0.002000	0.14202	0.001000	0.08648	0.013000	0.08279	-0.194000	0.09559	-0.223000	0.09943	0.184000	0.17185	TCC	POTEI	-	NULL	ENSG00000196834		0.622	POTEI-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEI	HGNC	protein_coding	OTTHUMT00000333222.2	84	0.00	0	G	XM_928585		131266543	131266543	-1	no_errors	ENST00000451531	ensembl	human	novel	69_37n	missense	38	19.15	9	SNP	0.001	C
PPA2	27068	genome.wustl.edu	37	4	106317458	106317458	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:106317458G>C	ENST00000341695.5	-	9	847	c.817C>G	c.(817-819)Caa>Gaa	p.Q273E	PPA2_ENST00000357415.4_Missense_Mutation_p.Q288E|PPA2_ENST00000509426.1_5'Flank|PPA2_ENST00000354147.3_Missense_Mutation_p.Q107E|PPA2_ENST00000348706.5_Missense_Mutation_p.Q244E|PPA2_ENST00000380004.2_Missense_Mutation_p.Q255E|PPA2_ENST00000432483.2_Missense_Mutation_p.Q171E	NM_176869.2	NP_789845.1	Q9H2U2	IPYR2_HUMAN	pyrophosphatase (inorganic) 2	273					diphosphate metabolic process (GO:0071344)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)	inorganic diphosphatase activity (GO:0004427)|magnesium ion binding (GO:0000287)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|pancreas(1)	11		Myeloproliferative disorder(5;0.0255)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;2.03e-07)		TTCCAACATTGATGAGTGGAT	0.294																																						dbGAP											0													97.0	91.0	93.0					4																	106317458		2203	4297	6500	-	-	-	SO:0001583	missense	0				CCDS3667.1, CCDS3668.2, CCDS3669.2, CCDS34043.1	4q25	2005-10-07			ENSG00000138777	ENSG00000138777			28883	protein-coding gene	gene with protein product		609988				11042152	Standard	NM_176869		Approved	FLJ20459	uc003hxl.3	Q9H2U2	OTTHUMG00000128781	ENST00000341695.5:c.817C>G	4.37:g.106317458G>C	ENSP00000343885:p.Gln273Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLP7|F8WDN9|I6L9B6|Q4W5E9|Q6PG51|Q8TBW0|Q96E55|Q9H0T0|Q9NX37|Q9P033|Q9ULX0	Missense_Mutation	SNP	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	p.Q288E	ENST00000341695.5	37	c.862	CCDS3667.1	4	.	.	.	.	.	.	.	.	.	.	G	2.666	-0.278622	0.05679	.	.	ENSG00000138777	ENST00000341695;ENST00000348706;ENST00000354147;ENST00000432483;ENST00000357415;ENST00000380004	T;T;T;T;T;T	0.37058	1.22;1.22;1.22;1.22;1.22;1.22	5.93	3.91	0.45181	.	0.536654	0.21599	N	0.071965	T	0.09949	0.0244	N	0.00510	-1.415	0.80722	D	1	B;B;B;B;B	0.10296	0.003;0.003;0.0;0.0;0.0	B;B;B;B;B	0.09377	0.001;0.004;0.001;0.0;0.002	T	0.26985	-1.0087	10	0.02654	T	1	-18.6674	12.659	0.56803	0.0:0.802:0.1251:0.073	.	107;171;244;255;273	Q9H2U2-4;F8WDN9;Q9H2U2-3;E2QRM6;Q9H2U2	.;.;.;.;IPYR2_HUMAN	E	273;244;107;171;288;255	ENSP00000343885:Q273E;ENSP00000313061:Q244E;ENSP00000340352:Q107E;ENSP00000389957:Q171E;ENSP00000349996:Q288E;ENSP00000369340:Q255E	ENSP00000343885:Q273E	Q	-	1	0	PPA2	106536907	0.835000	0.29415	0.968000	0.41197	0.989000	0.77384	0.968000	0.29357	1.501000	0.48654	-0.165000	0.13383	CAA	PPA2	-	pfam_Pyrophosphatase,superfamily_Pyrophosphatase	ENSG00000138777		0.294	PPA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPA2	HGNC	protein_coding	OTTHUMT00000250704.4	42	0.00	0	G	NM_176869		106317458	106317458	-1	no_errors	ENST00000357415	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.985	C
PPP1R3A	5506	genome.wustl.edu	37	7	113522199	113522199	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:113522199G>A	ENST00000284601.3	-	3	929	c.861C>T	c.(859-861)atC>atT	p.I287I		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	287					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						GAGAACAAATGATTGTTGGGA	0.299																																						dbGAP											0													121.0	108.0	112.0					7																	113522199		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.861C>T	7.37:g.113522199G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Silent	SNP	pfam_CBM_21,pfscan_CBM_21	p.I287	ENST00000284601.3	37	c.861	CCDS5759.1	7																																																																																			PPP1R3A	-	NULL	ENSG00000154415		0.299	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	110	0.00	0	G	NM_002711		113522199	113522199	-1	no_errors	ENST00000284601	ensembl	human	known	69_37n	silent	90	18.75	21	SNP	0.063	A
PPP2CA	5515	genome.wustl.edu	37	5	133533504	133533504	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:133533504C>T	ENST00000481195.1	-	7	1169	c.889G>A	c.(889-891)Gag>Aag	p.E297K	CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	297					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	ACATGTGGCTCGCCTCTACGA	0.433																																						dbGAP											0													80.0	81.0	81.0					5																	133533504		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.889G>A	5.37:g.133533504C>T	ENSP00000418447:p.Glu297Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P05323|P13197	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.E297K	ENST00000481195.1	37	c.889	CCDS4173.1	5	.	.	.	.	.	.	.	.	.	.	c	20.6	4.014839	0.75161	.	.	ENSG00000113575	ENST00000481195	T	0.13657	2.57	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	T	0.19525	0.0469	L	0.55017	1.72	0.80722	D	1	B	0.13594	0.008	B	0.04013	0.001	T	0.01706	-1.1291	10	0.72032	D	0.01	-9.1128	20.4216	0.99039	0.0:1.0:0.0:0.0	.	297	P67775	PP2AA_HUMAN	K	297	ENSP00000418447:E297K	ENSP00000418447:E297K	E	-	1	0	PPP2CA	133561403	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.407000	0.80029	2.839000	0.97877	0.580000	0.79431	GAG	PPP2CA	-	NULL	ENSG00000113575		0.433	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CA	HGNC	protein_coding	OTTHUMT00000251165.1	33	0.00	0	C	NM_002715		133533504	133533504	-1	no_errors	ENST00000481195	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	1.000	T
SIK2	23235	genome.wustl.edu	37	11	111597694	111597694	+	3'UTR	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:111597694C>G	ENST00000304987.3	+	0	5795				PPP2R1B_ENST00000311129.5_Missense_Mutation_p.D667H|PPP2R1B_ENST00000426998.2_Missense_Mutation_p.D603H|PPP2R1B_ENST00000530787.1_5'UTR	NM_015191.1	NP_056006.1	Q9H0K1	SIK2_HUMAN	salt-inducible kinase 2						insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of insulin receptor signaling pathway (GO:0046626)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(3)	30						GGGTATTAGTCTGTGCTTTGG	0.413																																						dbGAP											0													118.0	117.0	118.0					11																	111597694		2201	4297	6498	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB018324	CCDS8347.1	11q23.1	2008-12-23	2008-12-23	2008-12-23	ENSG00000170145	ENSG00000170145			21680	protein-coding gene	gene with protein product		608973	"""SNF1-like kinase 2"""	SNF1LK2		15067358	Standard	NM_015191		Approved	KIAA0781, QIK, DKFZp434K1115, LOH11CR1I	uc001plt.3	Q9H0K1	OTTHUMG00000150644	ENST00000304987.3:c.*2841C>G	11.37:g.111597694C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5B8|B0YJ94|O94878|Q17RV0|Q6AZE2|Q76N03|Q8NCV7|Q96CZ8	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.D667H	ENST00000304987.3	37	c.1999	CCDS8347.1	11	.	.	.	.	.	.	.	.	.	.	C	12.92	2.081543	0.36758	.	.	ENSG00000137713	ENST00000311129;ENST00000426998	.	.	.	5.5	2.45	0.29901	.	0.581322	0.16130	N	0.228241	T	0.28830	0.0715	N	0.08118	0	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.06405	0.0;0.002	T	0.10497	-1.0627	9	0.87932	D	0	.	5.6557	0.17640	0.1413:0.6448:0.1368:0.077	.	603;667	B4DWW5;P30154-2	.;.	H	667;603	.	ENSP00000311344:D667H	D	-	1	0	PPP2R1B	111102904	1.000000	0.71417	0.833000	0.33012	0.728000	0.41692	2.425000	0.44723	0.830000	0.34757	0.555000	0.69702	GAC	PPP2R1B	-	NULL	ENSG00000137713		0.413	SIK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R1B	HGNC	protein_coding	OTTHUMT00000319352.3	72	0.00	0	C	NM_015191		111597694	111597694	-1	no_errors	ENST00000311129	ensembl	human	known	69_37n	missense	68	23.60	21	SNP	0.956	G
PRDM9	56979	genome.wustl.edu	37	5	23522825	23522825	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:23522825C>T	ENST00000296682.3	+	8	895	c.713C>T	c.(712-714)tCa>tTa	p.S238L		NM_020227.2	NP_064612.2	Q9NQV7	PRDM9_HUMAN	PR domain containing 9	238					meiotic gene conversion (GO:0006311)|positive regulation of meiosis I (GO:0060903)|positive regulation of reciprocal meiotic recombination (GO:0010845)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|metal ion binding (GO:0046872)|recombination hotspot binding (GO:0010844)|sequence-specific DNA binding (GO:0043565)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(27)|lung(87)|ovary(6)|pancreas(2)|prostate(4)|skin(10)|upper_aerodigestive_tract(11)	172						CCCAACCGTTCAGCCCTCAGT	0.572										HNSCC(3;0.000094)																												dbGAP											0													54.0	52.0	53.0					5																	23522825		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF275816	CCDS43307.1	5p14.2	2014-06-03			ENSG00000164256	ENSG00000164256		"""-"", ""Zinc fingers, C2H2-type"""	13994	protein-coding gene	gene with protein product	"""PR-domain containing protein 9"""	609760	"""minisatellite binding protein 3, 115kDa"", ""minisatellite binding protein 3 (115kD)"""	MSBP3		10668202, 2062643, 24634223	Standard	NM_020227		Approved	PFM6, ZNF899	uc003jgo.3	Q9NQV7	OTTHUMG00000161918	ENST00000296682.3:c.713C>T	5.37:g.23522825C>T	ENSP00000296682:p.Ser238Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DX22|Q27Q50	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_SSXRD_motif,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_SET_dom,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Krueppel-associated_box-rel	p.S238L	ENST00000296682.3	37	c.713	CCDS43307.1	5	.	.	.	.	.	.	.	.	.	.	C	14.74	2.624428	0.46840	.	.	ENSG00000164256	ENST00000296682;ENST00000253473	T	0.41400	1.0	4.28	4.28	0.50868	.	0.000000	0.28847	N	0.013942	T	0.35364	0.0929	L	0.49126	1.545	0.39129	D	0.961827	P	0.37781	0.608	B	0.32090	0.14	T	0.47394	-0.9121	10	0.87932	D	0	-4.8864	12.6273	0.56636	0.0:1.0:0.0:0.0	.	238	Q9NQV7	PRDM9_HUMAN	L	238;32	ENSP00000296682:S238L	ENSP00000253473:S32L	S	+	2	0	PRDM9	23558582	0.599000	0.26891	0.246000	0.24233	0.439000	0.31926	3.662000	0.54510	2.095000	0.63458	0.597000	0.82753	TCA	PRDM9	-	NULL	ENSG00000164256		0.572	PRDM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM9	HGNC	protein_coding	OTTHUMT00000366375.1	55	0.00	0	C	NM_020227		23522825	23522825	+1	no_errors	ENST00000296682	ensembl	human	known	69_37n	missense	68	10.39	8	SNP	0.990	T
PRKAR2A	5576	genome.wustl.edu	37	3	48793865	48793865	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:48793865C>G	ENST00000265563.8	-	9	1135	c.886G>C	c.(886-888)Gat>Cat	p.D296H	PRKAR2A_ENST00000296446.8_Intron|PRKAR2A_ENST00000454963.1_Missense_Mutation_p.D296H	NM_004157.2	NP_004148.1	P13861	KAP2_HUMAN	protein kinase, cAMP-dependent, regulatory, type II, alpha	296					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|blood coagulation (GO:0007596)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|negative regulation of cAMP-dependent protein kinase activity (GO:2000480)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	AMP-activated protein kinase complex (GO:0031588)|cAMP-dependent protein kinase complex (GO:0005952)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|protein kinase A catalytic subunit binding (GO:0034236)|ubiquitin protein ligase binding (GO:0031625)		SLC26A6/PRKAR2A(2)	breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	6				BRCA - Breast invasive adenocarcinoma(193;0.000176)|Kidney(197;0.00246)|KIRC - Kidney renal clear cell carcinoma(197;0.00261)		TAAAAGCTATCAGCCTTTTCA	0.388																																						dbGAP											0													126.0	116.0	119.0					3																	48793865		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2778.1	3p21.3-p21.2	2009-07-10			ENSG00000114302	ENSG00000114302	2.7.11.1		9391	protein-coding gene	gene with protein product		176910		PRKAR2		9676433	Standard	NM_004157		Approved		uc003cux.1	P13861	OTTHUMG00000133540	ENST00000265563.8:c.886G>C	3.37:g.48793865C>G	ENSP00000265563:p.Asp296His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16823|Q9BUB1	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_cAMP_dep_PK_reg_su_I/II_a/b,superfamily_cNMP-bd-like,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,smart_cAMP_dep_PK_reg_su_I/II_a/b,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom,prints_cAMP/cGMP_kin	p.D296H	ENST00000265563.8	37	c.886	CCDS2778.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.51|18.51	3.639183|3.639183	0.67244|0.67244	.|.	.|.	ENSG00000114302|ENSG00000114302	ENST00000265563;ENST00000454963|ENST00000438535	T;T|.	0.54279|.	0.58;0.58|.	4.78|4.78	4.78|4.78	0.61160|0.61160	Cyclic nucleotide-binding, conserved site (1);Cyclic nucleotide-binding-like (1);RmlC-like jelly roll fold (1);Cyclic nucleotide-binding domain (3);|.	0.054541|.	0.64402|.	D|.	0.000002|.	D|.	0.83036|.	0.5167|.	M|M	0.87758|0.87758	2.905|2.905	0.80722|0.80722	D|D	1|1	P|.	0.45531|.	0.86|.	P|.	0.49332|.	0.607|.	D|.	0.85759|.	0.1348|.	10|.	0.59425|.	D|.	0.04|.	-3.2906|-3.2906	18.0035|18.0035	0.89203|0.89203	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	296|.	P13861|.	KAP2_HUMAN|.	H|S	296|64	ENSP00000265563:D296H;ENSP00000394041:D296H|.	ENSP00000265563:D296H|.	D|X	-|-	1|2	0|2	PRKAR2A|PRKAR2A	48768869|48768869	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	5.934000|5.934000	0.70138|0.70138	2.483000|2.483000	0.83821|0.83821	0.563000|0.563000	0.77884|0.77884	GAT|TGA	PRKAR2A	-	pfam_cNMP-bd_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pirsf_cAMP_dep_PK_reg_su,pfscan_cNMP-bd_dom	ENSG00000114302		0.388	PRKAR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAR2A	HGNC	protein_coding	OTTHUMT00000257518.1	95	0.00	0	C			48793865	48793865	-1	no_errors	ENST00000265563	ensembl	human	known	69_37n	missense	83	16.16	16	SNP	1.000	G
PRMT3	10196	genome.wustl.edu	37	11	20414539	20414539	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:20414539C>T	ENST00000331079.6	+	5	611	c.394C>T	c.(394-396)Caa>Taa	p.Q132*	PRMT3_ENST00000437750.2_Nonsense_Mutation_p.Q70*	NM_001145167.1|NM_005788.3	NP_001138639.1|NP_005779	O60678	ANM3_HUMAN	protein arginine methyltransferase 3	132					histone arginine methylation (GO:0034969)|negative regulation of protein ubiquitination (GO:0031397)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|ribosome (GO:0005840)	histone-arginine N-methyltransferase activity (GO:0008469)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)|modified amino acid binding (GO:0072341)|protein-arginine N-methyltransferase activity (GO:0016274)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|prostate(1)	17						CCTTTTACTTCAATTTGGTAA	0.368																																						dbGAP											0													141.0	143.0	143.0					11																	20414539		2203	4299	6502	-	-	-	SO:0001587	stop_gained	0			AF059531	CCDS7853.1, CCDS44554.1	11p15.1	2008-02-05	2006-02-16	2006-02-16	ENSG00000185238	ENSG00000185238		"""Protein arginine methyltransferases"""	30163	protein-coding gene	gene with protein product		603190	"""HMT1 hnRNP methyltransferase-like 3 (S. cerevisiae)"""	HRMT1L3		9642256	Standard	NM_005788		Approved		uc001mqb.3	O60678	OTTHUMG00000166022	ENST00000331079.6:c.394C>T	11.37:g.20414539C>T	ENSP00000331879:p.Gln132*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DUC7	Nonsense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_tRNA_mo5U34_MeTrfase,pfam_Methyltransf_11,pfam_Arg_MeTrfase,pfam_Small_mtfrase_dom,pfam_tRNA_Trfase_Trm5/Tyw2	p.Q132*	ENST00000331079.6	37	c.394	CCDS7853.1	11	.	.	.	.	.	.	.	.	.	.	C	35	5.417578	0.96092	.	.	ENSG00000185238	ENST00000331079;ENST00000541255;ENST00000437750	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	-16.353	19.6715	0.95914	0.0:1.0:0.0:0.0	.	.	.	.	X	132;132;70	.	ENSP00000331879:Q132X	Q	+	1	0	PRMT3	20371115	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.610000	0.74178	2.809000	0.96659	0.650000	0.86243	CAA	PRMT3	-	NULL	ENSG00000185238		0.368	PRMT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT3	HGNC	protein_coding	OTTHUMT00000387489.1	55	0.00	0	C	NM_005788		20414539	20414539	+1	no_errors	ENST00000331079	ensembl	human	known	69_37n	nonsense	64	12.33	9	SNP	1.000	T
PRSS35	167681	genome.wustl.edu	37	6	84233644	84233644	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:84233644C>T	ENST00000369700.3	+	2	661	c.484C>T	c.(484-486)Cag>Tag	p.Q162*	PRSS35_ENST00000536636.1_Nonsense_Mutation_p.Q162*	NM_153362.2	NP_699193.2	Q8N3Z0	PRS35_HUMAN	protease, serine, 35	162	Peptidase S1.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(2)|large_intestine(12)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	32		all_cancers(76;0.000113)|Acute lymphoblastic leukemia(125;1.09e-08)|all_hematologic(105;3.12e-05)|all_epithelial(107;0.0575)		BRCA - Breast invasive adenocarcinoma(397;0.0768)		CATTTCCCCTCAGCATGTTCT	0.453																																						dbGAP											0													107.0	108.0	108.0					6																	84233644		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC037170	CCDS4999.1	6q14.2	2010-05-12	2004-07-09	2004-07-09	ENSG00000146250	ENSG00000146250		"""Serine peptidases / Serine peptidases"""	21387	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 158"""	C6orf158			Standard	NM_153362		Approved	MGC46520, dJ223E3.1	uc003pjz.3	Q8N3Z0	OTTHUMG00000015113	ENST00000369700.3:c.484C>T	6.37:g.84233644C>T	ENSP00000358714:p.Gln162*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7B3|Q9BQP6	Nonsense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.Q162*	ENST00000369700.3	37	c.484	CCDS4999.1	6	.	.	.	.	.	.	.	.	.	.	C	13.42	2.232062	0.39399	.	.	ENSG00000146250	ENST00000536636;ENST00000369700	.	.	.	5.78	1.98	0.26296	.	0.623886	0.16759	N	0.200702	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-13.4152	14.2194	0.65815	0.547:0.453:0.0:0.0	.	.	.	.	X	162	.	ENSP00000358714:Q162X	Q	+	1	0	PRSS35	84290363	0.144000	0.22641	0.000000	0.03702	0.079000	0.17450	3.960000	0.56752	0.085000	0.17107	0.561000	0.74099	CAG	PRSS35	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	ENSG00000146250		0.453	PRSS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRSS35	HGNC	protein_coding	OTTHUMT00000041352.1	45	0.00	0	C	NM_153362		84233644	84233644	+1	no_errors	ENST00000369700	ensembl	human	known	69_37n	nonsense	51	12.07	7	SNP	0.005	T
PRUNE2	158471	genome.wustl.edu	37	9	79441592	79441592	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:79441592C>T	ENST00000376718.3	-	5	688	c.565G>A	c.(565-567)Gag>Aag	p.E189K	PRUNE2_ENST00000428286.1_5'UTR|PRUNE2_ENST00000376713.3_Missense_Mutation_p.E189K	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	189					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						AGAATTTCCTCCTGCTTCTCT	0.428																																						dbGAP											0													94.0	93.0	94.0					9																	79441592		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.565G>A	9.37:g.79441592C>T	ENSP00000365908:p.Glu189Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,pfam_DHHA2,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.E189K	ENST00000376718.3	37	c.565	CCDS47982.1	9	.	.	.	.	.	.	.	.	.	.	C	18.43	3.621692	0.66787	.	.	ENSG00000106772	ENST00000376718;ENST00000422033;ENST00000376713	T;T	0.14893	2.47;2.47	5.67	5.67	0.87782	.	0.325334	0.27896	N	0.017406	T	0.30230	0.0758	L	0.41824	1.3	0.80722	D	1	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.985	T	0.01617	-1.1311	10	0.05721	T	0.95	.	17.9504	0.89051	0.0:1.0:0.0:0.0	.	189;189	Q8WUY3;D6RTK6	PRUN2_HUMAN;.	K	189;188;189	ENSP00000365908:E189K;ENSP00000365903:E189K	ENSP00000365903:E189K	E	-	1	0	PRUNE2	78631412	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.903000	0.63272	2.680000	0.91292	0.563000	0.77884	GAG	PRUNE2	-	NULL	ENSG00000106772		0.428	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	52	0.00	0	C	NM_138818		79441592	79441592	-1	no_errors	ENST00000376718	ensembl	human	novel	69_37n	missense	30	20.51	8	SNP	1.000	T
PTCHD2	57540	genome.wustl.edu	37	1	11596435	11596435	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:11596435G>A	ENST00000294484.6	+	21	4009	c.3871G>A	c.(3871-3873)Gtg>Atg	p.V1291M	PTCHD2_ENST00000304391.6_Missense_Mutation_p.R177H|PTCHD2_ENST00000389575.3_Missense_Mutation_p.V1291M	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	1291					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GCACGTGGGCGTGGCCATCGT	0.667																																						dbGAP											0													80.0	83.0	82.0					1																	11596435		2197	4276	6473	-	-	-	SO:0001583	missense	0			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.3871G>A	1.37:g.11596435G>A	ENSP00000294484:p.Val1291Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTU9|Q9UJD6	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.V1291M	ENST00000294484.6	37	c.3871	CCDS41247.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.4|21.4	4.149461|4.149461	0.78001|0.78001	.|.	.|.	ENSG00000204624|ENSG00000204624	ENST00000304391|ENST00000294484;ENST00000389575	.|D;D	.|0.91945	.|-2.94;-1.92	4.89|4.89	4.89|4.89	0.63831|0.63831	.|Membrane transport protein, MMPL type (1);	.|0.000000	.|0.64402	.|D	.|0.000005	D|D	0.94265|0.94265	0.8158|0.8158	L|L	0.47716|0.47716	1.5|1.5	0.58432|0.58432	D|D	0.999994|0.999994	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	D|D	0.93421|0.93421	0.6777|0.6777	6|10	0.87932|0.34782	D|T	0|0.22	-26.0944|-26.0944	17.0791|17.0791	0.86593|0.86593	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1291	.|Q9P2K9	.|PTHD2_HUMAN	H|M	177|1291	.|ENSP00000294484:V1291M;ENSP00000374226:V1291M	ENSP00000303400:R177H|ENSP00000294484:V1291M	R|V	+|+	2|1	0|0	PTCHD2|PTCHD2	11519022|11519022	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.989000|0.989000	0.77384|0.77384	6.270000|6.270000	0.72563|0.72563	2.256000|2.256000	0.74724|0.74724	0.655000|0.655000	0.94253|0.94253	CGT|GTG	PTCHD2	-	pfam_Patched,pfam_MMPL-typ	ENSG00000204624		0.667	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	39	0.00	0	G	XM_052561		11596435	11596435	+1	no_errors	ENST00000294484	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	A
PTER	9317	genome.wustl.edu	37	10	16547122	16547122	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:16547122G>C	ENST00000378000.1	+	5	1048	c.802G>C	c.(802-804)Gat>Cat	p.D268H	PTER_ENST00000298942.3_Missense_Mutation_p.D268H|PTER_ENST00000423462.2_Intron|PTER_ENST00000535784.2_Missense_Mutation_p.D268H	NM_001001484.2|NM_001261838.1|NM_030664.4	NP_001001484.1|NP_001248767.1|NP_109589.2	Q96BW5	PTER_HUMAN	phosphotriesterase related	268					catabolic process (GO:0009056)|epithelial cell differentiation (GO:0030855)	extracellular vesicular exosome (GO:0070062)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(2)	15						ACTCGGCCCAGATATTGACAT	0.383																																					Ovarian(2;46 150 15648 38137 47908)	dbGAP											0													157.0	152.0	154.0					10																	16547122		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC015092	CCDS7111.1, CCDS58070.1, CCDS73070.1	10p12	2003-11-05			ENSG00000165983	ENSG00000165983			9590	protein-coding gene	gene with protein product		604446				9925913	Standard	NM_001001484		Approved		uc001ioi.2	Q96BW5	OTTHUMG00000017737	ENST00000378000.1:c.802G>C	10.37:g.16547122G>C	ENSP00000367239:p.Asp268His	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ77|B3KTF5|D3DRU0|Q9BY46	Missense_Mutation	SNP	pfam_Aryldialkylphosphatase,pfam_TatD_superfamily	p.D268H	ENST00000378000.1	37	c.802	CCDS7111.1	10	.	.	.	.	.	.	.	.	.	.	G	15.78	2.934517	0.52866	.	.	ENSG00000165983	ENST00000343656;ENST00000535784;ENST00000378000;ENST00000298942	T;T;T	0.46819	0.86;0.86;0.86	5.11	5.11	0.69529	.	0.290315	0.40144	N	0.001180	T	0.64605	0.2613	M	0.71581	2.175	0.46901	D	0.999246	P	0.40197	0.706	P	0.53062	0.717	T	0.63161	-0.6699	10	0.42905	T	0.14	-13.74	18.9747	0.92731	0.0:0.0:1.0:0.0	.	268	Q96BW5	PTER_HUMAN	H	268	ENSP00000439485:D268H;ENSP00000367239:D268H;ENSP00000298942:D268H	ENSP00000298942:D268H	D	+	1	0	PTER	16587128	1.000000	0.71417	0.952000	0.39060	0.347000	0.29111	4.080000	0.57620	2.569000	0.86673	0.556000	0.70494	GAT	PTER	-	pfam_Aryldialkylphosphatase	ENSG00000165983		0.383	PTER-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PTER	HGNC	protein_coding	OTTHUMT00000047001.2	93	0.00	0	G	NM_030664		16547122	16547122	+1	no_errors	ENST00000298942	ensembl	human	known	69_37n	missense	70	18.60	16	SNP	0.982	C
PTEN	5728	genome.wustl.edu	37	10	89720709	89720709	+	Nonsense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:89720709C>G	ENST00000371953.3	+	8	2217	c.860C>G	c.(859-861)tCa>tGa	p.S287*	PTEN_ENST00000472832.1_3'UTR	NM_000314.4	NP_000305.3	P60484	PTEN_HUMAN	phosphatase and tensin homolog	287	C2 tensin-type. {ECO:0000255|PROSITE- ProRule:PRU00589}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|aging (GO:0007568)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|brain morphogenesis (GO:0048854)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle tissue development (GO:0048738)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|central nervous system development (GO:0007417)|central nervous system myelin maintenance (GO:0032286)|central nervous system neuron axonogenesis (GO:0021955)|dendritic spine morphogenesis (GO:0060997)|dentate gyrus development (GO:0021542)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|innate immune response (GO:0045087)|inositol phosphate dephosphorylation (GO:0046855)|inositol phosphate metabolic process (GO:0043647)|learning or memory (GO:0007611)|locomotor rhythm (GO:0045475)|locomotory behavior (GO:0007626)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|male mating behavior (GO:0060179)|maternal behavior (GO:0042711)|memory (GO:0007613)|multicellular organismal response to stress (GO:0033555)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell aging (GO:0090344)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell size (GO:0045792)|negative regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031658)|negative regulation of dendritic spine morphogenesis (GO:0061002)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of myelination (GO:0031642)|negative regulation of organ growth (GO:0046621)|negative regulation of phagocytosis (GO:0050765)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of ribosome biogenesis (GO:0090071)|negative regulation of synaptic vesicle clustering (GO:2000808)|neuron-neuron synaptic transmission (GO:0007270)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell proliferation (GO:0008284)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|postsynaptic density assembly (GO:0097107)|prepulse inhibition (GO:0060134)|presynaptic membrane assembly (GO:0097105)|prostate gland growth (GO:0060736)|protein dephosphorylation (GO:0006470)|protein kinase B signaling (GO:0043491)|protein stabilization (GO:0050821)|regulation of B cell apoptotic process (GO:0002902)|regulation of cellular component size (GO:0032535)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of neuron projection development (GO:0010975)|regulation of protein stability (GO:0031647)|response to arsenic-containing substance (GO:0046685)|response to ATP (GO:0033198)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to glucose (GO:0009749)|response to nutrient (GO:0007584)|response to zinc ion (GO:0010043)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse maturation (GO:0060074)|T cell receptor signaling pathway (GO:0050852)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)|myelin sheath adaxonal region (GO:0035749)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)	anaphase-promoting complex binding (GO:0010997)|enzyme binding (GO:0019899)|inositol-1,3,4,5-tetrakisphosphate 3-phosphatase activity (GO:0051717)|lipid binding (GO:0008289)|magnesium ion binding (GO:0000287)|PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4,5-trisphosphate 3-phosphatase activity (GO:0016314)|phosphatidylinositol-3,4-bisphosphate 3-phosphatase activity (GO:0051800)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphoprotein phosphatase activity (GO:0004721)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.0?(37)|p.R55fs*1(5)|p.?(2)|p.N212fs*1(2)|p.Y27fs*1(2)|p.G165_*404del(1)|p.S287fs*8(1)|p.W274_F341del(1)|p.S287fs*1(1)|p.S287*(1)		NS(28)|autonomic_ganglia(2)|biliary_tract(6)|bone(5)|breast(92)|central_nervous_system(676)|cervix(26)|endometrium(1068)|eye(8)|haematopoietic_and_lymphoid_tissue(137)|kidney(24)|large_intestine(98)|liver(20)|lung(91)|meninges(2)|oesophagus(2)|ovary(82)|pancreas(6)|prostate(129)|salivary_gland(5)|skin(127)|soft_tissue(19)|stomach(30)|testis(1)|thyroid(29)|upper_aerodigestive_tract(29)|urinary_tract(12)|vulva(17)	2771		all_cancers(4;3.61e-31)|all_epithelial(4;3.96e-23)|Prostate(4;8.12e-23)|Breast(4;0.000111)|Melanoma(5;0.00146)|all_hematologic(4;0.00227)|Colorectal(252;0.00494)|all_neural(4;0.00513)|Acute lymphoblastic leukemia(4;0.0116)|Glioma(4;0.0274)|all_lung(38;0.132)	KIRC - Kidney renal clear cell carcinoma(1;0.214)	UCEC - Uterine corpus endometrioid carcinoma (6;0.000228)|all cancers(1;4.16e-84)|GBM - Glioblastoma multiforme(1;7.77e-49)|Epithelial(1;7.67e-41)|OV - Ovarian serous cystadenocarcinoma(1;6.22e-15)|BRCA - Breast invasive adenocarcinoma(1;1.1e-06)|Lung(2;3.18e-06)|Colorectal(12;4.88e-06)|LUSC - Lung squamous cell carcinoma(2;4.97e-06)|COAD - Colon adenocarcinoma(12;1.13e-05)|Kidney(1;0.000288)|KIRC - Kidney renal clear cell carcinoma(1;0.00037)|STAD - Stomach adenocarcinoma(243;0.218)		GAGGAAACCTCAGAAAAAGTA	0.313		31	"""D, Mis, N, F, S"""		"""glioma,  prostate, endometrial"""	"""harmartoma, glioma,  prostate, endometrial"""			Proteus syndrome;Juvenile Polyposis;Hereditary Mixed Polyposis Syndrome type 1;Cowden syndrome;Bannayan-Riley-Ruvalcaba syndrome	HNSCC(9;0.0022)|TCGA GBM(2;<1E-08)|TSP Lung(26;0.18)																												dbGAP	yes	Rec	yes	"""Cowden Syndrome, Bannayan-Riley-Ruvalcaba syndrome"""	10	10q23.3	5728	phosphatase and tensin homolog gene		"""L, E, M, O"""	53	Whole gene deletion(37)|Deletion - Frameshift(11)|Deletion - In frame(2)|Unknown(2)|Substitution - Nonsense(1)	prostate(16)|central_nervous_system(12)|skin(6)|lung(4)|haematopoietic_and_lymphoid_tissue(3)|endometrium(3)|breast(3)|ovary(3)|urinary_tract(2)|soft_tissue(1)											53.0	57.0	56.0					10																	89720709		2201	4295	6496	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Incl.: Encephalocraniocutaneous Lipomatosis, ECCL, Proteus-like s.;incl.: Juvenile Polyposis of the Stomach;HMPS1, Colorectal Adenoma Carcinoma syndrome, CRAC, CRAC1;CS, Cowden disease, Multiple Hamartoma Syndrome, incl.: Lhermitte-Duclos; part of PTEN hamartoma tumour syndrome (PHTS) / PTEN-MATCHS, Cowden-like syndrome;subset of PTEN-Hamartoma Tumor Syndrome; incl.: Ruvalcaba-Myhre-Smith s.	U92436	CCDS31238.1	10q23	2014-09-17	2008-07-31		ENSG00000171862	ENSG00000171862		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	9588	protein-coding gene	gene with protein product	"""mutated in multiple advanced cancers 1"""	601728		BZS, MHAM		9090379	Standard	NM_000314		Approved	MMAC1, TEP1, PTEN1	uc001kfb.3	P60484	OTTHUMG00000018688	ENST00000371953.3:c.860C>G	10.37:g.89720709C>G	ENSP00000361021:p.Ser287*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R904|F2YHV0|O00633|O02679|Q6ICT7	Nonsense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Tyr_Pase_cat,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.S287*	ENST00000371953.3	37	c.860	CCDS31238.1	10	.	.	.	.	.	.	.	.	.	.	C	48	14.349339	0.99791	.	.	ENSG00000171862	ENST00000371953	.	.	.	5.13	5.13	0.70059	.	0.313296	0.30602	N	0.009272	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.973	18.5632	0.91108	0.0:1.0:0.0:0.0	.	.	.	.	X	287	.	.	S	+	2	0	PTEN	89710689	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	2.976000	0.49289	2.399000	0.81585	0.591000	0.81541	TCA	PTEN	-	pfam_Tensin_phosphatase_C2-dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pirsf_Bifunc_PIno_P3_Pase/Pase_PTEN,pfscan_Tensin_phosphatase_C2-dom	ENSG00000171862		0.313	PTEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTEN	HGNC	protein_coding	OTTHUMT00000049241.1	60	0.00	0	C	NM_000314		89720709	89720709	+1	no_errors	ENST00000371953	ensembl	human	known	69_37n	nonsense	47	32.86	23	SNP	1.000	G
PTN	5764	genome.wustl.edu	37	7	136936040	136936040	+	Missense_Mutation	SNP	C	C	T	rs559496875		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:136936040C>T	ENST00000348225.2	-	4	815	c.388G>A	c.(388-390)Gaa>Aaa	p.E130K	PTN_ENST00000393083.2_Missense_Mutation_p.E130K	NM_002825.5	NP_002816.1	P21246	PTN_HUMAN	pleiotrophin	130					bone mineralization (GO:0030282)|learning (GO:0007612)|negative regulation of catalytic activity (GO:0043086)|nervous system development (GO:0007399)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	heparin binding (GO:0008201)|protein phosphatase inhibitor activity (GO:0004864)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(10)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	23						TTCTGGCATTCGGCATTGTGC	0.507													C|||	1	0.000199681	0.0	0.0	5008	,	,		17432	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													305.0	278.0	287.0					7																	136936040		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57399	CCDS5844.1	7q33	2014-01-30	2008-07-31		ENSG00000105894	ENSG00000105894		"""Endogenous ligands"""	9630	protein-coding gene	gene with protein product	"""heparin binding growth factor 8"""	162095	"""neurite growth-promoting factor 1"""	NEGF1		1457401, 1768439	Standard	NM_002825		Approved	HBNF, HBGF8	uc003vtq.2	P21246	OTTHUMG00000155709	ENST00000348225.2:c.388G>A	7.37:g.136936040C>T	ENSP00000341170:p.Glu130Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U0B0|Q6ICQ5|Q9UCC6	Missense_Mutation	SNP	pfam_Midkine_heparin-bd_GF_C,pfam_Midkine_heparin-bd_GF_N,superfamily_Midkine_heparin-bd_GF_diS,smart_Midkine_heparin-bd_GF,prints_Midkine_heparin-bd_GF	p.E130K	ENST00000348225.2	37	c.388	CCDS5844.1	7	.	.	.	.	.	.	.	.	.	.	C	19.83	3.900823	0.72754	.	.	ENSG00000105894	ENST00000348225;ENST00000393083	.	.	.	6.02	6.02	0.97574	Midkine heparin-binding growth factor, C-terminal (2);Midkine heparin-binding growth factor, disulphide-rich domain (1);	0.230372	0.51477	D	0.000093	T	0.43478	0.1249	L	0.47190	1.495	0.31381	N	0.678951	B;P	0.43938	0.12;0.822	B;B	0.34346	0.058;0.18	T	0.55464	-0.8137	9	0.59425	D	0.04	-9.791	20.5373	0.99239	0.0:1.0:0.0:0.0	.	130;130	C9JR52;P21246	.;PTN_HUMAN	K	130	.	ENSP00000341170:E130K	E	-	1	0	PTN	136586580	1.000000	0.71417	0.967000	0.41034	0.965000	0.64279	4.713000	0.61895	2.857000	0.98124	0.650000	0.86243	GAA	PTN	-	pfam_Midkine_heparin-bd_GF_C,superfamily_Midkine_heparin-bd_GF_diS,smart_Midkine_heparin-bd_GF,prints_Midkine_heparin-bd_GF	ENSG00000105894		0.507	PTN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTN	HGNC	protein_coding	OTTHUMT00000341339.1	131	0.75	1	C	NM_002825		136936040	136936040	-1	no_errors	ENST00000348225	ensembl	human	known	69_37n	missense	135	18.67	31	SNP	0.998	T
PTPN13	5783	genome.wustl.edu	37	4	87694013	87694013	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:87694013G>C	ENST00000411767.2	+	32	5314	c.5251G>C	c.(5251-5253)Gat>Cat	p.D1751H	PTPN13_ENST00000511467.1_Missense_Mutation_p.D1756H|PTPN13_ENST00000427191.2_Missense_Mutation_p.D1732H|PTPN13_ENST00000436978.1_Missense_Mutation_p.D1756H|PTPN13_ENST00000316707.6_Missense_Mutation_p.D1560H			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1751					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TAGTTCGATGGATAAGTATCA	0.413																																						dbGAP											0													128.0	121.0	123.0					4																	87694013		1834	4091	5925	-	-	-	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5251G>C	4.37:g.87694013G>C	ENSP00000407249:p.Asp1751His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.D1756H	ENST00000411767.2	37	c.5266	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	12.85	2.061524	0.36373	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.54866	0.55;0.59;0.68;0.56;0.59	5.78	5.78	0.91487	PDZ/DHR/GLGF (1);	0.390473	0.21480	N	0.073845	T	0.54886	0.1886	L	0.40543	1.245	0.09310	N	0.999998	P;P;P;P	0.48503	0.911;0.828;0.736;0.797	P;P;B;P	0.53062	0.717;0.532;0.332;0.526	T	0.51849	-0.8653	10	0.46703	T	0.11	.	10.9755	0.47463	0.0846:0.0:0.9154:0.0	.	1560;1732;1751;1756	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	H	1732;1756;1560;1751;1756;1700	ENSP00000408368:D1732H;ENSP00000394794:D1756H;ENSP00000322675:D1560H;ENSP00000407249:D1751H;ENSP00000426626:D1756H	ENSP00000322675:D1560H	D	+	1	0	PTPN13	87913037	0.656000	0.27385	0.058000	0.19502	0.240000	0.25518	2.327000	0.43858	2.724000	0.93272	0.563000	0.77884	GAT	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,superfamily_PDZ	ENSG00000163629		0.413	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	55	0.00	0	G			87694013	87694013	+1	no_errors	ENST00000436978	ensembl	human	known	69_37n	missense	46	17.86	10	SNP	0.321	C
RAI2	10742	genome.wustl.edu	37	X	17819188	17819188	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:17819188C>T	ENST00000545871.1	-	3	1403	c.943G>A	c.(943-945)Gag>Aag	p.E315K	RAI2_ENST00000415486.3_Missense_Mutation_p.E265K|RAI2_ENST00000331511.1_Missense_Mutation_p.E315K|RAI2_ENST00000360011.1_Missense_Mutation_p.E315K|RAI2_ENST00000451717.1_Missense_Mutation_p.E315K	NM_001172739.1|NM_001172743.1	NP_001166210|NP_001166214	Q9Y5P3	RAI2_HUMAN	retinoic acid induced 2	315					embryo development (GO:0009790)					breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|prostate(1)	22	Hepatocellular(33;0.183)					TCCAGGGCCTCGTTCTCACTT	0.547													c|||	1	0.000264901	0.0	0.0	3775	,	,		13797	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													106.0	104.0	104.0					X																	17819188		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z93242	CCDS14183.1, CCDS55374.1	Xp22	2008-02-05			ENSG00000131831	ENSG00000131831			9835	protein-coding gene	gene with protein product		300217				10049581, 10394933	Standard	NR_033348		Approved		uc010nfa.3	Q9Y5P3	OTTHUMG00000021209	ENST00000545871.1:c.943G>A	X.37:g.17819188C>T	ENSP00000444210:p.Glu315Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B1K2|B4DQM9|E7EMN4|Q8N6X7	Missense_Mutation	SNP	NULL	p.E315K	ENST00000545871.1	37	c.943	CCDS14183.1	X	.	.	.	.	.	.	.	.	.	.	c	18.18	3.567642	0.65651	.	.	ENSG00000131831	ENST00000331511;ENST00000360011;ENST00000545871;ENST00000451717;ENST00000415486	T;T;T;T;T	0.37235	1.21;1.21;1.21;1.21;1.24	5.29	5.29	0.74685	.	0.065436	0.56097	D	0.000021	T	0.53238	0.1784	L	0.55481	1.735	0.52501	D	0.99995	D;D	0.76494	0.999;0.999	P;P	0.60068	0.868;0.868	T	0.55457	-0.8138	10	0.72032	D	0.01	-23.1059	17.6607	0.88192	0.0:1.0:0.0:0.0	.	265;315	E7EMN4;Q9Y5P3	.;RAI2_HUMAN	K	315;315;315;315;265	ENSP00000333456:E315K;ENSP00000353106:E315K;ENSP00000444210:E315K;ENSP00000401323:E315K;ENSP00000392578:E265K	ENSP00000333456:E315K	E	-	1	0	RAI2	17729109	0.998000	0.40836	0.986000	0.45419	0.941000	0.58515	5.032000	0.64140	2.457000	0.83068	0.597000	0.82753	GAG	RAI2	-	NULL	ENSG00000131831		0.547	RAI2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RAI2	HGNC	protein_coding	OTTHUMT00000055937.1	74	0.00	0	C	NM_021785		17819188	17819188	-1	no_errors	ENST00000331511	ensembl	human	known	69_37n	missense	51	17.74	11	SNP	0.997	T
RARRES3	5920	genome.wustl.edu	37	11	63312154	63312154	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:63312154G>A	ENST00000255688.3	+	3	228	c.180G>A	c.(178-180)gtG>gtA	p.V60V	RARRES3_ENST00000354445.2_Silent_p.V60V|RARRES3_ENST00000537871.1_3'UTR|RARRES3_ENST00000439013.2_Silent_p.V60V	NM_004585.3	NP_004576.2	Q9UL19	HRSL4_HUMAN	retinoic acid receptor responder (tazarotene induced) 3	60					lipid catabolic process (GO:0016042)|negative regulation of cell proliferation (GO:0008285)|phospholipid metabolic process (GO:0006644)	integral component of membrane (GO:0016021)	phospholipase A2 activity (GO:0004623)			kidney(1)|large_intestine(1)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	6						GTGCAGAGGTGAAACGGGAGC	0.582																																						dbGAP											0													104.0	114.0	111.0					11																	63312154		1975	4159	6134	-	-	-	SO:0001819	synonymous_variant	0				CCDS41662.1	11q23	2008-05-02			ENSG00000133321	ENSG00000133321			9869	protein-coding gene	gene with protein product		605092				9270552	Standard	NM_004585		Approved	TIG3, HRASLS4	uc001nxf.4	Q9UL19	OTTHUMG00000167850	ENST00000255688.3:c.180G>A	11.37:g.63312154G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R599|B4DDW2|E7ENZ7|O95200	Silent	SNP	pfam_LRAT-like_dom	p.V60	ENST00000255688.3	37	c.180	CCDS41662.1	11																																																																																			RARRES3	-	pfam_LRAT-like_dom	ENSG00000133321		0.582	RARRES3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RARRES3	HGNC	protein_coding	OTTHUMT00000396629.1	38	0.00	0	G			63312154	63312154	+1	no_errors	ENST00000255688	ensembl	human	known	69_37n	silent	11	31.25	5	SNP	0.503	A
RASA1	5921	genome.wustl.edu	37	5	86676366	86676366	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:86676366C>T	ENST00000274376.6	+	20	3208	c.2644C>T	c.(2644-2646)Cag>Tag	p.Q882*	RASA1_ENST00000506290.1_Nonsense_Mutation_p.Q716*|RASA1_ENST00000512763.1_Nonsense_Mutation_p.Q715*|RASA1_ENST00000456692.2_Nonsense_Mutation_p.Q705*	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	882	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)	p.Q882*(1)		NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		GAAATCTGTTCAGCATAAGTG	0.363																																						dbGAP											1	Substitution - Nonsense(1)	upper_aerodigestive_tract(1)											155.0	152.0	153.0					5																	86676366		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.2644C>T	5.37:g.86676366C>T	ENSP00000274376:p.Gln882*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6W3|Q9UDI1	Nonsense_Mutation	SNP	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.Q882*	ENST00000274376.6	37	c.2644	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	C	40	8.432279	0.98808	.	.	ENSG00000145715	ENST00000274376;ENST00000456692;ENST00000512763;ENST00000506290	.	.	.	5.68	4.79	0.61399	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	16.7978	0.85607	0.0:0.8709:0.1291:0.0	.	.	.	.	X	882;705;715;716	.	ENSP00000274376:Q882X	Q	+	1	0	RASA1	86712122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.879000	0.69690	1.498000	0.48600	0.655000	0.94253	CAG	RASA1	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP	ENSG00000145715		0.363	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	HGNC	protein_coding	OTTHUMT00000369729.1	67	0.00	0	C	NM_002890		86676366	86676366	+1	no_errors	ENST00000274376	ensembl	human	known	69_37n	nonsense	73	14.94	13	SNP	1.000	T
RASAL2	9462	genome.wustl.edu	37	1	178436496	178436496	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:178436496G>C	ENST00000462775.1	+	15	3320	c.3195G>C	c.(3193-3195)aaG>aaC	p.K1065N	RASAL2_ENST00000367649.3_Missense_Mutation_p.K1206N|RASAL2_ENST00000448150.3_Missense_Mutation_p.K1195N	NM_004841.3	NP_004832.1	Q9UJF2	NGAP_HUMAN	RAS protein activator like 2	1065					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	Ras GTPase activator activity (GO:0005099)			biliary_tract(1)|breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(2)|lung(25)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	54						AGGAACTGAAGAAGGATCATG	0.403																																						dbGAP											0													97.0	88.0	91.0					1																	178436496		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF047711	CCDS1321.1, CCDS1322.1, CCDS1321.2	1q25	2013-01-10			ENSG00000075391	ENSG00000075391		"""Pleckstrin homology (PH) domain containing"""	9874	protein-coding gene	gene with protein product	"""Ras GTPase activating protein-like"", ""Ras protein activator like 1"""	606136				9877179	Standard	NM_004841		Approved	nGAP	uc001glq.3	Q9UJF2	OTTHUMG00000035022	ENST00000462775.1:c.3195G>C	1.37:g.178436496G>C	ENSP00000420558:p.Lys1065Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W755|O95174|Q2TB22|Q5TFU9	Missense_Mutation	SNP	pfam_DUF3498,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PP1_inhibitor,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.K1206N	ENST00000462775.1	37	c.3618	CCDS1322.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.92|12.92	2.082305|2.082305	0.36758|0.36758	.|.	.|.	ENSG00000075391|ENSG00000075391	ENST00000433130|ENST00000448150;ENST00000367649;ENST00000462775;ENST00000367647	.|T;T;T	.|0.15256	.|2.44;2.44;2.44	5.66|5.66	4.75|4.75	0.60458|0.60458	.|.	.|0.051658	.|0.85682	.|D	.|0.000000	T|T	0.26846|0.26846	0.0657|0.0657	L|L	0.49455|0.49455	1.56|1.56	0.46028|0.46028	D|D	0.998828|0.998828	.|B;P;B	.|0.41546	.|0.094;0.754;0.009	.|B;P;B	.|0.51945	.|0.053;0.685;0.031	T|T	0.01781|0.01781	-1.1275|-1.1275	5|10	.|0.87932	.|D	.|0	.|.	9.0645|9.0645	0.36455|0.36455	0.2187:0.0:0.7813:0.0|0.2187:0.0:0.7813:0.0	.|.	.|1195;1065;1206	.|B1AKC7;Q9UJF2;F8W755	.|.;NGAP_HUMAN;.	Q|N	616|1195;1206;1065;8	.|ENSP00000407768:K1195N;ENSP00000356621:K1206N;ENSP00000420558:K1065N	.|ENSP00000356619:K8N	E|K	+|+	1|3	0|2	RASAL2|RASAL2	176703119|176703119	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.950000|0.950000	0.60333|0.60333	0.805000|0.805000	0.27112|0.27112	1.392000|1.392000	0.46585|0.46585	0.650000|0.650000	0.86243|0.86243	GAA|AAG	RASAL2	-	pfam_DUF3498	ENSG00000075391		0.403	RASAL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RASAL2	HGNC	protein_coding	OTTHUMT00000084758.3	57	0.00	0	G	NM_170692		178436496	178436496	+1	no_errors	ENST00000367649	ensembl	human	known	69_37n	missense	56	15.15	10	SNP	1.000	C
RBM25	58517	genome.wustl.edu	37	14	73570039	73570039	+	Missense_Mutation	SNP	A	A	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:73570039A>T	ENST00000261973.7	+	10	1292	c.1007A>T	c.(1006-1008)gAa>gTa	p.E336V	RBM25_ENST00000527432.1_Missense_Mutation_p.E336V	NM_021239.2	NP_067062.1	P49756	RBM25_HUMAN	RNA binding motif protein 25	336	Arg-rich.|Glu-rich.|Necessary for nuclear speckle localization.				mRNA processing (GO:0006397)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of apoptotic process (GO:0042981)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(6)|ovary(2)|pancreas(1)	31				BRCA - Breast invasive adenocarcinoma(234;0.00362)|OV - Ovarian serous cystadenocarcinoma(108;0.0688)		cgtgaacgagaaaaggagaaa	0.532																																						dbGAP											0													163.0	142.0	149.0					14																	73570039		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX647116	CCDS32113.1	14q24.3	2013-02-12	2004-04-23	2004-04-29	ENSG00000119707	ENSG00000119707		"""RNA binding motif (RRM) containing"""	23244	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 94"""	612427	"""RNA-binding region (RNP1, RRM) containing 7"""	RNPC7		9847074, 7596406	Standard	NM_021239		Approved	S164, fSAP94, NET52, Snu71	uc001xno.3	P49756	OTTHUMG00000167540	ENST00000261973.7:c.1007A>T	14.37:g.73570039A>T	ENSP00000261973:p.Glu336Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJL9|B2RNA8|B3KT03|Q2TA72|Q5XJ17|Q6P665|Q9H6A1|Q9UEQ5|Q9UIE9	Missense_Mutation	SNP	pfam_PWI,pfam_RRM_dom,superfamily_PWI,smart_RRM_dom,smart_PWI,pfscan_RRM_dom	p.E336V	ENST00000261973.7	37	c.1007	CCDS32113.1	14	.	.	.	.	.	.	.	.	.	.	A	13.96	2.394056	0.42410	.	.	ENSG00000119707	ENST00000261973;ENST00000527432	T;T	0.09073	3.02;3.02	5.35	5.35	0.76521	.	0.517970	0.21807	N	0.068839	T	0.20536	0.0494	L	0.47716	1.5	0.80722	D	1	P	0.51653	0.947	D	0.67231	0.95	T	0.01039	-1.1472	10	0.29301	T	0.29	.	13.8613	0.63561	1.0:0.0:0.0:0.0	.	336	P49756	RBM25_HUMAN	V	336	ENSP00000261973:E336V;ENSP00000431150:E336V	ENSP00000261973:E336V	E	+	2	0	RBM25	72639792	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.614000	0.82996	2.152000	0.67230	0.482000	0.46254	GAA	RBM25	-	NULL	ENSG00000119707		0.532	RBM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM25	HGNC	protein_coding	OTTHUMT00000394966.1	121	0.00	0	A	XM_027330		73570039	73570039	+1	no_errors	ENST00000261973	ensembl	human	known	69_37n	missense	66	16.46	13	SNP	1.000	T
RBM39	9584	genome.wustl.edu	37	20	34293154	34293154	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr20:34293154G>A	ENST00000253363.6	-	15	1429	c.1406C>T	c.(1405-1407)tCa>tTa	p.S469L	RBM39_ENST00000407261.4_Missense_Mutation_p.S312L|RBM39_ENST00000528062.3_Missense_Mutation_p.S447L|RBM39_ENST00000361162.6_Missense_Mutation_p.S463L			Q14498	RBM39_HUMAN	RNA binding motif protein 39	469	Interaction with NCOA6. {ECO:0000250}.|RRM 3. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	microtubule cytoskeleton (GO:0015630)|microtubule organizing center (GO:0005815)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35	all_epithelial(2;0.00295)|Lung NSC(9;0.00453)|Breast(12;0.00544)|all_lung(11;0.00676)					TACCTGAGCTGAATTTTTGTC	0.338																																						dbGAP											0													87.0	84.0	85.0					20																	34293154		2203	4298	6501	-	-	-	SO:0001583	missense	0			L10910	CCDS13265.1, CCDS13266.1, CCDS56186.1	20q11.22	2014-07-03	2006-07-11	2006-07-11	ENSG00000131051	ENSG00000131051		"""RNA binding motif (RRM) containing"""	15923	protein-coding gene	gene with protein product	"""coactivator of activating protein-1 and estrogen receptors"", ""functional spliceosome-associated protein 59"""	604739	"""RNA-binding region (RNP1, RRM) containing 2"""	RNPC2		8227358, 15694343, 21551269	Standard	NM_184234		Approved	CC1.3, HCC1, CAPER, fSAP59, CAPERalpha	uc002xeb.3	Q14498	OTTHUMG00000032358	ENST00000253363.6:c.1406C>T	20.37:g.34293154G>A	ENSP00000253363:p.Ser469Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRD3|A5D8W2|B0BLV3|E1P5S0|E1P5S1|Q14499	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,smart_RRM_dom_euk,pfscan_RRM_dom,tigrfam_CC1_SF	p.S469L	ENST00000253363.6	37	c.1406	CCDS13266.1	20	.	.	.	.	.	.	.	.	.	.	G	35	5.482078	0.96307	.	.	ENSG00000131051	ENST00000253363;ENST00000361162;ENST00000528062;ENST00000407261	T;T;T;T	0.05447	3.44;3.44;3.44;3.44	5.64	5.64	0.86602	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (1);	0.000000	0.85682	D	0.000000	T	0.26376	0.0644	M	0.66378	2.025	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;0.998	T	0.00185	-1.1943	10	0.87932	D	0	.	19.7075	0.96079	0.0:0.0:1.0:0.0	.	441;447;463;469;445	B4DRA0;A2RRD3;Q14498-2;Q14498;B3KWX7	.;.;.;RBM39_HUMAN;.	L	469;463;447;312	ENSP00000253363:S469L;ENSP00000354437:S463L;ENSP00000436747:S447L;ENSP00000384541:S312L	ENSP00000253363:S469L	S	-	2	0	RBM39	33756568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.852000	0.99516	2.643000	0.89663	0.655000	0.94253	TCA	RBM39	-	smart_RRM_dom_euk,smart_RRM_dom,tigrfam_CC1_SF	ENSG00000131051		0.338	RBM39-002	KNOWN	basic|CCDS	protein_coding	RBM39	HGNC	protein_coding	OTTHUMT00000078931.2	73	0.00	0	G	NM_184237		34293154	34293154	-1	no_errors	ENST00000253363	ensembl	human	known	69_37n	missense	82	17.17	17	SNP	1.000	A
REG4	83998	genome.wustl.edu	37	1	120345554	120345554	+	Intron	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:120345554C>G	ENST00000354219.1	-	4	605				REG4_ENST00000530654.1_Intron|REG4_ENST00000256585.5_Intron|REG4_ENST00000369401.4_Missense_Mutation_p.R101T	NM_001159352.1	NP_001152824.1	Q9BYZ8	REG4_HUMAN	regenerating islet-derived family, member 4							cytoplasm (GO:0005737)|extracellular region (GO:0005576)	heparin binding (GO:0008201)|mannan binding (GO:2001065)			central_nervous_system(1)|large_intestine(1)|lung(8)|ovary(2)|prostate(1)|skin(2)	15	all_cancers(5;4.81e-10)|all_epithelial(5;7.98e-11)|Melanoma(3;1.93e-05)|Breast(55;0.218)|all_neural(166;0.219)	all_lung(203;8.1e-07)|Lung NSC(69;5.89e-06)|all_epithelial(167;0.000959)		Lung(183;0.011)|LUSC - Lung squamous cell carcinoma(189;0.0588)		ACCCTCTTCTCTCCATTTCAC	0.488																																						dbGAP											0													78.0	68.0	71.0					1																	120345554		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AY007243	CCDS906.1, CCDS53354.1	1p13.1-p12	2008-02-05			ENSG00000134193	ENSG00000134193			22977	protein-coding gene	gene with protein product	"""regenerating gene type IV"", "" gastrointestinal secretory protein"""	609846				11311942, 12455032	Standard	NM_032044		Approved	REG-IV, RELP, GISP	uc001eif.3	Q9BYZ8	OTTHUMG00000012175	ENST00000354219.1:c.165+136G>C	1.37:g.120345554C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NER6|Q8NER7	Missense_Mutation	SNP	superfamily_C-type_lectin_fold	p.R101T	ENST00000354219.1	37	c.302	CCDS906.1	1	.	.	.	.	.	.	.	.	.	.	c	8.125	0.781705	0.16120	.	.	ENSG00000134193	ENST00000369401	.	.	.	4.23	-1.15	0.09709	.	.	.	.	.	T	0.24044	0.0582	.	.	.	0.09310	N	1	D	0.57571	0.98	P	0.54174	0.744	T	0.07947	-1.0746	7	0.87932	D	0	.	4.2379	0.10634	0.0:0.3811:0.3265:0.2924	.	101	Q9BYZ8-2	.	T	101	.	ENSP00000358409:R101T	R	-	2	0	REG4	120147077	0.001000	0.12720	0.053000	0.19242	0.201000	0.24016	-0.201000	0.09464	-0.304000	0.08843	-0.224000	0.12420	AGA	REG4	-	NULL	ENSG00000134193		0.488	REG4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	REG4	HGNC	protein_coding	OTTHUMT00000033675.1	54	0.00	0	C	NM_032044		120345554	120345554	-1	no_errors	ENST00000369401	ensembl	human	known	69_37n	missense	31	13.51	5	SNP	0.079	G
RGAG1	57529	genome.wustl.edu	37	X	109696070	109696070	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:109696070G>A	ENST00000465301.2	+	3	2471	c.2225G>A	c.(2224-2226)gGa>gAa	p.G742E	RGAG1_ENST00000540313.1_Missense_Mutation_p.G742E	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	742										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						ATGACCGCTGGAGGGATGCAG	0.512																																						dbGAP											0													152.0	132.0	139.0					X																	109696070		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2225G>A	X.37:g.109696070G>A	ENSP00000419786:p.Gly742Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.G742E	ENST00000465301.2	37	c.2225	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	G	7.960	0.746817	0.15710	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.71934	-0.61;-0.61	4.39	1.61	0.23674	.	0.000000	0.38217	N	0.001769	T	0.52500	0.1738	L	0.32530	0.975	0.39229	D	0.963648	B	0.24533	0.105	B	0.28638	0.092	T	0.29336	-1.0015	9	.	.	.	-8.8949	3.9688	0.09444	0.0954:0.1566:0.5836:0.1644	.	742	Q8NET4	RGAG1_HUMAN	E	742	ENSP00000419786:G742E;ENSP00000441452:G742E	.	G	+	2	0	RGAG1	109582726	0.766000	0.28496	0.057000	0.19452	0.003000	0.03518	0.272000	0.18644	0.204000	0.20548	-0.202000	0.12741	GGA	RGAG1	-	NULL	ENSG00000243978		0.512	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	77	0.00	0	G	NM_020769		109696070	109696070	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	71	19.32	17	SNP	0.878	A
RHOXF1	158800	genome.wustl.edu	37	X	119249529	119249529	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:119249529G>A	ENST00000217999.2	-	1	318	c.244C>T	c.(244-246)Cag>Tag	p.Q82*	RP4-755D9.1_ENST00000553843.1_RNA|GS1-421I3.4_ENST00000422226.1_lincRNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	82					gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						GGCGGGGGCTGCGGCTGCTGC	0.692																																						dbGAP											0													23.0	26.0	25.0					X																	119249529		2168	4230	6398	-	-	-	SO:0001587	stop_gained	0				CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.244C>T	X.37:g.119249529G>A	ENSP00000217999:p.Gln82*	Somatic		WXS	Illumina GAIIx	Phase_IV	O95030|Q3SYE0	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif	p.Q82*	ENST00000217999.2	37	c.244	CCDS14593.1	X	.	.	.	.	.	.	.	.	.	.	g	14.07	2.425031	0.43020	.	.	ENSG00000101883	ENST00000217999	.	.	.	1.29	0.271	0.15640	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05525	T	0.97	.	4.0772	0.09909	0.0:0.0:0.5933:0.4067	.	.	.	.	X	82	.	ENSP00000217999:Q82X	Q	-	1	0	RHOXF1	119133557	0.004000	0.15560	0.000000	0.03702	0.001000	0.01503	-0.100000	0.10990	0.019000	0.15079	0.431000	0.28591	CAG	RHOXF1	-	NULL	ENSG00000101883		0.692	RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF1	HGNC	protein_coding	OTTHUMT00000058083.2	25	0.00	0	G	NM_139282		119249529	119249529	-1	no_errors	ENST00000217999	ensembl	human	known	69_37n	nonsense	5	50.00	5	SNP	0.000	A
RIMS2	9699	genome.wustl.edu	37	8	104709373	104709373	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:104709373C>T	ENST00000406091.3	+	2	236	c.236C>T	c.(235-237)tCa>tTa	p.S79L		NM_001100117.2	NP_001093587.1	Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	110	RabBD. {ECO:0000255|PROSITE- ProRule:PRU00234}.				calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			GGAGAAGAATCACAGCAACAG	0.403										HNSCC(12;0.0054)																												dbGAP											0													122.0	122.0	122.0					8																	104709373		1972	4149	6121	-	-	-	SO:0001583	missense	0			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000406091.3:c.236C>T	8.37:g.104709373C>T	ENSP00000384892:p.Ser79Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.S79L	ENST00000406091.3	37	c.236	CCDS55269.1	8	.	.	.	.	.	.	.	.	.	.	C	30	5.052894	0.93793	.	.	ENSG00000176406	ENST00000504942;ENST00000329869;ENST00000406091;ENST00000402998	T;T	0.77098	-1.07;-1.07	5.57	5.57	0.84162	.	.	.	.	.	T	0.65396	0.2687	N	0.21097	0.63	0.80722	D	1	P	0.36837	0.571	B	0.30855	0.121	T	0.63825	-0.6549	9	0.22706	T	0.39	.	19.6154	0.95632	0.0:1.0:0.0:0.0	.	79	F8WD47	.	L	79;110;79;110	ENSP00000427018:S79L;ENSP00000384892:S79L	ENSP00000332184:S110L	S	+	2	0	RIMS2	104778549	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.815000	0.86186	2.630000	0.89119	0.556000	0.70494	TCA	RIMS2	-	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	ENSG00000176406		0.403	RIMS2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	RIMS2	HGNC	protein_coding		88	0.00	0	C	NM_001100117		104709373	104709373	+1	no_errors	ENST00000406091	ensembl	human	known	69_37n	missense	30	36.17	17	SNP	1.000	T
RIOK2	55781	genome.wustl.edu	37	5	96512941	96512941	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:96512941C>T	ENST00000283109.3	-	4	445	c.377G>A	c.(376-378)aGa>aAa	p.R126K	RIOK2_ENST00000508447.1_Missense_Mutation_p.R126K|RNU1-73P_ENST00000383971.1_RNA|CTD-2215E18.1_ENST00000509481.1_Intron	NM_018343.2	NP_060813.2	Q9BVS4	RIOK2_HUMAN	RIO kinase 2	126							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(9)|pancreas(1)|prostate(1)|urinary_tract(2)	23		all_cancers(142;0.000125)|all_epithelial(76;8.48e-07)|all_lung(232;0.0131)|Lung NSC(167;0.0161)|Colorectal(57;0.0676)|Ovarian(225;0.105)		COAD - Colon adenocarcinoma(37;0.0657)		TCTTCCTAGTCTGTGAAGCTT	0.338																																						dbGAP											0													154.0	157.0	156.0					5																	96512941		2202	4299	6501	-	-	-	SO:0001583	missense	0			AK002021	CCDS4089.1, CCDS54884.1	5q14	2012-12-10	2012-12-10		ENSG00000058729	ENSG00000058729			18999	protein-coding gene	gene with protein product			"""RIO kinase 2 (yeast)"""				Standard	NM_018343		Approved	FLJ11159	uc003kmz.3	Q9BVS4	OTTHUMG00000128723	ENST00000283109.3:c.377G>A	5.37:g.96512941C>T	ENSP00000283109:p.Arg126Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D6RDI3|Q9NUT0	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_RIO2_kinase_winged_hlx_N,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase	p.R126K	ENST00000283109.3	37	c.377	CCDS4089.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.536071	0.96460	.	.	ENSG00000058729	ENST00000283109;ENST00000508447	T;T	0.05855	3.38;3.38	5.62	5.62	0.85841	Protein kinase-like domain (1);RIO-like kinase (1);	0.000000	0.85682	D	0.000000	T	0.30727	0.0774	M	0.82517	2.595	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.97110	1.0;0.998	T	0.02588	-1.1137	10	0.87932	D	0	-22.8066	19.2434	0.93891	0.0:1.0:0.0:0.0	.	126;126	D6RDI3;Q9BVS4	.;RIOK2_HUMAN	K	126	ENSP00000283109:R126K;ENSP00000420932:R126K	ENSP00000283109:R126K	R	-	2	0	RIOK2	96538697	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.348000	0.79366	2.646000	0.89796	0.557000	0.71058	AGA	RIOK2	-	pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_RIO_kinase	ENSG00000058729		0.338	RIOK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK2	HGNC	protein_coding	OTTHUMT00000250628.1	106	0.00	0	C	NM_018343		96512941	96512941	-1	no_errors	ENST00000283109	ensembl	human	known	69_37n	missense	89	19.64	22	SNP	1.000	T
RLF	6018	genome.wustl.edu	37	1	40661308	40661308	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:40661308C>T	ENST00000372771.4	+	4	506	c.479C>T	c.(478-480)tCa>tTa	p.S160L		NM_012421.3	NP_036553.2	Q13129	RLF_HUMAN	rearranged L-myc fusion	160					chromosome organization (GO:0051276)|DNA integration (GO:0015074)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(18)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(4)|urinary_tract(2)	68	Lung NSC(20;4.38e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;5.87e-19)|Epithelial(16;7.02e-16)|all cancers(16;1.69e-14)|Lung(16;0.0427)|LUSC - Lung squamous cell carcinoma(16;0.0461)			TTCTAGGAGTCACATGATGCA	0.338																																						dbGAP											0													59.0	58.0	58.0					1																	40661308		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS448.1	1p32	2010-05-07	2005-08-16		ENSG00000117000	ENSG00000117000		"""Zinc fingers, C2H2-type"""	10025	protein-coding gene	gene with protein product		180610	"""rearranged L-myc fusion sequence"""			1649386	Standard	NM_012421		Approved	ZNF292L, Zn-15L	uc001cfc.4	Q13129	OTTHUMG00000005763	ENST00000372771.4:c.479C>T	1.37:g.40661308C>T	ENSP00000361857:p.Ser160Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CQ1|Q9NU60	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S160L	ENST00000372771.4	37	c.479	CCDS448.1	1	.	.	.	.	.	.	.	.	.	.	C	24.8	4.571106	0.86542	.	.	ENSG00000117000	ENST00000372771	T	0.17213	2.29	5.1	5.1	0.69264	.	0.060730	0.64402	D	0.000003	T	0.28067	0.0692	L	0.51422	1.61	0.47547	D	0.999459	D	0.58268	0.982	P	0.50049	0.629	T	0.02512	-1.1148	10	0.87932	D	0	-8.5192	18.5035	0.90890	0.0:1.0:0.0:0.0	.	160	Q13129	RLF_HUMAN	L	160	ENSP00000361857:S160L	ENSP00000361857:S160L	S	+	2	0	RLF	40433895	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	5.653000	0.67967	2.369000	0.80426	0.460000	0.39030	TCA	RLF	-	NULL	ENSG00000117000		0.338	RLF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RLF	HGNC	protein_coding	OTTHUMT00000015767.1	54	0.00	0	C	NM_012421		40661308	40661308	+1	no_errors	ENST00000372771	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	1.000	T
ROBO1	6091	genome.wustl.edu	37	3	78666929	78666929	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:78666929C>T	ENST00000464233.1	-	27	4251	c.4138G>A	c.(4138-4140)Gag>Aag	p.E1380K	ROBO1_ENST00000436010.2_Missense_Mutation_p.E1341K|ROBO1_ENST00000467549.1_Missense_Mutation_p.E1280K|ROBO1_ENST00000495273.1_Missense_Mutation_p.E1335K	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	1380					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)			breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		ATGTTGTCCTCCTCTGAGGCT	0.577																																						dbGAP											0													53.0	60.0	58.0					3																	78666929		1964	4150	6114	-	-	-	SO:0001583	missense	0			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.4138G>A	3.37:g.78666929C>T	ENSP00000420321:p.Glu1380Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1380K	ENST00000464233.1	37	c.4138	CCDS54611.1	3	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569196	0.86439	.	.	ENSG00000169855	ENST00000436010;ENST00000398412;ENST00000464233;ENST00000495273;ENST00000467549;ENST00000398414	T;T;T;T	0.65364	0.03;0.01;0.01;-0.15	5.68	5.68	0.88126	.	0.000000	0.85682	D	0.000000	T	0.55545	0.1927	L	0.43923	1.385	0.80722	D	1	P;B;P;B;B	0.40050	0.59;0.418;0.7;0.007;0.152	B;B;B;B;B	0.34991	0.187;0.074;0.193;0.007;0.036	T	0.53788	-0.8389	9	.	.	.	.	20.1554	0.98111	0.0:1.0:0.0:0.0	.	1344;1380;1335;1280;1341	Q9Y6N7-3;Q9Y6N7;B2RXI1;E9PD49;Q9Y6N7-4	.;ROBO1_HUMAN;.;.;.	K	1341;1335;1380;1335;1280;1384	ENSP00000406043:E1341K;ENSP00000420321:E1380K;ENSP00000420637:E1335K;ENSP00000417992:E1280K	.	E	-	1	0	ROBO1	78749619	1.000000	0.71417	1.000000	0.80357	0.841000	0.47740	7.445000	0.80570	2.838000	0.97847	0.591000	0.81541	GAG	ROBO1	-	NULL	ENSG00000169855		0.577	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	57	0.00	0	C	NM_002941		78666929	78666929	-1	no_errors	ENST00000464233	ensembl	human	known	69_37n	missense	33	23.26	10	SNP	1.000	T
RNF13	11342	genome.wustl.edu	37	3	149563824	149563824	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:149563824C>T	ENST00000344229.3	+	3	713	c.11C>T	c.(10-12)tCc>tTc	p.S4F	RNF13_ENST00000392894.3_Missense_Mutation_p.S4F|ANKUB1_ENST00000473672.1_5'UTR	NM_007282.4	NP_009213.1	O43567	RNF13_HUMAN	ring finger protein 13	4					protein autoubiquitination (GO:0051865)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|skin(2)	11		all_neural(597;0.0138)|Myeloproliferative disorder(1037;0.0255)	LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			ATGCTGCTCTCCATAGGGATG	0.433																																						dbGAP											0													117.0	105.0	109.0					3																	149563824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF037204	CCDS3146.1	3q25.1	2013-01-09			ENSG00000082996	ENSG00000082996		"""RING-type (C3HC4) zinc fingers"""	10057	protein-coding gene	gene with protein product		609247					Standard	NM_183381		Approved	RZF	uc003exp.4	O43567	OTTHUMG00000150338	ENST00000344229.3:c.11C>T	3.37:g.149563824C>T	ENSP00000341361:p.Ser4Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC87|B3KR12|Q05D66|Q6IBJ9	Missense_Mutation	SNP	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.S4F	ENST00000344229.3	37	c.11	CCDS3146.1	3	.	.	.	.	.	.	.	.	.	.	C	17.71	3.457756	0.63401	.	.	ENSG00000082996	ENST00000392894;ENST00000344229;ENST00000470151;ENST00000466478;ENST00000543506;ENST00000468648;ENST00000459632;ENST00000466795;ENST00000482539;ENST00000490631	T;T;T;T;T;T;T;T	0.52754	3.57;3.57;0.65;2.35;2.77;2.76;0.69;2.78	5.56	5.56	0.83823	.	0.242965	0.42294	D	0.000732	T	0.53546	0.1803	N	0.14661	0.345	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.60037	-0.7341	10	0.87932	D	0	-17.0281	16.8069	0.85708	0.0:1.0:0.0:0.0	.	4	O43567	RNF13_HUMAN	F	4	ENSP00000376628:S4F;ENSP00000341361:S4F;ENSP00000419836:S4F;ENSP00000420067:S4F;ENSP00000419069:S4F;ENSP00000417655:S4F;ENSP00000420691:S4F;ENSP00000417294:S4F	ENSP00000341361:S4F	S	+	2	0	RNF13	151046514	1.000000	0.71417	1.000000	0.80357	0.733000	0.41908	6.648000	0.74359	2.781000	0.95711	0.591000	0.81541	TCC	RNF13	-	NULL	ENSG00000082996		0.433	RNF13-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF13	HGNC	protein_coding	OTTHUMT00000356876.1	62	0.00	0	C	NM_183384		149563824	149563824	+1	no_errors	ENST00000344229	ensembl	human	known	69_37n	missense	62	16.22	12	SNP	1.000	T
RPL10A	4736	genome.wustl.edu	37	6	35438059	35438059	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:35438059C>G	ENST00000322203.6	+	5	441	c.414C>G	c.(412-414)ctC>ctG	p.L138L	RPL10A_ENST00000467020.1_3'UTR	NM_007104.4	NP_009035.3	P62906	RL10A_HUMAN	ribosomal protein L10a	138					anatomical structure morphogenesis (GO:0009653)|cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|large_intestine(2)|ovary(1)	4						CTTCCCTGCTCACACACAACG	0.488																																						dbGAP											0													54.0	48.0	50.0					6																	35438059		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U12404	CCDS4806.1	6p21.31	2011-04-06			ENSG00000198755	ENSG00000198755		"""L ribosomal proteins"""	10299	protein-coding gene	gene with protein product		615660		NEDD6		7609734, 9647638	Standard	NM_007104		Approved	Csa-19, L10A	uc003okp.1	P62906	OTTHUMG00000014566	ENST00000322203.6:c.414C>G	6.37:g.35438059C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R801|P52859|P53025|Q5TZT6|Q8J013	Silent	SNP	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF,pirsf_Ribosomal_L1	p.L138	ENST00000322203.6	37	c.414	CCDS4806.1	6																																																																																			RPL10A	-	pfam_Ribosomal_L1,superfamily_Ribosomal_L1_SF,pirsf_Ribosomal_L1	ENSG00000198755		0.488	RPL10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL10A	HGNC	protein_coding	OTTHUMT00000040283.1	21	0.00	0	C	NM_007104		35438059	35438059	+1	no_errors	ENST00000322203	ensembl	human	known	69_37n	silent	15	34.78	8	SNP	1.000	G
ROS1	6098	genome.wustl.edu	37	6	117609722	117609722	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:117609722G>A	ENST00000368508.3	-	43	7175	c.6977C>T	c.(6976-6978)tCt>tTt	p.S2326F	ROS1_ENST00000368507.3_Missense_Mutation_p.S2320F	NM_002944.2	NP_002935.2	P08922	ROS1_HUMAN	ROS proto-oncogene 1 , receptor tyrosine kinase	2326					cell differentiation (GO:0030154)|cell growth (GO:0016049)|cell proliferation (GO:0008283)|columnar/cuboidal epithelial cell development (GO:0002066)|negative regulation of gene expression (GO:0010629)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of phosphate transport (GO:0010966)|regulation of TOR signaling (GO:0032006)|spermatogenesis (GO:0007283)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		TPM3_ENST00000368530/ROS1(4)|LRIG3/ROS1(2)|CD74_ENST00000009530/ROS1(32)|SLC34A2/ROS1(14)|EZR/ROS1(4)|GOPC/ROS1(14)|SDC4/ROS1(7)	NS(2)|breast(7)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(28)|lung(56)|ovary(8)|prostate(5)|skin(19)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	162		all_cancers(87;0.00846)|all_epithelial(87;0.0242)		GBM - Glioblastoma multiforme(226;0.0387)|OV - Ovarian serous cystadenocarcinoma(136;0.0954)|all cancers(137;0.137)		AGGCTTGCCAGAAGGGCAGTA	0.458			T	"""GOPC, SDC4, SLC34A2, EZR, LRIG3"""	"""glioblastoma, NSCLC"""																																	dbGAP		Dom	yes		6	6q22	6098	v-ros UR2 sarcoma virus oncogene homolog 1 (avian)		"""O, E"""	0													109.0	105.0	106.0					6																	117609722		2203	4300	6503	-	-	-	SO:0001583	missense	0			M13599	CCDS5116.1	6q21-q22	2014-06-26	2014-06-26		ENSG00000047936	ENSG00000047936		"""Fibronectin type III domain containing"""	10261	protein-coding gene	gene with protein product		165020	"""v-ros avian UR2 sarcoma virus oncogene homolog 1"", ""v-ros UR2 sarcoma virus oncogene homolog 1 (avian)"", ""c-ros oncogene 1 , receptor tyrosine kinase"""			1611909	Standard	NM_002944		Approved	MCF3, ROS, c-ros-1	uc003pxp.1	P08922	OTTHUMG00000016188	ENST00000368508.3:c.6977C>T	6.37:g.117609722G>A	ENSP00000357494:p.Ser2326Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15368|Q5TDB5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_LDLR_classB_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom	p.S2326F	ENST00000368508.3	37	c.6977	CCDS5116.1	6	.	.	.	.	.	.	.	.	.	.	G	13.47	2.246350	0.39697	.	.	ENSG00000047936	ENST00000368508;ENST00000368507	T;T	0.71698	-0.58;-0.59	4.18	3.21	0.36854	.	0.597249	0.14088	N	0.342233	T	0.30417	0.0764	N	0.08118	0	0.22796	N	0.998724	B	0.22480	0.07	B	0.25140	0.058	T	0.14504	-1.0470	10	0.87932	D	0	.	6.1006	0.20045	0.1427:0.0:0.8573:0.0	.	2326	P08922	ROS1_HUMAN	F	2326;2320	ENSP00000357494:S2326F;ENSP00000357493:S2320F	ENSP00000357493:S2320F	S	-	2	0	ROS1	117716415	1.000000	0.71417	1.000000	0.80357	0.938000	0.57974	2.476000	0.45171	2.162000	0.67917	0.563000	0.77884	TCT	ROS1	-	NULL	ENSG00000047936		0.458	ROS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ROS1	HGNC	protein_coding	OTTHUMT00000043464.1	59	0.00	0	G			117609722	117609722	-1	no_errors	ENST00000368508	ensembl	human	known	69_37n	missense	79	13.19	12	SNP	0.999	A
RPP30	10556	genome.wustl.edu	37	10	92660382	92660382	+	Silent	SNP	A	A	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:92660382A>T	ENST00000371703.3	+	11	1024	c.753A>T	c.(751-753)tcA>tcT	p.S251S	RPP30_ENST00000489806.1_3'UTR|RPP30_ENST00000413330.1_Silent_p.S251S	NM_006413.4	NP_006404.1	P78346	RPP30_HUMAN	ribonuclease P/MRP 30kDa subunit	251					RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|ribonuclease P activity (GO:0004526)			central_nervous_system(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	8						CTCGGCCATCAGAAGGAGATG	0.423																																						dbGAP											0													168.0	177.0	174.0					10																	92660382		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC006991	CCDS7411.1, CCDS44458.1	10q23.32-q23.33	2012-05-21			ENSG00000148688	ENSG00000148688			17688	protein-coding gene	gene with protein product		606115				9037013, 9308968	Standard	NM_006413		Approved	TSG15	uc001khd.2	P78346	OTTHUMG00000018733	ENST00000371703.3:c.753A>T	10.37:g.92660382A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R799|E9PB02	Silent	SNP	pfam_RNase_P_p30,superfamily_Pol/histidinol_Pase-like	p.S251	ENST00000371703.3	37	c.753	CCDS7411.1	10																																																																																			RPP30	-	NULL	ENSG00000148688		0.423	RPP30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPP30	HGNC	protein_coding	OTTHUMT00000049347.1	73	0.00	0	A	NM_006413		92660382	92660382	+1	no_errors	ENST00000413330	ensembl	human	known	69_37n	silent	35	30.00	15	SNP	0.852	T
RYR3	6263	genome.wustl.edu	37	15	33954819	33954819	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:33954819G>A	ENST00000389232.4	+	35	5158	c.5088G>A	c.(5086-5088)ctG>ctA	p.L1696L	RYR3_ENST00000415757.3_Silent_p.L1696L	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	1696	4 X approximate repeats.				calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CGAAGGCTCTGAGTATGCTGA	0.572																																						dbGAP											0													76.0	80.0	79.0					15																	33954819		2045	4210	6255	-	-	-	SO:0001819	synonymous_variant	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.5088G>A	15.37:g.33954819G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Silent	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L1696	ENST00000389232.4	37	c.5088	CCDS45210.1	15																																																																																			RYR3	-	NULL	ENSG00000198838		0.572	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	46	0.00	0	G			33954819	33954819	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	silent	46	17.86	10	SNP	0.996	A
RYR3	6263	genome.wustl.edu	37	15	34134069	34134069	+	Missense_Mutation	SNP	G	G	A	rs267604158		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:34134069G>A	ENST00000389232.4	+	91	13112	c.13042G>A	c.(13042-13044)Gaa>Aaa	p.E4348K	RYR3_ENST00000415757.3_Missense_Mutation_p.E4343K	NM_001036.3	NP_001027.3	Q15413	RYR3_HUMAN	ryanodine receptor 3	4348					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cellular response to ATP (GO:0071318)|cellular response to caffeine (GO:0071313)|cellular response to calcium ion (GO:0071277)|cellular response to magnesium ion (GO:0071286)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|protein homotetramerization (GO:0051289)|striated muscle contraction (GO:0006941)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum membrane (GO:0033017)	calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|ryanodine-sensitive calcium-release channel activity (GO:0005219)			NS(3)|breast(9)|central_nervous_system(8)|cervix(2)|endometrium(29)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(55)|lung(148)|ovary(7)|pancreas(1)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(3)	311		all_lung(180;7.18e-09)		all cancers(64;8.95e-12)|GBM - Glioblastoma multiforme(186;0.00109)|BRCA - Breast invasive adenocarcinoma(123;0.0363)		CTGCAGCATGGAAGATGGAGA	0.507																																						dbGAP											0													59.0	62.0	61.0					15																	34134069		1889	4112	6001	-	-	-	SO:0001583	missense	0				CCDS45210.1, CCDS58351.1	15q14-q15	2013-01-10				ENSG00000198838		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10485	protein-coding gene	gene with protein product		180903				8276408	Standard	NM_001036		Approved		uc001zhi.3	Q15413		ENST00000389232.4:c.13042G>A	15.37:g.34134069G>A	ENSP00000373884:p.Glu4348Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15175|Q15412	Missense_Mutation	SNP	pfam_Ryanodine_rcpt,pfam_Ca-rel_channel,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,superfamily_4_helix_cytokine-like_core,superfamily_ARM-type_fold,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E4348K	ENST00000389232.4	37	c.13042	CCDS45210.1	15	.	.	.	.	.	.	.	.	.	.	G	16.13	3.034719	0.54896	.	.	ENSG00000198838	ENST00000389232;ENST00000361728	D	0.94232	-3.38	5.55	5.55	0.83447	Ryanodine Receptor TM 4-6 (1);	0.119868	0.56097	D	0.000039	D	0.90490	0.7021	L	0.50333	1.59	0.80722	D	1	B;B	0.32467	0.372;0.014	B;B	0.30316	0.114;0.038	D	0.87521	0.2446	10	0.11485	T	0.65	.	19.6982	0.96039	0.0:0.0:1.0:0.0	.	4343;4348	Q15413-2;Q15413	.;RYR3_HUMAN	K	4348;4344	ENSP00000373884:E4348K	ENSP00000354735:E4344K	E	+	1	0	RYR3	31921361	1.000000	0.71417	1.000000	0.80357	0.486000	0.33341	9.468000	0.97676	2.894000	0.99253	0.655000	0.94253	GAA	RYR3	-	pfam_Ryanrecept_TM4-6,superfamily_ARM-type_fold	ENSG00000198838		0.507	RYR3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR3	HGNC	protein_coding	OTTHUMT00000417514.1	95	0.00	0	G			34134069	34134069	+1	no_errors	ENST00000389232	ensembl	human	known	69_37n	missense	73	10.98	9	SNP	1.000	A
RPUSD2	27079	genome.wustl.edu	37	15	40864016	40864016	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:40864016G>C	ENST00000315616.7	+	2	858	c.820G>C	c.(820-822)Gac>Cac	p.D274H	RPUSD2_ENST00000559271.1_Missense_Mutation_p.D213H	NM_152260.1	NP_689473.1	Q8IZ73	RUSD2_HUMAN	RNA pseudouridylate synthase domain containing 2	274					pseudouridine synthesis (GO:0001522)		poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			kidney(4)|lung(4)|skin(3)	11		all_cancers(109;2.74e-14)|all_epithelial(112;1.64e-11)|Lung NSC(122;6.69e-09)|all_lung(180;1.22e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;3.1e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0786)		GCATCGGCTTGACCGCCTTAC	0.552																																						dbGAP											0													133.0	116.0	122.0					15																	40864016		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK055971	CCDS10061.1, CCDS66737.1	15q13.3	2013-02-11	2005-01-31	2005-02-07	ENSG00000166133	ENSG00000166133		"""RNA pseudouridylate synthase domain containing"""	24180	protein-coding gene	gene with protein product			"""chromosome 15 open reading frame 19"""	C15orf19		12477932	Standard	NM_001286407		Approved	C18B11, FLJ31409	uc001zmd.1	Q8IZ73	OTTHUMG00000130031	ENST00000315616.7:c.820G>C	15.37:g.40864016G>C	ENSP00000323288:p.Asp274His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDD1|Q7L989|Q92939|Q96IA7|Q96N50	Missense_Mutation	SNP	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	p.D274H	ENST00000315616.7	37	c.820	CCDS10061.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.206646	0.95033	.	.	ENSG00000166133	ENST00000315616;ENST00000417769	T	0.58506	0.33	6.17	6.17	0.99709	Pseudouridine synthase, RsuA and RluB/C/D/E/F (1);Pseudouridine synthase, catalytic domain (1);Pseudouridine synthase, RluC/RluD, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.88115	0.6350	H	0.99487	4.59	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.92226	0.5788	10	0.87932	D	0	-27.5842	20.8794	0.99867	0.0:0.0:1.0:0.0	.	274	Q8IZ73	RUSD2_HUMAN	H	274;253	ENSP00000323288:D274H	ENSP00000323288:D274H	D	+	1	0	RPUSD2	38651308	1.000000	0.71417	0.996000	0.52242	0.993000	0.82548	9.629000	0.98417	2.941000	0.99782	0.655000	0.94253	GAC	RPUSD2	-	pfam_PsdUridine_synth_RsuA/RluD,superfamily_PsdUridine_synth_cat_dom,tigrfam_PsdUridine_synth_RluC/D	ENSG00000166133		0.552	RPUSD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPUSD2	HGNC	protein_coding	OTTHUMT00000252308.2	34	0.00	0	G	NM_152260		40864016	40864016	+1	no_errors	ENST00000315616	ensembl	human	known	69_37n	missense	42	22.41	13	SNP	1.000	C
SACS	26278	genome.wustl.edu	37	13	23928978	23928978	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr13:23928978G>C	ENST00000382292.3	-	7	2046	c.1773C>G	c.(1771-1773)ctC>ctG	p.L591L	SACS_ENST00000402364.1_5'UTR|SACS_ENST00000476776.1_5'UTR|SACS_ENST00000382298.3_Silent_p.L591L			Q9NZJ4	SACS_HUMAN	sacsin molecular chaperone	591					cell death (GO:0008219)|negative regulation of inclusion body assembly (GO:0090084)|protein folding (GO:0006457)	axon (GO:0030424)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|proteasome binding (GO:0070628)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(54)|lung(49)|ovary(7)|pancreas(1)|prostate(4)|skin(10)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(11)	189		all_cancers(29;1.51e-22)|all_epithelial(30;7.82e-19)|all_lung(29;4.71e-18)|Lung SC(185;0.0225)|Breast(139;0.128)		all cancers(112;0.00197)|Epithelial(112;0.00854)|OV - Ovarian serous cystadenocarcinoma(117;0.0298)|Lung(94;0.189)		GGAGGTAGTTGAGCACAGTTT	0.468																																						dbGAP											0													93.0	87.0	89.0					13																	23928978		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF193556	CCDS9300.2	13q11	2014-06-13	2014-01-30		ENSG00000151835	ENSG00000151835		"""Heat shock proteins / DNAJ (HSP40)"""	10519	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 138"""	604490	"""spastic ataxia of Charlevoix-Saguenay (sacsin)"""			10610707, 15057823, 21726565	Standard	NM_001278055		Approved	ARSACS, KIAA0730, DKFZp686B15167, DNAJC29, SPAX6, PPP1R138	uc001uon.3	Q9NZJ4	OTTHUMG00000016562	ENST00000382292.3:c.1773C>G	13.37:g.23928978G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	O94835|Q5T9J5|Q5T9J7|Q5T9J8|Q68DF5|Q6MZR4|Q8NBF9	Missense_Mutation	SNP	superfamily_ATPase-like_ATP-bd	p.Q491E	ENST00000382292.3	37	c.1471	CCDS9300.2	13	.	.	.	.	.	.	.	.	.	.	G	6.957	0.546466	0.13312	.	.	ENSG00000151835	ENST00000455470	.	.	.	5.63	2.9	0.33743	.	.	.	.	.	T	0.54224	0.1845	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47611	-0.9104	4	.	.	.	.	5.914	0.19045	0.1387:0.0:0.4812:0.38	.	.	.	.	E	491	.	.	Q	-	1	0	SACS	22826978	1.000000	0.71417	0.759000	0.31340	0.979000	0.70002	2.625000	0.46452	0.823000	0.34589	-0.254000	0.11334	CAA	SACS	-	NULL	ENSG00000151835		0.468	SACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACS	HGNC	protein_coding	OTTHUMT00000044148.3	43	0.00	0	G	NM_014363		23928978	23928978	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000455470	ensembl	human	putative	69_37n	missense	29	14.71	5	SNP	0.953	C
SEMA4D	10507	genome.wustl.edu	37	9	91994113	91994113	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:91994113G>A	ENST00000450295.1	-	16	2871	c.2095C>T	c.(2095-2097)Ccc>Tcc	p.P699S	SEMA4D_ENST00000455551.2_Intron|SEMA4D_ENST00000339861.4_Intron|SEMA4D_ENST00000420987.1_Intron|SEMA4D_ENST00000356444.2_Missense_Mutation_p.P699S|SEMA4D_ENST00000343780.4_Intron|SEMA4D_ENST00000438547.2_Missense_Mutation_p.P699S|SEMA4D_ENST00000422704.2_Missense_Mutation_p.P699S			Q92854	SEM4D_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D	699					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|immune response (GO:0006955)|leukocyte aggregation (GO:0070486)|negative regulation of alkaline phosphatase activity (GO:0010693)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell adhesion (GO:0007162)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ossification involved in bone maturation (GO:0043931)|positive regulation of cell migration (GO:0030335)|positive regulation of collateral sprouting (GO:0048672)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell projection organization (GO:0031344)|regulation of cell shape (GO:0008360)|regulation of dendrite morphogenesis (GO:0048814)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in bone trabecula morphogenesis (GO:1900220)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|receptor binding (GO:0005102)|semaphorin receptor binding (GO:0030215)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(3)|kidney(2)|large_intestine(13)|lung(8)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	34						GCAGGCTTGGGAGGAAGGGTG	0.597																																						dbGAP											0													68.0	69.0	69.0					9																	91994113		2203	4300	6503	-	-	-	SO:0001583	missense	0			U60800	CCDS6685.1, CCDS47991.1	9q22-q31	2013-01-11			ENSG00000187764	ENSG00000187764		"""Semaphorins"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10732	protein-coding gene	gene with protein product	"""M-sema G"""	601866	"""chromosome 9 open reading frame 164"""	SEMAJ, C9orf164		8876214, 8969198	Standard	NM_006378		Approved	CD100, coll-4, FLJ39737	uc004aqo.1	Q92854	OTTHUMG00000020185	ENST00000450295.1:c.2095C>T	9.37:g.91994113G>A	ENSP00000416523:p.Pro699Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPM6|Q7Z5S4|Q8N8B0	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,pfam_Immunoglobulin,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,smart_Ig_sub2,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.P699S	ENST00000450295.1	37	c.2095	CCDS6685.1	9	.	.	.	.	.	.	.	.	.	.	G	0.305	-0.971152	0.02232	.	.	ENSG00000187764	ENST00000450295;ENST00000438547;ENST00000356444;ENST00000422704	T;T;T;T	0.78707	-1.2;-1.2;-1.2;-1.2	4.08	-0.784	0.10954	.	2.153450	0.01778	N	0.031582	T	0.57902	0.2085	N	0.11560	0.145	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45041	-0.9288	10	0.45353	T	0.12	.	1.78	0.03029	0.3197:0.1333:0.3969:0.1501	.	699	Q92854	SEM4D_HUMAN	S	699	ENSP00000416523:P699S;ENSP00000405102:P699S;ENSP00000348822:P699S;ENSP00000388768:P699S	ENSP00000348822:P699S	P	-	1	0	SEMA4D	91183933	0.002000	0.14202	0.000000	0.03702	0.018000	0.09664	-0.074000	0.11450	-0.177000	0.10690	0.561000	0.74099	CCC	SEMA4D	-	NULL	ENSG00000187764		0.597	SEMA4D-018	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA4D	HGNC	protein_coding	OTTHUMT00000342411.1	70	0.00	0	G	NM_006378		91994113	91994113	-1	no_errors	ENST00000356444	ensembl	human	known	69_37n	missense	54	20.59	14	SNP	0.000	A
SGPL1	8879	genome.wustl.edu	37	10	72604392	72604392	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:72604392G>A	ENST00000373202.3	+	3	390	c.190G>A	c.(190-192)Gag>Aag	p.E64K		NM_003901.3	NP_003892.2	O95470	SGPL1_HUMAN	sphingosine-1-phosphate lyase 1	64					androgen metabolic process (GO:0008209)|apoptotic signaling pathway (GO:0097190)|ceramide metabolic process (GO:0006672)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|fatty acid metabolic process (GO:0006631)|fibroblast migration (GO:0010761)|hemopoiesis (GO:0030097)|kidney development (GO:0001822)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|palate development (GO:0060021)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|regulation of multicellular organism growth (GO:0040014)|skeletal system morphogenesis (GO:0048705)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid catabolic process (GO:0030149)|sphingolipid metabolic process (GO:0006665)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)	carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)|sphinganine-1-phosphate aldolase activity (GO:0008117)			large_intestine(4)	4						CTTCCAGCCAGAGAGTAAGTA	0.448																																					Colon(151;1054 2458 6676 40971)	dbGAP											0													138.0	124.0	129.0					10																	72604392		2203	4300	6503	-	-	-	SO:0001583	missense	0			AI128825	CCDS31216.1	10q21	2008-08-01			ENSG00000166224	ENSG00000166224			10817	protein-coding gene	gene with protein product		603729				9464245, 17090686	Standard	NM_003901		Approved	SPL	uc001jrm.3	O95470	OTTHUMG00000018421	ENST00000373202.3:c.190G>A	10.37:g.72604392G>A	ENSP00000362298:p.Glu64Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBD4|Q7Z732|Q9ULG8|Q9UN89	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E64K	ENST00000373202.3	37	c.190	CCDS31216.1	10	.	.	.	.	.	.	.	.	.	.	G	30	5.054592	0.93793	.	.	ENSG00000166224	ENST00000373202;ENST00000299297	T;T	0.43688	0.94;1.09	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.47040	0.1424	M	0.67700	2.07	0.80722	D	1	P	0.42010	0.768	B	0.43386	0.418	T	0.30621	-0.9972	10	0.18276	T	0.48	-31.4735	17.1394	0.86748	0.0:0.0:1.0:0.0	.	64	O95470	SGPL1_HUMAN	K	64;47	ENSP00000362298:E64K;ENSP00000299297:E47K	ENSP00000299297:E47K	E	+	1	0	SGPL1	72274398	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	5.449000	0.66619	2.778000	0.95560	0.650000	0.86243	GAG	SGPL1	-	NULL	ENSG00000166224		0.448	SGPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGPL1	HGNC	protein_coding	OTTHUMT00000048533.1	66	0.00	0	G	NM_003901		72604392	72604392	+1	no_errors	ENST00000373202	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	0.998	A
SH3GLB1	51100	genome.wustl.edu	37	1	87181436	87181436	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:87181436G>A	ENST00000370558.4	+	2	426	c.102G>A	c.(100-102)gaG>gaA	p.E34E	SH3GLB1_ENST00000482504.1_Silent_p.E34E|SH3GLB1_ENST00000535010.1_Intron	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	34	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		GCCAGGCTGAGAAGACAGAAT	0.323																																						dbGAP											0													77.0	81.0	80.0					1																	87181436		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.102G>A	1.37:g.87181436G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Silent	SNP	pfam_BAR_dom,pfam_BAR_dom-cont,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain	p.E34	ENST00000370558.4	37	c.102	CCDS710.1	1																																																																																			SH3GLB1	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom	ENSG00000097033		0.323	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB1	HGNC	protein_coding	OTTHUMT00000028287.2	47	0.00	0	G	NM_016009		87181436	87181436	+1	no_errors	ENST00000482504	ensembl	human	known	69_37n	silent	30	21.05	8	SNP	1.000	A
SHPRH	257218	genome.wustl.edu	37	6	146256486	146256486	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:146256486C>T	ENST00000367505.2	-	12	2925	c.2661G>A	c.(2659-2661)aaG>aaA	p.K887K	SHPRH_ENST00000438092.2_Silent_p.K887K|SHPRH_ENST00000275233.7_Silent_p.K887K|SHPRH_ENST00000367503.3_Silent_p.K887K			Q149N8	SHPRH_HUMAN	SNF2 histone linker PHD RING helicase, E3 ubiquitin protein ligase	887					DNA repair (GO:0006281)|nucleosome assembly (GO:0006334)|protein polyubiquitination (GO:0000209)	nucleosome (GO:0000786)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(33)|ovary(3)|pancreas(2)|prostate(7)|skin(1)|urinary_tract(1)	79		Ovarian(120;0.0365)		OV - Ovarian serous cystadenocarcinoma(155;1.47e-07)|GBM - Glioblastoma multiforme(68;0.0124)		GCTGAGGATTCTTCTTGCAGT	0.393																																						dbGAP											0													92.0	85.0	87.0					6																	146256486		1889	4109	5998	-	-	-	SO:0001819	synonymous_variant	0			AB095943	CCDS43513.1, CCDS47496.1, CCDS43513.2	6q24.2	2012-02-23	2012-02-23		ENSG00000146414	ENSG00000146414		"""RING-type (C3HC4) zinc fingers"""	19336	protein-coding gene	gene with protein product		608048	"""SNF2 histone linker PHD RING helicase"""			12837266	Standard	NM_001042683		Approved	FLJ90837, KIAA2023, bA545I5.2	uc003qlf.3	Q149N8	OTTHUMG00000015750	ENST00000367505.2:c.2661G>A	6.37:g.146256486C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q149N9|Q5VV79|Q68DS5|Q7Z5J5|Q8IVE8|Q8IWQ9|Q8N1S8|Q8NBR7	Silent	SNP	pfam_SNF2_N,pfam_Histone_H1/H5,superfamily_Znf_FYVE_PHD,superfamily_WW_Rsp5_WWP,smart_Helicase_ATP-bd,smart_Histone_H1/H5,smart_Znf_PHD,smart_Znf_RING,smart_Helicase_C,pfscan_Znf_RING,pfscan_Helicase_C	p.K887	ENST00000367505.2	37	c.2661	CCDS43513.2	6																																																																																			SHPRH	-	pfam_SNF2_N	ENSG00000146414		0.393	SHPRH-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SHPRH	HGNC	protein_coding	OTTHUMT00000042571.2	52	0.00	0	C	NM_173082		146256486	146256486	-1	no_errors	ENST00000367503	ensembl	human	known	69_37n	silent	46	11.54	6	SNP	1.000	T
SKI	6497	genome.wustl.edu	37	1	2234756	2234756	+	Silent	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:2234756C>G	ENST00000378536.4	+	3	1200	c.1128C>G	c.(1126-1128)ctC>ctG	p.L376L	SKI_ENST00000478223.2_3'UTR	NM_003036.3	NP_003027.1	P12755	SKI_HUMAN	SKI proto-oncogene	376					anterior/posterior axis specification (GO:0009948)|BMP signaling pathway (GO:0030509)|bone morphogenesis (GO:0060349)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|gene expression (GO:0010467)|lens morphogenesis in camera-type eye (GO:0002089)|myelination in peripheral nervous system (GO:0022011)|myotube differentiation (GO:0014902)|negative regulation of activin receptor signaling pathway (GO:0032926)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neural tube closure (GO:0001843)|nose morphogenesis (GO:0043585)|olfactory bulb development (GO:0021772)|palate development (GO:0060021)|positive regulation of DNA binding (GO:0043388)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|protein homotrimerization (GO:0070207)|regulation of apoptotic process (GO:0042981)|retina development in camera-type eye (GO:0060041)|skeletal muscle fiber development (GO:0048741)|SMAD protein signal transduction (GO:0060395)|somatic stem cell maintenance (GO:0035019)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase inhibitor activity (GO:0046811)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)|repressing transcription factor binding (GO:0070491)|SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(2)|lung(5)|prostate(1)|stomach(1)	10	all_cancers(77;0.000139)|all_epithelial(69;4.45e-05)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)			Epithelial(90;2.14e-37)|OV - Ovarian serous cystadenocarcinoma(86;2.72e-29)|GBM - Glioblastoma multiforme(42;2.45e-08)|Colorectal(212;5.33e-05)|COAD - Colon adenocarcinoma(227;0.000228)|Kidney(185;0.00268)|BRCA - Breast invasive adenocarcinoma(365;0.00471)|STAD - Stomach adenocarcinoma(132;0.0147)|KIRC - Kidney renal clear cell carcinoma(229;0.0385)|Lung(427;0.207)		GCCAGCGCCTCTCTGCTTTCC	0.602																																					Ovarian(177;144 1678 13697 20086 27838 40755)	dbGAP											0													152.0	154.0	154.0					1																	2234756		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X15218	CCDS39.1	1p36.33	2014-06-25	2014-06-25		ENSG00000157933	ENSG00000157933		"""SKI transcriptional corepressors"""	10896	protein-coding gene	gene with protein product		164780	"""v-ski avian sarcoma viral oncogene homolog"""			2762147	Standard	NM_003036		Approved		uc001aja.4	P12755	OTTHUMG00000001407	ENST00000378536.4:c.1128C>G	1.37:g.2234756C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYT7	Silent	SNP	pfam_c-SKI_SMAD4-bd_dom,pfam_Transform_Ski,superfamily_SAND_dom-like,superfamily_DNA-bd_dom_put	p.L376	ENST00000378536.4	37	c.1128	CCDS39.1	1																																																																																			SKI	-	NULL	ENSG00000157933		0.602	SKI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKI	HGNC	protein_coding	OTTHUMT00000004070.1	48	0.00	0	C	NM_003036		2234756	2234756	+1	no_errors	ENST00000378536	ensembl	human	known	69_37n	silent	44	26.67	16	SNP	0.999	G
SLAMF9	89886	genome.wustl.edu	37	1	159921589	159921589	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:159921589G>C	ENST00000368093.3	-	4	848	c.732C>G	c.(730-732)ttC>ttG	p.F244L	SLAMF9_ENST00000368092.3_Missense_Mutation_p.F153L|SLAMF9_ENST00000466773.1_5'UTR	NM_033438.3	NP_254273.2	Q96A28	SLAF9_HUMAN	SLAM family member 9	244						integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(1)|urinary_tract(1)	13	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CCAAGAGCAAGAAGATGAGCA	0.478																																						dbGAP											0													111.0	104.0	106.0					1																	159921589		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY034613	CCDS1191.1, CCDS53392.1	1q23.1	2013-01-11			ENSG00000162723	ENSG00000162723		"""Immunoglobulin superfamily / V-set domain containing"""	18430	protein-coding gene	gene with protein product		608589				11685473	Standard	NM_033438		Approved	CD2F-10, CD84-H1, SF2001	uc001fus.3	Q96A28	OTTHUMG00000024074	ENST00000368093.3:c.732C>G	1.37:g.159921589G>C	ENSP00000357072:p.Phe244Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRQ9|Q5JRR0|Q6UWG1	Missense_Mutation	SNP	pfam_Ig_V-set,pfscan_Ig-like	p.F244L	ENST00000368093.3	37	c.732	CCDS1191.1	1	.	.	.	.	.	.	.	.	.	.	G	0.160	-1.081834	0.01888	.	.	ENSG00000162723	ENST00000368093;ENST00000368092	T;T	0.37058	1.22;2.43	4.94	1.77	0.24775	.	0.973874	0.08446	N	0.944712	T	0.08044	0.0201	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.38023	-0.9680	8	.	.	.	-15.0281	7.6429	0.28305	0.0:0.3717:0.4577:0.1706	.	153;244	Q96A28-2;Q96A28	.;SLAF9_HUMAN	L	244;153	ENSP00000357072:F244L;ENSP00000357071:F153L	.	F	-	3	2	SLAMF9	158188213	0.075000	0.21258	0.002000	0.10522	0.001000	0.01503	0.748000	0.26305	0.634000	0.30469	-0.169000	0.13324	TTC	SLAMF9	-	NULL	ENSG00000162723		0.478	SLAMF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLAMF9	HGNC	protein_coding	OTTHUMT00000060630.1	58	0.00	0	G	NM_033438		159921589	159921589	-1	no_errors	ENST00000368093	ensembl	human	known	69_37n	missense	68	12.82	10	SNP	0.001	C
SLC45A3	85414	genome.wustl.edu	37	1	205628672	205628672	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:205628672C>T	ENST00000367145.3	-	5	1647	c.1352G>A	c.(1351-1353)aGt>aAt	p.S451N	SLC45A3_ENST00000460934.1_5'UTR	NM_033102.2	NP_149093.1	Q96JT2	S45A3_HUMAN	solute carrier family 45, member 3	451					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)			SLC45A3/BRAF(2)|SLC45A3/ELK4(18)|SLC45A3/ETV1(3)|SLC45A3/ETV5_ENST00000306376(2)|SLC45A3/ERG(50)	cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(7)|ovary(3)|prostate(5)	21	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0194)			GAGCAGGCCACTGCCTCCAGC	0.657			T	"""ETV1, ETV5, ELK4, ERG"""	prostate						OREG0014161	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP		Dom	yes		1	1q32	85414	"""solute carrier family 45, member 3"""		E	0													46.0	44.0	45.0					1																	205628672		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF109301	CCDS1458.1	1q32.1	2013-05-22	2005-10-04	2005-10-04	ENSG00000158715	ENSG00000158715		"""Solute carriers"""	8642	protein-coding gene	gene with protein product		605097	"""prostate cancer associated protein 6"", ""prostate cancer associated protein 2"", ""prostate cancer associated protein 8"""	PCANAP6, PCANAP2, PCANAP8		10613842, 11245466	Standard	XM_005245556		Approved	IPCA-6, prostein, IPCA-2, IPCA-8	uc001hda.1	Q96JT2	OTTHUMG00000037223	ENST00000367145.3:c.1352G>A	1.37:g.205628672C>T	ENSP00000356113:p.Ser451Asn	Somatic	2153	WXS	Illumina GAIIx	Phase_IV	A8K2U9	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S451N	ENST00000367145.3	37	c.1352	CCDS1458.1	1	.	.	.	.	.	.	.	.	.	.	C	8.783	0.928698	0.18131	.	.	ENSG00000158715	ENST00000367145	T	0.45276	0.9	4.31	2.32	0.28847	.	0.914911	0.09364	N	0.812406	T	0.31451	0.0797	L	0.36672	1.1	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21008	-1.0258	10	0.22706	T	0.39	-0.4904	8.9129	0.35563	0.0:0.7422:0.1638:0.0941	.	451	Q96JT2	S45A3_HUMAN	N	451	ENSP00000356113:S451N	ENSP00000356113:S451N	S	-	2	0	SLC45A3	203895295	0.001000	0.12720	0.018000	0.16275	0.361000	0.29550	0.560000	0.23500	1.046000	0.40249	0.491000	0.48974	AGT	SLC45A3	-	NULL	ENSG00000158715		0.657	SLC45A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A3	HGNC	protein_coding	OTTHUMT00000090619.1	28	0.00	0	C	NM_033102		205628672	205628672	-1	no_errors	ENST00000367145	ensembl	human	known	69_37n	missense	13	31.58	6	SNP	0.005	T
SLFN12	55106	genome.wustl.edu	37	17	33749892	33749892	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:33749892G>C	ENST00000394562.1	-	4	679	c.156C>G	c.(154-156)ctC>ctG	p.L52L	SLFN12_ENST00000460530.1_5'Flank|SLFN12_ENST00000452764.3_Silent_p.L52L|SLFN12_ENST00000304905.5_Silent_p.L52L			Q8IYM2	SLN12_HUMAN	schlafen family member 12	52							ATP binding (GO:0005524)			breast(1)|kidney(2)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18		Ovarian(249;0.17)		UCEC - Uterine corpus endometrioid carcinoma (308;0.0182)		CTCCAGAATTGAGCAGAGCAC	0.373																																						dbGAP											0													131.0	117.0	122.0					17																	33749892		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK001122	CCDS11295.1	17q12	2006-04-05			ENSG00000172123	ENSG00000172123			25500	protein-coding gene	gene with protein product		614955				12477932	Standard	NM_018042		Approved	FLJ10260	uc002hji.4	Q8IYM2	OTTHUMG00000132952	ENST00000394562.1:c.156C>G	17.37:g.33749892G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K711|Q9NP47	Silent	SNP	pfam_ATPase_AAA-4	p.L52	ENST00000394562.1	37	c.156	CCDS11295.1	17																																																																																			SLFN12	-	NULL	ENSG00000172123		0.373	SLFN12-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLFN12	HGNC	protein_coding	OTTHUMT00000256491.1	39	0.00	0	G	NM_018042		33749892	33749892	-1	no_errors	ENST00000304905	ensembl	human	known	69_37n	silent	33	19.51	8	SNP	0.113	C
SLMAP	7871	genome.wustl.edu	37	3	57835511	57835511	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:57835511C>G	ENST00000428312.1	+	5	581	c.487C>G	c.(487-489)Cag>Gag	p.Q163E	SLMAP_ENST00000295952.3_Missense_Mutation_p.Q163E|SLMAP_ENST00000449503.2_Missense_Mutation_p.Q163E|SLMAP_ENST00000383718.3_Missense_Mutation_p.Q163E|SLMAP_ENST00000295951.3_Missense_Mutation_p.Q163E|SLMAP_ENST00000416870.1_5'UTR			Q14BN4	SLMAP_HUMAN	sarcolemma associated protein	163	Necessary for targeting to centrosomes. {ECO:0000250}.				muscle contraction (GO:0006936)	cytoskeleton (GO:0005856)|integral component of plasma membrane (GO:0005887)|smooth endoplasmic reticulum (GO:0005790)				endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|urinary_tract(2)	18				BRCA - Breast invasive adenocarcinoma(55;0.000271)|KIRC - Kidney renal clear cell carcinoma(284;0.0602)|Kidney(284;0.0754)|OV - Ovarian serous cystadenocarcinoma(275;0.182)		TATGTACTCTCAGGAACTATT	0.323																																						dbGAP											0													162.0	158.0	159.0					3																	57835511		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100750	CCDS33774.1	3p21.2-p14.3	2008-07-18			ENSG00000163681	ENSG00000163681			16643	protein-coding gene	gene with protein product	"""Sarcolemmal-associated protein"""	602701				9405447, 11042152	Standard	NM_007159		Approved	SLAP, KIAA1601	uc003djd.1	Q14BN4	OTTHUMG00000133764	ENST00000428312.1:c.487C>G	3.37:g.57835511C>G	ENSP00000398661:p.Gln163Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14C95|Q6AI54|Q6UXC9|Q6ZVQ8|Q8NCW9|Q9H297|Q9HCH1|Q9Y681	Missense_Mutation	SNP	pfam_FHA_dom,pfam_PFD_beta-like,superfamily_SMAD_FHA_domain,superfamily_Prefoldin,smart_FHA_dom,pfscan_FHA_dom	p.Q163E	ENST00000428312.1	37	c.487		3	.	.	.	.	.	.	.	.	.	.	C	17.53	3.413267	0.62511	.	.	ENSG00000163681	ENST00000295951;ENST00000295952;ENST00000383718;ENST00000428312;ENST00000449503	T;T;T;T;T	0.55052	0.54;0.54;0.54;0.54;0.54	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.61751	0.2372	L	0.33189	0.99	0.80722	D	1	B;D;D;B	0.71674	0.207;0.998;0.992;0.207	B;D;D;B	0.75484	0.171;0.986;0.984;0.316	T	0.52726	-0.8537	10	0.12103	T	0.63	-7.9971	19.425	0.94737	0.0:1.0:0.0:0.0	.	163;163;163;163	Q14BN4-2;Q14BN4;Q14BN4-3;Q14BN4-6	.;SLMAP_HUMAN;.;.	E	163	ENSP00000295951:Q163E;ENSP00000295952:Q163E;ENSP00000373224:Q163E;ENSP00000398661:Q163E;ENSP00000412945:Q163E	ENSP00000295951:Q163E	Q	+	1	0	SLMAP	57810551	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.232000	0.78116	2.584000	0.87258	0.563000	0.77884	CAG	SLMAP	-	NULL	ENSG00000163681		0.323	SLMAP-013	KNOWN	basic	protein_coding	SLMAP	HGNC	protein_coding	OTTHUMT00000351584.1	119	0.00	0	C	NM_007159		57835511	57835511	+1	no_errors	ENST00000428312	ensembl	human	known	69_37n	missense	99	23.85	31	SNP	1.000	G
SMAP1	60682	genome.wustl.edu	37	6	71567695	71567695	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:71567695G>A	ENST00000370455.3	+	10	1280	c.1032G>A	c.(1030-1032)tcG>tcA	p.S344S	B3GAT2_ENST00000230053.6_3'UTR|SMAP1_ENST00000316999.5_Silent_p.S317S|SMAP1_ENST00000370452.3_Silent_p.S317S	NM_001044305.1|NM_001281440.1	NP_001037770.1|NP_001268369.1	Q8IYB5	SMAP1_HUMAN	small ArfGAP 1	344					positive regulation of erythrocyte differentiation (GO:0045648)|regulation of ARF GTPase activity (GO:0032312)|regulation of clathrin-mediated endocytosis (GO:2000369)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(6)|prostate(1)|urinary_tract(1)	15						GCTTTCCATCGATGGGCGTGC	0.493																																						dbGAP											0													111.0	104.0	106.0					6																	71567695		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023221	CCDS4973.1, CCDS43478.1, CCDS64459.1, CCDS75478.1	6q12-q13	2009-11-30	2008-09-05		ENSG00000112305	ENSG00000112305		"""ADP-ribosylation factor GTPase activating proteins"""	19651	protein-coding gene	gene with protein product		611372	"""stromal membrane-associated protein 1"", ""stromal membrane-associated GTPase-activating protein 1"""			9644265, 12119110	Standard	NM_001044305		Approved	FLJ13159, SMAP-1	uc003pfr.3	Q8IYB5	OTTHUMG00000014996	ENST00000370455.3:c.1032G>A	6.37:g.71567695G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53H70|Q5SYQ2|Q6PK24|Q8NDH4|Q96L38|Q96L39|Q9H8X4	Silent	SNP	pfam_ArfGAP,superfamily_ArfGAP,smart_ArfGAP,prints_ArfGAP,pfscan_ArfGAP	p.S344	ENST00000370455.3	37	c.1032	CCDS43478.1	6																																																																																			SMAP1	-	NULL	ENSG00000112305		0.493	SMAP1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAP1	HGNC	protein_coding	OTTHUMT00000041149.1	36	0.00	0	G	NM_001044305		71567695	71567695	+1	no_errors	ENST00000370455	ensembl	human	known	69_37n	silent	28	28.21	11	SNP	0.980	A
SMC3	9126	genome.wustl.edu	37	10	112364018	112364018	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:112364018G>C	ENST00000361804.4	+	29	3738	c.3612G>C	c.(3610-3612)gaG>gaC	p.E1204D		NM_005445.3	NP_005436.1	Q9UQE7	SMC3_HUMAN	structural maintenance of chromosomes 3	1204					DNA repair (GO:0006281)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid cohesion (GO:0007064)|mitotic spindle organization (GO:0007052)|negative regulation of DNA endoreduplication (GO:0032876)|regulation of DNA replication (GO:0006275)|signal transduction (GO:0007165)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	basement membrane (GO:0005604)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cohesin core heterodimer (GO:0008280)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|lateral element (GO:0000800)|meiotic cohesin complex (GO:0030893)|nuclear matrix (GO:0016363)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|dynein binding (GO:0045502)|microtubule motor activity (GO:0003777)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(5)|lung(13)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		Breast(234;0.0848)|Lung NSC(174;0.238)		Epithelial(162;0.00206)|all cancers(201;0.0227)|BRCA - Breast invasive adenocarcinoma(275;0.127)		TCACAGCAGAGATGGCCAAAG	0.318																																						dbGAP											0													126.0	121.0	123.0					10																	112364018		2203	4297	6500	-	-	-	SO:0001583	missense	0			AF020043	CCDS31285.1	10q25	2014-09-17	2006-07-06	2006-07-06	ENSG00000108055	ENSG00000108055		"""Structural maintenance of chromosomes proteins"", ""Proteoglycans / Extracellular Matrix : Other"""	2468	protein-coding gene	gene with protein product	"""bamacan proteoglycan"""	606062	"""chondroitin sulfate proteoglycan 6 (bamacan)"""	CSPG6		9506951, 10358101	Standard	NM_005445		Approved	HCAP, BAM, SMC3L1, bamacan	uc001kze.3	Q9UQE7	OTTHUMG00000019042	ENST00000361804.4:c.3612G>C	10.37:g.112364018G>C	ENSP00000354720:p.Glu1204Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K156|O60464|Q5T482	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge	p.E1204D	ENST00000361804.4	37	c.3612	CCDS31285.1	10	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750543	0.49257	.	.	ENSG00000108055	ENST00000361804	T	0.77620	-1.11	5.62	4.72	0.59763	.	0.000000	0.85682	D	0.000000	T	0.74045	0.3665	M	0.67953	2.075	0.80722	D	1	P	0.34412	0.453	B	0.33196	0.159	T	0.73591	-0.3934	10	0.45353	T	0.12	.	11.1487	0.48444	0.1585:0.0:0.8415:0.0	.	1204	Q9UQE7	SMC3_HUMAN	D	1204	ENSP00000354720:E1204D	ENSP00000354720:E1204D	E	+	3	2	SMC3	112354008	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.093000	0.50217	1.397000	0.46682	0.585000	0.79938	GAG	SMC3	-	NULL	ENSG00000108055		0.318	SMC3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SMC3	HGNC	protein_coding	OTTHUMT00000050337.1	72	0.00	0	G	NM_005445		112364018	112364018	+1	no_errors	ENST00000361804	ensembl	human	known	69_37n	missense	67	15.19	12	SNP	1.000	C
SNRPD3	6634	genome.wustl.edu	37	22	24967993	24967993	+	3'UTR	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:24967993G>A	ENST00000215829.3	+	0	1016				SNRPD3_ENST00000402849.1_Silent_p.L109L	NM_001278656.1|NM_004175.3	NP_001265585.1|NP_004166.1	P62318	SMD3_HUMAN	small nuclear ribonucleoprotein D3 polypeptide 18kDa						gene expression (GO:0010467)|histone mRNA metabolic process (GO:0008334)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|spliceosomal snRNP assembly (GO:0000387)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|methylosome (GO:0034709)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|pICln-Sm protein complex (GO:0034715)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN-Sm protein complex (GO:0034719)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)|U12-type spliceosomal complex (GO:0005689)|U4 snRNP (GO:0005687)|U7 snRNP (GO:0005683)	enzyme binding (GO:0019899)|histone pre-mRNA DCP binding (GO:0071208)|poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	6						CAGGTTATCTGAGTTCATTGG	0.393																																						dbGAP											0													39.0	36.0	37.0					22																	24967993		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			U15009	CCDS13828.1	22q11.23	2011-10-11	2002-08-29		ENSG00000100028	ENSG00000100028			11160	protein-coding gene	gene with protein product		601062	"""small nuclear ribonucleoprotein D3 polypeptide (18kD)"""			1701240, 7527560	Standard	NM_004175		Approved	SMD3, Sm-D3	uc003aam.1	P62318	OTTHUMG00000150727	ENST00000215829.3:c.*48G>A	22.37:g.24967993G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJP7|B5BU13|P43331	Silent	SNP	pfam_Ribonucl_LSM,superfamily_LSM_dom,smart_Ribonucl_LSM_euk/arc	p.L109	ENST00000215829.3	37	c.327	CCDS13828.1	22																																																																																			SNRPD3	-	NULL	ENSG00000100028		0.393	SNRPD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRPD3	HGNC	protein_coding	OTTHUMT00000319813.1	21	0.00	0	G	NM_004175		24967993	24967993	+1	no_errors	ENST00000402849	ensembl	human	known	69_37n	silent	15	40.00	10	SNP	0.455	A
SOWAHB	345079	genome.wustl.edu	37	4	77817742	77817742	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:77817742C>G	ENST00000334306.2	-	1	1260	c.1261G>C	c.(1261-1263)Gag>Cag	p.E421Q		NM_001029870.1	NP_001025041.1	A6NEL2	SWAHB_HUMAN	sosondowah ankyrin repeat domain family member B	421																	TGCAGCCCCTCTTCAGAAGCC	0.607																																						dbGAP											0													53.0	64.0	60.0					4																	77817742		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34017.1	4q21.1	2013-01-10	2012-01-12	2012-01-12	ENSG00000186212	ENSG00000186212		"""Ankyrin repeat domain containing"""	32958	protein-coding gene	gene with protein product			"""ankyrin repeat domain 56"""	ANKRD56		22234889	Standard	NM_001029870		Approved		uc003hki.3	A6NEL2	OTTHUMG00000160876	ENST00000334306.2:c.1261G>C	4.37:g.77817742C>G	ENSP00000334879:p.Glu421Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP29	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E421Q	ENST00000334306.2	37	c.1261	CCDS34017.1	4	.	.	.	.	.	.	.	.	.	.	C	17.02	3.283251	0.59867	.	.	ENSG00000186212	ENST00000334306	T	0.08720	3.06	5.05	5.05	0.67936	.	0.952839	0.08638	U	0.915953	T	0.08133	0.0203	N	0.24115	0.695	0.09310	N	0.999999	D	0.54397	0.966	P	0.44860	0.462	T	0.23583	-1.0184	10	0.32370	T	0.25	-2.0319	9.3516	0.38142	0.0:0.9059:0.0:0.0941	.	421	A6NEL2	ANR56_HUMAN	Q	421	ENSP00000334879:E421Q	ENSP00000334879:E421Q	E	-	1	0	ANKRD56	78036766	0.073000	0.21202	0.634000	0.29324	0.008000	0.06430	1.235000	0.32671	2.611000	0.88343	0.655000	0.94253	GAG	SOWAHB	-	NULL	ENSG00000186212		0.607	SOWAHB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOWAHB	HGNC	protein_coding	OTTHUMT00000362762.1	23	0.00	0	C	NM_001029870		77817742	77817742	-1	no_errors	ENST00000334306	ensembl	human	known	69_37n	missense	18	28.00	7	SNP	0.250	G
SRGAP1	57522	genome.wustl.edu	37	12	64383792	64383792	+	Silent	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:64383792G>C	ENST00000355086.3	+	3	890	c.366G>C	c.(364-366)ctG>ctC	p.L122L	SRGAP1_ENST00000357825.3_Silent_p.L122L|SRGAP1_ENST00000543397.1_Silent_p.L82L	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	122	F-BAR domain.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		ACATCTATCTGAACAATGTGA	0.418																																						dbGAP											0													220.0	181.0	195.0					12																	64383792		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.366G>C	12.37:g.64383792G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8A3|Q9P2P2	Silent	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L122	ENST00000355086.3	37	c.366	CCDS8967.1	12																																																																																			SRGAP1	-	NULL	ENSG00000196935		0.418	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	62	0.00	0	G			64383792	64383792	+1	no_errors	ENST00000355086	ensembl	human	known	69_37n	silent	53	13.11	8	SNP	1.000	C
SRSF10	10772	genome.wustl.edu	37	1	24294156	24294156	+	IGR	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:24294156G>C	ENST00000492112.2	-	0	1631				SRSF10_ENST00000374453.3_3'UTR|SRSF10_ENST00000344989.6_Missense_Mutation_p.I183M|SRSF10_ENST00000484146.2_Missense_Mutation_p.I165M|SRSF10_ENST00000453840.3_Missense_Mutation_p.I182M|SRSF10_ENST00000374452.5_3'UTR|SRSF10_ENST00000341154.6_5'UTR			O75494	SRS10_HUMAN	serine/arginine-rich splicing factor 10						cytoplasmic transport (GO:0016482)|mRNA export from nucleus (GO:0006406)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal tri-snRNP complex assembly (GO:0000244)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RS domain binding (GO:0050733)|unfolded protein binding (GO:0051082)										tccgctttcagatctttcttg	0.413																																						dbGAP											0													7.0	3.0	5.0					1																	24294156		1318	2080	3398	-	-	-	SO:0001628	intergenic_variant	0			AF047448	CCDS30629.1, CCDS30630.1, CCDS53280.1, CCDS53281.1, CCDS53282.1, CCDS53283.1, CCDS72728.1	1p36.11	2014-06-13	2010-06-22	2010-06-22	ENSG00000188529	ENSG00000188529		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	16713	protein-coding gene	gene with protein product	"""splicing factor, arginine/serine-rich 13"", ""SR splicing factor 10"", ""protein phosphatase 1, regulatory subunit 149"""	605221	"""FUS-interacting protein (serine-arginine rich) 2"", ""FUS interacting protein (serine/arginine-rich) 1"", ""splicing factor, arginine/serine-rich 13A"", ""neural-salient SR protein"""	FUSIP2, FUSIP1, SFRS13A		11891055, 20516191	Standard	XM_006710298		Approved	TASR1, TASR2, SRp38, SRrp40, SFRS13, PPP1R149	uc021oir.1	O75494	OTTHUMG00000013893		1.37:g.24294156G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFM6|A6NI42|A6NIU7|B4DJP9|O60572|Q5JRH9|Q5JRI0|Q5JRI2|Q5JRI3|Q5JRI4|Q96G09|Q96P17	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.I183M	ENST00000492112.2	37	c.549	CCDS30630.1	1	.	.	.	.	.	.	.	.	.	.	G	11.41	1.631807	0.29068	.	.	ENSG00000188529	ENST00000344989;ENST00000484146;ENST00000453840	T	0.15017	2.46	2.8	2.8	0.32819	.	.	.	.	.	T	0.12305	0.0299	N	0.08118	0	0.20074	N	0.999938	P	0.42518	0.782	P	0.46172	0.506	T	0.13791	-1.0496	9	0.87932	D	0	.	9.2899	0.37780	0.0:0.0:1.0:0.0	.	183	O75494-3	.	M	183;182;165	ENSP00000342913:I183M	ENSP00000342913:I183M	I	-	3	3	SRSF10	24166743	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.750000	0.55157	1.885000	0.54596	0.557000	0.71058	ATC	SRSF10	-	NULL	ENSG00000188529		0.413	SRSF10-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	SRSF10	HGNC	protein_coding	OTTHUMT00000038950.2	13	0.00	0	G	NM_006625		24294156	24294156	-1	no_errors	ENST00000344989	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	1.000	C
SSR1	6745	genome.wustl.edu	37	6	7295635	7295635	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:7295635C>T	ENST00000244763.4	-	7	869	c.783G>A	c.(781-783)ttG>ttA	p.L261L	SSR1_ENST00000397511.2_Silent_p.L261L|SSR1_ENST00000479365.1_Silent_p.L261L|SSR1_ENST00000474597.1_Silent_p.L261L|RP11-69L16.4_ENST00000379928.4_RNA|SSR1_ENST00000489567.1_Silent_p.L193L|SSR1_ENST00000534851.1_Silent_p.L234L	NM_003144.3	NP_003135.2	P43307	SSRA_HUMAN	signal sequence receptor, alpha	261					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|positive regulation of cell proliferation (GO:0008284)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|large_intestine(3)|lung(2)|prostate(1)	9	Ovarian(93;0.0398)					TGATTTGATTCAATGTTTCCT	0.328																																						dbGAP											0													115.0	104.0	108.0					6																	7295635		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4499.1	6p24.3	2010-11-24	2008-08-26		ENSG00000124783	ENSG00000124783			11323	protein-coding gene	gene with protein product	"""translocon-associated protein alpha"""	600868					Standard	NM_001292008		Approved	TRAPA	uc003mxf.4	P43307	OTTHUMG00000014202	ENST00000244763.4:c.783G>A	6.37:g.7295635C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K685|Q53GX2|Q53H19|Q5TAM3|Q6IB43|Q8NBH9|Q96IA2|Q9TNQ8|Q9UN49	Silent	SNP	pfam_TRAP_alpha	p.L261	ENST00000244763.4	37	c.783	CCDS4499.1	6																																																																																			SSR1	-	pfam_TRAP_alpha	ENSG00000124783		0.328	SSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSR1	HGNC	protein_coding	OTTHUMT00000039775.2	102	0.00	0	C			7295635	7295635	-1	no_errors	ENST00000244763	ensembl	human	known	69_37n	silent	84	14.29	14	SNP	1.000	T
ST18	9705	genome.wustl.edu	37	8	53084928	53084928	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:53084928C>G	ENST00000276480.7	-	10	1176	c.493G>C	c.(493-495)Gac>Cac	p.D165H		NM_014682.2	NP_055497.1	O60284	ST18_HUMAN	suppression of tumorigenicity 18, zinc finger	165					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(14)|lung(38)|ovary(4)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	85		Lung NSC(129;0.131)|all_epithelial(80;0.217)|all_lung(136;0.229)				AAGCACTCGTCTGCTTCATCG	0.398																																						dbGAP											0													116.0	106.0	109.0					8																	53084928		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011107	CCDS6149.1	8q11.23	2014-03-24	2014-03-24	2002-12-13	ENSG00000147488	ENSG00000147488		"""Zinc fingers, C2HC-type containing"""	18695	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 3"""		"""zinc finger protein 387"", ""suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein)"""	ZNF387		15489893	Standard	NM_014682		Approved	KIAA0535, ZC2HC10, NZF3	uc003xra.2	O60284	OTTHUMG00000164233	ENST00000276480.7:c.493G>C	8.37:g.53084928C>G	ENSP00000276480:p.Asp165His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RY1	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.D165H	ENST00000276480.7	37	c.493	CCDS6149.1	8	.	.	.	.	.	.	.	.	.	.	C	3.982	-0.006207	0.07773	.	.	ENSG00000147488	ENST00000276480;ENST00000517580	T;T	0.45276	0.9;0.9	5.63	3.83	0.44106	.	0.644929	0.16806	N	0.198789	T	0.29093	0.0723	L	0.31294	0.92	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.18335	-1.0340	10	0.41790	T	0.15	-8.5495	7.0389	0.25008	0.0:0.5881:0.269:0.1429	.	165	O60284	ST18_HUMAN	H	165	ENSP00000276480:D165H;ENSP00000428521:D165H	ENSP00000276480:D165H	D	-	1	0	ST18	53247481	0.716000	0.27956	0.008000	0.14137	0.122000	0.20287	1.508000	0.35769	0.721000	0.32231	0.655000	0.94253	GAC	ST18	-	NULL	ENSG00000147488		0.398	ST18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST18	HGNC	protein_coding	OTTHUMT00000377867.1	45	0.00	0	C			53084928	53084928	-1	no_errors	ENST00000276480	ensembl	human	known	69_37n	missense	36	32.08	17	SNP	0.149	G
ST7L	54879	genome.wustl.edu	37	1	113084637	113084637	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:113084637G>C	ENST00000358039.4	-	14	1869	c.1565C>G	c.(1564-1566)tCt>tGt	p.S522C	ST7L_ENST00000538187.1_Missense_Mutation_p.S466C|ST7L_ENST00000369666.1_Missense_Mutation_p.S505C|ST7L_ENST00000360743.4_Missense_Mutation_p.S491C|ST7L_ENST00000490067.1_Missense_Mutation_p.S505C|ST7L_ENST00000369669.1_Missense_Mutation_p.S339C|ST7L_ENST00000343210.7_Missense_Mutation_p.S522C|ST7L_ENST00000544629.1_Missense_Mutation_p.S457C|ST7L_ENST00000369668.2_Missense_Mutation_p.S522C|ST7L_ENST00000463235.1_5'UTR	NM_017744.4|NM_138727.3	NP_060214.2|NP_620055.1	Q8TDW4	ST7L_HUMAN	suppression of tumorigenicity 7 like	522					negative regulation of cell growth (GO:0030308)	integral component of membrane (GO:0016021)				endometrium(1)|kidney(4)|large_intestine(3)|lung(1)|prostate(2)|stomach(1)|urinary_tract(3)	15	Lung SC(450;0.246)	all_cancers(81;1.44e-07)|all_epithelial(167;7.64e-07)|all_lung(203;2.16e-05)|Lung NSC(69;3.86e-05)		Lung(183;0.0234)|all cancers(265;0.0246)|Epithelial(280;0.0342)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|LUSC - Lung squamous cell carcinoma(189;0.133)		CATTGCTGTAGAAGAGCAAAA	0.383																																						dbGAP											0													102.0	97.0	99.0					1																	113084637		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB081317	CCDS848.1, CCDS849.1, CCDS850.1, CCDS852.1	1p13.1	2008-06-06			ENSG00000007341	ENSG00000007341			18441	protein-coding gene	gene with protein product						12012006	Standard	NM_138729		Approved	FLJ20284, STLR, ST7R, FAM4B	uc001ecd.3	Q8TDW4	OTTHUMG00000011753	ENST00000358039.4:c.1565C>G	1.37:g.113084637G>C	ENSP00000350734:p.Ser522Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4S7|Q49AH6|Q5TEI4|Q5U5K6|Q6N067|Q7Z2Z0|Q7Z3C2|Q8N7P8|Q8TDW1|Q8TDW2|Q8TDW3|Q9NXF3	Missense_Mutation	SNP	pfam_ST7	p.S522C	ENST00000358039.4	37	c.1565	CCDS848.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.8|22.8	4.339390|4.339390	0.81911|0.81911	.|.	.|.	ENSG00000007341|ENSG00000007341	ENST00000418497|ENST00000358039;ENST00000360743;ENST00000369673;ENST00000544629;ENST00000369669;ENST00000490067;ENST00000369668;ENST00000343210;ENST00000369666;ENST00000538187	.|T;T;T;T;T;T;T;T;T	.|0.17528	.|2.27;2.46;2.27;2.27;2.27;2.27;2.27;2.27;2.27	6.11|6.11	5.19|5.19	0.71726|0.71726	.|.	.|0.110125	.|0.64402	.|D	.|0.000005	T|T	0.10208|0.10208	0.0250|0.0250	N|N	0.08118|0.08118	0|0	0.80722|0.80722	D|D	1|1	.|D;D;P;P;D;D;D;D	.|0.76494	.|0.992;0.999;0.933;0.94;0.967;0.967;0.98;0.967	.|P;D;P;P;P;P;P;P	.|0.65323	.|0.873;0.934;0.77;0.694;0.694;0.77;0.818;0.886	T|T	0.03673|0.03673	-1.1014|-1.1014	5|10	.|0.62326	.|D	.|0.03	-18.1433|-18.1433	6.2845|6.2845	0.21025|0.21025	0.2396:0.0:0.7604:0.0|0.2396:0.0:0.7604:0.0	.|.	.|466;457;457;522;505;505;491;522	.|B7Z7D4;B7Z3J2;F5H2P3;Q8TDW4-5;Q8TDW4-6;Q8TDW4-3;Q8TDW4-2;Q8TDW4	.|.;.;.;.;.;.;.;ST7L_HUMAN	V|C	266|522;491;272;457;339;505;522;522;505;466	.|ENSP00000350734:S522C;ENSP00000353972:S491C;ENSP00000445499:S457C;ENSP00000358683:S339C;ENSP00000417140:S505C;ENSP00000358682:S522C;ENSP00000345312:S522C;ENSP00000358680:S505C;ENSP00000444021:S466C	.|ENSP00000345312:S522C	L|S	-|-	1|2	2|0	ST7L|ST7L	112886160|112886160	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	7.425000|7.425000	0.80255|0.80255	2.906000|2.906000	0.99361|0.99361	0.655000|0.655000	0.94253|0.94253	CTA|TCT	ST7L	-	pfam_ST7	ENSG00000007341		0.383	ST7L-001	KNOWN	basic|CCDS	protein_coding	ST7L	HGNC	protein_coding	OTTHUMT00000032504.3	60	0.00	0	G			113084637	113084637	-1	no_errors	ENST00000358039	ensembl	human	known	69_37n	missense	60	16.67	12	SNP	1.000	C
STK10	6793	genome.wustl.edu	37	5	171488249	171488249	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:171488249C>G	ENST00000176763.5	-	14	2449	c.2106G>C	c.(2104-2106)caG>caC	p.Q702H		NM_005990.3	NP_005981.3	O94804	STK10_HUMAN	serine/threonine kinase 10	702					cell cycle (GO:0007049)|lymphocyte aggregation (GO:0071593)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of lymphocyte migration (GO:2000401)|signal transduction by phosphorylation (GO:0023014)	extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|polo kinase kinase activity (GO:0042801)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(15)|ovary(6)|pancreas(1)|prostate(1)|testis(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	47	Renal(175;0.000159)|Lung NSC(126;0.0056)|all_lung(126;0.0094)	Medulloblastoma(196;0.00868)|all_neural(177;0.026)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			GGTCCTCCTTCTGCTTGGCTA	0.582																																						dbGAP											0													135.0	123.0	127.0					5																	171488249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB015718	CCDS34290.1	5q35.1	2008-07-18			ENSG00000072786	ENSG00000072786			11388	protein-coding gene	gene with protein product		603919				10199912	Standard	NM_005990		Approved	LOK, PRO2729	uc003mbo.1	O94804	OTTHUMG00000163265	ENST00000176763.5:c.2106G>C	5.37:g.171488249C>G	ENSP00000176763:p.Gln702His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND35|B2R8F5|B3KMY1|Q6NSK0|Q9UIW4	Missense_Mutation	SNP	pfam_PKK,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q702H	ENST00000176763.5	37	c.2106	CCDS34290.1	5	.	.	.	.	.	.	.	.	.	.	C	21.4	4.144251	0.77888	.	.	ENSG00000072786	ENST00000176763;ENST00000545839	T	0.33865	1.39	4.99	4.99	0.66335	.	0.000000	0.85682	D	0.000000	T	0.62780	0.2456	M	0.79926	2.475	0.58432	D	0.999997	D	0.89917	1.0	D	0.85130	0.997	T	0.68330	-0.5437	10	0.72032	D	0.01	.	15.7898	0.78345	0.0:1.0:0.0:0.0	.	702	O94804	STK10_HUMAN	H	702	ENSP00000176763:Q702H	ENSP00000176763:Q702H	Q	-	3	2	STK10	171420854	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.621000	0.67743	2.299000	0.77371	0.455000	0.32223	CAG	STK10	-	pfam_PKK	ENSG00000072786		0.582	STK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK10	HGNC	protein_coding	OTTHUMT00000372374.2	49	0.00	0	C	NM_005990		171488249	171488249	-1	no_errors	ENST00000176763	ensembl	human	known	69_37n	missense	74	14.94	13	SNP	1.000	G
STK38	11329	genome.wustl.edu	37	6	36489522	36489522	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:36489522C>G	ENST00000229812.7	-	5	664	c.379G>C	c.(379-381)Gaa>Caa	p.E127Q	RN7SL748P_ENST00000483066.2_RNA	NM_007271.2	NP_009202.1			serine/threonine kinase 38											NS(1)|endometrium(4)|large_intestine(2)|lung(9)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TGCTCTTTTTCAAGCATATCT	0.308																																					Colon(180;997 3561 16158)	dbGAP											0													121.0	130.0	127.0					6																	36489522		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4822.1	6p21	2006-10-06			ENSG00000112079	ENSG00000112079			17847	protein-coding gene	gene with protein product		606964				7761441	Standard	NM_007271		Approved	NDR	uc003omh.3	Q15208	OTTHUMG00000014598	ENST00000229812.7:c.379G>C	6.37:g.36489522C>G	ENSP00000229812:p.Glu127Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Prot_kinase_cat_dom	p.E127Q	ENST00000229812.7	37	c.379	CCDS4822.1	6	.	.	.	.	.	.	.	.	.	.	C	17.00	3.277806	0.59758	.	.	ENSG00000112079	ENST00000229812	T	0.66815	-0.23	5.49	5.49	0.81192	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.089443	0.85682	D	0.000000	T	0.49795	0.1578	N	0.11154	0.105	0.80722	D	1	B	0.25105	0.118	B	0.41646	0.362	T	0.54536	-0.8279	10	0.41790	T	0.15	.	19.5755	0.95441	0.0:1.0:0.0:0.0	.	127	Q15208	STK38_HUMAN	Q	127	ENSP00000229812:E127Q	ENSP00000229812:E127Q	E	-	1	0	STK38	36597500	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.809000	0.69172	2.865000	0.98341	0.655000	0.94253	GAA	STK38	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000112079		0.308	STK38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK38	HGNC	protein_coding	OTTHUMT00000040346.1	52	0.00	0	C	NM_007271		36489522	36489522	-1	no_errors	ENST00000229812	ensembl	human	known	69_37n	missense	59	18.06	13	SNP	1.000	G
STRADA	92335	genome.wustl.edu	37	17	61784684	61784684	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:61784684G>C	ENST00000336174.6	-	9	788	c.676C>G	c.(676-678)Cgg>Ggg	p.R226G	STRADA_ENST00000447001.3_Missense_Mutation_p.R182G|STRADA_ENST00000580039.1_5'UTR|STRADA_ENST00000245865.5_Missense_Mutation_p.R168G|STRADA_ENST00000582137.1_Missense_Mutation_p.R197G|STRADA_ENST00000375840.4_Missense_Mutation_p.R168G|STRADA_ENST00000579340.1_Intron|STRADA_ENST00000392950.4_Missense_Mutation_p.R189G|RP11-51F16.8_ENST00000580553.1_3'UTR	NM_001003787.2	NP_001003787.1	Q7RTN6	STRAA_HUMAN	STE20-related kinase adaptor alpha	226	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of protein kinase activity (GO:0032147)|cell cycle arrest (GO:0007050)|insulin receptor signaling pathway (GO:0008286)|protein export from nucleus (GO:0006611)|protein phosphorylation (GO:0006468)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase binding (GO:0019900)|protein kinase activator activity (GO:0030295)|transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|liver(1)|lung(2)|ovary(1)|prostate(2)	13						ACTCGCTGCCGCTGCCCATGG	0.592																																						dbGAP											0													103.0	92.0	96.0					17																	61784684		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF308302	CCDS11642.1, CCDS32703.1, CCDS42367.1, CCDS54156.1, CCDS58585.1	17q23.3	2014-09-04			ENSG00000266173	ENSG00000266173			30172	protein-coding gene	gene with protein product	"""STE20-like pseudokinase"""	608626				12805220, 17921699	Standard	NM_153335		Approved	NY-BR-96, LYK5, Stlk, STRAD	uc002jbm.3	Q7RTN6	OTTHUMG00000178908	ENST00000336174.6:c.676C>G	17.37:g.61784684G>C	ENSP00000336655:p.Arg226Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDE3|B4DW17|J3KTC9|Q5JPI2|Q7Z4K9|Q8NC31|Q8NCF1|Q9H272	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R226G	ENST00000336174.6	37	c.676	CCDS32703.1	17	.	.	.	.	.	.	.	.	.	.	g	21.2	4.107911	0.77096	.	.	ENSG00000125695	ENST00000336174;ENST00000375840;ENST00000447001;ENST00000392950;ENST00000245865	T;T;T;T	0.59364	0.41;0.39;0.27;0.33	5.46	4.49	0.54785	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.046377	0.85682	D	0.000000	T	0.72614	0.3482	M	0.63428	1.95	0.80722	D	1	D;D;D;P;D;D;D	0.89917	1.0;0.999;0.998;0.814;1.0;0.997;0.998	D;D;D;B;D;D;D	0.78314	0.991;0.976;0.97;0.413;0.986;0.95;0.98	T	0.76228	-0.3036	10	0.87932	D	0	.	14.4689	0.67501	0.0709:0.0:0.9291:0.0	.	197;182;168;168;189;189;226	B4DW17;B4DDE3;Q5JPI2;Q86YC8;Q7RTN6-2;Q7RTN6-3;Q7RTN6	.;.;.;.;.;.;STRAA_HUMAN	G	226;168;182;189;188	ENSP00000336655:R226G;ENSP00000365000:R168G;ENSP00000398841:R182G;ENSP00000376677:R189G	ENSP00000245865:R188G	R	-	1	2	STRADA	59138416	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.873000	0.56093	1.432000	0.47375	0.556000	0.70494	CGG	STRADA	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000266173		0.592	STRADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRADA	HGNC	protein_coding	OTTHUMT00000443894.1	45	0.00	0	G			61784684	61784684	-1	no_errors	ENST00000336174	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	1.000	C
SUDS3	64426	genome.wustl.edu	37	12	118821844	118821844	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:118821844C>T	ENST00000543473.1	+	3	552	c.240C>T	c.(238-240)ctC>ctT	p.L80L	SUDS3_ENST00000397564.2_Silent_p.L80L	NM_022491.2	NP_071936.2	Q9H7L9	SDS3_HUMAN	suppressor of defective silencing 3 homolog (S. cerevisiae)	80	Mediates interaction with USP17L2.				apoptotic process (GO:0006915)|histone deacetylation (GO:0016575)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of apoptotic process (GO:0043065)|substantia nigra development (GO:0021762)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Sin3 complex (GO:0016580)	enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)			breast(1)|lung(1)	2	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					TGGCTTCTCTCAAGAGGCAGT	0.338																																						dbGAP											0													81.0	87.0	85.0					12																	118821844		1830	4090	5920	-	-	-	SO:0001819	synonymous_variant	0			AK023801	CCDS44993.1	12q24.23	2006-02-13	2006-02-13		ENSG00000111707	ENSG00000111707			29545	protein-coding gene	gene with protein product	"""sin3A-associated protein, 45kDa"""	608250	"""suppressor of defective silencing 3 homolog (SDS3, S. cerevisiae)"""			11909966	Standard	NM_022491		Approved	SDS3, FLJ00052, SAP45	uc001twz.3	Q9H7L9	OTTHUMG00000168884	ENST00000543473.1:c.240C>T	12.37:g.118821844C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMQ5|Q8N6H0|Q9H8D2	Silent	SNP	pfam_Sds3	p.L80	ENST00000543473.1	37	c.240	CCDS44993.1	12																																																																																			SUDS3	-	pfam_Sds3	ENSG00000111707		0.338	SUDS3-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	SUDS3	HGNC	protein_coding	OTTHUMT00000401504.1	63	0.00	0	C	NM_022491		118821844	118821844	+1	no_errors	ENST00000397564	ensembl	human	known	69_37n	silent	43	24.56	14	SNP	1.000	T
SUPT6H	6830	genome.wustl.edu	37	17	27009875	27009875	+	Splice_Site	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr17:27009875G>T	ENST00000314616.6	+	14	2010		c.e14+1		SUPT6H_ENST00000347486.4_Splice_Site	NM_003170.3	NP_003161.2	Q7KZ85	SPT6H_HUMAN	suppressor of Ty 6 homolog (S. cerevisiae)						chromatin remodeling (GO:0006338)|mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|negative regulation of histone H3-K27 methylation (GO:0061086)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|regulation of isotype switching (GO:0045191)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of muscle cell differentiation (GO:0051147)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|hydrolase activity, acting on ester bonds (GO:0016788)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(4)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(15)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64	Lung NSC(42;0.00431)					ACGTTTGCAGGTAGGCATGCA	0.607																																						dbGAP											0													56.0	48.0	51.0					17																	27009875		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U38658	CCDS32596.1	17q11.2	2013-02-14	2001-11-28			ENSG00000109111		"""SH2 domain containing"""	11470	protein-coding gene	gene with protein product		601333	"""suppressor of Ty (S.cerevisiae) 6 homolog"""			8786132	Standard	XM_005258026		Approved	KIAA0162, SPT6H	uc002hby.3	Q7KZ85		ENST00000314616.6:c.1727+1G>T	17.37:g.27009875G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B4|Q15737|Q6GMQ4|Q7KYW9|Q7LDK4|Q8N526|Q92775|Q96AH3|Q9BTH9|Q9BTI2	Splice_Site	SNP	-	e13+1	ENST00000314616.6	37	c.1727+1	CCDS32596.1	17	.	.	.	.	.	.	.	.	.	.	G	19.65	3.866947	0.72065	.	.	ENSG00000109111	ENST00000314616;ENST00000347486	.	.	.	5.95	5.95	0.96441	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.3854	0.98941	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SUPT6H	24034002	1.000000	0.71417	1.000000	0.80357	0.871000	0.50021	6.661000	0.74422	2.825000	0.97269	0.655000	0.94253	.	SUPT6H	-	-	ENSG00000109111		0.607	SUPT6H-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SUPT6H	HGNC	protein_coding	OTTHUMT00000446422.2	39	0.00	0	G	NM_003170	Intron	27009875	27009875	+1	no_errors	ENST00000314616	ensembl	human	known	69_37n	splice_site	26	13.33	4	SNP	1.000	T
SYNPO	11346	genome.wustl.edu	37	5	150028289	150028289	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:150028289G>A	ENST00000394243.1	+	3	1558	c.1184G>A	c.(1183-1185)aGa>aAa	p.R395K	SYNPO_ENST00000519664.1_Missense_Mutation_p.R151K|SYNPO_ENST00000518872.1_3'UTR|SYNPO_ENST00000522122.1_Missense_Mutation_p.R395K|SYNPO_ENST00000307662.4_Missense_Mutation_p.R151K	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	395					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)			NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GAGGAGGTGAGATGCAGCACA	0.597																																						dbGAP											0													155.0	157.0	156.0					5																	150028289		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1184G>A	5.37:g.150028289G>A	ENSP00000377789:p.Arg395Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKZ8|D3DQG8|O15271|Q9UPX1	Missense_Mutation	SNP	NULL	p.R395K	ENST00000394243.1	37	c.1184	CCDS54937.1	5	.	.	.	.	.	.	.	.	.	.	G	0.043	-1.277978	0.01410	.	.	ENSG00000171992	ENST00000394243;ENST00000522122;ENST00000307662;ENST00000519664	T;T;T	0.21543	2.0;2.0;2.01	5.19	-2.58	0.06228	.	1.228570	0.05745	N	0.602041	T	0.09774	0.0240	N	0.20986	0.625	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.29822	-0.9999	10	0.02654	T	1	-0.004	3.4328	0.07434	0.3134:0.0:0.2746:0.412	.	151;395	Q8N3V7-2;Q8N3V7	.;SYNPO_HUMAN	K	395;395;151;151	ENSP00000377789:R395K;ENSP00000428378:R395K;ENSP00000429268:R151K	ENSP00000302139:R151K	R	+	2	0	SYNPO	150008482	0.014000	0.17966	0.013000	0.15412	0.013000	0.08279	-0.108000	0.10857	-0.498000	0.06632	0.561000	0.74099	AGA	SYNPO	-	NULL	ENSG00000171992		0.597	SYNPO-002	KNOWN	basic|CCDS	protein_coding	SYNPO	HGNC	protein_coding	OTTHUMT00000252371.1	57	0.00	0	G	NM_007286		150028289	150028289	+1	no_errors	ENST00000394243	ensembl	human	known	69_37n	missense	33	19.51	8	SNP	0.000	A
SYNPO2	171024	genome.wustl.edu	37	4	119951272	119951272	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:119951272G>A	ENST00000429713.2	+	4	1524	c.1342G>A	c.(1342-1344)Gag>Aag	p.E448K	SYNPO2_ENST00000448416.2_Intron|SYNPO2_ENST00000307142.4_Missense_Mutation_p.E448K|SYNPO2_ENST00000434046.2_Missense_Mutation_p.E448K	NM_001128933.1	NP_001122405.1	Q9UMS6	SYNP2_HUMAN	synaptopodin 2	448						actin cytoskeleton (GO:0015629)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|Z disc (GO:0030018)	14-3-3 protein binding (GO:0071889)|muscle alpha-actinin binding (GO:0051371)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(18)|ovary(2)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	64						GGTGGATGAAGAGTTATTGTC	0.478																																						dbGAP											0													183.0	179.0	180.0					4																	119951272		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ010482	CCDS34054.1, CCDS47128.1, CCDS47129.1, CCDS75185.1, CCDS75186.1	4q26	2008-08-29			ENSG00000172403	ENSG00000172403			17732	protein-coding gene	gene with protein product						11673475, 17828378	Standard	NM_133477		Approved	MYOPODIN	uc010inb.3	Q9UMS6	OTTHUMG00000161165	ENST00000429713.2:c.1342G>A	4.37:g.119951272G>A	ENSP00000395143:p.Glu448Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP6|B2Y8J9|Q9UK89|S5XAM4	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E448K	ENST00000429713.2	37	c.1342	CCDS47129.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.07|16.07	3.019051|3.019051	0.54576|0.54576	.|.	.|.	ENSG00000172403|ENSG00000172403	ENST00000307142;ENST00000429713;ENST00000434046|ENST00000504178	T;T;T|.	0.11495|.	2.77;2.78;2.77|.	5.69|5.69	4.84|4.84	0.62591|0.62591	.|.	0.089722|.	0.48286|.	D|.	0.000197|.	T|T	0.73118|0.73118	0.3546|0.3546	M|M	0.68593|0.68593	2.085|2.085	0.80722|0.80722	D|D	1|1	P;P;P;P|.	0.52463|.	0.919;0.952;0.953;0.953|.	B;P;P;P|.	0.49085|.	0.395;0.6;0.551;0.551|.	T|T	0.73065|0.73065	-0.4100|-0.4100	10|5	0.72032|.	D|.	0.01|.	-23.73|-23.73	16.7862|16.7862	0.85575|0.85575	0.0:0.1289:0.8711:0.0|0.0:0.1289:0.8711:0.0	.|.	448;448;448;448|.	B9EG60;Q9UMS6-2;E9PEM2;Q9UMS6|.	.;.;.;SYNP2_HUMAN|.	K|K	448|399	ENSP00000306015:E448K;ENSP00000395143:E448K;ENSP00000390965:E448K|.	ENSP00000306015:E448K|.	E|R	+|+	1|2	0|0	SYNPO2|SYNPO2	120170720|120170720	1.000000|1.000000	0.71417|0.71417	0.697000|0.697000	0.30258|0.30258	0.039000|0.039000	0.13416|0.13416	6.092000|6.092000	0.71414|0.71414	1.394000|1.394000	0.46624|0.46624	0.563000|0.563000	0.77884|0.77884	GAG|AGA	SYNPO2	-	NULL	ENSG00000172403		0.478	SYNPO2-003	KNOWN	basic|CCDS	protein_coding	SYNPO2	HGNC	protein_coding	OTTHUMT00000364020.1	85	0.00	0	G			119951272	119951272	+1	no_errors	ENST00000307142	ensembl	human	known	69_37n	missense	65	28.57	26	SNP	0.995	A
SYTL5	94122	genome.wustl.edu	37	X	37969613	37969613	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:37969613C>T	ENST00000357972.5	+	13	2020	c.1474C>T	c.(1474-1476)Cag>Tag	p.Q492*	TM4SF2_ENST00000465127.1_Intron|SYTL5_ENST00000297875.2_Nonsense_Mutation_p.Q492*|SYTL5_ENST00000456733.2_Nonsense_Mutation_p.Q514*			Q8TDW5	SYTL5_HUMAN	synaptotagmin-like 5	492	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				exocytosis (GO:0006887)|intracellular protein transport (GO:0006886)	membrane (GO:0016020)	metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(9)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	44						AAGAACTCTGCAGCTCTCAGT	0.448																																						dbGAP											0													154.0	121.0	132.0					X																	37969613		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0				CCDS14244.1, CCDS55399.1	Xp21.1	2008-02-05			ENSG00000147041	ENSG00000147041			15589	protein-coding gene	gene with protein product	"""exophilin 9"""						Standard	NM_138780		Approved		uc004ddx.3	Q8TDW5	OTTHUMG00000033176	ENST00000357972.5:c.1474C>T	X.37:g.37969613C>T	ENSP00000350657:p.Gln492*	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRF2	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain	p.Q514*	ENST00000357972.5	37	c.1540	CCDS14244.1	X	.	.	.	.	.	.	.	.	.	.	C	43	10.360365	0.99391	.	.	ENSG00000147041	ENST00000297875;ENST00000357972;ENST00000456733	.	.	.	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-8.3384	19.0267	0.92935	0.0:1.0:0.0:0.0	.	.	.	.	X	492;492;514	.	ENSP00000297875:Q492X	Q	+	1	0	SYTL5	37854557	1.000000	0.71417	1.000000	0.80357	0.723000	0.41478	7.461000	0.80834	2.442000	0.82660	0.529000	0.55759	CAG	SYTL5	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	ENSG00000147041		0.448	SYTL5-201	KNOWN	basic|CCDS	protein_coding	SYTL5	HGNC	protein_coding	OTTHUMT00000080883.1	73	0.00	0	C	NM_138780		37969613	37969613	+1	no_errors	ENST00000456733	ensembl	human	known	69_37n	nonsense	55	25.68	19	SNP	1.000	T
TCTN3	26123	genome.wustl.edu	37	10	97452730	97452730	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:97452730C>G	ENST00000371217.5	-	3	469	c.446G>C	c.(445-447)aGa>aCa	p.R149T	TCTN3_ENST00000371209.5_Missense_Mutation_p.R149T|TCTN3_ENST00000265993.9_Missense_Mutation_p.R167T|TCTN3_ENST00000430368.2_Missense_Mutation_p.R149T			Q6NUS6	TECT3_HUMAN	tectonic family member 3	149					apoptotic process (GO:0006915)|cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(3)|endometrium(1)|large_intestine(2)|lung(8)|urinary_tract(1)	15		Colorectal(252;0.0815)		Epithelial(162;1.69e-07)|all cancers(201;5.63e-06)		CATGAAAACTCTTGAAGGAAA	0.403																																						dbGAP											0													74.0	65.0	68.0					10																	97452730		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098295	CCDS31258.2, CCDS44461.1	10q24.1	2014-01-28	2007-08-20	2007-08-20	ENSG00000119977	ENSG00000119977		"""Tectonic proteins"""	24519	protein-coding gene	gene with protein product		613847	"""chromosome 10 open reading frame 61"""	C10orf61		12975309	Standard	NM_015631		Approved	DKFZP564D116, TECT3, JBTS18	uc001klb.4	Q6NUS6	OTTHUMG00000018814	ENST00000371217.5:c.446G>C	10.37:g.97452730C>G	ENSP00000360261:p.Arg149Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIC8|B0QZ90|B4DR81|Q6P7P3|Q6UW27|Q6ZQQ0|Q8N7K1|Q8NBQ0|Q96GF7|Q9Y3U1	Missense_Mutation	SNP	pfam_DUF1619	p.R167T	ENST00000371217.5	37	c.500	CCDS31258.2	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.5|21.5	4.157861|4.157861	0.78114|0.78114	.|.	.|.	ENSG00000119977|ENSG00000119977	ENST00000424175|ENST00000265993;ENST00000430368;ENST00000371217;ENST00000371209	.|D;D	.|0.84800	.|-1.82;-1.9	5.7|5.7	4.79|4.79	0.61399|0.61399	.|Domain of unknown function DUF1619 (1);	.|0.281354	.|0.34777	.|N	.|0.003693	D|D	0.87289|0.87289	0.6140|0.6140	L|L	0.54863|0.54863	1.705|1.705	0.26729|0.26729	N|N	0.970631|0.970631	.|D;P;D	.|0.61697	.|0.972;0.48;0.99	.|P;B;P	.|0.62491	.|0.862;0.143;0.903	T|T	0.78043|0.78043	-0.2358|-0.2358	5|10	.|0.19590	.|T	.|0.45	-24.7057|-24.7057	10.9752|10.9752	0.47461|0.47461	0.0:0.912:0.0:0.088|0.0:0.912:0.0:0.088	.|.	.|149;149;149	.|B4DR81;Q6NUS6-2;Q6NUS6	.|.;.;TECT3_HUMAN	Q|T	129|149;149;167;149	.|ENSP00000265993:R149T;ENSP00000360253:R149T	.|ENSP00000265993:R149T	E|R	-|-	1|2	0|0	TCTN3|TCTN3	97442720|97442720	0.114000|0.114000	0.22134|0.22134	0.998000|0.998000	0.56505|0.56505	0.991000|0.991000	0.79684|0.79684	0.901000|0.901000	0.28445|0.28445	2.675000|2.675000	0.91044|0.91044	0.655000|0.655000	0.94253|0.94253	GAG|AGA	TCTN3	-	pfam_DUF1619	ENSG00000119977		0.403	TCTN3-009	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	TCTN3	HGNC	protein_coding	OTTHUMT00000471858.1	42	0.00	0	C	NM_015631		97452730	97452730	-1	no_errors	ENST00000371217	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.998	G
TDO2	6999	genome.wustl.edu	37	4	156825210	156825210	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:156825210G>C	ENST00000536354.2	+	2	140	c.76G>C	c.(76-78)Gac>Cac	p.D26H		NM_005651.3	NP_005642.1			tryptophan 2,3-dioxygenase											breast(3)|endometrium(1)|large_intestine(4)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	18	all_hematologic(180;0.24)	Renal(120;0.0854)		KIRC - Kidney renal clear cell carcinoma(143;0.0455)|Kidney(143;0.0568)|COAD - Colon adenocarcinoma(41;0.141)		CAGCGAAGAAGACAAATCACA	0.398																																					Colon(57;928 1036 2595 6946 26094)	dbGAP											0													94.0	93.0	93.0					4																	156825210		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34086.1	4q31-q32	2008-02-05				ENSG00000151790	1.13.11.11		11708	protein-coding gene	gene with protein product		191070					Standard	NM_005651		Approved	TDO, TPH2	uc003ipf.2	P48775		ENST00000536354.2:c.76G>C	4.37:g.156825210G>C	ENSP00000444788:p.Asp26His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Trp_2_3_dOase	p.D26H	ENST00000536354.2	37	c.76	CCDS34086.1	4	.	.	.	.	.	.	.	.	.	.	G	26.4	4.732147	0.89390	.	.	ENSG00000151790	ENST00000536354	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.63570	0.2522	N	0.14661	0.345	0.80722	D	1	D	0.89917	1.0	D	0.72982	0.979	T	0.69094	-0.5236	9	0.62326	D	0.03	-34.6621	19.5862	0.95490	0.0:0.0:1.0:0.0	.	26	P48775	T23O_HUMAN	H	26	.	ENSP00000281525:D26H	D	+	1	0	TDO2	157044660	1.000000	0.71417	0.995000	0.50966	0.925000	0.55904	9.170000	0.94795	2.641000	0.89580	0.650000	0.86243	GAC	TDO2	-	NULL	ENSG00000151790		0.398	TDO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TDO2	HGNC	protein_coding	OTTHUMT00000366209.3	68	0.00	0	G	NM_005651		156825210	156825210	+1	no_errors	ENST00000536354	ensembl	human	known	69_37n	missense	45	11.76	6	SNP	1.000	C
TET1	80312	genome.wustl.edu	37	10	70450998	70450998	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:70450998C>T	ENST00000373644.4	+	12	6047	c.5838C>T	c.(5836-5838)ctC>ctT	p.L1946L		NM_030625.2	NP_085128.2	Q8NFU7	TET1_HUMAN	tet methylcytosine dioxygenase 1	1946					chromatin modification (GO:0016568)|DNA demethylation (GO:0080111)|inner cell mass cell differentiation (GO:0001826)|negative regulation of methylation-dependent chromatin silencing (GO:0090310)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)|regulation of DNA methylation (GO:0044030)|stem cell maintenance (GO:0019827)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	iron ion binding (GO:0005506)|methylcytosine dioxygenase activity (GO:0070579)|structure-specific DNA binding (GO:0043566)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(2)|ovary(5)|prostate(1)|upper_aerodigestive_tract(2)	21						CCTCCTTCCTCACCTCTCCTC	0.542																																						dbGAP											0													108.0	90.0	96.0					10																	70450998		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF430147	CCDS7281.1	10q21	2014-02-18	2011-09-30	2008-03-12	ENSG00000138336	ENSG00000138336			29484	protein-coding gene	gene with protein product	"""leukemia-associated protein with a CXXC domain"", ""ten-eleven translocation-1"""	607790	"""CXXC zinc finger 6"", ""tet oncogene 1"""	CXXC6		12124344, 12646957	Standard	NM_030625		Approved	LCX, KIAA1676, bA119F7.1	uc001jok.4	Q8NFU7	OTTHUMG00000018359	ENST00000373644.4:c.5838C>T	10.37:g.70450998C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUP7|Q7Z6B6|Q8TCR1|Q9C0I7	Silent	SNP	pfam_Znf_CXXC,pfscan_Znf_CXXC	p.L1946	ENST00000373644.4	37	c.5838	CCDS7281.1	10																																																																																			TET1	-	NULL	ENSG00000138336		0.542	TET1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TET1	HGNC	protein_coding	OTTHUMT00000048354.1	48	0.00	0	C	NM_030625		70450998	70450998	+1	no_errors	ENST00000373644	ensembl	human	known	69_37n	silent	29	19.44	7	SNP	0.033	T
TFG	10342	genome.wustl.edu	37	3	100432575	100432575	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:100432575C>T	ENST00000240851.4	+	2	386	c.46C>T	c.(46-48)Caa>Taa	p.Q16*	TFG_ENST00000476228.1_Nonsense_Mutation_p.Q16*|TFG_ENST00000490574.1_Nonsense_Mutation_p.Q16*|TFG_ENST00000418917.2_Nonsense_Mutation_p.Q16*	NM_001195478.1|NM_001195479.1|NM_006070.5	NP_001182407.1|NP_001182408.1|NP_006061.2	Q92734	TFG_HUMAN	TRK-fused gene	16					cell death (GO:0008219)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	signal transducer activity (GO:0004871)		TFG/NR4A3(2)|TFG/NTRK1_ENST00000392302(5)|TFG/ALK(9)	large_intestine(4)|lung(2)|prostate(1)|stomach(1)	8						CATCAAAGCTCAACTTGGGGA	0.378			T	"""NTRK1, ALK"""	"""papillary thyroid, ALCL, NSCLC"""																																	dbGAP		Dom	yes		3	3q11-q12	10342	TRK-fused gene		"""E, L"""	0													115.0	109.0	111.0					3																	100432575		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC009241	CCDS2939.1, CCDS56266.1	3q12.2	2013-03-13	2001-12-04		ENSG00000114354	ENSG00000114354			11758	protein-coding gene	gene with protein product		602498				9169129, 23479643	Standard	NM_001007565		Approved	TF6, FLJ36137, SPG57	uc003dui.3	Q92734	OTTHUMG00000159085	ENST00000240851.4:c.46C>T	3.37:g.100432575C>T	ENSP00000240851:p.Gln16*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN49|G5E9V1|Q15656|Q969I2	Nonsense_Mutation	SNP	pfam_OPR_PB1,smart_OPR_PB1	p.Q16*	ENST00000240851.4	37	c.46	CCDS2939.1	3	.	.	.	.	.	.	.	.	.	.	C	38	6.880633	0.97908	.	.	ENSG00000114354	ENST00000418917;ENST00000490574;ENST00000240851;ENST00000479672;ENST00000476228;ENST00000443578;ENST00000463568;ENST00000487505	.	.	.	5.91	5.03	0.67393	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-8.5507	16.5781	0.84706	0.1313:0.8687:0.0:0.0	.	.	.	.	X	16	.	ENSP00000240851:Q16X	Q	+	1	0	TFG	101915265	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.248000	0.78268	1.488000	0.48433	0.655000	0.94253	CAA	TFG	-	pfam_OPR_PB1,smart_OPR_PB1	ENSG00000114354		0.378	TFG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFG	HGNC	protein_coding	OTTHUMT00000353242.1	54	0.00	0	C	NM_006070		100432575	100432575	+1	no_errors	ENST00000240851	ensembl	human	known	69_37n	nonsense	30	23.08	9	SNP	1.000	T
TJP2	9414	genome.wustl.edu	37	9	71863199	71863199	+	Intron	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:71863199C>T	ENST00000377245.4	+	19	3088				TJP2_ENST00000453658.2_Intron|TJP2_ENST00000265384.7_Missense_Mutation_p.S980L|TJP2_ENST00000535702.1_Intron|TJP2_ENST00000348208.4_Intron|TJP2_ENST00000539225.1_Intron	NM_004817.3	NP_004808.2	Q9UDY2	ZO2_HUMAN	tight junction protein 2						apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						CTTGCACTCTCGTGGACAGCT	0.607																																						dbGAP											0													92.0	122.0	113.0					9																	71863199		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000377245.4:c.2880+59C>T	9.37:g.71863199C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	Missense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin,prints_ZonOcculdens,prints_ZonOcculS2	p.S980L	ENST00000377245.4	37	c.2939	CCDS6627.1	9	.	.	.	.	.	.	.	.	.	.	C	10.80	1.452585	0.26074	.	.	ENSG00000119139	ENST00000265384	T	0.09163	3.01	4.21	1.74	0.24563	.	.	.	.	.	T	0.05456	0.0144	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43956	-0.9359	7	.	.	.	.	3.4076	0.07347	0.1989:0.1183:0.0:0.6828	.	980	Q9UDY2-5	.	L	980	ENSP00000265384:S980L	.	S	+	2	0	TJP2	71053019	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.001000	0.12947	0.221000	0.20879	-0.312000	0.09012	TCG	TJP2	-	NULL	ENSG00000119139		0.607	TJP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	TJP2	HGNC	protein_coding	OTTHUMT00000052572.2	61	0.00	0	C	NM_201629		71863199	71863199	+1	no_errors	ENST00000265384	ensembl	human	known	69_37n	missense	47	17.54	10	SNP	0.001	T
TMEM232	642987	genome.wustl.edu	37	5	109961003	109961003	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:109961003C>G	ENST00000455884.2	-	7	783	c.733G>C	c.(733-735)Gat>Cat	p.D245H	TMEM232_ENST00000515518.2_5'UTR|TMEM232_ENST00000429839.2_Missense_Mutation_p.D245H			C9JQI7	TM232_HUMAN	transmembrane protein 232	245						integral component of membrane (GO:0016021)				breast(1)|kidney(2)	3						CTTTTCTTATCTTCCACAGGT	0.363																																						dbGAP											0													281.0	240.0	252.0					5																	109961003		692	1591	2283	-	-	-	SO:0001583	missense	0			AK125070	CCDS47253.1, CCDS47253.2	5q22.1	2014-02-12	2009-10-02		ENSG00000186952	ENSG00000186952			37270	protein-coding gene	gene with protein product							Standard	NM_001039763		Approved	FLJ43080	uc011cvh.2	C9JQI7	OTTHUMG00000163297	ENST00000455884.2:c.733G>C	5.37:g.109961003C>G	ENSP00000401477:p.Asp245His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKF4	Missense_Mutation	SNP	NULL	p.D245H	ENST00000455884.2	37	c.733	CCDS47253.2	5	.	.	.	.	.	.	.	.	.	.	C	7.300	0.612788	0.14066	.	.	ENSG00000186952	ENST00000429839;ENST00000455884;ENST00000511883	.	.	.	4.64	-0.978	0.10279	.	0.929599	0.09147	N	0.842188	T	0.20007	0.0481	N	0.22421	0.69	0.09310	N	1	B;B;B	0.27791	0.001;0.189;0.12	B;B;B	0.32533	0.001;0.147;0.06	T	0.31530	-0.9940	8	.	.	.	-0.3476	1.138	0.01759	0.1379:0.266:0.2845:0.3116	.	245;245;127	C9JQI7;C9JQI7-2;E9PFK0	TM232_HUMAN;.;.	H	245	.	.	D	-	1	0	TMEM232	109988902	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.390000	0.07332	0.054000	0.16065	-2.191000	0.00312	GAT	TMEM232	-	NULL	ENSG00000186952		0.363	TMEM232-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TMEM232	HGNC	protein_coding	OTTHUMT00000372488.2	115	0.00	0	C	NM_001039763		109961003	109961003	-1	no_errors	ENST00000429839	ensembl	human	known	69_37n	missense	104	20.00	26	SNP	0.000	G
TMTC2	160335	genome.wustl.edu	37	12	83289819	83289819	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:83289819G>C	ENST00000321196.3	+	3	1584	c.877G>C	c.(877-879)Gat>Cat	p.D293H	TMTC2_ENST00000548305.1_Missense_Mutation_p.D293H|TMTC2_ENST00000549919.1_Missense_Mutation_p.D287H	NM_152588.1	NP_689801.1	Q8N394	TMTC2_HUMAN	transmembrane and tetratricopeptide repeat containing 2	293					calcium ion homeostasis (GO:0055074)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(7)|lung(13)|ovary(2)|skin(1)|urinary_tract(1)	39						CCTCAGTTTTGATTGGTCAAT	0.502																																						dbGAP											0													140.0	120.0	127.0					12																	83289819		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074634	CCDS9025.1	12q21.31	2014-06-09			ENSG00000179104	ENSG00000179104		"""Tetratricopeptide (TTC) repeat domain containing"""	25440	protein-coding gene	gene with protein product		615856				24764305	Standard	NM_152588		Approved	DKFZp762A217	uc001szt.3	Q8N394	OTTHUMG00000169736	ENST00000321196.3:c.877G>C	12.37:g.83289819G>C	ENSP00000322300:p.Asp293His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCU7|Q8N2K8	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_TPR-4,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.D293H	ENST00000321196.3	37	c.877	CCDS9025.1	12	.	.	.	.	.	.	.	.	.	.	G	20.2	3.943897	0.73672	.	.	ENSG00000179104	ENST00000321196;ENST00000548305;ENST00000549919;ENST00000546590	T;T;T	0.67171	-0.25;-0.25;-0.25	5.99	5.99	0.97316	Domain of unknown function DUF1736 (1);	0.000000	0.85682	D	0.000000	D	0.87958	0.6309	H	0.94658	3.565	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.90099	0.4183	10	0.87932	D	0	-24.2808	20.4777	0.99188	0.0:0.0:1.0:0.0	.	293;48;293	Q8N394;F8VRQ2;F8VSH2	TMTC2_HUMAN;.;.	H	293;293;287;48	ENSP00000322300:D293H;ENSP00000448292:D293H;ENSP00000447609:D287H	ENSP00000322300:D293H	D	+	1	0	TMTC2	81813950	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.476000	0.97823	2.840000	0.97914	0.655000	0.94253	GAT	TMTC2	-	pfam_DUF1736	ENSG00000179104		0.502	TMTC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC2	HGNC	protein_coding	OTTHUMT00000405663.1	48	0.00	0	G	NM_152588		83289819	83289819	+1	no_errors	ENST00000321196	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	C
TNIP2	79155	genome.wustl.edu	37	4	2744211	2744211	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:2744211C>T	ENST00000315423.7	-	6	1149	c.1063G>A	c.(1063-1065)Ggg>Agg	p.G355R	TNIP2_ENST00000505186.1_5'UTR|TNIP2_ENST00000510267.1_Missense_Mutation_p.G248R|TNIP2_ENST00000503235.1_Missense_Mutation_p.G272R	NM_024309.3	NP_077285.3			TNFAIP3 interacting protein 2											breast(2)|central_nervous_system(1)|large_intestine(4)|lung(6)|prostate(1)	14				UCEC - Uterine corpus endometrioid carcinoma (64;0.168)		GTTTTGCTCCCAGCGTGAATC	0.602																																						dbGAP											0													35.0	36.0	35.0					4																	2744211		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC002740	CCDS3362.1, CCDS54714.1, CCDS75093.1	4p16.3	2008-08-01			ENSG00000168884	ENSG00000168884			19118	protein-coding gene	gene with protein product		610669				11390377, 12933576	Standard	NM_024309		Approved	ABIN-2, MGC4289, KLIP, FLIP1	uc003gfg.2	Q8NFZ5	OTTHUMG00000090267	ENST00000315423.7:c.1063G>A	4.37:g.2744211C>T	ENSP00000321203:p.Gly355Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_EABR	p.G355R	ENST00000315423.7	37	c.1063	CCDS3362.1	4	.	.	.	.	.	.	.	.	.	.	C	15.64	2.892109	0.52014	.	.	ENSG00000168884	ENST00000510267;ENST00000315423;ENST00000503235	T;T;T	0.45668	0.89;0.89;0.89	4.25	0.941	0.19519	.	0.349612	0.32459	N	0.006068	T	0.53142	0.1778	M	0.76002	2.32	0.09310	N	1	D;D	0.71674	0.998;0.981	P;P	0.62649	0.905;0.708	T	0.45086	-0.9285	10	0.22109	T	0.4	-33.4778	8.395	0.32550	0.0:0.6452:0.0:0.3548	.	272;355	D6RGJ2;Q8NFZ5	.;TNIP2_HUMAN	R	248;355;272	ENSP00000427613:G248R;ENSP00000321203:G355R;ENSP00000426314:G272R	ENSP00000321203:G355R	G	-	1	0	TNIP2	2714009	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.705000	0.25675	0.381000	0.24851	0.555000	0.69702	GGG	TNIP2	-	NULL	ENSG00000168884		0.602	TNIP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNIP2	HGNC	protein_coding	OTTHUMT00000206589.5	24	0.00	0	C	NM_024309		2744211	2744211	-1	no_errors	ENST00000315423	ensembl	human	known	69_37n	missense	15	34.78	8	SNP	0.010	T
TOMM34	10953	genome.wustl.edu	37	20	43572097	43572097	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr20:43572097G>A	ENST00000372813.3	-	6	974	c.822C>T	c.(820-822)ctC>ctT	p.L274L	PABPC1L_ENST00000372819.1_Intron|PABPC1L_ENST00000490798.1_Intron	NM_006809.4	NP_006800.2	Q15785	TOM34_HUMAN	translocase of outer mitochondrial membrane 34	274					protein targeting to mitochondrion (GO:0006626)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	heat shock protein binding (GO:0031072)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(3)|prostate(1)	11		Myeloproliferative disorder(115;0.0122)				TTTTTACCTTGAGTGCTTTGT	0.473																																						dbGAP											0													162.0	147.0	152.0					20																	43572097		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58970	CCDS13340.1	20q12-q13.1	2013-01-10			ENSG00000025772	ENSG00000025772		"""Tetratricopeptide (TTC) repeat domain containing"""	15746	protein-coding gene	gene with protein product	"""outer mitochondrial membrane translocase (34kD)"""					9324309	Standard	NM_006809		Approved	TOM34, HTOM34P	uc002xmy.3	Q15785	OTTHUMG00000032552	ENST00000372813.3:c.822C>T	20.37:g.43572097G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53GH9|Q6IBN7|Q9NTZ3	Silent	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L274	ENST00000372813.3	37	c.822	CCDS13340.1	20																																																																																			TOMM34	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000025772		0.473	TOMM34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOMM34	HGNC	protein_coding	OTTHUMT00000079390.3	106	0.00	0	G	NM_006809		43572097	43572097	-1	no_errors	ENST00000372813	ensembl	human	known	69_37n	silent	78	17.02	16	SNP	1.000	A
TRAPPC11	60684	genome.wustl.edu	37	4	184626159	184626159	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:184626159C>T	ENST00000334690.6	+	27	3193	c.2991C>T	c.(2989-2991)atC>atT	p.I997I	RNU6-1053P_ENST00000515930.1_RNA|TRAPPC11_ENST00000357207.4_Silent_p.I997I|TRAPPC11_ENST00000512476.1_Silent_p.I603I	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	997					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											ATATCCCCATCATCACAACTG	0.393																																						dbGAP											0													182.0	170.0	174.0					4																	184626159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.2991C>T	4.37:g.184626159C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Silent	SNP	pfam_Foie-gras_1,pfam_DUF1683_C	p.I997	ENST00000334690.6	37	c.2991	CCDS34112.1	4	.	.	.	.	.	.	.	.	.	.	C	1.351	-0.591423	0.03799	.	.	ENSG00000168538	ENST00000360109	.	.	.	4.94	4.03	0.46877	.	.	.	.	.	T	0.48059	0.1479	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.47995	-0.9073	5	0.36615	T	0.2	.	3.5873	0.07975	0.0:0.5524:0.2332:0.2144	.	.	.	.	Y	978	.	ENSP00000353223:H978Y	H	+	1	0	C4orf41	184863153	0.555000	0.26530	0.843000	0.33291	0.083000	0.17756	-0.158000	0.10070	2.295000	0.77249	0.563000	0.77884	CAT	TRAPPC11	-	pfam_DUF1683_C	ENSG00000168538		0.393	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	HGNC	protein_coding	OTTHUMT00000361654.2	59	0.00	0	C	NM_021942		184626159	184626159	+1	no_errors	ENST00000334690	ensembl	human	known	69_37n	silent	58	15.94	11	SNP	0.995	T
TREML4	285852	genome.wustl.edu	37	6	41196523	41196523	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:41196523G>C	ENST00000341495.2	+	2	239	c.135G>C	c.(133-135)aaG>aaC	p.K45N	TREML4_ENST00000448827.2_Missense_Mutation_p.K45N	NM_198153.2	NP_937796.1	Q6UXN2	TRML4_HUMAN	triggering receptor expressed on myeloid cells-like 4	45	Ig-like V-type.					extracellular region (GO:0005576)				breast(1)|endometrium(1)|large_intestine(1)|lung(4)|skin(1)	8	Ovarian(28;0.0327)|Colorectal(47;0.196)					ACTCACCCAAGAGAGGGCCCT	0.542																																						dbGAP											0													86.0	83.0	84.0					6																	41196523		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF534826	CCDS34446.1	6p21.1	2013-01-11			ENSG00000188056	ENSG00000188056		"""Immunoglobulin superfamily / V-set domain containing"""	30807	protein-coding gene	gene with protein product	"""TREM like transcript 4"""	614664				12645956	Standard	NM_198153		Approved	TLT4	uc003oqc.3	Q6UXN2	OTTHUMG00000016408	ENST00000341495.2:c.135G>C	6.37:g.41196523G>C	ENSP00000342570:p.Lys45Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL92	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.K45N	ENST00000341495.2	37	c.135	CCDS34446.1	6	.	.	.	.	.	.	.	.	.	.	.	13.53	2.263541	0.39995	.	.	ENSG00000188056	ENST00000341495;ENST00000445267;ENST00000448827	T;T	0.65732	-0.17;-0.17	4.08	2.22	0.28083	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.56455	0.1986	M	0.71206	2.165	0.09310	N	1	D	0.58620	0.983	P	0.60286	0.872	T	0.45877	-0.9231	9	0.45353	T	0.12	1.3069	5.0642	0.14574	0.1182:0.2158:0.666:0.0	.	45	Q6UXN2	TRML4_HUMAN	N	45	ENSP00000342570:K45N;ENSP00000418078:K45N	ENSP00000342570:K45N	K	+	3	2	TREML4	41304501	0.001000	0.12720	0.000000	0.03702	0.011000	0.07611	0.443000	0.21644	0.348000	0.23949	0.591000	0.81541	AAG	TREML4	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000188056		0.542	TREML4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TREML4	HGNC	protein_coding	OTTHUMT00000043873.2	39	0.00	0	G			41196523	41196523	+1	no_errors	ENST00000341495	ensembl	human	known	69_37n	missense	41	22.64	12	SNP	0.000	C
TRIM60	166655	genome.wustl.edu	37	4	165961497	165961497	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:165961497G>A	ENST00000512596.1	+	3	489	c.273G>A	c.(271-273)caG>caA	p.Q91Q	TRIM60_ENST00000341062.5_Silent_p.Q91Q|TRIM60_ENST00000508504.1_Silent_p.Q91Q	NM_152620.2	NP_689833.1	Q495X7	TRI60_HUMAN	tripartite motif containing 60	91						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(3)|large_intestine(6)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	29	all_hematologic(180;0.221)	Prostate(90;0.0959)|Melanoma(52;0.18)		GBM - Glioblastoma multiforme(119;0.0844)		GAAAGAGGCAGAAAGAGAATG	0.423																																						dbGAP											0													67.0	66.0	66.0					4																	165961497		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093201	CCDS3808.1	4q32.3	2013-01-09	2011-01-25	2004-11-17	ENSG00000176979	ENSG00000176979		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	21162	protein-coding gene	gene with protein product			"""ring finger protein 129"", ""tripartite motif-containing 60"""	RNF129, RNF33			Standard	NM_152620		Approved	FLJ35882	uc003iqy.1	Q495X7	OTTHUMG00000161262	ENST00000512596.1:c.273G>A	4.37:g.165961497G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NA35	Silent	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q91	ENST00000512596.1	37	c.273	CCDS3808.1	4																																																																																			TRIM60	-	NULL	ENSG00000176979		0.423	TRIM60-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM60	HGNC	protein_coding	OTTHUMT00000364325.1	48	0.00	0	G	NM_152620		165961497	165961497	+1	no_errors	ENST00000341062	ensembl	human	known	69_37n	silent	40	16.67	8	SNP	0.038	A
TRMT13	54482	genome.wustl.edu	37	1	100613596	100613596	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:100613596G>A	ENST00000370141.2	+	10	970	c.964G>A	c.(964-966)Gag>Aag	p.E322K		NM_019083.2	NP_061956.2	Q9NUP7	TRM13_HUMAN	tRNA methyltransferase 13 homolog (S. cerevisiae)	322					tRNA processing (GO:0008033)		metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)										AAATGTCCCAGAGAAGTGGAA	0.408																																						dbGAP											0													87.0	88.0	88.0					1																	100613596		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC075811	CCDS765.1	1p21.2	2012-06-07	2012-06-07	2012-06-07	ENSG00000122435	ENSG00000122435			25502	protein-coding gene	gene with protein product			"""coiled-coil domain containing 76"""	CCDC76		11799066	Standard	NM_019083		Approved	FLJ10287, FLJ11219	uc001dsv.3	Q9NUP7	OTTHUMG00000010841	ENST00000370141.2:c.964G>A	1.37:g.100613596G>A	ENSP00000359160:p.Glu322Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVL0|Q9NW65	Missense_Mutation	SNP	pfam_Methyltransferase_TRM13,pfam_Znf_CCCH-type_TRM13,pfam_TRM13/UPF0224_CHHC_Znf_dom	p.E322K	ENST00000370141.2	37	c.964	CCDS765.1	1	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629906	0.67015	.	.	ENSG00000122435	ENST00000370141	T	0.42513	0.97	5.75	5.75	0.90469	Methyltransferase TRM13 (1);	0.249813	0.39407	N	0.001380	T	0.24122	0.0584	L	0.45137	1.4	0.80722	D	1	P	0.43231	0.801	B	0.38106	0.265	T	0.04307	-1.0961	10	0.15499	T	0.54	-20.9236	19.9525	0.97208	0.0:0.0:1.0:0.0	.	322	Q9NUP7	TRM13_HUMAN	K	322	ENSP00000359160:E322K	ENSP00000359160:E322K	E	+	1	0	CCDC76	100386184	0.974000	0.33945	1.000000	0.80357	0.566000	0.35808	3.072000	0.50049	2.719000	0.93026	0.655000	0.94253	GAG	TRMT13	-	pfam_Methyltransferase_TRM13	ENSG00000122435		0.408	TRMT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT13	HGNC	protein_coding	OTTHUMT00000029919.1	92	0.00	0	G	NM_019083		100613596	100613596	+1	no_errors	ENST00000370141	ensembl	human	known	69_37n	missense	43	23.21	13	SNP	0.999	A
TRMU	55687	genome.wustl.edu	37	22	46746264	46746264	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr22:46746264G>A	ENST00000290846.4	+	5	895	c.555G>A	c.(553-555)ctG>ctA	p.L185L	TRMU_ENST00000424260.2_Silent_p.*132*|TRMU_ENST00000381019.3_Silent_p.L185L	NM_018006.4	NP_060476.2	O75648	MTU1_HUMAN	tRNA 5-methylaminomethyl-2-thiouridylate methyltransferase	185					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|sulfurtransferase activity (GO:0016783)|tRNA binding (GO:0000049)			NS(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|ovary(1)	10		Ovarian(80;0.00965)|Breast(42;0.0194)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.00449)|LUAD - Lung adenocarcinoma(64;0.248)		AGGATGCCCTGAGGAGAACCA	0.458																																						dbGAP											0													90.0	99.0	96.0					22																	46746264		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY062123	CCDS14075.1, CCDS63510.1	22q13	2005-08-11	2005-08-11	2005-08-11	ENSG00000100416	ENSG00000100416	2.1.1.61		25481	protein-coding gene	gene with protein product		610230	"""tRNA (5-methylaminomethyl-2-thiouridylate)-methyltransferase """	TRMT		14746906	Standard	XM_005261678		Approved	FLJ10140, MTO2	uc003bhp.3	O75648	OTTHUMG00000150424	ENST00000290846.4:c.555G>A	22.37:g.46746264G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3U7|Q05C99|Q5W9C8|Q66K31|Q6ICC3|Q9NWC1	Silent	SNP	pfam_tRNA-specific_2-thiouridylase,pfam_ThiI_C_dom,pfam_NAD/GMP_synthase,tigrfam_tRNA-specific_2-thiouridylase	p.L185	ENST00000290846.4	37	c.555	CCDS14075.1	22																																																																																			TRMU	-	pfam_tRNA-specific_2-thiouridylase,tigrfam_tRNA-specific_2-thiouridylase	ENSG00000100416		0.458	TRMU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMU	HGNC	protein_coding	OTTHUMT00000318042.2	51	0.00	0	G	NM_018006		46746264	46746264	+1	no_errors	ENST00000290846	ensembl	human	known	69_37n	silent	42	19.23	10	SNP	0.973	A
TRPM2	7226	genome.wustl.edu	37	21	45811159	45811159	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr21:45811159C>T	ENST00000397928.1	+	11	1890	c.1445C>T	c.(1444-1446)tCa>tTa	p.S482L	TRPM2_ENST00000300482.5_Missense_Mutation_p.S482L|TRPM2_ENST00000397932.2_Missense_Mutation_p.S482L|TRPM2_ENST00000300481.9_Missense_Mutation_p.S482L|TRPM2_ENST00000498430.1_3'UTR	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	482					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						TCTCAGCCTTCAGATCTGCAC	0.542																																						dbGAP											0													105.0	75.0	85.0					21																	45811159		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1445C>T	21.37:g.45811159C>T	ENSP00000381023:p.Ser482Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Missense_Mutation	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.S482L	ENST00000397928.1	37	c.1445	CCDS13710.1	21	.	.	.	.	.	.	.	.	.	.	C	15.61	2.883856	0.51908	.	.	ENSG00000142185	ENST00000300482;ENST00000397928;ENST00000300481;ENST00000397932	T;T;T;T	0.35973	1.28;1.28;1.28;1.28	5.23	5.23	0.72850	.	0.407399	0.24083	N	0.041708	T	0.48277	0.1491	M	0.73962	2.25	0.34687	D	0.725341	P;P	0.51933	0.949;0.855	P;B	0.47470	0.548;0.282	T	0.64360	-0.6426	10	0.46703	T	0.11	-2.0374	16.963	0.86278	0.0:1.0:0.0:0.0	.	482;482	E9PGK7;O94759	.;TRPM2_HUMAN	L	482	ENSP00000300482:S482L;ENSP00000381023:S482L;ENSP00000300481:S482L;ENSP00000381026:S482L	ENSP00000300481:S482L	S	+	2	0	TRPM2	44635587	0.912000	0.30974	0.996000	0.52242	0.735000	0.41995	3.351000	0.52232	2.456000	0.83038	0.655000	0.94253	TCA	TRPM2	-	NULL	ENSG00000142185		0.542	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	18	0.00	0	C	NM_003307		45811159	45811159	+1	no_errors	ENST00000300482	ensembl	human	known	69_37n	missense	16	26.09	6	SNP	1.000	T
TRRAP	8295	genome.wustl.edu	37	7	98488014	98488014	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:98488014C>T	ENST00000359863.4	+	4	416	c.207C>T	c.(205-207)ttC>ttT	p.F69F	TRRAP_ENST00000446306.3_Silent_p.F69F|TRRAP_ENST00000355540.3_Silent_p.F69F	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	69					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			TCCCTCGATTCCTTACATTTC	0.383																																						dbGAP											0													109.0	102.0	104.0					7																	98488014		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.207C>T	7.37:g.98488014C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.F69	ENST00000359863.4	37	c.207	CCDS59066.1	7																																																																																			TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.383	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	77	0.00	0	C	NM_003496		98488014	98488014	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	silent	79	16.84	16	SNP	0.999	T
TSGA10	80705	genome.wustl.edu	37	2	99651728	99651728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:99651728G>A	ENST00000393483.3	-	17	2423	c.1579C>T	c.(1579-1581)Cga>Tga	p.R527*	TSGA10_ENST00000539964.1_Nonsense_Mutation_p.R527*|TSGA10_ENST00000355053.4_Nonsense_Mutation_p.R527*|TSGA10_ENST00000410001.1_Nonsense_Mutation_p.R527*	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	527					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)				NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						ACCAGCTGTCGATTAAGAAGT	0.313																																						dbGAP											0													53.0	53.0	53.0					2																	99651728		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.1579C>T	2.37:g.99651728G>A	ENSP00000377123:p.Arg527*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Nonsense_Mutation	SNP	NULL	p.R527*	ENST00000393483.3	37	c.1579	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	G	43	10.205226	0.99359	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000393482	.	.	.	5.13	4.25	0.50352	.	0.092530	0.44285	D	0.000468	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5059	14.1127	0.65132	0.0:0.0:0.8483:0.1517	.	.	.	.	X	527	.	ENSP00000347161:R527X	R	-	1	2	TSGA10	99018160	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	2.742000	0.47434	1.509000	0.48786	-0.181000	0.13052	CGA	TSGA10	-	NULL	ENSG00000135951		0.313	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	45	0.00	0	G	NM_182911		99651728	99651728	-1	no_errors	ENST00000355053	ensembl	human	known	69_37n	nonsense	39	22.00	11	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179397043	179397043	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:179397043C>T	ENST00000591111.1	-	308	99600	c.99376G>A	c.(99376-99378)Gag>Aag	p.E33126K	TTN-AS1_ENST00000588257.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592836.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585358.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000450692.2_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000604571.1_RNA|TTN-AS1_ENST00000585625.1_RNA|TTN-AS1_ENST00000589355.1_RNA|TTN-AS1_ENST00000588716.1_RNA|TTN-AS1_ENST00000587944.1_RNA|TTN-AS1_ENST00000591466.1_RNA|TTN-AS1_ENST00000589434.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E34767K|TTN-AS1_ENST00000592182.1_RNA|TTN-AS1_ENST00000587568.1_RNA|TTN-AS1_ENST00000588244.1_RNA|TTN-AS1_ENST00000442329.2_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E32199K|TTN-AS1_ENST00000585487.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.E25702K|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000591867.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589391.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000588804.1_RNA|TTN-AS1_ENST00000589842.1_RNA|TTN-AS1_ENST00000431259.2_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E25827K|TTN_ENST00000342175.6_Missense_Mutation_p.E25894K|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000590040.1_RNA			Q8WZ42	TITIN_HUMAN	titin	33126					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCCTCCCTCTCAGCCATGATT	0.502																																						dbGAP											0													205.0	191.0	195.0					2																	179397043		2039	4199	6238	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.99376G>A	2.37:g.179397043C>T	ENSP00000465570:p.Glu33126Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E32199K	ENST00000591111.1	37	c.96595		2	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586417	0.66105	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.64085	-0.08;0.16;0.14;0.13	5.73	5.73	0.89815	Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);	.	.	.	.	T	0.51312	0.1667	N	0.19112	0.55	0.58432	D	0.999995	B;B;B;B	0.32968	0.392;0.392;0.392;0.392	B;B;B;B	0.31191	0.069;0.069;0.125;0.125	T	0.55648	-0.8108	9	0.87932	D	0	.	19.4883	0.95039	0.0:1.0:0.0:0.0	.	25702;25827;25894;33126	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	32199;25702;25894;25827;25699	ENSP00000343764:E32199K;ENSP00000434586:E25702K;ENSP00000340554:E25894K;ENSP00000352154:E25827K	ENSP00000340554:E25894K	E	-	1	0	TTN	179105289	1.000000	0.71417	0.917000	0.36280	0.830000	0.47004	7.605000	0.82844	2.698000	0.92095	0.655000	0.94253	GAG	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.502	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	136	0.73	1	C	NM_133378		179397043	179397043	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	136	15.53	25	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179425723	179425723	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:179425723G>A	ENST00000591111.1	-	276	80437	c.80213C>T	c.(80212-80214)gCa>gTa	p.A26738V	TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.A28379V|TTN_ENST00000342992.6_Missense_Mutation_p.A25811V|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.A19314V|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.A19439V|TTN_ENST00000342175.6_Missense_Mutation_p.A19506V|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	26738	Ig-like 128.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGCAATGTCTGCATTTATCTT	0.408																																						dbGAP											0													176.0	163.0	167.0					2																	179425723		1936	4130	6066	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80213C>T	2.37:g.179425723G>A	ENSP00000465570:p.Ala26738Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A25811V	ENST00000591111.1	37	c.77432		2	.	.	.	.	.	.	.	.	.	.	G	17.40	3.378969	0.61735	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.39056	1.1;1.1;1.1;1.1	5.75	5.75	0.90469	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.63295	0.2499	L	0.56124	1.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.63580	-0.6605	9	0.87932	D	0	.	19.9525	0.97208	0.0:0.0:1.0:0.0	.	19314;19439;19506;26738	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	V	25811;19314;19506;19439;19312	ENSP00000343764:A25811V;ENSP00000434586:A19314V;ENSP00000340554:A19506V;ENSP00000352154:A19439V	ENSP00000340554:A19506V	A	-	2	0	TTN	179133969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.030000	0.88816	2.719000	0.93026	0.655000	0.94253	GCA	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000155657		0.408	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	60	0.00	0	G	NM_133378		179425723	179425723	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	82	19.61	20	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179443670	179443670	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:179443670G>A	ENST00000591111.1	-	270	63388	c.63164C>T	c.(63163-63165)tCa>tTa	p.S21055L	TTN-AS1_ENST00000591332.1_RNA|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.S22696L|TTN_ENST00000342992.6_Missense_Mutation_p.S20128L|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.S13631L|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000438095.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.S13756L|TTN_ENST00000342175.6_Missense_Mutation_p.S13823L|TTN-AS1_ENST00000586707.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21055	Fibronectin type-III 52. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTGGACAGCTGAGGCGCACGT	0.468																																						dbGAP											0													99.0	97.0	98.0					2																	179443670		1981	4147	6128	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63164C>T	2.37:g.179443670G>A	ENSP00000465570:p.Ser21055Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.S20128L	ENST00000591111.1	37	c.60383		2	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266277	0.59540	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.54279	0.58;0.58;0.58;0.58	5.87	5.87	0.94306	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74839	0.3769	M	0.86097	2.795	0.80722	D	1	D;D;D;D	0.58268	0.982;0.982;0.982;0.967	P;P;P;P	0.59825	0.864;0.864;0.864;0.812	T	0.77998	-0.2376	9	0.87932	D	0	.	20.2227	0.98327	0.0:0.0:1.0:0.0	.	13631;13756;13823;21055	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	L	20128;13631;13823;13756;13629	ENSP00000343764:S20128L;ENSP00000434586:S13631L;ENSP00000340554:S13823L;ENSP00000352154:S13756L	ENSP00000340554:S13823L	S	-	2	0	TTN	179151916	1.000000	0.71417	0.900000	0.35374	0.987000	0.75469	9.807000	0.99171	2.778000	0.95560	0.650000	0.86243	TCA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.468	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	48	0.00	0	G	NM_133378		179443670	179443670	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	41	19.61	10	SNP	1.000	A
TXLNA	200081	genome.wustl.edu	37	1	32653608	32653608	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:32653608G>C	ENST00000373609.1	+	4	932	c.651G>C	c.(649-651)caG>caC	p.Q217H	TXLNA_ENST00000373610.3_Missense_Mutation_p.Q217H			P40222	TXLNA_HUMAN	taxilin alpha	217					B cell activation (GO:0042113)|cell proliferation (GO:0008283)|exocytosis (GO:0006887)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	cytokine activity (GO:0005125)|high molecular weight B cell growth factor receptor binding (GO:0030372)			endometrium(1)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	13		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AGAAAAAGCAGAGCCAGCTGG	0.612																																						dbGAP											0													47.0	44.0	45.0					1																	32653608		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF516206	CCDS353.1	1p35	2012-02-21			ENSG00000084652	ENSG00000084652			30685	protein-coding gene	gene with protein product		608676				15184072, 14623251	Standard	NM_175852		Approved	DKFZp451J0118	uc001bui.3	P40222	OTTHUMG00000004423	ENST00000373609.1:c.651G>C	1.37:g.32653608G>C	ENSP00000362711:p.Gln217His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPP6|Q5TFJ6|Q66K62|Q86T54|Q86T85|Q86T86|Q86Y86|Q86YW3|Q8N2Y3	Missense_Mutation	SNP	pfam_Taxilin	p.Q217H	ENST00000373609.1	37	c.651	CCDS353.1	1	.	.	.	.	.	.	.	.	.	.	G	24.7	4.562408	0.86335	.	.	ENSG00000084652	ENST00000373610;ENST00000373609	T;T	0.31247	1.5;1.5	4.92	4.92	0.64577	.	0.053265	0.85682	D	0.000000	T	0.51669	0.1688	M	0.70275	2.135	0.58432	D	0.999998	P	0.51240	0.943	P	0.57548	0.823	T	0.52411	-0.8579	10	0.48119	T	0.1	-23.9863	18.491	0.90848	0.0:0.0:1.0:0.0	.	217	P40222	TXLNA_HUMAN	H	217	ENSP00000362712:Q217H;ENSP00000362711:Q217H	ENSP00000362711:Q217H	Q	+	3	2	TXLNA	32426195	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.802000	0.47916	2.442000	0.82660	0.655000	0.94253	CAG	TXLNA	-	pfam_Taxilin	ENSG00000084652		0.612	TXLNA-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TXLNA	HGNC	protein_coding	OTTHUMT00000012844.1	31	0.00	0	G	NM_175852		32653608	32653608	+1	no_errors	ENST00000373609	ensembl	human	known	69_37n	missense	18	21.74	5	SNP	1.000	C
UBE4A	9354	genome.wustl.edu	37	11	118245696	118245696	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:118245696C>G	ENST00000431736.2	+	9	1295	c.1223C>G	c.(1222-1224)tCc>tGc	p.S408C	UBE4A_ENST00000252108.3_Missense_Mutation_p.S401C					ubiquitination factor E4A											autonomic_ganglia(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(7)|liver(2)|lung(14)|ovary(3)|prostate(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	56	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.28e-05)		TGTATCTTGTCCTGGCTTGGA	0.448																																						dbGAP											0													99.0	90.0	93.0					11																	118245696		2200	4296	6496	-	-	-	SO:0001583	missense	0			D50916	CCDS8396.1, CCDS55790.1	11q23.3	2013-01-28	2011-05-19					"""U-box domain containing"""	12499	protein-coding gene	gene with protein product		603753	"""ubiquitination factor E4A (homologous to yeast UFD2)"", ""ubiquitination factor E4A (UFD2 homolog, yeast)"""			10089879	Standard	NM_004788		Approved	UBOX2, UFD2, KIAA0126, E4	uc001psv.3	Q14139	OTTHUMG00000168100	ENST00000431736.2:c.1223C>G	11.37:g.118245696C>G	ENSP00000387362:p.Ser408Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ub_conjug_fac_E4_core,pfam_Ubox_domain,smart_Ubox_domain	p.S408C	ENST00000431736.2	37	c.1223	CCDS8396.1	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.183981	0.78677	.	.	ENSG00000110344	ENST00000252108;ENST00000431736	T;T	0.48201	0.82;0.82	5.85	4.93	0.64822	Ubiquitin conjugation factor E4, core (1);	0.095984	0.85682	D	0.000000	T	0.60051	0.2239	L	0.54323	1.7	0.80722	D	1	D;P	0.63880	0.993;0.896	P;P	0.60173	0.87;0.487	T	0.62798	-0.6778	10	0.59425	D	0.04	-7.6197	14.0635	0.64815	0.0:0.9267:0.0:0.0733	.	401;408	Q14139;Q14139-2	UBE4A_HUMAN;.	C	401;408	ENSP00000252108:S401C;ENSP00000387362:S408C	ENSP00000252108:S401C	S	+	2	0	UBE4A	117750906	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.716000	0.68437	1.458000	0.47871	0.491000	0.48974	TCC	UBE4A	-	pfam_Ub_conjug_fac_E4_core	ENSG00000110344		0.448	UBE4A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBE4A	HGNC	protein_coding	OTTHUMT00000398143.1	39	0.00	0	C	NM_004788		118245696	118245696	+1	no_errors	ENST00000431736	ensembl	human	known	69_37n	missense	35	23.91	11	SNP	1.000	G
UBR5	51366	genome.wustl.edu	37	8	103284880	103284880	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr8:103284880C>T	ENST00000520539.1	-	48	7456	c.6850G>A	c.(6850-6852)Gag>Aag	p.E2284K	UBR5_ENST00000521922.1_Missense_Mutation_p.E2278K|UBR5_ENST00000220959.4_Missense_Mutation_p.E2284K|UBR5_ENST00000518205.1_Missense_Mutation_p.E13K	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	2284					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			TCTCCTGGCTCATCCTTAAAT	0.403																																					Ovarian(131;96 1741 5634 7352 27489)	dbGAP											0													134.0	114.0	121.0					8																	103284880		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.6850G>A	8.37:g.103284880C>T	ENSP00000429084:p.Glu2284Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.E2284K	ENST00000520539.1	37	c.6850	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.685213	0.96784	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000518205;ENST00000521922;ENST00000521566	T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14	5.44	5.44	0.79542	HECT (1);	0.057334	0.64402	D	0.000002	T	0.80127	0.4566	M	0.75085	2.285	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.79784	0.991;0.993	T	0.82034	-0.0657	10	0.87932	D	0	.	19.2658	0.93984	0.0:1.0:0.0:0.0	.	2278;2284	E7EMW7;O95071	.;UBR5_HUMAN	K	2284;2284;13;2278;109	ENSP00000429084:E2284K;ENSP00000220959:E2284K;ENSP00000428693:E13K;ENSP00000427819:E2278K	ENSP00000220959:E2284K	E	-	1	0	UBR5	103354056	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.487000	0.81328	2.570000	0.86706	0.585000	0.79938	GAG	UBR5	-	superfamily_HECT	ENSG00000104517		0.403	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	54	0.00	0	C	NM_015902		103284880	103284880	-1	no_errors	ENST00000520539	ensembl	human	known	69_37n	missense	39	20.41	10	SNP	1.000	T
UBXN7	26043	genome.wustl.edu	37	3	196088738	196088738	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:196088738G>C	ENST00000296328.4	-	10	1359	c.1285C>G	c.(1285-1287)Ctt>Gtt	p.L429V	UBXN7_ENST00000535858.1_Missense_Mutation_p.L281V|UBXN7_ENST00000428095.1_Missense_Mutation_p.L267V	NM_015562.1	NP_056377.1	O94888	UBXN7_HUMAN	UBX domain protein 7	429	UBX. {ECO:0000255|PROSITE- ProRule:PRU00215}.					Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|nucleus (GO:0005634)	transcription factor binding (GO:0008134)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			NS(1)|endometrium(2)|large_intestine(4)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	18						TGCTCTGGAAGAGTGATCTGT	0.433																																						dbGAP											0													132.0	122.0	125.0					3																	196088738		1884	4112	5996	-	-	-	SO:0001583	missense	0			AB018337	CCDS43191.1	3q29	2012-07-06	2008-07-25	2008-07-25	ENSG00000163960	ENSG00000163960		"""UBX domain containing"""	29119	protein-coding gene	gene with protein product			"""UBX domain containing 7"""	UBXD7		9872452, 22537386	Standard	NM_015562		Approved	KIAA0794	uc003fwm.4	O94888	OTTHUMG00000155639	ENST00000296328.4:c.1285C>G	3.37:g.196088738G>C	ENSP00000296328:p.Leu429Val	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXB3|Q6ZP77|Q86X20|Q8N327	Missense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,smart_UBX,pirsf_UCP037991_UAS/UBX,pfscan_UBX	p.L429V	ENST00000296328.4	37	c.1285	CCDS43191.1	3	.	.	.	.	.	.	.	.	.	.	G	17.72	3.459628	0.63401	.	.	ENSG00000163960	ENST00000296328;ENST00000428095;ENST00000535858	.	.	.	5.19	5.19	0.71726	UBX (3);	0.000000	0.85682	D	0.000000	T	0.69415	0.3108	L	0.60455	1.87	0.53688	D	0.999976	D	0.59767	0.986	D	0.74348	0.983	T	0.71490	-0.4577	9	0.87932	D	0	-12.1295	9.7681	0.40574	0.154:0.0:0.846:0.0	.	429	O94888	UBXN7_HUMAN	V	429;267;281	.	ENSP00000296328:L429V	L	-	1	0	UBXN7	197573135	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.258000	0.43249	2.593000	0.87608	0.655000	0.94253	CTT	UBXN7	-	pfam_UBX,smart_UBX,pirsf_UCP037991_UAS/UBX,pfscan_UBX	ENSG00000163960		0.433	UBXN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBXN7	HGNC	protein_coding	OTTHUMT00000340938.2	108	0.00	0	G	XM_087353		196088738	196088738	-1	no_errors	ENST00000296328	ensembl	human	known	69_37n	missense	71	14.46	12	SNP	1.000	C
UFSP2	55325	genome.wustl.edu	37	4	186336952	186336952	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr4:186336952C>T	ENST00000264689.6	-	5	519	c.403G>A	c.(403-405)Gaa>Aaa	p.E135K	Y_RNA_ENST00000384502.1_RNA|UFSP2_ENST00000502282.1_5'UTR	NM_018359.3	NP_060829.2	Q9NUQ7	UFSP2_HUMAN	UFM1-specific peptidase 2	135						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	small conjugating protein-specific protease activity (GO:0019783)|thiolester hydrolase activity (GO:0016790)			endometrium(3)|kidney(1)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	12		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;3.4e-25)|Epithelial(43;2.23e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.54e-11)|BRCA - Breast invasive adenocarcinoma(30;8.1e-05)|GBM - Glioblastoma multiforme(59;0.000148)|STAD - Stomach adenocarcinoma(60;0.000782)|LUSC - Lung squamous cell carcinoma(40;0.00939)|COAD - Colon adenocarcinoma(29;0.0108)|READ - Rectum adenocarcinoma(43;0.166)		CTTTCCCTTTCAATGATGGGC	0.373																																						dbGAP											0													112.0	101.0	105.0					4																	186336952		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002062	CCDS3842.1	4q35.1	2008-03-25	2008-03-25	2008-03-25	ENSG00000109775	ENSG00000109775			25640	protein-coding gene	gene with protein product		611482	"""chromosome 4 open reading frame 20"""	C4orf20		17182609	Standard	NM_018359		Approved	FLJ11200	uc003ixo.2	Q9NUQ7	OTTHUMG00000160441	ENST00000264689.6:c.403G>A	4.37:g.186336952C>T	ENSP00000264689:p.Glu135Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IA77|Q96FS3	Missense_Mutation	SNP	pfam_Peptidase_C78_UfSP1/2	p.E135K	ENST00000264689.6	37	c.403	CCDS3842.1	4	.	.	.	.	.	.	.	.	.	.	C	10.76	1.440825	0.25900	.	.	ENSG00000109775	ENST00000264689	T	0.30182	1.54	5.22	5.22	0.72569	.	0.371239	0.31415	N	0.007688	T	0.26195	0.0639	L	0.56769	1.78	0.33343	D	0.570066	B;B	0.29716	0.085;0.255	B;B	0.21360	0.006;0.034	T	0.25813	-1.0121	10	0.07482	T	0.82	-9.1842	14.3708	0.66838	0.0:0.8518:0.1482:0.0	.	135;35	Q9NUQ7;B3KRI4	UFSP2_HUMAN;.	K	135	ENSP00000264689:E135K	ENSP00000264689:E135K	E	-	1	0	UFSP2	186573946	1.000000	0.71417	0.998000	0.56505	0.833000	0.47200	3.254000	0.51477	2.577000	0.86979	0.655000	0.94253	GAA	UFSP2	-	NULL	ENSG00000109775		0.373	UFSP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UFSP2	HGNC	protein_coding	OTTHUMT00000360589.2	57	0.00	0	C	NM_018359		186336952	186336952	-1	no_errors	ENST00000264689	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	1.000	T
USH2A	7399	genome.wustl.edu	37	1	215853634	215853634	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:215853634C>G	ENST00000307340.3	-	62	12537	c.12151G>C	c.(12151-12153)Gaa>Caa	p.E4051Q	USH2A_ENST00000366943.2_Missense_Mutation_p.E4051Q	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4051	Fibronectin type-III 25. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		CTTAAAATTTCTCCTGCATGG	0.438										HNSCC(13;0.011)																												dbGAP											0													122.0	125.0	124.0					1																	215853634		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12151G>C	1.37:g.215853634C>G	ENSP00000305941:p.Glu4051Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.E4051Q	ENST00000307340.3	37	c.12151	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	C	8.764	0.924392	0.18056	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.54866	0.55;0.55	5.25	2.79	0.32731	Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.315387	0.22403	N	0.060504	T	0.38931	0.1059	L	0.47190	1.495	0.23624	N	0.997267	B	0.21071	0.051	B	0.17433	0.018	T	0.17167	-1.0378	10	0.26408	T	0.33	.	5.0767	0.14634	0.0:0.4616:0.2876:0.2508	.	4051	O75445	USH2A_HUMAN	Q	4051	ENSP00000305941:E4051Q;ENSP00000355910:E4051Q	ENSP00000305941:E4051Q	E	-	1	0	USH2A	213920257	0.842000	0.29525	1.000000	0.80357	0.984000	0.73092	0.322000	0.19576	0.878000	0.35920	0.650000	0.86243	GAA	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	72	0.00	0	C	NM_007123		215853634	215853634	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	69	13.75	11	SNP	0.996	G
USP25	29761	genome.wustl.edu	37	21	17199349	17199349	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr21:17199349C>T	ENST00000285679.6	+	14	1889	c.1520C>T	c.(1519-1521)tCa>tTa	p.S507L	USP25_ENST00000285681.2_Missense_Mutation_p.S507L|USP25_ENST00000351097.5_Intron|USP25_ENST00000400183.2_Missense_Mutation_p.S507L	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	507	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		ACATCACCTTCATCAGTTGCT	0.443																																						dbGAP											0													154.0	136.0	142.0					21																	17199349		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1520C>T	21.37:g.17199349C>T	ENSP00000285679:p.Ser507Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Ubiquitin-int_motif,superfamily_UBA-like,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19	p.S507L	ENST00000285679.6	37	c.1520	CCDS33515.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	6.989|6.989	0.552559|0.552559	0.13374|0.13374	.|.	.|.	ENSG00000155313|ENSG00000155313	ENST00000453553|ENST00000285681;ENST00000285679;ENST00000400183	.|T;T;T	.|0.23348	.|1.91;1.91;1.91	4.6|4.6	3.71|3.71	0.42584|0.42584	.|Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	.|1.329250	.|0.04723	.|N	.|0.419768	T|T	0.19765|0.19765	0.0475|0.0475	L|L	0.27053|0.27053	0.805|0.805	0.09310|0.09310	N|N	0.999995|0.999995	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.08055	.|0.001;0.003;0.0	T|T	0.17653|0.17653	-1.0362|-1.0362	5|10	.|0.42905	.|T	.|0.14	-2.6627|-2.6627	5.4925|5.4925	0.16785|0.16785	0.1628:0.6528:0.0:0.1844|0.1628:0.6528:0.0:0.1844	.|.	.|507;507;507	.|Q9UHP3-3;Q9UHP3-1;Q9UHP3	.|.;.;UBP25_HUMAN	Y|L	36|507	.|ENSP00000285681:S507L;ENSP00000285679:S507L;ENSP00000383044:S507L	.|ENSP00000285679:S507L	H|S	+|+	1|2	0|0	USP25|USP25	16121220|16121220	0.001000|0.001000	0.12720|0.12720	0.158000|0.158000	0.22627|0.22627	0.093000|0.093000	0.18481|0.18481	1.275000|1.275000	0.33144|0.33144	1.232000|1.232000	0.43678|0.43678	0.557000|0.557000	0.71058|0.71058	CAT|TCA	USP25	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000155313		0.443	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	HGNC	protein_coding	OTTHUMT00000157964.1	46	0.00	0	C			17199349	17199349	+1	no_errors	ENST00000400183	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	0.344	T
UTRN	7402	genome.wustl.edu	37	6	144835944	144835944	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:144835944C>G	ENST00000367545.3	+	36	5232	c.5232C>G	c.(5230-5232)atC>atG	p.I1744M		NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	1744	Interaction with SYNM.				aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		CTCAACATATCAAAAGTGCCA	0.368																																						dbGAP											0													99.0	102.0	101.0					6																	144835944		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.5232C>G	6.37:g.144835944C>G	ENSP00000356515:p.Ile1744Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.I1744M	ENST00000367545.3	37	c.5232	CCDS34547.1	6	.	.	.	.	.	.	.	.	.	.	C	17.02	3.281612	0.59758	.	.	ENSG00000152818	ENST00000367545	T	0.52754	0.65	5.34	3.47	0.39725	.	0.000000	0.46758	D	0.000262	T	0.56156	0.1966	M	0.76328	2.33	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61574	-0.7035	10	0.66056	D	0.02	.	9.7086	0.40231	0.146:0.7803:0.0:0.0737	.	1744	P46939	UTRO_HUMAN	M	1744	ENSP00000356515:I1744M	ENSP00000356515:I1744M	I	+	3	3	UTRN	144877637	1.000000	0.71417	0.974000	0.42286	0.969000	0.65631	2.670000	0.46833	1.327000	0.45338	0.655000	0.94253	ATC	UTRN	-	pfam_Spectrin_repeat,pirsf_Dystrophin/utrophin	ENSG00000152818		0.368	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	55	0.00	0	C			144835944	144835944	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	missense	48	15.79	9	SNP	1.000	G
UTRN	7402	genome.wustl.edu	37	6	145160371	145160371	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:145160371G>A	ENST00000367545.3	+	71	10128	c.10128G>A	c.(10126-10128)ctG>ctA	p.L3376L	UTRN_ENST00000367526.4_Silent_p.L931L	NM_007124.2	NP_009055.2	P46939	UTRO_HUMAN	utrophin	3376					aging (GO:0007568)|muscle cell differentiation (GO:0042692)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|neuron projection morphogenesis (GO:0048812)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane (GO:0016020)|membrane raft (GO:0045121)|myofibril (GO:0030016)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|cervix(2)|endometrium(21)|kidney(10)|large_intestine(29)|lung(56)|ovary(5)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	148		Ovarian(120;0.218)		OV - Ovarian serous cystadenocarcinoma(155;5.72e-07)|GBM - Glioblastoma multiforme(68;4.9e-05)|Colorectal(48;0.213)		ATTCTGCACTGAGCTACTCGC	0.537																																						dbGAP											0													123.0	109.0	114.0					6																	145160371		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK023675	CCDS34547.1	6q24	2008-02-05	2006-12-13		ENSG00000152818	ENSG00000152818			12635	protein-coding gene	gene with protein product		128240	"""utrophin (homologous to dystrophin)"""	DMDL		1426262	Standard	NM_007124		Approved	DRP, DRP1	uc003qkt.3	P46939	OTTHUMG00000015746	ENST00000367545.3:c.10128G>A	6.37:g.145160371G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY1|Q5SZ57|Q9UJ40	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.L3376	ENST00000367545.3	37	c.10128	CCDS34547.1	6																																																																																			UTRN	-	pirsf_Dystrophin/utrophin	ENSG00000152818		0.537	UTRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTRN	HGNC	protein_coding	OTTHUMT00000042551.1	68	0.00	0	G			145160371	145160371	+1	no_errors	ENST00000367545	ensembl	human	known	69_37n	silent	45	22.41	13	SNP	1.000	A
VANGL1	81839	genome.wustl.edu	37	1	116206759	116206759	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:116206759G>A	ENST00000355485.2	+	4	953	c.682G>A	c.(682-684)Gat>Aat	p.D228N	VANGL1_ENST00000369509.1_Missense_Mutation_p.D228N|VANGL1_ENST00000310260.3_Missense_Mutation_p.D228N|VANGL1_ENST00000369510.4_Missense_Mutation_p.D226N	NM_001172411.1|NM_138959.2	NP_001165882.1|NP_620409.1	Q8TAA9	VANG1_HUMAN	VANGL planar cell polarity protein 1	228					multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|lateral plasma membrane (GO:0016328)		p.D228H(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|liver(2)|lung(13)|urinary_tract(1)	27	Lung SC(450;0.211)	all_cancers(81;1.24e-06)|all_epithelial(167;1.02e-06)|all_lung(203;7.95e-06)|Lung NSC(69;4.97e-05)		Lung(183;0.0171)|Colorectal(144;0.0686)|LUSC - Lung squamous cell carcinoma(189;0.0903)|all cancers(265;0.108)|COAD - Colon adenocarcinoma(174;0.111)|Epithelial(280;0.12)		CTCCCTTGTGGATGCCCTCCT	0.557																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											140.0	137.0	138.0					1																	116206759		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB075805	CCDS883.1, CCDS53350.1	1p13.1	2013-03-05	2013-03-05		ENSG00000173218	ENSG00000173218			15512	protein-coding gene	gene with protein product		610132	"""vang (van gogh, Drosophila)-like 1, vang, van gogh-like 1 (Drosophila)"", ""vang-like 1 (van gogh, Drosophila)"""			11956595, 12011995	Standard	NM_001172411		Approved	STB2	uc001efv.1	Q8TAA9	OTTHUMG00000011971	ENST00000355485.2:c.682G>A	1.37:g.116206759G>A	ENSP00000347672:p.Asp228Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T1D3|Q5T1D4|Q86WG8|Q8N559	Missense_Mutation	SNP	pfam_Strabismus,pirsf_Strabismus	p.D228N	ENST00000355485.2	37	c.682	CCDS883.1	1	.	.	.	.	.	.	.	.	.	.	G	24.8	4.570099	0.86542	.	.	ENSG00000173218	ENST00000355485;ENST00000369510;ENST00000310260;ENST00000369509	D;D;D;D	0.87334	-2.24;-2.24;-2.24;-2.24	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	D	0.92625	0.7657	M	0.70108	2.13	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.998;0.999	D	0.91304	0.5069	10	0.51188	T	0.08	-1.5441	20.2921	0.98543	0.0:0.0:1.0:0.0	.	226;228	Q8TAA9-2;Q8TAA9	.;VANG1_HUMAN	N	228;226;228;228	ENSP00000347672:D228N;ENSP00000358523:D226N;ENSP00000310800:D228N;ENSP00000358522:D228N	ENSP00000310800:D228N	D	+	1	0	VANGL1	116008282	1.000000	0.71417	1.000000	0.80357	0.521000	0.34408	9.476000	0.97823	2.879000	0.98667	0.650000	0.86243	GAT	VANGL1	-	pfam_Strabismus,pirsf_Strabismus	ENSG00000173218		0.557	VANGL1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VANGL1	HGNC	protein_coding	OTTHUMT00000033096.1	75	0.00	0	G			116206759	116206759	+1	no_errors	ENST00000310260	ensembl	human	known	69_37n	missense	43	21.43	12	SNP	1.000	A
VAT1L	57687	genome.wustl.edu	37	16	77913106	77913106	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:77913106C>T	ENST00000302536.2	+	6	1020	c.867C>T	c.(865-867)ttC>ttT	p.F289F	VAT1L_ENST00000563850.1_3'UTR	NM_020927.1	NP_065978.1	Q9HCJ6	VAT1L_HUMAN	vesicle amine transport 1-like	289							oxidoreductase activity (GO:0016491)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(10)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	24						AGAGCTTCTTCAGCTTTGCAA	0.378																																						dbGAP											0													193.0	179.0	183.0					16																	77913106		2198	4300	6498	-	-	-	SO:0001819	synonymous_variant	0			AB046796	CCDS32492.1	16q23.1	2014-09-09	2013-08-23		ENSG00000171724	ENSG00000171724			29315	protein-coding gene	gene with protein product			"""vesicle amine transport protein 1 homolog (T. californica)-like"""			10997877	Standard	NM_020927		Approved	KIAA1576	uc002ffg.1	Q9HCJ6	OTTHUMG00000176845	ENST00000302536.2:c.867C>T	16.37:g.77913106C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYW8	Silent	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,smart_PKS_ER	p.F289	ENST00000302536.2	37	c.867	CCDS32492.1	16																																																																																			VAT1L	-	smart_PKS_ER	ENSG00000171724		0.378	VAT1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VAT1L	HGNC	protein_coding	OTTHUMT00000434010.1	67	0.00	0	C	NM_020927		77913106	77913106	+1	no_errors	ENST00000302536	ensembl	human	known	69_37n	silent	72	18.18	16	SNP	0.992	T
VPS13A	23230	genome.wustl.edu	37	9	79865048	79865048	+	Silent	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr9:79865048G>A	ENST00000360280.3	+	21	2333	c.2073G>A	c.(2071-2073)gtG>gtA	p.V691V	VPS13A_ENST00000376634.4_Silent_p.V691V|VPS13A_ENST00000357409.5_Silent_p.V691V|VPS13A_ENST00000376636.3_Silent_p.V691V	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	691					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						TACCAGATGTGAAACAAGGTG	0.323																																						dbGAP											0													120.0	110.0	114.0					9																	79865048		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.2073G>A	9.37:g.79865048G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Silent	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.V691	ENST00000360280.3	37	c.2073	CCDS6655.1	9																																																																																			VPS13A	-	NULL	ENSG00000197969		0.323	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	68	0.00	0	G	NM_015186		79865048	79865048	+1	no_errors	ENST00000360280	ensembl	human	known	69_37n	silent	47	27.69	18	SNP	0.428	A
VPS13C	54832	genome.wustl.edu	37	15	62256936	62256936	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:62256936G>A	ENST00000261517.5	-	31	3249	c.3176C>T	c.(3175-3177)tCa>tTa	p.S1059L	VPS13C_ENST00000249837.3_Missense_Mutation_p.S1016L|VPS13C_ENST00000395896.4_Missense_Mutation_p.S1059L|VPS13C_ENST00000395898.3_Missense_Mutation_p.S1016L	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						TTTTTCAGTTGAAATTTGTAC	0.328																																						dbGAP											0													70.0	75.0	73.0					15																	62256936		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.3176C>T	15.37:g.62256936G>A	ENSP00000261517:p.Ser1059Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.S1059L	ENST00000261517.5	37	c.3176	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	G	10.54	1.378367	0.24944	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.47177	0.85;0.85;0.85	5.63	1.04	0.20106	.	1.084660	0.07075	N	0.836017	T	0.30135	0.0755	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.16603	0.003;0.003;0.018;0.001	B;B;B;B	0.12156	0.003;0.005;0.007;0.002	T	0.23583	-1.0184	10	0.19590	T	0.45	.	2.4581	0.04534	0.1747:0.1153:0.4963:0.2137	.	1016;1059;1016;1059	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	L	1016;1059;1059;1059	ENSP00000249837:S1016L;ENSP00000261517:S1059L;ENSP00000379233:S1059L	ENSP00000249837:S1016L	S	-	2	0	VPS13C	60044228	0.000000	0.05858	0.001000	0.08648	0.756000	0.42949	0.706000	0.25690	0.726000	0.32339	0.650000	0.86243	TCA	VPS13C	-	NULL	ENSG00000129003		0.328	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	48	0.00	0	G	NM_017684		62256936	62256936	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	38	17.39	8	SNP	0.000	A
VSTM5	387804	genome.wustl.edu	37	11	93554310	93554310	+	Nonsense_Mutation	SNP	G	G	A	rs78730301		TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:93554310G>A	ENST00000409977.1	-	2	299	c.271C>T	c.(271-273)Caa>Taa	p.Q91*		NM_001144871.1	NP_001138343.1	A8MXK1	VSTM5_HUMAN	V-set and transmembrane domain containing 5	91	Ig-like C2-type.					integral component of membrane (GO:0016021)				endometrium(1)	1						TTGTGGCTTTGAGAGATGTTG	0.537																																						dbGAP											0													361.0	294.0	314.0					11																	93554310		692	1591	2283	-	-	-	SO:0001587	stop_gained	0				CCDS44709.1	11q21	2013-01-11	2011-07-01	2011-07-01	ENSG00000214376	ENSG00000214376		"""Immunoglobulin superfamily / V-set domain containing"""	34443	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 90"""	C11orf90		16554811	Standard	NM_001144871		Approved	LOC387804	uc010ruc.1	A8MXK1	OTTHUMG00000154159	ENST00000409977.1:c.271C>T	11.37:g.93554310G>A	ENSP00000386607:p.Gln91*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub	p.Q91*	ENST00000409977.1	37	c.271	CCDS44709.1	11	.	.	.	.	.	.	.	.	.	.	G	19.74	3.883727	0.72410	.	.	ENSG00000214376	ENST00000409977	.	.	.	5.66	3.63	0.41609	.	0.978236	0.08368	U	0.956506	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-2.2267	10.0171	0.42020	0.0:0.2127:0.5578:0.2296	.	.	.	.	X	91	.	ENSP00000386607:Q91X	Q	-	1	0	VSTM5	93193958	0.089000	0.21612	0.265000	0.24526	0.883000	0.51084	1.102000	0.31050	1.488000	0.48433	0.655000	0.94253	CAA	VSTM5	-	pfam_Ig_V-set,smart_Ig_sub	ENSG00000214376		0.537	VSTM5-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM5	HGNC	protein_coding	OTTHUMT00000334162.1	144	0.00	0	G	NM_001144871		93554310	93554310	-1	no_errors	ENST00000409977	ensembl	human	known	69_37n	nonsense	101	12.93	15	SNP	0.013	A
VTCN1	79679	genome.wustl.edu	37	1	117690304	117690304	+	Silent	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:117690304G>T	ENST00000369458.3	-	5	903	c.825C>A	c.(823-825)ctC>ctA	p.L275L	VTCN1_ENST00000539893.1_Silent_p.L180L|VTCN1_ENST00000359008.4_Silent_p.L278L|VTCN1_ENST00000328189.3_Silent_p.L159L	NM_024626.3	NP_078902.2			V-set domain containing T cell activation inhibitor 1											large_intestine(7)|lung(4)|upper_aerodigestive_tract(1)	12	Lung SC(450;0.225)	all_cancers(81;6.05e-06)|all_epithelial(167;5.59e-07)|all_lung(203;2.85e-06)|Lung NSC(69;2e-05)		Lung(183;0.0664)|LUSC - Lung squamous cell carcinoma(189;0.214)|Colorectal(144;0.23)		GGTAAGGGCTGAGAGGCAGAA	0.443																																						dbGAP											0													100.0	95.0	97.0					1																	117690304		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX648021	CCDS894.1, CCDS58019.1, CCDS58020.1	1p12	2013-01-29			ENSG00000134258	ENSG00000134258		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28873	protein-coding gene	gene with protein product	"""B7 family member, H4"", ""B7 superfamily member 1"""	608162				12818165, 12818166	Standard	NM_024626		Approved	B7-H4, FLJ22418, B7S1, B7X, B7H4	uc001ehb.3	Q7Z7D3	OTTHUMG00000012118	ENST00000369458.3:c.825C>A	1.37:g.117690304G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.L278	ENST00000369458.3	37	c.834	CCDS894.1	1																																																																																			VTCN1	-	NULL	ENSG00000134258		0.443	VTCN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	VTCN1	HGNC	protein_coding	OTTHUMT00000033500.2	79	0.00	0	G	NM_024626		117690304	117690304	-1	no_errors	ENST00000359008	ensembl	human	known	69_37n	silent	64	14.67	11	SNP	0.222	T
VWC2L	402117	genome.wustl.edu	37	2	215301441	215301441	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr2:215301441C>G	ENST00000312504.5	+	3	1281	c.479C>G	c.(478-480)cCa>cGa	p.P160R	VWC2L_ENST00000427124.1_Intron|AC107218.3_ENST00000437883.1_RNA|AC107218.3_ENST00000412896.1_RNA	NM_001080500.2	NP_001073969.1	B2RUY7	VWC2L_HUMAN	von Willebrand factor C domain containing protein 2-like	160	VWFC 2. {ECO:0000255|PROSITE- ProRule:PRU00220}.				negative regulation of BMP signaling pathway (GO:0030514)|positive regulation of neuron differentiation (GO:0045666)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)				breast(1)|endometrium(1)|large_intestine(3)|lung(10)|prostate(1)	16						TGTGTCAACCCAGTCTATGAA	0.453																																						dbGAP											0													109.0	106.0	107.0					2																	215301441		1987	4169	6156	-	-	-	SO:0001583	missense	0			AB374231	CCDS46509.1	2q34-q35	2011-01-25	2011-01-25		ENSG00000174453	ENSG00000174453			37203	protein-coding gene	gene with protein product			"""von Willebrand factor C domain-containing protein 2-like"""				Standard	NM_001080500		Approved		uc002vet.2	B2RUY7	OTTHUMG00000154811	ENST00000312504.5:c.479C>G	2.37:g.215301441C>G	ENSP00000308976:p.Pro160Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NC69|B2RUW7|B7X8X1	Missense_Mutation	SNP	smart_VWF_C,pfscan_VWF_C	p.P160R	ENST00000312504.5	37	c.479	CCDS46509.1	2	.	.	.	.	.	.	.	.	.	.	C	31	5.086554	0.94100	.	.	ENSG00000174453	ENST00000312504	T	0.67523	-0.27	6.16	6.16	0.99307	von Willebrand factor, type C (3);	.	.	.	.	D	0.85788	0.5778	M	0.88031	2.925	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.85132	0.0975	9	0.48119	T	0.1	-0.9139	20.8598	0.99761	0.0:1.0:0.0:0.0	.	160	B2RUY7	VWC2L_HUMAN	R	160	ENSP00000308976:P160R	ENSP00000308976:P160R	P	+	2	0	VWC2L	215009686	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.937000	0.99478	0.650000	0.86243	CCA	VWC2L	-	smart_VWF_C,pfscan_VWF_C	ENSG00000174453		0.453	VWC2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWC2L	HGNC	protein_coding	OTTHUMT00000337175.1	52	0.00	0	C	NM_001080500		215301441	215301441	+1	no_errors	ENST00000312504	ensembl	human	known	69_37n	missense	60	13.04	9	SNP	1.000	G
WBSCR28	135886	genome.wustl.edu	37	7	73279648	73279648	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:73279648C>T	ENST00000320531.2	+	2	434	c.398C>T	c.(397-399)tCa>tTa	p.S133L		NM_182504.3	NP_872310.2	Q6UE05	WBS28_HUMAN	Williams-Beuren syndrome chromosome region 28	133						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|lung(6)|skin(1)	11		Lung NSC(55;0.159)				CTGTTTTTGTCATGTCTGCAC	0.612																																						dbGAP											0													69.0	67.0	68.0					7																	73279648		2170	4268	6438	-	-	-	SO:0001583	missense	0			BC030643	CCDS43597.1	7q11.23	2006-07-04			ENSG00000175877	ENSG00000175877			23018	protein-coding gene	gene with protein product		612547				8812460	Standard	NM_182504		Approved	MGC26719	uc003tzk.2	Q6UE05	OTTHUMG00000157243	ENST00000320531.2:c.398C>T	7.37:g.73279648C>T	ENSP00000316775:p.Ser133Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UE04|Q8NHP4	Missense_Mutation	SNP	NULL	p.S133L	ENST00000320531.2	37	c.398	CCDS43597.1	7	.	.	.	.	.	.	.	.	.	.	C	2.982	-0.210124	0.06140	.	.	ENSG00000175877	ENST00000320531	T	0.27256	1.68	4.58	1.47	0.22746	.	0.000000	0.39475	N	0.001347	T	0.13114	0.0318	N	0.24115	0.695	0.09310	N	1	B	0.14438	0.01	B	0.14023	0.01	T	0.13926	-1.0491	10	0.48119	T	0.1	-10.879	2.5797	0.04815	0.2042:0.5176:0.1739:0.1043	.	133	Q6UE05	WBS28_HUMAN	L	133	ENSP00000316775:S133L	ENSP00000316775:S133L	S	+	2	0	WBSCR28	72917584	0.009000	0.17119	0.022000	0.16811	0.002000	0.02628	0.594000	0.24014	0.552000	0.29026	-0.910000	0.02820	TCA	WBSCR28	-	NULL	ENSG00000175877		0.612	WBSCR28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBSCR28	HGNC	protein_coding	OTTHUMT00000348130.1	97	0.00	0	C	NM_182504		73279648	73279648	+1	no_errors	ENST00000320531	ensembl	human	known	69_37n	missense	66	13.16	10	SNP	0.002	T
WDFY4	57705	genome.wustl.edu	37	10	50171988	50171988	+	Silent	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr10:50171988C>A	ENST00000325239.5	+	53	8352	c.8325C>A	c.(8323-8325)atC>atA	p.I2775I	WDFY4_ENST00000465910.1_3'UTR|WDFY4_ENST00000413659.2_3'UTR	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	2775	BEACH. {ECO:0000255|PROSITE- ProRule:PRU00026}.					integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						CTGTTAATATCTTCCACCCCT	0.517																																						dbGAP											0													105.0	84.0	90.0					10																	50171988		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.8325C>A	10.37:g.50171988C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L1866I	ENST00000325239.5	37	c.5596	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	3.110|3.110	-0.182856|-0.182856	0.06340|0.06340	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000265453	.|.	.|.	.|.	5.57|5.57	2.64|2.64	0.31445|0.31445	.|.	.|.	.|.	.|.	.|.	T|T	0.51822|0.51822	0.1697|0.1697	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.38779|0.38779	-0.9645|-0.9645	4|4	.|.	.|.	.|.	.|.	4.6313|4.6313	0.12502|0.12502	0.144:0.5456:0.0:0.3104|0.144:0.5456:0.0:0.3104	.|.	.|.	.|.	.|.	I|Y	1866|862	.|.	.|.	L|S	+|+	1|2	0|0	WDFY4|WDFY4	49841994|49841994	0.138000|0.138000	0.22547|0.22547	0.992000|0.992000	0.48379|0.48379	0.367000|0.367000	0.29736|0.29736	0.123000|0.123000	0.15708|0.15708	0.273000|0.273000	0.22049|0.22049	0.655000|0.655000	0.94253|0.94253	CTT|TCT	WDFY4	-	pfam_BEACH_dom,superfamily_BEACH_dom,pfscan_BEACH_dom	ENSG00000128815		0.517	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		50	0.00	0	C	XM_033379		50171988	50171988	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000312002	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	0.980	A
WDR66	144406	genome.wustl.edu	37	12	122395019	122395019	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr12:122395019C>G	ENST00000288912.4	+	11	2429	c.1575C>G	c.(1573-1575)ttC>ttG	p.F525L	WDR66_ENST00000397454.2_Missense_Mutation_p.F525L	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	525							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ACATTAAGTTCTATGATCACA	0.393																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													113.0	107.0	109.0					12																	122395019		1868	4110	5978	-	-	-	SO:0001583	missense	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.1575C>G	12.37:g.122395019C>G	ENSP00000288912:p.Phe525Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.F525L	ENST00000288912.4	37	c.1575	CCDS41853.1	12	.	.	.	.	.	.	.	.	.	.	C	22.5	4.297042	0.81025	.	.	ENSG00000158023	ENST00000288912;ENST00000397454	T;T	0.32023	1.47;1.47	5.4	4.5	0.54988	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.43678	0.1258	M	0.84846	2.72	0.49213	D	0.999767	B	0.34015	0.435	B	0.39771	0.309	T	0.40117	-0.9580	10	0.31617	T	0.26	.	14.0617	0.64804	0.0:0.9254:0.0:0.0746	.	525	Q8TBY9	WDR66_HUMAN	L	525	ENSP00000288912:F525L;ENSP00000380595:F525L	ENSP00000288912:F525L	F	+	3	2	WDR66	120879402	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	1.780000	0.38634	1.256000	0.44068	0.585000	0.79938	TTC	WDR66	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000158023		0.393	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	57	0.00	0	C	NM_144668		122395019	122395019	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	missense	53	18.46	12	SNP	1.000	G
WDR87	83889	genome.wustl.edu	37	19	38385971	38385971	+	Nonsense_Mutation	SNP	G	G	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:38385971G>T	ENST00000303868.5	-	4	479	c.255C>A	c.(253-255)taC>taA	p.Y85*	WDR87_ENST00000447313.2_Nonsense_Mutation_p.Y124*	NM_031951.3	NP_114157.3	Q6ZQQ6	WDR87_HUMAN	WD repeat domain 87	85										NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|lung(2)|prostate(1)|skin(3)|stomach(1)	36						GGTCACCACAGTAGACCACGA	0.527																																						dbGAP											0													313.0	257.0	274.0					19																	38385971		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AK128826	CCDS46063.1, CCDS74356.1	19q13.13	2013-01-09			ENSG00000171804	ENSG00000171804		"""WD repeat domain containing"""	29934	protein-coding gene	gene with protein product							Standard	XM_005259304		Approved	NYD-SP11	uc010efu.2	Q6ZQQ6	OTTHUMG00000048187	ENST00000303868.5:c.255C>A	19.37:g.38385971G>T	ENSP00000368025:p.Tyr85*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BWV9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,superfamily_Quinolinate_PRibosylTrfase_C,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.Y124*	ENST00000303868.5	37	c.372	CCDS46063.1	19	.	.	.	.	.	.	.	.	.	.	G	15.93	2.979600	0.53827	.	.	ENSG00000171804	ENST00000447313;ENST00000303868	.	.	.	5.86	2.59	0.31030	.	0.000000	0.49916	D	0.000133	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.3528	8.0649	0.30654	0.2508:0.0:0.7492:0.0	.	.	.	.	X	124;85	.	ENSP00000368025:Y85X	Y	-	3	2	WDR87	43077811	1.000000	0.71417	0.999000	0.59377	0.238000	0.25445	1.780000	0.38634	0.391000	0.25143	-0.796000	0.03273	TAC	WDR87	-	NULL	ENSG00000171804		0.527	WDR87-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	WDR87	HGNC	protein_coding	OTTHUMT00000314628.2	103	0.00	0	G	XM_940478		38385971	38385971	-1	no_errors	ENST00000447313	ensembl	human	known	69_37n	nonsense	64	17.95	14	SNP	1.000	T
WDR93	56964	genome.wustl.edu	37	15	90281436	90281436	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr15:90281436G>A	ENST00000268130.7	+	16	2031	c.1930G>A	c.(1930-1932)Gag>Aag	p.E644K	WDR93_ENST00000444934.2_Missense_Mutation_p.E361K|WDR93_ENST00000560294.1_Missense_Mutation_p.E616K	NM_020212.1	NP_064597.1	Q6P2C0	WDR93_HUMAN	WD repeat domain 93	644					electron transport chain (GO:0022900)		oxidoreductase activity, acting on NAD(P)H (GO:0016651)			NS(1)|breast(3)|endometrium(2)|kidney(4)|large_intestine(5)|liver(2)|lung(8)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	33	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			ACTGCCACTGGAGAAGAGATG	0.483																																						dbGAP											0													193.0	195.0	194.0					15																	90281436		2200	4299	6499	-	-	-	SO:0001583	missense	0				CCDS32326.1, CCDS66862.1, CCDS73779.1	15q26.1	2012-11-02						"""WD repeat domain containing"""	26924	protein-coding gene	gene with protein product							Standard	NM_020212		Approved		uc002boj.3	Q6P2C0		ENST00000268130.7:c.1930G>A	15.37:g.90281436G>A	ENSP00000268130:p.Glu644Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7Y8|Q9NP89	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.E644K	ENST00000268130.7	37	c.1930	CCDS32326.1	15	.	.	.	.	.	.	.	.	.	.	G	19.50	3.839214	0.71373	.	.	ENSG00000140527	ENST00000268130;ENST00000444934	T;T	0.54279	1.57;0.58	5.27	3.32	0.38043	.	0.224065	0.31082	N	0.008285	T	0.58595	0.2133	M	0.61703	1.905	0.23848	N	0.996677	D;D	0.60575	0.969;0.988	P;P	0.57911	0.766;0.829	T	0.47497	-0.9113	10	0.29301	T	0.29	-27.6431	7.6646	0.28423	0.0915:0.1639:0.7446:0.0	.	616;644	Q6P2C0-2;Q6P2C0	.;WDR93_HUMAN	K	644;361	ENSP00000268130:E644K;ENSP00000403871:E361K	ENSP00000268130:E644K	E	+	1	0	WDR93	88082440	1.000000	0.71417	0.840000	0.33206	0.018000	0.09664	2.083000	0.41615	1.190000	0.43042	0.650000	0.86243	GAG	WDR93	-	NULL	ENSG00000140527		0.483	WDR93-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR93	HGNC	protein_coding	OTTHUMT00000416369.1	57	0.00	0	G	NM_020212		90281436	90281436	+1	no_errors	ENST00000268130	ensembl	human	known	69_37n	missense	33	26.67	12	SNP	0.441	A
WT1	7490	genome.wustl.edu	37	11	32413552	32413552	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:32413552C>T	ENST00000379079.2	-	9	1035	c.762G>A	c.(760-762)ctG>ctA	p.L254L	WT1_ENST00000448076.3_Silent_p.L466L|WT1_ENST00000332351.3_Silent_p.L466L|WT1_ENST00000530998.1_Silent_p.L237L	NM_001198551.1	NP_001185480.1	P19544	WT1_HUMAN	Wilms tumor 1	398					adrenal cortex formation (GO:0035802)|adrenal gland development (GO:0030325)|branching involved in ureteric bud morphogenesis (GO:0001658)|camera-type eye development (GO:0043010)|cardiac muscle cell fate commitment (GO:0060923)|cellular response to cAMP (GO:0071320)|cellular response to gonadotropin stimulus (GO:0071371)|diaphragm development (GO:0060539)|epithelial cell differentiation (GO:0030855)|germ cell development (GO:0007281)|glomerular basement membrane development (GO:0032836)|glomerular visceral epithelial cell differentiation (GO:0072112)|glomerulus development (GO:0032835)|gonad development (GO:0008406)|heart development (GO:0007507)|kidney development (GO:0001822)|male genitalia development (GO:0030539)|male gonad development (GO:0008584)|mesenchymal to epithelial transition (GO:0060231)|metanephric epithelium development (GO:0072207)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of female gonad development (GO:2000195)|negative regulation of metanephric glomerular mesangial cell proliferation (GO:0072302)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|positive regulation of heart growth (GO:0060421)|positive regulation of male gonad development (GO:2000020)|positive regulation of metanephric ureteric bud development (GO:2001076)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|posterior mesonephric tubule development (GO:0072166)|regulation of organ formation (GO:0003156)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|sex determination (GO:0007530)|thorax and anterior abdomen determination (GO:0007356)|tissue development (GO:0009888)|ureteric bud development (GO:0001657)|vasculogenesis (GO:0001570)|visceral serous pericardium development (GO:0061032)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.V380_S410del(1)|p.H397fs*8(1)	EWSR1/WT1(234)	NS(1)|haematopoietic_and_lymphoid_tissue(348)|kidney(149)|large_intestine(9)|lung(20)|peritoneum(1)|pleura(2)|skin(2)|upper_aerodigestive_tract(1)	533	Breast(20;0.247)		OV - Ovarian serous cystadenocarcinoma(30;0.128)			TGTGGGTCTTCAGGTGGTCGG	0.408			"""D, Mis, N, F, S"""	EWSR1	"""Wilms, desmoplastic small round cell tumor"""	Wilms			Wilms' tumor-Aniridia-ambiguous Genitals-mental Retardation;Frasier syndrome;Familial Wilms' tumor;Denys-Drash syndrome																													dbGAP	yes	Rec	yes	"""Denys-Drash syndrome, Frasier syndrome, Familial Wilms tumor"""	11	11p13	7490	Wilms tumour 1 gene		O	2	Deletion - Frameshift(1)|Deletion - In frame(1)	haematopoietic_and_lymphoid_tissue(2)											195.0	194.0	194.0					11																	32413552		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	WAGR syndrome; ; ;incl.: Early Onset Nephrotic Syndrome-WT1 associated		CCDS7878.2, CCDS44561.1, CCDS44562.1, CCDS55750.1, CCDS55751.1	11p13	2014-09-17			ENSG00000184937	ENSG00000184937		"""Zinc fingers, C2H2-type"""	12796	protein-coding gene	gene with protein product		607102		GUD		14681303	Standard	NM_024424		Approved	WAGR, WIT-2, AWT1	uc001mtn.2	P19544	OTTHUMG00000039556	ENST00000379079.2:c.762G>A	11.37:g.32413552C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6S1|B3KSA5|Q15881|Q16256|Q16575|Q4VXV4|Q4VXV5|Q4VXV6|Q8IYZ5	Missense_Mutation	SNP	pfam_Wilms_tumour_N,pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E127K	ENST00000379079.2	37	c.379	CCDS55751.1	11	.	.	.	.	.	.	.	.	.	.	C	9.606	1.130007	0.21041	.	.	ENSG00000184937	ENST00000527882	.	.	.	6.04	5.12	0.69794	.	.	.	.	.	T	0.71409	0.3336	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.68899	-0.5287	4	.	.	.	.	15.6114	0.76721	0.0:0.9336:0.0:0.0664	.	.	.	.	K	127	.	.	E	-	1	0	WT1	32370128	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.036000	0.49767	2.873000	0.98535	0.561000	0.74099	GAA	WT1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000184937		0.408	WT1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WT1	HGNC	protein_coding	OTTHUMT00000095434.1	60	0.00	0	C	NM_000378		32413552	32413552	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000527882	ensembl	human	novel	69_37n	missense	52	11.86	7	SNP	1.000	T
YEATS2	55689	genome.wustl.edu	37	3	183435461	183435461	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr3:183435461G>C	ENST00000305135.5	+	3	318	c.123G>C	c.(121-123)aaG>aaC	p.K41N		NM_018023.4	NP_060493.3	Q9ULM3	YETS2_HUMAN	YEATS domain containing 2	41					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|mitotic spindle (GO:0072686)	TBP-class protein binding (GO:0017025)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(24)|ovary(3)|prostate(2)|skin(3)	49	all_cancers(143;6.55e-10)|Ovarian(172;0.0303)		all cancers(12;2.38e-42)|Epithelial(37;1.9e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)			CTGTGCAGAAGATTGAGACTA	0.333																																						dbGAP											0													115.0	114.0	114.0					3																	183435461		1849	4097	5946	-	-	-	SO:0001583	missense	0			AB033023	CCDS43175.1	3q27.3	2004-08-18			ENSG00000163872	ENSG00000163872			25489	protein-coding gene	gene with protein product		613373				10574462	Standard	NM_018023		Approved	FLJ10201, FLJ12841, FLJ13308, KIAA1197	uc003fly.2	Q9ULM3	OTTHUMG00000156898	ENST00000305135.5:c.123G>C	3.37:g.183435461G>C	ENSP00000306983:p.Lys41Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2B9|D3DNS9|Q641P6|Q9NW96	Missense_Mutation	SNP	pfam_YEATS,pfscan_YEATS	p.K41N	ENST00000305135.5	37	c.123	CCDS43175.1	3	.	.	.	.	.	.	.	.	.	.	G	21.2	4.114151	0.77210	.	.	ENSG00000163872	ENST00000421660;ENST00000305135	T	0.62105	0.05	5.44	3.63	0.41609	.	0.000000	0.85682	D	0.000000	T	0.74884	0.3775	M	0.67397	2.05	0.58432	D	0.999993	D	0.89917	1.0	D	0.80764	0.994	T	0.75625	-0.3253	10	0.87932	D	0	-20.0533	11.113	0.48243	0.1513:0.0:0.8487:0.0	.	41	Q9ULM3	YETS2_HUMAN	N	41	ENSP00000306983:K41N	ENSP00000306983:K41N	K	+	3	2	YEATS2	184918155	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.420000	0.66441	0.657000	0.30906	0.655000	0.94253	AAG	YEATS2	-	NULL	ENSG00000163872		0.333	YEATS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YEATS2	HGNC	protein_coding	OTTHUMT00000346507.2	64	0.00	0	G	NM_018023		183435461	183435461	+1	no_errors	ENST00000305135	ensembl	human	known	69_37n	missense	66	18.52	15	SNP	1.000	C
YTHDF2	51441	genome.wustl.edu	37	1	29064088	29064088	+	Intron	SNP	C	C	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:29064088C>A	ENST00000373812.3	+	2	389				YTHDF2_ENST00000542507.1_Intron|YTHDF2_ENST00000478283.1_3'UTR|YTHDF2_ENST00000541996.1_Intron	NM_016258.2	NP_057342.2	Q9Y5A9	YTHD2_HUMAN	YTH domain family, member 2						humoral immune response (GO:0006959)|regulation of mRNA stability (GO:0043488)	cytoplasmic mRNA processing body (GO:0000932)	N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	20		Colorectal(325;3.46e-05)|Lung NSC(340;0.000601)|all_lung(284;0.000771)|Breast(348;0.00502)|Renal(390;0.00758)|all_neural(195;0.0227)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0563)|Medulloblastoma(700;0.123)		Colorectal(126;8.36e-08)|COAD - Colon adenocarcinoma(152;5.46e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0221)|KIRC - Kidney renal clear cell carcinoma(1967;0.0296)|READ - Rectum adenocarcinoma(331;0.0649)		ATTCTCCCTTCGGGCCCTGCC	0.567																																						dbGAP											0													74.0	61.0	65.0					1																	29064088		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF155095	CCDS41296.1, CCDS53287.1	1p35	2008-02-05	2004-11-16		ENSG00000198492	ENSG00000198492			31675	protein-coding gene	gene with protein product		610640	"""YTH domain family 2"""			10508479	Standard	NM_016258		Approved	HGRG8, NY-REN-2	uc021okf.1	Q9Y5A9	OTTHUMG00000003648	ENST00000373812.3:c.28-82C>A	1.37:g.29064088C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKG4|A8K966|B4E1G7|D3DPM8|Q5VSZ9|Q8TDH0|Q9BUJ5	RNA	SNP	-	NULL	ENST00000373812.3	37	NULL	CCDS41296.1	1																																																																																			YTHDF2	-	-	ENSG00000198492		0.567	YTHDF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YTHDF2	HGNC	protein_coding	OTTHUMT00000010335.1	60	0.00	0	C	NM_016258		29064088	29064088	+1	no_errors	ENST00000478283	ensembl	human	known	69_37n	rna	45	13.46	7	SNP	0.002	A
ZBTB41	360023	genome.wustl.edu	37	1	197128914	197128914	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:197128914C>G	ENST00000367405.4	-	10	2373	c.2305G>C	c.(2305-2307)Gag>Cag	p.E769Q	ZBTB41_ENST00000467322.1_5'UTR	NM_194314.2	NP_919290.2	Q5SVQ8	ZBT41_HUMAN	zinc finger and BTB domain containing 41	769					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(11)|lung(11)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)	40						GATGAGTACTCAACTGGCAAG	0.378																																						dbGAP											0													191.0	183.0	186.0					1																	197128914		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS30960.1	1q31.3	2013-01-08			ENSG00000177888	ENSG00000177888		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	24819	protein-coding gene	gene with protein product							Standard	NM_194314		Approved	FRBZ1, FLJ36199, DKFZp686C06120, ZNF924	uc001gtx.1	Q5SVQ8	OTTHUMG00000036275	ENST00000367405.4:c.2305G>C	1.37:g.197128914C>G	ENSP00000356375:p.Glu769Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUA8|Q6MZT8|Q6ZR25|Q7Z4T1|Q8IZ99	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E769Q	ENST00000367405.4	37	c.2305	CCDS30960.1	1	.	.	.	.	.	.	.	.	.	.	C	11.69	1.713964	0.30413	.	.	ENSG00000177888	ENST00000367405	T	0.05258	3.47	5.97	5.97	0.96955	.	0.390615	0.18302	U	0.145394	T	0.06096	0.0158	L	0.27053	0.805	0.29329	N	0.866819	B	0.15473	0.013	B	0.08055	0.003	T	0.17806	-1.0357	10	0.28530	T	0.3	.	14.1787	0.65559	0.0:0.808:0.192:0.0	.	769	Q5SVQ8	ZBT41_HUMAN	Q	769	ENSP00000356375:E769Q	ENSP00000356375:E769Q	E	-	1	0	ZBTB41	195395537	0.928000	0.31464	0.960000	0.40013	0.721000	0.41392	1.536000	0.36072	2.836000	0.97738	0.655000	0.94253	GAG	ZBTB41	-	NULL	ENSG00000177888		0.378	ZBTB41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB41	HGNC	protein_coding	OTTHUMT00000088249.2	81	0.00	0	C	NM_194314		197128914	197128914	-1	no_errors	ENST00000367405	ensembl	human	known	69_37n	missense	116	15.94	22	SNP	0.950	G
ZC3H14	79882	genome.wustl.edu	37	14	89073594	89073594	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr14:89073594G>A	ENST00000251038.5	+	13	1980	c.1755G>A	c.(1753-1755)atG>atA	p.M585I	ZC3H14_ENST00000393514.5_Missense_Mutation_p.M560I|ZC3H14_ENST00000406216.3_Missense_Mutation_p.M131I|ZC3H14_ENST00000556945.1_Missense_Mutation_p.M454I|ZC3H14_ENST00000359301.3_Missense_Mutation_p.M420I|ZC3H14_ENST00000555900.1_Missense_Mutation_p.M287I|ZC3H14_ENST00000557607.1_Missense_Mutation_p.M274I|ZC3H14_ENST00000555755.1_Missense_Mutation_p.M580I|ZC3H14_ENST00000302216.8_Missense_Mutation_p.M429I|ZC3H14_ENST00000318308.6_Missense_Mutation_p.M156I|ZC3H14_ENST00000336693.4_Missense_Mutation_p.M420I	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	585						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.M585I(1)|p.M156I(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						TAGCTGAGATGAGTGAACTGA	0.413																																						dbGAP											2	Substitution - Missense(2)	lung(2)											151.0	137.0	142.0					14																	89073594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.1755G>A	14.37:g.89073594G>A	ENSP00000251038:p.Met585Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	smart_Znf_CCCH	p.M585I	ENST00000251038.5	37	c.1755	CCDS32133.1	14	.	.	.	.	.	.	.	.	.	.	G	10.71	1.427201	0.25726	.	.	ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000557607;ENST00000555755;ENST00000393514;ENST00000336693;ENST00000318308;ENST00000555900;ENST00000406216	.	.	.	5.42	4.52	0.55395	.	0.192647	0.53938	N	0.000045	T	0.56761	0.2007	L	0.59436	1.845	0.35439	D	0.794723	B;B;D;B;B;B;B;B	0.59357	0.002;0.001;0.985;0.2;0.157;0.001;0.002;0.2	B;B;P;B;B;B;B;B	0.51516	0.026;0.009;0.672;0.03;0.047;0.004;0.005;0.03	T	0.66748	-0.5845	9	0.38643	T	0.18	-8.5966	11.3315	0.49479	0.0702:0.1275:0.8023:0.0	.	454;435;580;585;131;156;429;585	G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-8;Q6PJT7-6;Q6PJT7-3;Q6PJT7	.;.;.;.;.;.;.;ZC3HE_HUMAN	I	585;560;420;429;435;454;274;580;560;420;156;287;131	.	ENSP00000251038:M585I	M	+	3	0	ZC3H14	88143347	1.000000	0.71417	1.000000	0.80357	0.444000	0.32077	2.630000	0.46494	1.270000	0.44297	-0.182000	0.12963	ATG	ZC3H14	-	NULL	ENSG00000100722		0.413	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	ZC3H14	HGNC	protein_coding	OTTHUMT00000410387.1	72	0.00	0	G	NM_024824		89073594	89073594	+1	no_errors	ENST00000251038	ensembl	human	known	69_37n	missense	55	10.94	7	SNP	1.000	A
ZCWPW1	55063	genome.wustl.edu	37	7	100014011	100014011	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:100014011G>A	ENST00000398027.2	-	7	795	c.548C>T	c.(547-549)aCa>aTa	p.T183I	ZCWPW1_ENST00000360951.4_Missense_Mutation_p.T183I|ZCWPW1_ENST00000490721.1_Missense_Mutation_p.T62I|ZCWPW1_ENST00000324725.6_Missense_Mutation_p.T62I	NM_017984.4	NP_060454.3	Q9H0M4	ZCPW1_HUMAN	zinc finger, CW type with PWWP domain 1	183							zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TAACTTAGATGTCCTTATCTC	0.418																																						dbGAP											0													139.0	130.0	132.0					7																	100014011		1889	4117	6006	-	-	-	SO:0001583	missense	0			AK000919	CCDS43623.1, CCDS59067.1	7q22.1	2012-02-10	2004-11-03		ENSG00000078487	ENSG00000078487			23486	protein-coding gene	gene with protein product			"""zinc finger, CW-type with PWWP domain 1"""			11230166, 14607086, 20826339	Standard	NM_017984		Approved	FLJ10057, DKFZp434N0510, ZCW1	uc003uut.4	Q9H0M4	OTTHUMG00000159537	ENST00000398027.2:c.548C>T	7.37:g.100014011G>A	ENSP00000381109:p.Thr183Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVF5|B4DUQ2|Q8NA98|Q9BUD0|Q9NWF7	Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,smart_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.T183I	ENST00000398027.2	37	c.548	CCDS43623.1	7	.	.	.	.	.	.	.	.	.	.	G	4.250	0.045333	0.08196	.	.	ENSG00000078487	ENST00000398027;ENST00000490721;ENST00000360951;ENST00000324725;ENST00000379559	T;T;T;T	0.49720	0.79;0.83;0.77;0.83	5.24	3.45	0.39498	.	0.456780	0.18746	N	0.132317	T	0.30103	0.0754	N	0.24115	0.695	0.09310	N	1	B;B;B;B;B	0.22276	0.067;0.055;0.006;0.024;0.041	B;B;B;B;B	0.20955	0.014;0.018;0.008;0.008;0.032	T	0.16424	-1.0403	9	.	.	.	-0.0855	8.3092	0.32060	0.1829:0.0:0.8171:0.0	.	183;143;184;183;62	B4DUQ2;B4DXS7;C9J435;Q9H0M4;Q9H0M4-4	.;.;.;ZCPW1_HUMAN;.	I	183;62;183;62;184	ENSP00000381109:T183I;ENSP00000419187:T62I;ENSP00000354210:T183I;ENSP00000314880:T62I	.	T	-	2	0	ZCWPW1	99851947	0.000000	0.05858	0.016000	0.15963	0.016000	0.09150	0.228000	0.17814	0.707000	0.31934	0.655000	0.94253	ACA	ZCWPW1	-	NULL	ENSG00000078487		0.418	ZCWPW1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZCWPW1	HGNC	protein_coding	OTTHUMT00000356083.1	85	0.00	0	G	NM_017984		100014011	100014011	-1	no_errors	ENST00000398027	ensembl	human	known	69_37n	missense	98	10.91	12	SNP	0.006	A
ZMYM3	9203	genome.wustl.edu	37	X	70462260	70462260	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:70462260G>A	ENST00000353904.2	-	23	3749	c.3562C>T	c.(3562-3564)Cga>Tga	p.R1188*	ZMYM3_ENST00000373998.1_Nonsense_Mutation_p.R1176*|ZMYM3_ENST00000373988.1_Nonsense_Mutation_p.R1190*|ZMYM3_ENST00000314425.5_Nonsense_Mutation_p.R1188*|ZMYM3_ENST00000489332.1_5'UTR|ZMYM3_ENST00000373984.3_Intron	NM_005096.3	NP_005087.1	Q14202	ZMYM3_HUMAN	zinc finger, MYM-type 3	1188					cytoskeleton organization (GO:0007010)|multicellular organismal development (GO:0007275)|regulation of cell morphogenesis (GO:0022604)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(7)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(12)|lung(17)|ovary(1)|prostate(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	64	Renal(35;0.156)					TCCTCCACTCGAGAGAACACC	0.537																																						dbGAP											0													48.0	40.0	43.0					X																	70462260		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB002383	CCDS14409.1, CCDS55443.1, CCDS55444.1	Xq13.1	2013-01-08	2005-12-19	2005-12-19	ENSG00000147130	ENSG00000147130		"""Zinc fingers, MYM type"""	13054	protein-coding gene	gene with protein product		300061	"""zinc finger protein 261"""	ZNF261		10486218	Standard	NM_201599		Approved	ZNF198L2, DXS6673E, KIAA0385, MYM	uc004dzh.2	Q14202	OTTHUMG00000021799	ENST00000353904.2:c.3562C>T	X.37:g.70462260G>A	ENSP00000343909:p.Arg1188*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVV3|O15089|Q96E26	Nonsense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.R1190*	ENST00000353904.2	37	c.3568	CCDS14409.1	X	.	.	.	.	.	.	.	.	.	.	g	46	12.957727	0.99709	.	.	ENSG00000147130	ENST00000314425;ENST00000373998;ENST00000353904;ENST00000373988	.	.	.	4.68	4.68	0.58851	.	0.000000	0.64402	D	0.000009	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-6.4787	16.8984	0.86107	0.0:0.0:1.0:0.0	.	.	.	.	X	1188;1176;1188;1190	.	ENSP00000322845:R1188X	R	-	1	2	ZMYM3	70378985	1.000000	0.71417	0.998000	0.56505	0.613000	0.37349	6.005000	0.70716	2.166000	0.68216	0.525000	0.51046	CGA	ZMYM3	-	pfam_DUF3504	ENSG00000147130		0.537	ZMYM3-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZMYM3	HGNC	protein_coding	OTTHUMT00000057154.1	22	0.00	0	G	NM_201599		70462260	70462260	-1	no_errors	ENST00000373988	ensembl	human	known	69_37n	nonsense	18	25.00	6	SNP	1.000	A
ZNF138	7697	genome.wustl.edu	37	7	64276007	64276007	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr7:64276007G>C	ENST00000359735.3	+	3	360	c.13G>C	c.(13-15)Gag>Cag	p.E5Q	ZNF138_ENST00000437743.1_Intron|ZNF138_ENST00000440598.1_Nonstop_Mutation_p.*63S|ZNF138_ENST00000430838.2_Intron|ZNF138_ENST00000307355.7_Missense_Mutation_p.E62Q|ZNF138_ENST00000494380.1_Missense_Mutation_p.E62Q|ZNF138_ENST00000397136.2_Missense_Mutation_p.E5Q|ZNF138_ENST00000440155.2_Intron	NM_001271637.1|NM_001271639.1	NP_001258566.1|NP_001258568.1	P52744	ZN138_HUMAN	zinc finger protein 138	5					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(3)|lung(2)|stomach(1)	7		Lung NSC(55;0.0795)|all_lung(88;0.18)				GAAGAGACATGAGATGGTGGT	0.413																																						dbGAP											0													136.0	127.0	130.0					7																	64276007		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09847	CCDS34645.1, CCDS34645.2, CCDS55115.1, CCDS64659.1, CCDS64660.1, CCDS64661.1, CCDS75607.1	7q11.21	2013-01-08	2005-07-11		ENSG00000197008	ENSG00000197008		"""Zinc fingers, C2H2-type"", ""-"""	12922	protein-coding gene	gene with protein product		604080	"""zinc finger protein 138 (clone pHZ-32)"""				Standard	NM_006524		Approved	pHZ-32	uc031sxl.1	P52744	OTTHUMG00000156603	ENST00000359735.3:c.13G>C	7.37:g.64276007G>C	ENSP00000352770:p.Glu5Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX2|B4DP87|E9PHI7|E9PHK7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E5Q	ENST00000359735.3	37	c.13		7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.003|0.003	-2.502444|-2.502444	0.00157|0.00157	.|.	.|.	ENSG00000197008|ENSG00000197008	ENST00000307355;ENST00000359735;ENST00000494380;ENST00000397136|ENST00000440598	T;T;T;T|.	0.07444|.	3.36;3.19;5.18;3.19|.	0.128|0.128	0.128|0.128	0.14733|0.14733	.|.	.|.	.|.	.|.	.|.	T|.	0.20333|.	0.0489|.	N|N	0.16656|0.16656	0.425|0.425	0.09310|0.09310	N|N	1|1	D;D|.	0.63046|.	0.992;0.978|.	P;P|.	0.61477|.	0.889;0.809|.	T|.	0.28396|.	-1.0045|.	8|.	0.52906|.	T|.	0.07|.	.|.	.|.	.|.	.|.	.|.	62;5|.	E9PHK7;P52744|.	.;ZN138_HUMAN|.	Q|S	62;5;62;5|63	ENSP00000303533:E62Q;ENSP00000352770:E5Q;ENSP00000419197:E62Q;ENSP00000380325:E5Q|.	ENSP00000303533:E62Q|.	E|X	+|+	1|2	0|2	ZNF138|ZNF138	63913442|63913442	0.000000|0.000000	0.05858|0.05858	0.210000|0.210000	0.23637|0.23637	0.209000|0.209000	0.24338|0.24338	-0.250000|-0.250000	0.08830|0.08830	0.283000|0.283000	0.22279|0.22279	0.289000|0.289000	0.19496|0.19496	GAG|TGA	ZNF138	-	NULL	ENSG00000197008		0.413	ZNF138-201	KNOWN	basic	protein_coding	ZNF138	HGNC	protein_coding		133	0.00	0	G	NM_006524		64276007	64276007	+1	no_errors	ENST00000359735	ensembl	human	known	69_37n	missense	86	16.50	17	SNP	0.353	C
ZNF263	10127	genome.wustl.edu	37	16	3339713	3339713	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:3339713G>A	ENST00000219069.5	+	6	2083	c.1207G>A	c.(1207-1209)Gaa>Aaa	p.E403K	ZNF263_ENST00000538765.1_Missense_Mutation_p.E51K|ZNF263_ENST00000574253.1_3'UTR	NM_005741.4	NP_005732.2	O14978	ZN263_HUMAN	zinc finger protein 263	403					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(4)|urinary_tract(3)	20						ACATGCAGCTGAAAGACTGTG	0.473																																						dbGAP											0													115.0	103.0	107.0					16																	3339713		2197	4300	6497	-	-	-	SO:0001583	missense	0			AC004232	CCDS10499.1	16p13.3	2013-01-09			ENSG00000006194	ENSG00000006194		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	13056	protein-coding gene	gene with protein product		604191				9256059	Standard	NM_005741		Approved	FPM315, ZKSCAN12, ZSCAN44	uc002cuq.3	O14978	OTTHUMG00000129323	ENST00000219069.5:c.1207G>A	16.37:g.3339713G>A	ENSP00000219069:p.Glu403Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R634|O43387|Q96H95	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.E403K	ENST00000219069.5	37	c.1207	CCDS10499.1	16	.	.	.	.	.	.	.	.	.	.	G	16.84	3.233813	0.58886	.	.	ENSG00000006194	ENST00000538765;ENST00000219069	T;T	0.63913	-0.07;-0.07	5.84	5.84	0.93424	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.110171	0.40728	N	0.001025	D	0.82356	0.5019	M	0.88640	2.97	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	D	0.85161	0.0992	10	0.87932	D	0	.	17.6329	0.88114	0.0:0.0:1.0:0.0	.	403	O14978	ZN263_HUMAN	K	51;403	ENSP00000444497:E51K;ENSP00000219069:E403K	ENSP00000219069:E403K	E	+	1	0	ZNF263	3279714	1.000000	0.71417	1.000000	0.80357	0.699000	0.40488	7.820000	0.86633	2.764000	0.94973	0.655000	0.94253	GAA	ZNF263	-	pfscan_Znf_C2H2	ENSG00000006194		0.473	ZNF263-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF263	HGNC	protein_coding	OTTHUMT00000251463.2	35	0.00	0	G			3339713	3339713	+1	no_errors	ENST00000219069	ensembl	human	known	69_37n	missense	31	13.89	5	SNP	1.000	A
ZNF280C	55609	genome.wustl.edu	37	X	129380918	129380918	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chrX:129380918C>T	ENST00000370978.4	-	3	246	c.93G>A	c.(91-93)caG>caA	p.Q31Q		NM_017666.4	NP_060136.1	Q8ND82	Z280C_HUMAN	zinc finger protein 280C	31					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(4)|large_intestine(9)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	26						CTACTTTCTTCTGCCATGGCT	0.353																																						dbGAP											0													309.0	253.0	272.0					X																	129380918		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834333	CCDS14622.1	Xq25	2008-05-02	2007-09-20	2007-09-20	ENSG00000056277	ENSG00000056277			25955	protein-coding gene	gene with protein product			"""suppressor of hairy wing homolog 3 (Drosophila)"""	SUHW3		12477932	Standard	NM_017666		Approved	FLJ20095, ZNF633	uc004evm.3	Q8ND82	OTTHUMG00000022393	ENST00000370978.4:c.93G>A	X.37:g.129380918C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2V8|Q9NXR3	Silent	SNP	smart_Znf_C2H2-like	p.Q31	ENST00000370978.4	37	c.93	CCDS14622.1	X																																																																																			ZNF280C	-	NULL	ENSG00000056277		0.353	ZNF280C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF280C	HGNC	protein_coding	OTTHUMT00000058251.1	169	0.00	0	C	NM_017666		129380918	129380918	-1	no_errors	ENST00000370978	ensembl	human	known	69_37n	silent	178	14.01	29	SNP	0.997	T
ZNF431	170959	genome.wustl.edu	37	19	21365779	21365779	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:21365779A>G	ENST00000311048.7	+	5	817	c.673A>G	c.(673-675)Att>Gtt	p.I225V	ZNF431_ENST00000594425.1_Intron|ZNF431_ENST00000600692.1_3'UTR	NM_133473.2	NP_597730.2	Q8TF32	ZN431_HUMAN	zinc finger protein 431	225					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(7)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	23						ACATAAAAGAATTCATATTAG	0.323																																						dbGAP											0													39.0	43.0	42.0					19																	21365779		2200	4296	6496	-	-	-	SO:0001583	missense	0			AB075849	CCDS32979.1	19p12	2013-01-08				ENSG00000196705		"""Zinc fingers, C2H2-type"", ""-"""	20809	protein-coding gene	gene with protein product						11853319	Standard	NM_133473		Approved	KIAA1969	uc002npp.2	Q8TF32		ENST00000311048.7:c.673A>G	19.37:g.21365779A>G	ENSP00000308578:p.Ile225Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAK7|Q8IWC4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.I225V	ENST00000311048.7	37	c.673	CCDS32979.1	19	.	.	.	.	.	.	.	.	.	.	.	1.024	-0.683824	0.03353	.	.	ENSG00000196705	ENST00000311048	T	0.00986	5.47	1.0	-0.168	0.13343	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.00815	0.0027	N	0.16567	0.415	0.21147	N	0.999772	P	0.39443	0.674	B	0.40940	0.344	T	0.52102	-0.8620	9	0.51188	T	0.08	.	5.1017	0.14762	0.7829:0.0:0.2171:0.0	.	225	Q8TF32	ZN431_HUMAN	V	225	ENSP00000308578:I225V	ENSP00000308578:I225V	I	+	1	0	ZNF431	21157619	0.000000	0.05858	0.150000	0.22450	0.138000	0.21146	-1.108000	0.03313	0.378000	0.24764	0.369000	0.22263	ATT	ZNF431	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196705		0.323	ZNF431-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF431	HGNC	protein_coding	OTTHUMT00000463943.1	37	0.00	0	A	XM_086098		21365779	21365779	+1	no_errors	ENST00000311048	ensembl	human	known	69_37n	missense	9	40.00	6	SNP	0.899	G
ZNF415	55786	genome.wustl.edu	37	19	53612984	53612984	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:53612984C>G	ENST00000500065.4	-	4	647	c.314G>C	c.(313-315)aGa>aCa	p.R105T	ZNF415_ENST00000421033.1_Missense_Mutation_p.R117T|ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000601215.1_3'UTR|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000448501.1_Missense_Mutation_p.R153T|ZNF415_ENST00000243643.4_Missense_Mutation_p.R105T|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000455735.2_Missense_Mutation_p.R153T|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.R92T	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	153					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		GTTGCAATTTCTTTCATCATC	0.373																																						dbGAP											0													134.0	122.0	126.0					19																	53612984		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.314G>C	19.37:g.53612984C>G	ENSP00000439435:p.Arg105Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.R153T	ENST00000500065.4	37	c.458	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	C	9.302	1.053341	0.19907	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.08282	3.11;3.11;3.11;3.11;3.11;3.11	2.15	1.09	0.20402	.	.	.	.	.	T	0.07503	0.0189	N	0.20685	0.6	0.09310	N	1	D;D;P;B;D;D	0.54964	0.969;0.967;0.948;0.002;0.969;0.969	P;B;B;B;P;P	0.54431	0.634;0.339;0.431;0.003;0.752;0.634	T	0.32719	-0.9896	9	0.13470	T	0.59	.	3.9767	0.09478	0.0:0.784:0.0:0.216	.	105;153;153;105;92;117	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	T	105;105;153;117;153;92	ENSP00000243643:R105T;ENSP00000439435:R105T;ENSP00000396492:R153T;ENSP00000395055:R117T;ENSP00000388787:R153T;ENSP00000414601:R92T	ENSP00000243643:R105T	R	-	2	0	ZNF415	58304796	0.000000	0.05858	0.006000	0.13384	0.043000	0.13939	-0.690000	0.05138	1.211000	0.43351	0.313000	0.20887	AGA	ZNF415	-	NULL	ENSG00000170954		0.373	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	74	0.00	0	C	NM_018355		53612984	53612984	-1	no_errors	ENST00000448501	ensembl	human	known	69_37n	missense	70	24.73	23	SNP	0.001	G
ZNF646	9726	genome.wustl.edu	37	16	31094355	31094355	+	3'UTR	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr16:31094355C>T	ENST00000394979.2	+	0	7133				ZNF646_ENST00000300850.5_Missense_Mutation_p.T1814M			O15015	ZN646_HUMAN	zinc finger protein 646						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CCCACCCCCACGACCCCACTC	0.637																																						dbGAP											0													42.0	38.0	39.0					16																	31094355		2197	4300	6497	-	-	-	SO:0001624	3_prime_UTR_variant	0			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.*1220C>T	16.37:g.31094355C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVD8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.T1814M	ENST00000394979.2	37	c.5441		16	.	.	.	.	.	.	.	.	.	.	C	10.94	1.492022	0.26774	.	.	ENSG00000167395	ENST00000300850	T	0.09255	3.0	5.58	3.4	0.38934	.	.	.	.	.	T	0.07413	0.0187	.	.	.	0.27165	N	0.961061	B	0.30146	0.27	B	0.20384	0.029	T	0.21965	-1.0230	8	0.62326	D	0.03	-0.0762	5.8116	0.18469	0.0:0.7355:0.0:0.2645	.	1814	O15015-2	.	M	1814	ENSP00000300850:T1814M	ENSP00000300850:T1814M	T	+	2	0	ZNF646	31001856	0.043000	0.20138	0.053000	0.19242	0.495000	0.33615	0.478000	0.22212	1.347000	0.45714	0.655000	0.94253	ACG	ZNF646	-	NULL	ENSG00000167395		0.637	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	22	0.00	0	C	NM_014699		31094355	31094355	+1	no_errors	ENST00000300850	ensembl	human	known	69_37n	missense	23	20.69	6	SNP	0.456	T
ZNF669	79862	genome.wustl.edu	37	1	247265074	247265074	+	Silent	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:247265074C>T	ENST00000343381.6	-	3	580	c.408G>A	c.(406-408)caG>caA	p.Q136Q	ZNF669_ENST00000366501.1_Missense_Mutation_p.R49K|ZNF669_ENST00000358785.4_Intron|ZNF669_ENST00000448299.2_Silent_p.Q50Q|ZNF669_ENST00000366500.1_Intron	NM_024804.2	NP_079080.2	Q96BR6	ZN669_HUMAN	zinc finger protein 669	136	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(3)|kidney(4)|large_intestine(2)|lung(6)	17	all_cancers(71;4.09e-05)|all_epithelial(71;6.72e-06)|Breast(184;0.0226)|Ovarian(71;0.0283)|all_lung(81;0.0488)|Lung NSC(105;0.053)		OV - Ovarian serous cystadenocarcinoma(106;0.00427)			CTTCAATATTCTGGTCTTTCC	0.348																																						dbGAP											0													84.0	83.0	83.0					1																	247265074		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0				CCDS31088.1, CCDS44345.1	1q44	2013-01-08			ENSG00000188295	ENSG00000188295		"""Zinc fingers, C2H2-type"", ""-"""	25736	protein-coding gene	gene with protein product						12477932	Standard	NM_024804		Approved	FLJ12606	uc001ice.2	Q96BR6	OTTHUMG00000040869	ENST00000343381.6:c.408G>A	1.37:g.247265074C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP94|Q5VT39|Q9H9Q6	Missense_Mutation	SNP	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	p.R49K	ENST00000343381.6	37	c.146	CCDS31088.1	1	.	.	.	.	.	.	.	.	.	.	C	5.784	0.328960	0.10956	.	.	ENSG00000188295	ENST00000366501	T	0.01871	4.59	0.217	0.217	0.15264	.	.	.	.	.	T	0.02156	0.0067	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.59537	-0.7436	6	0.16896	T	0.51	.	6.2124	0.20636	0.0:0.9997:0.0:3.0E-4	.	.	.	.	K	49	ENSP00000355457:R49K	ENSP00000355457:R49K	R	-	2	0	ZNF669	245331697	0.870000	0.30015	0.065000	0.19835	0.065000	0.16274	0.507000	0.22675	0.292000	0.22492	0.297000	0.19635	AGA	ZNF669	-	smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000188295		0.348	ZNF669-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF669	HGNC	protein_coding	OTTHUMT00000098394.4	46	0.00	0	C	NM_024804		247265074	247265074	-1	no_errors	ENST00000366501	ensembl	human	putative	69_37n	missense	60	11.76	8	SNP	0.996	T
ZNF692	55657	genome.wustl.edu	37	1	249152047	249152047	+	Nonsense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr1:249152047G>C	ENST00000306601.4	-	3	357	c.191C>G	c.(190-192)tCa>tGa	p.S64*	ZNF692_ENST00000366469.5_Nonsense_Mutation_p.S64*|ZNF692_ENST00000451251.1_Nonsense_Mutation_p.S69*|ZNF692_ENST00000427146.1_Nonsense_Mutation_p.S64*|ZNF692_ENST00000468455.1_5'Flank|ZNF692_ENST00000366471.3_Nonsense_Mutation_p.S64*|AL672294.1_ENST00000417047.1_RNA	NM_017865.3	NP_060335.2	Q9BU19	ZN692_HUMAN	zinc finger protein 692	64					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(6)|lung(7)|stomach(1)	17	all_cancers(71;3.33e-06)|all_epithelial(71;2.41e-06)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.0458)|Lung NSC(105;0.0494)|Melanoma(84;0.199)	all_cancers(173;0.19)	OV - Ovarian serous cystadenocarcinoma(106;0.00805)			GACACAGCCTGAAGAAGTGTA	0.607																																						dbGAP											0													50.0	42.0	44.0					1																	249152047		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC002948	CCDS31127.1, CCDS44348.1, CCDS53487.1	1q44	2013-01-08			ENSG00000171163	ENSG00000171163		"""Zinc fingers, C2H2-type"""	26049	protein-coding gene	gene with protein product						12477932	Standard	NM_001136036		Approved	FLJ20531, Zfp692	uc001ifc.2	Q9BU19	OTTHUMG00000040423	ENST00000306601.4:c.191C>G	1.37:g.249152047G>C	ENSP00000305483:p.Ser64*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DXZ0|Q5SRA5|Q5SRA6|Q9HBC9|Q9NW93|Q9NWY6|Q9UF97	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S69*	ENST00000306601.4	37	c.206	CCDS31127.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.314093	0.97467	.	.	ENSG00000171163	ENST00000306601;ENST00000427146;ENST00000366470;ENST00000366471;ENST00000366469;ENST00000451251;ENST00000496231	.	.	.	4.78	3.79	0.43588	.	0.642824	0.13676	N	0.370514	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-5.7429	10.4519	0.44526	0.0:0.198:0.802:0.0	.	.	.	.	X	64;64;64;64;64;69;64	.	ENSP00000305483:S64X	S	-	2	0	ZNF692	247118670	0.608000	0.26966	1.000000	0.80357	0.964000	0.63967	1.892000	0.39748	2.375000	0.81037	0.643000	0.83706	TCA	ZNF692	-	NULL	ENSG00000171163		0.607	ZNF692-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF692	HGNC	protein_coding	OTTHUMT00000097298.1	35	0.00	0	G	NM_017865		249152047	249152047	-1	no_errors	ENST00000451251	ensembl	human	known	69_37n	nonsense	20	22.22	6	SNP	0.997	C
ZNF705E	100131539	genome.wustl.edu	37	11	71527949	71527949	+	RNA	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr11:71527949G>A	ENST00000525199.1	-	0	583							A8MWA4	Z705E_HUMAN	zinc finger protein 705E						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)										ACATTGATATGATTTACCTTT	0.378																																						dbGAP											0																																										-	-	-			0					11q13.4	2013-04-03			ENSG00000214534	ENSG00000214534			33203	other	unknown							Standard	NM_001278713		Approved			A8MWA4	OTTHUMG00000167482		11.37:g.71527949G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000525199.1	37	NULL		11																																																																																			ZNF705E	-	-	ENSG00000214534		0.378	ZNF705E-002	KNOWN	basic	processed_transcript	ZNF705E	HGNC	pseudogene	OTTHUMT00000394768.1	55	0.00	0	G			71527949	71527949	-1	no_errors	ENST00000525199	ensembl	human	known	69_37n	rna	40	16.67	8	SNP	0.819	A
ZNF792	126375	genome.wustl.edu	37	19	35449354	35449354	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:35449354G>A	ENST00000404801.1	-	4	1791	c.1405C>T	c.(1405-1407)Cag>Tag	p.Q469*	ZNF792_ENST00000605484.1_Nonsense_Mutation_p.Q402*	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	469					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			TGAACTCGCTGATGTTTCATG	0.522																																					GBM(1;7 183 21053 22581 22847)	dbGAP											0													121.0	117.0	118.0					19																	35449354		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.1405C>T	19.37:g.35449354G>A	ENSP00000385099:p.Gln469*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E333|Q495L1|Q495L3|Q8N932	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q469*	ENST00000404801.1	37	c.1405	CCDS12440.2	19	.	.	.	.	.	.	.	.	.	.	g	39	7.721778	0.98453	.	.	ENSG00000180884	ENST00000404801;ENST00000379189	.	.	.	2.61	2.61	0.31194	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	11.3954	0.49838	0.0:0.0:1.0:0.0	.	.	.	.	X	469;229	.	ENSP00000368487:Q229X	Q	-	1	0	ZNF792	40141194	0.861000	0.29849	0.136000	0.22124	0.969000	0.65631	1.231000	0.32624	1.776000	0.52262	0.563000	0.77884	CAG	ZNF792	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180884		0.522	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF792	HGNC	protein_coding	OTTHUMT00000317673.1	47	0.00	0	G	NM_175872		35449354	35449354	-1	no_errors	ENST00000404801	ensembl	human	known	69_37n	nonsense	42	16.00	8	SNP	0.944	A
ZNF790	388536	genome.wustl.edu	37	19	37314208	37314208	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr19:37314208C>T	ENST00000356725.4	-	4	328	c.208G>A	c.(208-210)Gag>Aag	p.E70K	CTD-2162K18.5_ENST00000588906.1_RNA|CTD-2162K18.5_ENST00000587278.1_RNA	NM_001242802.1|NM_206894.3	NP_001229731.1|NP_996777.2	Q6PG37	ZN790_HUMAN	zinc finger protein 790	70	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			biliary_tract(1)|endometrium(2)|kidney(2)|large_intestine(14)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	32	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			CCTCTTGTCTCATCCCTCAAA	0.498																																						dbGAP											0													79.0	64.0	69.0					19																	37314208		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC057245	CCDS12496.1	19q13.12	2013-01-08			ENSG00000197863	ENSG00000197863		"""Zinc fingers, C2H2-type"", ""-"""	33114	protein-coding gene	gene with protein product							Standard	NM_206894		Approved	MGC62100, FLJ20350	uc021utm.1	Q6PG37	OTTHUMG00000165616	ENST00000356725.4:c.208G>A	19.37:g.37314208C>T	ENSP00000349161:p.Glu70Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E70K	ENST00000356725.4	37	c.208	CCDS12496.1	19	.	.	.	.	.	.	.	.	.	.	C	3.764	-0.049019	0.07407	.	.	ENSG00000197863	ENST00000356725;ENST00000528994;ENST00000525288	T;T;T	0.05199	3.48;6.25;5.89	3.75	-5.0	0.03001	Krueppel-associated box (1);	.	.	.	.	T	0.04182	0.0116	L	0.47016	1.485	0.09310	N	1	B	0.10296	0.003	B	0.08055	0.003	T	0.47315	-0.9127	9	0.17832	T	0.49	.	1.1807	0.01844	0.1542:0.2633:0.1519:0.4306	.	70	Q6PG37	ZN790_HUMAN	K	70	ENSP00000349161:E70K;ENSP00000435944:E70K;ENSP00000433389:E70K	ENSP00000349161:E70K	E	-	1	0	ZNF790	42006048	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-0.319000	0.08039	-1.010000	0.03396	-0.225000	0.12378	GAG	ZNF790	-	pfscan_Krueppel-associated_box	ENSG00000197863		0.498	ZNF790-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF790	HGNC	protein_coding	OTTHUMT00000385341.2	68	0.00	0	C	NM_206894		37314208	37314208	-1	no_errors	ENST00000356725	ensembl	human	known	69_37n	missense	40	16.67	8	SNP	0.000	T
ZRSR1	7310	genome.wustl.edu	37	5	112228363	112228363	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr5:112228363G>C	ENST00000391338.1	+	1	1051	c.1027G>C	c.(1027-1029)Gaa>Caa	p.E343Q	REEP5_ENST00000504247.1_Intron|CTC-487M23.8_ENST00000506997.1_3'UTR|REEP5_ENST00000474542.2_Intron|REEP5_ENST00000513339.1_Intron|REEP5_ENST00000379638.4_Intron|REEP5_ENST00000545426.1_3'UTR|CTC-487M23.8_ENST00000512790.1_3'UTR|CTC-487M23.5_ENST00000602872.1_RNA	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	343						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						TCCCAACAATGAATTCTGGGA	0.448																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.1027G>C	5.37:g.112228363G>C	ENSP00000375133:p.Glu343Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.E343Q	ENST00000391338.1	37	c.1027		5	.	.	.	.	.	.	.	.	.	.	G	23.6	4.440039	0.83993	.	.	ENSG00000212643	ENST00000391338	.	.	.	1.64	1.64	0.23874	.	0.000000	0.85682	D	0.000000	T	0.64394	0.2594	.	.	.	0.52501	D	0.999953	D	0.76494	0.999	D	0.66979	0.948	T	0.60475	-0.7256	8	0.22109	T	0.4	.	9.2236	0.37393	0.0:0.0:1.0:0.0	.	343	Q15695	U2AFL_HUMAN	Q	343	.	ENSP00000375133:E343Q	E	+	1	0	ZRSR1	112256262	1.000000	0.71417	0.847000	0.33407	0.874000	0.50279	6.288000	0.72679	1.210000	0.43336	0.591000	0.81541	GAA	ZRSR1	-	NULL	ENSG00000212643		0.448	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	46	0.00	0	G	NM_005083		112228363	112228363	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	37	27.45	14	SNP	1.000	C
ZSCAN23	222696	genome.wustl.edu	37	6	28402580	28402580	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A2L8-01A-11D-A18P-09	TCGA-BH-A2L8-10A-01D-A18P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	ce4179d3-b31d-4242-8ec1-f6785f9af2e1	b0e8676c-6f2d-4691-96c5-b323dded9687	g.chr6:28402580C>G	ENST00000289788.4	-	4	977	c.832G>C	c.(832-834)Gaa>Caa	p.E278Q	ZSCAN23_ENST00000486481.1_5'Flank	NM_001012455.1	NP_001012458.1	Q3MJ62	ZSC23_HUMAN	zinc finger and SCAN domain containing 23	278					transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|prostate(1)|stomach(2)	4						TCATCACATTCATAAGGCTTC	0.517																																						dbGAP											0													82.0	74.0	76.0					6																	28402580		692	1591	2283	-	-	-	SO:0001583	missense	0			AK092117	CCDS47393.1	6p21.33	2013-01-08	2007-02-20	2007-02-20	ENSG00000187987	ENSG00000187987		"""-"", ""Zinc fingers, C2H2-type"""	21193	protein-coding gene	gene with protein product			"""zinc finger protein 453"", ""zinc finger protein 390"""	ZNF453, ZNF390			Standard	NM_001012455		Approved	dJ29K1.3.1	uc003nli.4	Q3MJ62	OTTHUMG00000016346	ENST00000289788.4:c.832G>C	6.37:g.28402580C>G	ENSP00000289788:p.Glu278Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96KV9	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E278Q	ENST00000289788.4	37	c.832	CCDS47393.1	6	.	.	.	.	.	.	.	.	.	.	C	13.30	2.194641	0.38806	.	.	ENSG00000187987	ENST00000289788	T	0.20200	2.09	4.56	3.67	0.42095	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.526354	0.15929	N	0.237774	T	0.04724	0.0128	N	0.16130	0.375	0.09310	N	1	P	0.43607	0.812	B	0.42522	0.39	T	0.21621	-1.0240	10	0.21014	T	0.42	.	7.1764	0.25747	0.0:0.8011:0.0:0.1989	.	278	Q3MJ62	ZSC23_HUMAN	Q	278	ENSP00000289788:E278Q	ENSP00000289788:E278Q	E	-	1	0	ZSCAN23	28510559	0.000000	0.05858	0.568000	0.28447	0.987000	0.75469	-2.257000	0.01180	2.338000	0.79540	0.650000	0.86243	GAA	ZSCAN23	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000187987		0.517	ZSCAN23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN23	HGNC	protein_coding	OTTHUMT00000043751.2	39	0.00	0	C	XM_167147		28402580	28402580	-1	no_errors	ENST00000289788	ensembl	human	known	69_37n	missense	42	16.00	8	SNP	0.073	G
