#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTS7	11173	genome.wustl.edu	37	15	79056047	79056047	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr15:79056047C>T	ENST00000388820.4	-	22	4944	c.4734G>A	c.(4732-4734)tgG>tgA	p.W1578*		NM_014272.3	NP_055087.2	Q9UKP4	ATS7_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 7	1578	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular response to BMP stimulus (GO:0071773)|cellular response to interleukin-1 (GO:0071347)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of chondrocyte differentiation (GO:0032331)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(2)|lung(23)|ovary(1)|prostate(8)|skin(9)	54						TCACCTGGCCCCAGGGCCCCA	0.692																																						dbGAP											0													9.0	12.0	11.0					15																	79056047		2035	4017	6052	-	-	-	SO:0001587	stop_gained	0			AF140675	CCDS32303.1	15q25.1	2012-05-16	2005-08-19		ENSG00000136378	ENSG00000136378		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	223	protein-coding gene	gene with protein product	"""COMPase"", ""a disintegrin and metalloprotease with thrombospondin motifs-7 preproprotein"""	605009	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 7"""			10464288	Standard	NM_014272		Approved	ADAM-TS7, DKFZp434H204	uc002bej.4	Q9UKP4	OTTHUMG00000172907	ENST00000388820.4:c.4734G>A	15.37:g.79056047C>T	ENSP00000373472:p.Trp1578*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14F51|Q6P7J9	Nonsense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Peptidase_M12B_N,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.W1578*	ENST00000388820.4	37	c.4734	CCDS32303.1	15	.	.	.	.	.	.	.	.	.	.	c	45	12.043481	0.99630	.	.	ENSG00000136378	ENST00000388820	.	.	.	4.42	4.42	0.53409	.	0.000000	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.5879	0.76499	0.0:1.0:0.0:0.0	.	.	.	.	X	1578	.	ENSP00000373472:W1578X	W	-	3	0	ADAMTS7	76843102	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	7.460000	0.80816	1.985000	0.57927	0.574000	0.79327	TGG	ADAMTS7	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000136378		0.692	ADAMTS7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS7	HGNC	protein_coding	OTTHUMT00000421331.1	101	0.00	0	C	NM_014272		79056047	79056047	-1	no_errors	ENST00000388820	ensembl	human	known	69_37n	nonsense	73	12.05	10	SNP	1.000	T
AKR1C2	1646	genome.wustl.edu	37	10	5041580	5041580	+	Intron	SNP	C	C	T	rs34515072		TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr10:5041580C>T	ENST00000380753.4	-	4	557				AKR1C2_ENST00000407674.1_Intron|AKR1C2_ENST00000421196.3_Intron|RP11-499O7.7_ENST00000451575.2_RNA|RP11-499O7.7_ENST00000440414.1_RNA	NM_205845.2	NP_995317.1	P52895	AK1C2_HUMAN	aldo-keto reductase family 1, member C2						cellular response to jasmonic acid stimulus (GO:0071395)|daunorubicin metabolic process (GO:0044597)|digestion (GO:0007586)|doxorubicin metabolic process (GO:0044598)|epithelial cell differentiation (GO:0030855)|G-protein coupled receptor signaling pathway (GO:0007186)|oxidation-reduction process (GO:0055114)|positive regulation of cell proliferation (GO:0008284)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone metabolic process (GO:0042448)|prostaglandin metabolic process (GO:0006693)|response to prostaglandin (GO:0034694)|steroid metabolic process (GO:0008202)	cytoplasm (GO:0005737)	alditol:NADP+ 1-oxidoreductase activity (GO:0004032)|bile acid binding (GO:0032052)|carboxylic acid binding (GO:0031406)|ketosteroid monooxygenase activity (GO:0047086)|oxidoreductase activity, acting on NAD(P)H, quinone or similar compound as acceptor (GO:0016655)|phenanthrene 9,10-monooxygenase activity (GO:0018636)|prostaglandin F receptor activity (GO:0004958)|trans-1,2-dihydrobenzene-1,2-diol dehydrogenase activity (GO:0047115)			breast(1)|large_intestine(5)|lung(3)|skin(1)	10					Ursodeoxycholic acid(DB01586)	GGTGATGCAGCGCTCCAGAGA	0.418																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			L32592	CCDS7062.1, CCDS44350.1	10p15-p14	2014-01-29	2012-12-04		ENSG00000151632	ENSG00000151632	1.3.1.20, 1.1.1.213	"""Aldo-keto reductases"""	385	protein-coding gene	gene with protein product	"""dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III"""	600450	"""aldo-keto reductase family 1, member C2 (dihydrodiol dehydrogenase 2; bile acid binding protein; 3-alpha hydroxysteroid dehydrogenase, type III)"", ""testicular 17,20-desmolase deficiency"""	DDH2, TDD		9716498, 21802064	Standard	NM_001354		Approved	DD, BABP, DD2, HAKRD, MCDR2	uc001iht.3	P52895	OTTHUMG00000017584	ENST00000380753.4:c.370-111G>A	10.37:g.5041580C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2N9|B4DKR9|Q14133|Q5SR16|Q7M4N1|Q96A71	RNA	SNP	-	NULL	ENST00000380753.4	37	NULL	CCDS7062.1	10																																																																																			AKR1C2	-	-	ENSG00000151632		0.418	AKR1C2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKR1C2	HGNC	protein_coding	OTTHUMT00000046531.1	23	0.00	0	C	NM_001354		5041580	5041580	-1	no_errors	ENST00000460124	ensembl	human	known	69_37n	rna	28	26.32	10	SNP	0.000	T
ANKRD30BL	554226	genome.wustl.edu	37	2	133015522	133015522	+	5'UTR	SNP	C	C	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr2:133015522C>A	ENST00000470729.1	-	0	20				MIR663B_ENST00000408361.1_RNA	NR_027020.2		A7E2S9	A30BL_HUMAN	ankyrin repeat domain 30B-like											endometrium(1)|kidney(3)	4						CCTCGGCGGCCGGCCGGCGCA	0.682																																						dbGAP											0													23.0	28.0	26.0					2																	133015522		692	1591	2283	-	-	-	SO:0001623	5_prime_UTR_variant	0					2q21.2	2013-01-22	2010-06-14	2010-06-14	ENSG00000163046	ENSG00000163046		"""Ankyrin repeat domain containing"""	35167	protein-coding gene	gene with protein product			"""non-protein coding RNA 164"", ""ankyrin repeat domain 30B pseudogene 3"""	NCRNA00164, ANKRD30BP3		17114284	Standard	NR_027019		Approved		uc002tti.3	A7E2S9	OTTHUMG00000153491	ENST00000470729.1:c.-1405G>T	2.37:g.133015522C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZL7	RNA	SNP	-	NULL	ENST00000470729.1	37	NULL		2																																																																																			ANKRD30BL	-	-	ENSG00000163046		0.682	ANKRD30BL-002	KNOWN	basic	processed_transcript	ANKRD30BL	HGNC	protein_coding	OTTHUMT00000331354.1	62	0.00	0	C	NR_027019		133015522	133015522	-1	no_errors	ENST00000470729	ensembl	human	known	69_37n	rna	77	10.47	9	SNP	0.005	A
ASPHD2	57168	genome.wustl.edu	37	22	26839131	26839131	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr22:26839131G>A	ENST00000215906.5	+	4	1507	c.1069G>A	c.(1069-1071)Gaa>Aaa	p.E357K	HPS4_ENST00000493455.2_5'Flank	NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	357					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)	p.E331K(1)		endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						CGCAGCGGCCGAACGGCAGGC	0.607																																						dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											147.0	151.0	149.0					22																	26839131		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.1069G>A	22.37:g.26839131G>A	ENSP00000215906:p.Glu357Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCH3|Q7L0W3|Q9NSN3	Missense_Mutation	SNP	pfam_Asp_Arg_b-Hydrxlase	p.E357K	ENST00000215906.5	37	c.1069	CCDS13834.2	22	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932185	0.92389	.	.	ENSG00000128203	ENST00000215906	T	0.58506	0.33	4.53	4.53	0.55603	.	0.000000	0.85682	D	0.000000	T	0.78824	0.4344	M	0.87269	2.87	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	D	0.83619	0.0138	10	0.87932	D	0	-19.1228	16.4613	0.84055	0.0:0.0:1.0:0.0	.	357	Q6ICH7	ASPH2_HUMAN	K	357	ENSP00000215906:E357K	ENSP00000215906:E357K	E	+	1	0	ASPHD2	25169131	1.000000	0.71417	0.969000	0.41365	0.609000	0.37215	8.872000	0.92352	2.342000	0.79632	0.561000	0.74099	GAA	ASPHD2	-	NULL	ENSG00000128203		0.607	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPHD2	HGNC	protein_coding	OTTHUMT00000320422.1	36	0.00	0	G	NM_020437		26839131	26839131	+1	no_errors	ENST00000215906	ensembl	human	known	69_37n	missense	52	10.34	6	SNP	1.000	A
ATP13A3	79572	genome.wustl.edu	37	3	194147817	194147817	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr3:194147817G>T	ENST00000439040.1	-	29	3903	c.3112C>A	c.(3112-3114)Cat>Aat	p.H1038N	ATP13A3_ENST00000256031.4_Missense_Mutation_p.H1038N			Q9H7F0	AT133_HUMAN	ATPase type 13A3	1038						integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		GATTTTGGATGCCACACTTCA	0.323																																						dbGAP											0													62.0	59.0	60.0					3																	194147817		1807	4077	5884	-	-	-	SO:0001583	missense	0			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.3112C>A	3.37:g.194147817G>T	ENSP00000416508:p.His1038Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NC11|Q96KS1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.H1038N	ENST00000439040.1	37	c.3112	CCDS43187.1	3	.	.	.	.	.	.	.	.	.	.	G	10.19	1.283333	0.23392	.	.	ENSG00000133657	ENST00000439040;ENST00000256031	D;D	0.88124	-2.34;-2.34	5.39	3.36	0.38483	.	0.610430	0.17495	N	0.172200	T	0.67683	0.2919	N	0.03154	-0.405	0.20403	N	0.999902	B	0.02656	0.0	B	0.01281	0.0	T	0.54180	-0.8332	10	0.16896	T	0.51	0.4114	7.1194	0.25435	0.0:0.1209:0.465:0.4141	.	1038	Q9H7F0	AT133_HUMAN	N	1038	ENSP00000416508:H1038N;ENSP00000256031:H1038N	ENSP00000256031:H1038N	H	-	1	0	ATP13A3	195629106	1.000000	0.71417	0.846000	0.33378	0.949000	0.60115	2.778000	0.47726	1.221000	0.43506	0.573000	0.79308	CAT	ATP13A3	-	tigrfam_ATPase_P-typ_unknown-pump-sp	ENSG00000133657		0.323	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ATP13A3	HGNC	protein_coding	OTTHUMT00000342799.2	36	0.00	0	G	NM_024524		194147817	194147817	-1	no_errors	ENST00000256031	ensembl	human	known	69_37n	missense	35	10.26	4	SNP	0.984	T
BAZ2B	29994	genome.wustl.edu	37	2	160206348	160206348	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr2:160206348C>T	ENST00000392783.2	-	28	5229	c.4734G>A	c.(4732-4734)atG>atA	p.M1578I	BAZ2B_ENST00000392782.1_Missense_Mutation_p.M1542I|BAZ2B_ENST00000355831.2_Missense_Mutation_p.M1544I|BAZ2B_ENST00000343439.5_Missense_Mutation_p.M1478I	NM_013450.2	NP_038478.2	Q9UIF8	BAZ2B_HUMAN	bromodomain adjacent to zinc finger domain, 2B	1578					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(7)|liver(2)|lung(41)|ovary(3)|prostate(1)|skin(2)|soft_tissue(1)|urinary_tract(1)	82						AAGCAGTTGACATATCGGCAT	0.458																																						dbGAP											0													173.0	170.0	171.0					2																	160206348		2116	4238	6354	-	-	-	SO:0001583	missense	0			AB032255	CCDS2209.2, CCDS74594.1	2q24.2	2013-01-28			ENSG00000123636	ENSG00000123636		"""Zinc fingers, PHD-type"""	963	protein-coding gene	gene with protein product		605683				10662543	Standard	XM_005246488		Approved	WALp4	uc002uao.3	Q9UIF8	OTTHUMG00000132027	ENST00000392783.2:c.4734G>A	2.37:g.160206348C>T	ENSP00000376534:p.Met1578Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPA8|Q96EA1|Q96SQ8|Q9P252|Q9Y4N8	Missense_Mutation	SNP	pfam_Bromodomain,pfam_Methyl_CpG_DNA-bd,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_DNA-bd_integrase-typ,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Methyl_CpG_DNA-bd,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.M1578I	ENST00000392783.2	37	c.4734	CCDS2209.2	2	.	.	.	.	.	.	.	.	.	.	C	6.999	0.554483	0.13374	.	.	ENSG00000123636	ENST00000392782;ENST00000392783;ENST00000355831;ENST00000343439	T;T;T;T	0.56611	0.53;0.53;0.53;0.45	6.06	1.5	0.22942	.	1.593810	0.04414	U	0.366468	T	0.36358	0.0964	N	0.14661	0.345	0.09310	N	1	B;B	0.18863	0.0;0.031	B;B	0.04013	0.0;0.001	T	0.23691	-1.0181	10	0.37606	T	0.19	4.0316	7.8778	0.29603	0.0:0.4494:0.0:0.5506	.	1542;1578	Q9UIF8-5;Q9UIF8	.;BAZ2B_HUMAN	I	1542;1578;1544;1478	ENSP00000376533:M1542I;ENSP00000376534:M1578I;ENSP00000348087:M1544I;ENSP00000339670:M1478I	ENSP00000339670:M1478I	M	-	3	0	BAZ2B	159914594	0.000000	0.05858	0.003000	0.11579	0.894000	0.52154	0.295000	0.19065	0.369000	0.24510	0.655000	0.94253	ATG	BAZ2B	-	NULL	ENSG00000123636		0.458	BAZ2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ2B	HGNC	protein_coding	OTTHUMT00000255037.2	29	0.00	0	C			160206348	160206348	-1	no_errors	ENST00000392783	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.004	T
BTK	695	genome.wustl.edu	37	X	100617172	100617172	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chrX:100617172C>T	ENST00000308731.7	-	7	740	c.577G>A	c.(577-579)Gag>Aag	p.E193K	BTK_ENST00000372880.1_Missense_Mutation_p.E193K	NM_000061.2	NP_000052.1	Q06187	BTK_HUMAN	Bruton agammaglobulinemia tyrosine kinase	193					adaptive immune response (GO:0002250)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|calcium-mediated signaling (GO:0019722)|cell maturation (GO:0048469)|Fc-epsilon receptor signaling pathway (GO:0038095)|histamine secretion by mast cell (GO:0002553)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|mesoderm development (GO:0007498)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell cytokine production (GO:0002721)|response to organic substance (GO:0010033)|response to reactive oxygen species (GO:0000302)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein tyrosine kinase activity (GO:0004713)			breast(4)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(25)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	50						TGGTCCTCCTCAGGCGTTGGG	0.468									Agammaglobulinemia, X-linked																													dbGAP											0			GRCh37	CM030798	BTK	M							120.0	97.0	105.0					X																	100617172		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Bruton Type Agammaglobulinemia	AK057105	CCDS14482.1, CCDS76002.1, CCDS76003.1	Xq21.33-q22	2014-09-17			ENSG00000010671	ENSG00000010671	2.7.10.1	"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	1133	protein-coding gene	gene with protein product		300300		AGMX1, IMD1		8380905	Standard	NM_000061		Approved	ATK, XLA, PSCTK1	uc004ehg.2	Q06187	OTTHUMG00000022022	ENST00000308731.7:c.577G>A	X.37:g.100617172C>T	ENSP00000308176:p.Glu193Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAW1|Q32ML5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_Znf_Btk_motif,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_Znf_Btk_motif,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,prints_SH2,prints_Znf_Btk_motif	p.E193K	ENST00000308731.7	37	c.577	CCDS14482.1	X	.	.	.	.	.	.	.	.	.	.	C	24.3	4.513116	0.85389	.	.	ENSG00000010671	ENST00000372880;ENST00000308731	D;T	0.81996	-1.56;-0.98	5.5	5.5	0.81552	.	0.287656	0.39146	N	0.001454	T	0.74344	0.3704	N	0.08118	0	0.53688	D	0.999976	P;P;B	0.51449	0.945;0.599;0.267	P;B;B	0.47402	0.546;0.284;0.039	T	0.77474	-0.2574	10	0.37606	T	0.19	.	16.7194	0.85406	0.0:1.0:0.0:0.0	.	193;193;193	Q5JY90;B2RAW1;Q06187	.;.;BTK_HUMAN	K	193	ENSP00000361971:E193K;ENSP00000308176:E193K	ENSP00000308176:E193K	E	-	1	0	BTK	100503828	0.995000	0.38212	1.000000	0.80357	0.585000	0.36419	3.257000	0.51500	2.323000	0.78572	0.529000	0.55759	GAG	BTK	-	NULL	ENSG00000010671		0.468	BTK-006	KNOWN	basic|appris_principal|CCDS	protein_coding	BTK	HGNC	protein_coding	OTTHUMT00000057532.2	48	0.00	0	C	NM_000061		100617172	100617172	-1	no_errors	ENST00000308731	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	1.000	T
CDADC1	81602	genome.wustl.edu	37	13	49841963	49841963	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr13:49841963G>A	ENST00000251108.6	+	5	881	c.768G>A	c.(766-768)atG>atA	p.M256I	CDADC1_ENST00000444959.1_Missense_Mutation_p.M58I	NM_001193478.1|NM_030911.3	NP_001180407.1|NP_112173.1	Q9BWV3	CDAC1_HUMAN	cytidine and dCMP deaminase domain containing 1	256							hydrolase activity (GO:0016787)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(4)|upper_aerodigestive_tract(1)	16		Lung NSC(96;0.000705)|Breast(56;0.0011)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;1.06e-08)|COAD - Colon adenocarcinoma(199;0.216)		AAATACTGATGACTATAGGTT	0.323																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AY027525	CCDS9415.1	13q14.11	2008-02-05			ENSG00000102543	ENSG00000102543			20299	protein-coding gene	gene with protein product							Standard	NM_001193478		Approved	NYD-SP15	uc001vcu.3	Q9BWV3	OTTHUMG00000016913	ENST00000251108.6:c.768G>A	13.37:g.49841963G>A	ENSP00000251108:p.Met256Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49A08|Q4G119|Q5TAW9|Q7Z764|Q9NT36	Missense_Mutation	SNP	pfam_CMP_dCMP_Zn-bd,superfamily_Cytidine_deaminase-like	p.M256I	ENST00000251108.6	37	c.768	CCDS9415.1	13	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869057	0.51588	.	.	ENSG00000102543	ENST00000251108;ENST00000444959	.	.	.	5.53	5.53	0.82687	.	0.196398	0.56097	D	0.000021	T	0.21307	0.0513	N	0.19112	0.55	0.31033	N	0.71715	P;P	0.49961	0.93;0.93	B;B	0.35353	0.201;0.201	T	0.26643	-1.0097	9	0.66056	D	0.02	-21.4903	12.1867	0.54243	0.0779:0.0:0.9221:0.0	.	256;256	Q9BWV3;B2R742	CDAC1_HUMAN;.	I	256;58	.	ENSP00000251108:M256I	M	+	3	0	CDADC1	48739964	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.522000	0.53480	2.749000	0.94314	0.655000	0.94253	ATG	CDADC1	-	NULL	ENSG00000102543		0.323	CDADC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDADC1	HGNC	protein_coding	OTTHUMT00000044902.2	28	0.00	0	G	NM_030911		49841963	49841963	+1	no_errors	ENST00000251108	ensembl	human	known	69_37n	missense	44	16.98	9	SNP	1.000	A
CIR1	9541	genome.wustl.edu	37	2	175213341	175213341	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr2:175213341C>T	ENST00000342016.3	-	10	1329	c.1237G>A	c.(1237-1239)Gaa>Aaa	p.E413K	CIR1_ENST00000362053.5_3'UTR	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	413	Arg/Ser-rich (RS domain).				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						CTTTGCTCTTCACCAGGATTT	0.502																																						dbGAP											0													205.0	197.0	200.0					2																	175213341		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.1237G>A	2.37:g.175213341C>T	ENSP00000339723:p.Glu413Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Missense_Mutation	SNP	pfam_CIR_N_dom,superfamily_Znf_CCHC	p.E413K	ENST00000342016.3	37	c.1237	CCDS2256.1	2	.	.	.	.	.	.	.	.	.	.	C	8.823	0.937999	0.18206	.	.	ENSG00000138433	ENST00000342016	.	.	.	6.03	2.09	0.27110	.	0.817553	0.11727	N	0.535336	T	0.34513	0.0900	L	0.58101	1.795	0.21861	N	0.999505	B;B	0.11235	0.003;0.004	B;B	0.11329	0.004;0.006	T	0.28776	-1.0033	9	0.30078	T	0.28	.	4.4132	0.11443	0.1273:0.6146:0.1229:0.1353	.	413;413	A0PJI7;Q86X95	.;CIR1_HUMAN	K	413	.	ENSP00000339723:E413K	E	-	1	0	CIR1	174921587	0.016000	0.18221	0.015000	0.15790	0.003000	0.03518	0.149000	0.16243	0.421000	0.25980	0.557000	0.71058	GAA	CIR1	-	NULL	ENSG00000138433		0.502	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIR1	HGNC	protein_coding	OTTHUMT00000255460.1	72	0.00	0	C	NM_004882		175213341	175213341	-1	no_errors	ENST00000342016	ensembl	human	known	69_37n	missense	91	18.02	20	SNP	0.899	T
DEPDC5	9681	genome.wustl.edu	37	22	32297755	32297755	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr22:32297755G>A	ENST00000382112.3	+	40	4446	c.4376G>A	c.(4375-4377)cGa>cAa	p.R1459Q	DEPDC5_ENST00000382105.2_3'UTR|DEPDC5_ENST00000266091.3_Missense_Mutation_p.R1446Q|DEPDC5_ENST00000400249.2_Missense_Mutation_p.R1437Q|DEPDC5_ENST00000382111.2_Intron|DEPDC5_ENST00000400246.1_Intron|DEPDC5_ENST00000400248.2_Missense_Mutation_p.R1437Q|DEPDC5_ENST00000539165.1_Missense_Mutation_p.R285Q|DEPDC5_ENST00000535622.1_Missense_Mutation_p.R1368Q	NM_001136029.2|NM_001242896.1	NP_001129501.1|NP_001229825.1	O75140	DEPD5_HUMAN	DEP domain containing 5	1468					intracellular signal transduction (GO:0035556)	cytosol (GO:0005829)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(24)|ovary(5)|pancreas(2)|prostate(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	63						TACTGGGATCGAATGCACCTC	0.428																																						dbGAP											0													89.0	84.0	85.0					22																	32297755		1911	4120	6031	-	-	-	SO:0001583	missense	0			AB014545	CCDS43006.1, CCDS43007.1, CCDS46692.1, CCDS56229.1, CCDS74849.1	22q12.3	2013-04-29			ENSG00000100150	ENSG00000100150			18423	protein-coding gene	gene with protein product		614191				23542697, 23542701	Standard	NM_001242896		Approved	KIAA0645, DEP.5	uc011alu.2	O75140	OTTHUMG00000030926	ENST00000382112.3:c.4376G>A	22.37:g.32297755G>A	ENSP00000371546:p.Arg1459Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V6|A8MPX9|B4DH93|B9EGN9|Q5K3V5|Q5THY9|Q5THZ0|Q5THZ1|Q5THZ3|Q68DR1|Q6MZX3|Q6PEZ1|Q9UGV8|Q9UH13	Missense_Mutation	SNP	pfam_DUF3608,pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.R1446Q	ENST00000382112.3	37	c.4337	CCDS46692.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.291430	0.95546	.	.	ENSG00000100150	ENST00000535622;ENST00000266091;ENST00000400249;ENST00000382109;ENST00000382112;ENST00000400248;ENST00000539165	T;T;T;T;T	0.34667	1.35;1.77;1.78;1.78;1.78	4.74	4.74	0.60224	.	0.335556	0.23819	N	0.044249	T	0.56046	0.1959	M	0.70595	2.14	0.80722	D	1	D;D;D;D;D;D	0.69078	0.985;0.997;0.996;0.977;0.985;0.985	B;P;P;P;B;B	0.58391	0.416;0.838;0.806;0.525;0.416;0.416	T	0.61242	-0.7102	10	0.72032	D	0.01	.	17.5913	0.87997	0.0:0.0:1.0:0.0	.	1468;1368;854;1446;1459;1437	B9EGN9;B4DH93;O75140-7;O75140-4;A8MPX9;O75140	.;.;.;.;.;DEPD5_HUMAN	Q	1368;1446;1437;1368;1459;1437;285	ENSP00000440210:R1368Q;ENSP00000266091:R1446Q;ENSP00000383108:R1437Q;ENSP00000371546:R1459Q;ENSP00000383107:R1437Q	ENSP00000266091:R1446Q	R	+	2	0	DEPDC5	30627755	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	8.891000	0.92485	2.570000	0.86706	0.462000	0.41574	CGA	DEPDC5	-	NULL	ENSG00000100150		0.428	DEPDC5-006	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DEPDC5	HGNC	protein_coding	OTTHUMT00000129087.1	44	0.00	0	G	NM_014662		32297755	32297755	+1	no_errors	ENST00000266091	ensembl	human	known	69_37n	missense	43	27.12	16	SNP	1.000	A
HHLA3	11147	genome.wustl.edu	37	1	70820695	70820695	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr1:70820695G>A	ENST00000359875.5	+	1	201	c.61G>A	c.(61-63)Gaa>Aaa	p.E21K	HHLA3_ENST00000486110.1_3'UTR|HHLA3_ENST00000432224.1_Missense_Mutation_p.E21K|HHLA3_ENST00000361764.4_Missense_Mutation_p.E21K|ANKRD13C_ENST00000262346.6_5'Flank|HHLA3_ENST00000531950.1_Missense_Mutation_p.E21K|HHLA3_ENST00000370940.5_Missense_Mutation_p.E21K|ANKRD13C_ENST00000370944.4_5'Flank	NM_001036645.1	NP_001031722.1	Q9XRX5	HHLA3_HUMAN	HERV-H LTR-associating 3	21										large_intestine(3)|lung(1)	4						TCCCGCAGAGGAATGCAGAAT	0.517																																						dbGAP											0													101.0	82.0	88.0					1																	70820695		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126164	CCDS649.1, CCDS30752.1, CCDS30753.1	1p31.1	2008-02-05			ENSG00000197568	ENSG00000197568			4906	protein-coding gene	gene with protein product		604372				10444326	Standard	NR_027404		Approved		uc001dfa.3	Q9XRX5	OTTHUMG00000009346	ENST00000359875.5:c.61G>A	1.37:g.70820695G>A	ENSP00000352938:p.Glu21Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQ74|Q5VZP2|Q96FH5|Q9XRX4	Missense_Mutation	SNP	NULL	p.E21K	ENST00000359875.5	37	c.61	CCDS30753.1	1	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464342	0.26335	.	.	ENSG00000197568	ENST00000361764;ENST00000359875;ENST00000370940;ENST00000531950;ENST00000432224	.	.	.	2.53	-2.18	0.07037	.	.	.	.	.	T	0.04907	0.0132	N	0.08118	0	0.09310	N	1	B;B;B	0.28713	0.05;0.22;0.22	B;B;B	0.26310	0.068;0.028;0.058	T	0.33317	-0.9873	8	0.87932	D	0	.	1.0402	0.01557	0.1347:0.201:0.2902:0.3741	.	21;21;21	Q9XRX5-2;Q9XRX5-3;Q9XRX5	.;.;HHLA3_HUMAN	K	21	.	ENSP00000352938:E21K	E	+	1	0	HHLA3	70593283	0.001000	0.12720	0.000000	0.03702	0.004000	0.04260	0.423000	0.21313	-0.502000	0.06596	-0.913000	0.02753	GAA	HHLA3	-	NULL	ENSG00000197568		0.517	HHLA3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	HHLA3	HGNC	protein_coding	OTTHUMT00000025911.2	45	0.00	0	G	NM_007071		70820695	70820695	+1	no_errors	ENST00000432224	ensembl	human	known	69_37n	missense	70	14.63	12	SNP	0.000	A
HLA-DQB1	3119	genome.wustl.edu	37	6	32629935	32629935	+	Missense_Mutation	SNP	C	C	G	rs1063322		TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr6:32629935C>G	ENST00000399082.3	-	2	244	c.200G>C	c.(199-201)gGc>gCc	p.G67A	HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.G157A|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.G157A|HLA-DQB1_ENST00000460185.1_5'Flank|HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.G157A|HLA-DQB1_ENST00000399084.1_Missense_Mutation_p.G157A|XXbac-BPG254F23.6_ENST00000443574.1_RNA			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	157	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	TTTGATCTGGCCTGGATAGAA	0.567									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia																												Esophageal Squamous(151;720 1825 15000 40336 43415)	dbGAP											0													30.0	29.0	29.0					6																	32629935		2014	4198	6212	-	-	-	SO:0001583	missense	0	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.200G>C	6.37:g.32629935C>G	ENSP00000382032:p.Gly67Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.G157A	ENST00000399082.3	37	c.470		6	.	.	.	.	.	.	.	.	.	.	.	1.163	-0.643227	0.03531	.	.	ENSG00000179344	ENST00000399082;ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084;ENST00000447884	T;T;T;T;T	0.02682	4.2;4.2;4.2;4.2;4.2	4.52	0.489	0.16854	.	1.197420	0.06155	N	0.674887	T	0.01124	0.0037	.	.	.	0.80722	P	0.0	B;B;B;B	0.10296	0.002;0.003;0.003;0.002	B;B;B;B	0.19391	0.025;0.025;0.025;0.025	T	0.45381	-0.9265	8	0.59425	D	0.04	.	9.8117	0.40826	0.0:0.3076:0.6022:0.0902	rs1063322;rs3204388;rs9274000;rs9282126;rs17840187	157;122;157;157	A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.	A	67;157;157;157;157;93	ENSP00000382032:G67A;ENSP00000382029:G157A;ENSP00000364080:G157A;ENSP00000407332:G157A;ENSP00000382034:G157A	ENSP00000364080:G157A	G	-	2	0	HLA-DQB1	32737913	0.000000	0.05858	0.038000	0.18304	0.240000	0.25518	0.233000	0.17911	-0.243000	0.09653	-0.676000	0.03789	GGC	HLA-DQB1	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000179344		0.567	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	HLA-DQB1	HGNC	protein_coding	OTTHUMT00000276131.1	18	0.00	0	C	NM_002123		32629935	32629935	-1	no_errors	ENST00000374943	ensembl	human	known	69_37n	missense	16	40.74	11	SNP	0.001	G
HLA-DPB1	3115	genome.wustl.edu	37	6	33053652	33053652	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr6:33053652G>T	ENST00000418931.2	+	4	859	c.743G>T	c.(742-744)aGg>aTg	p.R248M		NM_002121.5	NP_002112.3	P04440	DPB1_HUMAN	major histocompatibility complex, class II, DP beta 1	248					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell proliferation (GO:0042102)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	cell surface (GO:0009986)|clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	peptide antigen binding (GO:0042605)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	11						TTCATGCACAGGAGGAGCAAG	0.542																																						dbGAP											0													87.0	81.0	83.0					6																	33053652		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4765.1	6p21.3	2013-01-11			ENSG00000223865	ENSG00000223865		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4940	protein-coding gene	gene with protein product		142858		HLA-DP1B			Standard	NM_002121		Approved		uc003ocu.2	P04440	OTTHUMG00000031076	ENST00000418931.2:c.743G>T	6.37:g.33053652G>T	ENSP00000408146:p.Arg248Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PFJ7|A5I886|A8YPB3|B5U8B4|B7VF80|B7VF87|B8ZX68|B8ZYT0|B9W5S8|B9W6F7|B9W6F9|C0MPP5|C0MPQ2|C0MPQ3|C0MPQ5|C0MPQ6|C0MPQ7|C4R9J5|C5IZL1|O00259|O19698|O19700|O19702|O19749|O46884|O77952|O98215|O98216|O98217|O98218|O98219|O98222|O98223|P01916|P04232|P13763|P79493|P79608|Q0P0L4|Q0ZFN3|Q14279|Q27S71|Q29682|Q29684|Q29698|Q29714|Q29775|Q29776|Q29778|Q29779|Q29781|Q29827|Q29828|Q29879|Q29880|Q29898|Q29977|Q2MGW3|Q30015|Q30031|Q30032|Q30033|Q30034|Q30050|Q30051|Q30052|Q30053|Q30054|Q30055|Q30174|Q4GY31|Q4JHD8|Q5ENE0|Q5ENE1|Q5ENW3|Q5EP46|Q5EP47|Q5EP49|Q5EP51|Q5EP52|Q5EP53|Q5EP56|Q5I4H8|Q5I4H9|Q5ISH4|Q5ISH5|Q5SQ73|Q5STP2|Q5YLA6|Q6IVX1|Q6LBX2|Q6LBX3|Q6LBX4|Q6LBX5|Q6LBX6|Q6LBX7|Q6PWX6|Q6TAS4|Q714U1|Q714U2|Q7YQ10|Q860Z7|Q8HWL7|Q8HWT5|Q8SNC4|Q95HC1|Q95IT7|Q95IT8|Q9BD13|Q9GIM2|Q9GIM4|Q9GIX6|Q9GJ41|Q9MY67|Q9TNT7|Q9TQE2|Q9XS11|Q9XS12	Nonsense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.G215*	ENST00000418931.2	37	c.643	CCDS4765.1	6	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	G|G|G	14.17|14.17|14.17	2.455460|2.455460|2.455460	0.43634|0.43634|0.43634	.|.|.	.|.|.	ENSG00000223865|ENSG00000223865|ENSG00000223865	ENST00000416804|ENST00000422592|ENST00000418931;ENST00000411942;ENST00000428835	.|.|T;T	.|.|0.00717	.|.|5.88;5.79	4.03|4.03|4.03	-8.06|-8.06|-8.06	0.01102|0.01102|0.01102	.|.|.	.|.|1.552010	.|.|0.03906	.|.|N	.|.|0.281147	.|T|T	.|0.00384|0.00384	.|0.0012|0.0012	L|L|L	0.40543|0.40543|0.40543	1.245|1.245|1.245	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|.|P;P;P	.|.|0.43885	.|.|0.713;0.82;0.82	.|.|B;P;P	.|.|0.48166	.|.|0.39;0.569;0.569	.|T|T	.|0.36866|0.36866	.|-0.9730|-0.9730	.|6|10	.|0.02654|0.72032	.|T|D	.|1|0.01	.|.|.	2.5303|2.5303|2.5303	0.04701|0.04701|0.04701	0.1154:0.1024:0.222:0.5602|0.1154:0.1024:0.222:0.5602|0.1154:0.1024:0.222:0.5602	.|.|.	.|.|214;258;248	.|.|A2ALJ6;Q59GY1;P04440	.|.|.;.;DPB1_HUMAN	X|H|M	215|58|248;218;225	.|.|ENSP00000408146:R248M;ENSP00000412654:R225M	.|ENSP00000413559:Q58H|ENSP00000389210:R218M	G|Q|R	+|+|+	1|3|2	0|2|0	HLA-DPB1|HLA-DPB1|HLA-DPB1	33161630|33161630|33161630	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.000000|0.000000|0.000000	0.03702|0.03702|0.03702	0.369000|0.369000|0.369000	0.29798|0.29798|0.29798	-1.023000|-1.023000|-1.023000	0.03607|0.03607|0.03607	-1.875000|-1.875000|-1.875000	0.01132|0.01132|0.01132	0.643000|0.643000|0.643000	0.83706|0.83706|0.83706	GGA|CAG|AGG	HLA-DPB1	-	NULL	ENSG00000223865		0.542	HLA-DPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-DPB1	HGNC	protein_coding	OTTHUMT00000076106.2	36	0.00	0	G	NM_002121		33053652	33053652	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416804	ensembl	human	known	69_37n	nonsense	35	10.26	4	SNP	0.000	T
KBTBD12	166348	genome.wustl.edu	37	3	127642153	127642153	+	Silent	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr3:127642153G>A	ENST00000405109.1	+	2	716	c.249G>A	c.(247-249)tcG>tcA	p.S83S	KBTBD12_ENST00000407609.3_Intron|KBTBD12_ENST00000343941.4_5'Flank|KBTBD12_ENST00000405256.1_Silent_p.S83S			Q3ZCT8	KBTBC_HUMAN	kelch repeat and BTB (POZ) domain containing 12	83	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									endometrium(1)|large_intestine(6)|lung(5)|ovary(1)	13						AAAGTGTGTCGGTGTTATTAA	0.383																																						dbGAP											0													82.0	77.0	78.0					3																	127642153		1929	4139	6068	-	-	-	SO:0001819	synonymous_variant	0				CCDS33848.2	3q21.3	2013-01-08	2009-10-01	2009-10-01	ENSG00000187715	ENSG00000187715		"""BTB/POZ domain containing"""	25731	protein-coding gene	gene with protein product			"""kelch domain containing 6"""	KLHDC6			Standard	NM_207335		Approved	FLJ46299	uc010hsr.3	Q3ZCT8	OTTHUMG00000150508	ENST00000405109.1:c.249G>A	3.37:g.127642153G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCC6|Q6ZRK1	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S83	ENST00000405109.1	37	c.249	CCDS33848.2	3																																																																																			KBTBD12	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	ENSG00000187715		0.383	KBTBD12-006	KNOWN	basic|appris_principal|CCDS	protein_coding	KBTBD12	HGNC	protein_coding	OTTHUMT00000318682.1	20	0.00	0	G	NM_207335		127642153	127642153	+1	no_errors	ENST00000405109	ensembl	human	known	69_37n	silent	34	17.07	7	SNP	0.011	A
LAMA5	3911	genome.wustl.edu	37	20	60889469	60889469	+	Silent	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr20:60889469G>A	ENST00000252999.3	-	62	8461	c.8395C>T	c.(8395-8397)Ctg>Ttg	p.L2799L		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	2799	Laminin G-like 1. {ECO:0000255|PROSITE- ProRule:PRU00122}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			TTGTCACGCAGAGACACACCC	0.607																																						dbGAP											0													114.0	93.0	100.0					20																	60889469		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.8395C>T	20.37:g.60889469G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Silent	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.L2799	ENST00000252999.3	37	c.8395	CCDS33502.1	20																																																																																			LAMA5	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000130702		0.607	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	50	0.00	0	G	NM_005560		60889469	60889469	-1	no_errors	ENST00000252999	ensembl	human	known	69_37n	silent	43	12.24	6	SNP	0.991	A
MAP3K1	4214	genome.wustl.edu	37	5	56177011	56177014	+	Frame_Shift_Del	DEL	ATAG	ATAG	-	rs570313957	byFrequency	TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	ATAG	ATAG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr5:56177011_56177014delATAG	ENST00000399503.3	+	13	2281_2284	c.2281_2284delATAG	c.(2281-2286)atagatfs	p.ID761fs		NM_005921.1	NP_005912.1	Q13233	M3K1_HUMAN	mitogen-activated protein kinase kinase kinase 1, E3 ubiquitin protein ligase	761					activation of MAPKK activity (GO:0000186)|apoptotic mitochondrial changes (GO:0008637)|cellular response to mechanical stimulus (GO:0071260)|epithelial cell morphogenesis (GO:0003382)|eyelid development in camera-type eye (GO:0061029)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of actin filament polymerization (GO:0030838)|protein phosphorylation (GO:0006468)|regulation of cell migration (GO:0030334)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	cytosol (GO:0005829)	ATP binding (GO:0005524)|JUN kinase kinase activity (GO:0008545)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|zinc ion binding (GO:0008270)			NS(1)|breast(19)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(11)|ovary(1)|skin(3)|urinary_tract(1)	57		Lung NSC(810;4.65e-05)|Prostate(74;0.0132)|Breast(144;0.0321)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;6.08e-40)		CCTTTGTCTTATAGATAGACTGTT	0.363																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U29671, AF042838	CCDS43318.1	5q11.2	2012-02-23	2012-02-23		ENSG00000095015	ENSG00000095015		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6848	protein-coding gene	gene with protein product		600982	"""mitogen-activated protein kinase kinase kinase 1"""	MEKK1		8597633	Standard	NM_005921		Approved	MEKK, MAPKKK1	uc003jqw.4	Q13233	OTTHUMG00000059486	ENST00000399503.3:c.2281_2284delATAG	5.37:g.56177015_56177018delATAG	ENSP00000382423:p.Ile761fs	Somatic		WXS	Illumina GAIIx	Phase_IV		Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Znf_RING,pfscan_Znf_SWIM,pfscan_Prot_kinase_cat_dom	p.R763fs	ENST00000399503.3	37	c.2281_2284	CCDS43318.1	5																																																																																			MAP3K1	-	superfamily_ARM-type_fold	ENSG00000095015		0.363	MAP3K1-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MAP3K1	HGNC	protein_coding	OTTHUMT00000132309.2	33	0.00	0	ATAG	XM_042066		56177011	56177014	+1	no_errors	ENST00000399503	ensembl	human	novel	69_37n	frame_shift_del	43	10.42	5	DEL	0.994:0.998:0.969:1.000	-
MUC12	10071	genome.wustl.edu	37	7	100644027	100644027	+	Missense_Mutation	SNP	C	C	A	rs140825627	byFrequency	TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr7:100644027C>A	ENST00000379442.3	+	5	10612	c.10612C>A	c.(10612-10614)Cct>Act	p.P3538T	MUC12_ENST00000536621.1_Missense_Mutation_p.P3395T			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	3538	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						AACACACTTCCCTGACAGCTC	0.542																																						dbGAP											0													1.0	1.0	1.0					7																	100644027		10	20	30	-	-	-	SO:0001583	missense	0			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.10612C>A	7.37:g.100644027C>A	ENSP00000368755:p.Pro3538Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.P3538T	ENST00000379442.3	37	c.10612		7	.	.	.	.	.	.	.	.	.	.	c	0.178	-1.064834	0.01934	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.14893	2.48;2.47	.	.	.	.	.	.	.	.	T	0.06735	0.0172	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.42716	-0.9435	5	0.14252	T	0.57	.	.	.	.	.	.	.	.	T	3538;3395	ENSP00000368755:P3538T;ENSP00000441929:P3395T	ENSP00000368755:P3538T	P	+	1	0	MUC12	100430747	0.006000	0.16342	0.015000	0.15790	0.015000	0.08874	-0.624000	0.05540	0.159000	0.19401	0.162000	0.16502	CCT	MUC12	-	NULL	ENSG00000205277		0.542	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	10	0.00	0	C	XM_379904		100644027	100644027	+1	no_errors	ENST00000379442	ensembl	human	known	69_37n	missense	2	50.00	2	SNP	0.016	A
MUC5B	727897	genome.wustl.edu	37	11	1269731	1269731	+	Missense_Mutation	SNP	C	C	A	rs542178907		TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr11:1269731C>A	ENST00000529681.1	+	31	11679	c.11621C>A	c.(11620-11622)aCa>aAa	p.T3874K	RP11-532E4.2_ENST00000532061.2_RNA|MUC5B_ENST00000447027.1_Missense_Mutation_p.T3877K	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	3874	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		ACGGGCTTCACAGTCACCCCC	0.652													C|||	1	0.000199681	0.0	0.0	5008	,	,		17120	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													135.0	158.0	150.0					11																	1269731		2107	4216	6323	-	-	-	SO:0001583	missense	0			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.11621C>A	11.37:g.1269731C>A	ENSP00000436812:p.Thr3874Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.T3877K	ENST00000529681.1	37	c.11630	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	C	5.029	0.191033	0.09547	.	.	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.28069	1.63;1.8	1.54	0.597	0.17504	.	.	.	.	.	T	0.32675	0.0837	M	0.77820	2.39	0.09310	N	1	P;P	0.47409	0.895;0.895	B;B	0.40602	0.334;0.334	T	0.23868	-1.0176	9	0.87932	D	0	.	8.0609	0.30633	0.0:0.8609:0.0:0.1391	.	4402;3877	A7Y9J9;E9PBJ0	.;.	K	3874;3877;3818;3779	ENSP00000436812:T3874K;ENSP00000415793:T3877K	ENSP00000343037:T3818K	T	+	2	0	MUC5B	1226307	0.000000	0.05858	0.001000	0.08648	0.019000	0.09904	-2.042000	0.01414	0.233000	0.21120	0.194000	0.17425	ACA	MUC5B	-	NULL	ENSG00000117983		0.652	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	75	0.00	0	C	XM_001126093		1269731	1269731	+1	no_errors	ENST00000447027	ensembl	human	known	69_37n	missense	90	20.35	23	SNP	0.010	A
NBEAL1	65065	genome.wustl.edu	37	2	203962315	203962315	+	Intron	SNP	G	G	C			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr2:203962315G>C	ENST00000449802.1	+	11	1431					NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1											NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GAACGAGAAAGACCTTGCCAA	0.358																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.1099-2037G>C	2.37:g.203962315G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	RNA	SNP	-	NULL	ENST00000449802.1	37	NULL	CCDS46495.1	2																																																																																			NBEAL1	-	-	ENSG00000144426		0.358	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	39	0.00	0	G			203962315	203962315	+1	no_errors	ENST00000483147	ensembl	human	putative	69_37n	rna	34	16.67	7	SNP	1.000	C
NLGN4X	57502	genome.wustl.edu	37	X	5947366	5947366	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chrX:5947366C>T	ENST00000381095.3	-	3	1207	c.580G>A	c.(580-582)Gga>Aga	p.G194R	NLGN4X_ENST00000538097.1_Missense_Mutation_p.G194R|NLGN4X_ENST00000381092.1_Missense_Mutation_p.G194R|NLGN4X_ENST00000381093.2_Missense_Mutation_p.G214R|NLGN4X_ENST00000275857.6_Missense_Mutation_p.G194R	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	194					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						ATGACGTTTCCGTAGCTTGCC	0.458																																						dbGAP											0													175.0	130.0	146.0					X																	5947366		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.580G>A	X.37:g.5947366C>T	ENSP00000370485:p.Gly194Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.G214R	ENST00000381095.3	37	c.640	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	C	16.21	3.058107	0.55325	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.66995	-0.24;-0.24;-0.24;-0.24;-0.24	4.01	4.01	0.46588	Carboxylesterase, type B (1);	.	.	.	.	D	0.82926	0.5143	M	0.87758	2.905	0.80722	D	1	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.73708	0.967;0.981;0.927	D	0.86643	0.1893	9	0.72032	D	0.01	.	14.6434	0.68742	0.0:1.0:0.0:0.0	.	214;194;214	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	R	194;214;194;194;194	ENSP00000370485:G194R;ENSP00000370483:G214R;ENSP00000275857:G194R;ENSP00000370482:G194R;ENSP00000439203:G194R	ENSP00000275857:G194R	G	-	1	0	NLGN4X	5957366	1.000000	0.71417	0.007000	0.13788	0.021000	0.10359	6.722000	0.74735	1.620000	0.50308	0.538000	0.68166	GGA	NLGN4X	-	pfam_CarbesteraseB,pfam_AB_hydrolase_3	ENSG00000146938		0.458	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	61	0.00	0	C	NM_020742		5947366	5947366	-1	no_errors	ENST00000381093	ensembl	human	known	69_37n	missense	91	16.51	18	SNP	1.000	T
OR4F15	390649	genome.wustl.edu	37	15	102358817	102358817	+	Missense_Mutation	SNP	A	A	G			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr15:102358817A>G	ENST00000332238.4	+	1	452	c.428A>G	c.(427-429)tAc>tGc	p.Y143C		NM_001001674.1	NP_001001674.1	Q8NGB8	O4F15_HUMAN	olfactory receptor, family 4, subfamily F, member 15	143						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(10)	19	Lung NSC(78;0.000991)|all_lung(78;0.00128)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.00039)|Lung(145;0.17)|LUSC - Lung squamous cell carcinoma(107;0.187)			ATGTGTCTATACTTTTTAGCC	0.418																																						dbGAP											0													229.0	213.0	218.0					15																	102358817		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004405	CCDS32342.1	15q26.3	2012-08-09				ENSG00000182854		"""GPCR / Class A : Olfactory receptors"""	15078	protein-coding gene	gene with protein product							Standard	NM_001001674		Approved		uc010uts.2	Q8NGB8		ENST00000332238.4:c.428A>G	15.37:g.102358817A>G	ENSP00000333184:p.Tyr143Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNQ5|Q6IF57|Q96R70	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y143C	ENST00000332238.4	37	c.428	CCDS32342.1	15	.	.	.	.	.	.	.	.	.	.	.	0.161	-1.081556	0.01888	.	.	ENSG00000182854	ENST00000332238	T	0.00084	8.75	5.57	-11.1	0.00147	GPCR, rhodopsin-like superfamily (1);	1.176380	0.06093	N	0.664011	T	0.00039	0.0001	N	0.02169	-0.655	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.40831	-0.9542	9	.	.	.	.	3.8048	0.08773	0.0875:0.129:0.2527:0.5309	.	143	Q8NGB8	O4F15_HUMAN	C	143	ENSP00000333184:Y143C	.	Y	+	2	0	OR4F15	100176340	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.369000	0.00495	-3.601000	0.00134	-0.321000	0.08615	TAC	OR4F15	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000182854		0.418	OR4F15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4F15	HGNC	protein_coding	OTTHUMT00000417594.1	65	0.00	0	A	NM_001001674		102358817	102358817	+1	no_errors	ENST00000332238	ensembl	human	known	69_37n	missense	65	14.29	11	SNP	0.000	G
PALMD	54873	genome.wustl.edu	37	1	100127929	100127929	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr1:100127929G>A	ENST00000263174.4	+	2	475	c.100G>A	c.(100-102)Gac>Aac	p.D34N	PALMD_ENST00000605497.1_Missense_Mutation_p.D34N	NM_017734.4	NP_060204.1	Q9NP74	PALMD_HUMAN	palmdelphin	34					regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(8)|ovary(6)|pancreas(1)|prostate(2)	31		all_epithelial(167;0.000813)|all_lung(203;0.0214)|Lung NSC(277;0.0216)		Epithelial(280;0.067)|all cancers(265;0.117)|COAD - Colon adenocarcinoma(174;0.142)|Lung(183;0.201)		AATAGAGGAAGACAAACTAAA	0.264																																						dbGAP											0													66.0	76.0	73.0					1																	100127929		2203	4297	6500	-	-	-	SO:0001583	missense	0			AJ312214	CCDS758.1	1p22-p21	2008-07-18			ENSG00000099260	ENSG00000099260			15846	protein-coding gene	gene with protein product		610182		C1orf11		11478809	Standard	NM_017734		Approved	FLJ20271, PALML	uc001dsg.3	Q9NP74	OTTHUMG00000010764	ENST00000263174.4:c.100G>A	1.37:g.100127929G>A	ENSP00000263174:p.Asp34Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H7E6|Q9NPM5|Q9NPM6|Q9NPS0	Missense_Mutation	SNP	pfam_Paralemmin	p.D34N	ENST00000263174.4	37	c.100	CCDS758.1	1	.	.	.	.	.	.	.	.	.	.	G	17.24	3.339538	0.60963	.	.	ENSG00000099260	ENST00000263174	T	0.20738	2.05	5.56	5.56	0.83823	.	0.051120	0.85682	D	0.000000	T	0.09598	0.0236	L	0.34521	1.04	0.28114	N	0.930862	B	0.12013	0.005	B	0.11329	0.006	T	0.07712	-1.0758	10	0.72032	D	0.01	-12.1185	16.4395	0.83895	0.0:0.0:1.0:0.0	.	34	Q9NP74	PALMD_HUMAN	N	34	ENSP00000263174:D34N	ENSP00000263174:D34N	D	+	1	0	PALMD	99900517	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	5.413000	0.66399	2.615000	0.88500	0.563000	0.77884	GAC	PALMD	-	NULL	ENSG00000099260		0.264	PALMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PALMD	HGNC	protein_coding	OTTHUMT00000029672.1	32	0.00	0	G	NM_017734		100127929	100127929	+1	no_errors	ENST00000263174	ensembl	human	known	69_37n	missense	55	11.29	7	SNP	1.000	A
PARP4	143	genome.wustl.edu	37	13	25021263	25021263	+	Missense_Mutation	SNP	T	T	C	rs77269056		TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr13:25021263T>C	ENST00000381989.3	-	26	3281	c.3176A>G	c.(3175-3177)cAg>cGg	p.Q1059R		NM_006437.3	NP_006428.2	Q9UKK3	PARP4_HUMAN	poly (ADP-ribose) polymerase family, member 4	1059					cell death (GO:0008219)|cellular protein modification process (GO:0006464)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|inflammatory response (GO:0006954)|protein ADP-ribosylation (GO:0006471)|response to drug (GO:0042493)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(14)|lung(18)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	63		all_epithelial(30;7.67e-16)|Lung SC(185;0.0225)|Breast(139;0.052)		all cancers(112;0.000127)|Epithelial(112;0.000778)|Kidney(163;0.039)|OV - Ovarian serous cystadenocarcinoma(117;0.0578)|KIRC - Kidney renal clear cell carcinoma(186;0.135)|Lung(94;0.195)		ATTGAGTTGCTGCCATTTGAC	0.483																																						dbGAP											0													68.0	64.0	66.0					13																	25021263		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF057160	CCDS9307.1	13q11	2010-09-29	2004-08-20	2004-08-26	ENSG00000102699	ENSG00000102699		"""Poly (ADP-ribose) polymerases"""	271	protein-coding gene	gene with protein product	"""von Willebrand factor A domain containing 5C"""	607519	"""ADP-ribosyltransferase (NAD+; poly (ADP-ribose) polymerase)-like 1"""	ADPRTL1		10644454	Standard	NM_006437		Approved	VAULT3, p193, VPARP, VWA5C	uc001upl.3	Q9UKK3	OTTHUMG00000016582	ENST00000381989.3:c.3176A>G	13.37:g.25021263T>C	ENSP00000371419:p.Gln1059Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O75903|Q14682|Q5QNZ9|Q9H1M6	Missense_Mutation	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_VIT,pfam_VWF_A,pfam_BRCT_dom,superfamily_Poly(ADP-ribose)pol_reg_dom,superfamily_BRCT_dom,smart_BRCT_dom,smart_VIT,smart_VWF_A,pfscan_BRCT_dom,pfscan_VWF_A,pfscan_Poly(ADP-ribose)pol_cat_dom,pfscan_Poly(ADP-ribose)pol_reg_dom	p.Q1059R	ENST00000381989.3	37	c.3176	CCDS9307.1	13	.	.	.	.	.	.	.	.	.	.	T	15.12	2.738796	0.49045	.	.	ENSG00000102699	ENST00000381989	T	0.01918	4.56	4.71	4.71	0.59529	.	0.121088	0.56097	D	0.000023	T	0.08582	0.0213	M	0.76328	2.33	0.38495	D	0.948071	D	0.69078	0.997	P	0.60789	0.879	T	0.01053	-1.1467	10	0.87932	D	0	-17.7634	7.9397	0.29950	0.1828:0.0:0.0:0.8172	.	1059	Q9UKK3	PARP4_HUMAN	R	1059	ENSP00000371419:Q1059R	ENSP00000371419:Q1059R	Q	-	2	0	PARP4	23919263	1.000000	0.71417	0.999000	0.59377	0.339000	0.28857	4.391000	0.59652	2.113000	0.64589	0.524000	0.50904	CAG	PARP4	-	NULL	ENSG00000102699		0.483	PARP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP4	HGNC	protein_coding	OTTHUMT00000044189.1	34	0.00	0	T	NM_006437		25021263	25021263	-1	no_errors	ENST00000381989	ensembl	human	known	69_37n	missense	36	14.29	6	SNP	1.000	C
PCDHAC1	56135	genome.wustl.edu	37	5	140307594	140307594	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr5:140307594G>T	ENST00000253807.2	+	1	1117	c.1117G>T	c.(1117-1119)Ggt>Tgt	p.G373C	PCDHAC1_ENST00000409700.3_Missense_Mutation_p.G373C|PCDHA7_ENST00000525929.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA8_ENST00000531613.1_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	373	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CGATTCTAATGGTAGGGTCAT	0.522																																						dbGAP											0													88.0	84.0	85.0					5																	140307594		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.1117G>T	5.37:g.140307594G>T	ENSP00000253807:p.Gly373Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G373C	ENST00000253807.2	37	c.1117	CCDS4241.1	5	.	.	.	.	.	.	.	.	.	.	G	16.87	3.241741	0.58995	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.03524	3.9;3.9	5.91	5.04	0.67666	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.34221	0.0890	H	0.98951	4.38	0.37933	D	0.932083	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.65166	-0.6234	9	0.87932	D	0	.	15.2758	0.73739	0.0673:0.0:0.9327:0.0	.	373;373	Q9H158;Q9H158-2	PCDC1_HUMAN;.	C	373	ENSP00000386356:G373C;ENSP00000253807:G373C	ENSP00000253807:G373C	G	+	1	0	PCDHAC1	140287778	1.000000	0.71417	1.000000	0.80357	0.685000	0.39939	4.802000	0.62539	1.509000	0.48786	0.462000	0.41574	GGT	PCDHAC1	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000248383		0.522	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	28	0.00	0	G	NM_018898		140307594	140307594	+1	no_errors	ENST00000253807	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
PCF11	51585	genome.wustl.edu	37	11	82892090	82892090	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr11:82892090C>T	ENST00000298281.4	+	12	4476	c.4024C>T	c.(4024-4026)Cag>Tag	p.Q1342*	RP11-727A23.4_ENST00000528133.1_RNA	NM_015885.3	NP_056969.2	O94913	PCF11_HUMAN	PCF11 cleavage and polyadenylation factor subunit	1342					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)				cervix(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(22)|ovary(1)|urinary_tract(1)	33						CACTGGTATTCAGTGTTACTC	0.343																																						dbGAP											0													69.0	66.0	67.0					11																	82892090		1900	4100	6000	-	-	-	SO:0001587	stop_gained	0			AB020631	CCDS44689.1	11q13	2013-07-02	2013-07-02		ENSG00000165494	ENSG00000165494			30097	protein-coding gene	gene with protein product		608876	"""PCF11, cleavage and polyadenylation factor II subunit, homolog (S. cerevisiae)"", ""PCF11, cleavage and polyadenylation factor subunit, homolog (S. cerevisiae)"""			11060040	Standard	NM_015885		Approved	KIAA0824	uc001ozx.4	O94913	OTTHUMG00000167031	ENST00000298281.4:c.4024C>T	11.37:g.82892090C>T	ENSP00000298281:p.Gln1342*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W7|O43671|Q6P0X8	Nonsense_Mutation	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,smart_RNA_polymerase_II_lsu_CTD	p.Q1342*	ENST00000298281.4	37	c.4024	CCDS44689.1	11	.	.	.	.	.	.	.	.	.	.	C	34	5.355047	0.95854	.	.	ENSG00000165494	ENST00000298281;ENST00000530906	.	.	.	5.67	5.67	0.87782	.	0.000000	0.52532	D	0.000066	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-7.3202	19.7589	0.96306	0.0:1.0:0.0:0.0	.	.	.	.	X	1342;127	.	.	Q	+	1	0	PCF11	82569738	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.368000	0.79567	2.670000	0.90874	0.650000	0.86243	CAG	PCF11	-	NULL	ENSG00000165494		0.343	PCF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCF11	HGNC	protein_coding	OTTHUMT00000392548.2	41	0.00	0	C	NM_015885		82892090	82892090	+1	no_errors	ENST00000298281	ensembl	human	known	69_37n	nonsense	47	12.96	7	SNP	1.000	T
PCNXL2	80003	genome.wustl.edu	37	1	233296053	233296053	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr1:233296053C>G	ENST00000258229.9	-	19	3727	c.3493G>C	c.(3493-3495)Gag>Cag	p.E1165Q	PCNXL2_ENST00000520463.1_5'UTR|PCNXL2_ENST00000488780.2_Missense_Mutation_p.E298Q	NM_014801.3	NP_055616.3	A6NKB5	PCX2_HUMAN	pecanex-like 2 (Drosophila)	1165						integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(16)|kidney(7)|large_intestine(19)|lung(30)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	86		all_cancers(173;0.0347)|Prostate(94;0.137)				TGATGATACTCTTTGTTTTTG	0.443																																						dbGAP											0													96.0	89.0	91.0					1																	233296053		1880	4114	5994	-	-	-	SO:0001583	missense	0			AK055374	CCDS44335.1	1q42.2	2008-02-05	2001-11-28		ENSG00000135749	ENSG00000135749			8736	protein-coding gene	gene with protein product			"""pecanex (Drosophila)-like 2"""			12477932	Standard	NM_014801		Approved	KIAA0435, FLJ11383	uc001hvl.2	A6NKB5	OTTHUMG00000037824	ENST00000258229.9:c.3493G>C	1.37:g.233296053C>G	ENSP00000258229:p.Glu1165Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O43162|Q5T9Z8|Q5TDF1|Q8TEP4|Q96HP9|Q9HAL8	Missense_Mutation	SNP	pfam_Pecanex,superfamily_Pept_cys/ser_Trypsin-like	p.E1165Q	ENST00000258229.9	37	c.3493	CCDS44335.1	1	.	.	.	.	.	.	.	.	.	.	C	23.3	4.400800	0.83120	.	.	ENSG00000135749	ENST00000258229;ENST00000484347;ENST00000488780	T	0.15834	2.39	4.54	4.54	0.55810	.	.	.	.	.	T	0.48874	0.1524	M	0.86864	2.845	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59857	-0.7375	9	0.87932	D	0	.	17.4997	0.87727	0.0:1.0:0.0:0.0	.	1165	A6NKB5	PCX2_HUMAN	Q	1165;1;298	ENSP00000258229:E1165Q	ENSP00000258229:E1165Q	E	-	1	0	PCNXL2	231362676	1.000000	0.71417	0.926000	0.36857	0.805000	0.45488	7.286000	0.78671	2.315000	0.78130	0.650000	0.86243	GAG	PCNXL2	-	NULL	ENSG00000135749		0.443	PCNXL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PCNXL2	HGNC	protein_coding	OTTHUMT00000092480.3	15	0.00	0	C	NM_014801		233296053	233296053	-1	no_errors	ENST00000258229	ensembl	human	known	69_37n	missense	25	18.75	6	SNP	1.000	G
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	36	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	52	17.46	11	SNP	1.000	A
PTPRJ	5795	genome.wustl.edu	37	11	48146604	48146604	+	Missense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr11:48146604C>T	ENST00000418331.2	+	6	1311	c.959C>T	c.(958-960)tCc>tTc	p.S320F	PTPRJ_ENST00000440289.2_Missense_Mutation_p.S320F	NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	320	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)			breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GTGGACCCATCCTCCGGCCAG	0.602																																						dbGAP											0													102.0	114.0	110.0					11																	48146604		2201	4298	6499	-	-	-	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.959C>T	11.37:g.48146604C>T	ENSP00000400010:p.Ser320Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.S320F	ENST00000418331.2	37	c.959	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	C	16.12	3.034271	0.54896	.	.	ENSG00000149177	ENST00000278456;ENST00000418331;ENST00000440289	T;T	0.38401	2.49;1.14	4.77	0.355	0.16069	Fibronectin, type III (1);	.	.	.	.	T	0.39118	0.1066	L	0.53249	1.67	0.09310	N	1	P;D	0.61697	0.82;0.99	B;P	0.54026	0.156;0.74	T	0.19418	-1.0306	9	0.46703	T	0.11	.	3.6308	0.08131	0.0:0.4803:0.1902:0.3295	.	320;320	Q12913;Q6P4H4	PTPRJ_HUMAN;.	F	320	ENSP00000400010:S320F;ENSP00000409733:S320F	ENSP00000278456:S320F	S	+	2	0	PTPRJ	48103180	0.003000	0.15002	0.000000	0.03702	0.004000	0.04260	0.599000	0.24089	0.205000	0.20568	0.563000	0.77884	TCC	PTPRJ	-	smart_Fibronectin_type3	ENSG00000149177		0.602	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	23	0.00	0	C			48146604	48146604	+1	no_errors	ENST00000418331	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	0.000	T
RAC2	5880	genome.wustl.edu	37	22	37627984	37627984	+	Silent	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr22:37627984G>A	ENST00000249071.6	-	4	397	c.276C>T	c.(274-276)aaC>aaT	p.N92N	RAC2_ENST00000405484.1_Silent_p.N85N|RAC2_ENST00000406508.1_Silent_p.N48N	NM_002872.3	NP_002863.1	P15153	RAC2_HUMAN	ras-related C3 botulinum toxin substrate 2 (rho family, small GTP binding protein Rac2)	92					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|cell projection assembly (GO:0030031)|G-protein coupled receptor signaling pathway (GO:0007186)|lymphocyte aggregation (GO:0071593)|platelet activation (GO:0030168)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lamellipodium assembly (GO:0010592)|positive regulation of neutrophil chemotaxis (GO:0090023)|regulation of cell-substrate adhesion (GO:0010810)|regulation of hydrogen peroxide metabolic process (GO:0010310)|regulation of neutrophil migration (GO:1902622)|regulation of respiratory burst (GO:0060263)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|skin(2)|upper_aerodigestive_tract(1)	12					Dextromethorphan(DB00514)	TGGCGCGGACGTTCTCATAAG	0.627																																						dbGAP											0													54.0	43.0	47.0					22																	37627984		2138	4178	6316	-	-	-	SO:0001819	synonymous_variant	0			M64595	CCDS13945.1	22q13.1	2014-09-17			ENSG00000128340	ENSG00000128340		"""Endogenous ligands"""	9802	protein-coding gene	gene with protein product		602049				2674130	Standard	NM_002872		Approved	EN-7	uc003arc.3	P15153	OTTHUMG00000150540	ENST00000249071.6:c.276C>T	22.37:g.37627984G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UDJ4	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.N92	ENST00000249071.6	37	c.276	CCDS13945.1	22																																																																																			RAC2	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom	ENSG00000128340		0.627	RAC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RAC2	HGNC	protein_coding	OTTHUMT00000318812.1	44	0.00	0	G			37627984	37627984	-1	no_errors	ENST00000249071	ensembl	human	known	69_37n	silent	42	16.00	8	SNP	0.996	A
SCPEP1	59342	genome.wustl.edu	37	17	55055526	55055526	+	Missense_Mutation	SNP	G	G	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr17:55055526G>T	ENST00000262288.3	+	1	61	c.6G>T	c.(4-6)gaG>gaT	p.E2D	SCPEP1_ENST00000571898.1_3'UTR	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1	2					negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					TTGTCATGGAGCTGGCACTGC	0.711																																						dbGAP											0													23.0	18.0	20.0					17																	55055526		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.6G>T	17.37:g.55055526G>T	ENSP00000262288:p.Glu2Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96A94|Q9H3F0	Missense_Mutation	SNP	pfam_Peptidase_S10,prints_Peptidase_S10	p.E2D	ENST00000262288.3	37	c.6	CCDS11593.1	17	.	.	.	.	.	.	.	.	.	.	G	10.22	1.289638	0.23478	.	.	ENSG00000121064	ENST00000262288	T	0.17370	2.28	4.1	3.12	0.35913	.	1.125910	0.06662	N	0.764704	T	0.28433	0.0703	L	0.34521	1.04	0.24619	N	0.993688	D	0.58970	0.984	D	0.65443	0.935	T	0.28713	-1.0035	10	0.23302	T	0.38	-3.6664	9.8062	0.40795	0.0:0.0:0.7936:0.2064	.	2	Q9HB40	RISC_HUMAN	D	2	ENSP00000262288:E2D	ENSP00000262288:E2D	E	+	3	2	SCPEP1	52410525	1.000000	0.71417	0.998000	0.56505	0.218000	0.24690	0.803000	0.27083	1.028000	0.39785	-0.261000	0.10672	GAG	SCPEP1	-	NULL	ENSG00000121064		0.711	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCPEP1	HGNC	protein_coding	OTTHUMT00000440622.1	25	0.00	0	G	NM_021626		55055526	55055526	+1	no_errors	ENST00000262288	ensembl	human	known	69_37n	missense	26	13.33	4	SNP	1.000	T
SIRT6	51548	genome.wustl.edu	37	19	4174718	4174718	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr19:4174718G>A	ENST00000337491.2	-	8	1028	c.964C>T	c.(964-966)Cag>Tag	p.Q322*	SIRT6_ENST00000601488.1_3'UTR|SIRT6_ENST00000381935.3_Nonsense_Mutation_p.Q250*|SIRT6_ENST00000594279.1_3'UTR|SIRT6_ENST00000305232.6_Nonsense_Mutation_p.Q295*	NM_016539.2	NP_057623.2	Q8N6T7	SIR6_HUMAN	sirtuin 6	322	Pro-rich.				histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|protein ADP-ribosylation (GO:0006471)|regulation of double-strand break repair via homologous recombination (GO:0010569)	nuclear telomeric heterochromatin (GO:0005724)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|NAD(P)+-protein-arginine ADP-ribosyltransferase activity (GO:0003956)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|NAD+ binding (GO:0070403)|NAD-dependent histone deacetylase activity (GO:0017136)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|lung(4)|ovary(1)|skin(1)	8		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.023)|STAD - Stomach adenocarcinoma(1328;0.18)		CCGTTGTGCTGGGCGCAGGGC	0.721																																						dbGAP											0													4.0	5.0	4.0					19																	4174718		2021	3969	5990	-	-	-	SO:0001587	stop_gained	0			AF233396	CCDS12122.1, CCDS54199.1	19p13.3	2010-06-25	2010-06-25			ENSG00000077463			14934	protein-coding gene	gene with protein product		606211	"""sirtuin (silent mating type information regulation 2, S. cerevisiae, homolog) 6"", ""sirtuin (silent mating type information regulation 2 homolog) 6 (S. cerevisiae)"""			10873683	Standard	NM_016539		Approved		uc002lzo.3	Q8N6T7		ENST00000337491.2:c.964C>T	19.37:g.4174718G>A	ENSP00000337332:p.Gln322*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCD0|O75291|Q6IAF5|Q6PK99|Q8NCD2|Q9BSI5|Q9BWP3|Q9NRC7|Q9UQD1	Nonsense_Mutation	SNP	pfam_NAD-dep_deAcase_sirtuin,pfscan_NAD-dep_deAcase_sirtuin	p.Q322*	ENST00000337491.2	37	c.964	CCDS12122.1	19	.	.	.	.	.	.	.	.	.	.	G	27.7	4.857934	0.91433	.	.	ENSG00000077463	ENST00000337491;ENST00000305232;ENST00000381935	.	.	.	4.07	4.07	0.47477	.	1.839730	0.02882	U	0.132944	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10111	T	0.7	-7.0024	12.9603	0.58453	0.0:0.0:1.0:0.0	.	.	.	.	X	322;295;250	.	ENSP00000305310:Q295X	Q	-	1	0	SIRT6	4125718	0.993000	0.37304	0.024000	0.17045	0.929000	0.56500	3.690000	0.54713	1.821000	0.53095	0.462000	0.41574	CAG	SIRT6	-	NULL	ENSG00000077463		0.721	SIRT6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIRT6	HGNC	protein_coding	OTTHUMT00000457931.2	41	0.00	0	G			4174718	4174718	-1	no_errors	ENST00000337491	ensembl	human	known	69_37n	nonsense	29	14.71	5	SNP	0.024	A
SIX4	51804	genome.wustl.edu	37	14	61180304	61180304	+	Missense_Mutation	SNP	C	C	G			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr14:61180304C>G	ENST00000216513.4	-	3	2226	c.2167G>C	c.(2167-2169)Gag>Cag	p.E723Q		NM_017420.4	NP_059116.3	Q9UIU6	SIX4_HUMAN	SIX homeobox 4	723					anatomical structure morphogenesis (GO:0009653)|embryonic cranial skeleton morphogenesis (GO:0048701)|generation of neurons (GO:0048699)|inner ear morphogenesis (GO:0042472)|metanephric mesenchyme development (GO:0072075)|myoblast migration (GO:0051451)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of ureteric bud formation (GO:0072107)|regulation of branch elongation involved in ureteric bud branching (GO:0072095)|regulation of protein localization (GO:0032880)|regulation of synaptic growth at neuromuscular junction (GO:0008582)|skeletal muscle tissue development (GO:0007519)|thymus development (GO:0048538)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E723K(1)		breast(5)|endometrium(1)|large_intestine(11)|liver(1)|lung(7)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	28				OV - Ovarian serous cystadenocarcinoma(108;0.0275)		AAGAAATTCTCTTTCATGTTA	0.423																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											109.0	105.0	106.0					14																	61180304		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB024687	CCDS9749.2	14q23.1	2012-10-02	2007-07-13		ENSG00000100625	ENSG00000100625		"""Homeoboxes / SINE class"""	10890	protein-coding gene	gene with protein product		606342	"""sine oculis homeobox (Drosophila) homolog 4"", ""sine oculis homeobox homolog 4 (Drosophila)"""			10512683, 10640827	Standard	NM_017420		Approved	AREC3	uc001xfc.3	Q9UIU6	OTTHUMG00000028996	ENST00000216513.4:c.2167G>C	14.37:g.61180304C>G	ENSP00000216513:p.Glu723Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4QQH5|Q4V764	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E723Q	ENST00000216513.4	37	c.2167	CCDS9749.2	14	.	.	.	.	.	.	.	.	.	.	C	17.45	3.392064	0.62066	.	.	ENSG00000100625	ENST00000216513;ENST00000554079	D;T	0.94092	-3.35;0.29	5.63	5.63	0.86233	.	0.125415	0.36066	N	0.002808	D	0.93736	0.7998	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	D	0.63488	0.915	D	0.94626	0.7817	10	0.87932	D	0	.	20.0396	0.97574	0.0:1.0:0.0:0.0	.	723	Q9UIU6	SIX4_HUMAN	Q	723;396	ENSP00000216513:E723Q;ENSP00000451537:E396Q	ENSP00000216513:E723Q	E	-	1	0	SIX4	60250057	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	4.312000	0.59154	2.814000	0.96858	0.563000	0.77884	GAG	SIX4	-	NULL	ENSG00000100625		0.423	SIX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIX4	HGNC	protein_coding	OTTHUMT00000072397.2	34	0.00	0	C			61180304	61180304	-1	no_errors	ENST00000216513	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	G
SMARCC1	6599	genome.wustl.edu	37	3	47629620	47629620	+	3'UTR	SNP	G	G	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr3:47629620G>T	ENST00000254480.5	-	0	3516				SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		AGAAACCCAAGAAAGTTGAGG	0.542																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.*79C>A	3.37:g.47629620G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RS0|Q6P172|Q8IWH2	RNA	SNP	-	NULL	ENST00000254480.5	37	NULL	CCDS2758.1	3																																																																																			SMARCC1	-	-	ENSG00000173473		0.542	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	22	0.00	0	G			47629620	47629620	-1	no_errors	ENST00000425518	ensembl	human	known	69_37n	rna	29	14.71	5	SNP	0.994	T
TRIM66	9866	genome.wustl.edu	37	11	8639492	8639492	+	Silent	SNP	C	C	T	rs543745597		TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr11:8639492C>T	ENST00000299550.6	-	20	3844	c.3650G>A	c.(3649-3651)tGa>tAa	p.*1217*	TRIM66_ENST00000402157.2_Silent_p.*1246*	NM_014818.1	NP_055633.1	O15016	TRI66_HUMAN	tripartite motif containing 66	0						aggresome (GO:0016235)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|kidney(1)|lung(1)|skin(2)	9						TTTTGGCTCTCACACCTGAGA	0.443																																						dbGAP											0													162.0	147.0	152.0					11																	8639492		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AB002296		11p15.4	2013-01-28	2011-01-25		ENSG00000166436	ENSG00000166436		"""Tripartite motif containing / Tripartite motif containing"", ""Zinc fingers, PHD-type"""	29005	protein-coding gene	gene with protein product		612000	"""chromosome 11 open reading frame 29"", ""tripartite motif-containing 66"""	C11orf29		9205841	Standard	NM_014818		Approved	KIAA0298, TIF1D	uc010rbo.2	O15016	OTTHUMG00000150481	ENST00000299550.6:c.3650G>A	11.37:g.8639492C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQQ4	Silent	SNP	pfam_Bromodomain,pfam_Znf_B-box,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,smart_Znf_B-box,smart_Znf_PHD,smart_Bbox_C,smart_Bromodomain,pfscan_Znf_B-box,pfscan_Znf_PHD-finger,pfscan_Bromodomain	p.*1217	ENST00000299550.6	37	c.3650		11																																																																																			TRIM66	-	NULL	ENSG00000166436		0.443	TRIM66-201	KNOWN	basic|appris_candidate	protein_coding	TRIM66	HGNC	protein_coding		35	0.00	0	C	XM_084529		8639492	8639492	-1	no_errors	ENST00000299550	ensembl	human	known	69_37n	silent	19	29.63	8	SNP	1.000	T
TUBB2B	347733	genome.wustl.edu	37	6	3225580	3225580	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr6:3225580G>A	ENST00000259818.7	-	4	934	c.743C>T	c.(742-744)gCa>gTa	p.A248V	TUBB2B_ENST00000473006.1_5'UTR	NM_178012.4	NP_821080.1	Q9BVA1	TBB2B_HUMAN	tubulin, beta 2B class IIb	248					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|neuron migration (GO:0001764)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			kidney(2)|large_intestine(5)|lung(1)|prostate(1)|skin(1)	10	Ovarian(93;0.0386)	all_hematologic(90;0.108)				GCGCAGGTCTGCGTTCAGCTG	0.677																																						dbGAP											0													4.0	3.0	3.0					6																	3225580		1333	2690	4023	-	-	-	SO:0001583	missense	0			BC001352	CCDS4485.1	6p25.2	2011-10-10	2011-10-10		ENSG00000137285	ENSG00000137285		"""Tubulins"""	30829	protein-coding gene	gene with protein product	"""class IIb beta-tubulin"""	612850	"""tubulin, beta 2B"""			8619474, 9110174	Standard	NM_178012		Approved	MGC8685, DKFZp566F223, bA506K6.1	uc003mvg.3	Q9BVA1	OTTHUMG00000014143	ENST00000259818.7:c.743C>T	6.37:g.3225580G>A	ENSP00000259818:p.Ala248Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K068	Missense_Mutation	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.A248V	ENST00000259818.7	37	c.743	CCDS4485.1	6	.	.	.	.	.	.	.	.	.	.	G	7.094	0.572680	0.13623	.	.	ENSG00000137285	ENST00000259818	D	0.83163	-1.69	5.06	4.18	0.49190	Tubulin/FtsZ, 2-layer sandwich domain (1);Tubulin/FtsZ, GTPase domain (1);Tubulin/FtsZ, C-terminal (1);	0.000000	0.64402	D	0.000004	T	0.65471	0.2694	L	0.32530	0.975	0.80722	D	1	B;B;B	0.30236	0.274;0.274;0.006	B;B;B	0.27715	0.055;0.082;0.022	T	0.69647	-0.5089	10	0.87932	D	0	.	14.8705	0.70453	0.0:0.0:0.8552:0.1448	.	248;248;248	Q8IZ29;Q8IWP6;Q9BVA1	.;.;TBB2B_HUMAN	V	248	ENSP00000259818:A248V	ENSP00000259818:A248V	A	-	2	0	TUBB2B	3170579	1.000000	0.71417	0.873000	0.34254	0.159000	0.22180	9.506000	0.97992	1.121000	0.41925	-0.248000	0.11899	GCA	TUBB2B	-	superfamily_Tub_FtsZ_C,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Gamma_tubulin	ENSG00000137285		0.677	TUBB2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2B	HGNC	protein_coding	OTTHUMT00000039680.2	15	0.00	0	G	NM_178012		3225580	3225580	-1	no_errors	ENST00000259818	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	1.000	A
VCX	26609	genome.wustl.edu	37	X	7811962	7811962	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chrX:7811962C>T	ENST00000381059.3	+	3	745	c.526C>T	c.(526-528)Cag>Tag	p.Q176*	VCX_ENST00000341408.4_Nonsense_Mutation_p.Q156*	NM_013452.2	NP_038480.2	Q9H320	VCX1_HUMAN	variable charge, X-linked	176	10 X 10 AA tandem repeats of L-S-Q-E-S- [EQ]-V-E-E-P.|Glu-rich.				chromatin organization (GO:0006325)|ribosome assembly (GO:0042255)|spermatogenesis (GO:0007283)	nucleolus (GO:0005730)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|endometrium(4)|large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	10		Colorectal(8;0.0136)|Medulloblastoma(8;0.184)				ACCACTGAGTCAGGAGAGCGA	0.582																																						dbGAP											0													120.0	119.0	119.0					X																	7811962		1756	3618	5374	-	-	-	SO:0001587	stop_gained	0			AF167081	CCDS14128.1	Xp22.31	2008-02-05	2003-09-12		ENSG00000182583	ENSG00000182583			12667	protein-coding gene	gene with protein product		300229	"""variable charge, X chromosome"""			10607842, 10903929	Standard	NM_013452		Approved	VCX1, VCX10R, VCX-10r, VCX-B1	uc004crz.3	Q9H320	OTTHUMG00000028608	ENST00000381059.3:c.526C>T	X.37:g.7811962C>T	ENSP00000370447:p.Gln176*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0JNS5|Q4V774|Q9P0H3	Nonsense_Mutation	SNP	NULL	p.Q176*	ENST00000381059.3	37	c.526	CCDS14128.1	X	.	.	.	.	.	.	.	.	.	.	c	10.31	1.315581	0.23908	.	.	ENSG00000182583	ENST00000381059;ENST00000341408	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.24107	N	0.995856	.	.	.	.	.	.	.	.	.	.	0.29301	T	0.29	.	5.8616	0.18752	0.0:0.9991:0.0:9.0E-4	.	.	.	.	X	176;156	.	ENSP00000344144:Q156X	Q	+	1	0	VCX	7771962	0.000000	0.05858	0.048000	0.18961	0.048000	0.14542	-2.671000	0.00843	0.068000	0.16574	0.068000	0.15388	CAG	VCX	-	NULL	ENSG00000182583		0.582	VCX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VCX	HGNC	protein_coding	OTTHUMT00000071474.1	68	0.00	0	C	NM_013452		7811962	7811962	+1	no_errors	ENST00000381059	ensembl	human	known	69_37n	nonsense	140	13.58	22	SNP	0.083	T
ZNF407	55628	genome.wustl.edu	37	18	72347245	72347245	+	Missense_Mutation	SNP	G	G	A			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr18:72347245G>A	ENST00000299687.5	+	1	4270	c.4270G>A	c.(4270-4272)Gat>Aat	p.D1424N	ZNF407_ENST00000309902.6_Missense_Mutation_p.D1424N|ZNF407_ENST00000582337.1_Missense_Mutation_p.D1424N|ZNF407_ENST00000577538.1_Missense_Mutation_p.D1424N	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1424					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		CTTCTTAGCAGATGGACTGAG	0.433																																						dbGAP											0													76.0	79.0	78.0					18																	72347245		2004	4191	6195	-	-	-	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4270G>A	18.37:g.72347245G>A	ENSP00000299687:p.Asp1424Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.D1424N	ENST00000299687.5	37	c.4270	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	G	28.6	4.932824	0.92458	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.01538	4.79;4.79	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);	0.192812	0.43260	D	0.000600	T	0.07143	0.0181	L	0.36672	1.1	0.53688	D	0.999978	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	T	0.51052	-0.8754	10	0.36615	T	0.2	.	19.7998	0.96502	0.0:0.0:1.0:0.0	.	1424;1424;1424	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	N	1424	ENSP00000299687:D1424N;ENSP00000310359:D1424N	ENSP00000299687:D1424N	D	+	1	0	ZNF407	70476233	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.471000	0.97696	2.156000	0.67533	0.528000	0.53228	GAT	ZNF407	-	smart_Znf_C2H2-like	ENSG00000215421		0.433	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	36	0.00	0	G	NM_017757		72347245	72347245	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	1.000	A
ZNF585B	92285	genome.wustl.edu	37	19	37677381	37677381	+	Missense_Mutation	SNP	G	G	C			TCGA-BH-A42V-01A-11D-A243-09	TCGA-BH-A42V-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	672163b5-fe8c-4e28-bdd1-d6f5f18f4170	89acbcda-52f5-44e6-b820-fc64a2d6ddc5	g.chr19:37677381G>C	ENST00000532828.2	-	5	1309	c.1058C>G	c.(1057-1059)tCt>tGt	p.S353C	CTC-454I21.3_ENST00000585860.2_Intron|ZNF585B_ENST00000312908.5_De_novo_Start_OutOfFrame|ZNF585B_ENST00000531805.1_Missense_Mutation_p.S298C|ZNF585B_ENST00000527838.1_3'UTR	NM_152279.3	NP_689492.3	Q52M93	Z585B_HUMAN	zinc finger protein 585B	353					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|endometrium(1)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			ACATATGGAAGATTTCTCTCT	0.403																																					Melanoma(93;882 1454 18863 28917 48427)	dbGAP											0													116.0	111.0	113.0					19																	37677381		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027834	CCDS12500.1	19q13.13	2013-01-08				ENSG00000245680		"""Zinc fingers, C2H2-type"", ""-"""	30948	protein-coding gene	gene with protein product						12477932	Standard	NM_152279		Approved	FLJ14928, SZFP41	uc002ofq.3	Q52M93		ENST00000532828.2:c.1058C>G	19.37:g.37677381G>C	ENSP00000433773:p.Ser353Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IZD3|Q96JW6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S353C	ENST00000532828.2	37	c.1058	CCDS12500.1	19	.	.	.	.	.	.	.	.	.	.	G	15.18	2.757811	0.49468	.	.	ENSG00000245680	ENST00000531805;ENST00000532828	T;T	0.08102	3.13;3.13	2.93	2.93	0.34026	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36519	N	0.002552	T	0.13030	0.0316	L	0.48986	1.54	0.80722	D	1	D;B	0.63880	0.993;0.013	P;B	0.49752	0.621;0.006	T	0.02829	-1.1105	10	0.87932	D	0	.	11.5938	0.50962	0.0:0.0:1.0:0.0	.	298;353	E9PQH3;Q52M93	.;Z585B_HUMAN	C	298;353	ENSP00000436774:S298C;ENSP00000433773:S353C	ENSP00000436774:S298C	S	-	2	0	ZNF585B	42369221	0.875000	0.30112	0.859000	0.33776	0.670000	0.39368	3.486000	0.53215	1.623000	0.50342	0.455000	0.32223	TCT	ZNF585B	-	pfscan_Znf_C2H2	ENSG00000245680		0.403	ZNF585B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF585B	HGNC	protein_coding	OTTHUMT00000388272.2	41	0.00	0	G	NM_152279		37677381	37677381	-1	no_errors	ENST00000532828	ensembl	human	known	69_37n	missense	56	11.11	7	SNP	0.996	C
