#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ADAMTSL1	92949	genome.wustl.edu	37	9	18906856	18906856	+	Frame_Shift_Del	DEL	T	T	-			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr9:18906856delT	ENST00000380548.4	+	28	5467	c.5128delT	c.(5128-5130)tggfs	p.W1710fs	ADAMTSL1_ENST00000380545.5_Frame_Shift_Del_p.W411fs	NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1710	TSP type-1 9. {ECO:0000255|PROSITE- ProRule:PRU00210}.					proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		CCTGTGCTCCTGGGGGCCCCG	0.592																																						dbGAP											0													68.0	78.0	75.0					9																	18906856		2030	4174	6204	-	-	-	SO:0001589	frameshift_variant	0			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.5128delT	9.37:g.18906856delT	ENSP00000369921:p.Trp1710fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_PLAC,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like	p.W411fs	ENST00000380548.4	37	c.1231	CCDS47954.1	9																																																																																			ADAMTSL1	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000178031		0.592	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	43	0.00	0	T			18906856	18906856	+1	no_errors	ENST00000380545	ensembl	human	putative	69_37n	frame_shift_del	74	25.89	29	DEL	1.000	-
ADRA1A	148	genome.wustl.edu	37	8	26627933	26627933	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:26627933G>A	ENST00000519229.1	-	2	1140	c.1134C>T	c.(1132-1134)ccC>ccT	p.P378P	ADRA1A_ENST00000380587.1_Intron|ADRA1A_ENST00000380581.2_Intron|ADRA1A_ENST00000380586.1_Silent_p.P378P|ADRA1A_ENST00000354550.4_Silent_p.P378P|ADRA1A_ENST00000380573.3_Silent_p.P378P|ADRA1A_ENST00000276393.4_Silent_p.P378P|ADRA1A_ENST00000380582.3_Silent_p.P378P			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	338					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	TTGATCCCACGGGGATGCGCA	0.557																																						dbGAP											0													137.0	130.0	132.0					8																	26627933		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.1134C>T	8.37:g.26627933G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPY0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrene_rcpt_A1Cs,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.P378	ENST00000519229.1	37	c.1134		8																																																																																			ADRA1A	-	prints_Adrene_rcpt_A1Cs	ENSG00000120907		0.557	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	109	0.00	0	G	NM_033303		26627933	26627933	-1	no_errors	ENST00000380586	ensembl	human	known	69_37n	silent	134	21.18	36	SNP	0.111	A
AGXT	189	genome.wustl.edu	37	2	241808313	241808313	+	Missense_Mutation	SNP	C	C	G	rs375712696		TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:241808313C>G	ENST00000307503.3	+	1	418	c.31C>G	c.(31-33)Ccc>Gcc	p.P11A		NM_000030.2	NP_000021.1	P21549	SPYA_HUMAN	alanine-glyoxylate aminotransferase	11			P -> L (common polymorphism; reduction of specific activity in vitro; causes mistargeting when associated with R-170; dbSNP:rs34116584). {ECO:0000269|PubMed:1703535}.		cellular nitrogen compound metabolic process (GO:0034641)|glycine biosynthetic process, by transamination of glyoxylate (GO:0019265)|glyoxylate catabolic process (GO:0009436)|glyoxylate metabolic process (GO:0046487)|L-alanine catabolic process (GO:0042853)|L-cysteine catabolic process (GO:0019448)|oxalic acid secretion (GO:0046724)|pyruvate biosynthetic process (GO:0042866)|response to cAMP (GO:0051591)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	alanine-glyoxylate transaminase activity (GO:0008453)|amino acid binding (GO:0016597)|protein homodimerization activity (GO:0042803)|pyridoxal phosphate binding (GO:0030170)|receptor binding (GO:0005102)|serine-pyruvate transaminase activity (GO:0004760)|transaminase activity (GO:0008483)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)	18		all_epithelial(40;1.61e-15)|Breast(86;2.35e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0294)|Lung NSC(271;0.094)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;8.14e-32)|all cancers(36;4.77e-29)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;4.88e-06)|Lung(119;0.000452)|LUSC - Lung squamous cell carcinoma(224;0.00415)|Colorectal(34;0.021)|COAD - Colon adenocarcinoma(134;0.15)	Glycine(DB00145)|L-Alanine(DB00160)|L-Serine(DB00133)	GGTGACCCCCCCCAAGGCCCT	0.662																																						dbGAP											0													27.0	31.0	30.0					2																	241808313		2199	4299	6498	-	-	-	SO:0001583	missense	0			D13368	CCDS2543.1	2q37.3	2008-02-05	2007-04-13		ENSG00000172482	ENSG00000172482	2.6.1.44, 2.6.1.51		341	protein-coding gene	gene with protein product	"""oxalosis I"", ""primary hyperoxaluria type 1"", ""L-alanine: glyoxylate aminotransferase 1"", ""serine:pyruvate aminotransferase"", ""glycolicaciduria"""	604285		SPAT		2039493, 2045108	Standard	NM_000030		Approved	AGXT1, PH1, AGT, SPT, AGT1	uc002waa.4	P21549	OTTHUMG00000133354	ENST00000307503.3:c.31C>G	2.37:g.241808313C>G	ENSP00000302620:p.Pro11Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QU6	Missense_Mutation	SNP	pfam_Aminotrans_V/Cys_dSase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.P11A	ENST00000307503.3	37	c.31	CCDS2543.1	2	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410715	0.42817	.	.	ENSG00000172482	ENST00000307503	D	0.89485	-2.52	4.42	3.54	0.40534	Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	D	0.94235	0.8149	M	0.87900	2.915	0.80722	D	1	D	0.89917	1.0	D	0.69824	0.966	D	0.94269	0.7509	10	0.72032	D	0.01	-18.1328	12.1753	0.54182	0.0:0.9161:0.0:0.0839	.	11	P21549	SPYA_HUMAN	A	11	ENSP00000302620:P11A	ENSP00000302620:P11A	P	+	1	0	AGXT	241456986	0.993000	0.37304	0.020000	0.16555	0.059000	0.15707	3.646000	0.54396	0.858000	0.35431	-0.350000	0.07774	CCC	AGXT	-	superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000172482		0.662	AGXT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT	HGNC	protein_coding	OTTHUMT00000257186.1	32	0.00	0	C	NM_000030		241808313	241808313	+1	no_errors	ENST00000307503	ensembl	human	known	69_37n	missense	21	38.24	13	SNP	0.659	G
APBA2	321	genome.wustl.edu	37	15	29346952	29346952	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr15:29346952G>C	ENST00000558402.1	+	5	1464	c.865G>C	c.(865-867)Gag>Cag	p.E289Q	APBA2_ENST00000558330.1_Missense_Mutation_p.E289Q|APBA2_ENST00000561069.1_Missense_Mutation_p.E289Q|APBA2_ENST00000558259.1_Missense_Mutation_p.E289Q|APBA2_ENST00000411764.1_Missense_Mutation_p.E289Q			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	289					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		CCTCCTTCCCGAGGCCAAGCA	0.667																																						dbGAP											0													19.0	23.0	22.0					15																	29346952		2202	4295	6497	-	-	-	SO:0001583	missense	0			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.865G>C	15.37:g.29346952G>C	ENSP00000453293:p.Glu289Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.E289Q	ENST00000558402.1	37	c.865	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	G	13.24	2.177739	0.38413	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.26373	1.74	4.96	4.04	0.47022	.	0.285984	0.33235	N	0.005124	T	0.22205	0.0535	L	0.51422	1.61	0.25501	N	0.98756	B;B;B	0.17667	0.023;0.011;0.023	B;B;B	0.15870	0.014;0.006;0.005	T	0.11842	-1.0571	10	0.15952	T	0.53	.	12.691	0.56974	0.0812:0.0:0.9188:0.0	.	289;289;289	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	Q	289	ENSP00000409312:E289Q	ENSP00000219865:E289Q	E	+	1	0	APBA2	27134244	0.995000	0.38212	0.853000	0.33588	0.893000	0.52053	2.281000	0.43452	2.280000	0.76307	0.650000	0.86243	GAG	APBA2	-	NULL	ENSG00000034053		0.667	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	12	0.00	0	G	NM_005503		29346952	29346952	+1	no_errors	ENST00000558259	ensembl	human	known	69_37n	missense	13	38.10	8	SNP	0.991	C
APC	324	genome.wustl.edu	37	5	112179630	112179630	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr5:112179630G>C	ENST00000457016.1	+	16	8719	c.8339G>C	c.(8338-8340)aGa>aCa	p.R2780T	CTC-554D6.1_ENST00000520401.1_Intron|APC_ENST00000257430.4_Missense_Mutation_p.R2780T|APC_ENST00000508376.2_Missense_Mutation_p.R2780T			P25054	APC_HUMAN	adenomatous polyposis coli	2780	Ser-rich.				anterior/posterior pattern specification (GO:0009952)|apoptotic process (GO:0006915)|axis specification (GO:0009798)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in negative regulation of apoptotic process (GO:0044336)|canonical Wnt signaling pathway involved in positive regulation of apoptotic process (GO:0044337)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to DNA damage stimulus (GO:0006974)|chromosome organization (GO:0051276)|cytoplasmic microtubule organization (GO:0031122)|dorsal/ventral pattern formation (GO:0009953)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|mitotic cytokinesis (GO:0000281)|mitotic spindle assembly checkpoint (GO:0007094)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of odontogenesis (GO:0042483)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell division (GO:0051781)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of pseudopodium assembly (GO:0031274)|protein complex assembly (GO:0006461)|proximal/distal pattern formation (GO:0009954)|regulation of attachment of spindle microtubules to kinetochore (GO:0051988)|regulation of microtubule-based process (GO:0032886)|regulation of nitrogen compound metabolic process (GO:0051171)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoclast differentiation (GO:0045670)|retina development in camera-type eye (GO:0060041)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)|thymus development (GO:0048538)|tight junction assembly (GO:0070830)	axonal growth cone (GO:0044295)|beta-catenin destruction complex (GO:0030877)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|kinetochore (GO:0000776)|lamellipodium (GO:0030027)|lateral plasma membrane (GO:0016328)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	beta-catenin binding (GO:0008013)|gamma-catenin binding (GO:0045295)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|protein kinase binding (GO:0019901)|protein kinase regulator activity (GO:0019887)	p.?(1)		NS(7)|adrenal_gland(6)|biliary_tract(5)|bone(6)|breast(29)|central_nervous_system(12)|cervix(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(6)|kidney(8)|large_intestine(2768)|liver(15)|lung(39)|oesophagus(1)|ovary(12)|pancreas(27)|prostate(15)|salivary_gland(2)|skin(14)|small_intestine(34)|soft_tissue(55)|stomach(136)|thyroid(22)|upper_aerodigestive_tract(8)|urinary_tract(20)	3261		all_cancers(142;3.01e-27)|all_epithelial(76;2.3e-18)|all_hematologic(541;4.32e-09)|Ovarian(225;1.78e-06)|Lung NSC(167;0.000195)|Breast(839;0.000231)|all_lung(232;0.000247)|Colorectal(10;0.000355)|Prostate(80;0.00133)		OV - Ovarian serous cystadenocarcinoma(64;1.09e-113)|Epithelial(69;3.79e-112)|all cancers(49;1.67e-104)|BRCA - Breast invasive adenocarcinoma(61;0.00136)|COAD - Colon adenocarcinoma(37;0.00155)|Colorectal(14;0.00191)		GTTGCTGCCAGAGTGACTCCT	0.468		12	"""D, Mis, N, F, S"""		"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""	"""colorectal, pancreatic, desmoid, hepatoblastoma, glioma, other CNS"""			Turcot syndrome;Hereditary Desmoid Disease;Familial Adenomatous Polyposis	TSP Lung(16;0.13)																											NSCLC(107;854 1218 9699 17025 28335 47076 52975)|Esophageal Squamous(32;282 584 32991 36563 39392 49665 50115)	dbGAP	yes	Rec	yes	Adenomatous polyposis coli; Turcot syndrome	5	5q21	324	adenomatous polyposis of the colon gene		"""E, M, O"""	1	Unknown(1)	skin(1)											81.0	83.0	82.0					5																	112179630		2202	4299	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome;Familial Infiltrative Mesenteric Fibromatosis;FAP, incl.: Gardner s., Attenuated FAP, Flat Adenoma s., Oldfield s,	M74088	CCDS4107.1	5q21-q22	2014-09-17	2008-01-08		ENSG00000134982	ENSG00000134982		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Armadillo repeat containing"""	583	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 46"""	611731	"""adenomatosis polyposis coli"""			1651563	Standard	NM_001127511		Approved	DP2, DP3, DP2.5, PPP1R46	uc003kpy.4	P25054	OTTHUMG00000128806	ENST00000457016.1:c.8339G>C	5.37:g.112179630G>C	ENSP00000413133:p.Arg2780Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT03|Q15162|Q15163|Q93042	Missense_Mutation	SNP	pfam_APC_basic_dom,pfam_EB1-bd,pfam_APC_Cys-rich_rpt,pfam_Armadillo,pfam_SAMP,pfam_APC_15aa_rpt,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.R2780T	ENST00000457016.1	37	c.8339	CCDS4107.1	5	.	.	.	.	.	.	.	.	.	.	G	18.73	3.685650	0.68157	.	.	ENSG00000134982	ENST00000457016;ENST00000257430;ENST00000508376	D;D;D	0.82619	-1.63;-1.63;-1.63	5.92	5.92	0.95590	EB-1 binding (1);	0.047019	0.85682	D	0.000000	D	0.87466	0.6184	L	0.32530	0.975	0.54753	D	0.999985	D;D	0.89917	1.0;0.997	D;D	0.87578	0.998;0.994	D	0.84989	0.0893	9	.	.	.	-25.0016	20.3248	0.98698	0.0:0.0:1.0:0.0	.	2782;2780	Q4LE70;P25054	.;APC_HUMAN	T	2780	ENSP00000413133:R2780T;ENSP00000257430:R2780T;ENSP00000427089:R2780T	.	R	+	2	0	APC	112207529	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.820000	0.92003	2.818000	0.97014	0.655000	0.94253	AGA	APC	-	pfam_EB1-bd	ENSG00000134982		0.468	APC-201	KNOWN	basic|appris_principal|CCDS	protein_coding	APC	HGNC	protein_coding	OTTHUMT00000250738.2	74	0.00	0	G	NM_000038		112179630	112179630	+1	no_errors	ENST00000257430	ensembl	human	known	69_37n	missense	91	13.21	14	SNP	1.000	C
APPBP2	10513	genome.wustl.edu	37	17	58531762	58531762	+	Silent	SNP	T	T	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr17:58531762T>C	ENST00000083182.3	-	11	1526	c.1239A>G	c.(1237-1239)tcA>tcG	p.S413S		NM_001282476.1|NM_006380.2	NP_001269405.1|NP_006371.2	Q92624	APBP2_HUMAN	amyloid beta precursor protein (cytoplasmic tail) binding protein 2	413					intracellular protein transport (GO:0006886)|intracellular transport (GO:0046907)|metabolic process (GO:0008152)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	microtubule motor activity (GO:0003777)			breast(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(17)|pancreas(1)|urinary_tract(1)	25	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		Epithelial(12;3.67e-13)|all cancers(12;1.44e-11)|Colorectal(3;0.01)			CTAGTTGGAGTGAAGACAGGT	0.358																																						dbGAP											0													136.0	142.0	140.0					17																	58531762		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF017782	CCDS32699.1	17q23.2	2012-09-20	2001-11-28		ENSG00000062725	ENSG00000062725			622	protein-coding gene	gene with protein product	"""protein interacting with APP tail 1"""	605324	"""amyloid beta precursor protein (cytoplasmic tail)-binding protein 2"""			9843960	Standard	NM_006380		Approved	KIAA0228, Hs.84084, PAT1	uc002iys.1	Q92624		ENST00000083182.3:c.1239A>G	17.37:g.58531762T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K862|O95095|Q8WVC9	Silent	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S413	ENST00000083182.3	37	c.1239	CCDS32699.1	17																																																																																			APPBP2	-	NULL	ENSG00000062725		0.358	APPBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APPBP2	HGNC	protein_coding	OTTHUMT00000449465.1	243	0.00	0	T	NM_006380		58531762	58531762	-1	no_errors	ENST00000083182	ensembl	human	known	69_37n	silent	94	53.43	109	SNP	0.988	C
ARFGEF1	10565	genome.wustl.edu	37	8	68138335	68138335	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:68138335C>T	ENST00000262215.3	-	28	4389	c.4000G>A	c.(4000-4002)Gca>Aca	p.A1334T	ARFGEF1_ENST00000520381.1_Missense_Mutation_p.A788T|ARFGEF1_ENST00000518230.1_Missense_Mutation_p.A172T	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1334					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			GGGAAAGCTGCATTGCACGCA	0.388																																						dbGAP											0													81.0	72.0	75.0					8																	68138335		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.4000G>A	8.37:g.68138335C>T	ENSP00000262215:p.Ala1334Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NV46|Q9UFV2|Q9UNL0	Missense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.A1334T	ENST00000262215.3	37	c.4000	CCDS6199.1	8	.	.	.	.	.	.	.	.	.	.	C	18.70	3.680399	0.68042	.	.	ENSG00000066777	ENST00000520381;ENST00000262215;ENST00000518230	T;T;T	0.67523	-0.27;-0.08;0.93	5.62	5.62	0.85841	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.65069	0.2656	L	0.52759	1.655	0.80722	D	1	B;B;B	0.23442	0.085;0.005;0.005	B;B;B	0.26094	0.066;0.031;0.031	T	0.58696	-0.7591	10	0.31617	T	0.26	.	20.0114	0.97452	0.0:1.0:0.0:0.0	.	1334;812;788	Q9Y6D6;Q59FY5;E5RIF2	BIG1_HUMAN;.;.	T	788;1334;172	ENSP00000428429:A788T;ENSP00000262215:A1334T;ENSP00000430891:A172T	ENSP00000262215:A1334T	A	-	1	0	ARFGEF1	68300889	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.715000	0.84713	2.795000	0.96236	0.655000	0.94253	GCA	ARFGEF1	-	superfamily_ARM-type_fold	ENSG00000066777		0.388	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	103	0.00	0	C	NM_006421		68138335	68138335	-1	no_errors	ENST00000262215	ensembl	human	known	69_37n	missense	141	30.73	63	SNP	1.000	T
ARHGAP28	79822	genome.wustl.edu	37	18	6868167	6868167	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr18:6868167C>A	ENST00000383472.4	+	6	849	c.745C>A	c.(745-747)Cca>Aca	p.P249T	ARHGAP28_ENST00000531294.1_Missense_Mutation_p.P85T|ARHGAP28_ENST00000314319.3_Missense_Mutation_p.P90T|ARHGAP28_ENST00000262227.3_Missense_Mutation_p.P197T|ARHGAP28_ENST00000400091.2_Missense_Mutation_p.P249T|ARHGAP28_ENST00000418986.1_Missense_Mutation_p.P90T|ARHGAP28_ENST00000419673.2_Missense_Mutation_p.P90T|ARHGAP28_ENST00000532996.1_Missense_Mutation_p.P72T			Q9P2N2	RHG28_HUMAN	Rho GTPase activating protein 28	249					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|nucleus (GO:0005634)	GTPase activator activity (GO:0005096)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(10)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	37		Colorectal(10;0.168)				TGAGACCATTCCAGTTCTACC	0.463																																						dbGAP											0													212.0	187.0	196.0					18																	6868167		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033668	CCDS32785.1	18p11.23	2011-06-29				ENSG00000088756		"""Rho GTPase activating proteins"""	25509	protein-coding gene	gene with protein product		610592				10718198	Standard	NM_001010000		Approved	KIAA1314, FLJ10312	uc002kne.3	Q9P2N2		ENST00000383472.4:c.745C>A	18.37:g.6868167C>A	ENSP00000372964:p.Pro249Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQB7|A8MU88|Q6P160|Q8N4T3|Q9NW53	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.P249T	ENST00000383472.4	37	c.745		18	.	.	.	.	.	.	.	.	.	.	C	6.983	0.551369	0.13374	.	.	ENSG00000088756	ENST00000400091;ENST00000262227;ENST00000419673;ENST00000531294;ENST00000314319;ENST00000418986;ENST00000532996;ENST00000383472	T;T;T;T;T;T	0.08720	3.26;3.22;3.16;3.18;3.16;3.06	5.59	3.8	0.43715	.	0.071617	0.53938	D	0.000051	T	0.07548	0.0190	L	0.40543	1.245	0.27707	N	0.945576	B;B;B;B	0.24823	0.077;0.085;0.112;0.037	B;B;B;B	0.21360	0.034;0.012;0.032;0.029	T	0.19353	-1.0308	10	0.40728	T	0.16	.	9.1307	0.36843	0.0:0.776:0.1467:0.0772	.	249;81;90;197	Q9P2N2;E9PRP2;F6VKJ9;Q9P2N2-2	RHG28_HUMAN;.;.;.	T	249;197;90;85;90;90;81;72	ENSP00000382963:P249T;ENSP00000262227:P197T;ENSP00000392660:P90T;ENSP00000437262:P85T;ENSP00000313506:P90T;ENSP00000406907:P90T	ENSP00000262227:P197T	P	+	1	0	ARHGAP28	6858167	0.999000	0.42202	0.126000	0.21872	0.048000	0.14542	2.973000	0.49264	0.830000	0.34757	-0.302000	0.09304	CCA	ARHGAP28	-	NULL	ENSG00000088756		0.463	ARHGAP28-006	NOVEL	basic|appris_principal	protein_coding	ARHGAP28	HGNC	protein_coding	OTTHUMT00000442123.3	262	0.00	0	C	XM_371108		6868167	6868167	+1	no_errors	ENST00000400091	ensembl	human	known	69_37n	missense	514	21.10	138	SNP	0.994	A
ATG14	22863	genome.wustl.edu	37	14	55852815	55852815	+	Splice_Site	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr14:55852815C>G	ENST00000247178.5	-	5	445		c.e5-1			NM_014924.4	NP_055739.2	Q6ZNE5	BAKOR_HUMAN	autophagy related 14						autophagic vacuole assembly (GO:0000045)|endosome to lysosome transport (GO:0008333)|positive regulation of autophagy (GO:0010508)	autophagic vacuole (GO:0005776)|axoneme (GO:0005930)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|pre-autophagosomal structure membrane (GO:0034045)				central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(6)|prostate(2)	13						CCTTCAGAATCTAAAATAAAT	0.418																																						dbGAP											0													63.0	58.0	60.0					14																	55852815		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB020638	CCDS32087.1	14q22.2	2014-02-12	2012-06-06	2010-06-29	ENSG00000126775	ENSG00000126775			19962	protein-coding gene	gene with protein product	"""Barkor"", ""beclin 1-associated autophagy-related key regulator"""	613515	"""KIAA0831"", ""ATG14 autophagy related 14 homolog (S. cerevisiae)"""	KIAA0831		18843052	Standard	NM_014924		Approved	ATG14L	uc001xbx.2	Q6ZNE5	OTTHUMG00000172129	ENST00000247178.5:c.410-1G>C	14.37:g.55852815C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJE4|A8K9U5|B7ZWP5|O94920|Q32MK7|Q32MK8	Splice_Site	SNP	-	e5-1	ENST00000247178.5	37	c.410-1	CCDS32087.1	14	.	.	.	.	.	.	.	.	.	.	c	19.19	3.778721	0.70107	.	.	ENSG00000126775	ENST00000247178	.	.	.	5.31	4.42	0.53409	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.8512	0.63499	0.0:0.9265:0.0:0.0735	.	.	.	.	.	-1	.	.	.	-	.	.	ATG14	54922568	1.000000	0.71417	0.998000	0.56505	0.954000	0.61252	6.714000	0.74692	1.235000	0.43724	0.655000	0.94253	.	ATG14	-	-	ENSG00000126775		0.418	ATG14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG14	HGNC	protein_coding	OTTHUMT00000416992.1	124	0.79	1	C	NM_014924	Intron	55852815	55852815	-1	no_errors	ENST00000247178	ensembl	human	known	69_37n	splice_site	40	46.67	35	SNP	1.000	G
ATG4D	84971	genome.wustl.edu	37	19	10662976	10662976	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr19:10662976G>C	ENST00000309469.4	+	9	1391	c.1218G>C	c.(1216-1218)gaG>gaC	p.E406D	RNU7-140P_ENST00000459546.1_RNA|MIR1238_ENST00000408483.1_RNA|ATG4D_ENST00000540862.1_Missense_Mutation_p.E73D	NM_032885.4	NP_116274.3	Q86TL0	ATG4D_HUMAN	autophagy related 4D, cysteine peptidase	406					apoptotic process (GO:0006915)|autophagy (GO:0006914)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	cysteine-type endopeptidase activity (GO:0004197)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	19			Epithelial(33;9.2e-06)|all cancers(31;3.9e-05)			AGGAGTTTGAGACACTCTGCT	0.607																																						dbGAP											0													54.0	47.0	49.0					19																	10662976		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ312332	CCDS12241.1	19p13.2	2014-02-12	2012-06-06	2005-09-11	ENSG00000130734	ENSG00000130734			20789	protein-coding gene	gene with protein product		611340	"""AUT-like 4, cysteine endopeptidase (S. cerevisiae)"", ""APG4 autophagy 4 homolog D (S. cerevisiae)"", ""ATG4 autophagy related 4 homolog D (S. cerevisiae)"""	AUTL4, APG4D		12446702	Standard	NM_032885		Approved	APG4-D	uc002mov.3	Q86TL0	OTTHUMG00000180582	ENST00000309469.4:c.1218G>C	19.37:g.10662976G>C	ENSP00000311318:p.Glu406Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q969K0	Missense_Mutation	SNP	pfam_Peptidase_C54	p.E406D	ENST00000309469.4	37	c.1218	CCDS12241.1	19	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779204	0.70107	.	.	ENSG00000130734	ENST00000309469;ENST00000540862	T	0.42900	0.96	5.28	5.28	0.74379	.	0.050899	0.85682	D	0.000000	T	0.32645	0.0836	N	0.25060	0.705	0.46927	D	0.999256	B;P	0.36086	0.333;0.536	B;P	0.44422	0.306;0.449	T	0.05971	-1.0853	10	0.05721	T	0.95	-13.4788	13.0512	0.58957	0.0:0.0:0.8387:0.1613	.	343;406	B4DGM8;Q86TL0	.;ATG4D_HUMAN	D	406;73	ENSP00000311318:E406D	ENSP00000311318:E406D	E	+	3	2	ATG4D	10523976	0.997000	0.39634	0.997000	0.53966	0.995000	0.86356	1.807000	0.38902	2.635000	0.89317	0.561000	0.74099	GAG	ATG4D	-	pfam_Peptidase_C54	ENSG00000130734		0.607	ATG4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG4D	HGNC	protein_coding	OTTHUMT00000452022.1	35	0.00	0	G	NM_032885		10662976	10662976	+1	no_errors	ENST00000309469	ensembl	human	known	69_37n	missense	119	19.05	28	SNP	0.999	C
ATP2B3	492	genome.wustl.edu	37	X	152827699	152827699	+	Splice_Site	SNP	A	A	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:152827699A>T	ENST00000349466.2	+	19	3484	c.3158A>T	c.(3157-3159)cAg>cTg	p.Q1053L	ATP2B3_ENST00000370181.2_Splice_Site_p.Q1039L|ATP2B3_ENST00000393842.1_Splice_Site_p.Q1039L|ATP2B3_ENST00000359149.3_Splice_Site_p.Q1053L|ATP2B3_ENST00000263519.4_Splice_Site_p.Q1053L|ATP2B3_ENST00000370186.1_Splice_Site_p.Q1039L			Q16720	AT2B3_HUMAN	ATPase, Ca++ transporting, plasma membrane 3	1053					blood coagulation (GO:0007596)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)|transport (GO:0006810)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|metal ion binding (GO:0046872)			NS(2)|breast(5)|endometrium(7)|large_intestine(8)|lung(23)|ovary(1)|pancreas(1)|skin(3)	50	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GTCTGGGGACAGGTGAGTGAC	0.592																																						dbGAP											0													121.0	94.0	103.0					X																	152827699		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			U60414	CCDS14722.1, CCDS35440.1	Xq28	2014-07-18			ENSG00000067842	ENSG00000067842	3.6.3.8	"""ATPases / P-type"""	816	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 3"", ""cilia and flagella associated protein 39"""	300014	"""spinocerebellar ataxia, X-linked 1"", ""cerebellar ataxia 2 (X-linked)"""	SCAX1, CLA2		8187550, 22912398	Standard	NM_021949		Approved	PMCA3, CFAP39	uc004fht.1	Q16720	OTTHUMG00000024202	ENST00000349466.2:c.3159+1A>T	X.37:g.152827699A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WNR8|B7WNY5|Q12995|Q16858	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.Q1053L	ENST00000349466.2	37	c.3158	CCDS35440.1	X	.	.	.	.	.	.	.	.	.	.	A	17.06	3.291677	0.59976	.	.	ENSG00000067842	ENST00000370186;ENST00000349466;ENST00000393842;ENST00000359149;ENST00000263519;ENST00000370181	D;D;D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73;-3.73;-3.73	4.91	4.91	0.64330	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.000000	0.64402	D	0.000001	D	0.96620	0.8897	M	0.65320	2	0.80722	D	1	D;D;B	0.89917	0.996;1.0;0.099	D;D;B	0.79784	0.99;0.993;0.1	D	0.95512	0.8587	10	0.29301	T	0.29	-15.7971	12.7445	0.57273	1.0:0.0:0.0:0.0	.	1039;1053;1053	Q16720-3;Q16720;Q16720-2	.;AT2B3_HUMAN;.	L	1039;1053;1039;1053;1053;1039	ENSP00000359205:Q1039L;ENSP00000343886:Q1053L;ENSP00000377425:Q1039L;ENSP00000352062:Q1053L;ENSP00000263519:Q1053L;ENSP00000359200:Q1039L	ENSP00000263519:Q1053L	Q	+	2	0	ATP2B3	152480893	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.281000	0.95811	1.647000	0.50633	0.430000	0.28490	CAG	ATP2B3	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Ca-transp_PMCA	ENSG00000067842		0.592	ATP2B3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B3	HGNC	protein_coding	OTTHUMT00000060957.1	84	0.00	0	A	NM_021949	Missense_Mutation	152827699	152827699	+1	no_errors	ENST00000263519	ensembl	human	known	69_37n	missense	177	27.64	68	SNP	1.000	T
ATXN2L	11273	genome.wustl.edu	37	16	28842316	28842316	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr16:28842316C>T	ENST00000336783.4	+	10	1411	c.1244C>T	c.(1243-1245)cCt>cTt	p.P415L	ATXN2L_ENST00000382686.4_Missense_Mutation_p.P415L|ATXN2L_ENST00000564304.1_Missense_Mutation_p.P415L|ATXN2L_ENST00000570200.1_Missense_Mutation_p.P415L|ATXN2L_ENST00000395547.2_Missense_Mutation_p.P415L|ATXN2L_ENST00000340394.8_Missense_Mutation_p.P415L|RP11-24N18.1_ENST00000563565.1_RNA|ATXN2L_ENST00000325215.6_Missense_Mutation_p.P415L	NM_007245.3	NP_009176.2	Q8WWM7	ATX2L_HUMAN	ataxin 2-like	415					regulation of cytoplasmic mRNA processing body assembly (GO:0010603)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|membrane (GO:0016020)|nuclear speck (GO:0016607)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36						GCACAACGGCCTCTGAGAGGT	0.473																																						dbGAP											0													51.0	49.0	50.0					16																	28842316		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10639.1, CCDS10640.1, CCDS10641.1, CCDS32423.1, CCDS45451.1, CCDS58443.1	16p11	2008-02-05			ENSG00000168488	ENSG00000168488			31326	protein-coding gene	gene with protein product		607931				11784712, 14769358	Standard	NM_007245		Approved	A2lp, A2D	uc002dqy.4	Q8WWM7	OTTHUMG00000097038	ENST00000336783.4:c.1244C>T	16.37:g.28842316C>T	ENSP00000338718:p.Pro415Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1R6|B9EGM2|E9PAR9|O95135|Q63ZY4|Q6NVJ8|Q6PJW6|Q8IU61|Q8IU95|Q8WWM3|Q8WWM4|Q8WWM5|Q8WWM6|Q99703	Missense_Mutation	SNP	pfam_LsmAD_domain,pfam_Ataxin-2_C,superfamily_LSM_dom	p.P415L	ENST00000336783.4	37	c.1244	CCDS10641.1	16	.	.	.	.	.	.	.	.	.	.	.	32	5.138971	0.94560	.	.	ENSG00000168488	ENST00000340394;ENST00000395547;ENST00000336783;ENST00000382686;ENST00000325215	T;T;T;T;T	0.51817	0.71;0.71;0.69;0.73;0.7	5.65	5.65	0.86999	.	0.000000	0.64402	D	0.000001	T	0.61912	0.2385	L	0.44542	1.39	0.80722	D	1	D;D;P;D;D;D;D;D	0.65815	0.995;0.982;0.948;0.991;0.995;0.969;0.991;0.995	D;D;P;P;D;P;P;D	0.66497	0.944;0.91;0.68;0.88;0.944;0.829;0.88;0.944	T	0.59726	-0.7400	10	0.52906	T	0.07	-10.7553	18.8526	0.92238	0.0:1.0:0.0:0.0	.	415;415;415;415;415;415;415;415	Q8WWM7-6;Q8WWM7-5;Q63ZY4;Q8WWM7;Q8WWM7-2;Q8WWM7-4;A8K1R6;Q8WWM7-3	.;.;.;ATX2L_HUMAN;.;.;.;.	L	415	ENSP00000341459:P415L;ENSP00000378917:P415L;ENSP00000338718:P415L;ENSP00000372133:P415L;ENSP00000315650:P415L	ENSP00000315650:P415L	P	+	2	0	ATXN2L	28749817	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	4.239000	0.58694	2.826000	0.97356	0.563000	0.77884	CCT	ATXN2L	-	NULL	ENSG00000168488		0.473	ATXN2L-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATXN2L	HGNC	protein_coding	OTTHUMT00000214139.1	98	0.00	0	C	NM_007245		28842316	28842316	+1	no_errors	ENST00000395547	ensembl	human	known	69_37n	missense	76	27.62	29	SNP	1.000	T
ATXN3L	92552	genome.wustl.edu	37	X	13337695	13337695	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:13337695C>A	ENST00000380622.2	-	1	823	c.359G>T	c.(358-360)tGg>tTg	p.W120L	GS1-600G8.3_ENST00000431486.1_RNA	NM_001135995.1	NP_001129467.1	Q9H3M9	ATX3L_HUMAN	ataxin 3-like	120	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				protein deubiquitination (GO:0016579)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	omega peptidase activity (GO:0008242)|ubiquitin-specific protease activity (GO:0004843)			endometrium(3)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						AATAGTAAACCAGTGTTGTTT	0.333																																						dbGAP											0													53.0	48.0	50.0					X																	13337695		1568	3581	5149	-	-	-	SO:0001583	missense	0				CCDS48080.1	Xp22	2010-09-30			ENSG00000123594	ENSG00000123594			24173	protein-coding gene	gene with protein product		300920					Standard	NM_001135995		Approved	MJDL	uc010ned.3	Q9H3M9	OTTHUMG00000021146	ENST00000380622.2:c.359G>T	X.37:g.13337695C>A	ENSP00000369996:p.Trp120Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNY8	Missense_Mutation	SNP	pfam_Josephin,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Josephin,pfscan_Ubiquitin-int_motif,prints_Josephin	p.W120L	ENST00000380622.2	37	c.359	CCDS48080.1	X	.	.	.	.	.	.	.	.	.	.	C	12.25	1.880416	0.33255	.	.	ENSG00000123594	ENST00000380622	T	0.72725	-0.68	0.943	-0.0254	0.13935	.	0.000000	0.85682	D	0.000000	D	0.83543	0.5277	H	0.95043	3.615	0.53688	D	0.999971	D	0.76494	0.999	D	0.80764	0.994	T	0.77395	-0.2604	10	0.87932	D	0	.	1.6741	0.02818	0.3297:0.4085:0.0:0.2618	.	120	Q9H3M9	ATX3L_HUMAN	L	120	ENSP00000369996:W120L	ENSP00000369996:W120L	W	-	2	0	ATXN3L	13247616	1.000000	0.71417	0.011000	0.14972	0.066000	0.16364	0.630000	0.24553	-0.079000	0.12707	0.422000	0.28245	TGG	ATXN3L	-	pfam_Josephin,pfscan_Josephin,prints_Josephin	ENSG00000123594		0.333	ATXN3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN3L	HGNC	protein_coding	OTTHUMT00000055785.2	95	0.00	0	C	NM_001135995		13337695	13337695	-1	no_errors	ENST00000380622	ensembl	human	known	69_37n	missense	37	32.73	18	SNP	1.000	A
BCORL1	63035	genome.wustl.edu	37	X	129148107	129148107	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:129148107G>A	ENST00000218147.7	+	4	1556	c.1359G>A	c.(1357-1359)ccG>ccA	p.P453P	BCORL1_ENST00000540052.1_Silent_p.P453P|BCORL1_ENST00000359304.2_Silent_p.P453P|BCORL1_ENST00000303743.5_Silent_p.P453P			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	453	Pro-rich.				chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						TATATATCCCGCCTCCAAGCT	0.602																																						dbGAP											0													47.0	42.0	44.0					X																	129148107		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.1359G>A	X.37:g.129148107G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P453	ENST00000218147.7	37	c.1359	CCDS14616.1	X																																																																																			BCORL1	-	NULL	ENSG00000085185		0.602	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	30	0.00	0	G	NM_021946		129148107	129148107	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	silent	39	18.37	9	SNP	0.001	A
CACNA2D4	93589	genome.wustl.edu	37	12	1920881	1920881	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr12:1920881C>A	ENST00000382722.5	-	27	2922	c.2560G>T	c.(2560-2562)Gtc>Ttc	p.V854F	CACNA2D4_ENST00000585708.1_Missense_Mutation_p.V790F|CACNA2D4_ENST00000586184.1_Missense_Mutation_p.V854F|CACNA2D4_ENST00000538027.2_5'UTR|CACNA2D4_ENST00000588077.1_Missense_Mutation_p.V790F|CACNA2D4_ENST00000538450.1_5'UTR|CACNA2D4_ENST00000587995.1_Missense_Mutation_p.V829F|CACNA2D4_ENST00000585732.1_Missense_Mutation_p.V715F	NM_172364.4	NP_758952.4	Q7Z3S7	CA2D4_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 4	854					calcium ion transmembrane transport (GO:0070588)|detection of light stimulus involved in visual perception (GO:0050908)	voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			endometrium(3)|kidney(2)|large_intestine(1)|liver(1)|lung(27)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	39	Ovarian(42;0.107)	Myeloproliferative disorder(1001;0.206)	OV - Ovarian serous cystadenocarcinoma(31;0.00113)	Kidney(2;0.0205)|KIRC - Kidney renal clear cell carcinoma(2;0.0451)		TTCATTTGGACGCCCGCGGCT	0.592																																					Colon(2;101 179 21030 23310 28141)	dbGAP											0													20.0	23.0	22.0					12																	1920881		1865	4047	5912	-	-	-	SO:0001583	missense	0			AF516695	CCDS44785.1	12p13.33	2003-03-05			ENSG00000151062	ENSG00000151062		"""Calcium channel subunits"""	20202	protein-coding gene	gene with protein product		608171				12181424	Standard	NM_172364		Approved		uc021qsx.1	Q7Z3S7	OTTHUMG00000168111	ENST00000382722.5:c.2560G>T	12.37:g.1920881C>A	ENSP00000372169:p.Val854Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3S8|Q86XZ5|Q8IZS9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.V854F	ENST00000382722.5	37	c.2560	CCDS44785.1	12	.	.	.	.	.	.	.	.	.	.	C	3.762	-0.049465	0.07407	.	.	ENSG00000151062	ENST00000456077;ENST00000280663;ENST00000382722	T	0.78126	-1.15	4.63	-0.395	0.12431	.	0.642218	0.14044	N	0.345238	T	0.55545	0.1927	N	0.12746	0.255	0.37042	D	0.897201	P;P	0.45569	0.861;0.71	B;B	0.43155	0.41;0.257	T	0.53920	-0.8370	10	0.09843	T	0.71	.	7.3468	0.26668	0.0:0.4321:0.0:0.5679	.	854;854	Q7Z3S7-2;Q7Z3S7	.;CA2D4_HUMAN	F	790;854;854	ENSP00000372169:V854F	ENSP00000280663:V854F	V	-	1	0	CACNA2D4	1791142	0.919000	0.31177	0.937000	0.37676	0.276000	0.26787	0.079000	0.14782	-0.463000	0.06973	0.436000	0.28706	GTC	CACNA2D4	-	NULL	ENSG00000151062		0.592	CACNA2D4-001	KNOWN	non_canonical_U12|basic|appris_candidate|CCDS	protein_coding	CACNA2D4	HGNC	protein_coding	OTTHUMT00000398230.2	37	0.00	0	C			1920881	1920881	-1	no_errors	ENST00000382722	ensembl	human	known	69_37n	missense	101	17.07	21	SNP	0.990	A
CKAP2L	150468	genome.wustl.edu	37	2	113518307	113518307	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:113518307G>C	ENST00000302450.6	-	3	217	c.139C>G	c.(139-141)Caa>Gaa	p.Q47E	CKAP2L_ENST00000481732.1_5'UTR|CKAP2L_ENST00000541405.1_De_novo_Start_OutOfFrame	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	47						centrosome (GO:0005813)|cytoplasm (GO:0005737)				breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						GAAGGTGGTTGATTCTGGCAA	0.284																																						dbGAP											0													64.0	72.0	69.0					2																	113518307		2192	4286	6478	-	-	-	SO:0001583	missense	0			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.139C>G	2.37:g.113518307G>C	ENSP00000305204:p.Gln47Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	NULL	p.Q47E	ENST00000302450.6	37	c.139	CCDS2100.1	2	.	.	.	.	.	.	.	.	.	.	G	10.37	1.330877	0.24167	.	.	ENSG00000169607	ENST00000302450	T	0.05447	3.44	4.8	4.8	0.61643	.	0.091370	0.41605	D	0.000859	T	0.04407	0.0121	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.43212	-0.9405	10	0.66056	D	0.02	-2.1616	14.0952	0.65016	0.0:0.0:1.0:0.0	.	47	Q8IYA6	CKP2L_HUMAN	E	47	ENSP00000305204:Q47E	ENSP00000305204:Q47E	Q	-	1	0	CKAP2L	113234778	1.000000	0.71417	0.747000	0.31113	0.677000	0.39632	4.670000	0.61583	2.593000	0.87608	0.655000	0.94253	CAA	CKAP2L	-	NULL	ENSG00000169607		0.284	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	HGNC	protein_coding	OTTHUMT00000254082.2	171	0.00	0	G	NM_152515		113518307	113518307	-1	no_errors	ENST00000302450	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	0.946	C
COL22A1	169044	genome.wustl.edu	37	8	139767455	139767455	+	Splice_Site	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:139767455T>A	ENST00000303045.6	-	21	2424		c.e21-2		COL22A1_ENST00000435777.1_Splice_Site	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1						extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			TGGAGCTCCCTGGTAACACAA	0.562										HNSCC(7;0.00092)																												dbGAP											0													69.0	68.0	68.0					8																	139767455		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.1978-2A>T	8.37:g.139767455T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Splice_Site	SNP	-	e20-2	ENST00000303045.6	37	c.1978-2	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	T	14.82	2.648950	0.47362	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	.	.	.	4.98	4.98	0.66077	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9982	0.47589	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	COL22A1	139836637	0.995000	0.38212	0.970000	0.41538	0.502000	0.33828	3.425000	0.52771	2.100000	0.63781	0.482000	0.46254	.	COL22A1	-	-	ENSG00000169436		0.562	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	44	0.00	0	T	XM_291257	Intron	139767455	139767455	-1	no_errors	ENST00000303045	ensembl	human	known	69_37n	splice_site	89	22.61	26	SNP	0.983	A
CPS1	1373	genome.wustl.edu	37	2	211512678	211512678	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:211512678C>G	ENST00000233072.5	+	26	3429	c.3233C>G	c.(3232-3234)aCa>aGa	p.T1078R	CPS1_ENST00000451903.2_Missense_Mutation_p.T627R|CPS1_ENST00000430249.2_Missense_Mutation_p.T1084R	NM_001875.4	NP_001866.2	P31327	CPSM_HUMAN	carbamoyl-phosphate synthase 1, mitochondrial	1078					anion homeostasis (GO:0055081)|carbamoyl phosphate biosynthetic process (GO:0070409)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to glucagon stimulus (GO:0071377)|cellular response to oleic acid (GO:0071400)|citrulline biosynthetic process (GO:0019240)|glutamine catabolic process (GO:0006543)|glycogen catabolic process (GO:0005980)|hepatocyte differentiation (GO:0070365)|homocysteine metabolic process (GO:0050667)|midgut development (GO:0007494)|nitric oxide metabolic process (GO:0046209)|positive regulation of vasodilation (GO:0045909)|response to amine (GO:0014075)|response to amino acid (GO:0043200)|response to dexamethasone (GO:0071548)|response to drug (GO:0042493)|response to food (GO:0032094)|response to growth hormone (GO:0060416)|response to lipopolysaccharide (GO:0032496)|response to starvation (GO:0042594)|response to toxic substance (GO:0009636)|response to zinc ion (GO:0010043)|small molecule metabolic process (GO:0044281)|triglyceride catabolic process (GO:0019433)|urea cycle (GO:0000050)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|carbamoyl-phosphate synthase (ammonia) activity (GO:0004087)|endopeptidase activity (GO:0004175)|glutamate binding (GO:0016595)|modified amino acid binding (GO:0072341)|phospholipid binding (GO:0005543)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(17)|lung(85)|ovary(8)|pancreas(1)|prostate(6)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	142				Epithelial(149;0.00697)|Lung(261;0.0521)|LUSC - Lung squamous cell carcinoma(261;0.0544)|all cancers(144;0.0843)	Carglumic Acid(DB06775)	ATCATGGGCACAAGCCCCCTG	0.507																																						dbGAP											0													114.0	106.0	108.0					2																	211512678		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154830	CCDS2393.1, CCDS46505.1, CCDS46506.1	2p	2014-09-17	2010-05-11		ENSG00000021826	ENSG00000021826	6.3.4.16		2323	protein-coding gene	gene with protein product		608307	"""carbamoyl-phosphate synthetase 1, mitochondrial"""				Standard	NM_001122633		Approved		uc002vee.4	P31327	OTTHUMG00000132994	ENST00000233072.5:c.3233C>G	2.37:g.211512678C>G	ENSP00000233072:p.Thr1078Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z818|J3KQL0|O43774|Q53TL5|Q59HF8|Q7Z5I5	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_ssu_N,pfam_CarbamoylP_synth_lsu_oligo,pfam_GATASE_1,pfam_CarbamoylP_synth_lsu_N,pfam_MGS-like_dom,pfam_ATP-grasp_carboxylate-amine,pfam_Dala_Dala_lig_C,superfamily_CarbamoylP_synth_lsu_oligo,superfamily_CarbamoylP_synth_ssu_N,superfamily_PreATP-grasp_fold,superfamily_MGS-like_dom,smart_MGS-like_dom,prints_CbamoylP_synth_lsu_CPSase_dom,pfscan_ATP-grasp,tigrfam_CarbamoylP_synth_lsu,tigrfam_CarbamoylP_synth_ssu	p.T1084R	ENST00000233072.5	37	c.3251	CCDS2393.1	2	.	.	.	.	.	.	.	.	.	.	C	26.2	4.711578	0.89112	.	.	ENSG00000021826	ENST00000430249;ENST00000539150;ENST00000233072;ENST00000451903	D;D;D	0.97791	-4.54;-4.54;-4.54	5.9	5.9	0.94986	PreATP-grasp-like fold (1);Carbamoyl-phosphate synthase, large subunit, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.99474	0.9813	H	0.99659	4.685	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97887	1.0295	10	0.87932	D	0	-9.0227	20.2704	0.98474	0.0:1.0:0.0:0.0	.	1088;1078	Q59HF8;P31327	.;CPSM_HUMAN	R	1084;1086;1078;627	ENSP00000402608:T1084R;ENSP00000233072:T1078R;ENSP00000406136:T627R	ENSP00000233072:T1078R	T	+	2	0	CPS1	211220923	1.000000	0.71417	0.947000	0.38551	0.965000	0.64279	7.487000	0.81328	2.793000	0.96121	0.591000	0.81541	ACA	CPS1	-	pfam_CarbamoylP_synth_lsu_N,superfamily_PreATP-grasp_fold,tigrfam_CarbamoylP_synth_lsu	ENSG00000021826		0.507	CPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPS1	HGNC	protein_coding	OTTHUMT00000256569.5	67	0.00	0	C			211512678	211512678	+1	no_errors	ENST00000430249	ensembl	human	known	69_37n	missense	110	25.68	38	SNP	1.000	G
CSPP1	79848	genome.wustl.edu	37	8	68087581	68087581	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:68087581G>C	ENST00000262210.5	+	24	3035	c.3004G>C	c.(3004-3006)Gat>Cat	p.D1002H	CSPP1_ENST00000521168.1_3'UTR|ARFGEF1_ENST00000520381.1_3'UTR|CSPP1_ENST00000412460.1_Missense_Mutation_p.D657H	NM_024790.6	NP_079066.5	Q1MSJ5	CSPP1_HUMAN	centrosome and spindle pole associated protein 1	1037					positive regulation of cell division (GO:0051781)|positive regulation of cytokinesis (GO:0032467)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|spindle (GO:0005819)|spindle pole (GO:0000922)				NS(1)|breast(3)|endometrium(4)|kidney(3)|large_intestine(11)|lung(17)|ovary(5)|prostate(3)|skin(1)|urinary_tract(1)	49	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.00145)|OV - Ovarian serous cystadenocarcinoma(28;0.00589)|all cancers(69;0.0069)|BRCA - Breast invasive adenocarcinoma(89;0.153)			TCCTCCAAGAGATCATCACAC	0.368																																						dbGAP											0													69.0	68.0	69.0					8																	68087581		1868	4100	5968	-	-	-	SO:0001583	missense	0			AJ583433	CCDS43744.1	8q13.2	2014-02-24			ENSG00000104218	ENSG00000104218			26193	protein-coding gene	gene with protein product		611654				15580290, 24360807	Standard	NM_024790		Approved	FLJ22490, CSPP, JBTS21	uc003xxj.3	Q1MSJ5	OTTHUMG00000164564	ENST00000262210.5:c.3004G>C	8.37:g.68087581G>C	ENSP00000262210:p.Asp1002His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND63|Q70F00|Q8TBC1	Missense_Mutation	SNP	NULL	p.D1002H	ENST00000262210.5	37	c.3004	CCDS43744.1	8	.	.	.	.	.	.	.	.	.	.	G	19.27	3.795747	0.70452	.	.	ENSG00000104218	ENST00000262210;ENST00000389042;ENST00000412460;ENST00000519668	T;T;T	0.40476	1.03;1.03;1.03	4.8	4.8	0.61643	.	0.000000	0.64402	D	0.000001	T	0.60431	0.2268	M	0.68952	2.095	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.99;0.999;0.974	T	0.63301	-0.6668	10	0.72032	D	0.01	-22.0739	11.3449	0.49554	0.0895:0.0:0.9105:0.0	.	160;657;1002;1037	Q9H688;Q1MSJ5-2;Q1MSJ5-1;Q1MSJ5	.;.;.;CSPP1_HUMAN	H	1002;1037;657;657	ENSP00000262210:D1002H;ENSP00000415782:D657H;ENSP00000430092:D657H	ENSP00000262210:D1002H	D	+	1	0	CSPP1	68250135	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.912000	0.56386	2.363000	0.80096	0.591000	0.81541	GAT	CSPP1	-	NULL	ENSG00000104218		0.368	CSPP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CSPP1	HGNC	protein_coding	OTTHUMT00000379254.1	113	0.00	0	G	NM_024790		68087581	68087581	+1	no_errors	ENST00000262210	ensembl	human	known	69_37n	missense	131	14.94	23	SNP	1.000	C
CSTF3	1479	genome.wustl.edu	37	11	33108591	33108591	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:33108591C>G	ENST00000323959.4	-	18	1877	c.1738G>C	c.(1738-1740)Gaa>Caa	p.E580Q	TCP11L1_ENST00000324357.9_Intron	NM_001326.2	NP_001317.1	Q12996	CSTF3_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa	580	Pro-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(4)|prostate(1)|skin(1)|stomach(1)	19						TTAGGGTATTCTGGTTTTCTA	0.448																																						dbGAP											0													318.0	291.0	301.0					11																	33108591		2202	4298	6500	-	-	-	SO:0001583	missense	0			U15782	CCDS7883.1, CCDS44563.1, CCDS44564.1	11p13	2007-01-05	2002-08-29		ENSG00000176102	ENSG00000176102			2485	protein-coding gene	gene with protein product		600367	"""cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kD"""			7984242	Standard	XM_006718154		Approved	CstF-77	uc001muh.3	Q12996	OTTHUMG00000166268	ENST00000323959.4:c.1738G>C	11.37:g.33108591C>G	ENSP00000315791:p.Glu580Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K471|D3DR04|E9PB40|Q32P22|Q96FQ8|Q96QD6|Q96QK4	Missense_Mutation	SNP	pfam_Suf,smart_HAT	p.E580Q	ENST00000323959.4	37	c.1738	CCDS7883.1	11	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462933	0.43736	.	.	ENSG00000176102	ENST00000323959;ENST00000537832	.	.	.	5.82	4.9	0.64082	Suppressor of forked (1);	0.000000	0.85682	D	0.000000	T	0.38321	0.1036	N	0.14661	0.345	0.80722	D	1	B	0.16802	0.019	B	0.17979	0.02	T	0.20773	-1.0265	9	0.08837	T	0.75	.	15.3088	0.74014	0.0:0.9319:0.0:0.0681	.	580	Q12996	CSTF3_HUMAN	Q	580;513	.	ENSP00000315791:E580Q	E	-	1	0	CSTF3	33065167	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.818000	0.86416	2.751000	0.94390	0.650000	0.86243	GAA	CSTF3	-	pfam_Suf	ENSG00000176102		0.448	CSTF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF3	HGNC	protein_coding	OTTHUMT00000388801.1	315	0.00	0	C	NM_001326		33108591	33108591	-1	no_errors	ENST00000323959	ensembl	human	known	69_37n	missense	309	23.96	98	SNP	1.000	G
DAAM2	23500	genome.wustl.edu	37	6	39824117	39824117	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr6:39824117C>A	ENST00000398904.2	+	2	221	c.39C>A	c.(37-39)ttC>ttA	p.F13L	DAAM2_ENST00000494405.1_3'UTR|DAAM2_ENST00000274867.4_Missense_Mutation_p.F13L|DAAM2_ENST00000405961.3_Missense_Mutation_p.F13L|DAAM2_ENST00000538976.1_Missense_Mutation_p.F13L			Q86T65	DAAM2_HUMAN	dishevelled associated activator of morphogenesis 2	13					actin cytoskeleton organization (GO:0030036)|determination of left/right symmetry (GO:0007368)					NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(18)|ovary(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)	49	Ovarian(28;0.0355)|Colorectal(47;0.196)					GCCTGGGCTTCCTGTGCTGCT	0.627																																						dbGAP											0													26.0	29.0	28.0					6																	39824117		2004	4174	6178	-	-	-	SO:0001583	missense	0			AB002379	CCDS54999.1, CCDS56426.1	6p21.1	2008-07-30			ENSG00000146122	ENSG00000146122			18143	protein-coding gene	gene with protein product		606627				11779461, 12632087	Standard	NM_015345		Approved	KIAA0381	uc003oow.3	Q86T65	OTTHUMG00000014653	ENST00000398904.2:c.39C>A	6.37:g.39824117C>A	ENSP00000381876:p.Phe13Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	G5EA45|Q5T4T8|Q5T4U0|Q9NQI5|Q9Y4G0	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Drf_FH3,pfam_Drf_GTPase-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.F13L	ENST00000398904.2	37	c.39	CCDS56426.1	6	.	.	.	.	.	.	.	.	.	.	C	24.0	4.484798	0.84854	.	.	ENSG00000146122	ENST00000274867;ENST00000398904;ENST00000538976;ENST00000405961	T;T;T	0.78924	-1.22;-1.22;-1.22	5.92	4.88	0.63580	.	0.110862	0.64402	D	0.000009	T	0.66187	0.2764	N	0.05124	-0.11	0.40545	D	0.981068	B;B;D	0.54964	0.0;0.0;0.969	B;B;D	0.63381	0.003;0.001;0.914	T	0.74942	-0.3492	10	0.72032	D	0.01	.	11.7018	0.51575	0.0:0.869:0.0:0.131	.	13;13;13	G5EA45;Q86T65;F2Z2Q2	.;DAAM2_HUMAN;.	L	13	ENSP00000274867:F13L;ENSP00000381876:F13L;ENSP00000437808:F13L	ENSP00000274867:F13L	F	+	3	2	DAAM2	39932095	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	2.579000	0.46059	2.805000	0.96524	0.655000	0.94253	TTC	DAAM2	-	NULL	ENSG00000146122		0.627	DAAM2-003	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	DAAM2	HGNC	protein_coding	OTTHUMT00000280648.1	65	0.00	0	C			39824117	39824117	+1	no_errors	ENST00000274867	ensembl	human	known	69_37n	missense	59	43.93	47	SNP	1.000	A
DCAF12L1	139170	genome.wustl.edu	37	X	125686220	125686220	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:125686220G>A	ENST00000371126.1	-	1	614	c.372C>T	c.(370-372)gaC>gaT	p.D124D		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	124										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						CTGACTCCACGTCCACCACGA	0.622																																						dbGAP											0													123.0	92.0	103.0					X																	125686220		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.372C>T	X.37:g.125686220G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IYK3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D124	ENST00000371126.1	37	c.372	CCDS14610.1	X																																																																																			DCAF12L1	-	superfamily_WD40_repeat_dom	ENSG00000198889		0.622	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	49	0.00	0	G	NM_178470		125686220	125686220	-1	no_errors	ENST00000371126	ensembl	human	known	69_37n	silent	184	18.94	43	SNP	0.996	A
DDB1	1642	genome.wustl.edu	37	11	61068381	61068382	+	Frame_Shift_Del	DEL	CG	CG	-			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	CG	CG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:61068381_61068382delCG	ENST00000301764.7	-	26	3635_3636	c.3238_3239delCG	c.(3238-3240)cggfs	p.R1080fs	DDB1_ENST00000538470.1_Frame_Shift_Del_p.R127fs|DDB1_ENST00000451943.2_Frame_Shift_Del_p.R67fs|DDB1_ENST00000450997.2_Frame_Shift_Del_p.R391fs	NM_001923.4	NP_001914.3	Q16531	DDB1_HUMAN	damage-specific DNA binding protein 1, 127kDa	1080	Interaction with CDT1 and CUL4A.				DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|negative regulation of apoptotic process (GO:0043066)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of mitotic cell cycle phase transition (GO:1901990)|UV-damage excision repair (GO:0070914)|viral process (GO:0016032)|Wnt signaling pathway (GO:0016055)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(7)|lung(22)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	48						TTCTGTCTTCCGCTCGGTGTGA	0.515								Nucleotide excision repair (NER)																														dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AJ002955	CCDS31576.1	11q12-q13	2014-09-17	2002-08-29		ENSG00000167986	ENSG00000167986			2717	protein-coding gene	gene with protein product		600045	"""damage-specific DNA binding protein 1 (127kD)"""			8530102, 10574459	Standard	NM_001923		Approved	XPE	uc001nrc.5	Q16531	OTTHUMG00000168209	ENST00000301764.7:c.3238_3239delCG	11.37:g.61068381_61068382delCG	ENSP00000301764:p.Arg1080fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NG77|B2R648|B4DG00|O15176|Q13289|Q58F96	Frame_Shift_Del	DEL	pfam_Cleavage/polyA-sp_fac_asu_C	p.R1080fs	ENST00000301764.7	37	c.3239_3238	CCDS31576.1	11																																																																																			DDB1	-	pfam_Cleavage/polyA-sp_fac_asu_C	ENSG00000167986		0.515	DDB1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	DDB1	HGNC	protein_coding	OTTHUMT00000398816.1	252	0.00	0	CG	NM_001923		61068381	61068382	-1	no_errors	ENST00000301764	ensembl	human	known	69_37n	frame_shift_del	278	23.92	89	DEL	1.000:1.000	-
DDX21	9188	genome.wustl.edu	37	10	70737415	70737415	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr10:70737415G>A	ENST00000354185.4	+	12	1971	c.1873G>A	c.(1873-1875)Gac>Aac	p.D625N		NM_001256910.1|NM_004728.3	NP_001243839.1|NP_004719.2	Q9NR30	DDX21_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 21	625					ATP catabolic process (GO:0006200)|osteoblast differentiation (GO:0001649)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CACGTCCGTAGACCAGCGCTC	0.478																																						dbGAP											0													100.0	98.0	99.0					10																	70737415		2203	4300	6503	-	-	-	SO:0001583	missense	0			U41387	CCDS31211.1, CCDS73144.1	10q21	2013-05-13	2012-02-23		ENSG00000165732	ENSG00000165732		"""DEAD-boxes"""	2744	protein-coding gene	gene with protein product		606357	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 21"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 21"""			8614622, 18180292	Standard	NM_004728		Approved	RH-II/GU, GURDB	uc001jov.2	Q9NR30	OTTHUMG00000018366	ENST00000354185.4:c.1873G>A	10.37:g.70737415G>A	ENSP00000346120:p.Asp625Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL0|Q13436|Q5VX41|Q68D35	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D625N	ENST00000354185.4	37	c.1873	CCDS31211.1	10	.	.	.	.	.	.	.	.	.	.	G	15.94	2.982157	0.53827	.	.	ENSG00000165732	ENST00000354185	T	0.16073	2.37	5.61	4.7	0.59300	GUCT (1);	0.133340	0.64402	D	0.000002	T	0.13884	0.0336	N	0.22421	0.69	0.38798	D	0.955134	P	0.43231	0.801	P	0.45538	0.484	T	0.08911	-1.0699	10	0.39692	T	0.17	-11.7994	7.9829	0.30194	0.1449:0.1414:0.7138:0.0	.	625	Q9NR30	DDX21_HUMAN	N	625	ENSP00000346120:D625N	ENSP00000346120:D625N	D	+	1	0	DDX21	70407421	1.000000	0.71417	0.952000	0.39060	0.877000	0.50540	4.360000	0.59455	1.504000	0.48704	0.655000	0.94253	GAC	DDX21	-	pfam_GUCT	ENSG00000165732		0.478	DDX21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX21	HGNC	protein_coding	OTTHUMT00000048374.1	63	0.00	0	G	NM_004728		70737415	70737415	+1	no_errors	ENST00000354185	ensembl	human	known	69_37n	missense	83	26.55	30	SNP	0.972	A
DHX9	1660	genome.wustl.edu	37	1	182853847	182853847	+	Silent	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:182853847C>T	ENST00000367549.3	+	27	3470	c.3360C>T	c.(3358-3360)atC>atT	p.I1120I	DHX9_ENST00000485081.1_3'UTR	NM_001357.4	NP_001348.2	Q08211	DHX9_HUMAN	DEAH (Asp-Glu-Ala-His) box helicase 9	1120					ATP catabolic process (GO:0006200)|cellular response to heat (GO:0034605)|circadian rhythm (GO:0007623)|CRD-mediated mRNA stabilization (GO:0070934)|DNA duplex unwinding (GO:0032508)|gene expression (GO:0010467)|innate immune response (GO:0045087)|mRNA splicing, via spliceosome (GO:0000398)|osteoblast differentiation (GO:0001649)|positive regulation of type I interferon production (GO:0032481)|RNA splicing (GO:0008380)	centrosome (GO:0005813)|CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|ATP-dependent RNA helicase activity (GO:0004004)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)|RNA polymerase II transcription factor binding (GO:0001085)			NS(1)|autonomic_ganglia(1)|central_nervous_system(1)|endometrium(10)|kidney(3)|large_intestine(7)|liver(1)|lung(19)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	49						AACCTGCTATCATCAGCCAGT	0.478																																					Colon(69;210 1162 3697 13559 39565)	dbGAP											0													111.0	101.0	104.0					1																	182853847		1992	4168	6160	-	-	-	SO:0001819	synonymous_variant	0			L13848	CCDS41444.1	1q25	2013-05-13	2013-05-13	2003-06-20	ENSG00000135829	ENSG00000135829		"""DEAH-boxes"""	2750	protein-coding gene	gene with protein product	"""NDH II"", ""RNA helicase A"""	603115	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 9 (RNA helicase A, nuclear DNA helicase II; leukophysin)"", ""DEAH (Asp-Glu-Ala-His) box polypeptide 9"""	LKP, DDX9		8344961, 9111062	Standard	NM_001357		Approved	RHA	uc001gpr.3	Q08211	OTTHUMG00000035337	ENST00000367549.3:c.3360C>T	1.37:g.182853847C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNV4|Q05CI5|Q12803|Q32Q22|Q5VY62|Q6PD69|Q99556	Silent	SNP	pfam_Ds-RNA-bd,pfam_Helicase-assoc_dom,pfam_Helicase_C,pfam_DUF1605,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Ds-RNA-bd,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Ds-RNA-bd	p.I1120	ENST00000367549.3	37	c.3360	CCDS41444.1	1																																																																																			DHX9	-	NULL	ENSG00000135829		0.478	DHX9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX9	HGNC	protein_coding	OTTHUMT00000085522.2	135	0.00	0	C	NM_030588		182853847	182853847	+1	no_errors	ENST00000367549	ensembl	human	known	69_37n	silent	201	22.39	58	SNP	0.997	T
DISP2	85455	genome.wustl.edu	37	15	40661944	40661944	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr15:40661944C>G	ENST00000267889.3	+	8	3718	c.3631C>G	c.(3631-3633)Cct>Gct	p.P1211A	RP11-64K12.4_ENST00000558421.1_RNA|LINC00594_ENST00000561261.1_lincRNA	NM_033510.1	NP_277045.1	A7MBM2	DISP2_HUMAN	dispatched homolog 2 (Drosophila)	1211					smoothened signaling pathway (GO:0007224)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(12)|ovary(4)	30		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;3.39e-06)|Colorectal(105;0.0114)|READ - Rectum adenocarcinoma(2;0.0649)|BRCA - Breast invasive adenocarcinoma(123;0.0798)|Lung(196;0.15)|LUAD - Lung adenocarcinoma(183;0.247)		CCCACCAGCCCCTGCCTCCCC	0.667																																						dbGAP											0													32.0	37.0	36.0					15																	40661944		2203	4297	6500	-	-	-	SO:0001583	missense	0			AB051529	CCDS10056.1	15q14	2004-01-15			ENSG00000140323	ENSG00000140323			19712	protein-coding gene	gene with protein product		607503				11214970, 10619433	Standard	NM_033510		Approved	DISPB, KIAA1742, HsT16908	uc001zlk.1	A7MBM2	OTTHUMG00000129983	ENST00000267889.3:c.3631C>G	15.37:g.40661944C>G	ENSP00000267889:p.Pro1211Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6AHW3|Q9C0C1	Missense_Mutation	SNP	pfscan_SSD	p.P1211A	ENST00000267889.3	37	c.3631	CCDS10056.1	15	.	.	.	.	.	.	.	.	.	.	C	11.62	1.692650	0.30052	.	.	ENSG00000140323	ENST00000267889	T	0.10960	2.82	5.5	4.57	0.56435	.	0.416770	0.27139	N	0.020744	T	0.06508	0.0167	N	0.19112	0.55	0.09310	N	1	B	0.28933	0.228	B	0.30855	0.121	T	0.34329	-0.9833	10	0.22109	T	0.4	-16.4237	6.8992	0.24273	0.1441:0.7143:0.0:0.1416	.	1211	A7MBM2	DISP2_HUMAN	A	1211	ENSP00000267889:P1211A	ENSP00000267889:P1211A	P	+	1	0	DISP2	38449236	0.540000	0.26410	0.808000	0.32385	0.929000	0.56500	1.201000	0.32259	2.868000	0.98415	0.555000	0.69702	CCT	DISP2	-	NULL	ENSG00000140323		0.667	DISP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DISP2	HGNC	protein_coding	OTTHUMT00000252249.1	16	0.00	0	C	NM_033510		40661944	40661944	+1	no_errors	ENST00000267889	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	0.082	G
ECE2	9718	genome.wustl.edu	37	3	184003269	184003269	+	Silent	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr3:184003269C>A	ENST00000402825.3	+	10	1506	c.1506C>A	c.(1504-1506)atC>atA	p.I502I	ECE2_ENST00000357474.5_Silent_p.I430I|ECE2_ENST00000404464.3_Silent_p.I384I|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000359140.4_Silent_p.I355I	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	502	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TTGTCAGCATCCTGAACAATT	0.527											OREG0015945	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													90.0	89.0	89.0					3																	184003269		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1506C>A	3.37:g.184003269C>A		Somatic	1988	WXS	Illumina GAIIx	Phase_IV	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Silent	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.I502	ENST00000402825.3	37	c.1506	CCDS3256.2	3																																																																																			ECE2	-	pfam_Peptidase_M13_N	ENSG00000145194		0.527	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	100	0.00	0	C	NM_014693		184003269	184003269	+1	no_errors	ENST00000402825	ensembl	human	known	69_37n	silent	154	20.62	40	SNP	0.204	A
EIF1AD	84285	genome.wustl.edu	37	11	65767848	65767848	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:65767848T>C	ENST00000312234.2	-	2	347	c.13A>G	c.(13-15)Acc>Gcc	p.T5A	EIF1AD_ENST00000527249.1_Missense_Mutation_p.T5A|BANF1_ENST00000533166.1_5'Flank|EIF1AD_ENST00000529964.1_Missense_Mutation_p.T5A|EIF1AD_ENST00000525767.1_Intron|EIF1AD_ENST00000533544.1_Missense_Mutation_p.T5A|EIF1AD_ENST00000526451.1_Missense_Mutation_p.T5A|BANF1_ENST00000527348.1_5'Flank|BANF1_ENST00000445560.2_5'Flank|BANF1_ENST00000312175.2_5'Flank	NM_001242481.1|NM_001242482.1|NM_001242483.1|NM_032325.3	NP_001229410.1|NP_001229411.1|NP_001229412.1|NP_115701.2	Q8N9N8	EIF1A_HUMAN	eukaryotic translation initiation factor 1A domain containing	5	S1-like. {ECO:0000255|PROSITE- ProRule:PRU00181}.					intermediate filament cytoskeleton (GO:0045111)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	translation initiation factor activity (GO:0003743)			lung(5)	5						TTCCTCTTGGTGGCCTGAGAC	0.572																																						dbGAP											0													98.0	74.0	82.0					11																	65767848		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK094129	CCDS8124.1	11q13.1	2009-05-27				ENSG00000175376			28147	protein-coding gene	gene with protein product						12477932	Standard	NM_001242482		Approved	MGC11102, haponin	uc001ogn.2	Q8N9N8		ENST00000312234.2:c.13A>G	11.37:g.65767848T>C	ENSP00000309175:p.Thr5Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4N5|Q9BSC1	Missense_Mutation	SNP	pfam_RNA-binding_domain_S1_IF1,superfamily_NA-bd_OB-fold-like,smart_TIF_eIF-1A,pfscan_RNA-binding_domain_S1_IF1	p.T5A	ENST00000312234.2	37	c.13	CCDS8124.1	11	.	.	.	.	.	.	.	.	.	.	T	21.1	4.103391	0.76983	.	.	ENSG00000175376	ENST00000526451;ENST00000312234;ENST00000529964;ENST00000533544;ENST00000527249;ENST00000530462;ENST00000532707;ENST00000527051	T;T;T;T;T;T;T;T	0.42131	0.98;0.98;0.98;0.98;0.98;0.98;0.98;0.98	5.09	5.09	0.68999	Nucleic acid-binding, OB-fold-like (1);RNA-binding domain, S1, IF1 type (1);Nucleic acid-binding, OB-fold (1);	0.054284	0.64402	D	0.000001	T	0.52741	0.1753	M	0.77103	2.36	0.53005	D	0.999965	D	0.53151	0.958	P	0.49799	0.622	T	0.56589	-0.7954	10	0.40728	T	0.16	.	12.8369	0.57777	0.0:0.0:0.0:1.0	.	5	Q8N9N8	EIF1A_HUMAN	A	5	ENSP00000436644:T5A;ENSP00000309175:T5A;ENSP00000435942:T5A;ENSP00000434056:T5A;ENSP00000435439:T5A;ENSP00000435891:T5A;ENSP00000433320:T5A;ENSP00000432135:T5A	ENSP00000309175:T5A	T	-	1	0	EIF1AD	65524424	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.693000	0.74582	1.927000	0.55829	0.459000	0.35465	ACC	EIF1AD	-	superfamily_NA-bd_OB-fold-like,pfscan_RNA-binding_domain_S1_IF1	ENSG00000175376		0.572	EIF1AD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF1AD	HGNC	protein_coding	OTTHUMT00000391072.1	112	0.00	0	T	NM_032325		65767848	65767848	-1	no_errors	ENST00000312234	ensembl	human	known	69_37n	missense	261	23.91	82	SNP	1.000	C
ELMO2	63916	genome.wustl.edu	37	20	45021783	45021783	+	Splice_Site	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr20:45021783C>A	ENST00000290246.6	-	6	387		c.e6-1		ELMO2_ENST00000445496.2_Splice_Site|ELMO2_ENST00000488853.1_Splice_Site|ELMO2_ENST00000396391.1_Splice_Site|ELMO2_ENST00000352077.2_Splice_Site|ELMO2_ENST00000372176.1_Splice_Site|ELMO2_ENST00000439931.2_Splice_Site	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2						apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				CACTGCGAGTCTGGGTAGTGA	0.328																																						dbGAP											0													74.0	77.0	76.0					20																	45021783		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.193-1G>T	20.37:g.45021783C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	Splice_Site	SNP	-	e4-1	ENST00000290246.6	37	c.193-1	CCDS13398.1	20	.	.	.	.	.	.	.	.	.	.	C	16.66	3.183877	0.57800	.	.	ENSG00000062598	ENST00000290246;ENST00000396391;ENST00000439931;ENST00000352077;ENST00000450812	.	.	.	4.89	4.89	0.63831	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.2215	0.86958	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ELMO2	44455190	1.000000	0.71417	0.985000	0.45067	0.585000	0.36419	7.303000	0.78871	2.537000	0.85549	0.491000	0.48974	.	ELMO2	-	-	ENSG00000062598		0.328	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELMO2	HGNC	protein_coding	OTTHUMT00000080466.1	193	0.00	0	C	NM_022086	Intron	45021783	45021783	-1	no_errors	ENST00000439931	ensembl	human	known	69_37n	splice_site	93	21.85	26	SNP	1.000	A
EMR2	30817	genome.wustl.edu	37	19	14884859	14884859	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr19:14884859G>A	ENST00000315576.3	-	4	541	c.90C>T	c.(88-90)gcC>gcT	p.A30A	EMR2_ENST00000353005.1_Silent_p.A30A|EMR2_ENST00000594294.1_Silent_p.A30A|EMR2_ENST00000594076.1_Silent_p.A30A|EMR2_ENST00000596991.2_Silent_p.A30A|EMR2_ENST00000601345.1_Silent_p.A30A|EMR2_ENST00000353876.1_Silent_p.A30A|EMR2_ENST00000392965.3_Silent_p.A30A|EMR2_ENST00000392964.3_5'Flank|EMR2_ENST00000346057.1_Silent_p.A30A|EMR2_ENST00000599423.1_5'UTR|EMR2_ENST00000392967.2_Silent_p.A30A|EMR2_ENST00000595839.1_Silent_p.A30A	NM_013447.3	NP_038475.2	Q9UHX3	EMR2_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 2	30	EGF-like 1. {ECO:0000255|PROSITE- ProRule:PRU00076}.				cell adhesion (GO:0007155)|cell migration (GO:0016477)|G-protein coupled receptor signaling pathway (GO:0007186)|granulocyte chemotaxis (GO:0071621)|inflammatory response (GO:0006954)|neuropeptide signaling pathway (GO:0007218)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)	48						GGCACCACCGGGCACAGCCTG	0.592																																						dbGAP											0													107.0	103.0	104.0					19																	14884859		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF114491	CCDS32935.1, CCDS59361.1	19p13.1	2014-08-08	2003-11-26			ENSG00000127507		"""CD molecules"", ""-"", ""GPCR / Class B : Orphans"""	3337	protein-coding gene	gene with protein product		606100	"""egf-like module containing, mucin-like, hormone receptor-like sequence 2"""				Standard	NM_013447		Approved	CD312	uc002mzp.2	Q9UHX3		ENST00000315576.3:c.90C>T	19.37:g.14884859G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DQ96|E7ESD7|E9PBR1|E9PEL6|E9PFQ5|E9PG91|Q8NG96|Q9Y4B1	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_EGF-like_Ca-bd,pfam_GPS_dom,pfam_EGF-like_dom,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,prints_GPCR_2_CD97,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like	p.A30	ENST00000315576.3	37	c.90	CCDS32935.1	19																																																																																			EMR2	-	smart_EGF-like,prints_GPCR_2_CD97	ENSG00000127507		0.592	EMR2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	EMR2	HGNC	protein_coding	OTTHUMT00000466502.2	106	0.00	0	G			14884859	14884859	-1	no_errors	ENST00000315576	ensembl	human	known	69_37n	silent	318	22.89	95	SNP	0.000	A
ABHD17C	58489	genome.wustl.edu	37	15	81046555	81046555	+	Silent	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr15:81046555C>A	ENST00000258884.4	+	3	961	c.834C>A	c.(832-834)gtC>gtA	p.V278V	ABHD17C_ENST00000559506.1_3'UTR|ABHD17C_ENST00000560609.1_Silent_p.V43V|ABHD17C_ENST00000558464.1_Silent_p.V244V	NM_021214.1	NP_067037.1	Q6PCB6	AB17C_HUMAN	abhydrolase domain containing 17C	278							hydrolase activity (GO:0016787)										AGGATGAGGTCATCGATTTCT	0.517																																						dbGAP											0													85.0	82.0	83.0					15																	81046555		1962	4150	6112	-	-	-	SO:0001819	synonymous_variant	0				CCDS45323.1	15q25.1	2013-03-15	2013-03-15	2013-03-15	ENSG00000136379	ENSG00000136379		"""Abhydrolase domain containing"""	26925	protein-coding gene	gene with protein product			"""family with sequence similarity 108, member C1"""	FAM108C1			Standard	NM_021214		Approved		uc002bfu.3	Q6PCB6		ENST00000258884.4:c.834C>A	15.37:g.81046555C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1RMD6|Q9NPM1	Silent	SNP	pfam_Peptidase_S9,pfam_Dienelactn_hydro	p.V278	ENST00000258884.4	37	c.834	CCDS45323.1	15																																																																																			FAM108C1	-	pfam_Peptidase_S9,pfam_Dienelactn_hydro	ENSG00000136379		0.517	ABHD17C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM108C1	HGNC	protein_coding	OTTHUMT00000417652.1	92	0.00	0	C	NM_021214		81046555	81046555	+1	no_errors	ENST00000258884	ensembl	human	known	69_37n	silent	140	25.13	47	SNP	1.000	A
FAM13B	51306	genome.wustl.edu	37	5	137284667	137284667	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr5:137284667T>C	ENST00000033079.3	-	17	2522	c.2071A>G	c.(2071-2073)Agg>Ggg	p.R691G	FAM13B_ENST00000425075.2_Missense_Mutation_p.R595G|FAM13B_ENST00000420893.2_Missense_Mutation_p.R691G	NM_016603.2	NP_057687.2	Q9NYF5	FA13B_HUMAN	family with sequence similarity 13, member B	691					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)			endometrium(4)|kidney(2)|lung(5)	11						GGAAGACACCTCTCAATACGT	0.353																																						dbGAP											0													119.0	120.0	119.0					5																	137284667		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251038	CCDS4195.1, CCDS47269.1, CCDS47270.1	5q31	2011-09-07	2009-01-20	2009-01-20	ENSG00000031003	ENSG00000031003		"""Rho GTPase activating proteins"""	1335	protein-coding gene	gene with protein product		609371	"""chromosome 5 open reading frame 5"", ""family with sequence similarity 13, member B1"""	C5orf5, FAM13B1		11087669, 11161817	Standard	NM_016603		Approved	N61, KHCHP, ARHGAP49	uc003lbz.2	Q9NYF5	OTTHUMG00000129202	ENST00000033079.3:c.2071A>G	5.37:g.137284667T>C	ENSP00000033079:p.Arg691Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQB5|G3V0H9|Q3ZCR0|Q6PGQ2|Q9P0I7	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R691G	ENST00000033079.3	37	c.2071	CCDS4195.1	5	.	.	.	.	.	.	.	.	.	.	T	14.62	2.588599	0.46110	.	.	ENSG00000031003	ENST00000033079;ENST00000425075;ENST00000420893	T;T;T	0.23754	3.08;1.89;3.01	5.02	2.53	0.30540	.	0.285236	0.37304	N	0.002141	T	0.20861	0.0502	L	0.28274	0.84	0.34182	D	0.67106	B;P;B	0.51351	0.452;0.944;0.323	B;P;B	0.47402	0.164;0.546;0.079	T	0.20773	-1.0265	10	0.20519	T	0.43	-7.0185	11.7157	0.51653	0.0:0.0:0.2911:0.7089	.	595;691;691	G3V0H9;Q9NYF5-2;Q9NYF5	.;.;FA13B_HUMAN	G	691;595;691	ENSP00000033079:R691G;ENSP00000394669:R595G;ENSP00000388521:R691G	ENSP00000033079:R691G	R	-	1	2	FAM13B	137312566	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.842000	0.55858	0.317000	0.23160	0.524000	0.50904	AGG	FAM13B	-	NULL	ENSG00000031003		0.353	FAM13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM13B	HGNC	protein_coding	OTTHUMT00000251279.1	205	0.00	0	T			137284667	137284667	-1	no_errors	ENST00000033079	ensembl	human	known	69_37n	missense	103	31.79	48	SNP	0.997	C
FAM183B	340286	genome.wustl.edu	37	7	38725521	38725521	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr7:38725521G>A	ENST00000409072.3	-	2	1019	c.85C>T	c.(85-87)Cga>Tga	p.R29*				Q6ZVS7	F183B_HUMAN	family with sequence similarity 183, member B	29										endometrium(1)|lung(7)	8						TTCTGGGTTCGTAACTCTTTG	0.542																																						dbGAP											0													104.0	108.0	106.0					7																	38725521		1960	4150	6110	-	-	-	SO:0001587	stop_gained	0			AK124132, BC045803		7p14.1	2008-08-11			ENSG00000164556	ENSG00000164556			34511	protein-coding gene	gene with protein product							Standard	NR_028347		Approved	LOC340286	uc011kbd.2	Q6ZVS7	OTTHUMG00000153653	ENST00000409072.3:c.85C>T	7.37:g.38725521G>A	ENSP00000386657:p.Arg29*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Y1	Nonsense_Mutation	SNP	NULL	p.R29*	ENST00000409072.3	37	c.85		7	.	.	.	.	.	.	.	.	.	.	G	41	8.909523	0.98998	.	.	ENSG00000164556	ENST00000409072	.	.	.	1.03	-0.304	0.12788	.	0.647597	0.13854	N	0.358151	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	3.6315	0.08133	0.3221:0.0:0.6779:0.0	.	.	.	.	X	29	.	ENSP00000386657:R29X	R	-	1	2	FAM183B	38692046	0.821000	0.29204	0.337000	0.25536	0.338000	0.28826	1.423000	0.34837	-0.384000	0.07845	-0.373000	0.07131	CGA	FAM183B	-	NULL	ENSG00000164556		0.542	FAM183B-001	NOVEL	basic|appris_principal	protein_coding	FAM183B	HGNC	protein_coding	OTTHUMT00000331972.1	114	0.00	0	G	NM_001105282		38725521	38725521	-1	no_errors	ENST00000409072	ensembl	human	novel	69_37n	nonsense	112	29.38	47	SNP	0.505	A
TVP23C	201158	genome.wustl.edu	37	17	15450400	15450400	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr17:15450400C>G	ENST00000225576.3	-	4	398	c.303G>C	c.(301-303)aaG>aaC	p.K101N	TVP23C_ENST00000519970.1_Missense_Mutation_p.K15N|TVP23C_ENST00000584811.1_Missense_Mutation_p.K37N|TVP23C_ENST00000428082.2_Missense_Mutation_p.K101N|TVP23C_ENST00000438826.3_Missense_Mutation_p.K101N|TVP23C-CDRT4_ENST00000522212.2_Missense_Mutation_p.K101N|TVP23C_ENST00000518321.1_Missense_Mutation_p.K101N	NM_145301.2	NP_660344.2	Q96ET8	TV23C_HUMAN	trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)	101						integral component of membrane (GO:0016021)											CCCAATGGCTCTTTCCATCTT	0.333																																						dbGAP											0													15.0	17.0	17.0					17																	15450400		1921	4106	6027	-	-	-	SO:0001583	missense	0			BC011952	CCDS11170.1, CCDS45617.1	17p12	2012-11-29	2012-11-29	2012-11-29	ENSG00000175106	ENSG00000175106			30453	protein-coding gene	gene with protein product			"""family with sequence similarity 18, member B2"""	FAM18B2			Standard	NM_001135036		Approved	MGC8763	uc002goq.2	Q96ET8	OTTHUMG00000171461	ENST00000225576.3:c.303G>C	17.37:g.15450400C>G	ENSP00000225576:p.Lys101Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LIC7	Missense_Mutation	SNP	pfam_DUF846_euk	p.K101N	ENST00000225576.3	37	c.303	CCDS11170.1	17	.	.	.	.	.	.	.	.	.	.	.	12.26	1.885777	0.33255	.	.	ENSG00000259024;ENSG00000259024;ENSG00000259024;ENSG00000175106;ENSG00000175106;ENSG00000175106;ENSG00000175106;ENSG00000175106	ENST00000522212;ENST00000557349;ENST00000481756;ENST00000519970;ENST00000225576;ENST00000428082;ENST00000438826;ENST00000419890	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	4.68	3.66	0.41972	.	0.125135	0.53938	D	0.000042	T	0.48241	0.1489	L	0.41632	1.29	0.41198	D	0.986358	D;D;D;D	0.71674	0.973;0.998;0.973;0.997	D;D;P;D	0.76575	0.913;0.988;0.877;0.982	T	0.41070	-0.9529	10	0.33141	T	0.24	.	6.1336	0.20219	0.0:0.6991:0.0:0.3009	.	101;15;101;101	Q96ET8-2;B4E0Q0;Q96ET8-3;Q96ET8	.;.;.;F18B2_HUMAN	N	101;15;15;15;101;101;101;37	ENSP00000429865:K101N;ENSP00000428961:K15N;ENSP00000225576:K101N;ENSP00000406387:K101N;ENSP00000413355:K101N;ENSP00000409988:K37N	ENSP00000225576:K101N	K	-	3	2	RP11-726O12.1;FAM18B2	15391125	0.999000	0.42202	1.000000	0.80357	0.973000	0.67179	0.676000	0.25247	0.938000	0.37419	0.557000	0.71058	AAG	FAM18B2	-	pfam_DUF846_euk	ENSG00000175106		0.333	TVP23C-001	KNOWN	basic|CCDS	protein_coding	FAM18B2	HGNC	protein_coding	OTTHUMT00000130705.2	260	0.00	0	C	NM_145301		15450400	15450400	-1	no_errors	ENST00000225576	ensembl	human	known	69_37n	missense	94	40.13	63	SNP	1.000	G
FAM65B	9750	genome.wustl.edu	37	6	24850064	24850064	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr6:24850064C>G	ENST00000259698.4	-	11	1088	c.913G>C	c.(913-915)Ggt>Cgt	p.G305R	FAM65B_ENST00000510784.2_Missense_Mutation_p.G339R|FAM65B_ENST00000378023.4_Missense_Mutation_p.G305R|FAM65B_ENST00000538035.1_Missense_Mutation_p.G334R|FAM65B_ENST00000540914.1_Missense_Mutation_p.G305R	NM_014722.2	NP_055537.2	Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	305					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						TTGATGGTACCAAGGTCATTG	0.473																																						dbGAP											0													213.0	222.0	219.0					6																	24850064		2133	4273	6406	-	-	-	SO:0001583	missense	0			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000259698.4:c.913G>C	6.37:g.24850064C>G	ENSP00000259698:p.Gly305Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.G305R	ENST00000259698.4	37	c.913	CCDS47383.1	6	.	.	.	.	.	.	.	.	.	.	C	32	5.131500	0.94473	.	.	ENSG00000111913	ENST00000259698;ENST00000538035;ENST00000378023;ENST00000540914;ENST00000510784	T;T;T;T;T	0.03330	3.97;3.97;3.97;3.97;3.97	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	T	0.15696	0.0378	M	0.81802	2.56	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.00617	-1.1642	10	0.87932	D	0	-32.9234	19.9403	0.97159	0.0:1.0:0.0:0.0	.	339;334;305;305	B7Z6U4;F5GX51;Q9Y4F9-2;Q9Y4F9	.;.;.;FA65B_HUMAN	R	305;334;305;305;339	ENSP00000259698:G305R;ENSP00000441138:G334R;ENSP00000367262:G305R;ENSP00000438425:G305R;ENSP00000441305:G339R	ENSP00000259698:G305R	G	-	1	0	FAM65B	24958043	1.000000	0.71417	0.998000	0.56505	0.982000	0.71751	7.487000	0.81328	2.712000	0.92718	0.650000	0.86243	GGT	FAM65B	-	NULL	ENSG00000111913		0.473	FAM65B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM65B	HGNC	protein_coding	OTTHUMT00000040024.2	85	0.00	0	C			24850064	24850064	-1	no_errors	ENST00000259698	ensembl	human	known	69_37n	missense	160	29.52	67	SNP	1.000	G
FAM71A	149647	genome.wustl.edu	37	1	212798330	212798330	+	Silent	SNP	C	C	T	rs201256590		TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:212798330C>T	ENST00000294829.3	+	1	542	c.111C>T	c.(109-111)taC>taT	p.Y37Y	RP11-338C15.5_ENST00000427949.1_RNA	NM_153606.3	NP_705834.2	Q8IYT1	FA71A_HUMAN	family with sequence similarity 71, member A	37						nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(7)|liver(1)|lung(12)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				OV - Ovarian serous cystadenocarcinoma(81;0.00631)|all cancers(67;0.00981)|GBM - Glioblastoma multiforme(131;0.0715)|Epithelial(68;0.094)		AGGGGGAGTACGATATATTCA	0.483													T|||	1	0.000199681	0.0	0.0014	5008	,	,		22074	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													158.0	143.0	148.0					1																	212798330		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1507.1	1q32.3	2008-02-05			ENSG00000162771	ENSG00000162771			26541	protein-coding gene	gene with protein product						12477932	Standard	NM_153606		Approved	FLJ32796	uc010pth.1	Q8IYT1	OTTHUMG00000041084	ENST00000294829.3:c.111C>T	1.37:g.212798330C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTZ1	Silent	SNP	pfam_DUF3699	p.Y37	ENST00000294829.3	37	c.111	CCDS1507.1	1																																																																																			FAM71A	-	NULL	ENSG00000162771		0.483	FAM71A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71A	HGNC	protein_coding	OTTHUMT00000098529.1	72	0.00	0	C	NM_153606		212798330	212798330	+1	no_errors	ENST00000294829	ensembl	human	known	69_37n	silent	241	17.75	52	SNP	0.030	T
FAM96A	84191	genome.wustl.edu	37	15	64367694	64367694	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr15:64367694C>G	ENST00000300030.3	-	4	631	c.382G>C	c.(382-384)Gac>Cac	p.D128H	FAM96A_ENST00000557835.1_3'UTR|FAM96A_ENST00000558779.1_5'Flank|FAM96A_ENST00000380290.3_3'UTR|FAM96A_ENST00000559950.1_Missense_Mutation_p.D128H	NM_032231.4	NP_115607.1	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A	128					chromosome segregation (GO:0007059)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						CACTTACTGTCTTCTTCTGTT	0.338																																						dbGAP											0													130.0	126.0	128.0					15																	64367694		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10189.1, CCDS45278.1	15q22.31	2014-01-16			ENSG00000166797	ENSG00000166797			26235	protein-coding gene	gene with protein product						23891004	Standard	NM_032231		Approved	FLJ22875	uc002amt.1	Q9H5X1	OTTHUMG00000132961	ENST00000300030.3:c.382G>C	15.37:g.64367694C>G	ENSP00000300030:p.Asp128His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKS1|B2R5F8|B7Z8Z5	Missense_Mutation	SNP	pfam_DUF59	p.D128H	ENST00000300030.3	37	c.382	CCDS10189.1	15	.	.	.	.	.	.	.	.	.	.	C	21.3	4.130290	0.77549	.	.	ENSG00000166797	ENST00000300030	.	.	.	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.63355	0.2504	N	0.19112	0.55	0.58432	D	0.999991	D	0.89917	1.0	D	0.83275	0.996	T	0.67405	-0.5679	9	0.54805	T	0.06	.	15.8396	0.78835	0.0:1.0:0.0:0.0	.	128	Q9H5X1	FA96A_HUMAN	H	128	.	ENSP00000300030:D128H	D	-	1	0	FAM96A	62154747	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	6.664000	0.74437	2.318000	0.78349	0.650000	0.86243	GAC	FAM96A	-	NULL	ENSG00000166797		0.338	FAM96A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM96A	HGNC	protein_coding	OTTHUMT00000256520.1	471	0.00	0	C	NM_032231		64367694	64367694	-1	no_errors	ENST00000300030	ensembl	human	known	69_37n	missense	184	33.57	93	SNP	1.000	G
FBN2	2201	genome.wustl.edu	37	5	127686601	127686601	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr5:127686601A>T	ENST00000508053.1	-	27	3745	c.2771T>A	c.(2770-2772)cTc>cAc	p.L924H	FBN2_ENST00000262464.4_Missense_Mutation_p.L924H|FBN2_ENST00000508989.1_Missense_Mutation_p.L891H			P35556	FBN2_HUMAN	fibrillin 2	924	TB 4.				anatomical structure morphogenesis (GO:0009653)|bone trabecula formation (GO:0060346)|embryonic limb morphogenesis (GO:0030326)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|sequestering of TGFbeta in extracellular matrix (GO:0035583)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(37)|liver(1)|lung(89)|ovary(9)|pancreas(2)|prostate(6)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	197		all_cancers(142;0.0216)|Prostate(80;0.0551)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0821)|Epithelial(69;0.146)		GGCGGCTCCGAGGGTGGCACA	0.562																																						dbGAP											0													60.0	62.0	61.0					5																	127686601		2203	4300	6503	-	-	-	SO:0001583	missense	0			U03272	CCDS34222.1	5q23-q31	2008-08-01	2008-08-01			ENSG00000138829			3604	protein-coding gene	gene with protein product	"""fibrillin 5"""	612570	"""congenital contractural arachnodactyly"""	CCA		1852206, 8120105	Standard	NM_001999		Approved	DA9	uc003kuu.3	P35556		ENST00000508053.1:c.2771T>A	5.37:g.127686601A>T	ENSP00000424571:p.Leu924His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU01|Q59ES6	Missense_Mutation	SNP	pirsf_Fibrillin,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Cadherin-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.L924H	ENST00000508053.1	37	c.2771	CCDS34222.1	5	.	.	.	.	.	.	.	.	.	.	A	15.83	2.950130	0.53186	.	.	ENSG00000138829	ENST00000262464;ENST00000508053;ENST00000508989	D;D;D	0.93659	-3.26;-3.26;-3.26	3.81	3.81	0.43845	Matrix fibril-associated (3);TGF-beta binding (1);	0.000000	0.42294	D	0.000736	D	0.96787	0.8951	M	0.88450	2.955	0.45452	D	0.998424	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.97007	0.9733	10	0.54805	T	0.06	.	13.6404	0.62246	1.0:0.0:0.0:0.0	.	891;924	D6RJI3;P35556	.;FBN2_HUMAN	H	924;924;891	ENSP00000262464:L924H;ENSP00000424571:L924H;ENSP00000425596:L891H	ENSP00000262464:L924H	L	-	2	0	FBN2	127714500	1.000000	0.71417	0.046000	0.18839	0.185000	0.23345	9.084000	0.94076	1.950000	0.56595	0.533000	0.62120	CTC	FBN2	-	pirsf_Fibrillin,pfam_TB_dom,superfamily_TB_dom	ENSG00000138829		0.562	FBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN2	HGNC	protein_coding	OTTHUMT00000371618.2	102	0.00	0	A	NM_001999		127686601	127686601	-1	no_errors	ENST00000262464	ensembl	human	known	69_37n	missense	53	33.33	27	SNP	0.877	T
FGD6	55785	genome.wustl.edu	37	12	95603690	95603690	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr12:95603690T>A	ENST00000343958.4	-	2	1593	c.1370A>T	c.(1369-1371)aAg>aTg	p.K457M	FGD6_ENST00000546711.1_Missense_Mutation_p.K457M|FGD6_ENST00000550368.1_5'Flank|FGD6_ENST00000549499.1_Missense_Mutation_p.K457M	NM_018351.3	NP_060821.3	Q6ZV73	FGD6_HUMAN	FYVE, RhoGEF and PH domain containing 6	457					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(3)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(14)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	56						TTTGAGCTGCTTAGGCAGGCT	0.418																																						dbGAP											0													90.0	90.0	90.0					12																	95603690		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037783	CCDS31878.1	12q23.1	2013-01-10				ENSG00000180263		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	21740	protein-coding gene	gene with protein product		613520					Standard	NM_018351		Approved	ZFYVE24, FLJ11183	uc001tdp.4	Q6ZV73	OTTHUMG00000170133	ENST00000343958.4:c.1370A>T	12.37:g.95603690T>A	ENSP00000344446:p.Lys457Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZR53|Q7Z2Z7|Q96D44|Q9NUR8|Q9P2I5	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.K457M	ENST00000343958.4	37	c.1370	CCDS31878.1	12	.	.	.	.	.	.	.	.	.	.	T	16.45	3.127262	0.56721	.	.	ENSG00000180263	ENST00000343958;ENST00000546711;ENST00000549499	T;T;T	0.75477	-0.85;-0.94;-0.89	6.04	3.5	0.40072	.	0.128383	0.35646	N	0.003080	D	0.82287	0.5004	M	0.64997	1.995	0.41401	D	0.987679	D	0.76494	0.999	D	0.64042	0.921	D	0.84699	0.0727	10	0.87932	D	0	-16.2209	14.1588	0.65434	0.0:0.0:0.2462:0.7538	.	457	Q6ZV73	FGD6_HUMAN	M	457	ENSP00000344446:K457M;ENSP00000450342:K457M;ENSP00000449005:K457M	ENSP00000344446:K457M	K	-	2	0	FGD6	94127821	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.908000	0.56355	1.073000	0.40885	0.459000	0.35465	AAG	FGD6	-	NULL	ENSG00000180263		0.418	FGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD6	HGNC	protein_coding	OTTHUMT00000407600.1	109	0.00	0	T	NM_018351		95603690	95603690	-1	no_errors	ENST00000343958	ensembl	human	known	69_37n	missense	59	35.87	33	SNP	0.998	A
FHOD3	80206	genome.wustl.edu	37	18	34298590	34298590	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr18:34298590T>G	ENST00000359247.4	+	15	2753	c.2753T>G	c.(2752-2754)cTg>cGg	p.L918R	FHOD3_ENST00000257209.4_Missense_Mutation_p.L935R|FHOD3_ENST00000592128.1_5'UTR|FHOD3_ENST00000445677.1_Missense_Mutation_p.L897R|FHOD3_ENST00000591635.1_Missense_Mutation_p.L131R|FHOD3_ENST00000590592.1_Missense_Mutation_p.L1110R	NM_001281739.1	NP_001268668.1	Q2V2M9	FHOD3_HUMAN	formin homology 2 domain containing 3	918	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				actin filament network formation (GO:0051639)|cardiac myofibril assembly (GO:0055003)|negative regulation of actin filament polymerization (GO:0030837)|sarcomere organization (GO:0045214)	striated muscle thin filament (GO:0005865)				NS(1)|breast(5)|central_nervous_system(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|liver(2)|lung(29)|ovary(3)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)	90		all_epithelial(2;0.0181)|Colorectal(2;0.0195)				AGAGAATTCCTGTGGTCAAAA	0.458																																						dbGAP											0													140.0	143.0	142.0					18																	34298590		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK091899	CCDS32816.1, CCDS62418.1, CCDS62419.1	18q12	2007-08-02				ENSG00000134775			26178	protein-coding gene	gene with protein product		609691				11214970	Standard	NM_025135		Approved	FHOS2, KIAA1695, FLJ22297, FLJ22717	uc021uiv.1	Q2V2M9		ENST00000359247.4:c.2753T>G	18.37:g.34298590T>G	ENSP00000352186:p.Leu918Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQT4|E5F5Q0|Q642I2|Q6ZRQ7|Q86TF9|Q8N3A5|Q9C0G8|Q9H604|Q9H6G7	Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,superfamily_ARM-type_fold,smart_Actin-bd_FH2/DRF_autoreg	p.L935R	ENST00000359247.4	37	c.2804		18	.	.	.	.	.	.	.	.	.	.	T	19.78	3.892001	0.72524	.	.	ENSG00000134775	ENST00000257209;ENST00000359247;ENST00000445677	T;T;T	0.22743	1.94;1.94;1.94	4.46	4.46	0.54185	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.168840	0.40818	N	0.001008	T	0.43942	0.1270	M	0.71206	2.165	0.80722	D	1	D;D;D	0.76494	0.998;0.999;0.993	D;D;D	0.72982	0.965;0.979;0.921	T	0.44483	-0.9325	10	0.87932	D	0	.	12.5695	0.56328	0.0:0.0:0.0:1.0	.	897;918;935	Q2V2M9-2;Q2V2M9;Q2V2M9-3	.;FHOD3_HUMAN;.	R	935;918;897	ENSP00000257209:L935R;ENSP00000352186:L918R;ENSP00000411430:L897R	ENSP00000257209:L935R	L	+	2	0	FHOD3	32552588	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.004000	0.88535	1.654000	0.50703	0.454000	0.30748	CTG	FHOD3	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	ENSG00000134775		0.458	FHOD3-001	PUTATIVE	basic	protein_coding	FHOD3	HGNC	protein_coding	OTTHUMT00000460884.1	110	0.00	0	T	XM_371114		34298590	34298590	+1	no_errors	ENST00000257209	ensembl	human	known	69_37n	missense	114	37.36	68	SNP	1.000	G
FOXO4	4303	genome.wustl.edu	37	X	70316804	70316804	+	Silent	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:70316804T>A	ENST00000374259.3	+	1	758	c.426T>A	c.(424-426)ggT>ggA	p.G142G	FOXO4_ENST00000466874.1_3'UTR|FOXO4_ENST00000341558.3_Silent_p.G87G	NM_001170931.1|NM_005938.3	NP_001164402.1|NP_005929.2	P98177	FOXO4_HUMAN	forkhead box O4	142					cell cycle arrest (GO:0007050)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|mitotic G2 DNA damage checkpoint (GO:0007095)|muscle organ development (GO:0007517)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of smooth muscle cell differentiation (GO:0051151)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|stem cell differentiation (GO:0048863)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)	18	Renal(35;0.156)					AGGACAAGGGTGACAGCAACA	0.537																																						dbGAP											0													56.0	53.0	54.0					X																	70316804		2194	4295	6489	-	-	-	SO:0001819	synonymous_variant	0				CCDS43969.1, CCDS55440.1	Xq13.1	2008-02-05	2007-05-02	2007-05-02	ENSG00000184481	ENSG00000184481		"""Forkhead boxes"""	7139	protein-coding gene	gene with protein product		300033	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 7"", ""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 7"""	MLLT7		7529552	Standard	NM_005938		Approved	AFX1	uc004dys.2	P98177	OTTHUMG00000021789	ENST00000374259.3:c.426T>A	X.37:g.70316804T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7WPJ7|O43821|Q13720|Q3KPF1|Q8TDK9	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.G142	ENST00000374259.3	37	c.426	CCDS43969.1	X																																																																																			FOXO4	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head	ENSG00000184481		0.537	FOXO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXO4	HGNC	protein_coding	OTTHUMT00000057115.1	74	0.00	0	T	NM_005938		70316804	70316804	+1	no_errors	ENST00000374259	ensembl	human	known	69_37n	silent	96	28.06	39	SNP	1.000	A
FMR1	2332	genome.wustl.edu	37	X	147014261	147014261	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:147014261C>G	ENST00000370475.4	+	9	987	c.859C>G	c.(859-861)Caa>Gaa	p.Q287E	FMR1_ENST00000370471.3_Missense_Mutation_p.Q287E|FMR1_ENST00000439526.2_Missense_Mutation_p.Q287E|FMR1_ENST00000334557.6_Missense_Mutation_p.Q287E|FMR1_ENST00000440235.2_5'UTR|FMR1_ENST00000370477.1_Missense_Mutation_p.Q287E|FMR1_ENST00000370470.1_Missense_Mutation_p.Q287E|FMR1_ENST00000218200.8_Missense_Mutation_p.Q287E	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1	287	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					AGATGTAATACAAGTTCCAAG	0.333									Fragile X syndrome																													dbGAP											0													65.0	63.0	63.0					X																	147014261		2202	4299	6501	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.859C>G	X.37:g.147014261C>G	ENSP00000359506:p.Gln287Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	Missense_Mutation	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet,smart_KH_dom,pfscan_KH_dom_type_1	p.Q287E	ENST00000370475.4	37	c.859	CCDS14682.1	X	.	.	.	.	.	.	.	.	.	.	C	15.33	2.800746	0.50315	.	.	ENSG00000102081	ENST00000218200;ENST00000370471;ENST00000370477;ENST00000370475;ENST00000334557;ENST00000439526;ENST00000370470	T;T;T;T;T;T;T	0.37584	1.62;1.62;1.62;1.62;1.48;1.19;1.62	5.85	5.85	0.93711	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.144082	0.64402	D	0.000006	T	0.36248	0.0960	L	0.45352	1.415	0.80722	D	1	B;P;B;B;B	0.35468	0.178;0.503;0.156;0.264;0.141	B;B;B;B;B	0.37943	0.103;0.261;0.113;0.108;0.073	T	0.05971	-1.0853	10	0.27082	T	0.32	-21.4178	17.9846	0.89152	0.0:1.0:0.0:0.0	.	287;287;203;287;287	Q8IXW7;Q06787;Q59GC1;Q06787-8;G3V0J0	.;FMR1_HUMAN;.;.;.	E	287	ENSP00000218200:Q287E;ENSP00000359502:Q287E;ENSP00000359508:Q287E;ENSP00000359506:Q287E;ENSP00000355115:Q287E;ENSP00000395923:Q287E;ENSP00000359501:Q287E	ENSP00000218200:Q287E	Q	+	1	0	FMR1	146821953	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.772000	0.62324	2.469000	0.83416	0.538000	0.68166	CAA	FMR1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1	ENSG00000102081		0.333	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	150	0.00	0	C	NM_002024		147014261	147014261	+1	no_errors	ENST00000370475	ensembl	human	known	69_37n	missense	107	23.02	32	SNP	1.000	G
GALNT13	114805	genome.wustl.edu	37	2	155265555	155265555	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:155265555A>T	ENST00000392825.3	+	11	1923	c.1356A>T	c.(1354-1356)aaA>aaT	p.K452N	GALNT13_ENST00000409237.1_Missense_Mutation_p.K452N|GALNT13_ENST00000487047.1_3'UTR	NM_052917.2	NP_443149.2	Q8IUC8	GLT13_HUMAN	polypeptide N-acetylgalactosaminyltransferase 13	452	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			NS(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(6)|lung(37)|ovary(3)|pancreas(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	65						AAAATGAAAAAGTGGGTATAT	0.363																																						dbGAP											0													125.0	124.0	124.0					2																	155265555		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067505	CCDS2199.1	2q24.1	2014-03-13	2014-03-13		ENSG00000144278	ENSG00000144278	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	23242	protein-coding gene	gene with protein product	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13"", ""polypeptide GalNAc transferase 13"""	608369	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 13 (GalNAc-T13)"""			11572484, 12407114	Standard	XM_005246267		Approved	KIAA1918, GalNAc-T13	uc002tyr.4	Q8IUC8	OTTHUMG00000131917	ENST00000392825.3:c.1356A>T	2.37:g.155265555A>T	ENSP00000376570:p.Lys452Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08ER7|Q68VI8|Q6ZWG1|Q96PX0|Q9UIE5	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.K452N	ENST00000392825.3	37	c.1356	CCDS2199.1	2	.	.	.	.	.	.	.	.	.	.	A	17.42	3.384200	0.61845	.	.	ENSG00000144278	ENST00000392825;ENST00000409237;ENST00000422126	T;T	0.26223	1.75;1.75	5.32	5.32	0.75619	Ricin B-related lectin (1);Ricin B lectin (3);	0.045785	0.85682	D	0.000000	T	0.17365	0.0417	N	0.20766	0.605	0.80722	D	1	B;B;B;B	0.24258	0.082;0.1;0.011;0.045	B;B;B;B	0.26202	0.023;0.059;0.058;0.067	T	0.09100	-1.0690	10	0.17832	T	0.49	.	13.5212	0.61569	1.0:0.0:0.0:0.0	.	452;452;452;452	Q8IUC8-2;B3KY85;Q08ER7;Q8IUC8	.;.;.;GLT13_HUMAN	N	452;452;11	ENSP00000376570:K452N;ENSP00000387239:K452N	ENSP00000376570:K452N	K	+	3	2	GALNT13	154973801	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.953000	0.56699	2.142000	0.66516	0.528000	0.53228	AAA	GALNT13	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000144278		0.363	GALNT13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT13	HGNC	protein_coding	OTTHUMT00000254870.2	274	0.00	0	A	NM_052917		155265555	155265555	+1	no_errors	ENST00000409237	ensembl	human	known	69_37n	missense	201	25.74	70	SNP	1.000	T
GPRIN2	9721	genome.wustl.edu	37	10	46999151	46999151	+	Missense_Mutation	SNP	T	T	C	rs3127820	byFrequency	TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr10:46999151T>C	ENST00000374317.1	+	3	544	c.271T>C	c.(271-273)Tgg>Cgg	p.W91R	GPRIN2_ENST00000374314.4_Missense_Mutation_p.W91R	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	91			W -> R (in dbSNP:rs3127820). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:9628581}.							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						AGGCCACTGGTGGAGCAGCAC	0.667																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.271T>C	10.37:g.46999151T>C	ENSP00000363436:p.Trp91Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SVF0	Missense_Mutation	SNP	NULL	p.W91R	ENST00000374317.1	37	c.271	CCDS31192.1	10	.	.	.	.	.	.	.	.	.	.	C	1.236	-0.622628	0.03636	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.02787	4.16;4.16	5.47	1.98	0.26296	.	0.168204	0.28219	N	0.016148	T	0.00637	0.0021	N	0.00138	-2.015	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.46884	-0.9159	10	0.02654	T	1	-11.6103	6.6474	0.22943	0.5496:0.3615:0.0:0.0888	rs3127820;rs9422225	91	O60269	GRIN2_HUMAN	R	91	ENSP00000363436:W91R;ENSP00000363433:W91R	ENSP00000363433:W91R	W	+	1	0	GPRIN2	46419157	0.000000	0.05858	0.997000	0.53966	0.921000	0.55340	-0.664000	0.05292	0.330000	0.23485	-0.128000	0.14901	TGG	GPRIN2	-	NULL	ENSG00000204175		0.667	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	9	0.00	0	T	NM_014696		46999151	46999151	+1	no_errors	ENST00000374314	ensembl	human	known	69_37n	missense	20	37.50	12	SNP	0.588	C
ICA1L	130026	genome.wustl.edu	37	2	203661619	203661619	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:203661619C>G	ENST00000392237.2	-	11	1136	c.979G>C	c.(979-981)Gaa>Caa	p.E327Q	ICA1L_ENST00000358299.2_Missense_Mutation_p.E327Q	NM_138468.4	NP_612477.3	Q8NDH6	ICA1L_HUMAN	islet cell autoantigen 1,69kDa-like	327										breast(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22						TTACCATTTTCAGAGTTAGAA	0.284																																						dbGAP											0													75.0	72.0	73.0					2																	203661619		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB053317	CCDS2354.1, CCDS74632.1	2q33	2008-02-05	2006-05-26	2006-05-26	ENSG00000163596	ENSG00000163596			14442	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 15"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 14"""	ALS2CR15, ALS2CR14		11586298	Standard	NM_138468		Approved		uc002uzh.1	Q8NDH6	OTTHUMG00000132856	ENST00000392237.2:c.979G>C	2.37:g.203661619C>G	ENSP00000376070:p.Glu327Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRW6|Q53P45|Q53QZ4|Q53T97|Q96N47|Q96Q32|Q9BVQ2	Missense_Mutation	SNP	pfam_Islet_autoAg_Ica1_C,pfam_Arfaptin_homology_dom,pfscan_Arfaptin_homology_dom	p.E327Q	ENST00000392237.2	37	c.979	CCDS2354.1	2	.	.	.	.	.	.	.	.	.	.	c	11.18	1.561541	0.27915	.	.	ENSG00000163596	ENST00000392237;ENST00000358299	.	.	.	3.65	3.65	0.41850	Islet cell autoantigen Ica1, C-terminal (1);	0.277460	0.34110	N	0.004259	T	0.54983	0.1892	M	0.63428	1.95	0.80722	D	1	B	0.18610	0.029	B	0.15870	0.014	T	0.51403	-0.8710	9	0.19147	T	0.46	.	11.208	0.48782	0.0:1.0:0.0:0.0	.	327	Q8NDH6	ICA1L_HUMAN	Q	327	.	ENSP00000351047:E327Q	E	-	1	0	ICA1L	203369864	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.569000	0.45973	1.757000	0.51966	0.586000	0.80456	GAA	ICA1L	-	pfam_Islet_autoAg_Ica1_C	ENSG00000163596		0.284	ICA1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICA1L	HGNC	protein_coding	OTTHUMT00000256330.1	137	0.00	0	C	NM_138468		203661619	203661619	-1	no_errors	ENST00000358299	ensembl	human	known	69_37n	missense	78	24.27	25	SNP	1.000	G
IFNA2	3440	genome.wustl.edu	37	9	21384882	21384882	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr9:21384882G>C	ENST00000380206.2	-	1	514	c.447C>G	c.(445-447)atC>atG	p.I149M		NM_000605.3	NP_000596.2	P01563	IFNA2_HUMAN	interferon, alpha 2	149					apoptotic process (GO:0006915)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of gene expression (GO:0010629)|negative regulation of interleukin-13 secretion (GO:2000666)|negative regulation of interleukin-5 secretion (GO:2000663)|negative regulation of T cell differentiation (GO:0045581)|negative regulation of T-helper 2 cell cytokine production (GO:2000552)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of viral entry into host cell (GO:0046597)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	type I interferon receptor binding (GO:0005132)			breast(2)|large_intestine(4)|lung(6)|upper_aerodigestive_tract(1)	13				Lung(24;7.66e-27)|LUSC - Lung squamous cell carcinoma(38;1.4e-13)|OV - Ovarian serous cystadenocarcinoma(39;0.0173)		GATAGAGAGTGATTCTTTGGA	0.463																																						dbGAP											0													207.0	208.0	208.0					9																	21384882		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6506.1	9p22	2010-08-24			ENSG00000188379	ENSG00000188379		"""Interferons"""	5423	protein-coding gene	gene with protein product	"""alpha-2a interferon"", ""interferon alpha 2b"", ""interferon alpha A"""	147562				1385305	Standard	NM_000605		Approved	IFNA, IFN-alphaA	uc003zpb.3	P01563	OTTHUMG00000019674	ENST00000380206.2:c.447C>G	9.37:g.21384882G>C	ENSP00000369554:p.Ile149Met	Somatic		WXS	Illumina GAIIx	Phase_IV	H2DF54|H2DF55|P01564|Q14606|Q6DJX8|Q96KI6	Missense_Mutation	SNP	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta,prints_Interferon_alpha/beta/delta	p.I149M	ENST00000380206.2	37	c.447	CCDS6506.1	9	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653232	0.47362	.	.	ENSG00000188379	ENST00000380206	T	0.58210	0.35	3.24	-1.34	0.09143	.	0.286729	0.32852	N	0.005575	T	0.64886	0.2639	M	0.87328	2.875	0.09310	N	1	P	0.44986	0.847	D	0.63597	0.916	T	0.56715	-0.7933	10	0.87932	D	0	.	0.8101	0.01091	0.2453:0.2717:0.32:0.1629	.	149	Q6DJX8	.	M	149	ENSP00000369554:I149M	ENSP00000369554:I149M	I	-	3	3	IFNA2	21374882	0.016000	0.18221	0.028000	0.17463	0.679000	0.39708	0.427000	0.21379	0.096000	0.17463	0.484000	0.47621	ATC	IFNA2	-	pfam_Interferon_alpha/beta/delta,superfamily_4_helix_cytokine-like_core,smart_Interferon_alpha/beta/delta	ENSG00000188379		0.463	IFNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNA2	HGNC	protein_coding	OTTHUMT00000051903.1	324	0.00	0	G	NM_000605		21384882	21384882	-1	no_errors	ENST00000380206	ensembl	human	known	69_37n	missense	360	11.30	46	SNP	0.007	C
IGSF3	3321	genome.wustl.edu	37	1	117122205	117122205	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:117122205G>A	ENST00000369486.3	-	10	3908	c.3143C>T	c.(3142-3144)cCt>cTt	p.P1048L	IGSF3_ENST00000369483.1_Missense_Mutation_p.P1068L|IGSF3_ENST00000318837.6_Missense_Mutation_p.P1068L	NM_001007237.1	NP_001007238.1	O75054	IGSF3_HUMAN	immunoglobulin superfamily, member 3	1048	Ig-like C2-type 8.				lacrimal gland development (GO:0032808)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|liver(1)|lung(31)|ovary(4)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	62	Lung SC(450;0.225)	all_cancers(81;1.24e-06)|all_epithelial(167;4.85e-07)|all_lung(203;1.66e-06)|Lung NSC(69;1.11e-05)		Lung(183;0.0142)|Colorectal(144;0.0929)|LUSC - Lung squamous cell carcinoma(189;0.108)|COAD - Colon adenocarcinoma(174;0.139)|all cancers(265;0.159)|Epithelial(280;0.166)		GCCCTCCCAAGGACTGCCCTC	0.642																																						dbGAP											0													45.0	45.0	45.0					1																	117122205		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031174	CCDS30813.1, CCDS30814.1	1p13	2013-01-29			ENSG00000143061	ENSG00000143061		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5950	protein-coding gene	gene with protein product		603491				9790749	Standard	NM_001007237		Approved	V8, EWI-3, MGC117164	uc031pnr.1	O75054	OTTHUMG00000022751	ENST00000369486.3:c.3143C>T	1.37:g.117122205G>A	ENSP00000358498:p.Pro1048Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJZ6|A6NMC7	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P1068L	ENST00000369486.3	37	c.3203	CCDS30813.1	1	.	.	.	.	.	.	.	.	.	.	G	13.29	2.191757	0.38707	.	.	ENSG00000143061	ENST00000369486;ENST00000369483;ENST00000318837	T;T;T	0.02787	4.16;4.16;4.16	4.67	3.69	0.42338	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.521720	0.20728	N	0.086763	T	0.00580	0.0019	N	0.08118	0	0.46185	D	0.998912	P;B	0.34462	0.454;0.304	B;B	0.30401	0.115;0.079	T	0.56950	-0.7894	10	0.14656	T	0.56	-32.1059	7.0027	0.24820	0.0:0.1739:0.6212:0.2049	.	1048;1068	O75054;A6NJZ6	IGSF3_HUMAN;.	L	1048;1068;1068	ENSP00000358498:P1048L;ENSP00000358495:P1068L;ENSP00000321184:P1068L	ENSP00000321184:P1068L	P	-	2	0	IGSF3	116923728	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	2.429000	0.44758	2.421000	0.82119	0.462000	0.41574	CCT	IGSF3	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000143061		0.642	IGSF3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF3	HGNC	protein_coding	OTTHUMT00000059040.1	38	0.00	0	G	NM_001542		117122205	117122205	-1	no_errors	ENST00000318837	ensembl	human	known	69_37n	missense	70	28.00	28	SNP	1.000	A
IKZF1	10320	genome.wustl.edu	37	7	50450348	50450348	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr7:50450348T>A	ENST00000331340.3	+	5	687	c.532T>A	c.(532-534)Tgc>Agc	p.C178S	IKZF1_ENST00000346667.4_Intron|IKZF1_ENST00000439701.1_Missense_Mutation_p.C178S|IKZF1_ENST00000357364.4_Missense_Mutation_p.C178S|IKZF1_ENST00000343574.5_Missense_Mutation_p.C91S|IKZF1_ENST00000440768.2_Missense_Mutation_p.C178S|IKZF1_ENST00000438033.1_Missense_Mutation_p.C91S|IKZF1_ENST00000349824.4_Intron|IKZF1_ENST00000359197.5_Missense_Mutation_p.C178S	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	178					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(131)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				ATGCCACCTCTGCAACTACGC	0.647			"""D,T"""	BCL6	"""ALL, DLBCL"""																																	dbGAP		"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	131	Unknown(131)	haematopoietic_and_lymphoid_tissue(131)											25.0	31.0	29.0					7																	50450348		2148	4267	6415	-	-	-	SO:0001583	missense	0			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.532T>A	7.37:g.50450348T>A	ENSP00000331614:p.Cys178Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C178S	ENST00000331340.3	37	c.532		7	.	.	.	.	.	.	.	.	.	.	T	26.0	4.690637	0.88735	.	.	ENSG00000185811	ENST00000343574;ENST00000359197;ENST00000440768;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	D;D;D;D;D;D;D	0.85861	-2.04;-2.04;-2.04;-2.04;-2.04;-2.04;-2.04	5.97	5.97	0.96955	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.92652	0.7665	.	.	.	0.80722	D	1	D;D;D	0.89917	0.997;1.0;0.996	D;D;D	0.91635	0.995;0.999;0.997	D	0.93455	0.6805	9	0.87932	D	0	-18.9622	16.4504	0.83984	0.0:0.0:0.0:1.0	.	91;178;178	Q13422-2;Q13422-7;Q13422	.;.;IKZF1_HUMAN	S	91;178;178;178;178;91;178	ENSP00000342750:C91S;ENSP00000352123:C178S;ENSP00000401507:C178S;ENSP00000349928:C178S;ENSP00000331614:C178S;ENSP00000396554:C91S;ENSP00000413025:C178S	ENSP00000331614:C178S	C	+	1	0	IKZF1	50417842	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.037000	0.88933	2.288000	0.76882	0.533000	0.62120	TGC	IKZF1	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185811		0.647	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	38	0.00	0	T	NM_006060		50450348	50450348	+1	no_errors	ENST00000331340	ensembl	human	known	69_37n	missense	55	27.63	21	SNP	1.000	A
IRS1	3667	genome.wustl.edu	37	2	227662969	227662969	+	Silent	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:227662969C>T	ENST00000305123.5	-	1	1506	c.486G>A	c.(484-486)gaG>gaA	p.E162E	RP11-395N3.2_ENST00000607970.1_lincRNA	NM_005544.2	NP_005535.1	P35568	IRS1_HUMAN	insulin receptor substrate 1	162	IRS-type PTB. {ECO:0000255|PROSITE- ProRule:PRU00389}.				cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose homeostasis (GO:0042593)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|lipid catabolic process (GO:0016042)|mammary gland development (GO:0030879)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of insulin secretion (GO:0046676)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of fatty acid beta-oxidation (GO:0032000)|positive regulation of glucose import (GO:0046326)|positive regulation of glucose import in response to insulin stimulus (GO:2001275)|positive regulation of glucose metabolic process (GO:0010907)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of insulin receptor signaling pathway (GO:0046628)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|protein kinase B signaling (GO:0043491)|protein localization to nucleus (GO:0034504)|regulation of gene expression (GO:0010468)|response to insulin (GO:0032868)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	caveola (GO:0005901)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|insulin receptor complex (GO:0005899)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(2)|central_nervous_system(4)|endometrium(5)|kidney(4)|large_intestine(10)|lung(33)|ovary(6)|pancreas(1)|prostate(1)|urinary_tract(2)	69		Renal(207;0.023)|all_lung(227;0.0994)|all_hematologic(139;0.118)|Esophageal squamous(248;0.23)		Epithelial(121;3.03e-11)|all cancers(144;2.42e-08)|Lung(261;0.00712)|LUSC - Lung squamous cell carcinoma(224;0.0137)		CTTGCCAGACCTCTTTGAATG	0.612											OREG0015248	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													53.0	53.0	53.0					2																	227662969		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2463.1	2q36	2013-01-10			ENSG00000169047	ENSG00000169047		"""Pleckstrin homology (PH) domain containing"""	6125	protein-coding gene	gene with protein product		147545				1648180	Standard	NM_005544		Approved	HIRS-1	uc002voh.4	P35568	OTTHUMG00000133179	ENST00000305123.5:c.486G>A	2.37:g.227662969C>T		Somatic	2321	WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Pleckstrin_homology,pfscan_Insln_rcpt_S1	p.E162	ENST00000305123.5	37	c.486	CCDS2463.1	2																																																																																			IRS1	-	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,prints_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	ENSG00000169047		0.612	IRS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRS1	HGNC	protein_coding	OTTHUMT00000256886.3	11	0.00	0	C	NM_005544		227662969	227662969	-1	no_errors	ENST00000305123	ensembl	human	known	69_37n	silent	29	19.44	7	SNP	1.000	T
ITIH4	3700	genome.wustl.edu	37	3	52850986	52850986	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr3:52850986G>A	ENST00000266041.4	-	21	2481	c.2385C>T	c.(2383-2385)caC>caT	p.H795H	RP5-966M1.6_ENST00000468472.1_3'UTR|ITIH4_ENST00000485816.1_Silent_p.H800H|ITIH4_ENST00000406595.1_Silent_p.H765H|ITIH4_ENST00000346281.5_Silent_p.H779H	NM_002218.4	NP_002209.2	Q14624	ITIH4_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 4	795					acute-phase response (GO:0006953)|hyaluronan metabolic process (GO:0030212)|negative regulation of endopeptidase activity (GO:0010951)|response to cytokine (GO:0034097)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(4)|large_intestine(3)|lung(9)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	30				BRCA - Breast invasive adenocarcinoma(193;7e-05)|Kidney(197;0.000656)|KIRC - Kidney renal clear cell carcinoma(197;0.000794)|OV - Ovarian serous cystadenocarcinoma(275;0.0496)		CAGGGGATGCGTGAACCCATA	0.572																																						dbGAP											0													156.0	155.0	156.0					3																	52850986		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D38535	CCDS2865.1, CCDS54596.1	3p21.1	2011-10-26	2011-10-26		ENSG00000055955	ENSG00000055955			6169	protein-coding gene	gene with protein product	"""plasma Kallikrein-sensitive glycoprotein"""	600564	"""inter-alpha (globulin) inhibitor H4 (plasma Kallikrein-sensitive glycoprotein)"""	ITIHL1		9480842, 7805892	Standard	NM_002218		Approved	IHRP, H4P	uc003dfz.3	Q14624	OTTHUMG00000159023	ENST00000266041.4:c.2385C>T	3.37:g.52850986G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z545|E9PGN5|Q15135|Q9P190|Q9UQ54	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R584C	ENST00000266041.4	37	c.1750	CCDS2865.1	3	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.518386	0.00967	.	.	ENSG00000055955	ENST00000441637	.	.	.	5.47	-8.67	0.00863	.	.	.	.	.	T	0.16981	0.0408	.	.	.	0.23120	N	0.99826	.	.	.	.	.	.	T	0.19582	-1.0301	4	.	.	.	-5.2606	3.4896	0.07633	0.3195:0.1249:0.4335:0.1221	.	.	.	.	C	584	.	.	R	-	1	0	ITIH4	52826026	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.774000	0.04684	-1.659000	0.01488	-1.267000	0.01435	CGC	ITIH4	-	pfam_ITI_HC_C	ENSG00000055955		0.572	ITIH4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITIH4	HGNC	protein_coding	OTTHUMT00000317715.1	87	0.00	0	G	NM_002218		52850986	52850986	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441637	ensembl	human	novel	69_37n	missense	84	37.50	51	SNP	0.000	A
KCNN2	3781	genome.wustl.edu	37	5	113740461	113740461	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr5:113740461G>C	ENST00000512097.3	+	4	1927	c.909G>C	c.(907-909)aaG>aaC	p.K303N	KCNN2_ENST00000264773.3_Missense_Mutation_p.K303N|KCNN2_ENST00000507750.1_Intron			Q9H2S1	KCNN2_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 2	303					potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transport (GO:1901379)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|protein homodimerization activity (GO:0042803)|small conductance calcium-activated potassium channel activity (GO:0016286)			breast(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.86e-05)|all_epithelial(76;9.33e-06)|Prostate(80;0.00955)|Ovarian(225;0.0444)|Breast(839;0.159)|Lung NSC(810;0.174)|all_lung(232;0.206)		OV - Ovarian serous cystadenocarcinoma(64;1.89e-08)|Epithelial(69;2.04e-08)|all cancers(49;3.74e-06)|COAD - Colon adenocarcinoma(37;0.142)|Colorectal(14;0.195)	Miconazole(DB01110)|Procaine(DB00721)	TTGTTATGAAGACTTTAATGA	0.378																																						dbGAP											0													138.0	136.0	137.0					5																	113740461		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF239613	CCDS4114.1, CCDS43352.1	5q22.3	2012-07-05			ENSG00000080709	ENSG00000080709		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6291	protein-coding gene	gene with protein product		605879				16382103	Standard	NM_001278204		Approved	KCa2.2, hSK2	uc003kqo.3	Q9H2S1	OTTHUMG00000128836	ENST00000512097.3:c.909G>C	5.37:g.113740461G>C	ENSP00000427120:p.Lys303Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NF94|Q0VFZ4|Q6PJI0|Q6X2Y2	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom,prints_K_chnl_Ca-activ_SK	p.K303N	ENST00000512097.3	37	c.909	CCDS4114.1	5	.	.	.	.	.	.	.	.	.	.	G	20.4	3.989315	0.74589	.	.	ENSG00000080709	ENST00000512097;ENST00000264773	D;D	0.99252	-5.63;-5.63	5.42	5.42	0.78866	.	0.046066	0.85682	D	0.000000	D	0.99483	0.9816	M	0.90425	3.115	0.80722	D	1	D	0.56287	0.975	P	0.62649	0.905	D	0.98554	1.0638	10	0.87932	D	0	-6.0013	18.8255	0.92117	0.0:0.0:1.0:0.0	.	303	Q9H2S1	KCNN2_HUMAN	N	303	ENSP00000427120:K303N;ENSP00000264773:K303N	ENSP00000264773:K303N	K	+	3	2	KCNN2	113768360	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.746000	0.98859	2.545000	0.85829	0.491000	0.48974	AAG	KCNN2	-	NULL	ENSG00000080709		0.378	KCNN2-001	KNOWN	not_organism_supported|upstream_ATG|basic|appris_principal|CCDS	protein_coding	KCNN2	HGNC	protein_coding	OTTHUMT00000250775.2	141	0.00	0	G	NM_021614		113740461	113740461	+1	no_errors	ENST00000264773	ensembl	human	known	69_37n	missense	124	11.43	16	SNP	1.000	C
KIAA0232	9778	genome.wustl.edu	37	4	6865611	6865611	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr4:6865611T>G	ENST00000307659.5	+	7	3957	c.3502T>G	c.(3502-3504)Tca>Gca	p.S1168A	KIAA0232_ENST00000425103.1_Missense_Mutation_p.S1168A	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	1168							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						CTATGGAAAATCAGAGCTTGA	0.418																																						dbGAP											0													61.0	59.0	60.0					4																	6865611		1811	4071	5882	-	-	-	SO:0001583	missense	0			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.3502T>G	4.37:g.6865611T>G	ENSP00000303928:p.Ser1168Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2D2	Missense_Mutation	SNP	NULL	p.S1168A	ENST00000307659.5	37	c.3502	CCDS43209.1	4	.	.	.	.	.	.	.	.	.	.	T	18.10	3.549637	0.65311	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.14	2.4	0.29515	.	0.149175	0.47455	D	0.000234	T	0.39545	0.1082	L	0.29908	0.895	0.35583	D	0.806415	B	0.26195	0.144	B	0.31442	0.13	T	0.44787	-0.9305	9	0.37606	T	0.19	-27.5691	9.6809	0.40070	0.2768:0.0:0.0:0.7232	.	1168	Q92628	K0232_HUMAN	A	1168	.	ENSP00000303928:S1168A	S	+	1	0	KIAA0232	6916512	0.968000	0.33430	0.931000	0.37212	0.999000	0.98932	2.923000	0.48868	0.842000	0.35045	0.533000	0.62120	TCA	KIAA0232	-	NULL	ENSG00000170871		0.418	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	74	0.00	0	T	NM_014743		6865611	6865611	+1	no_errors	ENST00000307659	ensembl	human	known	69_37n	missense	42	10.20	5	SNP	0.961	G
LEPREL1	55214	genome.wustl.edu	37	3	189704666	189704666	+	Splice_Site	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr3:189704666C>G	ENST00000319332.5	-	6	1296	c.1099G>C	c.(1099-1101)Gat>Cat	p.D367H	LEPREL1_ENST00000427335.2_Splice_Site_p.D186H	NM_018192.3	NP_060662.2	Q8IVL5	P3H2_HUMAN	leprecan-like 1	367					collagen metabolic process (GO:0032963)|extracellular matrix organization (GO:0030198)|negative regulation of cell proliferation (GO:0008285)|peptidyl-proline hydroxylation (GO:0019511)	basement membrane (GO:0005604)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-proline 3-dioxygenase activity (GO:0019797)			NS(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(5)	41	all_cancers(143;4.01e-10)|Ovarian(172;0.0925)		Lung(62;4.35e-05)	GBM - Glioblastoma multiforme(93;0.02)	L-Proline(DB00172)|Succinic acid(DB00139)|Vitamin C(DB00126)	ATTGTTAAATCCTAGAGAAAA	0.343																																						dbGAP											0													71.0	76.0	74.0					3																	189704666		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0				CCDS3294.1, CCDS46981.1	3q29	2014-01-28			ENSG00000090530	ENSG00000090530	1.14.11.7		19317	protein-coding gene	gene with protein product	"""prolyl 3-hydroxylase 2"""	610341				15063763, 21885030	Standard	NM_018192		Approved	FLJ10718, MLAT4, P3H2	uc011bsk.2	Q8IVL5	OTTHUMG00000156312	ENST00000319332.5:c.1099-1G>C	3.37:g.189704666C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPK0|B3KWI9|D3DNV8|Q9NVI2	Missense_Mutation	SNP	pfam_Oxoglu/Fe-dep_dioxygenase,smart_Pro_4_hyd_alph	p.D367H	ENST00000319332.5	37	c.1099	CCDS3294.1	3	.	.	.	.	.	.	.	.	.	.	C	18.17	3.564251	0.65651	.	.	ENSG00000090530	ENST00000319332;ENST00000427335	T;T	0.38240	1.15;1.53	5.74	5.74	0.90152	.	0.146884	0.64402	D	0.000011	T	0.52075	0.1712	L	0.58810	1.83	0.54753	D	0.999982	P	0.48016	0.904	P	0.54924	0.764	T	0.37619	-0.9698	9	.	.	.	-29.7446	18.8992	0.92435	0.0:1.0:0.0:0.0	.	367	Q8IVL5	P3H2_HUMAN	H	367;186	ENSP00000316881:D367H;ENSP00000408947:D186H	.	D	-	1	0	LEPREL1	191187360	1.000000	0.71417	0.998000	0.56505	0.429000	0.31625	3.669000	0.54561	2.728000	0.93425	0.585000	0.79938	GAT	LEPREL1	-	NULL	ENSG00000090530		0.343	LEPREL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPREL1	HGNC	protein_coding	OTTHUMT00000343855.1	85	0.00	0	C	NM_018192	Missense_Mutation	189704666	189704666	-1	no_errors	ENST00000319332	ensembl	human	known	69_37n	missense	78	10.34	9	SNP	1.000	G
LHX4	89884	genome.wustl.edu	37	1	180241004	180241004	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:180241004G>A	ENST00000263726.2	+	5	885	c.641G>A	c.(640-642)cGc>cAc	p.R214H	RP5-1180C10.2_ENST00000415414.1_RNA|RP5-1180C10.2_ENST00000440959.2_RNA	NM_033343.3	NP_203129.1	Q969G2	LHX4_HUMAN	LIM homeobox 4	214					medial motor column neuron differentiation (GO:0021526)|motor neuron axon guidance (GO:0008045)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|placenta development (GO:0001890)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)	16						AAAGAGAAACGCCTGAAGAAG	0.592																																						dbGAP											0													86.0	98.0	94.0					1																	180241004		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037683	CCDS1338.1	1q25.3	2011-06-20			ENSG00000121454	ENSG00000121454		"""Homeoboxes / LIM class"""	21734	protein-coding gene	gene with protein product		602146				11844481, 11567216	Standard	NM_033343		Approved	Gsh4	uc001goe.2	Q969G2	OTTHUMG00000035115	ENST00000263726.2:c.641G>A	1.37:g.180241004G>A	ENSP00000263726:p.Arg214His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHE0|Q8NHM1|Q8TCJ1|Q8WWX2|Q969W2	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.R214H	ENST00000263726.2	37	c.641	CCDS1338.1	1	.	.	.	.	.	.	.	.	.	.	G	35	5.477863	0.96291	.	.	ENSG00000121454	ENST00000263726	D	0.96685	-4.09	5.59	5.59	0.84812	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);	0.000000	0.85682	D	0.000000	D	0.98551	0.9516	M	0.91768	3.24	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99513	1.0956	10	0.87932	D	0	.	18.3679	0.90398	0.0:0.0:1.0:0.0	.	214	Q969G2	LHX4_HUMAN	H	214	ENSP00000263726:R214H	ENSP00000263726:R214H	R	+	2	0	LHX4	178507627	1.000000	0.71417	0.786000	0.31890	0.866000	0.49608	9.703000	0.98714	2.631000	0.89168	0.561000	0.74099	CGC	LHX4	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	ENSG00000121454		0.592	LHX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LHX4	HGNC	protein_coding	OTTHUMT00000084995.2	107	0.00	0	G	NM_033343		180241004	180241004	+1	no_errors	ENST00000263726	ensembl	human	known	69_37n	missense	91	14.95	16	SNP	1.000	A
LRFN1	57622	genome.wustl.edu	37	19	39805332	39805333	+	Frame_Shift_Del	DEL	CA	CA	-			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	CA	CA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr19:39805332_39805333delCA	ENST00000248668.4	-	1	643_644	c.644_645delTG	c.(643-645)ctgfs	p.L215fs	CTC-246B18.8_ENST00000601911.1_RNA	NM_020862.1	NP_065913.1	Q9P244	LRFN1_HUMAN	leucine rich repeat and fibronectin type III domain containing 1	215						cell junction (GO:0030054)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)				central_nervous_system(2)|cervix(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	18	all_cancers(60;1.85e-07)|all_lung(34;4.03e-08)|Lung NSC(34;4.66e-08)|all_epithelial(25;6.4e-07)|Ovarian(47;0.0512)		Epithelial(26;1.96e-27)|all cancers(26;2.05e-24)|Lung(45;0.000278)|LUSC - Lung squamous cell carcinoma(53;0.000335)			AGGTCATGTCCAGACGGACCAG	0.644																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC014678	CCDS46071.1	19q13.2	2013-02-11				ENSG00000128011		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	29290	protein-coding gene	gene with protein product		612807				10819331, 16828986	Standard	NM_020862		Approved	KIAA1484, SALM2	uc002okw.2	Q9P244		ENST00000248668.4:c.644_645delTG	19.37:g.39805332_39805333delCA	ENSP00000248668:p.Leu215fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TBS9	Frame_Shift_Del	DEL	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L215fs	ENST00000248668.4	37	c.645_644	CCDS46071.1	19																																																																																			LRFN1	-	smart_Leu-rich_rpt_typical-subtyp	ENSG00000128011		0.644	LRFN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN1	HGNC	protein_coding	OTTHUMT00000463835.1	23	0.00	0	CA	NM_020862		39805332	39805333	-1	no_errors	ENST00000248668	ensembl	human	known	69_37n	frame_shift_del	77	22.64	24	DEL	1.000:1.000	-
LRRC41	10489	genome.wustl.edu	37	1	46752022	46752022	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:46752022G>C	ENST00000343304.6	-	4	792	c.507C>G	c.(505-507)atC>atG	p.I169M	LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41	169					protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					GCATGTTACAGATGGTGAGCT	0.587																																						dbGAP											0													63.0	65.0	64.0					1																	46752022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.507C>G	1.37:g.46752022G>C	ENSP00000343298:p.Ile169Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.I169M	ENST00000343304.6	37	c.507	CCDS533.1	1	.	.	.	.	.	.	.	.	.	.	g	12.16	1.853562	0.32791	.	.	ENSG00000132128	ENST00000343304;ENST00000371972	D	0.82344	-1.6	5.08	3.06	0.35304	.	0.475549	0.21061	N	0.080838	T	0.78033	0.4220	N	0.14661	0.345	0.26292	N	0.978119	D;D;D	0.57899	0.962;0.981;0.962	P;P;P	0.60012	0.7;0.867;0.628	T	0.67558	-0.5640	10	0.87932	D	0	-0.8324	5.3862	0.16220	0.0738:0.2581:0.5325:0.1356	.	169;147;169	Q15345-3;E9PE58;Q15345	.;.;LRC41_HUMAN	M	169;147	ENSP00000343298:I169M	ENSP00000343298:I169M	I	-	3	3	LRRC41	46524609	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.856000	0.27818	1.149000	0.42402	0.430000	0.28490	ATC	LRRC41	-	NULL	ENSG00000132128		0.587	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	39	0.00	0	G	NM_006369		46752022	46752022	-1	no_errors	ENST00000343304	ensembl	human	known	69_37n	missense	65	18.75	15	SNP	1.000	C
MAPK13	5603	genome.wustl.edu	37	6	36103593	36103593	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr6:36103593G>A	ENST00000211287.4	+	4	634	c.372G>A	c.(370-372)gaG>gaA	p.E124E	MAPK13_ENST00000490334.1_3'UTR|MAPK13_ENST00000373766.5_Silent_p.E124E|MAPK13_ENST00000373759.1_Silent_p.E46E|MAPK13_ENST00000373761.6_Silent_p.E124E	NM_002754.4	NP_002745.1	O15264	MK13_HUMAN	mitogen-activated protein kinase 13	124	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle (GO:0007049)|intracellular signal transduction (GO:0035556)|MAPK cascade (GO:0000165)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interleukin-6 production (GO:0032755)|Ras protein signal transduction (GO:0007265)|regulation of transcription, DNA-templated (GO:0006355)|response to osmotic stress (GO:0006970)|response to stress (GO:0006950)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase activity (GO:0004707)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(2)|prostate(2)|skin(1)	12						AGTTCAGTGAGGAGAAGATCC	0.562																																						dbGAP											0													193.0	155.0	168.0					6																	36103593		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y10488	CCDS4818.1	6p21	2011-06-09			ENSG00000156711	ENSG00000156711	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6875	protein-coding gene	gene with protein product		602899		PRKM13		9295308, 9218798	Standard	NM_002754		Approved	SAPK4, p38delta	uc003ols.4	O15264	OTTHUMG00000014587	ENST00000211287.4:c.372G>A	6.37:g.36103593G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O14739|O15124|Q5U4A5|Q6FI46|Q9UNU0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_p38,prints_MAPK_JNK	p.E124	ENST00000211287.4	37	c.372	CCDS4818.1	6																																																																																			MAPK13	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_JNK	ENSG00000156711		0.562	MAPK13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK13	HGNC	protein_coding	OTTHUMT00000040328.1	204	0.00	0	G			36103593	36103593	+1	no_errors	ENST00000211287	ensembl	human	known	69_37n	silent	500	20.03	126	SNP	1.000	A
MBD3L1	85509	genome.wustl.edu	37	19	8953926	8953926	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr19:8953926C>T	ENST00000595891.1	+	3	803	c.572C>T	c.(571-573)cCt>cTt	p.P191L	MBD3L1_ENST00000305625.2_Missense_Mutation_p.P191L			Q8WWY6	MB3L1_HUMAN	methyl-CpG binding domain protein 3-like 1	191					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|cervix(1)|large_intestine(5)|liver(1)|lung(2)|skin(2)	12						GAAGGCCGTCCTGAAAAACGC	0.428																																						dbGAP											0													29.0	28.0	28.0					19																	8953926		2202	4298	6500	-	-	-	SO:0001583	missense	0			AY038022	CCDS12209.1	19p13.2	2011-01-31	2003-03-19	2003-03-21	ENSG00000170948	ENSG00000170948			15774	protein-coding gene	gene with protein product		607963	"""methyl-CpG binding domain protein 3-like"""	MBD3L		12504854	Standard	NM_145208		Approved		uc002mko.2	Q8WWY6		ENST00000595891.1:c.572C>T	19.37:g.8953926C>T	ENSP00000471575:p.Pro191Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BUM6|Q2M291	Missense_Mutation	SNP	NULL	p.P191L	ENST00000595891.1	37	c.572	CCDS12209.1	19	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882189	0.33255	.	.	ENSG00000170948	ENST00000305625	T	0.43688	0.94	3.73	-1.23	0.09465	.	.	.	.	.	T	0.27454	0.0674	L	0.51422	1.61	0.09310	N	1	B	0.12013	0.005	B	0.06405	0.002	T	0.26430	-1.0103	9	0.19590	T	0.45	-16.0437	1.0221	0.01520	0.1816:0.4256:0.1773:0.2154	.	191	Q8WWY6	MB3L1_HUMAN	L	191	ENSP00000304198:P191L	ENSP00000304198:P191L	P	+	2	0	MBD3L1	8814926	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.875000	0.01634	-0.095000	0.12351	0.591000	0.81541	CCT	MBD3L1	-	NULL	ENSG00000170948		0.428	MBD3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L1	HGNC	protein_coding	OTTHUMT00000459973.1	23	0.00	0	C	NM_145208		8953926	8953926	+1	no_errors	ENST00000305625	ensembl	human	known	69_37n	missense	25	40.91	18	SNP	0.000	T
MCM10	55388	genome.wustl.edu	37	10	13237166	13237166	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr10:13237166C>T	ENST00000484800.2	+	14	1977	c.1874C>T	c.(1873-1875)aCg>aTg	p.T625M	MCM10_ENST00000378714.3_Missense_Mutation_p.T624M|MCM10_ENST00000378694.1_Missense_Mutation_p.T624M			Q7L590	MCM10_HUMAN	minichromosome maintenance complex component 10	625					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)			central_nervous_system(1)|large_intestine(4)|ovary(2)|skin(1)|stomach(1)	9						GCCACAATGACGCCCAAGCTG	0.567																																						dbGAP											0													55.0	52.0	53.0					10																	13237166		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB042719	CCDS7095.1, CCDS7096.1	10p13	2008-08-01	2007-04-04		ENSG00000065328	ENSG00000065328			18043	protein-coding gene	gene with protein product		609357	"""MCM10 minichromosome maintenance deficient 10 (S. cerevisiae)"""			11095689, 17699597	Standard	NM_018518		Approved	PRO2249, CNA43, DNA43	uc001ima.3	Q7L590	OTTHUMG00000017694	ENST00000484800.2:c.1874C>T	10.37:g.13237166C>T	ENSP00000418268:p.Thr625Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9I6|B7ZKZ8|Q3MIR3|Q7LD55|Q96GX4|Q96NB6|Q9H0D7|Q9H3P9|Q9P177	Missense_Mutation	SNP	pfam_Rep_factor_Mcm10,pfam_Znf_Mcm10/DnaG	p.T625M	ENST00000484800.2	37	c.1874	CCDS7096.1	10	.	.	.	.	.	.	.	.	.	.	C	10.60	1.396928	0.25205	.	.	ENSG00000065328	ENST00000378714;ENST00000361282;ENST00000484800;ENST00000378694	T;T;T	0.35421	1.31;1.31;1.31	5.5	-8.68	0.00859	Replication factor Mcm10 (1);	0.955387	0.08845	N	0.885252	T	0.19248	0.0462	N	0.16368	0.405	0.09310	N	1	B;B;B	0.28350	0.208;0.04;0.049	B;B;B	0.30646	0.118;0.014;0.025	T	0.27297	-1.0078	10	0.31617	T	0.26	-15.3307	11.9586	0.52995	0.0:0.4594:0.0794:0.4612	.	624;624;625	Q5T670;Q7L590-2;Q7L590	.;.;MCM10_HUMAN	M	624;625;625;624	ENSP00000367986:T624M;ENSP00000418268:T625M;ENSP00000367966:T624M	ENSP00000354945:T625M	T	+	2	0	MCM10	13277172	0.000000	0.05858	0.000000	0.03702	0.022000	0.10575	-0.080000	0.11339	-1.729000	0.01364	-0.761000	0.03458	ACG	MCM10	-	pfam_Rep_factor_Mcm10	ENSG00000065328		0.567	MCM10-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCM10	HGNC	protein_coding	OTTHUMT00000356853.1	72	0.00	0	C	NM_182751		13237166	13237166	+1	no_errors	ENST00000361282	ensembl	human	known	69_37n	missense	143	23.94	45	SNP	0.000	T
MEAF6	64769	genome.wustl.edu	37	1	37979110	37979110	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:37979110G>C	ENST00000296214.5	-	2	147	c.120C>G	c.(118-120)atC>atG	p.I40M	MEAF6_ENST00000373075.2_Missense_Mutation_p.I40M|MEAF6_ENST00000475828.1_5'UTR|MEAF6_ENST00000448519.2_Missense_Mutation_p.I40M|MEAF6_ENST00000373073.4_Missense_Mutation_p.I40M|MEAF6_ENST00000373074.1_Missense_Mutation_p.I18M	NM_001270875.1	NP_001257804.1	Q9HAF1	EAF6_HUMAN	MYST/Esa1-associated factor 6	40					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H3-K14 acetylation (GO:0044154)|histone H4-K12 acetylation (GO:0043983)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|MOZ/MORF histone acetyltransferase complex (GO:0070776)|NuA4 histone acetyltransferase complex (GO:0035267)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				autonomic_ganglia(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						CAAAAGCATAGATCTGTCGCT	0.408																																						dbGAP											0													177.0	155.0	162.0					1																	37979110		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016328	CCDS418.1, CCDS59195.1, CCDS59196.1	1p35.3-p33	2011-08-12	2009-07-13	2009-07-13	ENSG00000163875	ENSG00000163875			25674	protein-coding gene	gene with protein product	"""Esa1p-associated factor 6 homolog (S. cerevisiae)"", ""centromere protein 28"""	611001	"""chromosome 1 open reading frame 149"""	C1orf149		8619474, 9110174, 12963728, 14966270, 16387653	Standard	NM_022756		Approved	NY-SAR-91, FLJ11730, Eaf6, CENP-28	uc001cbe.2	Q9HAF1	OTTHUMG00000004223	ENST00000296214.5:c.120C>G	1.37:g.37979110G>C	ENSP00000296214:p.Ile40Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK64|Q4F967|Q7Z311|Q86WE3	Missense_Mutation	SNP	pfam_Hist_AcTrfase_NuA4_cplx	p.I40M	ENST00000296214.5	37	c.120	CCDS59196.1	1	.	.	.	.	.	.	.	.	.	.	G	16.64	3.180361	0.57800	.	.	ENSG00000163875	ENST00000373075;ENST00000296214;ENST00000373074;ENST00000373073;ENST00000448519	.	.	.	4.56	3.63	0.41609	.	0.000000	0.85682	D	0.000000	D	0.85204	0.5643	M	0.94021	3.485	0.53688	D	0.999976	D;D;D;D	0.89917	1.0;1.0;1.0;0.991	D;D;D;D	0.91635	0.999;0.999;0.999;0.98	D	0.88533	0.3104	9	0.87932	D	0	12.289	13.3207	0.60430	0.0:0.0:0.841:0.159	.	40;40;40;18	Q9HAF1-2;Q9HAF1;Q9HAF1-3;B1AK63	.;EAF6_HUMAN;.;.	M	40;40;18;40;40	.	ENSP00000296214:I40M	I	-	3	3	MEAF6	37751697	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.319000	0.51983	1.023000	0.39654	0.561000	0.74099	ATC	MEAF6	-	pfam_Hist_AcTrfase_NuA4_cplx	ENSG00000163875		0.408	MEAF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEAF6	HGNC	protein_coding	OTTHUMT00000012161.1	164	0.00	0	G	NM_022756		37979110	37979110	-1	no_errors	ENST00000373075	ensembl	human	known	69_37n	missense	246	20.32	63	SNP	1.000	C
MED12	9968	genome.wustl.edu	37	X	70352290	70352290	+	Silent	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:70352290C>G	ENST00000374080.3	+	31	4349	c.4317C>G	c.(4315-4317)gtC>gtG	p.V1439V	MED12_ENST00000374102.1_Silent_p.V1439V|MED12_ENST00000333646.6_Silent_p.V1439V			Q93074	MED12_HUMAN	mediator complex subunit 12	1439					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					CCACCTCAGTCCAGGGACATG	0.552			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																															dbGAP		Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													64.0	58.0	60.0					X																	70352290		1948	4128	6076	-	-	-	SO:0001819	synonymous_variant	0			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.4317C>G	X.37:g.70352290C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Silent	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.V1439	ENST00000374080.3	37	c.4317	CCDS43970.1	X																																																																																			MED12	-	NULL	ENSG00000184634		0.552	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	163	0.00	0	C	NM_005120		70352290	70352290	+1	no_errors	ENST00000333646	ensembl	human	known	69_37n	silent	226	16.61	45	SNP	0.995	G
MEFV	4210	genome.wustl.edu	37	16	3297157	3297157	+	Frame_Shift_Del	DEL	G	G	-			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr16:3297157delG	ENST00000219596.1	-	5	1485	c.1446delC	c.(1444-1446)gccfs	p.A482fs	MEFV_ENST00000536379.1_Frame_Shift_Del_p.A271fs|MEFV_ENST00000339854.4_Frame_Shift_Del_p.A302fs|MEFV_ENST00000541159.1_Frame_Shift_Del_p.A271fs	NM_000243.2	NP_000234.1	O15553	MEFV_HUMAN	Mediterranean fever	482	Required for homotrimerization and induction of pyroptosomes.				inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of macrophage inflammatory protein 1 alpha production (GO:0071641)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity (GO:2001056)	cell projection (GO:0042995)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)	actin binding (GO:0003779)|zinc ion binding (GO:0008270)			NS(2)|biliary_tract(1)|breast(5)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(19)|ovary(3)|prostate(1)|skin(6)	50						CCTCCAGTGAGGCCACAAAGA	0.577																																						dbGAP											0													176.0	161.0	166.0					16																	3297157		2197	4300	6497	-	-	-	SO:0001589	frameshift_variant	0			AF018080	CCDS10498.1, CCDS55981.1	16p13.3	2014-09-17			ENSG00000103313	ENSG00000103313		"""Tripartite motif containing / Tripartite motif containing"""	6998	protein-coding gene	gene with protein product	"""pyrin"""	608107		MEF		9288094	Standard	NM_000243		Approved	FMF, TRIM20	uc002cun.1	O15553	OTTHUMG00000129324	ENST00000219596.1:c.1446delC	16.37:g.3297157delG	ENSP00000219596:p.Ala482fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUC0|F5H0Q3|Q3MJ84|Q96PN4|Q96PN5	Frame_Shift_Del	DEL	pfam_DAPIN,pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl,superfamily_DEATH-like,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_DAPIN,pfscan_Znf_B-box,prints_Butyrophylin	p.S483fs	ENST00000219596.1	37	c.1446	CCDS10498.1	16																																																																																			MEFV	-	NULL	ENSG00000103313		0.577	MEFV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEFV	HGNC	protein_coding	OTTHUMT00000251464.1	69	0.00	0	G	NM_000243		3297157	3297157	-1	no_errors	ENST00000219596	ensembl	human	known	69_37n	frame_shift_del	161	25.55	58	DEL	1.000	-
MOK	5891	genome.wustl.edu	37	14	102698065	102698065	+	Silent	SNP	A	A	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr14:102698065A>G	ENST00000361847.2	-	10	1191	c.960T>C	c.(958-960)atT>atC	p.I320I	MOK_ENST00000524214.1_Silent_p.I290I|MOK_ENST00000561150.1_Intron|MOK_ENST00000520266.1_Intron|MOK_ENST00000193029.6_Intron|MOK_ENST00000522867.1_Intron|MOK_ENST00000517966.1_Intron|MOK_ENST00000522874.1_Silent_p.I319I|MOK_ENST00000522534.1_Intron|MOK_ENST00000524370.1_Intron|MOK_ENST00000523231.1_Intron|MOK_ENST00000519058.1_Intron	NM_014226.1	NP_055041.1	Q9UQ07	MOK_HUMAN	MOK protein kinase	320					protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)										CCTCCTTGGAAATCTGGCAGC	0.597																																						dbGAP											0													167.0	166.0	166.0					14																	102698065		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB022694	CCDS9971.1, CCDS61552.1	14q32	2014-04-23	2011-09-06	2011-09-06	ENSG00000080823	ENSG00000080823			9833	protein-coding gene	gene with protein product		605762	"""renal tumor antigen"""	RAGE		8781117, 10421840	Standard	NM_014226		Approved	RAGE1, STK30	uc001ylm.4	Q9UQ07	OTTHUMG00000164896	ENST00000361847.2:c.960T>C	14.37:g.102698065A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6Z4|B7Z7P6|E7ER76|E7ERR8|Q92790|Q93067	Missense_Mutation	SNP	NULL	p.F32L	ENST00000361847.2	37	c.94	CCDS9971.1	14	.	.	.	.	.	.	.	.	.	.	A	5.845	0.340097	0.11069	.	.	ENSG00000080823	ENST00000521937	.	.	.	4.73	-6.9	0.01655	.	.	.	.	.	T	0.29945	0.0749	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.42275	-0.9461	4	.	.	.	-3.3842	11.0436	0.47846	0.1527:0.7512:0.096:0.0	.	.	.	.	L	32	.	.	F	-	1	0	RAGE	101767818	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-1.318000	0.02705	-0.564000	0.06070	-0.666000	0.03841	TTC	MOK	-	NULL	ENSG00000080823		0.597	MOK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOK	HGNC	protein_coding	OTTHUMT00000380848.3	103	0.00	0	A			102698065	102698065	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000521937	ensembl	human	putative	69_37n	missense	93	40.51	64	SNP	0.000	G
MSLN	10232	genome.wustl.edu	37	16	816661	816661	+	Silent	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr16:816661C>T	ENST00000382862.3	+	13	1343	c.1248C>T	c.(1246-1248)ctC>ctT	p.L416L	MSLN_ENST00000566549.1_Intron|MSLN_ENST00000563941.1_Intron|MSLN_ENST00000545450.2_Intron	NM_013404.4	NP_037536.2	Q13421	MSLN_HUMAN	mesothelin	416					cell adhesion (GO:0007155)|pancreas development (GO:0031016)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(2)|kidney(2)|lung(11)|pancreas(1)|prostate(1)|skin(3)	20		Hepatocellular(780;0.00335)				GGCGGCCCCTCCCACAGGTGG	0.637																																						dbGAP											0													53.0	58.0	56.0					16																	816661		2188	4286	6474	-	-	-	SO:0001819	synonymous_variant	0			U40434	CCDS32356.1, CCDS45370.1	16p13.3	2008-04-16			ENSG00000102854	ENSG00000102854			7371	protein-coding gene	gene with protein product		601051				7665620, 8552591	Standard	NM_005823		Approved	CAK1, MPF	uc002cjw.2	Q13421	OTTHUMG00000047992	ENST00000382862.3:c.1248C>T	16.37:g.816661C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU65|Q14859|Q4VQD5|Q96GR6|Q96KJ5|Q9BR17|Q9BTR2|Q9UCB2|Q9UK57	Silent	SNP	pfam_Mesothelin	p.L416	ENST00000382862.3	37	c.1248	CCDS32356.1	16																																																																																			MSLN	-	pfam_Mesothelin	ENSG00000102854		0.637	MSLN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MSLN	HGNC	protein_coding	OTTHUMT00000109253.2	29	0.00	0	C			816661	816661	+1	no_errors	ENST00000382862	ensembl	human	known	69_37n	silent	46	13.21	7	SNP	0.003	T
MYO18A	399687	genome.wustl.edu	37	17	27424325	27424325	+	Silent	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr17:27424325C>T	ENST00000527372.1	-	27	4326	c.4146G>A	c.(4144-4146)gtG>gtA	p.V1382V	MYO18A_ENST00000531253.1_Silent_p.V1382V|MYO18A_ENST00000533112.1_Silent_p.V1382V|MYO18A_ENST00000354329.4_Silent_p.V1382V	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1382					actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			TGGTGAAGTCCACCTCCCGCA	0.627																																					Esophageal Squamous(182;472 2015 7001 15270 22562)	dbGAP											0													51.0	55.0	53.0					17																	27424325		2077	4193	6270	-	-	-	SO:0001819	synonymous_variant	0			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.4146G>A	17.37:g.27424325C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.V1382	ENST00000527372.1	37	c.4146	CCDS45642.1	17																																																																																			MYO18A	-	pfam_Myosin_tail	ENSG00000196535		0.627	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	46	0.00	0	C	NM_078471		27424325	27424325	-1	no_errors	ENST00000354329	ensembl	human	known	69_37n	silent	171	20.37	44	SNP	1.000	T
NCR2	9436	genome.wustl.edu	37	6	41309625	41309625	+	Missense_Mutation	SNP	G	G	T	rs35180361	byFrequency	TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr6:41309625G>T	ENST00000373089.5	+	3	576	c.488G>T	c.(487-489)aGa>aTa	p.R163I	NCR2_ENST00000373083.4_Missense_Mutation_p.R163I|NCR2_ENST00000373086.3_Missense_Mutation_p.R163I	NM_004828.3	NP_004819.2	O95944	NCTR2_HUMAN	natural cytotoxicity triggering receptor 2	163					cellular defense response (GO:0006968)|innate immune response (GO:0045087)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	14	Ovarian(28;0.0327)|Colorectal(47;0.196)					GCAGGAGCCAGACAAGCCCCT	0.642																																						dbGAP											0													92.0	86.0	88.0					6																	41309625		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ225109	CCDS4855.1, CCDS56428.1, CCDS56429.1	6p21.1	2013-01-11	2002-11-13	2002-11-15	ENSG00000096264	ENSG00000096264		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	6732	protein-coding gene	gene with protein product		604531	"""lymphocyte antigen 95 (activating NK-receptor; NK-p44)"""	LY95		10049942	Standard	NM_004828		Approved	NK-p44, CD336	uc003oqh.2	O95944	OTTHUMG00000014678	ENST00000373089.5:c.488G>T	6.37:g.41309625G>T	ENSP00000362181:p.Arg163Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H562|Q9H563|Q9H564|Q9UMT1|Q9UMT2	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.R163I	ENST00000373089.5	37	c.488	CCDS4855.1	6	.	.	.	.	.	.	.	.	.	.	G	2.116	-0.402625	0.04865	.	.	ENSG00000096264	ENST00000373083;ENST00000373089;ENST00000373086	T;T;T	0.15256	2.45;2.58;2.44	1.78	-1.8	0.07907	.	.	.	.	.	T	0.02848	0.0085	N	0.19112	0.55	0.09310	N	1	B;B;B	0.26775	0.002;0.09;0.159	B;B;B	0.21546	0.009;0.025;0.035	T	0.42396	-0.9454	9	0.30078	T	0.28	.	9.1711	0.37081	0.0:0.6349:0.3651:0.0	.	163;163;163	O95944-3;O95944-2;O95944	.;.;NCTR2_HUMAN	I	163	ENSP00000362175:R163I;ENSP00000362181:R163I;ENSP00000362178:R163I	ENSP00000362175:R163I	R	+	2	0	NCR2	41417603	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.243000	0.08915	-0.526000	0.06383	-0.538000	0.04264	AGA	NCR2	-	NULL	ENSG00000096264		0.642	NCR2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCR2	HGNC	protein_coding	OTTHUMT00000040511.3	96	0.00	0	G			41309625	41309625	+1	no_errors	ENST00000373089	ensembl	human	known	69_37n	missense	87	40.82	60	SNP	0.001	T
NT5E	4907	genome.wustl.edu	37	6	86197087	86197087	+	Silent	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr6:86197087G>A	ENST00000257770.3	+	5	1033	c.984G>A	c.(982-984)agG>agA	p.R328R	NT5E_ENST00000369651.3_Silent_p.R328R	NM_002526.3	NP_002517.1	P21589	5NTD_HUMAN	5'-nucleotidase, ecto (CD73)	328					adenosine biosynthetic process (GO:0046086)|AMP catabolic process (GO:0006196)|dephosphorylation (GO:0016311)|DNA metabolic process (GO:0006259)|negative regulation of inflammatory response (GO:0050728)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(9)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		all_cancers(76;0.000215)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0427)		BRCA - Breast invasive adenocarcinoma(108;0.0417)	Cytarabine(DB00987)|Pentoxifylline(DB00806)	ACAAATGGAGGATAAAATTGG	0.378																																					Melanoma(140;797 1765 2035 2752 18208)	dbGAP											0													104.0	106.0	106.0					6																	86197087		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X55740	CCDS5002.1, CCDS56439.1	6q14-q21	2013-08-28	2002-04-18	2002-04-19	ENSG00000135318	ENSG00000135318	3.1.3.5	"""CD molecules"""	8021	protein-coding gene	gene with protein product		129190	"""5' nucleotidase (CD73)"""	NT5			Standard	NM_002526		Approved	CD73, eN, eNT, CALJA	uc003pko.4	P21589	OTTHUMG00000015139	ENST00000257770.3:c.984G>A	6.37:g.86197087G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQI8|O75520|Q5W116	Missense_Mutation	SNP	pfam_5'-Nucleotdase_C,superfamily_5'-Nucleotdase_C	p.G93E	ENST00000257770.3	37	c.278	CCDS5002.1	6	.	.	.	.	.	.	.	.	.	.	G	3.109	-0.182993	0.06340	.	.	ENSG00000135318	ENST00000416334;ENST00000437581	.	.	.	5.38	2.61	0.31194	.	.	.	.	.	T	0.39989	0.1099	.	.	.	0.49582	D	0.999803	.	.	.	.	.	.	T	0.22452	-1.0216	4	.	.	.	-9.439	7.2401	0.26092	0.2526:0.0:0.6264:0.121	.	.	.	.	E	93;24	.	.	G	+	2	0	NT5E	86253806	0.378000	0.25114	0.083000	0.20561	0.581000	0.36288	0.699000	0.25586	0.020000	0.15106	-1.151000	0.01829	GGA	NT5E	-	NULL	ENSG00000135318		0.378	NT5E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5E	HGNC	protein_coding	OTTHUMT00000041388.1	142	0.00	0	G			86197087	86197087	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000416334	ensembl	human	known	69_37n	missense	85	29.75	36	SNP	0.624	A
NUDCD1	84955	genome.wustl.edu	37	8	110308645	110308645	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:110308645C>A	ENST00000239690.4	-	3	801	c.427G>T	c.(427-429)Gaa>Taa	p.E143*	RP11-122A21.2_ENST00000504175.2_RNA|NUDCD1_ENST00000427660.2_Nonsense_Mutation_p.E114*	NM_032869.3	NP_116258.2			NudC domain containing 1											breast(1)|kidney(1)|large_intestine(4)|lung(15)|ovary(1)|prostate(2)|skin(1)	25	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;1.56e-12)			TTTCCACGTTCACCTGTTCCA	0.398																																						dbGAP											0													233.0	219.0	224.0					8																	110308645		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF283302	CCDS6312.1, CCDS47910.1	8q23	2005-02-07			ENSG00000120526	ENSG00000120526			24306	protein-coding gene	gene with protein product		606109				11416219	Standard	NM_032869		Approved	CML66, FLJ14991	uc003ynb.4	Q96RS6	OTTHUMG00000164931	ENST00000239690.4:c.427G>T	8.37:g.110308645C>A	ENSP00000239690:p.Glu143*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_CS_domain,superfamily_HSP20-like_chaperone,pfscan_CS-like_domain	p.E143*	ENST00000239690.4	37	c.427	CCDS6312.1	8	.	.	.	.	.	.	.	.	.	.	C	39	7.787067	0.98489	.	.	ENSG00000120526	ENST00000239690;ENST00000427660	.	.	.	5.84	5.84	0.93424	.	0.155329	0.56097	D	0.000034	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07813	T	0.8	-10.9555	8.5742	0.33587	0.0:0.8386:0.0:0.1614	.	.	.	.	X	143;114	.	ENSP00000239690:E143X	E	-	1	0	NUDCD1	110377821	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.651000	0.61447	2.779000	0.95612	0.591000	0.81541	GAA	NUDCD1	-	NULL	ENSG00000120526		0.398	NUDCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDCD1	HGNC	protein_coding	OTTHUMT00000380996.1	234	0.00	0	C	NM_032869		110308645	110308645	-1	no_errors	ENST00000239690	ensembl	human	known	69_37n	nonsense	401	16.91	82	SNP	1.000	A
NXF5	55998	genome.wustl.edu	37	X	101091722	101091722	+	Silent	SNP	A	A	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:101091722A>G	ENST00000361708.2	-	16	1523	c.1164T>C	c.(1162-1164)ccT>ccC	p.P388P	NXF5_ENST00000537026.1_Intron|NXF5_ENST00000473265.2_Intron			Q9H1B4	NXF5_HUMAN	nuclear RNA export factor 5	388					mRNA export from nucleus (GO:0006406)|multicellular organismal development (GO:0007275)|RNA transport (GO:0050658)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(16)|skin(1)	30						TTGCGGCCAGAGGTAGTGATG	0.532																																						dbGAP											0													271.0	191.0	218.0					X																	101091722		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277654	CCDS14491.1, CCDS14491.2	Xq22	2008-07-28			ENSG00000126952	ENSG00000126952			8075	protein-coding gene	gene with protein product		300319				11566096	Standard	NM_032946		Approved		uc011mrk.1	Q9H1B4	OTTHUMG00000022042	ENST00000361708.2:c.1164T>C	X.37:g.101091722A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRM0|B1AV82|B1AV83|B1AV84|B1AV85|Q9H1B0|Q9H1B1|Q9H1B2|Q9H1B3	Silent	SNP	pfam_Tap_RNA-bd	p.P388	ENST00000361708.2	37	c.1164		X																																																																																			NXF5	-	NULL	ENSG00000126952		0.532	NXF5-201	KNOWN	basic	protein_coding	NXF5	HGNC	protein_coding		217	0.00	0	A			101091722	101091722	-1	no_errors	ENST00000263032	ensembl	human	known	69_37n	silent	454	22.50	133	SNP	0.001	G
OR51B6	390058	genome.wustl.edu	37	11	5373049	5373049	+	Silent	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:5373049T>A	ENST00000380219.1	+	1	312	c.312T>A	c.(310-312)acT>acA	p.T104T	HBG2_ENST00000380252.1_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380259.2_Intron|HBE1_ENST00000380237.1_Intron	NM_001004750.1	NP_001004750.1	Q9H340	O51B6_HUMAN	olfactory receptor, family 51, subfamily B, member 6	104					detection of chemical stimulus involved in sensory perception of smell (GO:0050911)|sensory perception of smell (GO:0007608)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|urinary_tract(1)	21		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TTATCCATACTCTTTCTGTCA	0.483																																						dbGAP											0													124.0	119.0	121.0					11																	5373049		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0				CCDS31379.1	11p15.4	2012-08-09			ENSG00000176239	ENSG00000176239		"""GPCR / Class A : Olfactory receptors"""	19600	protein-coding gene	gene with protein product							Standard	NM_001004750		Approved		uc010qzb.2	Q9H340	OTTHUMG00000066669	ENST00000380219.1:c.312T>A	11.37:g.5373049T>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	p.T104	ENST00000380219.1	37	c.312	CCDS31379.1	11																																																																																			OR51B6	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000176239		0.483	OR51B6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51B6	HGNC	protein_coding	OTTHUMT00000142960.1	124	0.00	0	T	NM_001004750		5373049	5373049	+1	no_errors	ENST00000380219	ensembl	human	known	69_37n	silent	172	19.63	42	SNP	0.237	A
PIK3C2A	5286	genome.wustl.edu	37	11	17121503	17121503	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:17121503C>T	ENST00000265970.7	-	25	4021	c.4022G>A	c.(4021-4023)gGg>gAg	p.G1341E	PIK3C2A_ENST00000540361.1_Missense_Mutation_p.G961E|PIK3C2A_ENST00000531428.1_5'UTR	NM_002645.2	NP_002636.2	O00443	P3C2A_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 alpha	1341	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				clathrin coat assembly (GO:0048268)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|exocytosis (GO:0006887)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|small molecule metabolic process (GO:0044281)|vascular smooth muscle contraction (GO:0014829)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol binding (GO:0035091)			central_nervous_system(4)|endometrium(5)|kidney(5)|large_intestine(7)|lung(24)|ovary(3)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	58						TTCTGGTAACCCTGAAGGAAT	0.363																																						dbGAP											0													88.0	89.0	89.0					11																	17121503		2200	4291	6491	-	-	-	SO:0001583	missense	0			Y13367	CCDS7824.1	11p15.5-p14	2012-07-13	2012-07-13			ENSG00000011405	2.7.1.154		8971	protein-coding gene	gene with protein product		603601	"""phosphoinositide-3-kinase, class 2, alpha polypeptide"""			9337861	Standard	NM_002645		Approved	PI3K-C2alpha	uc001mmq.4	O00443		ENST00000265970.7:c.4022G>A	11.37:g.17121503C>T	ENSP00000265970:p.Gly1341Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH2|B4E2G4|Q14CQ9	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_C2_Ca-dep,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.G1341E	ENST00000265970.7	37	c.4022	CCDS7824.1	11	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421031	0.83559	.	.	ENSG00000011405	ENST00000265970;ENST00000540361	T;T	0.81078	-1.45;-1.45	5.43	5.43	0.79202	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.046661	0.85682	D	0.000000	D	0.91026	0.7177	M	0.90759	3.145	0.80722	D	1	D	0.61080	0.989	P	0.61201	0.885	D	0.91879	0.5514	10	0.56958	D	0.05	-5.2439	19.6092	0.95599	0.0:1.0:0.0:0.0	.	1341	O00443	P3C2A_HUMAN	E	1341;961	ENSP00000265970:G1341E;ENSP00000438687:G961E	ENSP00000265970:G1341E	G	-	2	0	PIK3C2A	17078079	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.935000	0.70145	2.711000	0.92665	0.655000	0.94253	GGG	PIK3C2A	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000011405		0.363	PIK3C2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2A	HGNC	protein_coding	OTTHUMT00000387553.1	102	0.00	0	C	NM_002645		17121503	17121503	-1	no_errors	ENST00000265970	ensembl	human	known	69_37n	missense	85	39.72	56	SNP	1.000	T
PKIB	5570	genome.wustl.edu	37	6	123038978	123038978	+	Silent	SNP	T	T	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr6:123038978T>C	ENST00000368448.1	+	5	666	c.39T>C	c.(37-39)tcT>tcC	p.S13S	PKIB_ENST00000258014.3_Silent_p.S20S|PKIB_ENST00000392490.1_Silent_p.S13S|PKIB_ENST00000354275.2_Silent_p.S13S|PKIB_ENST00000368446.1_Silent_p.S22S|PKIB_ENST00000392491.2_Silent_p.S13S|PKIB_ENST00000368452.2_Silent_p.S13S			Q9C010	IPKB_HUMAN	protein kinase (cAMP-dependent, catalytic) inhibitor beta	13							cAMP-dependent protein kinase inhibitor activity (GO:0004862)			large_intestine(3)|lung(1)	4				GBM - Glioblastoma multiforme(226;0.164)		ACGTGGAGTCTGGGGTCGCCA	0.473																																						dbGAP											0													122.0	116.0	118.0					6																	123038978		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS5126.1, CCDS59033.1	6q21-q22.1	2008-05-27			ENSG00000135549	ENSG00000135549			9018	protein-coding gene	gene with protein product		606914		PRKACN2		10880337	Standard	NM_181795		Approved		uc003pzc.4	Q9C010	OTTHUMG00000015488	ENST00000368448.1:c.39T>C	6.37:g.123038978T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCK2|Q567T9|Q5T0Z7	Silent	SNP	pfam_cAMP_dep_PKI,pirsf_cAMP_dep_PKI	p.S22	ENST00000368448.1	37	c.66	CCDS5126.1	6																																																																																			PKIB	-	pfam_cAMP_dep_PKI,pirsf_cAMP_dep_PKI	ENSG00000135549		0.473	PKIB-004	KNOWN	basic|appris_principal|CCDS	protein_coding	PKIB	HGNC	protein_coding	OTTHUMT00000042035.1	53	0.00	0	T			123038978	123038978	+1	no_errors	ENST00000368446	ensembl	human	known	69_37n	silent	49	33.33	25	SNP	0.271	C
PLXNA4	91584	genome.wustl.edu	37	7	131887475	131887475	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr7:131887475G>A	ENST00000359827.3	-	12	3478	c.2516C>T	c.(2515-2517)cCt>cTt	p.P839L	PLXNA4_ENST00000321063.4_Missense_Mutation_p.P839L			Q9HCM2	PLXA4_HUMAN	plexin A4	839	PSI 3.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)	p.P839H(2)		NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						CTCCTGGGCAGGGCAGTGCTG	0.657																																						dbGAP											2	Substitution - Missense(2)	lung(2)											29.0	32.0	31.0					7																	131887475		2057	4200	6257	-	-	-	SO:0001583	missense	0			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2516C>T	7.37:g.131887475G>A	ENSP00000352882:p.Pro839Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.P839L	ENST00000359827.3	37	c.2516	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	G	13.89	2.371997	0.42003	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.16743	2.32;2.32	4.5	4.5	0.54988	.	0.129095	0.53938	D	0.000042	T	0.15046	0.0363	L	0.46885	1.475	0.54753	D	0.99998	B	0.06786	0.001	B	0.12837	0.008	T	0.04229	-1.0967	10	0.41790	T	0.15	.	8.4421	0.32820	0.1721:0.0:0.8279:0.0	.	839	Q9HCM2	PLXA4_HUMAN	L	839	ENSP00000323194:P839L;ENSP00000352882:P839L	ENSP00000323194:P839L	P	-	2	0	PLXNA4	131538015	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	3.729000	0.54999	2.350000	0.79820	0.561000	0.74099	CCT	PLXNA4	-	pfam_Plexin_repeat,superfamily_Plexin-like_fold,smart_Plexin-like	ENSG00000221866		0.657	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	25	0.00	0	G	NM_181775		131887475	131887475	-1	no_errors	ENST00000321063	ensembl	human	known	69_37n	missense	60	21.05	16	SNP	0.992	A
PNPO	55163	genome.wustl.edu	37	17	46023746	46023746	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr17:46023746A>T	ENST00000225573.4	+	6	709	c.604A>T	c.(604-606)Aag>Tag	p.K202*	PNPO_ENST00000544840.1_Nonsense_Mutation_p.K184*|PNPO_ENST00000434554.2_Nonsense_Mutation_p.K159*|RP11-6N17.9_ENST00000582262.1_RNA|RP11-6N17.6_ENST00000582142.1_RNA|RP11-6N17.6_ENST00000580372.1_RNA|PNPO_ENST00000534893.1_Nonsense_Mutation_p.K107*	NM_018129.3	NP_060599.1	Q9NVS9	PNPO_HUMAN	pyridoxamine 5'-phosphate oxidase	202					pyridoxine biosynthetic process (GO:0008615)|small molecule metabolic process (GO:0044281)|vitamin B6 metabolic process (GO:0042816)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	FMN binding (GO:0010181)|pyridoxamine-phosphate oxidase activity (GO:0004733)			endometrium(2)|large_intestine(1)|lung(1)|urinary_tract(1)	5						AGAGGTGCCCAAGCCAAAATC	0.517																																						dbGAP											0													72.0	76.0	75.0					17																	46023746		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF468030	CCDS11522.1	17q21.32	2008-11-27	2006-07-12			ENSG00000108439	1.4.3.5		30260	protein-coding gene	gene with protein product		603287	"""pyridoxine 5'-phosphate oxidase"""			9601034, 15182361	Standard	NM_018129		Approved	PDXPO	uc002imo.3	Q9NVS9		ENST00000225573.4:c.604A>T	17.37:g.46023746A>T	ENSP00000225573:p.Lys202*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E0V0|B4E152|B4E1D7|D3DTT9	Nonsense_Mutation	SNP	pfam_Pyridox_Oxase_FMN-bd,pfam_Pyridoxamine_oxidase_dimer_C,superfamily_Split_barrel_FMN-bd-related,tigrfam_Pyridox_Oxase	p.K202*	ENST00000225573.4	37	c.604	CCDS11522.1	17	.	.	.	.	.	.	.	.	.	.	A	26.9	4.781921	0.90282	.	.	ENSG00000108439	ENST00000225573;ENST00000434554;ENST00000544840;ENST00000534893	.	.	.	5.31	5.31	0.75309	.	0.092672	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.31617	T	0.26	-7.1168	14.2353	0.65922	1.0:0.0:0.0:0.0	.	.	.	.	X	202;159;184;107	.	ENSP00000225573:K202X	K	+	1	0	PNPO	43378745	1.000000	0.71417	0.967000	0.41034	0.938000	0.57974	8.314000	0.89980	2.002000	0.58637	0.459000	0.35465	AAG	PNPO	-	superfamily_Split_barrel_FMN-bd-related,tigrfam_Pyridox_Oxase	ENSG00000108439		0.517	PNPO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PNPO	HGNC	protein_coding	OTTHUMT00000441407.1	84	0.00	0	A	NM_018129		46023746	46023746	+1	no_errors	ENST00000225573	ensembl	human	known	69_37n	nonsense	68	48.48	64	SNP	0.998	T
POLA1	5422	genome.wustl.edu	37	X	24760174	24760174	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:24760174C>T	ENST00000379059.3	+	22	2399	c.2384C>T	c.(2383-2385)gCa>gTa	p.A795V	POLA1_ENST00000379068.3_Missense_Mutation_p.A801V|SCARNA23_ENST00000516060.1_RNA	NM_016937.3	NP_058633.2	P09884	DPOLA_HUMAN	polymerase (DNA directed), alpha 1, catalytic subunit	795					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA replication, synthesis of RNA primer (GO:0006269)|DNA strand elongation involved in DNA replication (GO:0006271)|double-strand break repair via nonhomologous end joining (GO:0006303)|G1/S transition of mitotic cell cycle (GO:0000082)|lagging strand elongation (GO:0006273)|leading strand elongation (GO:0006272)|mitotic cell cycle (GO:0000278)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0000083)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|translesion synthesis (GO:0019985)|viral process (GO:0016032)	alpha DNA polymerase:primase complex (GO:0005658)|cytoplasm (GO:0005737)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|4 iron, 4 sulfur cluster binding (GO:0051539)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleoside binding (GO:0001882)|nucleotide binding (GO:0000166)|protein kinase binding (GO:0019901)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|ovary(2)|skin(2)	11					Cladribine(DB00242)|Clofarabine(DB00631)|Fludarabine(DB01073)|Nelarabine(DB01280)	TTGCTTCATGCATTTTACGAA	0.383																																						dbGAP											0													107.0	96.0	100.0					X																	24760174		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS14214.1	Xp22.1-p21.3	2014-01-30	2008-08-07	2006-09-26	ENSG00000101868	ENSG00000101868	2.7.7.7	"""DNA polymerases"""	9173	protein-coding gene	gene with protein product		312040	"""polymerase (DNA directed), alpha"", ""polymerase (DNA directed), alpha 1"", ""N syndrome (mental retardation, malformations, chromosome breakage)"""	POLA, NSX		1689958	Standard	NM_016937		Approved	p180	uc004dbl.3	P09884	OTTHUMG00000021277	ENST00000379059.3:c.2384C>T	X.37:g.24760174C>T	ENSP00000368349:p.Ala795Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UQ7	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,pfam_Znf_DNA-dir_DNA_pol_B_alpha,pfam_DNA_pol_a_cat_su_N,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	p.A801V	ENST00000379059.3	37	c.2402	CCDS14214.1	X	.	.	.	.	.	.	.	.	.	.	C	25.9	4.686299	0.88639	.	.	ENSG00000101868	ENST00000379068;ENST00000379059	T;T	0.18174	2.23;2.23	5.09	5.09	0.68999	DNA-directed DNA polymerase, family B, multifunctional domain (1);Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.45736	0.1357	M	0.80422	2.495	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.43572	-0.9383	10	0.45353	T	0.12	-11.4511	17.674	0.88225	0.0:1.0:0.0:0.0	.	795	P09884	DPOLA_HUMAN	V	801;795	ENSP00000368358:A801V;ENSP00000368349:A795V	ENSP00000368349:A795V	A	+	2	0	POLA1	24670095	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	5.545000	0.67237	2.360000	0.80028	0.544000	0.68410	GCA	POLA1	-	pfam_DNA-dir_DNA_pol_B_multi_dom,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,tigrfam_DNA-dir_DNA_pol_B_pol2	ENSG00000101868		0.383	POLA1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	POLA1	HGNC	protein_coding	OTTHUMT00000056111.1	106	0.00	0	C	NM_016937		24760174	24760174	+1	no_errors	ENST00000379068	ensembl	human	known	69_37n	missense	118	26.71	43	SNP	1.000	T
PRUNE2	158471	genome.wustl.edu	37	9	79324986	79324986	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr9:79324986T>A	ENST00000376718.3	-	8	2327	c.2204A>T	c.(2203-2205)gAg>gTg	p.E735V	PRUNE2_ENST00000428286.1_Missense_Mutation_p.E376V	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	735					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CAAGCTTTCCTCATTTTTGTC	0.448																																						dbGAP											0													56.0	52.0	53.0					9																	79324986		1568	3582	5150	-	-	-	SO:0001583	missense	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.2204A>T	9.37:g.79324986T>A	ENSP00000365908:p.Glu735Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.E376V	ENST00000376718.3	37	c.1127	CCDS47982.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	9.739|9.739	1.164274|1.164274	0.21538|0.21538	.|.	.|.	ENSG00000106772|ENSG00000106772	ENST00000376718;ENST00000428286;ENST00000422033|ENST00000426088	T;T|.	0.23950|.	1.88;1.88|.	5.97|5.97	4.82|4.82	0.62117|0.62117	.|.	0.000000|.	0.51477|.	D|.	0.000084|.	T|.	0.65698|.	0.2716|.	M|M	0.67953|0.67953	2.075|2.075	0.49687|0.49687	D|D	0.99981|0.99981	D|.	0.89917|.	1.0|.	D|.	0.74674|.	0.984|.	T|.	0.65348|.	-0.6190|.	10|.	0.87932|.	D|.	0|.	-18.9423|-18.9423	11.0717|11.0717	0.48008|0.48008	0.0:0.0712:0.0:0.9288|0.0:0.0712:0.0:0.9288	.|.	735|.	Q8WUY3|.	PRUN2_HUMAN|.	V|C	735;376;734|56	ENSP00000365908:E735V;ENSP00000397425:E376V|.	ENSP00000365908:E735V|.	E|X	-|-	2|3	0|0	PRUNE2|PRUNE2	78514806|78514806	0.336000|0.336000	0.24757|0.24757	0.059000|0.059000	0.19551|0.19551	0.013000|0.013000	0.08279|0.08279	2.694000|2.694000	0.47035|0.47035	2.288000|2.288000	0.76882|0.76882	0.533000|0.533000	0.62120|0.62120	GAG|TGA	PRUNE2	-	NULL	ENSG00000106772		0.448	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	102	0.00	0	T	NM_138818		79324986	79324986	-1	no_errors	ENST00000428286	ensembl	human	known	69_37n	missense	152	20.83	40	SNP	0.274	A
PSKH1	5681	genome.wustl.edu	37	16	67942876	67942876	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr16:67942876C>G	ENST00000291041.5	+	2	394	c.224C>G	c.(223-225)tCa>tGa	p.S75*		NM_006742.2	NP_006733.1	P11801	KPSH1_HUMAN	protein serine kinase H1	75						cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(2)|large_intestine(1)|lung(7)|pancreas(1)	12		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0044)|Epithelial(162;0.0197)|all cancers(182;0.128)		GAGCCTCCCTCAGAACCACCA	0.607																																						dbGAP											0													63.0	57.0	59.0					16																	67942876		2198	4300	6498	-	-	-	SO:0001587	stop_gained	0			M14504	CCDS10851.1	16q22.1	2008-02-05			ENSG00000159792	ENSG00000159792			9529	protein-coding gene	gene with protein product		177015				8268911	Standard	NM_006742		Approved		uc002euv.3	P11801	OTTHUMG00000137548	ENST00000291041.5:c.224C>G	16.37:g.67942876C>G	ENSP00000291041:p.Ser75*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NY19	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S75*	ENST00000291041.5	37	c.224	CCDS10851.1	16	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434456	0.62955	.	.	ENSG00000159792	ENST00000291041	.	.	.	4.21	4.21	0.49690	.	0.388549	0.23132	N	0.051562	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-4.5249	8.1675	0.31235	0.0:0.8944:0.0:0.1056	.	.	.	.	X	75	.	ENSP00000291041:S75X	S	+	2	0	PSKH1	66500377	0.505000	0.26131	0.962000	0.40283	0.913000	0.54294	1.503000	0.35715	2.645000	0.89757	0.655000	0.94253	TCA	PSKH1	-	NULL	ENSG00000159792		0.607	PSKH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSKH1	HGNC	protein_coding	OTTHUMT00000268882.3	63	0.00	0	C	NM_006742		67942876	67942876	+1	no_errors	ENST00000291041	ensembl	human	known	69_37n	nonsense	172	23.89	54	SNP	0.892	G
PXDNL	137902	genome.wustl.edu	37	8	52336142	52336142	+	Silent	SNP	T	T	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:52336142T>G	ENST00000356297.4	-	14	1888	c.1788A>C	c.(1786-1788)acA>acC	p.T596T	PXDNL_ENST00000543296.1_Silent_p.T596T	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	596	Ig-like C2-type 4.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				TACCCGTGACTGTAAGAAACA	0.453																																						dbGAP											0													99.0	103.0	102.0					8																	52336142		2062	4211	6273	-	-	-	SO:0001819	synonymous_variant	0				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1788A>C	8.37:g.52336142T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Silent	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,prints_Haem_peroxidase_animal_subgr,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like	p.T596	ENST00000356297.4	37	c.1788	CCDS47855.1	8																																																																																			PXDNL	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000147485		0.453	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	111	0.00	0	T	NM_144651		52336142	52336142	-1	no_errors	ENST00000356297	ensembl	human	known	69_37n	silent	217	21.94	61	SNP	0.012	G
QSER1	79832	genome.wustl.edu	37	11	32956801	32956801	+	Missense_Mutation	SNP	G	G	A	rs201406150		TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:32956801G>A	ENST00000399302.2	+	4	3945	c.3610G>A	c.(3610-3612)Gtg>Atg	p.V1204M	QSER1_ENST00000527788.1_Missense_Mutation_p.V965M	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	1204										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					CACACCTTTAGTGTCTGAAAC	0.438																																						dbGAP											0													118.0	116.0	117.0					11																	32956801		1875	4101	5976	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.3610G>A	11.37:g.32956801G>A	ENSP00000382241:p.Val1204Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.V1204M	ENST00000399302.2	37	c.3610	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	G	0.016	-1.527605	0.00959	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.23552	2.23;1.9	5.31	1.31	0.21738	.	0.879860	0.09703	N	0.766681	T	0.24736	0.0600	L	0.40543	1.245	0.09310	N	1	P;D;P	0.60575	0.755;0.988;0.641	P;P;B	0.49953	0.568;0.627;0.188	T	0.12553	-1.0543	10	0.45353	T	0.12	.	3.2014	0.06651	0.2046:0.1216:0.5548:0.119	.	965;965;1204	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	M	1204;965;965	ENSP00000382241:V1204M;ENSP00000432766:V965M	ENSP00000078652:V965M	V	+	1	0	QSER1	32913377	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.311000	0.08124	-0.002000	0.14469	-1.446000	0.01064	GTG	QSER1	-	NULL	ENSG00000060749		0.438	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	119	0.00	0	G	NM_024774		32956801	32956801	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	129	19.88	32	SNP	0.000	A
RNF213	57674	genome.wustl.edu	37	17	78306165	78306165	+	Silent	SNP	C	C	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr17:78306165C>T	ENST00000582970.1	+	21	4020	c.3877C>T	c.(3877-3879)Cta>Tta	p.L1293L	RNF213_ENST00000508628.2_Silent_p.L1342L|RNF213_ENST00000456466.1_Silent_p.L1293L	NM_001256071.1	NP_001243000.1	Q63HN8	RN213_HUMAN	ring finger protein 213	1293					ATP catabolic process (GO:0006200)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATPase activity (GO:0016887)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(7)|central_nervous_system(1)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(23)|lung(36)|ovary(11)|pancreas(2)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	130	all_neural(118;0.0538)		BRCA - Breast invasive adenocarcinoma(99;0.0252)|OV - Ovarian serous cystadenocarcinoma(97;0.057)			GCACCAGGATCTAAAGTCAGG	0.423																																						dbGAP											0													49.0	43.0	45.0					17																	78306165		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK074030	CCDS58606.1	17q25.3	2013-01-09	2007-02-08	2007-02-08		ENSG00000173821		"""RING-type (C3HC4) zinc fingers"""	14539	protein-coding gene	gene with protein product		613768	"""chromosome 17 open reading frame 27"", ""KIAA1618"", ""moyamoya disease 2"", ""Moyamoya disease 2"""	C17orf27, KIAA1618, MYMY2		10997877, 21048783, 21799892	Standard	NM_020954		Approved	KIAA1554, NET57	uc021uen.2	Q63HN8		ENST00000582970.1:c.3877C>T	17.37:g.78306165C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JCP4|D6RI12|F8WKS1|Q658P6|Q69YK7|Q6MZR1|Q8IWF4|Q8IZX1|Q8IZX2|Q8N406|Q8TEU0|Q9H6C9|Q9H6H9|Q9H6P3|Q9H8A9|Q9HCF4|Q9HCL8	Silent	SNP	smart_AAA+_ATPase,smart_Znf_RING,pfscan_Znf_RING	p.L1293	ENST00000582970.1	37	c.3877	CCDS58606.1	17																																																																																			RNF213	-	NULL	ENSG00000173821		0.423	RNF213-020	KNOWN	basic|appris_candidate|CCDS	protein_coding	RNF213	HGNC	protein_coding	OTTHUMT00000443298.1	47	0.00	0	C	NM_020914		78306165	78306165	+1	no_errors	ENST00000582970	ensembl	human	known	69_37n	silent	64	16.88	13	SNP	0.949	T
SCIN	85477	genome.wustl.edu	37	7	12620847	12620847	+	Splice_Site	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr7:12620847G>A	ENST00000297029.5	+	3	617		c.e3+1			NM_001112706.2	NP_001106177.1	Q9Y6U3	ADSV_HUMAN	scinderin						actin filament capping (GO:0051693)|actin filament severing (GO:0051014)|actin nucleation (GO:0045010)|calcium ion-dependent exocytosis (GO:0017156)|negative regulation of cell proliferation (GO:0008285)|positive regulation of apoptotic process (GO:0043065)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of secretion (GO:0051047)|regulation of chondrocyte differentiation (GO:0032330)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)	1-phosphatidylinositol binding (GO:0005545)|actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			endometrium(3)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)	17				UCEC - Uterine corpus endometrioid carcinoma (126;0.195)		CCTTGGCACCGTAAGTTTCAT	0.413																																						dbGAP											0													119.0	92.0	100.0					7																	12620847		692	1591	2283	-	-	-	SO:0001630	splice_region_variant	0			AF276507	CCDS47545.1, CCDS47546.1	7p21.3	2006-04-25			ENSG00000006747	ENSG00000006747			21695	protein-coding gene	gene with protein product		613416					Standard	NM_033128		Approved	adseverin, KIAA1905	uc003ssn.4	Q9Y6U3	OTTHUMG00000152385	ENST00000297029.5:c.516+1G>A	7.37:g.12620847G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2U8|Q8NBZ6|Q8WU97|Q96JC7|Q96PY2	Splice_Site	SNP	-	e3+1	ENST00000297029.5	37	c.516+1	CCDS47545.1	7	.	.	.	.	.	.	.	.	.	.	G	25.9	4.685995	0.88639	.	.	ENSG00000006747	ENST00000297029	.	.	.	5.11	5.11	0.69529	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.529	0.90984	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCIN	12587372	1.000000	0.71417	0.996000	0.52242	0.977000	0.68977	9.869000	0.99810	2.384000	0.81235	0.655000	0.94253	.	SCIN	-	-	ENSG00000006747		0.413	SCIN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCIN	HGNC	protein_coding	OTTHUMT00000326041.1	91	0.00	0	G	NM_033128	Intron	12620847	12620847	+1	no_errors	ENST00000297029	ensembl	human	known	69_37n	splice_site	145	26.26	52	SNP	1.000	A
SEC14L5	9717	genome.wustl.edu	37	16	5038149	5038149	+	Splice_Site	SNP	G	G	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr16:5038149G>T	ENST00000251170.7	+	4	393		c.e4-1			NM_014692.1	NP_055507.1	O43304	S14L5_HUMAN	SEC14-like 5 (S. cerevisiae)							integral component of membrane (GO:0016021)|intracellular (GO:0005622)	transporter activity (GO:0005215)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(9)|ovary(1)|skin(1)	29						TTCCCTTGCAGATCGCAGGTG	0.637																																						dbGAP											0													43.0	44.0	43.0					16																	5038149		2047	4170	6217	-	-	-	SO:0001630	splice_region_variant	0			AB007880	CCDS45403.1	16p13.3	2008-02-05				ENSG00000103184			29032	protein-coding gene	gene with protein product						9455477	Standard	NM_014692		Approved	KIAA0420, PRELID4B	uc002cye.2	O43304		ENST00000251170.7:c.214-1G>T	16.37:g.5038149G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e3-1	ENST00000251170.7	37	c.214-1	CCDS45403.1	16	.	.	.	.	.	.	.	.	.	.	G	33	5.230121	0.95207	.	.	ENSG00000103184	ENST00000251170	.	.	.	4.33	4.33	0.51752	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.0073	0.86396	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SEC14L5	4978150	1.000000	0.71417	0.658000	0.29665	0.717000	0.41224	8.992000	0.93519	2.254000	0.74563	0.491000	0.48974	.	SEC14L5	-	-	ENSG00000103184		0.637	SEC14L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L5	HGNC	protein_coding	OTTHUMT00000434379.1	15	0.00	0	G		Intron	5038149	5038149	+1	no_errors	ENST00000251170	ensembl	human	known	69_37n	splice_site	79	24.04	25	SNP	1.000	T
SERP1	27230	genome.wustl.edu	37	3	150321284	150321284	+	5'Flank	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr3:150321284T>A	ENST00000479209.1	-	0	0				SELT_ENST00000485923.1_5'UTR|SELT_ENST00000471696.1_Silent_p.I45I|SELT_ENST00000480740.1_Intron|SELT_ENST00000477889.1_5'UTR|SERP1_ENST00000490945.1_5'Flank			Q9Y6X1	SERP1_HUMAN	stress-associated endoplasmic reticulum protein 1						activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|endoplasmic reticulum unfolded protein response (GO:0030968)|glucose metabolic process (GO:0006006)|multicellular organismal aging (GO:0010259)|muscle organ morphogenesis (GO:0048644)|plasma membrane organization (GO:0007009)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of organ growth (GO:0046622)|positive regulation of translation (GO:0045727)|post-embryonic development (GO:0009791)|protein glycosylation (GO:0006486)|protein transport (GO:0015031)|response to stress (GO:0006950)|skeletal system development (GO:0001501)	cytoplasmic microtubule (GO:0005881)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|ribosome (GO:0005840)				large_intestine(1)|lung(3)	4			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			AGTTCCAGATTTGGTGAGTAT	0.667																																						dbGAP											0													12.0	15.0	14.0					3																	150321284		1942	4137	6079	-	-	-	SO:0001631	upstream_gene_variant	0			AK125413	CCDS3150.1	3q25.1	2007-12-07	2007-12-07		ENSG00000120742	ENSG00000120742			10759	protein-coding gene	gene with protein product	"""ribosome associated membrane protein 4"""					10601334, 11230166	Standard	NM_014445		Approved	RAMP4, FLJ43424	uc003exy.3	Q9Y6X1	OTTHUMG00000159769		3.37:g.150321284T>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNI6	Silent	SNP	NULL	p.I45	ENST00000479209.1	37	c.135	CCDS3150.1	3																																																																																			RP11-392O18.1	-	NULL	ENSG00000198843		0.667	SERP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SELT	Clone_based_vega_gene	protein_coding	OTTHUMT00000357239.1	21	0.00	0	T	NM_014445		150321284	150321284	+1	no_errors	ENST00000492132	ensembl	human	known	69_37n	silent	24	35.14	13	SNP	1.000	A
SMARCC2	6601	genome.wustl.edu	37	12	56567506	56567506	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr12:56567506C>G	ENST00000267064.4	-	17	1710	c.1624G>C	c.(1624-1626)Gtg>Ctg	p.V542L	SMARCC2_ENST00000550164.1_Missense_Mutation_p.V542L|SMARCC2_ENST00000347471.4_Missense_Mutation_p.V542L|SMARCC2_ENST00000394023.3_Missense_Mutation_p.V542L|RP11-977G19.5_ENST00000553176.1_RNA	NM_003075.3	NP_003066.2	Q8TAQ2	SMRC2_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 2	542					ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome disassembly (GO:0006337)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase II promoter involved in forebrain neuron fate commitment (GO:0021882)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(3)|lung(20)|ovary(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(18;0.123)			TGCAGAGGCACCAGCCCTGAT	0.537																																						dbGAP											0													141.0	146.0	144.0					12																	56567506		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66616	CCDS8907.1, CCDS8908.1, CCDS55835.1	12q13.2	2008-05-14				ENSG00000139613			11105	protein-coding gene	gene with protein product		601734				8804307, 9693044	Standard	NM_001130420		Approved	BAF170, Rsc8, CRACC2	uc001skb.3	Q8TAQ2	OTTHUMG00000170288	ENST00000267064.4:c.1624G>C	12.37:g.56567506C>G	ENSP00000267064:p.Val542Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VTJ5|Q59GV3|Q92923|Q96E12|Q96GY4	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.V542L	ENST00000267064.4	37	c.1624	CCDS8907.1	12	.	.	.	.	.	.	.	.	.	.	C	19.87	3.907243	0.72868	.	.	ENSG00000139613	ENST00000394023;ENST00000550164;ENST00000347471;ENST00000267064	T;T;T	0.45276	0.96;0.97;0.9	4.77	4.77	0.60923	.	0.000000	0.64402	D	0.000001	T	0.62962	0.2471	M	0.73598	2.24	0.50813	D	0.99989	D;D;D;D;D	0.61697	0.984;0.99;0.984;0.984;0.99	D;D;D;D;D	0.70935	0.935;0.971;0.935;0.935;0.971	T	0.58869	-0.7560	10	0.23302	T	0.38	-13.5716	17.4276	0.87530	0.0:1.0:0.0:0.0	.	431;542;547;542;542	B4DF22;F8VTJ5;Q59G16;Q8TAQ2;Q8TAQ2-2	.;.;.;SMRC2_HUMAN;.	L	542	ENSP00000449396:V542L;ENSP00000302919:V542L;ENSP00000267064:V542L	ENSP00000267064:V542L	V	-	1	0	SMARCC2	54853773	0.987000	0.35691	1.000000	0.80357	0.982000	0.71751	2.144000	0.42197	2.579000	0.87056	0.563000	0.77884	GTG	SMARCC2	-	superfamily_Chromodomain-like	ENSG00000139613		0.537	SMARCC2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMARCC2	HGNC	protein_coding	OTTHUMT00000408370.1	74	0.00	0	C			56567506	56567506	-1	no_errors	ENST00000267064	ensembl	human	known	69_37n	missense	107	35.54	59	SNP	1.000	G
SMTN	6525	genome.wustl.edu	37	22	31486977	31486977	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr22:31486977C>A	ENST00000347557.2	+	10	1186	c.968C>A	c.(967-969)tCa>tAa	p.S323*	SMTN_ENST00000333137.7_Nonsense_Mutation_p.S323*|SMTN_ENST00000358743.1_Nonsense_Mutation_p.S323*|SMTN_ENST00000404574.1_5'Flank	NM_001207017.1|NM_006932.4	NP_001193946.1|NP_008863.3	P53814	SMTN_HUMAN	smoothelin	323					muscle organ development (GO:0007517)|smooth muscle contraction (GO:0006939)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			breast(2)|endometrium(2)|large_intestine(5)|lung(9)|ovary(3)|pancreas(1)|prostate(3)	25						GGACCTTCCTCATTCCAGCGG	0.602																																						dbGAP											0													120.0	111.0	114.0					22																	31486977		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY061972	CCDS13886.1, CCDS13887.1, CCDS13888.1, CCDS74845.1, CCDS74846.1	22q12	2006-01-27			ENSG00000183963	ENSG00000183963			11126	protein-coding gene	gene with protein product		602127				9244445, 8707825	Standard	NM_006932		Approved		uc011ale.2	P53814	OTTHUMG00000151203	ENST00000347557.2:c.968C>A	22.37:g.31486977C>A	ENSP00000328635:p.Ser323*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00569|O95769|O95937|Q8N4H8|Q8WWW1|Q8WWW2|Q9P1S8|Q9UIT1|Q9UIT2	Nonsense_Mutation	SNP	pfam_Smoothelin,pfam_CH-domain,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.S323*	ENST00000347557.2	37	c.968	CCDS13886.1	22	.	.	.	.	.	.	.	.	.	.	C	21.0	4.079583	0.76528	.	.	ENSG00000183963	ENST00000358743;ENST00000347557;ENST00000333137;ENST00000329852;ENST00000404496	.	.	.	4.95	1.48	0.22813	.	1.132580	0.06956	N	0.815490	.	.	.	.	.	.	0.19575	N	0.999963	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.0315	5.8799	0.18850	0.1445:0.646:0.1316:0.0779	.	.	.	.	X	323;323;323;323;315	.	ENSP00000329393:S323X	S	+	2	0	SMTN	29816977	0.002000	0.14202	0.014000	0.15608	0.609000	0.37215	0.397000	0.20883	0.175000	0.19841	0.491000	0.48974	TCA	SMTN	-	NULL	ENSG00000183963		0.602	SMTN-001	KNOWN	basic|CCDS	protein_coding	SMTN	HGNC	protein_coding	OTTHUMT00000321766.1	124	0.00	0	C	NM_134270		31486977	31486977	+1	no_errors	ENST00000347557	ensembl	human	known	69_37n	nonsense	292	28.61	117	SNP	0.124	A
SMYD1	150572	genome.wustl.edu	37	2	88409999	88409999	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:88409999C>G	ENST00000419482.2	+	10	1526	c.1441C>G	c.(1441-1443)Cca>Gca	p.P481A	SMYD1_ENST00000438570.1_Intron|SMYD1_ENST00000444564.2_Missense_Mutation_p.P468A	NM_198274.3	NP_938015.1	Q8NB12	SMYD1_HUMAN	SET and MYND domain containing 1	481					chromatin remodeling (GO:0006338)|heart development (GO:0007507)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|positive regulation of myotube differentiation (GO:0010831)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			NS(1)|breast(4)|central_nervous_system(1)|large_intestine(6)|lung(19)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	41						CAGCAATGAGCCATCCCCAGC	0.592																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF086123	CCDS33240.1	2p11.1	2011-07-01			ENSG00000115593	ENSG00000115593		"""Zinc fingers, MYND-type"", ""Chromatin-modifying enzymes / K-methyltransferases"""	20986	protein-coding gene	gene with protein product		606846				11923873	Standard	NM_198274		Approved	BOP, ZMYND22, KMT3D	uc002ssr.3	Q8NB12	OTTHUMG00000155045	ENST00000419482.2:c.1441C>G	2.37:g.88409999C>G	ENSP00000393453:p.Pro481Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV30|A6NE13	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,smart_SET_dom,pfscan_SET_dom,pfscan_Znf_MYND	p.P481A	ENST00000419482.2	37	c.1441	CCDS33240.1	2	.	.	.	.	.	.	.	.	.	.	C	3.117	-0.181437	0.06340	.	.	ENSG00000115593	ENST00000419482;ENST00000444564;ENST00000295833	T;T	0.20881	2.04;2.04	5.83	2.79	0.32731	.	0.296465	0.36778	N	0.002410	T	0.07458	0.0188	N	0.04508	-0.205	0.80722	D	1	B	0.09022	0.002	B	0.06405	0.002	T	0.19484	-1.0304	10	0.06236	T	0.91	-10.4331	9.1004	0.36664	0.3244:0.4793:0.1963:0.0	.	481	Q8NB12	SMYD1_HUMAN	A	481;468;302	ENSP00000393453:P481A;ENSP00000407888:P468A	ENSP00000295833:P302A	P	+	1	0	SMYD1	88191114	0.995000	0.38212	0.993000	0.49108	0.829000	0.46940	1.383000	0.34385	1.425000	0.47237	0.655000	0.94253	CCA	SMYD1	-	NULL	ENSG00000115593		0.592	SMYD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD1	HGNC	protein_coding	OTTHUMT00000338229.2	52	0.00	0	C	XM_097915		88409999	88409999	+1	no_errors	ENST00000419482	ensembl	human	known	69_37n	missense	140	29.50	59	SNP	0.978	G
SPTLC1	10558	genome.wustl.edu	37	9	94821572	94821572	+	Silent	SNP	A	A	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr9:94821572A>G	ENST00000262554.2	-	7	584	c.579T>C	c.(577-579)ttT>ttC	p.F193F	SPTLC1_ENST00000482632.1_5'UTR	NM_006415.2	NP_006406.1	O15269	SPTC1_HUMAN	serine palmitoyltransferase, long chain base subunit 1	193					ceramide biosynthetic process (GO:0046513)|small molecule metabolic process (GO:0044281)|sphinganine biosynthetic process (GO:0046511)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingomyelin biosynthetic process (GO:0006686)|sphingosine biosynthetic process (GO:0046512)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|serine C-palmitoyltransferase complex (GO:0017059)|SPOTS complex (GO:0035339)	pyridoxal phosphate binding (GO:0030170)|serine C-palmitoyltransferase activity (GO:0004758)			breast(2)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14					L-Serine(DB00133)	TCTGAATAGCAAAGCAGGCAG	0.403																																						dbGAP											0													97.0	86.0	90.0					9																	94821572		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y08685	CCDS6692.1, CCDS6693.1	9q22.31	2014-09-17	2003-12-02		ENSG00000090054	ENSG00000090054	2.3.1.50		11277	protein-coding gene	gene with protein product		605712	"""hereditary sensory neuropathy, type 1"""	HSN1		9363775	Standard	NM_006415		Approved	LCB1, SPTI, HSAN1, hLCB1	uc004arl.1	O15269	OTTHUMG00000021047	ENST00000262554.2:c.579T>C	9.37:g.94821572A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K681|Q5VWB4|Q96IX6	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.F193	ENST00000262554.2	37	c.579	CCDS6692.1	9																																																																																			SPTLC1	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000090054		0.403	SPTLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTLC1	HGNC	protein_coding	OTTHUMT00000055553.1	166	0.00	0	A	NM_006415		94821572	94821572	-1	no_errors	ENST00000262554	ensembl	human	known	69_37n	silent	99	55.41	123	SNP	1.000	G
SRGAP2	23380	genome.wustl.edu	37	1	206634438	206634438	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:206634438G>C	ENST00000414007.1	+	19	2469	c.2469G>C	c.(2467-2469)caG>caC	p.Q823H				O75044	SRGP2_HUMAN	SLIT-ROBO Rho GTPase activating protein 2	963					actin filament severing (GO:0051014)|axon guidance (GO:0007411)|dendritic spine development (GO:0060996)|extension of a leading process involved in cell motility in cerebral cortex radial glia guided migration (GO:0021816)|filopodium assembly (GO:0046847)|lamellipodium assembly involved in ameboidal cell migration (GO:0003363)|negative regulation of neuron migration (GO:2001223)|neuron projection morphogenesis (GO:0048812)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|substrate adhesion-dependent cell spreading (GO:0034446)	cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine head (GO:0044327)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	protein homodimerization activity (GO:0042803)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)	p.Q823Q(1)		NS(1)|breast(1)|kidney(1)|lung(1)	4	Breast(84;0.137)					TAGAACGGCAGAGCAGTGTCA	0.567																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											55.0	61.0	59.0					1																	206634438		1953	4154	6107	-	-	-	SO:0001583	missense	0			AB007925	CCDS73017.1	1q32.1	2014-08-13	2004-11-12	2004-11-12	ENSG00000163486	ENSG00000266028		"""Rho GTPase activating proteins"""	19751	protein-coding gene	gene with protein product		606524	"""formin binding protein 2"""	FNBP2		15046868, 11672528	Standard	XM_005277510		Approved	KIAA0456, ARHGAP34, SRGAP2A	uc001hdy.3	O75044	OTTHUMG00000184381	ENST00000414007.1:c.2469G>C	1.37:g.206634438G>C	ENSP00000390898:p.Gln823His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,smart_RhoGAP_dom,smart_SH3_domain,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.E877Q	ENST00000414007.1	37	c.2629		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.05|17.05	3.289961|3.289961	0.59976|0.59976	.|.	.|.	ENSG00000163486|ENSG00000163486	ENST00000295713|ENST00000414007	.|T	.|0.13307	.|2.6	6.04|6.04	4.95|4.95	0.65309|0.65309	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.24699|0.24699	0.0599|0.0599	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.14643|0.14643	-1.0465|-1.0465	3|6	.|0.87932	.|D	.|0	.|.	10.7718|10.7718	0.46327|0.46327	0.1902:0.0:0.8098:0.0|0.1902:0.0:0.8098:0.0	.|.	.|.	.|.	.|.	Q|H	877|823	.|ENSP00000390898:Q823H	.|ENSP00000390898:Q823H	E|Q	+|+	1|3	0|2	SRGAP2|SRGAP2	204701061|204701061	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.957000|0.957000	0.61999|0.61999	1.834000|1.834000	0.39171|0.39171	2.873000|2.873000	0.98535|0.98535	0.561000|0.561000	0.74099|0.74099	GAG|CAG	SRGAP2	-	NULL	ENSG00000163486		0.567	SRGAP2-201	KNOWN	basic	protein_coding	SRGAP2	HGNC	protein_coding		64	0.00	0	G	NM_015326		206634438	206634438	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000295713	ensembl	human	known	69_37n	missense	125	11.97	17	SNP	1.000	C
STRA6	64220	genome.wustl.edu	37	15	74472480	74472481	+	Missense_Mutation	DNP	GG	GG	AC			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr15:74472480_74472481GG>AC	ENST00000323940.5	-	19	2189_2190	c.1944_1945CC>GT	c.(1942-1947)aaCCca>aaGTca	p.648_649NP>KS	STRA6_ENST00000563965.1_Missense_Mutation_p.687_688NP>KS|STRA6_ENST00000449139.2_Missense_Mutation_p.648_649NP>KS|STRA6_ENST00000395105.4_Missense_Mutation_p.648_649NP>KS|STRA6_ENST00000535552.1_Missense_Mutation_p.685_686NP>KS|STRA6_ENST00000574278.1_Missense_Mutation_p.663_664NP>KS|STRA6_ENST00000423167.2_Missense_Mutation_p.639_640NP>KS|STRA6_ENST00000574439.1_5'UTR|RP11-665J16.1_ENST00000561647.1_RNA|STRA6_ENST00000416286.3_Missense_Mutation_p.640_641NP>KS	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6	648					adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						TGCAGGGTTGGGTTGTGCAGCA	0.663																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.1944_1945delinsAC	15.37:g.74472480_74472481delinsAC	ENSP00000326085:p.N648_P649delinsKS	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	Missense_Mutation	SNP	NULL	p.P688S|p.N687K	ENST00000323940.5	37	c.2062|c.2061	CCDS10261.1	15																																																																																			STRA6	-	NULL	ENSG00000137868		0.663	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STRA6	HGNC	protein_coding	OTTHUMT00000272891.1	24|23	0.00	0	G			74472480|74472481	74472480|74472481	-1	no_errors	ENST00000563965	ensembl	human	known	69_37n	missense	57|56	27.50|28.21	22	SNP	1.000	A|C
STX5	6811	genome.wustl.edu	37	11	62598707	62598707	+	Silent	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:62598707C>G	ENST00000294179.3	-	2	162	c.9G>C	c.(7-9)ccG>ccC	p.P3P	RP11-727F15.9_ENST00000535817.1_RNA|STX5_ENST00000541317.1_Intron|RP11-727F15.9_ENST00000535867.1_RNA|STX5_ENST00000394690.1_Intron|STX5_ENST00000377897.4_Silent_p.P3P	NM_001244666.1|NM_003164.4	NP_001231595.1|NP_003155.2	Q13190	STX5_HUMAN	syntaxin 5	3					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)|vesicle fusion with Golgi apparatus (GO:0048280)|vesicle targeting (GO:0006903)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|SNARE complex (GO:0031201)	protein N-terminus binding (GO:0047485)|SNAP receptor activity (GO:0005484)			breast(2)|endometrium(2)|large_intestine(3)|lung(3)|ovary(2)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	18						AGCGTTTCCGCGGGATCATTG	0.572																																						dbGAP											0													38.0	32.0	34.0					11																	62598707		2197	4276	6473	-	-	-	SO:0001819	synonymous_variant	0			U26648	CCDS8038.2, CCDS58140.1	11q12.3	2008-02-05	2006-04-25	2006-04-25	ENSG00000162236	ENSG00000162236			11440	protein-coding gene	gene with protein product		603189	"""syntaxin 5A"""	STX5A		9188044, 11959998	Standard	NM_003164		Approved	SED5	uc001nvh.3	Q13190	OTTHUMG00000143864	ENST00000294179.3:c.9G>C	11.37:g.62598707C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8T2|F8W8Q9|Q5U0D4|Q7Z3T6|Q9BUG1	Silent	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.P3	ENST00000294179.3	37	c.9	CCDS8038.2	11																																																																																			STX5	-	NULL	ENSG00000162236		0.572	STX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX5	HGNC	protein_coding	OTTHUMT00000290113.1	15	0.00	0	C	NM_003164		62598707	62598707	-1	no_errors	ENST00000294179	ensembl	human	known	69_37n	silent	38	25.49	13	SNP	1.000	G
TAS2R14	50840	genome.wustl.edu	37	12	11091327	11091327	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr12:11091327T>G	ENST00000537503.1	-	1	535	c.480A>C	c.(478-480)agA>agC	p.R160S	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_023922.1	NP_076411.1	Q9NYV8	T2R14_HUMAN	taste receptor, type 2, member 14	160					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)|taste receptor activity (GO:0008527)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(1)	8						TCTTGTTTCTTCTGTATCCAT	0.348																																						dbGAP											0													82.0	85.0	84.0					12																	11091327		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF227138	CCDS8637.1	12p13	2012-08-22			ENSG00000212127	ENSG00000212127		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14920	protein-coding gene	gene with protein product		604790				10761934, 10766242	Standard	NM_023922		Approved	T2R14, TRB1	uc010shi.2	Q9NYV8	OTTHUMG00000162720	ENST00000537503.1:c.480A>C	12.37:g.11091327T>G	ENSP00000441949:p.Arg160Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q645X3	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.R160S	ENST00000537503.1	37	c.480	CCDS8637.1	12	.	.	.	.	.	.	.	.	.	.	T	11.01	1.513758	0.27123	.	.	ENSG00000212127	ENST00000537503	T	0.00705	5.81	3.95	0.00937	0.14079	.	1.612190	0.04375	U	0.359787	T	0.00998	0.0033	L	0.36672	1.1	0.09310	N	1	B	0.13594	0.008	B	0.25987	0.065	T	0.49331	-0.8951	10	0.66056	D	0.02	.	3.5046	0.07685	0.0:0.2259:0.2001:0.5741	.	160	Q9NYV8	T2R14_HUMAN	S	160	ENSP00000441949:R160S	ENSP00000375094:R160S	R	-	3	2	TAS2R14	10982594	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.478000	0.22212	-0.090000	0.12462	0.496000	0.49642	AGA	TAS2R14	-	pfam_TAS2_rcpt	ENSG00000212127		0.348	TAS2R14-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TAS2R14	HGNC	protein_coding	OTTHUMT00000370194.4	135	0.74	1	T	NM_023922		11091327	11091327	-1	no_errors	ENST00000537503	ensembl	human	known	69_37n	missense	88	27.87	34	SNP	0.000	G
TCF4	6925	genome.wustl.edu	37	18	52901809	52901809	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr18:52901809C>A	ENST00000356073.4	-	16	2067	c.1456G>T	c.(1456-1458)Gac>Tac	p.D486Y	TCF4_ENST00000564999.1_Missense_Mutation_p.D486Y|TCF4_ENST00000540999.1_Missense_Mutation_p.D462Y|TCF4_ENST00000566286.1_Missense_Mutation_p.D483Y|TCF4_ENST00000570177.2_Missense_Mutation_p.D356Y|TCF4_ENST00000457482.3_Missense_Mutation_p.D326Y|TCF4_ENST00000543082.1_Missense_Mutation_p.D444Y|TCF4_ENST00000570287.2_Missense_Mutation_p.D326Y|TCF4_ENST00000354452.3_Missense_Mutation_p.D486Y|TCF4_ENST00000561992.1_Missense_Mutation_p.D356Y|TCF4_ENST00000544241.2_Missense_Mutation_p.D415Y|TCF4_ENST00000561831.3_Missense_Mutation_p.D326Y|TCF4_ENST00000537856.3_Missense_Mutation_p.D356Y|TCF4_ENST00000565018.2_Missense_Mutation_p.D486Y|TCF4_ENST00000567880.1_Missense_Mutation_p.D426Y|TCF4_ENST00000564403.2_Missense_Mutation_p.D492Y|TCF4_ENST00000568740.1_Missense_Mutation_p.D461Y|TCF4_ENST00000564228.1_Missense_Mutation_p.D415Y|TCF4_ENST00000566279.1_Missense_Mutation_p.D426Y|TCF4_ENST00000398339.1_Missense_Mutation_p.D588Y|TCF4_ENST00000568673.1_Missense_Mutation_p.D462Y|TCF4_ENST00000537578.1_Missense_Mutation_p.D462Y	NM_003199.2	NP_003190.1	P15884	ITF2_HUMAN	transcription factor 4	486					DNA-templated transcription, initiation (GO:0006352)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein-DNA complex assembly (GO:0065004)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|protein C-terminus binding (GO:0008022)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase recruiting transcription factor activity (GO:0001011)|sequence-specific DNA binding transcription factor activity (GO:0003700)|TFIIB-class binding transcription factor activity (GO:0001087)|TFIIB-class transcription factor binding (GO:0001093)			breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(15)|ovary(1)|prostate(1)|skin(5)|urinary_tract(1)	41				Colorectal(16;0.00108)|READ - Rectum adenocarcinoma(59;0.0649)|COAD - Colon adenocarcinoma(17;0.0718)		GGGTTCAGGTCAGGGGAAGTC	0.572											OREG0024990	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													113.0	111.0	112.0					18																	52901809		2203	4300	6503	-	-	-	SO:0001583	missense	0			M74719	CCDS11960.1, CCDS42438.1, CCDS58623.1, CCDS58624.1, CCDS58625.1, CCDS58626.1, CCDS58627.1, CCDS58628.1, CCDS58629.1, CCDS58630.1, CCDS58631.1, CCDS59321.1	18q21.1	2013-05-21			ENSG00000196628	ENSG00000196628		"""Basic helix-loop-helix proteins"""	11634	protein-coding gene	gene with protein product		602272				9302263, 2308860	Standard	NM_001083962		Approved	SEF2-1B, ITF2, bHLHb19, E2-2	uc002lga.3	P15884	OTTHUMG00000132713	ENST00000356073.4:c.1456G>T	18.37:g.52901809C>A	ENSP00000348374:p.Asp486Tyr	Somatic	988	WXS	Illumina GAIIx	Phase_IV	B3KT62|B3KUC0|B4DT37|B4DUG3|B7Z5M6|B7Z6Y1|G0LNT9|G0LNU0|G0LNU1|G0LNU2|G0LNU4|G0LNU5|G0LNU8|G0LNU9|G0LNV0|G0LNV1|G0LNV2|H3BPQ1|Q08AP2|Q08AP3|Q15439|Q15440|Q15441	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D588Y	ENST00000356073.4	37	c.1762	CCDS11960.1	18	.	.	.	.	.	.	.	.	.	.	C	18.85	3.712250	0.68730	.	.	ENSG00000196628	ENST00000354452;ENST00000457482;ENST00000356073;ENST00000543082;ENST00000540999;ENST00000537578;ENST00000544241;ENST00000537856;ENST00000398339	T;T;T;T;T;T;T;T;T	0.69685	-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42;-0.42	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	D	0.82829	0.5122	M	0.78456	2.415	0.80722	D	1	D;D;D;D;B;D;D;D;D	0.89917	1.0;0.958;0.99;0.998;0.064;1.0;0.999;1.0;1.0	D;P;D;D;B;D;D;D;D	0.83275	0.982;0.755;0.947;0.961;0.014;0.987;0.971;0.996;0.98	D	0.84361	0.0538	10	0.87932	D	0	-18.9592	18.543	0.91037	0.0:1.0:0.0:0.0	.	462;486;326;588;486;444;415;326;483	B7Z5M6;G0LNT9;G0LNV1;E9PH57;P15884;B3KUC0;B3KT62;G0LNU9;G0LNU5	.;.;.;.;ITF2_HUMAN;.;.;.;.	Y	486;326;486;444;462;462;415;356;588	ENSP00000346440:D486Y;ENSP00000409447:D326Y;ENSP00000348374:D486Y;ENSP00000439656:D444Y;ENSP00000445202:D462Y;ENSP00000440731:D462Y;ENSP00000441562:D415Y;ENSP00000439827:D356Y;ENSP00000381382:D588Y	ENSP00000346440:D486Y	D	-	1	0	TCF4	51052807	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.408000	0.73285	2.758000	0.94735	0.563000	0.77884	GAC	TCF4	-	NULL	ENSG00000196628		0.572	TCF4-002	KNOWN	upstream_uORF|basic|CCDS	protein_coding	TCF4	HGNC	protein_coding	OTTHUMT00000256014.1	104	0.00	0	C	NM_003199		52901809	52901809	-1	no_errors	ENST00000398339	ensembl	human	known	69_37n	missense	233	15.52	43	SNP	1.000	A
TOR3A	64222	genome.wustl.edu	37	1	179054768	179054768	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:179054768G>A	ENST00000367627.3	+	3	1131	c.379G>A	c.(379-381)Gag>Aag	p.E127K	TOR3A_ENST00000352445.6_Missense_Mutation_p.E127K	NM_022371.3	NP_071766.2	Q9H497	TOR3A_HUMAN	torsin family 3, member A	127					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.E127K(1)		endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|urinary_tract(1)	13						CTTAGGCTTAGAGTGGGACCT	0.542																																						dbGAP											1	Substitution - Missense(1)	lung(1)											146.0	153.0	151.0					1																	179054768		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001085	CCDS1329.1	1q25.2	2008-02-05	2003-04-02		ENSG00000186283	ENSG00000186283			11997	protein-coding gene	gene with protein product		607555	"""ATP-dependant interferon responsive"""	ADIR		10644435	Standard	NM_022371		Approved	FLJ22345, ADIR2	uc001gmd.3	Q9H497	OTTHUMG00000035077	ENST00000367627.3:c.379G>A	1.37:g.179054768G>A	ENSP00000356599:p.Glu127Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSY0|B7ZB65|Q5M7Y7|Q8WVA7|Q8WWM2|Q9H495|Q9H6E7	Missense_Mutation	SNP	pfam_Torsin	p.E127K	ENST00000367627.3	37	c.379	CCDS1329.1	1	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021571	0.35701	.	.	ENSG00000186283	ENST00000367627;ENST00000352445;ENST00000447595	T;T;T	0.47177	0.85;0.85;0.85	5.57	0.572	0.17357	.	0.549918	0.20993	N	0.082000	T	0.31358	0.0794	L	0.41236	1.265	0.09310	N	0.999999	B	0.16166	0.016	B	0.16289	0.015	T	0.15925	-1.0420	10	0.23891	T	0.37	-2.0292	5.7247	0.18006	0.3462:0.1255:0.5283:0.0	.	127	Q9H497	TOR3A_HUMAN	K	127;127;19	ENSP00000356599:E127K;ENSP00000335351:E127K;ENSP00000410195:E19K	ENSP00000335351:E127K	E	+	1	0	TOR3A	177321391	0.816000	0.29132	0.000000	0.03702	0.453000	0.32348	2.150000	0.42254	-0.136000	0.11475	0.561000	0.74099	GAG	TOR3A	-	pfam_Torsin	ENSG00000186283		0.542	TOR3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR3A	HGNC	protein_coding	OTTHUMT00000084927.1	58	0.00	0	G	NM_022371		179054768	179054768	+1	no_errors	ENST00000367627	ensembl	human	known	69_37n	missense	97	24.22	31	SNP	0.001	A
TP53	7157	genome.wustl.edu	37	17	7578265	7578265	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr17:7578265A>G	ENST00000269305.4	-	6	773	c.584T>C	c.(583-585)aTc>aCc	p.I195T	TP53_ENST00000574684.1_Intron|TP53_ENST00000420246.2_Missense_Mutation_p.I195T|TP53_ENST00000445888.2_Missense_Mutation_p.I195T|TP53_ENST00000455263.2_Missense_Mutation_p.I195T|TP53_ENST00000359597.4_Missense_Mutation_p.I195T|TP53_ENST00000413465.2_Missense_Mutation_p.I195T	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	195	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		I -> F (in sporadic cancers; somatic mutation).|I -> L (in a sporadic cancer; somatic mutation).|I -> N (in sporadic cancers; somatic mutation).|I -> S (in sporadic cancers; somatic mutation).|I -> T (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:17224074, ECO:0000269|PubMed:9450901}.|I -> V (in a sporadic cancer; somatic mutation).|I -> Y (in a sporadic cancer; somatic mutation; requires 2 nucleotide substitutions).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.I195T(69)|p.I195N(12)|p.I195S(10)|p.0?(8)|p.I195fs*14(5)|p.?(5)|p.A189_V197delAPPQHLIRV(4)|p.P191_E198>Q(3)|p.I102S(2)|p.I102T(2)|p.I63T(2)|p.I63S(2)|p.P191fs*6(1)|p.H193_I195delHLI(1)|p.P59_E66>Q(1)|p.I102fs*14(1)|p.I195fs*12(1)|p.I195fs*50(1)|p.I195_G199delIRVEG(1)|p.P98_E105>Q(1)|p.I63fs*14(1)|p.H193_I195>AP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	TTCCACTCGGATAAGATGCTG	0.552		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	134	Substitution - Missense(99)|Whole gene deletion(8)|Insertion - Frameshift(7)|Deletion - In frame(6)|Complex - deletion inframe(6)|Unknown(5)|Deletion - Frameshift(2)|Complex - frameshift(1)	ovary(37)|breast(21)|large_intestine(18)|lung(10)|central_nervous_system(8)|biliary_tract(6)|haematopoietic_and_lymphoid_tissue(5)|skin(5)|stomach(4)|oesophagus(4)|bone(4)|endometrium(3)|urinary_tract(3)|upper_aerodigestive_tract(2)|liver(2)|pancreas(2)											100.0	89.0	93.0					17																	7578265		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.584T>C	17.37:g.7578265A>G	ENSP00000269305:p.Ile195Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.I195T	ENST00000269305.4	37	c.584	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	A	13.73	2.324656	0.41197	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99823	-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95;-6.95	5.41	3.21	0.36854	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.103171	0.64402	N	0.000004	D	0.99785	0.9910	M	0.90019	3.08	0.52099	D	0.999943	D;D;D;D;D;D;D	0.89917	1.0;0.999;0.991;0.989;0.998;0.997;1.0	D;D;D;D;D;D;D	0.91635	0.999;0.995;0.953;0.979;0.995;0.993;0.996	D	0.98429	1.0581	10	0.87932	D	0	-18.4587	8.2743	0.31864	0.8356:0.0:0.1644:0.0	.	156;195;195;102;195;195;195	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	T	195;195;195;195;195;195;184;102;63;102;63	ENSP00000410739:I195T;ENSP00000352610:I195T;ENSP00000269305:I195T;ENSP00000398846:I195T;ENSP00000391127:I195T;ENSP00000391478:I195T;ENSP00000425104:I63T;ENSP00000423862:I102T	ENSP00000269305:I195T	I	-	2	0	TP53	7518990	1.000000	0.71417	0.946000	0.38457	0.026000	0.11368	9.287000	0.95975	0.456000	0.26937	-0.256000	0.11100	ATC	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd	ENSG00000141510		0.552	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	195	0.00	0	A	NM_000546		7578265	7578265	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	120	38.14	74	SNP	1.000	G
TRIM6	117854	genome.wustl.edu	37	11	5624607	5624607	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:5624607T>A	ENST00000278302.5	+	2	205	c.65T>A	c.(64-66)cTa>cAa	p.L22Q	TRIM6_ENST00000445329.1_Intron|TRIM6_ENST00000380097.3_Missense_Mutation_p.L50Q|TRIM6_ENST00000380107.1_Missense_Mutation_p.L22Q|TRIM6-TRIM34_ENST00000354852.5_Missense_Mutation_p.L50Q|HBG2_ENST00000380259.2_Intron|TRIM6_ENST00000507320.1_Intron|AC015691.13_ENST00000394793.2_RNA|TRIM6_ENST00000506134.1_Intron|TRIM6_ENST00000515022.1_Intron	NM_001198645.1|NM_058166.4	NP_001185574.1|NP_477514.1	Q9C030	TRIM6_HUMAN	tripartite motif containing 6	22					protein trimerization (GO:0070206)	cytoplasm (GO:0005737)	zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(5)|prostate(2)|stomach(1)	22		Lung NSC(207;2.23e-07)|all_lung(207;1.81e-06)|Medulloblastoma(188;0.00225)|Breast(177;0.0101)|all_neural(188;0.0212)		Epithelial(150;1.12e-45)|BRCA - Breast invasive adenocarcinoma(625;0.00101)|LUSC - Lung squamous cell carcinoma(625;0.192)		CTGGAGCTCCTAACAGAACCC	0.542																																						dbGAP											0													121.0	98.0	106.0					11																	5624607		2201	4297	6498	-	-	-	SO:0001583	missense	0			AF220030	CCDS31389.1, CCDS31390.1, CCDS55738.1	11p15	2013-01-09	2011-01-25		ENSG00000121236	ENSG00000121236		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16277	protein-coding gene	gene with protein product		607564	"""tripartite motif-containing 6"""			11331580	Standard	NM_058166		Approved	RNF89		Q9C030	OTTHUMG00000150029	ENST00000278302.5:c.65T>A	11.37:g.5624607T>A	ENSP00000278302:p.Leu22Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2A7|B4DDQ5|Q86WZ8|Q9HCR1	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING	p.L50Q	ENST00000278302.5	37	c.149	CCDS31390.1	11	.	.	.	.	.	.	.	.	.	.	T	21.5	4.164922	0.78339	.	.	ENSG00000121236;ENSG00000121236;ENSG00000121236;ENSG00000258659;ENSG00000258588	ENST00000278302;ENST00000380107;ENST00000380097;ENST00000337072;ENST00000354852	T;T;T;T	0.21361	2.01;2.01;2.01;2.01	4.39	4.39	0.52855	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, RING-type (2);Zinc finger, C3HC4 RING-type (1);	.	.	.	.	T	0.41050	0.1142	L	0.59967	1.855	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.994;0.998;0.999;1.0	T	0.28170	-1.0052	9	0.87932	D	0	.	12.232	0.54492	0.0:0.0:0.0:1.0	.	22;50;50;22	E9PFM0;B2RNG4;Q9C030-2;Q9C030	.;.;.;TRIM6_HUMAN	Q	22;22;50;50;50	ENSP00000278302:L22Q;ENSP00000369450:L22Q;ENSP00000369440:L50Q;ENSP00000346916:L50Q	ENSP00000278302:L22Q	L	+	2	0	TRIM34;TRIM6;TRIM6-TRIM34	5581183	0.947000	0.32204	1.000000	0.80357	0.984000	0.73092	5.418000	0.66429	2.198000	0.70561	0.528000	0.53228	CTA	TRIM34	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000258659		0.542	TRIM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM34	HGNC	protein_coding	OTTHUMT00000143376.2	126	0.00	0	T	NM_001003818		5624607	5624607	+1	no_errors	ENST00000337072	ensembl	human	known	69_37n	missense	160	22.60	47	SNP	1.000	A
TUBB8	347688	genome.wustl.edu	37	10	93603	93603	+	Silent	SNP	C	C	T	rs6560827	byFrequency	TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr10:93603C>T	ENST00000309812.4	-	4	791	c.729G>A	c.(727-729)ccG>ccA	p.P243P	TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000447903.2_Silent_p.P171P	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	243					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		TCAGCTGGCCCGGGAAGCGCA	0.607													t|||	3356	0.670128	0.73	0.6715	5008	,	,		18596	0.4812		0.8101	False		,,,				2504	0.6391				Pancreas(192;2041 3010 9013 18103)	dbGAP											0													10.0	13.0	12.0					10																	93603		1909	3621	5530	-	-	-	SO:0001819	synonymous_variant	0			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.729G>A	10.37:g.93603C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQX9|Q8WZ78	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.P243	ENST00000309812.4	37	c.729	CCDS7051.1	10																																																																																			TUBB8	-	superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase	ENSG00000173876		0.607	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	8	0.00	0	C	NM_177987		93603	93603	-1	no_errors	ENST00000328974	ensembl	human	known	69_37n	silent	9	43.75	7	SNP	0.987	T
TUT1	64852	genome.wustl.edu	37	11	62348589	62348589	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr11:62348589C>A	ENST00000476907.1	-	4	1370	c.679G>T	c.(679-681)Gaa>Taa	p.E227*	TUT1_ENST00000308436.7_Nonsense_Mutation_p.E265*|MIR3654_ENST00000496634.2_Nonsense_Mutation_p.E227*			Q9H6E5	STPAP_HUMAN	terminal uridylyl transferase 1, U6 snRNA-specific	227					mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|snRNA processing (GO:0016180)	intercellular bridge (GO:0045171)|nuclear speck (GO:0016607)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|mRNA 3'-UTR binding (GO:0003730)|polynucleotide adenylyltransferase activity (GO:0004652)|RNA binding (GO:0003723)|RNA uridylyltransferase activity (GO:0050265)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						TGGGGCTCTTCCAAGTCACCC	0.532																																						dbGAP											0													115.0	109.0	111.0					11																	62348589		2202	4299	6501	-	-	-	SO:0001587	stop_gained	0			BC005013	CCDS8021.1, CCDS8021.2	11q12.2	2014-03-05	2006-10-06	2006-10-06	ENSG00000149016	ENSG00000149016	2.7.7.52	"""RNA binding motif (RRM) containing"""	26184	protein-coding gene	gene with protein product	"""RNA uridylyltransferase"", ""U6 TUTase"", ""TUTase 6"""	610641	"""RNA binding motif protein 21"""	RBM21		16790842	Standard	NM_022830		Approved	FLJ22347, FLJ22267, FLJ21850, PAPD2, TUTase	uc001nto.2	Q9H6E5	OTTHUMG00000158564	ENST00000476907.1:c.679G>T	11.37:g.62348589C>A	ENSP00000419607:p.Glu227*	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A527|A8K995|Q2NL65|Q7L583|Q9H6H7	Nonsense_Mutation	SNP	pfam_PAP_assoc,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E265*	ENST00000476907.1	37	c.793		11	.	.	.	.	.	.	.	.	.	.	C	40	8.286906	0.98742	.	.	ENSG00000149016	ENST00000308436;ENST00000476907;ENST00000494385	.	.	.	5.5	3.46	0.39613	.	1.119980	0.06568	N	0.747975	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10377	T	0.69	-0.596	11.589	0.50935	0.0:0.6516:0.3484:0.0	.	.	.	.	X	265;227;141	.	ENSP00000441670:E227X	E	-	1	0	TUT1	62105165	1.000000	0.71417	0.998000	0.56505	0.951000	0.60555	2.251000	0.43187	1.274000	0.44362	0.555000	0.69702	GAA	TUT1	-	NULL	ENSG00000149016		0.532	TUT1-001	KNOWN	basic|appris_candidate	protein_coding	TUT1	HGNC	protein_coding	OTTHUMT00000351319.2	55	0.00	0	C	NM_022830		62348589	62348589	-1	no_errors	ENST00000308436	ensembl	human	known	69_37n	nonsense	125	26.90	46	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	216138777	216138777	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:216138777A>C	ENST00000307340.3	-	37	7388	c.7002T>G	c.(7000-7002)aaT>aaG	p.N2334K	USH2A_ENST00000366943.2_Missense_Mutation_p.N2334K	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	2334	Fibronectin type-III 10. {ECO:0000255|PROSITE-ProRule:PRU00316}.				hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)			NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		TGACAAACACATTTACTGTTC	0.423										HNSCC(13;0.011)																												dbGAP											0													138.0	138.0	138.0					1																	216138777		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.7002T>G	1.37:g.216138777A>C	ENSP00000305941:p.Asn2334Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.N2334K	ENST00000307340.3	37	c.7002	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	A	3.784	-0.045021	0.07452	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	T;T	0.56444	0.46;0.46	5.56	-11.1	0.00147	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.350108	0.20675	N	0.087744	T	0.29061	0.0722	L	0.53249	1.67	0.09310	N	1	B	0.14805	0.011	B	0.10450	0.005	T	0.42599	-0.9442	10	0.07644	T	0.81	.	5.3135	0.15843	0.2156:0.1136:0.5189:0.1519	.	2334	O75445	USH2A_HUMAN	K	2334	ENSP00000305941:N2334K;ENSP00000355910:N2334K	ENSP00000305941:N2334K	N	-	3	2	USH2A	214205400	0.008000	0.16893	0.002000	0.10522	0.992000	0.81027	-0.873000	0.04214	-2.533000	0.00490	-0.274000	0.10170	AAT	USH2A	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000042781		0.423	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	190	0.00	0	A	NM_007123		216138777	216138777	-1	no_errors	ENST00000366943	ensembl	human	known	69_37n	missense	209	18.68	48	SNP	0.000	C
USP15	9958	genome.wustl.edu	37	12	62775318	62775318	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr12:62775318G>C	ENST00000280377.5	+	9	1021	c.963G>C	c.(961-963)aaG>aaC	p.K321N	USP15_ENST00000393654.3_Missense_Mutation_p.K296N|USP15_ENST00000353364.3_Missense_Mutation_p.K292N	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	321	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		TCAATGATAAGTATCAAGAAG	0.318																																					Melanoma(181;615 2041 39364 49691 50001)	dbGAP											0													129.0	118.0	122.0					12																	62775318		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.963G>C	12.37:g.62775318G>C	ENSP00000280377:p.Lys321Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.K321N	ENST00000280377.5	37	c.963	CCDS58251.1	12	.	.	.	.	.	.	.	.	.	.	G	11.05	1.525968	0.27299	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.30182	1.54;1.54;1.54	5.09	1.12	0.20585	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.153804	0.56097	D	0.000022	T	0.18173	0.0436	L	0.28192	0.835	0.44843	D	0.997859	B;B	0.14805	0.011;0.005	B;B	0.18871	0.023;0.013	T	0.08027	-1.0742	9	.	.	.	-12.1827	9.2893	0.37778	0.4299:0.0:0.5701:0.0	.	321;292	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	N	292;321;296	ENSP00000258123:K292N;ENSP00000280377:K321N;ENSP00000377264:K296N	.	K	+	3	2	USP15	61061585	0.998000	0.40836	1.000000	0.80357	0.996000	0.88848	0.573000	0.23699	0.315000	0.23110	0.585000	0.79938	AAG	USP15	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000135655		0.318	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	HGNC	protein_coding	OTTHUMT00000407831.2	235	0.00	0	G	NM_006313		62775318	62775318	+1	no_errors	ENST00000280377	ensembl	human	known	69_37n	missense	235	25.87	82	SNP	1.000	C
USP48	84196	genome.wustl.edu	37	1	22084186	22084186	+	Silent	SNP	G	G	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr1:22084186G>T	ENST00000308271.9	-	2	873	c.225C>A	c.(223-225)atC>atA	p.I75I	USP48_ENST00000421625.2_Silent_p.I75I|USP48_ENST00000400301.1_Silent_p.I75I|USP48_ENST00000529637.1_Silent_p.I75I	NM_032236.5	NP_115612.4	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 48	75					ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)			NS(1)|endometrium(6)|kidney(2)|large_intestine(11)|lung(14)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|all_lung(284;4.29e-05)|Lung NSC(340;4.66e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0182)|OV - Ovarian serous cystadenocarcinoma(117;4.74e-26)|COAD - Colon adenocarcinoma(152;1.3e-05)|GBM - Glioblastoma multiforme(114;1.86e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000614)|STAD - Stomach adenocarcinoma(196;0.00644)|KIRC - Kidney renal clear cell carcinoma(1967;0.00711)|Lung(427;0.0327)|READ - Rectum adenocarcinoma(331;0.0657)|LUSC - Lung squamous cell carcinoma(448;0.0753)		TGGGATCATCGATGTTATGAA	0.358																																						dbGAP											0													113.0	105.0	107.0					1																	22084186		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF502942	CCDS30623.1, CCDS44084.1	1p36.12	2008-02-05	2005-08-08	2004-04-07	ENSG00000090686	ENSG00000090686		"""Ubiquitin-specific peptidases"""	18533	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"", ""ubiquitin specific protease 48"""	USP31		12838346	Standard	XM_005246009		Approved	FLJ23277, FLJ11328, FLJ20103, FLJ23054, MGC14879	uc001bfb.3	Q86UV5	OTTHUMG00000007798	ENST00000308271.9:c.225C>A	1.37:g.22084186G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Silent	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19,pfscan_Ubiquitin_supergroup	p.I75	ENST00000308271.9	37	c.225	CCDS30623.1	1																																																																																			USP48	-	NULL	ENSG00000090686		0.358	USP48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP48	HGNC	protein_coding	OTTHUMT00000021372.1	254	0.00	0	G	NM_032236		22084186	22084186	-1	no_errors	ENST00000308271	ensembl	human	known	69_37n	silent	238	17.93	52	SNP	0.729	T
XDH	7498	genome.wustl.edu	37	2	31621458	31621458	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr2:31621458C>G	ENST00000379416.3	-	5	462	c.414G>C	c.(412-414)gaG>gaC	p.E138D		NM_000379.3	NP_000370.2	P47989	XDH_HUMAN	xanthine dehydrogenase	138					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|lactation (GO:0007595)|negative regulation of endothelial cell differentiation (GO:0045602)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of gene expression (GO:0010629)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|negative regulation of vasculogenesis (GO:2001213)|nucleobase-containing small molecule metabolic process (GO:0055086)|positive regulation of p38MAPK cascade (GO:1900745)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)|xanthine catabolic process (GO:0009115)	cytosol (GO:0005829)|extracellular space (GO:0005615)|peroxisome (GO:0005777)	2 iron, 2 sulfur cluster binding (GO:0051537)|electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|iron ion binding (GO:0005506)|molybdopterin cofactor binding (GO:0043546)|protein homodimerization activity (GO:0042803)|UDP-N-acetylmuramate dehydrogenase activity (GO:0008762)|xanthine dehydrogenase activity (GO:0004854)|xanthine oxidase activity (GO:0004855)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(31)|ovary(1)|pancreas(1)|prostate(3)|skin(9)|urinary_tract(1)	74	Acute lymphoblastic leukemia(172;0.155)				Aldesleukin(DB00041)|Allopurinol(DB00437)|Azathioprine(DB00993)|Carboplatin(DB00958)|Carvedilol(DB01136)|Chlorphenesin(DB00856)|Cisplatin(DB00515)|Daunorubicin(DB00694)|Deferoxamine(DB00746)|Doxorubicin(DB00997)|Flavin adenine dinucleotide(DB03147)|L-Carnitine(DB00583)|Menadione(DB00170)|Mercaptopurine(DB01033)|Nitrofural(DB00336)|Procarbazine(DB01168)|Pyrazinamide(DB00339)|Spermine(DB00127)|Trifluoperazine(DB00831)	CATTCTCAATCTCCTCCATGG	0.587																																					Colon(66;682 1445 30109 40147)	dbGAP											0													124.0	115.0	118.0					2																	31621458		2203	4300	6503	-	-	-	SO:0001583	missense	0			D11456	CCDS1775.1	2p23.1	2009-07-10	2003-03-20		ENSG00000158125	ENSG00000158125	1.17.1.4		12805	protein-coding gene	gene with protein product		607633	"""xanthene dehydrogenase"""			8224915	Standard	NM_000379		Approved	XOR, XO	uc002rnv.1	P47989	OTTHUMG00000099385	ENST00000379416.3:c.414G>C	2.37:g.31621458C>G	ENSP00000368727:p.Glu138Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16681|Q16712|Q4PJ16	Missense_Mutation	SNP	pfam_AldOxase/xan_DH_Mopterin-bd,pfam_Mopterin_DH_FAD-bd,pfam_Ald_Oxase/Xan_DH_a/b,pfam_2Fe-2S-bd,pfam_CO_DH_flav_C,pfam_2Fe-2S_ferredoxin-type,superfamily_AldOxase/xan_DH_Mopterin-bd,superfamily_FAD-bd_2,superfamily_Ald_Oxase/Xan_DH_a/b,superfamily_2Fe-2S-bd,superfamily_CO_DH_flav_C,superfamily_2Fe-2S_ferredoxin-type,pirsf_Ald_Oxase/xanthine_DH,pfscan_2Fe-2S_ferredoxin-type,tigrfam_Xanthine_DH_ssu	p.E138D	ENST00000379416.3	37	c.414	CCDS1775.1	2	.	.	.	.	.	.	.	.	.	.	C	0.642	-0.813048	0.02798	.	.	ENSG00000158125	ENST00000379416	T	0.66815	-0.23	6.16	3.35	0.38373	[2Fe-2S]-binding (3);Xanthine dehydrogenase, small subunit (1);	0.141794	0.64402	D	0.000010	T	0.41534	0.1163	N	0.12471	0.22	0.45227	D	0.998232	B	0.18863	0.031	B	0.27796	0.083	T	0.11372	-1.0590	10	0.07644	T	0.81	.	5.8463	0.18667	0.0:0.6266:0.1376:0.2358	.	138	P47989	XDH_HUMAN	D	138	ENSP00000368727:E138D	ENSP00000368727:E138D	E	-	3	2	XDH	31474962	0.465000	0.25815	0.902000	0.35471	0.020000	0.10135	-0.377000	0.07456	0.445000	0.26639	0.650000	0.86243	GAG	XDH	-	pfam_2Fe-2S-bd,superfamily_2Fe-2S-bd,pirsf_Ald_Oxase/xanthine_DH,tigrfam_Xanthine_DH_ssu	ENSG00000158125		0.587	XDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XDH	HGNC	protein_coding	OTTHUMT00000216840.1	89	0.00	0	C	NM_000379		31621458	31621458	-1	no_errors	ENST00000379416	ensembl	human	known	69_37n	missense	116	21.09	31	SNP	0.998	G
ZFAT	57623	genome.wustl.edu	37	8	135669982	135669982	+	Splice_Site	SNP	T	T	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr8:135669982T>C	ENST00000377838.3	-	2	194		c.e2-2		ZFAT_ENST00000523399.1_Splice_Site|ZFAT_ENST00000520356.1_Splice_Site|ZFAT_ENST00000520214.1_Splice_Site|ZFAT_ENST00000520727.1_Splice_Site|ZFAT_ENST00000429442.2_Splice_Site	NM_001174157.1|NM_020863.3	NP_001167628.1|NP_065914.2	Q9P243	ZFAT_HUMAN	zinc finger and AT hook domain containing						hematopoietic progenitor cell differentiation (GO:0002244)|spongiotrophoblast layer development (GO:0060712)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(10)|kidney(9)|large_intestine(8)|lung(16)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	54	all_epithelial(106;8.26e-19)|Lung NSC(106;3.47e-07)|all_lung(105;1.39e-06)|Ovarian(258;0.0102)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0432)			CCGTGTTTTCTGTAAGGAAAA	0.403																																						dbGAP											0													83.0	77.0	79.0					8																	135669982		1871	4101	5972	-	-	-	SO:0001630	splice_region_variant	0			BC025423	CCDS43768.1, CCDS47924.1, CCDS43768.2, CCDS55275.1, CCDS55276.1	8q24.23	2008-06-05	2008-01-25	2008-01-25	ENSG00000066827	ENSG00000066827		"""Zinc fingers, C2H2-type"""	19899	protein-coding gene	gene with protein product		610931	"""zinc finger protein 406"""	ZNF406, ZFAT1		10819331, 18329245	Standard	NM_020863		Approved	KIAA1485	uc003yup.3	Q9P243	OTTHUMG00000164321	ENST00000377838.3:c.20-2A>G	8.37:g.135669982T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL15|E9PER3|Q3MIM5|Q6PJ01|Q75PJ6|Q75PJ7|Q75PJ9|Q86X64	Splice_Site	SNP	-	e2-2	ENST00000377838.3	37	c.20-2	CCDS47924.1	8	.	.	.	.	.	.	.	.	.	.	T	20.4	3.986054	0.74589	.	.	ENSG00000066827	ENST00000377838;ENST00000523399	.	.	.	5.91	5.91	0.95273	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3004	0.66346	0.0:0.0:0.0:1.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZFAT	135739164	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	5.555000	0.67301	2.254000	0.74563	0.533000	0.62120	.	ZFAT	-	-	ENSG00000066827		0.403	ZFAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFAT	HGNC	protein_coding	OTTHUMT00000378272.1	139	0.00	0	T	NM_001029939	Intron	135669982	135669982	-1	no_errors	ENST00000377838	ensembl	human	known	69_37n	splice_site	254	12.07	35	SNP	1.000	C
ZFR2	23217	genome.wustl.edu	37	19	3852528	3852528	+	Intron	SNP	G	G	C	rs577342013	byFrequency	TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr19:3852528G>C	ENST00000262961.4	-	1	64				ZFR2_ENST00000591965.1_Intron|ZFR2_ENST00000591712.1_Missense_Mutation_p.D44E|ZFR2_ENST00000439086.2_Missense_Mutation_p.D46E|ZFR2_ENST00000592398.1_Missense_Mutation_p.D44E	NM_015174.1	NP_055989.1	Q9UPR6	ZFR2_HUMAN	zinc finger RNA binding protein 2								nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.00514)|STAD - Stomach adenocarcinoma(1328;0.19)		cagtcacagcgtcacttccac	0.602																																						dbGAP											0													85.0	81.0	82.0					19																	3852528		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB029009	CCDS45921.1, CCDS45922.1	19p13.3	2012-10-05	2008-03-25	2008-03-25	ENSG00000105278	ENSG00000105278			29189	protein-coding gene	gene with protein product			"""KIAA1086"""	KIAA1086		10470851	Standard	NM_015174		Approved		uc002lyw.2	Q9UPR6	OTTHUMG00000180918	ENST00000262961.4:c.53+16434C>G	19.37:g.3852528G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.D46E	ENST00000262961.4	37	c.138	CCDS45921.1	19	.	.	.	.	.	.	.	.	.	.	G	1.630	-0.519284	0.04171	.	.	ENSG00000105278	ENST00000439086	.	.	.	0.497	-0.995	0.10222	.	.	.	.	.	T	0.53174	0.1780	.	.	.	0.09310	N	1	D	0.61080	0.989	D	0.64237	0.923	T	0.44483	-0.9325	6	0.87932	D	0	.	.	.	.	.	46	Q9UPR6-2	.	E	46	.	ENSP00000388567:D46E	D	-	3	2	ZFR2	3803528	0.000000	0.05858	0.009000	0.14445	0.051000	0.14879	-1.086000	0.03386	-0.407000	0.07576	-0.701000	0.03672	GAC	ZFR2	-	NULL	ENSG00000105278		0.602	ZFR2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFR2	HGNC	protein_coding	OTTHUMT00000453648.2	86	0.00	0	G	NM_015174		3852528	3852528	-1	no_errors	ENST00000439086	ensembl	human	known	69_37n	missense	123	34.04	64	SNP	0.009	C
ZIK1	284307	genome.wustl.edu	37	19	58102405	58102405	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr19:58102405G>T	ENST00000597850.1	+	4	1441	c.1226G>T	c.(1225-1227)tGt>tTt	p.C409F	ZIK1_ENST00000307468.4_3'UTR|ZIK1_ENST00000599456.1_Missense_Mutation_p.C354F|ZIK1_ENST00000536878.2_Missense_Mutation_p.C396F	NM_001010879.2	NP_001010879.2	Q3SY52	ZIK1_HUMAN	zinc finger protein interacting with K protein 1	409					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	34		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		CCTTATAAGTGTGGTGACTGT	0.458																																						dbGAP											0													66.0	61.0	63.0					19																	58102405		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK092538	CCDS33135.1	19q13.43	2013-01-08	2012-12-07		ENSG00000171649	ENSG00000171649		"""Zinc fingers, C2H2-type"", ""-"""	33104	protein-coding gene	gene with protein product			"""zinc finger protein interacting with K protein 1 homolog (mouse)"""				Standard	XM_005258769		Approved	ZNF762	uc002qpg.3	Q3SY52		ENST00000597850.1:c.1226G>T	19.37:g.58102405G>T	ENSP00000472867:p.Cys409Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O43339|Q3SY51|Q3SY53	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C409F	ENST00000597850.1	37	c.1226	CCDS33135.1	19	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575810	0.45902	.	.	ENSG00000171649	ENST00000536878;ENST00000356724;ENST00000307468	D	0.85088	-1.94	3.37	3.37	0.38596	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94578	0.8253	H	0.96943	3.91	0.54753	D	0.999984	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96141	0.9100	9	0.87932	D	0	.	14.0247	0.64580	0.0:0.0:1.0:0.0	.	396;409	F5H435;Q3SY52	.;ZIK1_HUMAN	F	396;362;409	ENSP00000438487:C396F	ENSP00000303820:C409F	C	+	2	0	ZIK1	62794217	1.000000	0.71417	0.218000	0.23776	0.241000	0.25554	6.953000	0.75995	1.881000	0.54492	0.655000	0.94253	TGT	ZIK1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000171649		0.458	ZIK1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZIK1	HGNC	protein_coding	OTTHUMT00000466791.1	149	0.00	0	G	NM_001010879		58102405	58102405	+1	no_errors	ENST00000307468	ensembl	human	known	69_37n	missense	115	20.14	29	SNP	0.970	T
ZNF449	203523	genome.wustl.edu	37	X	134493837	134493837	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chrX:134493837G>T	ENST00000339249.4	+	4	720	c.580G>T	c.(580-582)Gac>Tac	p.D194Y		NM_152695.5	NP_689908.3	Q6P9G9	ZN449_HUMAN	zinc finger protein 449	194					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(6)|ovary(2)|prostate(1)|skin(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					ACCAAAACTTGACATGAACTT	0.373																																						dbGAP											0													130.0	127.0	128.0					X																	134493837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY280801	CCDS14649.1	Xq26.3	2013-01-09			ENSG00000173275	ENSG00000173275		"""-"", ""Zinc fingers, C2H2-type"""	21039	protein-coding gene	gene with protein product		300627					Standard	NM_152695		Approved	ZSCAN19, FLJ23614	uc004eys.3	Q6P9G9	OTTHUMG00000022478	ENST00000339249.4:c.580G>T	X.37:g.134493837G>T	ENSP00000339585:p.Asp194Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRZ7|Q5JRZ8|Q6NZX2|Q8N3Q1|Q8TED7	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.D194Y	ENST00000339249.4	37	c.580	CCDS14649.1	X	.	.	.	.	.	.	.	.	.	.	G	11.76	1.735259	0.30774	.	.	ENSG00000173275	ENST00000339249	T	0.08546	3.08	4.86	4.86	0.63082	.	0.000000	0.48767	D	0.000174	T	0.14313	0.0346	L	0.27053	0.805	0.80722	D	1	D	0.69078	0.997	D	0.66196	0.942	T	0.02009	-1.1230	10	0.42905	T	0.14	.	10.4231	0.44363	0.0:0.1929:0.8071:0.0	.	194	Q6P9G9	ZN449_HUMAN	Y	194	ENSP00000339585:D194Y	ENSP00000339585:D194Y	D	+	1	0	ZNF449	134321503	0.798000	0.28890	0.876000	0.34364	0.199000	0.23934	2.153000	0.42282	2.423000	0.82170	0.529000	0.55759	GAC	ZNF449	-	NULL	ENSG00000173275		0.373	ZNF449-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF449	HGNC	protein_coding	OTTHUMT00000058411.1	225	0.00	0	G	NM_152695		134493837	134493837	+1	no_errors	ENST00000339249	ensembl	human	known	69_37n	missense	206	20.77	54	SNP	0.804	T
ZNF74	7625	genome.wustl.edu	37	22	20760374	20760374	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr22:20760374C>G	ENST00000400451.2	+	5	1565	c.1051C>G	c.(1051-1053)Ctg>Gtg	p.L351V	ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000405993.1_Missense_Mutation_p.L319V|ZNF74_ENST00000403682.3_3'UTR|ZNF74_ENST00000356671.5_Missense_Mutation_p.L351V	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	351					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			CAGCATGCACCTGCGGGTGCA	0.672																																						dbGAP											0													36.0	41.0	39.0					22																	20760374		2203	4299	6502	-	-	-	SO:0001583	missense	0			X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.1051C>G	22.37:g.20760374C>G	ENSP00000383301:p.Leu351Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L351V	ENST00000400451.2	37	c.1051	CCDS42982.1	22	.	.	.	.	.	.	.	.	.	.	C	14.58	2.578188	0.45902	.	.	ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993	T;T;T	0.20598	2.06;2.06;2.06	3.94	2.92	0.33932	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.918548	0.08812	N	0.890132	T	0.12774	0.0310	N	0.13140	0.3	0.09310	N	1	P	0.39282	0.666	B	0.38921	0.285	T	0.17107	-1.0380	10	0.59425	D	0.04	-7.9837	5.1244	0.14876	0.2033:0.6903:0.0:0.1064	.	351	Q16587	ZNF74_HUMAN	V	351;351;319	ENSP00000383301:L351V;ENSP00000349098:L351V;ENSP00000385855:L319V	ENSP00000349098:L351V	L	+	1	2	ZNF74	19090374	0.010000	0.17322	0.777000	0.31699	0.970000	0.65996	0.240000	0.18042	1.251000	0.43983	0.655000	0.94253	CTG	ZNF74	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000185252		0.672	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF74	HGNC	protein_coding	OTTHUMT00000319648.2	21	0.00	0	C	NM_003426		20760374	20760374	+1	no_errors	ENST00000356671	ensembl	human	known	69_37n	missense	113	31.52	52	SNP	0.088	G
ZNF862	643641	genome.wustl.edu	37	7	149557807	149557807	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12K-01A-21D-A10Y-09	TCGA-C8-A12K-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	bcf92c27-3aa7-4449-9c7a-fc715789788f	5516f85d-911f-451a-b9b2-3bf9b4e5d74b	g.chr7:149557807G>C	ENST00000223210.4	+	7	1803	c.1558G>C	c.(1558-1560)Gaa>Caa	p.E520Q	RP4-751H13.7_ENST00000608963.1_RNA	NM_001099220.1	NP_001092690.1	O60290	ZN862_HUMAN	zinc finger protein 862	520					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(10)|ovary(1)|prostate(1)|skin(1)	34						AAAATACCATGAAGTCAGCAA	0.488																																						dbGAP											0													65.0	69.0	68.0					7																	149557807		2015	4171	6186	-	-	-	SO:0001583	missense	0			AB011115	CCDS47741.1	7q36.1	2013-01-11			ENSG00000106479	ENSG00000106479		"""Zinc fingers, C2H2-type"", ""-"""	34519	protein-coding gene	gene with protein product							Standard	NM_001099220		Approved		uc010lpn.3	O60290	OTTHUMG00000158093	ENST00000223210.4:c.1558G>C	7.37:g.149557807G>C	ENSP00000223210:p.Glu520Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUL8	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_HATC,superfamily_Krueppel-associated_box,superfamily_RNaseH-like_dom,smart_Krueppel-associated_box,smart_Znf_TTF,pfscan_Krueppel-associated_box	p.E520Q	ENST00000223210.4	37	c.1558	CCDS47741.1	7	.	.	.	.	.	.	.	.	.	.	G	18.13	3.555769	0.65425	.	.	ENSG00000106479	ENST00000223210	T	0.01172	5.23	5.19	5.19	0.71726	Zinc finger, TTF-type (1);	0.000000	0.52532	D	0.000062	T	0.04048	0.0113	M	0.68317	2.08	0.28719	N	0.903118	D	0.64830	0.994	P	0.55055	0.767	T	0.12528	-1.0544	10	0.44086	T	0.13	-46.7857	14.2328	0.65906	0.0:0.0:1.0:0.0	.	520	O60290	ZN862_HUMAN	Q	520	ENSP00000223210:E520Q	ENSP00000223210:E520Q	E	+	1	0	ZNF862	149188740	0.954000	0.32549	0.999000	0.59377	0.999000	0.98932	3.908000	0.56355	2.431000	0.82371	0.655000	0.94253	GAA	ZNF862	-	smart_Znf_TTF	ENSG00000106479		0.488	ZNF862-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF862	HGNC	protein_coding	OTTHUMT00000350165.1	54	0.00	0	G	NM_001099220		149557807	149557807	+1	no_errors	ENST00000223210	ensembl	human	known	69_37n	missense	44	33.33	22	SNP	1.000	C
