#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA5	23461	genome.wustl.edu	37	17	67282161	67282161	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:67282161T>C	ENST00000392676.3	-	17	2214	c.2150A>G	c.(2149-2151)tAt>tGt	p.Y717C	ABCA5_ENST00000392677.2_Missense_Mutation_p.Y717C|ABCA5_ENST00000588877.1_Missense_Mutation_p.Y717C			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	717					cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TGTGGCACAATATTTGTCTAT	0.308																																						dbGAP											0													116.0	117.0	117.0					17																	67282161		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.2150A>G	17.37:g.67282161T>C	ENSP00000376443:p.Tyr717Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.Y717C	ENST00000392676.3	37	c.2150	CCDS11685.1	17	.	.	.	.	.	.	.	.	.	.	T	9.172	1.021503	0.19433	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	T;T	0.62788	-0.0;-0.0	4.79	2.53	0.30540	.	0.133797	0.33980	N	0.004375	T	0.55924	0.1951	L	0.39147	1.195	0.09310	N	1	D;D	0.56968	0.978;0.97	P;P	0.53401	0.725;0.619	T	0.47328	-0.9126	9	.	.	.	.	2.9684	0.05915	0.1414:0.0784:0.1474:0.6328	.	717;717	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	C	717	ENSP00000376444:Y717C;ENSP00000376443:Y717C	.	Y	-	2	0	ABCA5	64793756	0.007000	0.16637	0.911000	0.35937	0.979000	0.70002	0.197000	0.17197	0.188000	0.20168	-0.727000	0.03589	TAT	ABCA5	-	NULL	ENSG00000154265		0.308	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCA5	HGNC	protein_coding	OTTHUMT00000450654.1	276	0.00	0	T	NM_018672		67282161	67282161	-1	no_errors	ENST00000392677	ensembl	human	known	69_37n	missense	166	20.95	44	SNP	0.003	C
ANK3	288	genome.wustl.edu	37	10	61819641	61819641	+	Intron	SNP	G	G	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr10:61819641G>C	ENST00000280772.2	-	41	12787				ANK3_ENST00000373827.2_Missense_Mutation_p.P1621R|RP11-388P9.2_ENST00000414383.1_RNA|ANK3_ENST00000355288.2_Missense_Mutation_p.P761R|ANK3_ENST00000503366.1_Missense_Mutation_p.P1628R	NM_020987.3	NP_066267.2	Q12955	ANK3_HUMAN	ankyrin 3, node of Ranvier (ankyrin G)						axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization (GO:0045184)|Golgi to plasma membrane protein transport (GO:0043001)|maintenance of protein location in plasma membrane (GO:0072660)|membrane assembly (GO:0071709)|mitotic cytokinesis (GO:0000281)|neuromuscular junction development (GO:0007528)|neuronal action potential (GO:0019228)|plasma membrane organization (GO:0007009)|positive regulation of cell communication by electrical coupling (GO:0010650)|positive regulation of gene expression (GO:0010628)|positive regulation of homotypic cell-cell adhesion (GO:0034112)|positive regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900827)|positive regulation of membrane potential (GO:0045838)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein localization to plasma membrane (GO:0072659)|protein targeting to plasma membrane (GO:0072661)|regulation of potassium ion transport (GO:0043266)|signal transduction (GO:0007165)	axon initial segment (GO:0043194)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|costamere (GO:0043034)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|lateral plasma membrane (GO:0016328)|lysosome (GO:0005764)|neuromuscular junction (GO:0031594)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|T-tubule (GO:0030315)|Z disc (GO:0030018)	cadherin binding (GO:0045296)|cytoskeletal protein binding (GO:0008092)|ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			NS(4)|breast(7)|central_nervous_system(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(5)|kidney(14)|large_intestine(30)|liver(2)|lung(59)|ovary(8)|pancreas(2)|prostate(5)|skin(26)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	196						CAGTCTACTAGGGGTTCTAAG	0.498																																						dbGAP											0													99.0	96.0	97.0					10																	61819641		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			U13616	CCDS7258.1, CCDS7259.1, CCDS55711.1, CCDS55712.1	10q21	2013-01-10			ENSG00000151150	ENSG00000151150		"""Ankyrin repeat domain containing"""	494	protein-coding gene	gene with protein product	"""ankyrin-3, node of Ranvier"", ""ankyrin-G"""	600465				7665168	Standard	NM_020987		Approved		uc001jky.3	Q12955	OTTHUMG00000018288	ENST00000280772.2:c.12596-453C>G	10.37:g.61819641G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQT2|B4DIL1|E9PE32|Q13484|Q5CZH9|Q5VXD5|Q7Z3G4|Q9H0P5	Missense_Mutation	SNP	pfam_ZU5,pfam_Death,superfamily_DEATH-like,smart_ZU5,smart_Death,pfscan_Death,pfscan_ZU5	p.P761R	ENST00000280772.2	37	c.2282	CCDS7258.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.94|17.94	3.512505|3.512505	0.64522|0.64522	.|.	.|.	ENSG00000151150|ENSG00000151150	ENST00000514197|ENST00000373827;ENST00000373820;ENST00000355288;ENST00000423532;ENST00000503366;ENST00000395299;ENST00000373817	.|T;T;T;T	.|0.58358	.|0.34;0.34;0.34;0.34	5.77|5.77	5.77|5.77	0.91146|0.91146	.|.	.|.	.|.	.|.	.|.	T|T	0.61887|0.61887	0.2383|0.2383	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|P;P;P;B;D;D	.|0.69078	.|0.612;0.937;0.594;0.006;0.983;0.997	.|B;B;B;B;P;P	.|0.59221	.|0.284;0.326;0.215;0.009;0.694;0.854	T|T	0.51841|0.51841	-0.8654|-0.8654	5|9	.|0.11485	.|T	.|0.65	.|.	19.9961|19.9961	0.97386|0.97386	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1628;761;1621;862;761;160	.|E9PE32;A8KA62;Q5CZH9;F5GXK0;B1AQT2;B1AQT0	.|.;.;.;.;.;.	V|R	143|1621;219;761;761;1628;1607;862	.|ENSP00000362933:P1621R;ENSP00000362926:P219R;ENSP00000347436:P761R;ENSP00000425236:P1628R	.|ENSP00000347436:P761R	L|P	-|-	1|2	2|0	ANK3|ANK3	61489647|61489647	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.972000|0.972000	0.66771|0.66771	7.177000|7.177000	0.77650|0.77650	2.744000|2.744000	0.94065|0.94065	0.561000|0.561000	0.74099|0.74099	CTA|CCT	ANK3	-	NULL	ENSG00000151150		0.498	ANK3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANK3	HGNC	protein_coding	OTTHUMT00000048201.4	124	0.00	0	G	NM_020987		61819641	61819641	-1	no_errors	ENST00000355288	ensembl	human	known	69_37n	missense	64	16.88	13	SNP	1.000	C
C11orf53	341032	genome.wustl.edu	37	11	111156467	111156467	+	Silent	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:111156467G>A	ENST00000280325.4	+	4	546	c.399G>A	c.(397-399)acG>acA	p.T133T		NM_198498.1	NP_940900.1	Q8IXP5	CK053_HUMAN	chromosome 11 open reading frame 53	133										endometrium(1)|large_intestine(2)|lung(3)|skin(2)	8		all_cancers(61;2.05e-09)|Melanoma(852;4.04e-05)|all_epithelial(67;6.15e-05)|all_hematologic(158;0.000826)|Acute lymphoblastic leukemia(157;0.000966)|all_neural(223;0.0332)|Medulloblastoma(222;0.0425)|Breast(348;0.147)		Epithelial(105;1.7e-06)|BRCA - Breast invasive adenocarcinoma(274;3.16e-06)|all cancers(92;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(223;0.0507)		CACCCAGCACGAGTTGCCTCT	0.632																																						dbGAP											0													76.0	68.0	71.0					11																	111156467		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			BC039669	CCDS31674.1	11q23.1	2012-05-31			ENSG00000150750	ENSG00000150750			30527	protein-coding gene	gene with protein product						12477932	Standard	NM_198498		Approved	MGC50104	uc001plc.3	Q8IXP5	OTTHUMG00000166656	ENST00000280325.4:c.399G>A	11.37:g.111156467G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.T133	ENST00000280325.4	37	c.399	CCDS31674.1	11																																																																																			C11orf53	-	NULL	ENSG00000150750		0.632	C11orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf53	HGNC	protein_coding	OTTHUMT00000390989.1	52	0.00	0	G	NM_198498		111156467	111156467	+1	no_errors	ENST00000280325	ensembl	human	known	69_37n	silent	15	42.31	11	SNP	0.008	A
CACNA2D3	55799	genome.wustl.edu	37	3	54786629	54786629	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr3:54786629C>T	ENST00000474759.1	+	12	1219	c.1171C>T	c.(1171-1173)Cgc>Tgc	p.R391C	CACNA2D3_ENST00000490478.1_Missense_Mutation_p.R297C|CACNA2D3_ENST00000415676.2_Missense_Mutation_p.R391C|CACNA2D3_ENST00000288197.5_Missense_Mutation_p.R391C	NM_018398.2	NP_060868.2	Q8IZS8	CA2D3_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 3	391	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.					integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)	p.R391C(1)		NS(1)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(3)	59				KIRC - Kidney renal clear cell carcinoma(284;0.00287)|Kidney(284;0.00327)	Amlodipine(DB00381)|Nilvadipine(DB06712)|Spironolactone(DB00421)	CCTTCAGGTTCGCATCTTCAC	0.512																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											116.0	119.0	118.0					3																	54786629		2173	4263	6436	-	-	-	SO:0001583	missense	0			AJ272268	CCDS54598.1	3p21.1	2010-10-05	2008-02-26		ENSG00000157445	ENSG00000157445		"""Calcium channel subunits"""	15460	protein-coding gene	gene with protein product		606399				11245980	Standard	XM_005265318		Approved	HSA272268	uc003dhf.3	Q8IZS8	OTTHUMG00000158580	ENST00000474759.1:c.1171C>T	3.37:g.54786629C>T	ENSP00000419101:p.Arg391Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPL6|Q9NY16|Q9NY18	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R391C	ENST00000474759.1	37	c.1171	CCDS54598.1	3	.	.	.	.	.	.	.	.	.	.	C	32	5.182541	0.94885	.	.	ENSG00000157445	ENST00000415676;ENST00000474759;ENST00000288197;ENST00000490478;ENST00000398624;ENST00000438476	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	6.02	6.02	0.97574	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	T	0.56659	0.2000	M	0.93854	3.465	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.66048	-0.6020	10	0.87932	D	0	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	391	Q8IZS8	CA2D3_HUMAN	C	391;391;391;297;297;296	ENSP00000389506:R391C;ENSP00000419101:R391C;ENSP00000288197:R391C;ENSP00000417279:R297C	ENSP00000288197:R391C	R	+	1	0	CACNA2D3	54761669	1.000000	0.71417	1.000000	0.80357	0.955000	0.61496	7.216000	0.77974	2.865000	0.98341	0.655000	0.94253	CGC	CACNA2D3	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000157445		0.512	CACNA2D3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CACNA2D3	HGNC	protein_coding	OTTHUMT00000351402.1	185	0.00	0	C			54786629	54786629	+1	no_errors	ENST00000288197	ensembl	human	known	69_37n	missense	134	20.24	34	SNP	1.000	T
CENPE	1062	genome.wustl.edu	37	4	104059573	104059573	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr4:104059573T>C	ENST00000265148.3	-	39	6327	c.6238A>G	c.(6238-6240)Agg>Ggg	p.R2080G	CENPE_ENST00000380026.3_Missense_Mutation_p.R1959G	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2080					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)			NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		CTTAGTAACCTTTTTTCAGGT	0.363																																						dbGAP											0													237.0	229.0	232.0					4																	104059573		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.6238A>G	4.37:g.104059573T>C	ENSP00000265148:p.Arg2080Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,prints_Kinesin_motor_dom,pfscan_Kinesin_motor_dom	p.R2080G	ENST00000265148.3	37	c.6238	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	T	10.43	1.347560	0.24426	.	.	ENSG00000138778	ENST00000265148;ENST00000394771;ENST00000380026	T;T	0.70749	-0.51;-0.5	3.97	-2.39	0.06602	.	.	.	.	.	T	0.48390	0.1497	N	0.16478	0.41	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.30621	-0.9972	9	0.54805	T	0.06	.	4.836	0.13466	0.0:0.4528:0.1944:0.3528	.	1959;2080	Q02224-3;Q02224	.;CENPE_HUMAN	G	2080;2080;1959	ENSP00000265148:R2080G;ENSP00000369365:R1959G	ENSP00000265148:R2080G	R	-	1	2	CENPE	104279022	0.000000	0.05858	0.000000	0.03702	0.434000	0.31775	-0.683000	0.05179	-0.554000	0.06150	0.450000	0.29827	AGG	CENPE	-	NULL	ENSG00000138778		0.363	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		553	0.18	1	T			104059573	104059573	-1	no_errors	ENST00000265148	ensembl	human	known	69_37n	missense	418	18.20	93	SNP	0.000	C
COL4A5	1287	genome.wustl.edu	37	X	107814670	107814670	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chrX:107814670G>T	ENST00000361603.2	+	7	656	c.412G>T	c.(412-414)Ggt>Tgt	p.G138C	COL4A5_ENST00000328300.6_Missense_Mutation_p.G138C	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	138	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						AGGCAGTCCCGGTTTTCCTGG	0.388									Alport syndrome with Diffuse Leiomyomatosis																													dbGAP											0													151.0	158.0	156.0					X																	107814670		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.412G>T	X.37:g.107814670G>T	ENSP00000354505:p.Gly138Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.G138C	ENST00000361603.2	37	c.412	CCDS14543.1	X	.	.	.	.	.	.	.	.	.	.	G	18.85	3.711754	0.68730	.	.	ENSG00000188153	ENST00000328300;ENST00000361603;ENST00000508186	D;D	0.99637	-6.29;-6.29	6.13	6.13	0.99165	.	0.057864	0.64402	D	0.000002	D	0.99871	0.9939	H	0.99697	4.71	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96319	0.9235	10	0.87932	D	0	.	19.7251	0.96161	0.0:0.0:1.0:0.0	.	138;138	E7EVY4;P29400	.;CO4A5_HUMAN	C	138	ENSP00000331902:G138C;ENSP00000354505:G138C	ENSP00000331902:G138C	G	+	1	0	COL4A5	107701326	1.000000	0.71417	0.997000	0.53966	0.993000	0.82548	8.536000	0.90627	2.615000	0.88500	0.597000	0.82753	GGT	COL4A5	-	pfam_Collagen	ENSG00000188153		0.388	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	290	0.00	0	G			107814670	107814670	+1	no_errors	ENST00000328300	ensembl	human	known	69_37n	missense	144	17.61	31	SNP	1.000	T
COPS3	8533	genome.wustl.edu	37	17	17163709	17163709	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:17163709T>C	ENST00000268717.5	-	8	948	c.842A>G	c.(841-843)aAg>aGg	p.K281R	COPS3_ENST00000539941.2_Missense_Mutation_p.K261R|COPS3_ENST00000439936.2_Intron	NM_003653.3	NP_003644.2	Q9UNS2	CSN3_HUMAN	COP9 signalosome subunit 3	281	PCI.				cullin deneddylation (GO:0010388)|in utero embryonic development (GO:0001701)|response to light stimulus (GO:0009416)|signal transduction (GO:0007165)	COP9 signalosome (GO:0008180)|cytoplasm (GO:0005737)				NS(1)|large_intestine(3)|lung(6)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	13						TTCACTGTGCTTATTCACCAG	0.443																																						dbGAP											0													227.0	187.0	200.0					17																	17163709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF031647	CCDS11183.1, CCDS56022.1	17p11.2	2013-03-14	2013-03-14		ENSG00000141030	ENSG00000141030			2239	protein-coding gene	gene with protein product		604665	"""COP9 (constitutive photomorphogenic, Arabidopsis, homolog) subunit 3"", ""COP9 constitutive photomorphogenic homolog subunit 3 (Arabidopsis)"""			9535219, 10191102	Standard	NM_003653		Approved	SGN3, CSN3	uc002grd.3	Q9UNS2	OTTHUMG00000059281	ENST00000268717.5:c.842A>G	17.37:g.17163709T>C	ENSP00000268717:p.Lys281Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R683|B4DY81|O43191|Q7LDR6	Missense_Mutation	SNP	pfam_PCI_dom,smart_PCI_dom	p.K281R	ENST00000268717.5	37	c.842	CCDS11183.1	17	.	.	.	.	.	.	.	.	.	.	T	16.81	3.226791	0.58668	.	.	ENSG00000141030	ENST00000268717;ENST00000539941;ENST00000417352	T;T	0.32753	1.44;1.44	5.47	5.47	0.80525	Proteasome component (PCI) domain (1);	0.045244	0.85682	D	0.000000	T	0.35038	0.0918	M	0.66378	2.025	0.80722	D	1	B	0.09022	0.002	B	0.20577	0.03	T	0.10132	-1.0643	10	0.35671	T	0.21	-25.1845	14.7268	0.69351	0.0:0.0:0.0:1.0	.	281	Q9UNS2	CSN3_HUMAN	R	281;261;312	ENSP00000268717:K281R;ENSP00000437606:K261R	ENSP00000268717:K281R	K	-	2	0	COPS3	17104434	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.953000	0.70290	2.074000	0.62210	0.533000	0.62120	AAG	COPS3	-	pfam_PCI_dom	ENSG00000141030		0.443	COPS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPS3	HGNC	protein_coding	OTTHUMT00000131603.2	620	0.16	1	T			17163709	17163709	-1	no_errors	ENST00000268717	ensembl	human	known	69_37n	missense	544	17.58	116	SNP	1.000	C
CPB2	1361	genome.wustl.edu	37	13	46629931	46629931	+	Silent	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr13:46629931G>T	ENST00000181383.4	-	10	1069	c.1053C>A	c.(1051-1053)acC>acA	p.T351T	CPB2-AS1_ENST00000606351.1_RNA|CPB2_ENST00000439329.3_Silent_p.T314T|CPB2-AS1_ENST00000606991.1_RNA|CPB2-AS1_ENST00000606243.1_RNA|CPB2-AS1_ENST00000415033.2_RNA	NM_001872.3	NP_001863.3	Q96IY4	CBPB2_HUMAN	carboxypeptidase B2 (plasma)	351					blood coagulation (GO:0007596)|cellular response to glucose stimulus (GO:0071333)|fibrinolysis (GO:0042730)|liver regeneration (GO:0097421)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of plasminogen activation (GO:0010757)|positive regulation of extracellular matrix constituent secretion (GO:0003331)|proteolysis (GO:0006508)|response to drug (GO:0042493)|response to heat (GO:0009408)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|cervix(1)|large_intestine(3)|liver(1)|lung(9)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	21		Lung NSC(96;4.21e-05)|Breast(56;0.000118)|Prostate(109;0.00217)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)|all_neural(104;0.235)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;5.44e-05)		GTGTATACCTGGTATTTTTAC	0.353																																						dbGAP											0													107.0	106.0	107.0					13																	46629931		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			M75106	CCDS9401.1, CCDS73568.1	13q14.11	2012-02-10	2007-02-21		ENSG00000080618	ENSG00000080618			2300	protein-coding gene	gene with protein product	"""thrombin-activatable fibrinolysis inhibitor"", ""carboxypeptidase U"", ""plasma carboxypeptidase B"", ""carboxypeptidase R"""	603101	"""carboxypeptidase B2 (plasma, carboxypeptidase U)"""			1939207, 1427879	Standard	NM_001278541		Approved	CPU, PCPB, TAFI	uc001vaw.3	Q96IY4	OTTHUMG00000016867	ENST00000181383.4:c.1053C>A	13.37:g.46629931G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K464|Q15114|Q5T9K1|Q5T9K2|Q9P2Y6	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.T351	ENST00000181383.4	37	c.1053	CCDS9401.1	13																																																																																			CPB2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000080618		0.353	CPB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPB2	HGNC	protein_coding	OTTHUMT00000044803.2	228	0.00	0	G	NM_001872		46629931	46629931	-1	no_errors	ENST00000181383	ensembl	human	known	69_37n	silent	28	65.85	54	SNP	0.007	T
CRHR1	1394	genome.wustl.edu	37	17	43906585	43906585	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:43906585A>C	ENST00000398285.3	+	5	332	c.332A>C	c.(331-333)aAa>aCa	p.K111T	CRHR1_ENST00000314537.5_Missense_Mutation_p.K111T|CRHR1_ENST00000352855.5_Missense_Mutation_p.K71T|CRHR1_ENST00000577353.1_Missense_Mutation_p.K111T|CRHR1_ENST00000339069.5_Missense_Mutation_p.K10T|CRHR1_ENST00000293493.7_5'UTR	NM_001145146.1	NP_001138618.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1	111					activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		CTCCAGAAAAAAAGCAAGGTG	0.587																																					Ovarian(110;57 1568 10207 38216 49865)	dbGAP											0													67.0	74.0	72.0					17																	43906585		2104	4207	6311	-	-	-	SO:0001583	missense	0			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000398285.3:c.332A>C	17.37:g.43906585A>C	ENSP00000381333:p.Lys111Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIE9|Q13008|Q4QRJ1|Q9UK64	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CRF1_rcpt,prints_GPCR_2_diuretic_rcpt	p.K111T	ENST00000398285.3	37	c.332	CCDS45712.1	17	.	.	.	.	.	.	.	.	.	.	A	14.19	2.460582	0.43736	.	.	ENSG00000120088	ENST00000339069;ENST00000398285;ENST00000314537;ENST00000347197;ENST00000352855	T;T;T;T;T	0.69561	0.98;1.01;0.92;-0.41;1.26	5.43	4.36	0.52297	GPCR, family 2, extracellular hormone receptor domain (1);	0.153390	0.56097	D	0.000025	T	0.69788	0.3150	L	0.41492	1.28	0.80722	D	1	P;B;P;D;B;P	0.71674	0.609;0.417;0.929;0.998;0.409;0.609	P;B;P;D;B;B	0.63113	0.506;0.129;0.57;0.911;0.322;0.258	T	0.71471	-0.4583	10	0.62326	D	0.03	.	8.8075	0.34948	0.912:0.0:0.088:0.0	.	111;111;10;10;71;111	P34998-4;P34998;B3TIK8;B4DMR5;P34998-3;P34998-2	.;CRFR1_HUMAN;.;.;.;.	T	10;111;111;111;71	ENSP00000340522:K10T;ENSP00000381333:K111T;ENSP00000326060:K111T;ENSP00000239167:K111T;ENSP00000344068:K71T	ENSP00000326060:K111T	K	+	2	0	CRHR1	41262366	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.301000	0.72782	2.072000	0.62099	0.459000	0.35465	AAA	CRHR1	-	smart_GPCR_2_extracellular_dom,prints_GPCR_2_CRF_rcpt,prints_GPCR_2_CRF1_rcpt,prints_GPCR_2_diuretic_rcpt	ENSG00000120088		0.587	CRHR1-001	KNOWN	basic|CCDS	protein_coding	CRHR1	HGNC	protein_coding	OTTHUMT00000441241.3	126	0.00	0	A			43906585	43906585	+1	no_errors	ENST00000398285	ensembl	human	known	69_37n	missense	44	45.00	36	SNP	1.000	C
CSMD1	64478	genome.wustl.edu	37	8	3057330	3057330	+	Splice_Site	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr8:3057330C>T	ENST00000520002.1	-	34	5658	c.5103G>A	c.(5101-5103)ggG>ggA	p.G1701G	CSMD1_ENST00000539096.1_Splice_Site_p.G1700G|CSMD1_ENST00000537824.1_Splice_Site_p.G1700G|CSMD1_ENST00000602723.1_Splice_Site_p.G1701G|CSMD1_ENST00000542608.1_Splice_Site_p.G1700G|CSMD1_ENST00000400186.3_Splice_Site_p.G1701G|CSMD1_ENST00000602557.1_Splice_Site_p.G1701G|CSMD1_ENST00000523387.1_5'UTR			Q96PZ7	CSMD1_HUMAN	CUB and Sushi multiple domains 1	1701	CUB 10. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)				breast(20)|large_intestine(5)	25		all_cancers(1;5.7e-41)|all_epithelial(1;2.54e-36)|Lung NSC(1;7.54e-11)|all_lung(1;3.2e-10)|Hepatocellular(1;3.78e-05)|Breast(1;0.000196)|Myeloproliferative disorder(4;0.000374)|Esophageal squamous(1;0.0157)|Ovarian(12;0.091)|Renal(68;0.144)|Colorectal(14;0.234)		all cancers(1;5.03e-41)|Epithelial(1;4.78e-31)|Lung(1;1.14e-14)|LUSC - Lung squamous cell carcinoma(1;2.34e-14)|GBM - Glioblastoma multiforme(1;4.49e-10)|Colorectal(4;1.18e-07)|OV - Ovarian serous cystadenocarcinoma(1;3.2e-07)|BRCA - Breast invasive adenocarcinoma(1;6.17e-07)|COAD - Colon adenocarcinoma(4;0.000539)|READ - Rectum adenocarcinoma(4;0.00896)|Kidney(5;0.00957)|KIRC - Kidney renal clear cell carcinoma(5;0.0689)		GCAATGTTTCCCCTAGAAACG	0.453																																						dbGAP											0													33.0	34.0	34.0					8																	3057330		1916	4137	6053	-	-	-	SO:0001630	splice_region_variant	0					8p23.2	2012-04-17			ENSG00000183117	ENSG00000183117		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	14026	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 24"""	608397					Standard	NM_033225		Approved	KIAA1890, PPP1R24	uc022aqr.1	Q96PZ7	OTTHUMG00000163605	ENST00000520002.1:c.5102-1G>A	8.37:g.3057330C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0H0J5|Q96QU9|Q96RM4	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.G1181R	ENST00000520002.1	37	c.3541		8	.	.	.	.	.	.	.	.	.	.	C	0.012	-1.673560	0.00758	.	.	ENSG00000183117	ENST00000335551	T	0.59772	0.24	5.61	-9.82	0.00484	.	0.000000	0.85682	D	0.000000	T	0.41213	0.1149	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.48139	-0.9061	7	0.37606	T	0.19	.	1.4139	0.02297	0.1416:0.3182:0.2318:0.3084	.	.	.	.	R	1181	ENSP00000334828:G1181R	ENSP00000334828:G1181R	G	-	1	0	CSMD1	3044737	0.004000	0.15560	0.593000	0.28771	0.019000	0.09904	-1.311000	0.02723	-1.188000	0.02705	-0.266000	0.10368	GGA	CSMD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000183117		0.453	CSMD1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CSMD1	HGNC	protein_coding	OTTHUMT00000374500.2	79	0.00	0	C	NM_033225	Silent	3057330	3057330	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000335551	ensembl	human	novel	69_37n	missense	14	41.67	10	SNP	0.632	T
DAP3	7818	genome.wustl.edu	37	1	155701787	155701787	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr1:155701787C>A	ENST00000368336.5	+	11	1080	c.956C>A	c.(955-957)cCc>cAc	p.P319H	DAP3_ENST00000343043.3_Missense_Mutation_p.P319H|MSTO1_ENST00000538143.1_Intron|DAP3_ENST00000421487.2_Missense_Mutation_p.P285H|MSTO1_ENST00000452804.2_Intron|DAP3_ENST00000471642.2_Missense_Mutation_p.P278H|DAP3_ENST00000535183.1_Missense_Mutation_p.P278H	NM_001199849.1|NM_004632.3	NP_001186778.1|NP_004623.1	P51398	RT29_HUMAN	death associated protein 3	319					apoptotic mitochondrial changes (GO:0008637)|apoptotic signaling pathway (GO:0097190)	mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|ovary(1)|prostate(2)|skin(1)|urinary_tract(1)	24	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)					CTCTTTAAGCCCCGGAAAGCC	0.418																																						dbGAP											0													40.0	40.0	40.0					1																	155701787		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83544	CCDS1120.1, CCDS55646.1, CCDS55647.1	1q22	2012-11-14			ENSG00000132676	ENSG00000132676		"""Mitochondrial ribosomal proteins / small subunits"""	2673	protein-coding gene	gene with protein product	"""mitochondrial 28S ribosomal protein S29"""	602074				7499268, 9284927	Standard	NM_004632		Approved	MRPS29, DAP-3, MRP-S29, bMRP-10, MGC126058, MGC126059, DKFZp686G12159	uc001flr.3	P51398	OTTHUMG00000035439	ENST00000368336.5:c.956C>A	1.37:g.155701787C>A	ENSP00000357320:p.Pro319His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DP59|B4DY62|E7EM60|Q13044|Q68CT7|Q96Q20	Missense_Mutation	SNP	pfam_Ribosomal_S23/S29_mit,prints_Ribosomal_S29_mit	p.P319H	ENST00000368336.5	37	c.956	CCDS1120.1	1	.	.	.	.	.	.	.	.	.	.	C	14.27	2.485471	0.44147	.	.	ENSG00000132676	ENST00000368336;ENST00000343043;ENST00000421487;ENST00000535183	T;T;T;T	0.49139	1.06;1.06;0.79;1.0	5.09	3.19	0.36642	.	0.124873	0.53938	D	0.000044	T	0.44685	0.1305	L	0.57536	1.79	0.43555	D	0.995861	D;D;D;D	0.71674	0.995;0.998;0.998;0.995	D;D;D;D	0.72338	0.941;0.977;0.962;0.963	T	0.40979	-0.9534	10	0.15952	T	0.53	-4.6608	9.8908	0.41290	0.0:0.7837:0.1404:0.0759	.	278;285;285;319	B4DP59;B4DY62;E7EM60;P51398	.;.;.;RT29_HUMAN	H	319;319;285;278	ENSP00000357320:P319H;ENSP00000341692:P319H;ENSP00000412605:P285H;ENSP00000445003:P278H	ENSP00000341692:P319H	P	+	2	0	DAP3	153968411	0.998000	0.40836	0.692000	0.30179	0.970000	0.65996	4.392000	0.59659	0.702000	0.31825	0.557000	0.71058	CCC	DAP3	-	pfam_Ribosomal_S23/S29_mit	ENSG00000132676		0.418	DAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAP3	HGNC	protein_coding	OTTHUMT00000086042.1	234	0.00	0	C	NM_004632		155701787	155701787	+1	no_errors	ENST00000343043	ensembl	human	known	69_37n	missense	305	11.08	38	SNP	0.977	A
DKK2	27123	genome.wustl.edu	37	4	107845202	107845202	+	Missense_Mutation	SNP	C	C	T	rs539488952		TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr4:107845202C>T	ENST00000285311.3	-	4	1394	c.689G>A	c.(688-690)cGt>cAt	p.R230H	DKK2_ENST00000510463.1_Missense_Mutation_p.R184H|DKK2_ENST00000513208.1_Missense_Mutation_p.R130H	NM_014421.2	NP_055236.1	Q9UBU2	DKK2_HUMAN	dickkopf WNT signaling pathway inhibitor 2	230	DKK-type Cys-2.				multicellular organismal development (GO:0007275)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)		p.R230H(3)		autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(7)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	32		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;6.34e-06)		ACAGTCGCAACGCTGGAAAAT	0.488													C|||	1	0.000199681	0.0	0.0	5008	,	,		18840	0.001		0.0	False		,,,				2504	0.0					dbGAP											3	Substitution - Missense(3)	large_intestine(2)|prostate(1)											161.0	147.0	152.0					4																	107845202		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB033208	CCDS3675.1	4q25	2013-05-15	2013-05-15		ENSG00000155011	ENSG00000155011			2892	protein-coding gene	gene with protein product		605415	"""dickkopf (Xenopus laevis) homolog 2"", ""dickkopf 2 homolog (Xenopus laevis)"""			10570958	Standard	NM_014421		Approved		uc003hyi.3	Q9UBU2	OTTHUMG00000131216	ENST00000285311.3:c.689G>A	4.37:g.107845202C>T	ENSP00000285311:p.Arg230His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVE9|B2R6S7|Q9UIU3	Missense_Mutation	SNP	pfam_Dickkopf_N,superfamily_Zn2-C6_fun-type_DNA-bd	p.R230H	ENST00000285311.3	37	c.689	CCDS3675.1	4	.	.	.	.	.	.	.	.	.	.	C	28.2	4.897895	0.91962	.	.	ENSG00000155011	ENST00000285311;ENST00000513208;ENST00000510463	T;T;T	0.57595	0.39;0.52;0.54	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	T	0.75361	0.3839	M	0.81341	2.54	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.77051	-0.2731	10	0.59425	D	0.04	-11.8314	19.6876	0.95986	0.0:1.0:0.0:0.0	.	230	Q9UBU2	DKK2_HUMAN	H	230;130;184	ENSP00000285311:R230H;ENSP00000421255:R130H;ENSP00000423797:R184H	ENSP00000285311:R230H	R	-	2	0	DKK2	108064651	1.000000	0.71417	1.000000	0.80357	0.692000	0.40212	7.487000	0.81328	2.657000	0.90304	0.585000	0.79938	CGT	DKK2	-	NULL	ENSG00000155011		0.488	DKK2-001	NOVEL	basic|appris_principal|CCDS	protein_coding	DKK2	HGNC	protein_coding	OTTHUMT00000253959.4	176	0.00	0	C			107845202	107845202	-1	no_errors	ENST00000285311	ensembl	human	novel	69_37n	missense	87	44.23	69	SNP	1.000	T
DNHD1	144132	genome.wustl.edu	37	11	6561187	6561187	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:6561187C>T	ENST00000527990.2	+	16	3502	c.3502C>T	c.(3502-3504)Cgc>Tgc	p.R1168C	DNHD1_ENST00000254579.6_Missense_Mutation_p.R1168C			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	1168					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		GCGCCAGCTGCGCCTGCTCAA	0.587																																						dbGAP											0													61.0	64.0	63.0					11																	6561187		692	1591	2283	-	-	-	SO:0001583	missense	0			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.3502C>T	11.37:g.6561187C>T	ENSP00000436180:p.Arg1168Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy,superfamily_t-SNARE	p.R1168C	ENST00000527990.2	37	c.3502	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307606	0.81247	.	.	ENSG00000179532	ENST00000254579;ENST00000527990	T;T	0.61392	0.11;0.11	5.57	4.63	0.57726	Dynein heavy chain, domain-2 (1);	.	.	.	.	T	0.57755	0.2075	N	0.08118	0	0.43673	D	0.996104	D	0.89917	1.0	D	0.91635	0.999	T	0.66060	-0.6017	9	0.56958	D	0.05	.	14.3244	0.66509	0.1498:0.8502:0.0:0.0	.	1168	Q96M86	DNHD1_HUMAN	C	1168	ENSP00000254579:R1168C;ENSP00000436180:R1168C	ENSP00000254579:R1168C	R	+	1	0	DNHD1	6517763	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	2.914000	0.48797	1.272000	0.44329	0.561000	0.74099	CGC	DNHD1	-	pfam_Dynein_heavy_dom-2	ENSG00000179532		0.587	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	48	0.00	0	C	NM_144666		6561187	6561187	+1	no_errors	ENST00000254579	ensembl	human	known	69_37n	missense	52	26.76	19	SNP	1.000	T
DUOX1	53905	genome.wustl.edu	37	15	45444508	45444508	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr15:45444508C>T	ENST00000321429.4	+	26	3625	c.3218C>T	c.(3217-3219)aCg>aTg	p.T1073M	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000389037.3_Missense_Mutation_p.T1073M|DUOX1_ENST00000561166.1_Missense_Mutation_p.T719M	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1073	Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GCACATCACACGGGCATCACA	0.622																																						dbGAP											0													124.0	91.0	102.0					15																	45444508		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3218C>T	15.37:g.45444508C>T	ENSP00000317997:p.Thr1073Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.T1073M	ENST00000321429.4	37	c.3218	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	C	5.773	0.326933	0.10900	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.86366	-2.11;-2.11	4.07	-8.13	0.01073	.	1.272990	0.05026	N	0.473652	T	0.76154	0.3948	L	0.42245	1.32	0.19575	N	0.999961	P;B	0.37276	0.589;0.027	B;B	0.32289	0.143;0.007	T	0.67530	-0.5647	10	0.46703	T	0.11	-0.4232	3.4152	0.07373	0.5209:0.2152:0.163:0.1009	.	206;1073	Q9NT13;Q9NRD9	.;DUOX1_HUMAN	M	1073	ENSP00000317997:T1073M;ENSP00000373689:T1073M	ENSP00000317997:T1073M	T	+	2	0	DUOX1	43231800	0.000000	0.05858	0.023000	0.16930	0.759000	0.43091	-1.732000	0.01851	-4.112000	0.00073	-1.402000	0.01139	ACG	DUOX1	-	NULL	ENSG00000137857		0.622	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	125	0.00	0	C	NM_017434		45444508	45444508	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	111	16.54	22	SNP	0.001	T
GATA3	2625	genome.wustl.edu	37	10	8115873	8115874	+	Frame_Shift_Ins	INS	-	-	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr10:8115873_8115874insC	ENST00000346208.3	+	6	1674_1675	c.1219_1220insC	c.(1219-1221)tcgfs	p.S407fs	GATA3_ENST00000461472.1_3'UTR|GATA3_ENST00000379328.3_Frame_Shift_Ins_p.S408fs			P23771	GATA3_HUMAN	GATA binding protein 3	407					anatomical structure formation involved in morphogenesis (GO:0048646)|anatomical structure morphogenesis (GO:0009653)|aortic valve morphogenesis (GO:0003180)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|canonical Wnt signaling pathway involved in metanephric kidney development (GO:0061290)|cardiac right ventricle morphogenesis (GO:0003215)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|cellular response to interferon-alpha (GO:0035457)|cellular response to interleukin-4 (GO:0071353)|cellular response to tumor necrosis factor (GO:0071356)|defense response (GO:0006952)|developmental growth (GO:0048589)|ear development (GO:0043583)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|humoral immune response (GO:0006959)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|interferon-gamma secretion (GO:0072643)|interleukin-4 secretion (GO:0072602)|kidney development (GO:0001822)|lens development in camera-type eye (GO:0002088)|lymphocyte migration (GO:0072676)|male gonad development (GO:0008584)|mast cell differentiation (GO:0060374)|mesenchymal to epithelial transition (GO:0060231)|mesonephros development (GO:0001823)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell motility (GO:2000146)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cell proliferation involved in mesonephros development (GO:2000607)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fibroblast growth factor receptor signaling pathway involved in ureteric bud formation (GO:2000703)|negative regulation of glial cell-derived neurotrophic factor receptor signaling pathway involved in ureteric bud formation (GO:2000734)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-2 production (GO:0032703)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of transcription, DNA-templated (GO:0045892)|nephric duct formation (GO:0072179)|nephric duct morphogenesis (GO:0072178)|neuron migration (GO:0001764)|norepinephrine biosynthetic process (GO:0042421)|otic vesicle development (GO:0071599)|parathyroid gland development (GO:0060017)|parathyroid hormone secretion (GO:0035898)|pharyngeal system development (GO:0060037)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of interleukin-13 production (GO:0032736)|positive regulation of interleukin-13 secretion (GO:2000667)|positive regulation of interleukin-4 production (GO:0032753)|positive regulation of interleukin-5 production (GO:0032754)|positive regulation of interleukin-5 secretion (GO:2000664)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of signal transduction (GO:0009967)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of ureteric bud formation (GO:0072107)|post-embryonic development (GO:0009791)|pro-T cell differentiation (GO:0002572)|regulation of CD4-positive, alpha-beta T cell differentiation (GO:0043370)|regulation of cellular response to X-ray (GO:2000683)|regulation of cytokine biosynthetic process (GO:0042035)|regulation of establishment of cell polarity (GO:2000114)|regulation of histone H3-K27 methylation (GO:0061085)|regulation of histone H3-K4 methylation (GO:0051569)|regulation of nephron tubule epithelial cell differentiation (GO:0072182)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to ethanol (GO:0045471)|response to gamma radiation (GO:0010332)|response to virus (GO:0009615)|signal transduction (GO:0007165)|sympathetic nervous system development (GO:0048485)|T cell receptor signaling pathway (GO:0050852)|T-helper 2 cell differentiation (GO:0045064)|thymic T cell selection (GO:0045061)|thymus development (GO:0048538)|TOR signaling (GO:0031929)|transcription from RNA polymerase II promoter (GO:0006366)|type IV hypersensitivity (GO:0001806)|ureter maturation (GO:0035799)|ureteric bud formation (GO:0060676)|uterus development (GO:0060065)|ventricular septum development (GO:0003281)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	core promoter proximal region sequence-specific DNA binding (GO:0000987)|core promoter sequence-specific DNA binding (GO:0001046)|DNA binding (GO:0003677)|E-box binding (GO:0070888)|enhancer sequence-specific DNA binding (GO:0001158)|HMG box domain binding (GO:0071837)|nucleic acid binding transcription factor activity (GO:0001071)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)	p.P409fs*>37(5)		NS(1)|breast(44)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(24)|ovary(3)|skin(2)	87						GAGCCACATCTCGCCCTTCAGC	0.599			"""F, N, S"""		breast		"""HDR syndrome (HYPOPARATHYROIDISM, SENSORINEURAL DEAFNESS, AND RENAL DISEASE)"""																															dbGAP		Rec	yes		10	10p15	2625	GATA binding protein 3	yes	E	5	Insertion - Frameshift(5)	breast(5)																																								-	-	-	SO:0001589	frameshift_variant	0			X55122	CCDS7083.1, CCDS31143.1	10p15	2013-01-25	2001-11-28		ENSG00000107485	ENSG00000107485		"""GATA zinc finger domain containing"""	4172	protein-coding gene	gene with protein product		131320	"""GATA-binding protein 3"""			2050118, 15087456	Standard	NM_002051		Approved	HDR	uc001ijz.3	P23771	OTTHUMG00000017640	ENST00000346208.3:c.1220dupC	10.37:g.8115874_8115874dupC	ENSP00000341619:p.Ser407fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWG7|Q5VWG8|Q96J16	Frame_Shift_Ins	INS	pfam_Znf_GATA,smart_Znf_GATA,pirsf_TF_GATA-1/2/3,pfscan_Znf_GATA,prints_Znf_GATA	p.P409fs	ENST00000346208.3	37	c.1222_1223	CCDS7083.1	10																																																																																			GATA3	-	pirsf_TF_GATA-1/2/3	ENSG00000107485		0.599	GATA3-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	GATA3	HGNC	protein_coding	OTTHUMT00000046719.1	120	0.00	0	-	NM_001002295		8115873	8115874	+1	no_errors	ENST00000379328	ensembl	human	known	69_37n	frame_shift_ins	124	29.55	52	INS	0.876:0.903	C
GNG5P2	347687	genome.wustl.edu	37	X	109590120	109590120	+	Silent	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chrX:109590120G>A	ENST00000372054.1	-	1	81	c.18C>T	c.(16-18)agC>agT	p.S6S	AMMECR1_ENST00000372057.1_Intron					guanine nucleotide binding protein (G protein), gamma 5 pseudogene 2																		TAGCGGCGACGCTGGAGAAGC	0.592																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0					Xq22.3	2008-11-05			ENSG00000133136	ENSG00000133136			24826	pseudogene	pseudogene						10819326	Standard	NG_002699		Approved				OTTHUMG00000022193	ENST00000372054.1:c.18C>T	X.37:g.109590120G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_G-protein_gamma-like_dom,superfamily_G-protein_gamma-like_dom,smart_G-protein_gamma-like_dom,prints_Gprotein-gamma,pfscan_G-protein_gamma-like_dom	p.S6	ENST00000372054.1	37	c.18		X																																																																																			GNG5P2	-	superfamily_G-protein_gamma-like_dom,pfscan_G-protein_gamma-like_dom	ENSG00000133136		0.592	GNG5P2-001	KNOWN	basic|appris_principal	protein_coding	GNG5P2	HGNC	protein_coding	OTTHUMT00000057903.1	33	0.00	0	G	NG_002699		109590120	109590120	-1	no_errors	ENST00000372054	ensembl	human	known	69_37n	silent	43	17.31	9	SNP	0.998	A
GOLGA1	2800	genome.wustl.edu	37	9	127683437	127683437	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr9:127683437T>C	ENST00000373555.4	-	10	1147	c.814A>G	c.(814-816)Att>Gtt	p.I272V		NM_002077.3	NP_002068	Q92805	GOGA1_HUMAN	golgin A1	272					protein targeting to Golgi (GO:0000042)	Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)				NS(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|stomach(1)	20						AGCTGCTGAATGAGTGCTTGG	0.373																																						dbGAP											0													246.0	231.0	236.0					9																	127683437		2203	4300	6503	-	-	-	SO:0001583	missense	0			U51587	CCDS6860.1	9q34.11	2010-02-12	2010-02-12		ENSG00000136935	ENSG00000136935			4424	protein-coding gene	gene with protein product		602502	"""golgi autoantigen, golgin subfamily a, 1"""			9324025	Standard	NM_002077		Approved	golgin-97, MGC33154	uc004bpc.3	Q92805	OTTHUMG00000020665	ENST00000373555.4:c.814A>G	9.37:g.127683437T>C	ENSP00000362656:p.Ile272Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T164|Q8IYZ9	Missense_Mutation	SNP	pfam_GRIP,superfamily_Prefoldin,superfamily_GRIP,smart_GRIP,pfscan_GRIP	p.I272V	ENST00000373555.4	37	c.814	CCDS6860.1	9	.	.	.	.	.	.	.	.	.	.	T	13.52	2.262617	0.39995	.	.	ENSG00000136935	ENST00000373555	T	0.16073	2.37	5.24	2.87	0.33458	.	0.147317	0.30840	U	0.008779	T	0.32071	0.0817	M	0.74881	2.28	0.42088	D	0.991286	D;D	0.62365	0.991;0.985	D;D	0.72625	0.978;0.952	T	0.44787	-0.9305	10	0.06236	T	0.91	-1.6678	9.1807	0.37141	0.0:0.1499:0.0:0.8501	.	171;272	Q59HA1;Q92805	.;GOGA1_HUMAN	V	272	ENSP00000362656:I272V	ENSP00000362656:I272V	I	-	1	0	GOLGA1	126723258	1.000000	0.71417	0.909000	0.35828	0.889000	0.51656	3.462000	0.53042	0.395000	0.25257	0.482000	0.46254	ATT	GOLGA1	-	NULL	ENSG00000136935		0.373	GOLGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLGA1	HGNC	protein_coding	OTTHUMT00000054049.1	581	0.00	0	T	NM_002077		127683437	127683437	-1	no_errors	ENST00000373555	ensembl	human	known	69_37n	missense	426	28.04	166	SNP	0.988	C
GOLGA6L2	283685	genome.wustl.edu	37	15	23684997	23684998	+	Frame_Shift_Ins	INS	-	-	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr15:23684997_23684998insG	ENST00000567107.1	-	8	2676_2677	c.2624_2625insC	c.(2623-2625)gaafs	p.E875fs	GOLGA6L2_ENST00000312015.5_Frame_Shift_Ins_p.K549fs|GOLGA6L2_ENST00000345070.5_Frame_Shift_Ins_p.E280fs			Q8N9W4	GG6L2_HUMAN	golgin A6 family-like 2	0										breast(1)|endometrium(7)	8						cctctcctccttctctcgcatc	0.599																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK093463		15q11.2	2012-10-05	2010-02-12		ENSG00000174450	ENSG00000174450			26695	protein-coding gene	gene with protein product	"""cancer/testis antigen 105"""		"""golgi autoantigen, golgin subfamily a, 6-like 2"""				Standard	XM_002343322		Approved	CT105, FLJ36144	uc021sfy.1	Q8N9W4	OTTHUMG00000176417	ENST00000567107.1:c.2624_2625insC	15.37:g.23684997_23684998insG	ENSP00000454407:p.Glu875fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L301	Frame_Shift_Ins	INS	prints_Tropomyosin	p.E280fs	ENST00000567107.1	37	c.840_839		15																																																																																			GOLGA6L2	-	NULL	ENSG00000174450		0.599	GOLGA6L2-002	PUTATIVE	basic|appris_candidate_longest	protein_coding	GOLGA6L2	HGNC	protein_coding	OTTHUMT00000431937.1	11	0.00	0	-	NM_182561		23684997	23684998	-1	no_errors	ENST00000345070	ensembl	human	known	69_37n	frame_shift_ins	6	33.33	3	INS	0.001:0.001	G
GPR84	53831	genome.wustl.edu	37	12	54757355	54757355	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr12:54757355C>A	ENST00000551809.1	-	1	916	c.281G>T	c.(280-282)aGg>aTg	p.R94M	GPR84_ENST00000267015.3_Missense_Mutation_p.R94M|RP11-753H16.5_ENST00000552785.1_RNA|RP11-753H16.3_ENST00000550474.1_RNA			Q9NQS5	GPR84_HUMAN	G protein-coupled receptor 84	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(2)|kidney(2)|large_intestine(6)|lung(5)|skin(1)|urinary_tract(1)	18						CCCAAATACCCTGCAGAAGGT	0.577																																						dbGAP											0													111.0	101.0	104.0					12																	54757355		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF237762	CCDS8878.1	12q13.13	2012-08-20						"""GPCR / Class A : Fatty acid receptors"""	4535	protein-coding gene	gene with protein product		606383				11273702	Standard	NM_020370		Approved	EX33	uc001sfu.3	Q9NQS5		ENST00000551809.1:c.281G>T	12.37:g.54757355C>A	ENSP00000450310:p.Arg94Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B6V9G7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	p.R94M	ENST00000551809.1	37	c.281	CCDS8878.1	12	.	.	.	.	.	.	.	.	.	.	C	16.77	3.216010	0.58452	.	.	ENSG00000139572	ENST00000267015;ENST00000551809	T;T	0.73258	-0.73;-0.73	5.21	4.33	0.51752	GPCR, rhodopsin-like superfamily (1);	0.156200	0.38959	N	0.001505	T	0.80602	0.4654	M	0.74467	2.265	0.52501	D	0.999952	D	0.57571	0.98	P	0.60886	0.88	T	0.82610	-0.0372	10	0.72032	D	0.01	-10.234	11.9661	0.53035	0.0:0.9147:0.0:0.0853	.	94	Q9NQS5	GPR84_HUMAN	M	94	ENSP00000267015:R94M;ENSP00000450310:R94M	ENSP00000267015:R94M	R	-	2	0	GPR84	53043622	0.970000	0.33590	0.768000	0.31515	0.371000	0.29859	1.564000	0.36375	1.341000	0.45600	0.555000	0.69702	AGG	GPR84	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000139572		0.577	GPR84-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GPR84	HGNC	protein_coding	OTTHUMT00000406156.1	238	0.42	1	C			54757355	54757355	-1	no_errors	ENST00000267015	ensembl	human	known	69_37n	missense	236	17.48	50	SNP	0.991	A
GUF1	60558	genome.wustl.edu	37	4	44682858	44682858	+	Splice_Site	SNP	C	C	G	rs534419729	byFrequency	TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr4:44682858C>G	ENST00000281543.5	+	3	619	c.425C>G	c.(424-426)cCg>cGg	p.P142R	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)											breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						ATTGATACACCGGTAAGTTTA	0.333																																						dbGAP											0													70.0	70.0	70.0					4																	44682858		2187	4255	6442	-	-	-	SO:0001630	splice_region_variant	0				CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.426+1C>G	4.37:g.44682858C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_LepA_GTP-bd_C,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Small_GTPase,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd,tigrfam_EF-4,tigrfam_Small_GTP-bd_dom	p.P142R	ENST00000281543.5	37	c.425	CCDS3468.1	4	.	.	.	.	.	.	.	.	.	.	C	22.4	4.290568	0.80914	.	.	ENSG00000151806	ENST00000281543	D	0.91631	-2.88	5.13	5.13	0.70059	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	D	0.000000	D	0.98397	0.9467	H	0.99965	5.09	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99675	1.0997	10	0.87932	D	0	-10.3646	17.9272	0.88987	0.0:1.0:0.0:0.0	.	142	Q8N442	GUF1_HUMAN	R	142	ENSP00000281543:P142R	ENSP00000281543:P142R	P	+	2	0	GUF1	44377615	1.000000	0.71417	0.991000	0.47740	0.855000	0.48748	7.445000	0.80570	2.528000	0.85240	0.655000	0.94253	CCG	GUF1	-	pfam_ProtSyn_GTP-bd,pfam_Small_GTPase,prints_ProtSyn_GTP-bd,tigrfam_EF-4,tigrfam_Small_GTP-bd_dom	ENSG00000151806		0.333	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUF1	HGNC	protein_coding	OTTHUMT00000250469.3	209	0.00	0	C	NM_021927	Missense_Mutation	44682858	44682858	+1	no_errors	ENST00000281543	ensembl	human	known	69_37n	missense	74	40.32	50	SNP	1.000	G
HFE	3077	genome.wustl.edu	37	6	26093039	26093039	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr6:26093039C>G	ENST00000357618.5	+	4	865	c.743C>G	c.(742-744)gCc>gGc	p.A248G	HFE_ENST00000488199.1_Missense_Mutation_p.A146G|HFE_ENST00000352392.4_Intron|HFE_ENST00000461397.1_Missense_Mutation_p.A234G|HFE_ENST00000397022.3_Missense_Mutation_p.A225G|HFE_ENST00000317896.7_Missense_Mutation_p.A156G|HFE_ENST00000349999.4_Missense_Mutation_p.A160G|HFE_ENST00000336625.8_Missense_Mutation_p.A142G|HFE_ENST00000353147.5_Missense_Mutation_p.A68G|HFE_ENST00000470149.1_Missense_Mutation_p.A245G|HFE_ENST00000309234.6_Missense_Mutation_p.A248G	NM_000410.3|NM_139006.2	NP_000401.1|NP_620575.1	Q30201	HFE_HUMAN	hemochromatosis	248	Alpha-3.|Ig-like C1-type.			A -> T (in Ref. 7; AAG29575). {ECO:0000305}.	antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular iron ion homeostasis (GO:0006879)|cellular response to iron ion starvation (GO:0010106)|female pregnancy (GO:0007565)|hormone biosynthetic process (GO:0042446)|immune response (GO:0006955)|iron ion import into cell (GO:0097459)|multicellular organismal iron ion homeostasis (GO:0060586)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein complex assembly (GO:0006461)	apical part of cell (GO:0045177)|basal part of cell (GO:0045178)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|integral component of plasma membrane (GO:0005887)|MHC class I protein complex (GO:0042612)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	peptide antigen binding (GO:0042605)|receptor binding (GO:0005102)			endometrium(3)|large_intestine(3)|liver(2)|lung(7)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19						CCAATGGATGCCAAGGAGTTC	0.532									Hemochromatosis																													dbGAP											0													125.0	117.0	120.0					6																	26093039		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database			CCDS4578.1, CCDS4579.1, CCDS4580.1, CCDS4581.1, CCDS4582.1, CCDS47386.1, CCDS47387.1, CCDS54974.1, CCDS54975.1, CCDS75412.1	6p21.3	2014-09-17			ENSG00000010704	ENSG00000010704		"""Immunoglobulin superfamily / C1-set domain containing"""	4886	protein-coding gene	gene with protein product	"""high Fe"""	613609				3460331	Standard	XR_241893		Approved	HLA-H	uc003nfx.1	Q30201	OTTHUMG00000016348	ENST00000357618.5:c.743C>G	6.37:g.26093039C>G	ENSP00000417404:p.Ala248Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2CKL0|O75929|O75930|O75931|Q17RT0|Q96KU5|Q96KU6|Q96KU7|Q96KU8|Q9HC64|Q9HC68|Q9HC70|Q9HC83	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,prints_MHC_I_a_a1/a2,pfscan_Ig-like	p.A248G	ENST00000357618.5	37	c.743	CCDS4578.1	6	.	.	.	.	.	.	.	.	.	.	.	11.47	1.648134	0.29336	.	.	ENSG00000010704	ENST00000349999;ENST00000397022;ENST00000317896;ENST00000353147;ENST00000357618;ENST00000470149;ENST00000336625;ENST00000461397;ENST00000488199;ENST00000309234	T;T;T;T;T;T;T;T;T;T	0.02944	4.1;4.1;4.1;4.1;4.1;4.1;4.1;4.1;4.1;4.1	5.35	4.48	0.54585	Immunoglobulin-like (1);Immunoglobulin C1-set (2);Immunoglobulin-like fold (1);	0.413163	0.23039	N	0.052634	T	0.05502	0.0145	L	0.55103	1.725	0.33218	D	0.554286	P;B;B;D;D;B;B;B;B	0.76494	0.488;0.328;0.014;0.999;0.997;0.158;0.141;0.0;0.19	B;B;B;D;P;B;B;B;B	0.68483	0.223;0.104;0.009;0.958;0.854;0.068;0.064;0.001;0.112	T	0.05084	-1.0907	10	0.87932	D	0	.	12.0565	0.53538	0.0:0.8133:0.1867:0.0	.	245;68;146;156;142;234;160;225;248	Q6B0J5;Q30201-6;Q30201-4;Q30201-7;Q30201-10;Q30201-3;Q30201-2;Q30201-5;Q30201	.;.;.;.;.;.;.;.;HFE_HUMAN	G	160;225;156;68;248;245;142;234;146;248	ENSP00000259699:A160G;ENSP00000380217:A225G;ENSP00000313776:A156G;ENSP00000312342:A68G;ENSP00000417404:A248G;ENSP00000419725:A245G;ENSP00000337819:A142G;ENSP00000420802:A234G;ENSP00000420559:A146G;ENSP00000311698:A248G	ENSP00000311698:A248G	A	+	2	0	HFE	26201018	0.002000	0.14202	0.538000	0.28064	0.114000	0.19823	-0.023000	0.12456	1.612000	0.50221	0.655000	0.94253	GCC	HFE	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	ENSG00000010704		0.532	HFE-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HFE	HGNC	protein_coding	OTTHUMT00000356133.1	222	0.00	0	C			26093039	26093039	+1	no_errors	ENST00000357618	ensembl	human	known	69_37n	missense	135	19.05	32	SNP	0.741	G
HNRNPLL	92906	genome.wustl.edu	37	2	38795342	38795342	+	Splice_Site	SNP	C	C	G	rs138662849		TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr2:38795342C>G	ENST00000449105.3	-	12	1911	c.1572G>C	c.(1570-1572)ccG>ccC	p.P524P	HNRNPLL_ENST00000409636.1_Splice_Site_p.P519P|HNRNPLL_ENST00000608859.1_Splice_Site_p.P524P|HNRNPLL_ENST00000378915.3_Splice_Site_p.P490P|HNRNPLL_ENST00000409328.1_Splice_Site_p.P490P			Q8WVV9	HNRLL_HUMAN	heterogeneous nuclear ribonucleoprotein L-like	524					mRNA processing (GO:0006397)|positive regulation of RNA splicing (GO:0033120)	membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										TTTACTTACTCGGCACTCTTA	0.368																																						dbGAP											0													85.0	79.0	81.0					2																	38795342		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			BC008217	CCDS46261.1, CCDS1796.2	2p22	2014-02-10		2013-06-12	ENSG00000143889	ENSG00000143889		"""RNA binding motif (RRM) containing"""	25127	protein-coding gene	gene with protein product		611208		HNRPLL		18669861	Standard	NM_138394		Approved		uc021vgc.1	Q8WVV9	OTTHUMG00000102075	ENST00000449105.3:c.1573+1G>C	2.37:g.38795342C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53T80|Q5JB51|Q5JB52|Q659B9|Q8IVH5|Q8IVH6|Q96HR5	Missense_Mutation	SNP	NULL	p.E131Q	ENST00000449105.3	37	c.391		2	.	.	.	.	.	.	.	.	.	.	C	11.72	1.721432	0.30503	.	.	ENSG00000143889	ENST00000441689	.	.	.	5.64	1.54	0.23209	.	.	.	.	.	T	0.43255	0.1239	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.24548	-1.0157	4	.	.	.	3.0E-4	2.0362	0.03540	0.1161:0.2046:0.1199:0.5594	.	.	.	.	Q	131	.	.	E	-	1	0	HNRPLL	38648846	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	0.915000	0.28638	0.377000	0.24735	-0.455000	0.05494	GAG	HNRPLL	-	NULL	ENSG00000143889		0.368	HNRNPLL-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	HNRPLL	HGNC	protein_coding	OTTHUMT00000219887.2	364	0.00	0	C	NM_138394	Silent	38795342	38795342	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000441689	ensembl	human	putative	69_37n	missense	93	60.25	144	SNP	0.997	G
HRNR	388697	genome.wustl.edu	37	1	152186490	152186490	+	Missense_Mutation	SNP	C	C	T	rs201463788	byFrequency	TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr1:152186490C>T	ENST00000368801.2	-	3	7690	c.7615G>A	c.(7615-7617)Ggc>Agc	p.G2539S	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	2539				G -> S (in Ref. 1; BAC57496). {ECO:0000305}.	establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CCACGCTGGCCGTGGCCTGGA	0.632													C|||	888	0.177316	0.1203	0.2147	5008	,	,		40970	0.2679		0.0934	False		,,,				2504	0.2209					dbGAP											0													1.0	1.0	1.0					1																	152186490		2	12	14	-	-	-	SO:0001583	missense	0			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.7615G>A	1.37:g.152186490C>T	ENSP00000357791:p.Gly2539Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5DT20|Q5U1F4	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.G2539S	ENST00000368801.2	37	c.7615	CCDS30859.1	1	.	.	.	.	.	.	.	.	.	.	C	8.448	0.852355	0.17106	.	.	ENSG00000197915	ENST00000368801	T	0.05081	3.5	3.1	-1.4	0.08968	.	.	.	.	.	T	0.00967	0.0032	L	0.40543	1.245	0.80722	P	0.0	P	0.39181	0.663	B	0.20184	0.028	T	0.49818	-0.8899	8	0.11794	T	0.64	.	7.0816	0.25234	0.0:0.4912:0.0:0.5088	rs7514457;rs9661330	2539	Q86YZ3	HORN_HUMAN	S	2539	ENSP00000357791:G2539S	ENSP00000357791:G2539S	G	-	1	0	HRNR	150453114	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.984000	0.03755	-0.477000	0.06832	0.603000	0.83216	GGC	HRNR	-	NULL	ENSG00000197915		0.632	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	9	0.00	0	C	XM_373868		152186490	152186490	-1	no_errors	ENST00000368801	ensembl	human	known	69_37n	missense	15	42.31	11	SNP	0.000	T
KBTBD4	55709	genome.wustl.edu	37	11	47594816	47594816	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:47594816T>C	ENST00000526005.1	-	4	1376	c.1223A>G	c.(1222-1224)gAc>gGc	p.D408G	NDUFS3_ENST00000533507.1_Intron|KBTBD4_ENST00000533290.1_Missense_Mutation_p.D433G|KBTBD4_ENST00000395288.2_Missense_Mutation_p.D408G|PTPMT1_ENST00000527079.2_3'UTR|KBTBD4_ENST00000430070.2_Missense_Mutation_p.D424G			Q9NVX7	KBTB4_HUMAN	kelch repeat and BTB (POZ) domain containing 4	408										NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	24						ATGGCATTTGTCTGTCTCTGT	0.522																																						dbGAP											0													140.0	123.0	129.0					11																	47594816		2201	4298	6499	-	-	-	SO:0001583	missense	0			AF151086	CCDS7940.1, CCDS44594.1	11p11.2	2013-01-08	2003-12-12	2003-12-17	ENSG00000123444	ENSG00000123444		"""BTB/POZ domain containing"""	23761	protein-coding gene	gene with protein product			"""BTB and kelch domain containing 4"""	BKLHD4		11042152	Standard	NM_018095		Approved	FLJ10450, HSPC252	uc001nfz.3	Q9NVX7	OTTHUMG00000166894	ENST00000526005.1:c.1223A>G	11.37:g.47594816T>C	ENSP00000433340:p.Asp408Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQS1|D3DQS2|Q6IA85|Q9BUC3|Q9NV76	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.D424G	ENST00000526005.1	37	c.1271	CCDS7940.1	11	.	.	.	.	.	.	.	.	.	.	T	15.69	2.907638	0.52333	.	.	ENSG00000123444	ENST00000526005;ENST00000533290;ENST00000395288;ENST00000430070	T;T;T;T	0.66460	-0.21;-0.21;-0.21;-0.21	5.86	5.86	0.93980	Kelch-type beta propeller (1);	0.095144	0.64402	D	0.000001	T	0.56292	0.1975	N	0.24115	0.695	0.48511	D	0.999664	B;B;B	0.19817	0.004;0.011;0.039	B;B;B	0.20767	0.008;0.02;0.031	T	0.54596	-0.8270	10	0.66056	D	0.02	-17.9871	16.2605	0.82541	0.0:0.0:0.0:1.0	.	424;408;433	Q9NVX7-2;Q9NVX7;B3KRH9	.;KBTB4_HUMAN;.	G	408;433;408;424	ENSP00000433340:D408G;ENSP00000436713:D433G;ENSP00000378703:D408G;ENSP00000415106:D424G	ENSP00000378703:D408G	D	-	2	0	KBTBD4	47551392	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.698000	0.84413	2.237000	0.73441	0.460000	0.39030	GAC	KBTBD4	-	NULL	ENSG00000123444		0.522	KBTBD4-003	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	KBTBD4	HGNC	protein_coding	OTTHUMT00000391763.1	146	0.00	0	T	NM_016506		47594816	47594816	-1	no_errors	ENST00000430070	ensembl	human	known	69_37n	missense	66	22.35	19	SNP	1.000	C
LARP1	23367	genome.wustl.edu	37	5	154181757	154181757	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr5:154181757A>T	ENST00000336314.4	+	11	1700	c.1676A>T	c.(1675-1677)gAt>gTt	p.D559V		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	636					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)			breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			TATGAGATTGATGACAGGGAT	0.547																																						dbGAP											0													144.0	127.0	133.0					5																	154181757		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.1676A>T	5.37:g.154181757A>T	ENSP00000336721:p.Asp559Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O94836|Q8N4M2|Q8NB73|Q9UFD7	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.D559V	ENST00000336314.4	37	c.1676	CCDS4328.1	5	.	.	.	.	.	.	.	.	.	.	A	26.5	4.739730	0.89573	.	.	ENSG00000155506	ENST00000336314;ENST00000518297;ENST00000524248	T;T;T	0.38077	1.59;1.16;1.2	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.64349	0.2590	M	0.82517	2.595	0.80722	D	1	D;D	0.76494	0.997;0.999	D;D	0.71656	0.946;0.974	T	0.69168	-0.5216	10	0.87932	D	0	-18.8314	16.8222	0.85835	1.0:0.0:0.0:0.0	.	636;559	Q6PKG0;Q6PKG0-3	LARP1_HUMAN;.	V	559;636;431	ENSP00000336721:D559V;ENSP00000428589:D636V;ENSP00000429904:D431V	ENSP00000336721:D559V	D	+	2	0	LARP1	154161950	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.262000	0.95591	2.371000	0.80710	0.533000	0.62120	GAT	LARP1	-	NULL	ENSG00000155506		0.547	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	208	0.00	0	A	NM_033551		154181757	154181757	+1	no_errors	ENST00000336314	ensembl	human	known	69_37n	missense	183	30.68	81	SNP	1.000	T
LGALS3BP	3959	genome.wustl.edu	37	17	76968195	76968195	+	Silent	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:76968195C>T	ENST00000262776.3	-	6	1529	c.1221G>A	c.(1219-1221)cgG>cgA	p.R407R	LGALS3BP_ENST00000591778.1_3'UTR	NM_005567.3	NP_005558.1	Q08380	LG3BP_HUMAN	lectin, galactoside-binding, soluble, 3 binding protein	407					cell adhesion (GO:0007155)|cellular defense response (GO:0006968)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|central_nervous_system(5)|endometrium(3)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17			BRCA - Breast invasive adenocarcinoma(99;0.0677)|OV - Ovarian serous cystadenocarcinoma(97;0.139)			AGGTGTAAATCCGGGGCTTGT	0.567											OREG0024787	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(89;1105 1755 18102 21513)	dbGAP											0													53.0	58.0	57.0					17																	76968195		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L13210	CCDS11759.1	17q25	2014-07-09				ENSG00000108679		"""BTB/POZ domain containing"", ""Endogenous ligands"""	6564	protein-coding gene	gene with protein product	"""L3 antigen"", ""Mac-2-binding protein"", ""serum protein 90K"", ""transport and golgi organization 10 homolog B (Drosophila)"""	600626				7698018, 8034587, 8390986	Standard	NM_005567		Approved	MAC-2-BP, 90K, BTBD17B, TANGO10B, M2BP, gp90, CyCAP	uc002jwh.3	Q08380		ENST00000262776.3:c.1221G>A	17.37:g.76968195C>T		Somatic	1172	WXS	Illumina GAIIx	Phase_IV	Q7M4S0|Q9UCH8|Q9UCH9|Q9UCI0	Silent	SNP	pfam_Srcr_rcpt,pfam_BACK,superfamily_Srcr_rcpt-rel,superfamily_BTB/POZ_fold,smart_Srcr_rcpt-rel,smart_BACK,prints_Srcr_rcpt,pfscan_BTB/POZ-like,pfscan_Srcr_rcpt	p.R407	ENST00000262776.3	37	c.1221	CCDS11759.1	17																																																																																			LGALS3BP	-	NULL	ENSG00000108679		0.567	LGALS3BP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS3BP	HGNC	protein_coding	OTTHUMT00000437785.3	105	0.00	0	C	NM_005567		76968195	76968195	-1	no_errors	ENST00000262776	ensembl	human	known	69_37n	silent	489	20.81	129	SNP	0.421	T
LRP6	4040	genome.wustl.edu	37	12	12397348	12397348	+	Silent	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr12:12397348C>T	ENST00000261349.4	-	2	373	c.297G>A	c.(295-297)ggG>ggA	p.G99G	LRP6_ENST00000543091.1_Silent_p.G99G	NM_002336.2	NP_002327.2	O75581	LRP6_HUMAN	low density lipoprotein receptor-related protein 6	99	Beta-propeller 1.				anterior/posterior pattern specification (GO:0009952)|axis elongation involved in somitogenesis (GO:0090245)|bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|canonical Wnt signaling pathway (GO:0060070)|canonical Wnt signaling pathway involved in cardiac neural crest cell differentiation involved in heart development (GO:0061310)|canonical Wnt signaling pathway involved in neural crest cell differentiation (GO:0044335)|canonical Wnt signaling pathway involved in positive regulation of cardiac outflow tract cell proliferation (GO:0061324)|canonical Wnt signaling pathway involved in regulation of cell proliferation (GO:0044340)|cell migration involved in gastrulation (GO:0042074)|cellular response to cholesterol (GO:0071397)|cerebellum morphogenesis (GO:0021587)|cerebral cortex cell migration (GO:0021795)|cerebral cortex development (GO:0021987)|convergent extension (GO:0060026)|dopaminergic neuron differentiation (GO:0071542)|embryonic camera-type eye morphogenesis (GO:0048596)|embryonic digit morphogenesis (GO:0042733)|embryonic forelimb morphogenesis (GO:0035115)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic limb morphogenesis (GO:0030326)|embryonic pattern specification (GO:0009880)|embryonic retina morphogenesis in camera-type eye (GO:0060059)|external genitalia morphogenesis (GO:0035261)|face morphogenesis (GO:0060325)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|gastrulation with mouth forming second (GO:0001702)|heart looping (GO:0001947)|mammary placode formation (GO:0060596)|midbrain development (GO:0030901)|midbrain-hindbrain boundary development (GO:0030917)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of planar cell polarity pathway involved in cardiac muscle tissue morphogenesis (GO:2000151)|negative regulation of planar cell polarity pathway involved in cardiac right atrium morphogenesis (GO:2000162)|negative regulation of planar cell polarity pathway involved in neural tube closure (GO:2000168)|negative regulation of planar cell polarity pathway involved in outflow tract morphogenesis (GO:2000164)|negative regulation of planar cell polarity pathway involved in pericardium morphogenesis (GO:2000166)|negative regulation of planar cell polarity pathway involved in ventricular septum morphogenesis (GO:2000149)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of smooth muscle cell apoptotic process (GO:0034392)|neural crest cell differentiation (GO:0014033)|neural crest formation (GO:0014029)|neural tube closure (GO:0001843)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|pericardium morphogenesis (GO:0003344)|positive regulation of apoptotic process (GO:0043065)|positive regulation of bone resorption (GO:0045780)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell cycle (GO:0045787)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of ossification (GO:0045778)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of Wnt signaling pathway involved in dorsal/ventral axis specification (GO:2000055)|post-anal tail morphogenesis (GO:0036342)|primitive streak formation (GO:0090009)|receptor-mediated endocytosis of low-density lipoprotein particle involved in cholesterol transport (GO:0090118)|regulation of cell development (GO:0060284)|regulation of fat cell differentiation (GO:0045598)|regulation of ossification (GO:0030278)|response to folic acid (GO:0051593)|response to peptide hormone (GO:0043434)|single organismal cell-cell adhesion (GO:0016337)|synaptic transmission (GO:0007268)|thalamus development (GO:0021794)|toxin transport (GO:1901998)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway involved in dorsal/ventral axis specification (GO:0044332)|Wnt signaling pathway involved in forebrain neuroblast division (GO:0021874)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	cell surface (GO:0009986)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|synapse (GO:0045202)	apolipoprotein binding (GO:0034185)|coreceptor activity involved in Wnt signaling pathway (GO:0071936)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|kinase inhibitor activity (GO:0019210)|low-density lipoprotein receptor activity (GO:0005041)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|toxin transporter activity (GO:0019534)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(19)|lung(28)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	85		Prostate(47;0.0865)				CACATGCCAGCCCATCGGGGG	0.383																																						dbGAP											0													99.0	93.0	95.0					12																	12397348		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF074264	CCDS8647.1	12p13.2	2013-05-29			ENSG00000070018	ENSG00000070018		"""Low density lipoprotein receptors"""	6698	protein-coding gene	gene with protein product		603507				9704021	Standard	NM_002336		Approved	ADCAD2	uc001rah.4	O75581	OTTHUMG00000168540	ENST00000261349.4:c.297G>A	12.37:g.12397348C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RZ2	Silent	SNP	pirsf_Low_density_Lipo_rcpt-rel_p5/6,pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDLR_classB_rpt,smart_EGF-like,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.G99	ENST00000261349.4	37	c.297	CCDS8647.1	12																																																																																			LRP6	-	pirsf_Low_density_Lipo_rcpt-rel_p5/6,smart_LDLR_classB_rpt,pfscan_LDLR_classB_rpt	ENSG00000070018		0.383	LRP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP6	HGNC	protein_coding	OTTHUMT00000400137.1	227	0.00	0	C			12397348	12397348	-1	no_errors	ENST00000261349	ensembl	human	known	69_37n	silent	147	14.53	25	SNP	0.876	T
MIS18BP1	55320	genome.wustl.edu	37	14	45693721	45693722	+	Frame_Shift_Ins	INS	-	-	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr14:45693721_45693722insT	ENST00000310806.4	-	11	2526_2527	c.2068_2069insA	c.(2068-2070)agtfs	p.S690fs		NM_018353.4	NP_060823.3	Q6P0N0	M18BP_HUMAN	MIS18 binding protein 1	690					CENP-A containing nucleosome assembly (GO:0034080)|mitotic nuclear division (GO:0007067)|nucleosome assembly (GO:0006334)	chromosome, centromeric region (GO:0000775)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|breast(2)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(10)|liver(1)|lung(13)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	39						GCTGATGGGACTTTTTTTTTGA	0.376																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AB067490	CCDS9684.1	14q21.1	2011-06-03	2011-02-23	2011-02-23	ENSG00000129534	ENSG00000129534			20190	protein-coding gene	gene with protein product	"""kinetochore null 2 homolog (C. elegans)"""		"""chromosome 14 open reading frame 106"""	C14orf106		17339379, 17199038	Standard	NM_018353		Approved	M18BP1, FLJ11186, KIAA1903, KNL2	uc001wwf.3	Q6P0N0	OTTHUMG00000140266	ENST00000310806.4:c.2069dupA	14.37:g.45693730_45693730dupT	ENSP00000309790:p.Ser690fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSA7|Q86V14|Q96PY4|Q9NUR5|Q9Y4X9	Frame_Shift_Ins	INS	pfam_SANTA,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.S690fs	ENST00000310806.4	37	c.2069_2068	CCDS9684.1	14																																																																																			MIS18BP1	-	NULL	ENSG00000129534		0.376	MIS18BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIS18BP1	HGNC	protein_coding	OTTHUMT00000276795.2	105	0.00	0	-			45693721	45693722	-1	no_errors	ENST00000310806	ensembl	human	known	69_37n	frame_shift_ins	53	11.67	7	INS	0.004:0.797	T
MYO6	4646	genome.wustl.edu	37	6	76554660	76554663	+	Frame_Shift_Del	DEL	ACAA	ACAA	-			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	ACAA	ACAA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr6:76554660_76554663delACAA	ENST00000369977.3	+	10	1002_1005	c.863_866delACAA	c.(862-867)gacaaafs	p.DK288fs	MYO6_ENST00000369975.1_Frame_Shift_Del_p.DK288fs|MYO6_ENST00000369985.4_Frame_Shift_Del_p.DK288fs|MYO6_ENST00000369981.3_Frame_Shift_Del_p.DK288fs	NM_004999.3	NP_004990.3	Q9UM54	MYO6_HUMAN	myosin VI	288	Myosin motor.|Responsible for slow ATPase activity. {ECO:0000250}.				actin filament-based movement (GO:0030048)|auditory receptor cell differentiation (GO:0042491)|cellular response to electrical stimulus (GO:0071257)|dendrite development (GO:0016358)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|endocytosis (GO:0006897)|glutamate secretion (GO:0014047)|inner ear morphogenesis (GO:0042472)|intracellular protein transport (GO:0006886)|locomotory behavior (GO:0007626)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein targeting (GO:0006605)|regulation of secretion (GO:0051046)|regulation of synaptic plasticity (GO:0048167)|response to drug (GO:0042493)|sensory perception of sound (GO:0007605)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|axon (GO:0030424)|cell cortex (GO:0005938)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microvillus (GO:0005902)|neuronal cell body (GO:0043025)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|ruffle membrane (GO:0032587)|unconventional myosin complex (GO:0016461)|vesicle membrane (GO:0012506)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|minus-end directed microfilament motor activity (GO:0060001)|motor activity (GO:0003774)			breast(2)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(16)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	58		all_hematologic(105;0.189)		BRCA - Breast invasive adenocarcinoma(397;0.223)		AAAGAAACTGACAAACAGATTTTA	0.299																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U90236, AB002387	CCDS34487.1, CCDS75481.1	6q14.1	2014-09-17	2004-05-19		ENSG00000196586	ENSG00000196586		"""Myosins / Myosin superfamily : Class VI"""	7605	protein-coding gene	gene with protein product		600970	"""deafness, autosomal recessive 37"""	DFNA22, DFNB37		9259267, 11468689	Standard	XM_005248719		Approved	KIAA0389	uc003pih.1	Q9UM54	OTTHUMG00000015061	ENST00000369977.3:c.863_866delACAA	6.37:g.76554660_76554663delACAA	ENSP00000358994:p.Asp288fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8V4|E1P540|Q5TEM5|Q5TEM6|Q5TEM7|Q9BZZ7|Q9UEG2	Frame_Shift_Del	DEL	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.K289fs	ENST00000369977.3	37	c.863_866	CCDS34487.1	6																																																																																			MYO6	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom	ENSG00000196586		0.299	MYO6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO6	HGNC	protein_coding	OTTHUMT00000041279.2	248	0.00	0	ACAA	NM_004999		76554660	76554663	+1	no_errors	ENST00000369981	ensembl	human	known	69_37n	frame_shift_del	131	32.12	62	DEL	1.000:1.000:1.000:1.000	-
NEIL1	79661	genome.wustl.edu	37	15	75647144	75647144	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr15:75647144C>T	ENST00000564784.1	+	10	1716	c.1087C>T	c.(1087-1089)Cga>Tga	p.R363*	MIR631_ENST00000384904.1_RNA|NEIL1_ENST00000569035.1_Nonsense_Mutation_p.R363*|NEIL1_ENST00000355059.4_Nonsense_Mutation_p.R363*|RP11-817O13.6_ENST00000563660.1_lincRNA			Q96FI4	NEIL1_HUMAN	nei endonuclease VIII-like 1 (E. coli)	363					base-excision repair (GO:0006284)|negative regulation of nuclease activity (GO:0032074)|nucleotide-excision repair (GO:0006289)|response to oxidative stress (GO:0006979)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	damaged DNA binding (GO:0003684)|DNA N-glycosylase activity (GO:0019104)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|hydrolase activity, acting on glycosyl bonds (GO:0016798)|protein C-terminus binding (GO:0008022)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|large_intestine(4)|lung(4)|ovary(1)	13						GAGGAAGGGGCGACAGGCAGC	0.617								Base excision repair (BER), DNA glycosylases																														dbGAP											0													37.0	42.0	40.0					15																	75647144		2197	4294	6491	-	-	-	SO:0001587	stop_gained	0			AK026055	CCDS10278.1	15q33.33	2008-07-18			ENSG00000140398	ENSG00000140398			18448	protein-coding gene	gene with protein product		608844				11904416	Standard	NM_024608		Approved	FLJ22402, hFPG1, NEI1, FPG1	uc002bae.4	Q96FI4	OTTHUMG00000142821	ENST00000564784.1:c.1087C>T	15.37:g.75647144C>T	ENSP00000457352:p.Arg363*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW75|Q6ZRA7|Q86XW7|Q9H6C3	Nonsense_Mutation	SNP	pfam_Endonuclease-VIII_DNA-bd,pfam_DNA_glycosylase/AP_lyase_cat,pfam_DNA_glyclase/AP_lyase_DNA-bd,superfamily_DNA_glycosylase/AP_lyase_cat,superfamily_Ribosomal_S13-like_H2TH,smart_DNA_glycosylase/AP_lyase_cat,pfscan_DNA_glycosylase/AP_lyase_cat	p.R363*	ENST00000564784.1	37	c.1087	CCDS10278.1	15	.	.	.	.	.	.	.	.	.	.	C	38	6.942344	0.97952	.	.	ENSG00000140398	ENST00000355059	.	.	.	4.07	-3.02	0.05446	.	2.658450	0.01189	N	0.007270	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.8156	8.1606	0.31196	0.6761:0.2376:0.0:0.0863	.	.	.	.	X	363	.	ENSP00000347170:R363X	R	+	1	2	NEIL1	73434197	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.911000	0.04050	-0.566000	0.06054	-0.310000	0.09108	CGA	NEIL1	-	NULL	ENSG00000140398		0.617	NEIL1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NEIL1	HGNC	protein_coding	OTTHUMT00000419885.1	29	0.00	0	C	NM_024608		75647144	75647144	+1	no_errors	ENST00000355059	ensembl	human	known	69_37n	nonsense	26	18.18	6	SNP	0.000	T
NR1H2	7376	genome.wustl.edu	37	19	50881600	50881600	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr19:50881600C>T	ENST00000253727.5	+	5	611	c.376C>T	c.(376-378)Cgg>Tgg	p.R126W	NR1H2_ENST00000411902.2_Intron|NR1H2_ENST00000593926.1_Missense_Mutation_p.R126W|NR1H2_ENST00000542413.1_Intron|NR1H2_ENST00000599105.1_Missense_Mutation_p.R126W|NR1H2_ENST00000598168.1_Missense_Mutation_p.R126W	NM_007121.5	NP_009052	P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2	126					cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		CTATGCCTGCCGGGGTGGCGG	0.657																																						dbGAP											0													50.0	60.0	56.0					19																	50881600		2198	4294	6492	-	-	-	SO:0001583	missense	0			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000253727.5:c.376C>T	19.37:g.50881600C>T	ENSP00000253727:p.Arg126Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Ecdystd_rcpt,prints_ThyrH_rcpt	p.R126W	ENST00000253727.5	37	c.376	CCDS42593.1	19	.	.	.	.	.	.	.	.	.	.	C	16.17	3.046972	0.55110	.	.	ENSG00000131408	ENST00000253727;ENST00000376942	D	0.97404	-4.37	4.74	2.59	0.31030	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (3);	0.115977	0.37012	N	0.002296	D	0.97685	0.9241	M	0.82132	2.575	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.70716	0.97;0.97	D	0.96750	0.9553	10	0.87932	D	0	.	6.5397	0.22372	0.4257:0.4894:0.0:0.0849	.	126;126	P55055;F1D8P7	NR1H2_HUMAN;.	W	126	ENSP00000253727:R126W	ENSP00000253727:R126W	R	+	1	2	NR1H2	55573412	1.000000	0.71417	1.000000	0.80357	0.392000	0.30506	3.393000	0.52544	0.721000	0.32231	-0.268000	0.10319	CGG	NR1H2	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Liver_X_rcpt	ENSG00000131408		0.657	NR1H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR1H2	HGNC	protein_coding	OTTHUMT00000464724.2	24	0.00	0	C			50881600	50881600	+1	no_errors	ENST00000253727	ensembl	human	known	69_37n	missense	13	43.48	10	SNP	1.000	T
NTNG2	84628	genome.wustl.edu	37	9	135073814	135073814	+	Silent	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr9:135073814C>T	ENST00000393229.3	+	3	1451	c.675C>T	c.(673-675)ccC>ccT	p.P225P	NTNG2_ENST00000360670.3_Silent_p.P225P|NTNG2_ENST00000372179.3_Silent_p.P225P|NTNG2_ENST00000393228.4_Silent_p.P225P	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	225	Laminin N-terminal. {ECO:0000255|PROSITE- ProRule:PRU00466}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		TTGCCGGCCCCGACCTGCGCA	0.662																																						dbGAP											0													53.0	51.0	51.0					9																	135073814		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.675C>T	9.37:g.135073814C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUJ2|Q6UXY0|Q96JH0	Silent	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_EGF_extracell,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.P225	ENST00000393229.3	37	c.675	CCDS6946.1	9																																																																																			NTNG2	-	pfam_Laminin_N,smart_Laminin_N,pfscan_Laminin_N	ENSG00000196358		0.662	NTNG2-001	KNOWN	basic|CCDS	protein_coding	NTNG2	HGNC	protein_coding	OTTHUMT00000054779.1	11	0.00	0	C	NM_032536		135073814	135073814	+1	no_errors	ENST00000360670	ensembl	human	known	69_37n	silent	6	60.00	9	SNP	0.040	T
OR6B3	150681	genome.wustl.edu	37	2	240984860	240984860	+	Silent	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr2:240984860T>C	ENST00000319423.4	-	1	629	c.630A>G	c.(628-630)ccA>ccG	p.P210P	PRR21_ENST00000408934.1_5'Flank	NM_173351.1	NP_775486.1	Q8NGW1	OR6B3_HUMAN	olfactory receptor, family 6, subfamily B, member 3	210						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(10)|lung(4)|ovary(2)|prostate(1)	18		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;1.05e-29)|all cancers(36;3.52e-28)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)|Colorectal(34;0.019)|COAD - Colon adenocarcinoma(134;0.141)		TGGCCAGGAGTGGAAACACCA	0.587																																						dbGAP											0													63.0	70.0	67.0					2																	240984860		2144	4245	6389	-	-	-	SO:0001819	synonymous_variant	0				CCDS42837.1	2q37.3	2013-09-23	2002-11-13	2002-11-15	ENSG00000178586	ENSG00000178586		"""GPCR / Class A : Olfactory receptors"""	15042	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 3 pseudogene"""	OR6B3P			Standard	NM_173351		Approved	OR6B3Q	uc010zoe.2	Q8NGW1	OTTHUMG00000152399	ENST00000319423.4:c.630A>G	2.37:g.240984860T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFH3	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.P210	ENST00000319423.4	37	c.630	CCDS42837.1	2																																																																																			OR6B3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000178586		0.587	OR6B3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B3	HGNC	protein_coding	OTTHUMT00000326078.1	138	0.72	1	T			240984860	240984860	-1	no_errors	ENST00000319423	ensembl	human	known	69_37n	silent	83	38.52	52	SNP	0.001	C
OR6C70	390327	genome.wustl.edu	37	12	55863307	55863307	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr12:55863307T>C	ENST00000327335.4	-	1	615	c.616A>G	c.(616-618)Att>Gtt	p.I206V	RP11-110A12.2_ENST00000555138.1_RNA|RP11-110A12.2_ENST00000554049.1_RNA|RP11-110A12.2_ENST00000555146.1_RNA|RP11-110A12.2_ENST00000556750.1_RNA	NM_001005499.1	NP_001005499.1	A6NIJ9	O6C70_HUMAN	olfactory receptor, family 6, subfamily C, member 70	206						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			autonomic_ganglia(1)|cervix(1)|endometrium(2)|large_intestine(3)|lung(5)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	18						AATGTGACAATAAGTGTCATC	0.353																																						dbGAP											0													119.0	125.0	123.0					12																	55863307		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS31825.1	12q13.2	2013-09-23			ENSG00000184954	ENSG00000184954		"""GPCR / Class A : Olfactory receptors"""	31299	protein-coding gene	gene with protein product							Standard	NM_001005499		Approved		uc010spn.2	A6NIJ9	OTTHUMG00000171127	ENST00000327335.4:c.616A>G	12.37:g.55863307T>C	ENSP00000329153:p.Ile206Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.I206V	ENST00000327335.4	37	c.616	CCDS31825.1	12	.	.	.	.	.	.	.	.	.	.	T	0.013	-1.643929	0.00792	.	.	ENSG00000184954	ENST00000327335	T	0.36520	1.25	4.13	-0.00342	0.14025	GPCR, rhodopsin-like superfamily (1);	0.147283	0.32884	N	0.005528	T	0.14485	0.0350	N	0.05554	-0.025	0.09310	N	1	B	0.06786	0.001	B	0.11329	0.006	T	0.15896	-1.0421	10	0.26408	T	0.33	.	5.3533	0.16047	0.0:0.2325:0.4834:0.2841	.	206	A6NIJ9	O6C70_HUMAN	V	206	ENSP00000329153:I206V	ENSP00000329153:I206V	I	-	1	0	OR6C70	54149574	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	-1.888000	0.01616	0.227000	0.20999	0.533000	0.62120	ATT	OR6C70	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000184954		0.353	OR6C70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C70	HGNC	protein_coding	OTTHUMT00000411820.1	166	0.00	0	T			55863307	55863307	-1	no_errors	ENST00000327335	ensembl	human	known	69_37n	missense	103	18.90	24	SNP	0.000	C
OR8D4	338662	genome.wustl.edu	37	11	123777212	123777212	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:123777212T>G	ENST00000321355.2	+	1	104	c.74T>G	c.(73-75)cTg>cGg	p.L25R		NM_001005197.1	NP_001005197.1	Q8NGM9	OR8D4_HUMAN	olfactory receptor, family 8, subfamily D, member 4	25						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(1)|lung(16)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	25		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.93e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0409)		GAGCTTCAGCTGCCCCTCTTC	0.433																																						dbGAP											0													115.0	111.0	112.0					11																	123777212		2202	4299	6501	-	-	-	SO:0001583	missense	0			AB065761	CCDS31698.1	11q24.1	2012-08-09			ENSG00000181518	ENSG00000181518		"""GPCR / Class A : Olfactory receptors"""	14840	protein-coding gene	gene with protein product							Standard	NM_001005197		Approved		uc010saa.2	Q8NGM9	OTTHUMG00000165960	ENST00000321355.2:c.74T>G	11.37:g.123777212T>G	ENSP00000325381:p.Leu25Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IFE9	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L25R	ENST00000321355.2	37	c.74	CCDS31698.1	11	.	.	.	.	.	.	.	.	.	.	T	14.11	2.436743	0.43224	.	.	ENSG00000181518	ENST00000321355	T	0.00457	7.29	5.58	3.16	0.36331	.	0.000000	0.36854	N	0.002366	T	0.01029	0.0034	M	0.66378	2.025	0.26938	N	0.966302	D	0.89917	1.0	D	0.67900	0.954	T	0.37934	-0.9684	10	0.72032	D	0.01	.	10.011	0.41986	0.2698:0.0:0.0:0.7302	.	25	Q8NGM9	OR8D4_HUMAN	R	25	ENSP00000325381:L25R	ENSP00000325381:L25R	L	+	2	0	OR8D4	123282422	0.000000	0.05858	0.894000	0.35097	0.421000	0.31385	-0.258000	0.08733	0.342000	0.23796	-0.333000	0.08304	CTG	OR8D4	-	NULL	ENSG00000181518		0.433	OR8D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D4	HGNC	protein_coding	OTTHUMT00000387262.1	329	0.00	0	T	NM_001005197		123777212	123777212	+1	no_errors	ENST00000321355	ensembl	human	known	69_37n	missense	44	58.88	63	SNP	0.678	G
PCDH19	57526	genome.wustl.edu	37	X	99663201	99663201	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chrX:99663201G>T	ENST00000373034.4	-	1	2070	c.395C>A	c.(394-396)gCa>gAa	p.A132E	PCDH19_ENST00000255531.7_Missense_Mutation_p.A132E|PCDH19_ENST00000420881.2_Missense_Mutation_p.A132E	NM_001184880.1	NP_001171809.1	Q8TAB3	PCD19_HUMAN	protocadherin 19	132	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(5)|endometrium(11)|kidney(1)|large_intestine(14)|liver(1)|lung(23)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	68						CTCGATCTGTGCTGCCGGGAA	0.577																																						dbGAP											0													117.0	113.0	114.0					X																	99663201		2134	4226	6360	-	-	-	SO:0001583	missense	0			AB037734	CCDS43976.1, CCDS48141.1, CCDS55462.1	Xq22.1	2014-06-28			ENSG00000165194	ENSG00000165194		"""Cadherins / Protocadherins : Non-clustered"""	14270	protein-coding gene	gene with protein product		300460	"""epilepsy, female restricted, with mental retardation (Juberg-Hellman syndrome)"""	EFMR		11549318, 18469813, 19752159	Standard	NM_020766		Approved	KIAA1313, EIEE9	uc010nmz.3	Q8TAB3	OTTHUMG00000022000	ENST00000373034.4:c.395C>A	X.37:g.99663201G>T	ENSP00000362125:p.Ala132Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LDS4|E9PAM6|Q5JTG1|Q5JTG2|Q68DT7|Q9P2N3	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A132E	ENST00000373034.4	37	c.395	CCDS55462.1	X	.	.	.	.	.	.	.	.	.	.	G	3.757	-0.050319	0.07407	.	.	ENSG00000165194	ENST00000420881;ENST00000373034;ENST00000255531	T;T;T	0.20069	2.1;2.1;2.1	5.7	3.77	0.43336	Cadherin (2);Cadherin-like (1);	0.399577	0.29900	N	0.010912	T	0.07324	0.0185	N	0.04655	-0.195	0.09310	N	0.999995	B;B;B	0.19817	0.039;0.0;0.0	B;B;B	0.16722	0.016;0.0;0.0	T	0.38757	-0.9646	10	0.02654	T	1	.	7.5952	0.28044	0.0:0.1256:0.4842:0.3901	.	132;132;132	Q8TAB3;Q8TAB3-2;E9PAM6	PCD19_HUMAN;.;.	E	132	ENSP00000400327:A132E;ENSP00000362125:A132E;ENSP00000255531:A132E	ENSP00000255531:A132E	A	-	2	0	PCDH19	99549857	1.000000	0.71417	0.942000	0.38095	0.946000	0.59487	2.248000	0.43160	1.112000	0.41740	0.544000	0.68410	GCA	PCDH19	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000165194		0.577	PCDH19-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDH19	HGNC	protein_coding	OTTHUMT00000057479.2	101	0.98	1	G	NM_020766		99663201	99663201	-1	no_errors	ENST00000373034	ensembl	human	known	69_37n	missense	115	22.30	33	SNP	0.230	T
PELP1	27043	genome.wustl.edu	37	17	4576281	4576281	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:4576281C>A	ENST00000574876.1	-	16	2022	c.2005G>T	c.(2005-2007)Ggc>Tgc	p.G669C	PELP1_ENST00000269230.7_Silent_p.R579R|PELP1_ENST00000572293.1_Missense_Mutation_p.G719C|AC091153.4_ENST00000441700.2_RNA|PELP1_ENST00000301396.4_Missense_Mutation_p.G813C|PELP1_ENST00000436683.2_Missense_Mutation_p.G522C			Q8IZL8	PELP1_HUMAN	proline, glutamate and leucine rich protein 1	669	Pro-rich.				cellular response to estrogen stimulus (GO:0071391)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	15						GGCATGGGGCCCGGAGGATGG	0.716																																						dbGAP											0													33.0	37.0	36.0					17																	4576281		1957	4122	6079	-	-	-	SO:0001583	missense	0				CCDS58503.1, CCDS58503.2, CCDS62038.1	17p13.2	2012-05-02	2008-02-21			ENSG00000141456			30134	protein-coding gene	gene with protein product		609455	"""proline, glutamic acid and leucine rich protein 1"""			11481323, 12682072	Standard	NM_014389		Approved	MNAR	uc002fyi.4	Q8IZL8		ENST00000574876.1:c.2005G>T	17.37:g.4576281C>A	ENSP00000461625:p.Gly669Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15450|Q5EGN3|Q6NTE6|Q96FT1|Q9BU60	Missense_Mutation	SNP	pfam_Uncharacterised_NUC202,superfamily_ARM-type_fold	p.G813C	ENST00000574876.1	37	c.2437	CCDS58503.1	17	.	.	.	.	.	.	.	.	.	.	C	7.761	0.705313	0.15172	.	.	ENSG00000141456	ENST00000301396;ENST00000436683	T;T	0.52057	0.68;1.33	5.82	2.62	0.31277	.	0.606892	0.16761	N	0.200590	T	0.29945	0.0749	N	0.14661	0.345	0.22629	N	0.998915	D;D	0.56287	0.975;0.975	P;P	0.44647	0.456;0.456	T	0.07558	-1.0766	10	0.49607	T	0.09	-1.0889	6.4077	0.21674	0.1481:0.6927:0.0:0.1592	.	522;669	E7EV54;Q8IZL8	.;PELP1_HUMAN	C	813;522	ENSP00000301396:G813C;ENSP00000416231:G522C	ENSP00000301396:G813C	G	-	1	0	AC091153.1	4523030	0.104000	0.21937	0.381000	0.26106	0.252000	0.25951	2.295000	0.43576	0.812000	0.34326	0.655000	0.94253	GGC	PELP1	-	NULL	ENSG00000141456		0.716	PELP1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PELP1	HGNC	protein_coding	OTTHUMT00000439140.2	50	0.00	0	C	NM_014389		4576281	4576281	-1	no_errors	ENST00000301396	ensembl	human	known	69_37n	missense	24	60.66	37	SNP	0.374	A
PITPNM2	57605	genome.wustl.edu	37	12	123498580	123498580	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr12:123498580G>A	ENST00000542749.1	-	2	151	c.88C>T	c.(88-90)Cgt>Tgt	p.R30C	PITPNM2_ENST00000320201.4_Missense_Mutation_p.R30C|PITPNM2_ENST00000280562.5_Missense_Mutation_p.R30C|PITPNM2_ENST00000546049.1_Missense_Mutation_p.R30C|PITPNM2_ENST00000392428.1_Missense_Mutation_p.R30C|RN7SL133P_ENST00000585256.1_RNA|PITPNM2_ENST00000451868.2_5'UTR			Q9BZ72	PITM2_HUMAN	phosphatidylinositol transfer protein, membrane-associated 2	30					metabolic process (GO:0008152)|transport (GO:0006810)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)	calcium ion binding (GO:0005509)|lipid binding (GO:0008289)			NS(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(10)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	39	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.55e-05)|Epithelial(86;8.43e-05)|BRCA - Breast invasive adenocarcinoma(302;0.123)		GTCTCGTTACGGCTCTTCTTC	0.602																																						dbGAP											0													72.0	63.0	66.0					12																	123498580		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF334585	CCDS9242.1, CCDS73543.1	12q24.31	2008-02-05				ENSG00000090975			21044	protein-coding gene	gene with protein product		608920				10022914	Standard	XM_005253582		Approved	RDGBA2, RDGB2, NIR3	uc001uej.1	Q9BZ72		ENST00000542749.1:c.88C>T	12.37:g.123498580G>A	ENSP00000437611:p.Arg30Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P271	Missense_Mutation	SNP	pfam_PI_transfer,pfam_DDHD,pfam_LNS2,superfamily_HAD-like_dom,smart_LNS2,pfscan_DDHD,prints_PI_transfer	p.R30C	ENST00000542749.1	37	c.88	CCDS9242.1	12	.	.	.	.	.	.	.	.	.	.	G	22.3	4.267237	0.80469	.	.	ENSG00000090975	ENST00000280562;ENST00000320201;ENST00000392428;ENST00000542749;ENST00000542210	T;T;T;T;T	0.52295	0.67;0.67;0.67;0.67;0.67	4.42	4.42	0.53409	START-like domain (1);	0.000000	0.85682	D	0.000000	T	0.70527	0.3234	M	0.84773	2.715	0.50039	D	0.999846	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;0.999	T	0.76375	-0.2982	10	0.87932	D	0	-20.0387	13.3924	0.60830	0.0:0.0:0.8321:0.1678	.	30;30;30	A5D8U3;Q9BZ72-2;Q9BZ72	.;.;PITM2_HUMAN	C	30	ENSP00000280562:R30C;ENSP00000322218:R30C;ENSP00000376223:R30C;ENSP00000437611:R30C;ENSP00000437869:R30C	ENSP00000280562:R30C	R	-	1	0	PITPNM2	122064533	1.000000	0.71417	0.996000	0.52242	0.870000	0.49936	2.312000	0.43726	2.168000	0.68352	0.655000	0.94253	CGT	PITPNM2	-	pfam_PI_transfer,prints_PI_transfer	ENSG00000090975		0.602	PITPNM2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	PITPNM2	HGNC	protein_coding	OTTHUMT00000401342.1	59	0.00	0	G	NM_020845		123498580	123498580	-1	no_errors	ENST00000320201	ensembl	human	known	69_37n	missense	29	23.08	9	SNP	1.000	A
PPAT	5471	genome.wustl.edu	37	4	57272683	57272683	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr4:57272683T>C	ENST00000264220.2	-	3	517	c.380A>G	c.(379-381)aAt>aGt	p.N127S	PPAT_ENST00000507648.1_5'UTR	NM_002703.4	NP_002694.3	Q06203	PUR1_HUMAN	phosphoribosyl pyrophosphate amidotransferase	127	Glutamine amidotransferase type-2. {ECO:0000255|PROSITE-ProRule:PRU00609}.				'de novo' IMP biosynthetic process (GO:0006189)|cellular response to drug (GO:0035690)|cellular response to insulin stimulus (GO:0032869)|G1/S transition of mitotic cell cycle (GO:0000082)|glutamine catabolic process (GO:0006543)|kidney development (GO:0001822)|lactation (GO:0007595)|maternal process involved in female pregnancy (GO:0060135)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|organ regeneration (GO:0031100)|protein homotetramerization (GO:0051289)|purine nucleobase biosynthetic process (GO:0009113)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide biosynthetic process (GO:0006164)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	4 iron, 4 sulfur cluster binding (GO:0051539)|amidophosphoribosyltransferase activity (GO:0004044)|metal ion binding (GO:0046872)			cervix(1)|endometrium(2)|large_intestine(6)|lung(8)|prostate(2)|upper_aerodigestive_tract(1)	20	Glioma(25;0.08)|all_neural(26;0.101)				Fluorouracil(DB00544)|L-Glutamine(DB00130)|Mercaptopurine(DB01033)	TCGAGCAGCATTTACCAATTC	0.378																																						dbGAP											0													154.0	131.0	139.0					4																	57272683		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3505.1	4q12	2012-10-02			ENSG00000128059	ENSG00000128059	2.4.2.14		9238	protein-coding gene	gene with protein product		172450					Standard	NM_002703		Approved	GPAT, PRAT	uc003hbr.3	Q06203	OTTHUMG00000128842	ENST00000264220.2:c.380A>G	4.37:g.57272683T>C	ENSP00000264220:p.Asn127Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GATase_dom,pfam_PRibTrfase,pirsf_Amd_phspho_trans,tigrfam_Amd_phspho_trans	p.N127S	ENST00000264220.2	37	c.380	CCDS3505.1	4	.	.	.	.	.	.	.	.	.	.	T	25.7	4.661486	0.88154	.	.	ENSG00000128059	ENST00000264220	D	0.82984	-1.67	5.62	5.62	0.85841	Glutamine amidotransferase, type II (1);Glutamine amidotransferase, class-II (1);	0.000000	0.85682	D	0.000000	D	0.94775	0.8313	H	0.98682	4.3	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.96823	0.9605	10	0.87932	D	0	-33.4073	15.8261	0.78709	0.0:0.0:0.0:1.0	.	127	Q06203	PUR1_HUMAN	S	127	ENSP00000264220:N127S	ENSP00000264220:N127S	N	-	2	0	PPAT	56967440	1.000000	0.71417	0.921000	0.36526	0.982000	0.71751	7.655000	0.83696	2.138000	0.66242	0.477000	0.44152	AAT	PPAT	-	pfam_GATase_dom,pirsf_Amd_phspho_trans,tigrfam_Amd_phspho_trans	ENSG00000128059		0.378	PPAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAT	HGNC	protein_coding	OTTHUMT00000250781.2	224	0.00	0	T	NM_002703		57272683	57272683	-1	no_errors	ENST00000264220	ensembl	human	known	69_37n	missense	175	13.79	28	SNP	1.000	C
PRUNE2	158471	genome.wustl.edu	37	9	79320728	79320728	+	Silent	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr9:79320728G>A	ENST00000376718.3	-	8	6585	c.6462C>T	c.(6460-6462)gtC>gtT	p.V2154V	PRUNE2_ENST00000428286.1_Silent_p.V1795V	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)	2154					apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						CATTGGATGGGACAAACTCCC	0.498																																						dbGAP											0													126.0	115.0	118.0					9																	79320728		1568	3582	5150	-	-	-	SO:0001819	synonymous_variant	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.6462C>T	9.37:g.79320728G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	Missense_Mutation	SNP	pfam_Bcl2-/adenovirus-E1B,pfam_CRAL-TRIO_dom,superfamily_CRAL-TRIO_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom	p.P1476S	ENST00000376718.3	37	c.4426	CCDS47982.1	9	.	.	.	.	.	.	.	.	.	.	G	3.196	-0.164724	0.06502	.	.	ENSG00000106772	ENST00000426088	.	.	.	5.35	2.43	0.29744	.	.	.	.	.	T	0.21468	0.0517	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.21008	-1.0258	4	.	.	.	-0.1788	1.0875	0.01656	0.2704:0.1406:0.4249:0.1642	.	.	.	.	S	1476	.	.	P	-	1	0	PRUNE2	78510548	0.003000	0.15002	0.003000	0.11579	0.018000	0.09664	0.490000	0.22403	0.346000	0.23899	0.655000	0.94253	CCC	PRUNE2	-	NULL	ENSG00000106772		0.498	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	166	0.60	1	G	NM_138818		79320728	79320728	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000426088	ensembl	human	known	69_37n	missense	148	15.91	28	SNP	0.000	A
GRIN3A	116443	genome.wustl.edu	37	9	104356697	104356697	+	Intron	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr9:104356697G>A	ENST00000361820.3	-	7	3367				PPP3R2_ENST00000374806.1_Silent_p.I172I	NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A						calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	AGGCTCATACGATGAGGACCA	0.463																																						dbGAP											0													106.0	90.0	95.0					9																	104356697		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.2767-15055C>T	9.37:g.104356697G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,prints_Recoverin,prints_Parvalbumin,pfscan_EF_HAND_2	p.I172	ENST00000361820.3	37	c.516	CCDS6758.1	9																																																																																			PPP3R2	-	NULL	ENSG00000188386		0.463	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP3R2	HGNC	protein_coding	OTTHUMT00000053453.1	59	0.00	0	G			104356697	104356697	-1	no_errors	ENST00000374806	ensembl	human	known	69_37n	silent	42	17.65	9	SNP	0.002	A
PSTK	118672	genome.wustl.edu	37	10	124742808	124742809	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr10:124742808_124742809delCT	ENST00000368887.3	+	3	969_970	c.529_530delCT	c.(529-531)ctcfs	p.L177fs	PSTK_ENST00000405485.1_Frame_Shift_Del_p.L177fs|PSTK_ENST00000497219.1_3'UTR	NM_153336.2	NP_699167.2	Q8IV42	PSTK_HUMAN	phosphoseryl-tRNA kinase	177					selenocysteine incorporation (GO:0001514)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|tRNA binding (GO:0000049)			endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(5)|skin(1)|stomach(2)	13		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.0686)|COAD - Colon adenocarcinoma(40;0.0725)		CTTTTGCCAGCTCTTTTTAGAT	0.386																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK127173	CCDS7633.1	10q26.13	2007-04-17	2007-04-17	2007-04-17	ENSG00000179988	ENSG00000179988			28578	protein-coding gene	gene with protein product		611310	"""chromosome 10 open reading frame 89"""	C10orf89		15317934	Standard	NM_153336		Approved	MGC35392	uc001lgy.1	Q8IV42	OTTHUMG00000019191	ENST00000368887.3:c.529_530delCT	10.37:g.124742810_124742811delCT	ENSP00000357882:p.Leu177fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZSS9	Frame_Shift_Del	DEL	pfam_Chromatin_KTI12,tigrfam_L-seryl-tRNA_Sec_kinase_euk	p.L179fs	ENST00000368887.3	37	c.529_530	CCDS7633.1	10																																																																																			PSTK	-	pfam_Chromatin_KTI12,tigrfam_L-seryl-tRNA_Sec_kinase_euk	ENSG00000179988		0.386	PSTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSTK	HGNC	protein_coding	OTTHUMT00000050811.1	244	0.00	0	CT	NM_153336		124742808	124742809	+1	no_errors	ENST00000368887	ensembl	human	known	69_37n	frame_shift_del	101	18.25	23	DEL	0.993:1.000	-
PTPRB	5787	genome.wustl.edu	37	12	70933795	70933795	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr12:70933795G>A	ENST00000261266.5	-	22	4977	c.4948C>T	c.(4948-4950)Cga>Tga	p.R1650*	RP11-588H23.3_ENST00000551438.1_RNA|RP11-588H23.3_ENST00000548687.1_RNA|RP11-588H23.3_ENST00000549460.1_RNA|PTPRB_ENST00000538708.1_Nonsense_Mutation_p.R1560*|RP11-588H23.3_ENST00000547656.1_RNA|RP11-588H23.3_ENST00000546836.1_RNA|PTPRB_ENST00000334414.6_Nonsense_Mutation_p.R1868*|PTPRB_ENST00000451516.2_Nonsense_Mutation_p.R1560*|PTPRB_ENST00000550358.1_Nonsense_Mutation_p.R1780*|PTPRB_ENST00000550857.1_Nonsense_Mutation_p.R1560*	NM_002837.4	NP_002828.3	P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	1650					angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGTCTTTCTCGACCATGGCTG	0.433																																						dbGAP											0													73.0	70.0	71.0					12																	70933795		1896	4110	6006	-	-	-	SO:0001587	stop_gained	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000261266.5:c.4948C>T	12.37:g.70933795G>A	ENSP00000261266:p.Arg1650*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.R1868*	ENST00000261266.5	37	c.5602	CCDS44944.1	12	.	.	.	.	.	.	.	.	.	.	G	44	10.929054	0.99490	.	.	ENSG00000127329	ENST00000334414;ENST00000451516;ENST00000550358;ENST00000538708;ENST00000550857;ENST00000261266	.	.	.	5.42	1.12	0.20585	.	0.567838	0.18454	N	0.140748	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	5.0105	0.14310	0.0683:0.268:0.4491:0.2146	.	.	.	.	X	1868;1560;1780;1560;1560;1650	.	ENSP00000261266:R1650X	R	-	1	2	PTPRB	69220062	0.811000	0.29063	0.971000	0.41717	0.935000	0.57460	1.476000	0.35420	-0.091000	0.12440	-0.467000	0.05162	CGA	PTPRB	-	NULL	ENSG00000127329		0.433	PTPRB-007	KNOWN	basic|CCDS	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404439.1	204	0.00	0	G			70933795	70933795	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	nonsense	439	14.40	74	SNP	0.871	A
PTPRJ	5795	genome.wustl.edu	37	11	48164480	48164480	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:48164480C>G	ENST00000418331.2	+	12	2805	c.2453C>G	c.(2452-2454)cCt>cGt	p.P818R		NM_002843.3	NP_002834.3	Q12913	PTPRJ_HUMAN	protein tyrosine phosphatase, receptor type, J	818	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				contact inhibition (GO:0060242)|heart development (GO:0007507)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of platelet-derived growth factor receptor signaling pathway (GO:0010642)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of vascular permeability (GO:0043116)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine dephosphorylation (GO:0035335)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive chemotaxis (GO:0050918)|positive regulation of cell adhesion (GO:0045785)|positive regulation of focal adhesion assembly (GO:0051894)|positive regulation of protein kinase B signaling (GO:0051897)|regulation of cell adhesion (GO:0030155)|vasculogenesis (GO:0001570)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|gamma-catenin binding (GO:0045295)|mitogen-activated protein kinase binding (GO:0051019)|phosphatase activity (GO:0016791)|platelet-derived growth factor receptor binding (GO:0005161)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)	p.P818L(1)		breast(3)|endometrium(7)|kidney(7)|large_intestine(5)|lung(15)|ovary(1)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						GATCCCCCTCCTCCAGATGGA	0.423																																						dbGAP											1	Substitution - Missense(1)	skin(1)											55.0	51.0	52.0					11																	48164480		2201	4298	6499	-	-	-	SO:0001583	missense	0			U10886	CCDS7945.1, CCDS44596.1	11p11.2	2013-02-11			ENSG00000149177	ENSG00000149177		"""CD molecules"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9673	protein-coding gene	gene with protein product		600925				7937872, 7994032	Standard	NM_001098503		Approved	DEP1, HPTPeta, CD148	uc001ngp.4	Q12913	OTTHUMG00000166573	ENST00000418331.2:c.2453C>G	11.37:g.48164480C>G	ENSP00000400010:p.Pro818Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15255|Q6P4H4|Q8NHM2|Q9UDA9	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.P818R	ENST00000418331.2	37	c.2453	CCDS7945.1	11	.	.	.	.	.	.	.	.	.	.	C	5.214	0.225039	0.09916	.	.	ENSG00000149177	ENST00000418331	T	0.53857	0.6	5.82	-0.907	0.10521	Fibronectin, type III (2);Immunoglobulin-like fold (1);	.	.	.	.	T	0.25082	0.0609	N	0.14661	0.345	0.09310	N	1	B	0.18968	0.032	B	0.14578	0.011	T	0.17776	-1.0358	9	0.12766	T	0.61	.	1.2603	0.02000	0.1414:0.3432:0.2754:0.2401	.	818	Q12913	PTPRJ_HUMAN	R	818	ENSP00000400010:P818R	ENSP00000400010:P818R	P	+	2	0	PTPRJ	48121056	0.022000	0.18835	0.002000	0.10522	0.881000	0.50899	-0.009000	0.12765	-0.116000	0.11893	0.655000	0.94253	CCT	PTPRJ	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3	ENSG00000149177		0.423	PTPRJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRJ	HGNC	protein_coding	OTTHUMT00000390525.1	124	0.00	0	C			48164480	48164480	+1	no_errors	ENST00000418331	ensembl	human	known	69_37n	missense	62	26.19	22	SNP	0.003	G
PTPRQ	374462	genome.wustl.edu	37	12	80935456	80935456	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr12:80935456C>T	ENST00000266688.5	+	26	3265	c.3265C>T	c.(3265-3267)Cag>Tag	p.Q1089*				Q9UMZ3	PTPRQ_HUMAN	protein tyrosine phosphatase, receptor type, Q	1135	Fibronectin type-III 11. {ECO:0000255|PROSITE-ProRule:PRU00316}.				regulation of fat cell differentiation (GO:0045598)	integral component of membrane (GO:0016021)	protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(7)|kidney(9)|lung(2)|prostate(1)|skin(2)|stomach(2)	24						ACTGATCTTACAGCAGACTCC	0.388																																						dbGAP											0													121.0	96.0	103.0					12																	80935456		692	1591	2283	-	-	-	SO:0001587	stop_gained	0			AF169351	CCDS73501.1	12q21.31	2013-02-11	2001-12-04		ENSG00000139304	ENSG00000139304		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9679	protein-coding gene	gene with protein product		603317	"""deafness, autosomal recessive 84"""	DFNB84		20346435	Standard	NM_001145026		Approved		uc001sze.2	Q9UMZ3	OTTHUMG00000170171	ENST00000266688.5:c.3265C>T	12.37:g.80935456C>T	ENSP00000266688:p.Gln1089*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.Q1089*	ENST00000266688.5	37	c.3265		12	.	.	.	.	.	.	.	.	.	.	C	39	7.827711	0.98513	.	.	ENSG00000139304	ENST00000266688	.	.	.	5.89	5.89	0.94794	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06099	T	0.92	.	7.8456	0.29424	0.2294:0.6932:0.0:0.0774	.	.	.	.	X	1089	.	ENSP00000266688:Q1089X	Q	+	1	0	PTPRQ	79459587	0.878000	0.30173	0.998000	0.56505	0.980000	0.70556	0.399000	0.20916	2.787000	0.95880	0.655000	0.94253	CAG	PTPRQ	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000139304		0.388	PTPRQ-201	KNOWN	basic|appris_principal	protein_coding	PTPRQ	HGNC	protein_coding		185	0.00	0	C	NM_001145026		80935456	80935456	+1	no_errors	ENST00000266688	ensembl	human	known	69_37n	nonsense	151	25.62	52	SNP	0.994	T
PYHIN1	149628	genome.wustl.edu	37	1	158913619	158913619	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr1:158913619G>T	ENST00000368140.1	+	6	1287	c.1042G>T	c.(1042-1044)Gat>Tat	p.D348Y	PYHIN1_ENST00000368138.3_Missense_Mutation_p.D339Y|PYHIN1_ENST00000392252.3_Missense_Mutation_p.D339Y|PYHIN1_ENST00000392254.2_Missense_Mutation_p.D348Y|PYHIN1_ENST00000485134.1_3'UTR	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	348	HIN-200. {ECO:0000255|PROSITE- ProRule:PRU00106}.				cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TGAAATTCAGGATAAAACAGG	0.358																																						dbGAP											0													79.0	80.0	80.0					1																	158913619		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1042G>T	1.37:g.158913619G>T	ENSP00000357122:p.Asp348Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.D348Y	ENST00000368140.1	37	c.1042	CCDS1178.1	1	.	.	.	.	.	.	.	.	.	.	G	12.79	2.042106	0.35989	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.50001	0.76;0.76;0.76;0.76	3.13	3.13	0.36017	HIN-200/IF120x (2);Nucleic acid-binding, OB-fold (1);	.	.	.	.	T	0.58466	0.2124	M	0.81682	2.555	0.33674	D	0.611256	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.63079	-0.6717	9	0.87932	D	0	.	9.8595	0.41105	0.0:0.0:1.0:0.0	.	339;348;339;348	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	Y	348;339;348;339	ENSP00000357122:D348Y;ENSP00000357120:D339Y;ENSP00000376083:D348Y;ENSP00000376082:D339Y	ENSP00000357120:D339Y	D	+	1	0	PYHIN1	157180243	0.019000	0.18553	0.010000	0.14722	0.003000	0.03518	1.432000	0.34936	1.725000	0.51514	0.655000	0.94253	GAT	PYHIN1	-	pfam_HIN200/IF120x,pfscan_HIN200/IF120x	ENSG00000163564		0.358	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PYHIN1	HGNC	protein_coding	OTTHUMT00000090110.1	182	0.00	0	G	NM_152501		158913619	158913619	+1	no_errors	ENST00000368140	ensembl	human	known	69_37n	missense	94	57.66	128	SNP	0.018	T
ROM1	6094	genome.wustl.edu	37	11	62381084	62381084	+	Frame_Shift_Del	DEL	G	G	-			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:62381084delG	ENST00000278833.3	+	1	872	c.331delG	c.(331-333)gggfs	p.G113fs	ROM1_ENST00000534093.1_Intron|EML3_ENST00000278845.4_5'Flank|EML3_ENST00000531557.1_5'Flank|EML3_ENST00000494176.2_5'Flank|EML3_ENST00000394773.2_5'Flank|EML3_ENST00000529309.1_5'Flank	NM_000327.3	NP_000318	Q03395	ROM1_HUMAN	retinal outer segment membrane protein 1	113					camera-type eye photoreceptor cell differentiation (GO:0060219)|cell adhesion (GO:0007155)|regulation of gene expression (GO:0010468)|retina vasculature development in camera-type eye (GO:0061298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)				central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|skin(1)	8						CACGGCTGGTGGGGGGGGGCT	0.677																																						dbGAP											0													14.0	17.0	16.0					11																	62381084		2193	4287	6480	-	-	-	SO:0001589	frameshift_variant	0			L07894	CCDS8024.1	11q13	2013-02-14				ENSG00000149489		"""Tetraspanins"""	10254	protein-coding gene	gene with protein product		180721				8504299	Standard	NM_000327		Approved	TSPAN23, ROM	uc001ntv.3	Q03395		ENST00000278833.3:c.331delG	11.37:g.62381084delG	ENSP00000278833:p.Gly113fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R978	Frame_Shift_Del	DEL	pfam_Tetraspanin/Peripherin,superfamily_Tetraspanin_EC2,prints_Peripherin/rom-1	p.L114fs	ENST00000278833.3	37	c.331	CCDS8024.1	11																																																																																			ROM1	-	pfam_Tetraspanin/Peripherin,prints_Peripherin/rom-1	ENSG00000149489		0.677	ROM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROM1	HGNC	protein_coding	OTTHUMT00000394929.1	29	0.00	0	G	NM_000327		62381084	62381084	+1	no_errors	ENST00000278833	ensembl	human	known	69_37n	frame_shift_del	34	12.82	5	DEL	0.023	-
SMURF2	64750	genome.wustl.edu	37	17	62553744	62553745	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:62553744_62553745delAG	ENST00000262435.9	-	13	1599_1600	c.1412_1413delCT	c.(1411-1413)cctfs	p.P471fs		NM_022739.3	NP_073576.1	Q9HAU4	SMUF2_HUMAN	SMAD specific E3 ubiquitin protein ligase 2	471	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				BMP signaling pathway (GO:0030509)|gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|SMAD binding (GO:0046332)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(2)|lung(6)|prostate(1)|skin(4)	22	Breast(5;1.32e-14)		BRCA - Breast invasive adenocarcinoma(8;9.88e-12)			CTGCAGAATCAGGATTGATCTG	0.322																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF301463	CCDS32707.1	17q22-q23	2012-10-05			ENSG00000108854	ENSG00000108854			16809	protein-coding gene	gene with protein product		605532				11016919	Standard	XM_005257585		Approved		uc002jep.1	Q9HAU4	OTTHUMG00000179189	ENST00000262435.9:c.1412_1413delCT	17.37:g.62553744_62553745delAG	ENSP00000262435:p.Pro471fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LL1|Q9H260	Frame_Shift_Del	DEL	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.P471fs	ENST00000262435.9	37	c.1413_1412	CCDS32707.1	17																																																																																			SMURF2	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000108854		0.322	SMURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMURF2	HGNC	protein_coding	OTTHUMT00000445227.1	177	0.00	0	AG	NM_022739		62553744	62553745	-1	no_errors	ENST00000262435	ensembl	human	known	69_37n	frame_shift_del	304	13.03	46	DEL	0.990:1.000	-
SRPR	6734	genome.wustl.edu	37	11	126134994	126134994	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr11:126134994A>G	ENST00000332118.6	-	11	1539	c.1385T>C	c.(1384-1386)gTg>gCg	p.V462A	SRPR_ENST00000530680.1_5'Flank|SRPR_ENST00000532259.1_Missense_Mutation_p.V434A	NM_003139.3	NP_003130.2	P08240	SRPR_HUMAN	signal recognition particle receptor (docking protein)	462					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|endoplasmic reticulum unfolded protein response (GO:0030968)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|signal recognition particle receptor complex (GO:0005785)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			endometrium(7)|large_intestine(2)|lung(9)|ovary(2)|prostate(1)	21	all_hematologic(175;0.145)			BRCA - Breast invasive adenocarcinoma(274;1.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0736)		CAGCTGCTCCACGGCCCCAGC	0.522																																						dbGAP											0													63.0	59.0	61.0					11																	126134994		2201	4299	6500	-	-	-	SO:0001583	missense	0			BC001162	CCDS31717.1, CCDS53722.1	11q24-q25	2012-10-02	2008-10-29		ENSG00000182934	ENSG00000182934			11307	protein-coding gene	gene with protein product		182180	"""signal recognition particle receptor ('docking protein')"""			3340536, 1312991	Standard	NM_001177842		Approved	SRP-alpha, Sralpha	uc001qdh.3	P08240	OTTHUMG00000165826	ENST00000332118.6:c.1385T>C	11.37:g.126134994A>G	ENSP00000328023:p.Val462Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIB3|B2R5Z8|B4E0H3|E9PJS4|Q9BVJ4	Missense_Mutation	SNP	pfam_Sig_recog_particle_rcpt_asu_N,pfam_Signal_recog_part_SRP54_GTPase,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_Signal_recog_particl_SRP54_hlx,superfamily_Longin-like_dom,superfamily_Signal_recog_particl_SRP54_hlx,smart_Signal_recog_particl_SRP54_hlx,smart_AAA+_ATPase,smart_Signal_recog_part_SRP54_GTPase	p.V462A	ENST00000332118.6	37	c.1385	CCDS31717.1	11	.	.	.	.	.	.	.	.	.	.	A	28.7	4.945836	0.92593	.	.	ENSG00000182934	ENST00000332118;ENST00000532259	.	.	.	5.26	5.26	0.73747	ATPase, AAA+ type, core (1);Signal recognition particle, SRP54 subunit, GTPase (2);	0.113458	0.64402	D	0.000013	T	0.78817	0.4343	M	0.74389	2.26	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.81703	-0.0812	9	0.87932	D	0	-16.22	15.3398	0.74287	1.0:0.0:0.0:0.0	.	434;462	E9PJS4;P08240	.;SRPR_HUMAN	A	462;434	.	ENSP00000328023:V462A	V	-	2	0	SRPR	125640204	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.909000	0.92647	2.215000	0.71742	0.528000	0.53228	GTG	SRPR	-	pfam_Signal_recog_part_SRP54_GTPase,pfam_ArgK,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,smart_AAA+_ATPase,smart_Signal_recog_part_SRP54_GTPase	ENSG00000182934		0.522	SRPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRPR	HGNC	protein_coding	OTTHUMT00000386425.2	133	0.00	0	A	NM_003139		126134994	126134994	-1	no_errors	ENST00000332118	ensembl	human	known	69_37n	missense	68	25.27	23	SNP	1.000	G
TAF1L	138474	genome.wustl.edu	37	9	32632815	32632815	+	Silent	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr9:32632815G>T	ENST00000242310.4	-	1	2852	c.2763C>A	c.(2761-2763)ggC>ggA	p.G921G	RP11-555J4.4_ENST00000430787.1_RNA	NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	921					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		TCTCACCATAGCCAGCATCCT	0.443																																						dbGAP											0													185.0	167.0	173.0					9																	32632815		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.2763C>A	9.37:g.32632815G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q0VG57	Silent	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.G921	ENST00000242310.4	37	c.2763	CCDS35003.1	9																																																																																			TAF1L	-	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591	ENSG00000122728		0.443	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	570	0.00	0	G			32632815	32632815	-1	no_errors	ENST00000242310	ensembl	human	known	69_37n	silent	387	16.41	76	SNP	1.000	T
TANC2	26115	genome.wustl.edu	37	17	61428682	61428682	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:61428682G>T	ENST00000424789.2	+	11	1661	c.1657G>T	c.(1657-1659)Gat>Tat	p.D553Y	TANC2_ENST00000389520.4_Missense_Mutation_p.D553Y	NM_025185.3	NP_079461.2	Q9HCD6	TANC2_HUMAN	tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 2	553					in utero embryonic development (GO:0001701)					breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(2)|upper_aerodigestive_tract(3)	44						TCACAAACCGGATTATGGGGA	0.333																																						dbGAP											0													99.0	101.0	100.0					17																	61428682		1811	4075	5886	-	-	-	SO:0001583	missense	0			AB032974	CCDS45754.1	17q23.3	2013-01-11				ENSG00000170921		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	30212	protein-coding gene	gene with protein product	"""rolling pebbles homolog B (Drosophila)"""	615047					Standard	NM_025185		Approved	DKFZP564D166, FLJ10215, FLJ11824, KIAA1148, KIAA1636, rols, ROLSA	uc002jal.4	Q9HCD6		ENST00000424789.2:c.1657G>T	17.37:g.61428682G>T	ENSP00000387593:p.Asp553Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9HAC3|Q9NW88|Q9NXY9|Q9ULS2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_TPR_repeat,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.D553Y	ENST00000424789.2	37	c.1657	CCDS45754.1	17	.	.	.	.	.	.	.	.	.	.	G	26.2	4.715696	0.89112	.	.	ENSG00000170921	ENST00000389520;ENST00000424789	T;T	0.22134	1.97;1.97	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.50990	0.1648	M	0.79475	2.455	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.994;0.977	T	0.53173	-0.8476	10	0.87932	D	0	.	19.6557	0.95837	0.0:0.0:1.0:0.0	.	553;553	Q9HCD6-2;Q9HCD6	.;TANC2_HUMAN	Y	553	ENSP00000374171:D553Y;ENSP00000387593:D553Y	ENSP00000374171:D553Y	D	+	1	0	TANC2	58782414	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.643000	0.89663	0.557000	0.71058	GAT	TANC2	-	NULL	ENSG00000170921		0.333	TANC2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TANC2	HGNC	protein_coding	OTTHUMT00000444765.1	295	0.00	0	G			61428682	61428682	+1	no_errors	ENST00000424789	ensembl	human	known	69_37n	missense	164	13.23	25	SNP	1.000	T
TMTC4	84899	genome.wustl.edu	37	13	101278370	101278370	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr13:101278370T>G	ENST00000376234.3	-	12	1673	c.1484A>C	c.(1483-1485)aAa>aCa	p.K495T	TMTC4_ENST00000342624.5_Missense_Mutation_p.K514T|TMTC4_ENST00000328767.5_Missense_Mutation_p.K384T|TMTC4_ENST00000462211.1_5'UTR	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	495						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CTGGTTGCCTTTATCAGCCAG	0.458																																						dbGAP											0													125.0	118.0	120.0					13																	101278370		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1484A>C	13.37:g.101278370T>G	ENSP00000365408:p.Lys495Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K514T	ENST00000376234.3	37	c.1541	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	T	13.22	2.172204	0.38315	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.60672	0.17;0.17;0.17	5.3	2.89	0.33648	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.281738	0.45126	D	0.000396	T	0.39200	0.1069	L	0.27053	0.805	0.23602	N	0.997316	B;B;B;B	0.06786	0.001;0.001;0.0;0.001	B;B;B;B	0.15870	0.011;0.007;0.007;0.014	T	0.18903	-1.0322	10	0.23302	T	0.38	.	7.9519	0.30019	0.0:0.2239:0.0:0.7761	.	384;495;495;514	B7Z666;Q5T4D3-2;Q5T4D3;Q5T4D3-3	.;.;TMTC4_HUMAN;.	T	495;514;384	ENSP00000365408:K495T;ENSP00000343871:K514T;ENSP00000365409:K384T	ENSP00000365409:K384T	K	-	2	0	TMTC4	100076371	1.000000	0.71417	0.111000	0.21465	0.982000	0.71751	2.446000	0.44908	0.425000	0.26087	0.533000	0.62120	AAA	TMTC4	-	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000125247		0.458	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	160	0.00	0	T	NM_032813		101278370	101278370	-1	no_errors	ENST00000342624	ensembl	human	known	69_37n	missense	93	50.00	93	SNP	0.965	G
TMX4	56255	genome.wustl.edu	37	20	8000123	8000123	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr20:8000123G>C	ENST00000246024.2	-	1	353	c.138C>G	c.(136-138)aaC>aaG	p.N46K	RP5-971N18.3_ENST00000457707.1_RNA|RP5-971N18.3_ENST00000607924.1_RNA	NM_021156.2	NP_066979.2	Q9H1E5	TMX4_HUMAN	thioredoxin-related transmembrane protein 4	46	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|oxidation-reduction process (GO:0055114)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)			endometrium(3)|large_intestine(2)|lung(11)|skin(1)	17						CCAGCGTCCAGTTGGAGGCGG	0.731																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS13101.1	20p12	2011-10-19	2009-02-23	2009-02-23	ENSG00000125827	ENSG00000125827		"""Protein disulfide isomerases"""	25237	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 14"""		"""thioredoxin domain containing 13"""	TXNDC13			Standard	NM_021156		Approved	DJ971N18.2, KIAA1162, PDIA14	uc002wmx.1	Q9H1E5	OTTHUMG00000031843	ENST00000246024.2:c.138C>G	20.37:g.8000123G>C	ENSP00000246024:p.Asn46Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N4P7|Q8NCC1|Q9UJA1|Q9ULQ8	Missense_Mutation	SNP	pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.N46K	ENST00000246024.2	37	c.138	CCDS13101.1	20	.	.	.	.	.	.	.	.	.	.	G	28.2	4.895744	0.91962	.	.	ENSG00000125827	ENST00000246024;ENST00000527925	T;T	0.26067	2.12;1.76	4.91	3.95	0.45737	Thioredoxin-like fold (3);	0.079806	0.51477	D	0.000090	T	0.56906	0.2017	M	0.91818	3.245	0.58432	D	0.999999	D	0.64830	0.994	D	0.73708	0.981	T	0.65496	-0.6154	10	0.62326	D	0.03	-13.1219	12.3204	0.54981	0.0847:0.0:0.9153:0.0	.	46	Q9H1E5	TMX4_HUMAN	K	46	ENSP00000246024:N46K;ENSP00000435735:N46K	ENSP00000246024:N46K	N	-	3	2	TMX4	7948123	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.995000	0.57001	1.046000	0.40249	0.563000	0.77884	AAC	TMX4	-	superfamily_Thioredoxin-like_fold	ENSG00000125827		0.731	TMX4-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TMX4	HGNC	protein_coding	OTTHUMT00000077928.2	14	0.00	0	G	NM_021156		8000123	8000123	-1	no_errors	ENST00000246024	ensembl	human	known	69_37n	missense	13	27.78	5	SNP	1.000	C
TRIM25	7706	genome.wustl.edu	37	17	54978817	54978817	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr17:54978817C>G	ENST00000316881.4	-	4	1099	c.1050G>C	c.(1048-1050)caG>caC	p.Q350H	TRIM25_ENST00000537230.1_Missense_Mutation_p.Q350H	NM_005082.4	NP_005073.2	Q14258	TRI25_HUMAN	tripartite motif containing 25	350	Interaction with influenza A virus NS1.				defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein ubiquitination (GO:0016567)|regulation of viral entry into host cell (GO:0046596)|regulation of viral release from host cell (GO:1902186)|response to estrogen (GO:0043627)|response to vitamin D (GO:0033280)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|kidney(4)|large_intestine(3)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Breast(9;6.15e-08)					GCCCGATGCACTGCTTCAGCT	0.572																																						dbGAP											0													306.0	273.0	284.0					17																	54978817		2203	4300	6503	-	-	-	SO:0001583	missense	0			D21205	CCDS11591.1	17q23.1	2013-01-09	2011-01-25	2004-03-30				"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	12932	protein-coding gene	gene with protein product		600453	"""zinc finger protein 147 (estrogen-responsive finger protein)"", ""tripartite motif-containing 25"""	ZNF147		7789997	Standard	NM_005082		Approved	EFP, RNF147	uc002iut.3	Q14258		ENST00000316881.4:c.1050G>C	17.37:g.54978817C>G	ENSP00000323889:p.Gln350His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,smart_Znf_RING,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Znf_RING	p.Q350H	ENST00000316881.4	37	c.1050	CCDS11591.1	17	.	.	.	.	.	.	.	.	.	.	C	9.139	1.013462	0.19277	.	.	ENSG00000121060	ENST00000316881;ENST00000537230	T;T	0.68025	-0.3;-0.3	5.53	-7.41	0.01392	.	1.598220	0.03381	N	0.200455	T	0.34890	0.0913	N	0.00841	-1.15	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.31081	-0.9956	10	0.31617	T	0.26	.	14.4976	0.67700	0.0:0.132:0.7043:0.1637	.	350	Q14258	TRI25_HUMAN	H	350	ENSP00000323889:Q350H;ENSP00000445961:Q350H	ENSP00000323889:Q350H	Q	-	3	2	TRIM25	52333816	0.000000	0.05858	0.000000	0.03702	0.286000	0.27126	-0.962000	0.03841	-0.760000	0.04677	-0.314000	0.08810	CAG	TRIM25	-	NULL	ENSG00000121060		0.572	TRIM25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM25	HGNC	protein_coding	OTTHUMT00000440609.1	386	0.00	0	C	NM_005082		54978817	54978817	-1	no_errors	ENST00000316881	ensembl	human	known	69_37n	missense	776	20.06	195	SNP	0.000	G
TRRAP	8295	genome.wustl.edu	37	7	98528431	98528431	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr7:98528431T>A	ENST00000359863.4	+	25	3778	c.3569T>A	c.(3568-3570)gTc>gAc	p.V1190D	TRRAP_ENST00000355540.3_Missense_Mutation_p.V1190D|TRRAP_ENST00000446306.3_Missense_Mutation_p.V1189D	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	1190					chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			CTTCTCTTTGTCATGATGGAC	0.473																																						dbGAP											0													108.0	103.0	105.0					7																	98528431		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.3569T>A	7.37:g.98528431T>A	ENSP00000352925:p.Val1190Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.V1190D	ENST00000359863.4	37	c.3569	CCDS59066.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	31|31	5.091115|5.091115	0.94149|0.94149	.|.	.|.	ENSG00000196367|ENSG00000196367	ENST00000456197|ENST00000359863;ENST00000355540;ENST00000446306	.|T;T	.|0.65916	.|-0.18;-0.18	5.88|5.88	5.88|5.88	0.94601|0.94601	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.77315|0.77315	0.4112|0.4112	M|M	0.61703|0.61703	1.905|1.905	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.89917	.|1.0;1.0;1.0	.|D;D;D	.|0.76575	.|0.988;0.982;0.98	T|T	0.79480|0.79480	-0.1786|-0.1786	5|10	.|0.87932	.|D	.|0	.|.	16.2762|16.2762	0.82644|0.82644	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	.|1190;904;1190	.|Q9Y4A5-2;Q59FH1;Q9Y4A5	.|.;.;TRRAP_HUMAN	T|D	905|1190;1190;1188	.|ENSP00000352925:V1190D;ENSP00000347733:V1190D	.|ENSP00000347733:V1190D	S|V	+|+	1|2	0|0	TRRAP|TRRAP	98366367|98366367	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	7.988000|7.988000	0.88194|0.88194	2.243000|2.243000	0.73865|0.73865	0.482000|0.482000	0.46254|0.46254	TCA|GTC	TRRAP	-	superfamily_ARM-type_fold	ENSG00000196367		0.473	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	320	0.31	1	T	NM_003496		98528431	98528431	+1	no_errors	ENST00000359863	ensembl	human	known	69_37n	missense	195	38.87	124	SNP	1.000	A
TTF1	7270	genome.wustl.edu	37	9	135273709	135273709	+	Silent	SNP	G	G	A			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr9:135273709G>A	ENST00000334270.2	-	4	1635	c.1596C>T	c.(1594-1596)gtC>gtT	p.V532V		NM_001205296.1|NM_007344.3	NP_001192225.1|NP_031370.2	Q15361	TTF1_HUMAN	transcription termination factor, RNA polymerase I	532					chromatin remodeling (GO:0006338)|DNA-templated transcription, termination (GO:0006353)|gene expression (GO:0010467)|negative regulation of DNA replication (GO:0008156)|regulation of transcription, DNA-templated (GO:0006355)|termination of RNA polymerase I transcription (GO:0006363)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			endometrium(3)|kidney(1)|large_intestine(5)|lung(13)|ovary(2)|pancreas(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;4.25e-06)|Epithelial(140;9.09e-05)		ATTTAATAGCGACACCTAGAA	0.393																																						dbGAP											0													68.0	62.0	64.0					9																	135273709		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC050734	CCDS6948.1, CCDS75925.1	9q34.3	2008-02-05			ENSG00000125482	ENSG00000125482			12397	protein-coding gene	gene with protein product		600777				7597036	Standard	NM_007344		Approved		uc004cbl.3	Q15361	OTTHUMG00000020836	ENST00000334270.2:c.1596C>T	9.37:g.135273709G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L160|Q4VXF3|Q58EY2|Q6P5T5	Silent	SNP	superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.V532	ENST00000334270.2	37	c.1596	CCDS6948.1	9																																																																																			TTF1	-	NULL	ENSG00000125482		0.393	TTF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTF1	HGNC	protein_coding	OTTHUMT00000054784.2	229	0.43	1	G	NM_007344		135273709	135273709	-1	no_errors	ENST00000334270	ensembl	human	known	69_37n	silent	168	18.05	37	SNP	0.007	A
WBP4	11193	genome.wustl.edu	37	13	41639395	41639395	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr13:41639395G>T	ENST00000379487.3	+	4	634	c.234G>T	c.(232-234)gaG>gaT	p.E78D	WBP4_ENST00000542082.1_Missense_Mutation_p.E57D	NM_007187.3	NP_009118.1	O75554	WBP4_HUMAN	WW domain binding protein 4	78					mRNA cis splicing, via spliceosome (GO:0045292)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spliceosomal complex (GO:0005681)	nucleic acid binding (GO:0003676)|proline-rich region binding (GO:0070064)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|liver(2)|lung(2)|prostate(1)|skin(1)	12		Lung NSC(96;3.55e-06)|Breast(139;0.00123)|Prostate(109;0.0181)|Lung SC(185;0.0262)|Hepatocellular(98;0.114)		all cancers(112;3.11e-09)|Epithelial(112;3.37e-06)|OV - Ovarian serous cystadenocarcinoma(117;8.3e-05)|GBM - Glioblastoma multiforme(144;0.00102)|BRCA - Breast invasive adenocarcinoma(63;0.07)		CATACCAAGAGGATTTGAAAA	0.383																																						dbGAP											0													53.0	57.0	56.0					13																	41639395		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF071185	CCDS9375.1	13q13.3	2012-10-17	2012-10-17		ENSG00000120688	ENSG00000120688			12739	protein-coding gene	gene with protein product	"""formin binding protein 21"""	604981				9724750	Standard	NM_007187		Approved	FBP21, MGC117310	uc001uxt.3	O75554	OTTHUMG00000016784	ENST00000379487.3:c.234G>T	13.37:g.41639395G>T	ENSP00000368801:p.Glu78Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4M2|Q32P29	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,pfam_Znf_U1-C,superfamily_WW_Rsp5_WWP,smart_Znf_U1,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP,pfscan_Znf_C2H2_matrin	p.E78D	ENST00000379487.3	37	c.234	CCDS9375.1	13	.	.	.	.	.	.	.	.	.	.	G	19.05	3.751751	0.69533	.	.	ENSG00000120688	ENST00000379487;ENST00000542082	.	.	.	5.55	2.54	0.30619	.	0.000000	0.85682	D	0.000000	T	0.56746	0.2006	L	0.34521	1.04	0.50313	D	0.999861	D;D	0.76494	0.999;0.999	D;D	0.78314	0.991;0.991	T	0.52675	-0.8544	9	0.52906	T	0.07	1.8343	8.0324	0.30472	0.3474:0.0:0.6526:0.0	.	57;78	B7Z4M2;O75554	.;WBP4_HUMAN	D	78;57	.	ENSP00000368801:E78D	E	+	3	2	WBP4	40537395	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.016000	0.40971	0.168000	0.19655	0.650000	0.86243	GAG	WBP4	-	NULL	ENSG00000120688		0.383	WBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WBP4	HGNC	protein_coding	OTTHUMT00000044655.2	100	0.99	1	G	NM_007187		41639395	41639395	+1	no_errors	ENST00000379487	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	1.000	T
WWOX	51741	genome.wustl.edu	37	16	78466448	78466448	+	Silent	SNP	C	C	T			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr16:78466448C>T	ENST00000566780.1	+	8	1221	c.855C>T	c.(853-855)aaC>aaT	p.N285N	WWOX_ENST00000539474.2_Intron|WWOX_ENST00000408984.3_Silent_p.N285N|WWOX_ENST00000406884.2_Intron|WWOX_ENST00000402655.2_Intron	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	285	Interaction with MAPT. {ECO:0000250}.				cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		CAACAAAAAACGACTATTGGG	0.478																																						dbGAP											0													109.0	112.0	111.0					16																	78466448		1969	4155	6124	-	-	-	SO:0001819	synonymous_variant	0			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.855C>T	16.37:g.78466448C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Silent	SNP	pfam_WW_Rsp5_WWP,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP,prints_Glc/ribitol_DH	p.N285	ENST00000566780.1	37	c.855	CCDS42196.1	16	.	.	.	.	.	.	.	.	.	.	C	0.046	-1.264683	0.01433	.	.	ENSG00000186153	ENST00000299644	.	.	.	5.93	-11.9	0.00025	.	.	.	.	.	T	0.51092	0.1654	.	.	.	0.47659	D	0.999483	.	.	.	.	.	.	T	0.68629	-0.5358	5	0.72032	D	0.01	.	6.3233	0.21229	0.1297:0.6397:0.1204:0.1102	.	.	.	.	M	128	.	ENSP00000299644:T128M	T	+	2	0	WWOX	77023949	0.020000	0.18652	0.000000	0.03702	0.035000	0.12851	-0.322000	0.08007	-1.832000	0.01196	-0.793000	0.03317	ACG	WWOX	-	NULL	ENSG00000186153		0.478	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WWOX	HGNC	protein_coding	OTTHUMT00000434328.1	188	0.00	0	C			78466448	78466448	+1	no_errors	ENST00000566780	ensembl	human	known	69_37n	silent	116	17.14	24	SNP	0.000	T
ZSCAN5C	649137	genome.wustl.edu	37	19	56720339	56720339	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12M-01A-11D-A135-09	TCGA-C8-A12M-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	9a0a7b93-da6e-45b7-9a6f-190d79552b49	5f9aae0c-1d2f-4bb2-b801-32478f7058a2	g.chr19:56720339T>G	ENST00000534327.1	+	5	1410	c.1261T>G	c.(1261-1263)Ttc>Gtc	p.F421V	ZSCAN5C_ENST00000376267.1_Missense_Mutation_p.F421V			A6NGD5	ZSA5C_HUMAN	zinc finger and SCAN domain containing 5C	421					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|lung(6)|stomach(1)	8						CCAGAAGCAGTTCACCCAGAA	0.522																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0					19q13.43	2013-01-08			ENSG00000204532	ENSG00000204532		"""-"", ""Zinc fingers, C2H2-type"""	34294	protein-coding gene	gene with protein product							Standard	NG_012782		Approved	ZNF495C		A6NGD5	OTTHUMG00000167475	ENST00000534327.1:c.1261T>G	19.37:g.56720339T>G	ENSP00000435234:p.Phe421Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.F421V	ENST00000534327.1	37	c.1261		19	.	.	.	.	.	.	.	.	.	.	T	17.00	3.276324	0.59649	.	.	ENSG00000204532	ENST00000534327;ENST00000376267	T;T	0.46063	0.88;0.88	1.38	1.38	0.22167	.	.	.	.	.	T	0.47764	0.1463	.	.	.	0.43814	D	0.996374	.	.	.	.	.	.	T	0.50039	-0.8874	6	0.87932	D	0	.	6.8401	0.23957	0.0:0.0:0.0:1.0	.	.	.	.	V	421	ENSP00000435234:F421V;ENSP00000365443:F421V	ENSP00000365443:F421V	F	+	1	0	ZSCAN5C	61412151	0.999000	0.42202	0.030000	0.17652	0.203000	0.24098	4.669000	0.61575	0.907000	0.36646	0.164000	0.16699	TTC	ZSCAN5C	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000204532		0.522	ZSCAN5C-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	ZSCAN5C	HGNC	protein_coding	OTTHUMT00000394739.1	140	0.00	0	T	XM_001131980		56720339	56720339	+1	no_errors	ENST00000376267	ensembl	human	known	69_37n	missense	107	21.32	29	SNP	0.692	G
