#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB1	5243	genome.wustl.edu	37	7	87225124	87225124	+	Silent	SNP	T	T	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:87225124T>C	ENST00000265724.3	-	4	492	c.75A>G	c.(73-75)aaA>aaG	p.K25K	ABCB1_ENST00000543898.1_Silent_p.K25K	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	25					drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	CCTTCTTATCTTTTTCACTGC	0.254																																						dbGAP											0													61.0	64.0	63.0					7																	87225124		2199	4289	6488	-	-	-	SO:0001819	synonymous_variant	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.75A>G	7.37:g.87225124T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K294|B5AK60|Q12755|Q14812	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.K25	ENST00000265724.3	37	c.75	CCDS5608.1	7																																																																																			ABCB1	-	NULL	ENSG00000085563		0.254	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	112	0.00	0	T	NM_000927		87225124	87225124	-1	no_errors	ENST00000265724	ensembl	human	known	69_37n	silent	148	14.45	25	SNP	0.998	C
ACTRT1	139741	genome.wustl.edu	37	X	127185866	127185866	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:127185866A>G	ENST00000371124.3	-	1	516	c.320T>C	c.(319-321)cTt>cCt	p.L107P		NM_138289.3	NP_612146.1	Q8TDG2	ACTT1_HUMAN	actin-related protein T1	107						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(13)|ovary(2)|skin(3)	34						CTCGGTCATAAGTACAGGCTG	0.463																																						dbGAP											0													233.0	225.0	228.0					X																	127185866		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF440739	CCDS14611.1	Xq25	2008-02-05	2005-11-22		ENSG00000123165	ENSG00000123165			24027	protein-coding gene	gene with protein product		300487				12243744	Standard	NM_138289		Approved	AIP1, KIAA0705, ARIP1, Arp-T1	uc004eum.3	Q8TDG2	OTTHUMG00000022359	ENST00000371124.3:c.320T>C	X.37:g.127185866A>G	ENSP00000360165:p.Leu107Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6X7C1|Q96L10	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.L107P	ENST00000371124.3	37	c.320	CCDS14611.1	X	.	.	.	.	.	.	.	.	.	.	A	11.77	1.739153	0.30774	.	.	ENSG00000123165	ENST00000371124	D	0.97209	-4.29	3.76	3.76	0.43208	.	0.221228	0.30901	N	0.008645	D	0.98823	0.9603	H	0.97635	4.045	0.58432	D	0.999991	D	0.89917	1.0	D	0.76575	0.988	D	0.98781	1.0732	10	0.87932	D	0	.	9.9632	0.41708	1.0:0.0:0.0:0.0	.	107	Q8TDG2	ACTT1_HUMAN	P	107	ENSP00000360165:L107P	ENSP00000360165:L107P	L	-	2	0	ACTRT1	127013547	1.000000	0.71417	0.100000	0.21137	0.002000	0.02628	6.495000	0.73665	1.710000	0.51325	0.441000	0.28932	CTT	ACTRT1	-	pfam_Actin-like,smart_Actin-like	ENSG00000123165		0.463	ACTRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTRT1	HGNC	protein_coding	OTTHUMT00000058192.1	206	0.00	0	A	NM_138289		127185866	127185866	-1	no_errors	ENST00000371124	ensembl	human	known	69_37n	missense	186	13.89	30	SNP	0.998	G
ADCY3	109	genome.wustl.edu	37	2	25065185	25065185	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr2:25065185G>A	ENST00000260600.5	-	3	1745	c.894C>T	c.(892-894)gaC>gaT	p.D298D	ADCY3_ENST00000405392.1_5'Flank	NM_004036.3	NP_004027.2	O60266	ADCY3_HUMAN	adenylate cyclase 3	298					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|sensory perception of smell (GO:0007608)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			NS(1)|breast(5)|endometrium(7)|kidney(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(4)|skin(2)	44	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.203)					TCTGGCTCTCGTCTTTCTTCA	0.582																																						dbGAP											0													242.0	195.0	211.0					2																	25065185		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF033861	CCDS1715.1	2p23.3	2013-02-04			ENSG00000138031	ENSG00000138031	4.6.1.1	"""Adenylate cyclases"""	234	protein-coding gene	gene with protein product		600291				9920776	Standard	NM_004036		Approved	AC3	uc002rfs.4	O60266	OTTHUMG00000094765	ENST00000260600.5:c.894C>T	2.37:g.25065185G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KT86|Q53T54|Q9UDB1	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.D298	ENST00000260600.5	37	c.894	CCDS1715.1	2																																																																																			ADCY3	-	smart_A/G_cyclase	ENSG00000138031		0.582	ADCY3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY3	HGNC	protein_coding	OTTHUMT00000211574.2	443	0.00	0	G			25065185	25065185	-1	no_errors	ENST00000260600	ensembl	human	known	69_37n	silent	393	13.44	61	SNP	0.898	A
AK5	26289	genome.wustl.edu	37	1	77883374	77883374	+	Missense_Mutation	SNP	G	G	A	rs559194404		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:77883374G>A	ENST00000354567.2	+	8	1296	c.1033G>A	c.(1033-1035)Gat>Aat	p.D345N	RNU7-8P_ENST00000515958.1_RNA|AK5_ENST00000344720.5_Missense_Mutation_p.D319N	NM_174858.2	NP_777283.1	Q9Y6K8	KAD5_HUMAN	adenylate kinase 5	345					ADP biosynthetic process (GO:0006172)|ATP metabolic process (GO:0046034)|dADP biosynthetic process (GO:0006173)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside diphosphate phosphorylation (GO:0006165)|nucleoside triphosphate biosynthetic process (GO:0009142)|pyrimidine ribonucleotide biosynthetic process (GO:0009220)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule organizing center (GO:0005815)	adenylate kinase activity (GO:0004017)|ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside kinase activity (GO:0019206)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(27)|prostate(1)|skin(2)|stomach(1)	40						AGAGATCATTGATACAGGATC	0.308																																						dbGAP											0													107.0	98.0	101.0					1																	77883374		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF062595	CCDS675.1, CCDS676.1	1p31	2008-02-05			ENSG00000154027	ENSG00000154027		"""Adenylate kinases"""	365	protein-coding gene	gene with protein product		608009				10215863	Standard	NM_012093		Approved		uc001dhn.3	Q9Y6K8	OTTHUMG00000009796	ENST00000354567.2:c.1033G>A	1.37:g.77883374G>A	ENSP00000346577:p.Asp345Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U622|Q6FH66|Q7Z4T5|Q86YS0|Q8N464|Q96EC9	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_Dpy-30_motif,superfamily_cAMP_dep_PK_reg_su_I/II_a/b,prints_Adenylate_kin,tigrfam_Adenylate_kin1	p.D345N	ENST00000354567.2	37	c.1033	CCDS675.1	1	.	.	.	.	.	.	.	.	.	.	G	9.072	0.997081	0.19043	.	.	ENSG00000154027	ENST00000354567;ENST00000344720	T;T	0.70869	-0.52;-0.52	4.99	4.08	0.47627	.	0.222279	0.37483	N	0.002065	T	0.39963	0.1098	N	0.24115	0.695	0.80722	D	1	B	0.06786	0.001	B	0.06405	0.002	T	0.33752	-0.9856	10	0.31617	T	0.26	0.0359	13.1079	0.59257	0.0811:0.0:0.9189:0.0	.	345	Q9Y6K8	KAD5_HUMAN	N	345;319	ENSP00000346577:D345N;ENSP00000341430:D319N	ENSP00000341430:D319N	D	+	1	0	AK5	77655962	1.000000	0.71417	0.311000	0.25182	0.101000	0.19017	4.280000	0.58959	1.428000	0.47296	-0.140000	0.14226	GAT	AK5	-	NULL	ENSG00000154027		0.308	AK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AK5	HGNC	protein_coding	OTTHUMT00000026993.4	204	0.00	0	G	NM_174858		77883374	77883374	+1	no_errors	ENST00000354567	ensembl	human	known	69_37n	missense	139	20.11	35	SNP	0.487	A
AKAP4	8852	genome.wustl.edu	37	X	49957750	49957750	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:49957750A>T	ENST00000376056.2	-	5	1737	c.1587T>A	c.(1585-1587)gaT>gaA	p.D529E	AKAP4_ENST00000376064.3_Missense_Mutation_p.D529E|AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_Intron|AKAP4_ENST00000358526.2_Missense_Mutation_p.D538E					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					TGGCCAGTGAATCTGTGGAAG	0.458																																						dbGAP											0													193.0	152.0	166.0					X																	49957750		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.1587T>A	X.37:g.49957750A>T	ENSP00000365224:p.Asp529Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.D538E	ENST00000376056.2	37	c.1614	CCDS14330.1	X	.	.	.	.	.	.	.	.	.	.	A	15.67	2.901796	0.52227	.	.	ENSG00000147081	ENST00000376056;ENST00000358526;ENST00000376064	T;T;T	0.14266	2.52;2.52;2.52	4.93	1.11	0.20524	A-kinase anchor 110kDa, C-terminal (1);	0.000000	0.53938	D	0.000042	T	0.29684	0.0741	M	0.76328	2.33	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	T	0.01287	-1.1395	9	.	.	.	-18.6131	6.0933	0.20007	0.6662:0.0:0.3338:0.0	.	538	Q5JQC9	AKAP4_HUMAN	E	529;538;529	ENSP00000365224:D529E;ENSP00000351327:D538E;ENSP00000365232:D529E	.	D	-	3	2	AKAP4	49844490	0.998000	0.40836	1.000000	0.80357	0.954000	0.61252	0.312000	0.19397	0.103000	0.17682	0.427000	0.28365	GAT	AKAP4	-	pfam_AKAP_110_C,smart_AKAP_110	ENSG00000147081		0.458	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	228	0.00	0	A	NM_003886		49957750	49957750	-1	no_errors	ENST00000358526	ensembl	human	known	69_37n	missense	204	19.37	49	SNP	0.999	T
AKAP6	9472	genome.wustl.edu	37	14	33293371	33293371	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:33293371C>G	ENST00000280979.4	+	13	6522	c.6352C>G	c.(6352-6354)Cat>Gat	p.H2118D	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	2118					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		TCTCTCATCTCATGACAGTGA	0.448																																					Melanoma(49;821 1200 7288 13647 42351)	dbGAP											0													105.0	102.0	103.0					14																	33293371		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.6352C>G	14.37:g.33293371C>G	ENSP00000280979:p.His2118Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.H2118D	ENST00000280979.4	37	c.6352	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	26.2	4.718002	0.89205	.	.	ENSG00000151320	ENST00000280979	T	0.61274	0.12	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	T	0.77363	0.4119	M	0.71581	2.175	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	T	0.77498	-0.2565	10	0.87932	D	0	-14.8866	20.5568	0.99304	0.0:1.0:0.0:0.0	.	2118	Q13023	AKAP6_HUMAN	D	2118	ENSP00000280979:H2118D	ENSP00000280979:H2118D	H	+	1	0	AKAP6	32363122	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.709000	0.84645	2.861000	0.98227	0.655000	0.94253	CAT	AKAP6	-	NULL	ENSG00000151320		0.448	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	131	0.00	0	C	NM_004274		33293371	33293371	+1	no_errors	ENST00000280979	ensembl	human	known	69_37n	missense	100	18.70	23	SNP	1.000	G
ALDH8A1	64577	genome.wustl.edu	37	6	135239645	135239645	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:135239645C>T	ENST00000265605.2	-	7	1440	c.1372G>A	c.(1372-1374)Ggg>Agg	p.G458R	ALDH8A1_ENST00000367847.2_Missense_Mutation_p.G408R|ALDH8A1_ENST00000367845.2_Missense_Mutation_p.G404R	NM_022568.3	NP_072090.1	Q9H2A2	AL8A1_HUMAN	aldehyde dehydrogenase 8 family, member A1	458					9-cis-retinoic acid biosynthetic process (GO:0042904)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)	retinal dehydrogenase activity (GO:0001758)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	36	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.00401)|GBM - Glioblastoma multiforme(68;0.0058)		TTCATCCCCCCGAAAGGAAGG	0.532																																						dbGAP											0													88.0	80.0	83.0					6																	135239645		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL021939	CCDS5171.1, CCDS5172.1, CCDS55057.1	6q24.1-q25.1	2008-07-03			ENSG00000118514	ENSG00000118514		"""Aldehyde dehydrogenases"""	15471	protein-coding gene	gene with protein product		606467				11007799	Standard	NM_001193480		Approved	ALDH12	uc003qew.3	Q9H2A2	OTTHUMG00000015623	ENST00000265605.2:c.1372G>A	6.37:g.135239645C>T	ENSP00000265605:p.Gly458Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z521|O60793|Q24JS9|Q53GT3|Q5TI80	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.G458R	ENST00000265605.2	37	c.1372	CCDS5171.1	6	.	.	.	.	.	.	.	.	.	.	C	34	5.371372	0.95923	.	.	ENSG00000118514	ENST00000265605;ENST00000367845;ENST00000367847	T;T;T	0.52754	0.65;0.65;0.65	6.07	6.07	0.98685	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, C-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.000000	0.85682	D	0.000000	T	0.76969	0.4062	H	0.94771	3.58	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.82078	-0.0635	10	0.87932	D	0	.	20.6439	0.99570	0.0:1.0:0.0:0.0	.	408;404;458	B7Z521;Q9H2A2-2;Q9H2A2	.;.;AL8A1_HUMAN	R	458;404;408	ENSP00000265605:G458R;ENSP00000356819:G404R;ENSP00000356821:G408R	ENSP00000265605:G458R	G	-	1	0	ALDH8A1	135281338	1.000000	0.71417	0.969000	0.41365	0.992000	0.81027	7.710000	0.84655	2.884000	0.98904	0.655000	0.94253	GGG	ALDH8A1	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	ENSG00000118514		0.532	ALDH8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH8A1	HGNC	protein_coding	OTTHUMT00000042334.2	182	0.00	0	C			135239645	135239645	-1	no_errors	ENST00000265605	ensembl	human	known	69_37n	missense	124	20.00	31	SNP	1.000	T
ALOXE3	59344	genome.wustl.edu	37	17	8020169	8020169	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr17:8020169C>T	ENST00000448843.2	-	3	617	c.277G>A	c.(277-279)Gat>Aat	p.D93N	ALOXE3_ENST00000318227.3_Missense_Mutation_p.D225N|ALOXE3_ENST00000380149.1_Missense_Mutation_p.D249N	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	93	PLAT. {ECO:0000255|PROSITE- ProRule:PRU00152}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						ACACTACCATCCGGTTCGGTG	0.572																																						dbGAP											0													156.0	110.0	126.0					17																	8020169		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.277G>A	17.37:g.8020169C>T	ENSP00000400581:p.Asp93Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_C	p.D225N	ENST00000448843.2	37	c.673	CCDS11130.1	17	.	.	.	.	.	.	.	.	.	.	C	4.436	0.080601	0.08533	.	.	ENSG00000179148	ENST00000380149;ENST00000318227;ENST00000448843	T;T;T	0.62788	-0.0;-0.0;-0.0	5.26	5.26	0.73747	Lipoxygenase, LH2 (4);Lipase/lipooxygenase, PLAT/LH2 (1);	0.211314	0.49916	D	0.000136	T	0.41926	0.1180	N	0.17345	0.48	0.42052	D	0.991127	B;B;B	0.11235	0.004;0.002;0.002	B;B;B	0.17098	0.017;0.006;0.006	T	0.33033	-0.9884	10	0.21540	T	0.41	-10.6859	7.9233	0.29859	0.0:0.7512:0.1633:0.0855	.	225;93;93	B7Z3W0;Q9BYJ1;B3KVD2	.;LOXE3_HUMAN;.	N	249;225;93	ENSP00000369494:D249N;ENSP00000314879:D225N;ENSP00000400581:D93N	ENSP00000314879:D225N	D	-	1	0	ALOXE3	7960894	0.000000	0.05858	0.509000	0.27700	0.161000	0.22273	1.009000	0.29886	2.615000	0.88500	0.555000	0.69702	GAT	ALOXE3	-	pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2	ENSG00000179148		0.572	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOXE3	HGNC	protein_coding	OTTHUMT00000441475.1	176	0.00	0	C			8020169	8020169	-1	no_errors	ENST00000318227	ensembl	human	known	69_37n	missense	59	24.36	19	SNP	0.965	T
ANKRD30B	374860	genome.wustl.edu	37	18	14843061	14843061	+	Silent	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr18:14843061C>G	ENST00000358984.4	+	33	2970	c.2790C>G	c.(2788-2790)ggC>ggG	p.G930G		NM_001145029.1	NP_001138501.1	Q9BXX2	AN30B_HUMAN	ankyrin repeat domain 30B	930										breast(3)|endometrium(4)|kidney(3)|lung(8)|ovary(1)|prostate(2)|skin(1)	22						CAAATAAAGGCTTAGAATGGA	0.299																																						dbGAP											0													67.0	58.0	61.0					18																	14843061		692	1588	2280	-	-	-	SO:0001819	synonymous_variant	0			BC028407	CCDS54182.1	18p11.21	2013-01-10			ENSG00000180777	ENSG00000180777		"""Ankyrin repeat domain containing"""	24165	protein-coding gene	gene with protein product						11280766	Standard	NM_001145029		Approved	NY-BR-1.1	uc010dlo.2	Q9BXX2		ENST00000358984.4:c.2790C>G	18.37:g.14843061C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGP1|F8WAG3|Q4G175	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.G930	ENST00000358984.4	37	c.2790	CCDS54182.1	18																																																																																			ANKRD30B	-	NULL	ENSG00000180777		0.299	ANKRD30B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD30B	HGNC	protein_coding	OTTHUMT00000443557.1	475	0.00	0	C	NM_001145029		14843061	14843061	+1	no_errors	ENST00000358984	ensembl	human	known	69_37n	silent	444	14.45	75	SNP	0.000	G
APOL4	80832	genome.wustl.edu	37	22	36587925	36587925	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr22:36587925C>T	ENST00000405511.1	-	6	665	c.243G>A	c.(241-243)aaG>aaA	p.K81K	APOL4_ENST00000404685.3_Silent_p.K84K|APOL4_ENST00000479929.1_5'UTR|APOL4_ENST00000332987.1_Silent_p.K81K|APOL4_ENST00000352371.1_Silent_p.K84K|APOL4_ENST00000429038.2_Silent_p.K81K	NM_030643.3	NP_085146.2	Q9BPW4	APOL4_HUMAN	apolipoprotein L, 4	84					lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)	extracellular space (GO:0005615)	lipid binding (GO:0008289)			lung(1)	1						GTGTAAGATTCTTCAGAGCTT	0.398																																						dbGAP											0													87.0	87.0	87.0					22																	36587925		2038	4217	6255	-	-	-	SO:0001819	synonymous_variant	0			AF305226	CCDS74851.1, CCDS74852.1	22q11.2-q13.2	2013-01-24			ENSG00000100336	ENSG00000100336		"""Apolipoproteins"""	14867	protein-coding gene	gene with protein product		607254				11374903	Standard	NM_030643		Approved	APOLIV	uc003aox.3	Q9BPW4	OTTHUMG00000150630	ENST00000405511.1:c.243G>A	22.37:g.36587925C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BQ37|Q9BXQ8	Silent	SNP	pfam_ApoL	p.K84	ENST00000405511.1	37	c.252		22																																																																																			APOL4	-	pfam_ApoL	ENSG00000100336		0.398	APOL4-002	PUTATIVE	basic	protein_coding	APOL4	HGNC	protein_coding	OTTHUMT00000319256.2	121	0.00	0	C	NM_145660		36587925	36587925	-1	no_errors	ENST00000352371	ensembl	human	known	69_37n	silent	108	14.96	19	SNP	0.000	T
ATP13A1	57130	genome.wustl.edu	37	19	19756232	19756232	+	Nonstop_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:19756232C>G	ENST00000357324.6	-	26	3640	c.3614G>C	c.(3613-3615)tGa>tCa	p.*1205S	GMIP_ENST00000203556.4_5'Flank|GMIP_ENST00000445806.2_5'Flank|ATP13A1_ENST00000291503.5_Nonstop_Mutation_p.*1087S|GMIP_ENST00000587238.1_5'Flank	NM_020410.2	NP_065143.2	Q9HD20	AT131_HUMAN	ATPase type 13A1	0						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|liver(2)|lung(7)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						ACTGCCATCTCAGGAAGGCAC	0.677																																					Esophageal Squamous(142;920 1789 9047 14684 24777)	dbGAP											0													23.0	25.0	24.0					19																	19756232		2200	4296	6496	-	-	-	SO:0001578	stop_lost	0			AK056420	CCDS32970.2	19p13.11	2010-04-20	2005-01-12	2005-01-12	ENSG00000105726	ENSG00000105726		"""ATPases / P-type"""	24215	protein-coding gene	gene with protein product	"""cation transporting ATPase"""		"""ATPase type 13A"""	ATP13A		11347906	Standard	NM_020410		Approved	KIAA1825, FLJ31858, CGI-152	uc002nnh.4	Q9HD20	OTTHUMG00000153016	ENST00000357324.6:c.3614G>C	19.37:g.19756232C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPJ2|B3KTA7|Q6NT90|Q6ZMG7|Q9H6C6	Nonstop_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.*1205S	ENST00000357324.6	37	c.3614	CCDS32970.2	19	.	.	.	.	.	.	.	.	.	.	C	16.91	3.252981	0.59212	.	.	ENSG00000105726	ENST00000291503;ENST00000357324	.	.	.	5.24	5.24	0.73138	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3157	0.82923	0.0:1.0:0.0:0.0	.	.	.	.	S	1087;1205	.	.	X	-	2	2	ATP13A1	19617232	1.000000	0.71417	0.998000	0.56505	0.713000	0.41058	5.617000	0.67716	2.462000	0.83206	0.561000	0.74099	TGA	ATP13A1	-	NULL	ENSG00000105726		0.677	ATP13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A1	HGNC	protein_coding	OTTHUMT00000329005.1	38	0.00	0	C	NM_020410		19756232	19756232	-1	no_errors	ENST00000357324	ensembl	human	known	69_37n	nonstop	30	25.00	10	SNP	1.000	G
ATP6AP1	537	genome.wustl.edu	37	X	153660671	153660671	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:153660671C>T	ENST00000369762.2	+	4	484	c.423C>T	c.(421-423)gtC>gtT	p.V141V	ATP6AP1_ENST00000484908.1_3'UTR	NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	141					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					GGTATGCAGTCAGCACTCTGA	0.637											OREG0003605	type=REGULATORY REGION|Gene=ATP6AP1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													61.0	51.0	54.0					X																	153660671		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.423C>T	X.37:g.153660671C>T		Somatic	1757	WXS	Illumina GAIIx	Phase_IV	A6ZKI4|Q8NBT4|Q9H0C7	Silent	SNP	pfam_BIG/ATPase_V1_suS1	p.V141	ENST00000369762.2	37	c.423	CCDS35451.1	X																																																																																			ATP6AP1	-	pfam_BIG/ATPase_V1_suS1	ENSG00000071553		0.637	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6AP1	HGNC	protein_coding	OTTHUMT00000081639.4	135	0.00	0	C	NM_001183		153660671	153660671	+1	no_errors	ENST00000369762	ensembl	human	known	69_37n	silent	108	14.29	18	SNP	0.999	T
AVL9	23080	genome.wustl.edu	37	7	32598959	32598959	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:32598959G>C	ENST00000318709.4	+	10	1319	c.1098G>C	c.(1096-1098)gaG>gaC	p.E366D	AVL9_ENST00000409301.1_Missense_Mutation_p.E366D|AVL9_ENST00000404479.1_Missense_Mutation_p.E366D	NM_015060.1	NP_055875.1	Q8NBF6	AVL9_HUMAN	AVL9 homolog (S. cerevisiase)	366					cell migration (GO:0016477)	integral component of membrane (GO:0016021)|recycling endosome (GO:0055037)				endometrium(3)|kidney(1)|large_intestine(3)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	18						TCCCCTCAGAGAGTCTTCCAA	0.483																																						dbGAP											0													47.0	47.0	47.0					7																	32598959		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87682	CCDS34613.1	7p14.3	2013-05-01	2008-10-03	2008-10-03	ENSG00000105778	ENSG00000105778			28994	protein-coding gene	gene with protein product		612927	"""KIAA0241"""	KIAA0241		17229886, 22595670	Standard	XM_005249668		Approved		uc003tcv.1	Q8NBF6	OTTHUMG00000152929	ENST00000318709.4:c.1098G>C	7.37:g.32598959G>C	ENSP00000315568:p.Glu366Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q92573	Missense_Mutation	SNP	pfam_Secretory_pathway_prot_Avl9,pfam_DUF2347	p.E366D	ENST00000318709.4	37	c.1098	CCDS34613.1	7	.	.	.	.	.	.	.	.	.	.	G	0.470	-0.884970	0.02511	.	.	ENSG00000105778	ENST00000318709;ENST00000409301;ENST00000329714;ENST00000404479;ENST00000446718	T;T;T;T	0.48522	0.92;0.92;0.86;0.81	5.41	-1.1	0.09872	.	0.443828	0.26891	N	0.021976	T	0.22627	0.0546	N	0.25647	0.755	0.22940	N	0.998532	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.002;0.0;0.001	T	0.10965	-1.0607	10	0.11794	T	0.64	-3.7096	1.9081	0.03281	0.339:0.3205:0.2011:0.1394	.	366;366;366	Q8N6Z3;Q8NBF6-2;Q8NBF6	.;.;AVL9_HUMAN	D	366;366;366;366;297	ENSP00000315568:E366D;ENSP00000387011:E366D;ENSP00000385242:E366D;ENSP00000395134:E297D	ENSP00000315568:E366D	E	+	3	2	AVL9	32565484	0.984000	0.35163	0.980000	0.43619	0.167000	0.22549	0.242000	0.18087	-0.270000	0.09285	-1.731000	0.00696	GAG	AVL9	-	pfam_Secretory_pathway_prot_Avl9	ENSG00000105778		0.483	AVL9-003	NOVEL	basic|appris_principal|CCDS	protein_coding	AVL9	HGNC	protein_coding	OTTHUMT00000328643.1	22	0.00	0	G	NM_015060		32598959	32598959	+1	no_errors	ENST00000404479	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.891	C
BBS9	27241	genome.wustl.edu	37	7	33388717	33388717	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:33388717A>C	ENST00000242067.6	+	13	1888	c.1367A>C	c.(1366-1368)aAa>aCa	p.K456T	BBS9_ENST00000354265.4_Missense_Mutation_p.K456T|BBS9_ENST00000396127.2_Missense_Mutation_p.K456T|BBS9_ENST00000355070.2_Missense_Mutation_p.K456T|BBS9_ENST00000350941.3_Missense_Mutation_p.K456T	NM_198428.2	NP_940820.1	Q3SYG4	PTHB1_HUMAN	Bardet-Biedl syndrome 9	456					cilium assembly (GO:0042384)|fat cell differentiation (GO:0045444)|protein transport (GO:0015031)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	BBSome (GO:0034464)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)			BBS9/PKD1L1(2)	NS(1)|autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(27)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	50			GBM - Glioblastoma multiforme(11;0.0894)			CAAAAAGCCAAATTATCAGTC	0.338									Bardet-Biedl syndrome																													dbGAP											0													186.0	165.0	172.0					7																	33388717		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	BBS, Bardet-Biedl syndrome, type 1-12: BBS1-12,Laurence-Moon-Biedl syndrome		CCDS5441.1, CCDS34618.1, CCDS43566.1, CCDS47572.1	7p14	2014-06-17			ENSG00000122507	ENSG00000122507			30000	protein-coding gene	gene with protein product	"""parathyroid hormone responsive B1 gene"""	607968				16380913, 10221542	Standard	XM_005249701		Approved	B1, PTHB1	uc003tdn.1	Q3SYG4	OTTHUMG00000128659	ENST00000242067.6:c.1367A>C	7.37:g.33388717A>C	ENSP00000242067:p.Lys456Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDC9|P78514|Q7KYS6|Q7KYS7|Q8N570|Q99844|Q99854|Q9Y699|Q9Y6A0	Missense_Mutation	SNP	NULL	p.K456T	ENST00000242067.6	37	c.1367	CCDS43566.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	4.059|4.059	0.008714|0.008714	0.07912|0.07912	.|.	.|.	ENSG00000122507|ENSG00000122507	ENST00000242067;ENST00000350941;ENST00000396127;ENST00000355070;ENST00000354265;ENST00000396132;ENST00000396125;ENST00000537775|ENST00000434373	T;T;T;T;T|.	0.58940|.	2.71;0.31;0.3;2.71;2.71|.	5.41|5.41	3.03|3.03	0.35002|0.35002	.|.	0.428217|.	0.22527|.	N|.	0.058890|.	T|T	0.32585|0.32585	0.0834|0.0834	L|L	0.31664|0.31664	0.95|0.95	0.20196|0.20196	N|N	0.999923|0.999923	B;B;B;B|.	0.20550|.	0.004;0.02;0.02;0.046|.	B;B;B;B|.	0.21708|.	0.008;0.022;0.027;0.036|.	T|T	0.19647|0.19647	-1.0299|-1.0299	10|5	0.16896|.	T|.	0.51|.	-9.0892|-9.0892	8.3682|8.3682	0.32399|0.32399	0.8426:0.0:0.1574:0.0|0.8426:0.0:0.1574:0.0	.|.	456;456;456;456|.	Q3SYG4-2;E9PDC9;Q3SYG4-4;Q3SYG4|.	.;.;.;PTHB1_HUMAN|.	T|H	456;456;456;456;456;456;456;334|22	ENSP00000242067:K456T;ENSP00000313122:K456T;ENSP00000379433:K456T;ENSP00000347182:K456T;ENSP00000346214:K456T|.	ENSP00000242067:K456T|.	K|Q	+|+	2|3	0|2	BBS9|BBS9	33355242|33355242	0.998000|0.998000	0.40836|0.40836	0.919000|0.919000	0.36401|0.36401	0.246000|0.246000	0.25737|0.25737	2.240000|2.240000	0.43088|0.43088	0.361000|0.361000	0.24292|0.24292	0.477000|0.477000	0.44152|0.44152	AAA|CAA	BBS9	-	NULL	ENSG00000122507		0.338	BBS9-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BBS9	HGNC	protein_coding	OTTHUMT00000329064.1	241	0.00	0	A			33388717	33388717	+1	no_errors	ENST00000242067	ensembl	human	known	69_37n	missense	282	11.60	37	SNP	0.267	C
BRAF	673	genome.wustl.edu	37	7	140500217	140500217	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:140500217C>A	ENST00000288602.6	-	7	985	c.925G>T	c.(925-927)Gag>Tag	p.E309*		NM_004333.4	NP_004324.2	P15056	BRAF_HUMAN	B-Raf proto-oncogene, serine/threonine kinase	309					activation of MAPKK activity (GO:0000186)|CD4-positive, alpha-beta T cell differentiation (GO:0043367)|cellular response to calcium ion (GO:0071277)|cellular response to drug (GO:0035690)|fibroblast growth factor receptor signaling pathway (GO:0008543)|long-term synaptic potentiation (GO:0060291)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast migration (GO:0010764)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of synaptic vesicle exocytosis (GO:2000301)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of stress fiber assembly (GO:0051496)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive T cell selection (GO:0043368)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell proliferation (GO:0042127)|response to cAMP (GO:0051591)|response to epidermal growth factor (GO:0070849)|response to peptide hormone (GO:0043434)|small GTPase mediated signal transduction (GO:0007264)|somatic stem cell maintenance (GO:0035019)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cell body (GO:0044297)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|MAP kinase kinase kinase activity (GO:0004709)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)		SLC45A3/BRAF(2)|AGTRAP/BRAF(2)|FAM131B_ENST00000443739/BRAF(7)|AKAP9_ENST00000356239/BRAF(10)|KIAA1549/BRAF(703)|FCHSD1/BRAF(2)	NS(588)|adrenal_gland(3)|autonomic_ganglia(3)|biliary_tract(29)|bone(7)|breast(21)|central_nervous_system(99)|cervix(6)|endometrium(33)|eye(72)|gastrointestinal_tract_(site_indeterminate)(2)|genital_tract(4)|haematopoietic_and_lymphoid_tissue(436)|kidney(3)|large_intestine(6953)|liver(17)|lung(192)|oesophagus(4)|ovary(275)|pancreas(15)|pituitary(1)|prostate(25)|salivary_gland(1)|skin(6285)|small_intestine(12)|soft_tissue(40)|stomach(11)|testis(7)|thyroid(12220)|upper_aerodigestive_tract(13)|urinary_tract(3)	27380	Melanoma(164;0.00956)				Dabrafenib(DB08912)|Regorafenib(DB08896)|Sorafenib(DB00398)|Vemurafenib(DB08881)	AGGGCAGTCTCTGCTAAGGAC	0.498		61	"""Mis, T, O"""	"""AKAP9, KIAA1549"""	"""melanoma, colorectal, papillary thyroid, borderline ov, Non small-cell lung cancer (NSCLC), cholangiocarcinoma, pilocytic astrocytoma"""		Cardio-facio-cutaneous syndrome		Cardiofaciocutaneous syndrome																												Colon(40;35 892 2973 5743 27438)	dbGAP		Dom	yes		7	7q34	673	v-raf murine sarcoma viral oncogene homolog B1	yes	E	0													186.0	140.0	156.0					7																	140500217		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	CFC, CFCS	M95712	CCDS5863.1	7q34	2014-09-17	2014-06-26		ENSG00000157764	ENSG00000157764			1097	protein-coding gene	gene with protein product		164757	"""v-raf murine sarcoma viral oncogene homolog B"""			2284096, 1565476	Standard	NM_004333		Approved	BRAF1	uc003vwc.4	P15056	OTTHUMG00000157457	ENST00000288602.6:c.925G>T	7.37:g.140500217C>A	ENSP00000288602:p.Glu309*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1T4|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q13878|Q3MIN6|Q9UDP8|Q9Y6T3	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Raf-like_ras-bd,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_Kinase-like_dom,smart_Raf-like_ras-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Raf-like_ras-bd,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_DAG/PE-bd	p.E309*	ENST00000288602.6	37	c.925	CCDS5863.1	7	.	.	.	.	.	.	.	.	.	.	C	37	6.073385	0.97256	.	.	ENSG00000157764	ENST00000288602	.	.	.	6.06	6.06	0.98353	.	0.046522	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06757	T	0.87	.	20.6397	0.99537	0.0:1.0:0.0:0.0	.	.	.	.	X	309	.	ENSP00000288602:E309X	E	-	1	0	BRAF	140146686	1.000000	0.71417	1.000000	0.80357	0.614000	0.37383	7.184000	0.77705	2.880000	0.98712	0.650000	0.86243	GAG	BRAF	-	NULL	ENSG00000157764		0.498	BRAF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAF	HGNC	protein_coding	OTTHUMT00000348886.1	119	0.00	0	C	NM_004333		140500217	140500217	-1	no_errors	ENST00000288602	ensembl	human	known	69_37n	nonsense	89	14.42	15	SNP	1.000	A
BTBD7	55727	genome.wustl.edu	37	14	93723687	93723687	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:93723687T>G	ENST00000334746.5	-	6	1769	c.1462A>C	c.(1462-1464)Agt>Cgt	p.S488R	BTBD7_ENST00000554565.1_Missense_Mutation_p.S137R|BTBD7_ENST00000393170.2_Missense_Mutation_p.S62R	NM_001002860.2	NP_001002860.2	Q9P203	BTBD7_HUMAN	BTB (POZ) domain containing 7	488					multicellular organismal development (GO:0007275)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)	nucleus (GO:0005634)				breast(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(8)|ovary(1)|pancreas(1)|skin(8)|upper_aerodigestive_tract(1)	35		all_cancers(154;0.08)		Epithelial(152;0.196)|COAD - Colon adenocarcinoma(157;0.212)|all cancers(159;0.223)		GCAGTGCCACTCAGTAAGTTT	0.423																																						dbGAP											0													142.0	129.0	133.0					14																	93723687		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040958	CCDS32146.1, CCDS32147.1, CCDS73684.1	14q32.13	2013-01-08			ENSG00000011114	ENSG00000011114		"""BTB/POZ domain containing"""	18269	protein-coding gene	gene with protein product		610386				10819331, 11527404	Standard	NM_001289133		Approved	FLJ10648, FUP1	uc001ybo.3	Q9P203	OTTHUMG00000171269	ENST00000334746.5:c.1462A>C	14.37:g.93723687T>G	ENSP00000335615:p.Ser488Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5V7|Q69Z05|Q7Z308|Q86TS0|Q9HAA4|Q9NVM0	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,pfscan_BTB/POZ-like	p.S488R	ENST00000334746.5	37	c.1462	CCDS32146.1	14	.	.	.	.	.	.	.	.	.	.	T	29.7	5.029402	0.93518	.	.	ENSG00000011114	ENST00000334746;ENST00000554565;ENST00000553975;ENST00000393170	T;T	0.54479	1.0;0.57	5.64	5.64	0.86602	BTB/Kelch-associated (1);	0.000000	0.85682	D	0.000000	T	0.71409	0.3336	M	0.67397	2.05	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	T	0.74553	-0.3627	10	0.87932	D	0	.	16.1564	0.81670	0.0:0.0:0.0:1.0	.	62;137;488	E7ERI4;Q9P203-5;Q9P203	.;.;BTBD7_HUMAN	R	488;137;103;62	ENSP00000335615:S488R;ENSP00000451010:S137R	ENSP00000335615:S488R	S	-	1	0	BTBD7	92793440	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.997000	0.88414	2.274000	0.75844	0.528000	0.53228	AGT	BTBD7	-	smart_BACK	ENSG00000011114		0.423	BTBD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTBD7	HGNC	protein_coding	OTTHUMT00000412701.1	239	0.00	0	T	NM_001002860		93723687	93723687	-1	no_errors	ENST00000334746	ensembl	human	known	69_37n	missense	222	14.29	37	SNP	1.000	G
BTN2A2	10385	genome.wustl.edu	37	6	26388255	26388255	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:26388255C>A	ENST00000356709.4	+	4	568	c.457C>A	c.(457-459)Ccc>Acc	p.P153T	BTN2A2_ENST00000482536.1_Intron|BTN2A2_ENST00000432533.2_Intron|BTN2A2_ENST00000469230.1_Missense_Mutation_p.P153T|BTN2A2_ENST00000416795.2_Missense_Mutation_p.P153T|BTN2A2_ENST00000352867.2_Missense_Mutation_p.P37T	NM_001197240.1|NM_006995.4	NP_001184169.1|NP_008926.2	Q8WVV5	BT2A2_HUMAN	butyrophilin, subfamily 2, member A2	153	Ig-like C2-type.				negative regulation of activated T cell proliferation (GO:0046007)|negative regulation of cellular metabolic process (GO:0031324)|negative regulation of cytokine secretion (GO:0050710)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(2)|endometrium(3)|large_intestine(5)|lung(13)	23						TGGGTCTAAGCCCCTCATTGA	0.562																																						dbGAP											0													51.0	50.0	51.0					6																	26388255		2203	4300	6503	-	-	-	SO:0001583	missense	0			U90550	CCDS4606.1, CCDS4607.1, CCDS56401.1, CCDS56402.1, CCDS56403.1	6p22.1	2014-01-14			ENSG00000124508	ENSG00000124508		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1137	protein-coding gene	gene with protein product		613591				10354554, 9149941	Standard	NM_006995		Approved	BTF2, BT2.2, BTN2.2	uc003nhq.3	Q8WVV5	OTTHUMG00000014452	ENST00000356709.4:c.457C>A	6.37:g.26388255C>A	ENSP00000349143:p.Pro153Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NM84|B4DE97|B4DQ01|E9PH07|O00480	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.P153T	ENST00000356709.4	37	c.457	CCDS4606.1	6	.	.	.	.	.	.	.	.	.	.	c	11.73	1.725472	0.30593	.	.	ENSG00000124508	ENST00000469230;ENST00000356709;ENST00000352867;ENST00000493275;ENST00000472507;ENST00000416795;ENST00000483410	T;T;T;T;T;T;T	0.58060	3.27;0.76;0.36;3.79;3.92;0.76;3.82	4.22	3.34	0.38264	.	0.000000	0.53938	D	0.000057	T	0.70527	0.3234	H	0.95470	3.675	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;0.998	D;D;D;D	0.97110	1.0;1.0;1.0;0.993	T	0.63166	-0.6698	10	0.87932	D	0	.	9.0646	0.36455	0.0:0.8887:0.0:0.1113	.	37;153;37;153	B4E3J1;Q8WVV5-2;A6NM84;Q8WVV5	.;.;.;BT2A2_HUMAN	T	153;153;37;153;37;153;37	ENSP00000417472:P153T;ENSP00000349143:P153T;ENSP00000337117:P37T;ENSP00000418857:P153T;ENSP00000419226:P37T;ENSP00000399308:P153T;ENSP00000418176:P37T	ENSP00000337117:P37T	P	+	1	0	BTN2A2	26496234	0.215000	0.23574	0.011000	0.14972	0.398000	0.30690	2.848000	0.48278	1.927000	0.55829	0.454000	0.30748	CCC	BTN2A2	-	NULL	ENSG00000124508		0.562	BTN2A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN2A2	HGNC	protein_coding	OTTHUMT00000040117.1	127	0.78	1	C			26388255	26388255	+1	no_errors	ENST00000356709	ensembl	human	known	69_37n	missense	114	12.88	17	SNP	0.054	A
C12orf77	196415	genome.wustl.edu	37	12	25148864	25148864	+	Missense_Mutation	SNP	G	G	A	rs369384258		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:25148864G>A	ENST00000549828.1	-	3	488	c.284C>T	c.(283-285)tCt>tTt	p.S95F	C12orf77_ENST00000549262.1_Missense_Mutation_p.S40F|C12orf77_ENST00000434912.3_Missense_Mutation_p.S40F	NM_001101339.1	NP_001094809.1	C9JDV5	CL097_HUMAN	chromosome 12 open reading frame 77	95										endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|prostate(1)	7						TGTTTCAGTAGAGATGGCATA	0.483																																						dbGAP											0													79.0	83.0	82.0					12																	25148864		1970	4146	6116	-	-	-	SO:0001583	missense	0			BC046192	CCDS44846.1	12p12.1	2009-09-30			ENSG00000226397	ENSG00000226397			27282	protein-coding gene	gene with protein product						12477932	Standard	NM_001101339		Approved		uc001rgf.3	C9JDV5	OTTHUMG00000170185	ENST00000549828.1:c.284C>T	12.37:g.25148864G>A	ENSP00000447146:p.Ser95Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S95F	ENST00000549828.1	37	c.284	CCDS44846.1	12	.	.	.	.	.	.	.	.	.	.	G	9.392	1.075669	0.20227	.	.	ENSG00000226397	ENST00000549828;ENST00000549262;ENST00000434912	T;T;T	0.56103	0.52;0.48;0.48	2.7	-0.367	0.12541	.	.	.	.	.	T	0.27098	0.0664	N	0.08118	0	0.09310	N	1	B	0.27656	0.184	B	0.24974	0.057	T	0.19516	-1.0303	9	0.87932	D	0	.	3.5186	0.07734	0.1334:0.0:0.4276:0.4389	.	95	C9JDV5	CL097_HUMAN	F	95;40;40	ENSP00000447146:S95F;ENSP00000447028:S40F;ENSP00000403451:S40F	ENSP00000403451:S40F	S	-	2	0	C12orf77	25040131	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.252000	0.18278	-0.084000	0.12595	0.655000	0.94253	TCT	C12orf77	-	NULL	ENSG00000226397		0.483	C12orf77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf77	HGNC	protein_coding	OTTHUMT00000407827.1	229	0.43	1	G	NM_001101339		25148864	25148864	-1	no_errors	ENST00000549828	ensembl	human	known	69_37n	missense	158	21.00	42	SNP	0.000	A
C7	730	genome.wustl.edu	37	5	40959700	40959700	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:40959700G>C	ENST00000313164.9	+	12	1998	c.1639G>C	c.(1639-1641)Gat>Cat	p.D547H		NM_000587.2	NP_000578.2	P10643	CO7_HUMAN	complement component 7	547	CCP 1.|TSP type-1 2. {ECO:0000255|PROSITE- ProRule:PRU00210}.				cellular sodium ion homeostasis (GO:0006883)|complement activation (GO:0006956)|complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)							Ovarian(839;0.0112)				ACAATGCGAAGATGAGGAGCT	0.527																																						dbGAP											0													77.0	84.0	82.0					5																	40959700		2029	4183	6212	-	-	-	SO:0001583	missense	0			J03507	CCDS47201.1	5p13.1	2014-09-17			ENSG00000112936	ENSG00000112936		"""Complement system"""	1346	protein-coding gene	gene with protein product		217070					Standard	NM_000587		Approved		uc003jmh.3	P10643	OTTHUMG00000150340	ENST00000313164.9:c.1639G>C	5.37:g.40959700G>C	ENSP00000322061:p.Asp547His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P3T5|Q92489	Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.D547H	ENST00000313164.9	37	c.1639	CCDS47201.1	5	.	.	.	.	.	.	.	.	.	.	G	15.98	2.992697	0.54041	.	.	ENSG00000112936	ENST00000313164;ENST00000440677	T	0.54071	0.59	5.4	4.52	0.55395	.	0.167340	0.52532	D	0.000075	T	0.73024	0.3534	M	0.83603	2.65	0.44816	D	0.997828	D	0.76494	0.999	D	0.69824	0.966	T	0.77765	-0.2465	10	0.87932	D	0	-10.2037	14.5008	0.67719	0.0722:0.0:0.9278:0.0	.	547	P10643	CO7_HUMAN	H	547;387	ENSP00000322061:D547H	ENSP00000322061:D547H	D	+	1	0	C7	40995457	1.000000	0.71417	0.058000	0.19502	0.212000	0.24457	5.720000	0.68470	2.538000	0.85594	0.462000	0.41574	GAT	C7	-	pfam_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000112936		0.527	C7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7	HGNC	protein_coding	OTTHUMT00000317680.1	148	0.00	0	G			40959700	40959700	+1	no_errors	ENST00000313164	ensembl	human	known	69_37n	missense	177	12.38	25	SNP	1.000	C
CABIN1	23523	genome.wustl.edu	37	22	24573644	24573644	+	Silent	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr22:24573644C>G	ENST00000398319.2	+	36	6763	c.6378C>G	c.(6376-6378)tcC>tcG	p.S2126S	CABIN1_ENST00000405822.2_Silent_p.S2047S|CABIN1_ENST00000263119.5_Silent_p.S2126S|CABIN1_ENST00000337989.7_Silent_p.S496S	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	2126	Required for interaction with calcineurin. {ECO:0000250}.				cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						GGGCTAAGTCCCGCCCCCTGC	0.687																																						dbGAP											0													63.0	54.0	57.0					22																	24573644		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.6378C>G	22.37:g.24573644C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	G5E9F3|Q6PHY0|Q9Y460	Silent	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S2126	ENST00000398319.2	37	c.6378	CCDS13823.1	22																																																																																			CABIN1	-	NULL	ENSG00000099991		0.687	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	62	0.00	0	C	NM_012295		24573644	24573644	+1	no_errors	ENST00000263119	ensembl	human	known	69_37n	silent	62	27.91	24	SNP	0.864	G
CD109	135228	genome.wustl.edu	37	6	74473391	74473391	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:74473391C>G	ENST00000287097.5	+	10	1202	c.1090C>G	c.(1090-1092)Ctc>Gtc	p.L364V	CD109_ENST00000437994.2_Missense_Mutation_p.L364V|CD109_ENST00000422508.2_Missense_Mutation_p.L287V			Q6YHK3	CD109_HUMAN	CD109 molecule	364					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of wound healing (GO:0061045)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)	serine-type endopeptidase inhibitor activity (GO:0004867)|transforming growth factor beta binding (GO:0050431)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(2)|lung(26)|ovary(2)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	63						GAAGCCATCTCTCAACTTCAC	0.318																																						dbGAP											0													80.0	82.0	81.0					6																	74473391		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF410459	CCDS4982.1, CCDS55038.1, CCDS55039.1	6q14.1	2008-02-05	2006-03-28		ENSG00000156535	ENSG00000156535		"""CD molecules"""	21685	protein-coding gene	gene with protein product		608859	"""CD109 antigen (Gov platelet alloantigens)"""			11861284, 11861285	Standard	XM_005248659		Approved	FLJ38569, DKFZp762L1111, CPAMD7	uc003php.3	Q6YHK3	OTTHUMG00000015040	ENST00000287097.5:c.1090C>G	6.37:g.74473391C>G	ENSP00000287097:p.Leu364Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YKK4|B2R948|B3KW25|Q0P6K7|Q5SYA8|Q5XUM7|Q5XUM9|Q6MZI7|Q8N3A7|Q8N915|Q8TDJ2|Q8TDJ3	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.L364V	ENST00000287097.5	37	c.1090	CCDS4982.1	6	.	.	.	.	.	.	.	.	.	.	C	18.71	3.682039	0.68042	.	.	ENSG00000156535	ENST00000437994;ENST00000422508;ENST00000287097	T;T;T	0.28069	1.63;1.83;1.63	4.28	4.28	0.50868	.	0.160714	0.43260	D	0.000583	T	0.44540	0.1298	M	0.64997	1.995	0.40887	D	0.984044	D;D;P;D	0.89917	0.998;1.0;0.842;0.998	D;D;P;D	0.77557	0.93;0.99;0.891;0.927	T	0.43261	-0.9402	10	0.56958	D	0.05	.	15.9866	0.80157	0.0:1.0:0.0:0.0	.	287;364;364;364	Q6YHK3-2;Q6YHK3-3;Q6YHK3-4;Q6YHK3	.;.;.;CD109_HUMAN	V	364;287;364	ENSP00000388062:L364V;ENSP00000404475:L287V;ENSP00000287097:L364V	ENSP00000287097:L364V	L	+	1	0	CD109	74530112	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.352000	0.52239	2.351000	0.79841	0.591000	0.81541	CTC	CD109	-	NULL	ENSG00000156535		0.318	CD109-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD109	HGNC	protein_coding	OTTHUMT00000041230.3	208	0.00	0	C	NM_133493		74473391	74473391	+1	no_errors	ENST00000287097	ensembl	human	known	69_37n	missense	95	32.62	46	SNP	1.000	G
CPXM1	56265	genome.wustl.edu	37	20	2777840	2777840	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr20:2777840G>A	ENST00000380605.2	-	6	894	c.830C>T	c.(829-831)tCa>tTa	p.S277L		NM_001184699.1|NM_019609.4	NP_001171628.1|NP_062555.1	Q96SM3	CPXM1_HUMAN	carboxypeptidase X (M14 family), member 1	277					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(5)|large_intestine(8)|lung(17)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	43						CTGCCCACCTGAGACTGGGCA	0.647																																						dbGAP											0													27.0	29.0	29.0					20																	2777840		2203	4299	6502	-	-	-	SO:0001583	missense	0			AL035460	CCDS13033.1	20p13	2012-02-10	2006-08-24	2006-08-24	ENSG00000088882	ENSG00000088882			15771	protein-coding gene	gene with protein product	"""carboxypeptidase-like protein X1"""	609555	"""carboxypeptidase X (M14 family)"""	CPXM		14702039	Standard	NM_019609		Approved	CPX-1, CPX1	uc002wgu.3	Q96SM3	OTTHUMG00000031706	ENST00000380605.2:c.830C>T	20.37:g.2777840G>A	ENSP00000369979:p.Ser277Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P4G8|Q6UW65|Q9NUB5	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,prints_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom	p.S277L	ENST00000380605.2	37	c.830	CCDS13033.1	20	.	.	.	.	.	.	.	.	.	.	G	15.41	2.824114	0.50739	.	.	ENSG00000088882	ENST00000380605	D	0.98862	-5.19	4.79	3.84	0.44239	.	0.410516	0.23716	N	0.045269	D	0.97056	0.9038	L	0.53249	1.67	0.35247	D	0.778364	P;B	0.42827	0.791;0.255	B;B	0.41860	0.368;0.053	D	0.98776	1.0730	10	0.56958	D	0.05	-19.7405	10.8001	0.46483	0.0922:0.0:0.9078:0.0	.	277;277	Q8N2E1;Q96SM3	.;CPXM1_HUMAN	L	277	ENSP00000369979:S277L	ENSP00000369979:S277L	S	-	2	0	CPXM1	2725840	1.000000	0.71417	0.996000	0.52242	0.948000	0.59901	4.782000	0.62396	1.250000	0.43966	0.655000	0.94253	TCA	CPXM1	-	NULL	ENSG00000088882		0.647	CPXM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM1	HGNC	protein_coding	OTTHUMT00000077643.2	58	0.00	0	G	NM_019609		2777840	2777840	-1	no_errors	ENST00000380605	ensembl	human	known	69_37n	missense	87	14.71	15	SNP	1.000	A
CHRNA4	1137	genome.wustl.edu	37	20	61981765	61981765	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr20:61981765C>T	ENST00000370263.4	-	5	1219	c.998G>A	c.(997-999)cGc>cAc	p.R333H	CHRNA4_ENST00000463705.1_5'UTR	NM_000744.6|NM_001256573.1	NP_000735.1|NP_001243502.1	P43681	ACHA4_HUMAN	cholinergic receptor, nicotinic, alpha 4 (neuronal)	333					action potential (GO:0001508)|B cell activation (GO:0042113)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cognition (GO:0050890)|DNA repair (GO:0006281)|exploration behavior (GO:0035640)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|neurological system process (GO:0050877)|regulation of dopamine secretion (GO:0014059)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of membrane potential (GO:0042391)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|response to oxidative stress (GO:0006979)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.R333H(1)		breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(19)|prostate(3)|skin(3)|soft_tissue(1)	33	all_cancers(38;1.71e-10)				Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	GCGTGGCGAGCGGTGGTGCAC	0.612																																						dbGAP											1	Substitution - Missense(1)	lung(1)											187.0	130.0	149.0					20																	61981765		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13517.1	20q13.33	2013-09-20	2012-02-07		ENSG00000101204	ENSG00000101204		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1958	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 4 (neuronal)"""	118504	"""cholinergic receptor, nicotinic, alpha polypeptide 4"""	EBN, EBN1		1505988	Standard	NM_000744		Approved	BFNC	uc002yes.3	P43681	OTTHUMG00000033080	ENST00000370263.4:c.998G>A	20.37:g.61981765C>T	ENSP00000359285:p.Arg333His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4JGR7|Q4VAQ5|Q4VAQ6	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R333H	ENST00000370263.4	37	c.998	CCDS13517.1	20	.	.	.	.	.	.	.	.	.	.	C	27.4	4.832084	0.91036	.	.	ENSG00000101204	ENST00000370258;ENST00000370263;ENST00000539366	D	0.88741	-2.42	5.15	5.15	0.70609	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.93723	0.7994	M	0.64676	1.99	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.993	D	0.94330	0.7561	10	0.87932	D	0	.	18.6226	0.91326	0.0:1.0:0.0:0.0	.	262;333	Q4VAQ5;P43681	.;ACHA4_HUMAN	H	239;333;262	ENSP00000359285:R333H	ENSP00000359280:R239H	R	-	2	0	CHRNA4	61452209	1.000000	0.71417	0.998000	0.56505	0.604000	0.37047	7.577000	0.82486	2.390000	0.81377	0.655000	0.94253	CGC	CHRNA4	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel	ENSG00000101204		0.612	CHRNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA4	HGNC	protein_coding	OTTHUMT00000080508.3	196	0.51	1	C			61981765	61981765	-1	no_errors	ENST00000370263	ensembl	human	known	69_37n	missense	241	10.99	30	SNP	1.000	T
CREB3L3	84699	genome.wustl.edu	37	19	4171688	4171688	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:4171688C>G	ENST00000078445.2	+	10	1255	c.1108C>G	c.(1108-1110)Cgc>Ggc	p.R370G	CREB3L3_ENST00000602257.1_Missense_Mutation_p.R368G|CREB3L3_ENST00000595923.1_Missense_Mutation_p.R369G|CREB3L3_ENST00000252587.3_Silent_p.P258P|CREB3L3_ENST00000602147.1_Missense_Mutation_p.P334R	NM_001271995.1|NM_001271996.1|NM_032607.1	NP_001258924.1|NP_001258925.1|NP_115996.1	Q68CJ9	CR3L3_HUMAN	cAMP responsive element binding protein 3-like 3	370					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)			breast(2)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|urinary_tract(3)	24				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0232)|STAD - Stomach adenocarcinoma(1328;0.18)		TGCTGCCTCCCGCGTGGCTGC	0.642																																						dbGAP											0													66.0	78.0	74.0					19																	4171688		2201	4288	6489	-	-	-	SO:0001583	missense	0				CCDS12121.1, CCDS62498.1, CCDS62499.1, CCDS62500.1	19p13.3	2013-01-10				ENSG00000060566		"""basic leucine zipper proteins"""	18855	protein-coding gene	gene with protein product		611998				11353085	Standard	NM_032607		Approved	CREB-H	uc002lzl.4	Q68CJ9		ENST00000078445.2:c.1108C>G	19.37:g.4171688C>G	ENSP00000078445:p.Arg370Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7S6|B7ZL69|M0QYW7|Q6ZMC5|Q96TB9	Missense_Mutation	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP	p.R370G	ENST00000078445.2	37	c.1108	CCDS12121.1	19	.	.	.	.	.	.	.	.	.	.	C	15.47	2.844059	0.51164	.	.	ENSG00000060566	ENST00000078445;ENST00000381943	D	0.86030	-2.06	3.53	2.38	0.29361	.	0.546439	0.17111	N	0.186637	D	0.89560	0.6750	M	0.76002	2.32	0.46678	D	0.999155	D;D;D	0.89917	1.0;0.998;0.997	D;D;P	0.85130	0.997;0.957;0.906	D	0.86886	0.2045	10	0.34782	T	0.22	-17.5649	7.4972	0.27496	0.2566:0.7434:0.0:0.0	.	368;369;370	B7ZL69;Q68CJ9-2;Q68CJ9	.;.;CR3L3_HUMAN	G	370;328	ENSP00000078445:R370G	ENSP00000078445:R370G	R	+	1	0	CREB3L3	4122688	0.287000	0.24315	0.900000	0.35374	0.848000	0.48234	0.870000	0.28010	1.974000	0.57490	0.561000	0.74099	CGC	CREB3L3	-	NULL	ENSG00000060566		0.642	CREB3L3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CREB3L3	HGNC	protein_coding	OTTHUMT00000457922.1	8	0.00	0	C	NM_032607		4171688	4171688	+1	no_errors	ENST00000078445	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	0.603	G
CRELD2	79174	genome.wustl.edu	37	22	50319160	50319160	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr22:50319160G>A	ENST00000328268.4	+	9	1038	c.964G>A	c.(964-966)Ggc>Agc	p.G322S	CRELD2_ENST00000404488.3_Missense_Mutation_p.G371S|CRELD2_ENST00000407217.3_Missense_Mutation_p.G290S|CRELD2_ENST00000403427.3_Missense_Mutation_p.G294S	NM_024324.3	NP_077300.3	Q6UXH1	CREL2_HUMAN	cysteine-rich with EGF-like domains 2	322	EGF-like 2; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.					endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|stomach(3)	9		all_cancers(38;5.53e-07)|all_epithelial(38;3.84e-06)|all_lung(38;0.00208)|Breast(42;0.0104)|Lung NSC(38;0.0199)|Ovarian(80;0.0907)|Lung SC(80;0.236)		BRCA - Breast invasive adenocarcinoma(115;0.198)|LUAD - Lung adenocarcinoma(64;0.247)		GTGTCCTGACGGCTTCGAAGA	0.572																																						dbGAP											0													111.0	104.0	106.0					22																	50319160		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC050675	CCDS14082.1, CCDS46730.1, CCDS63515.1, CCDS63516.1	22q13.33	2005-12-08			ENSG00000184164	ENSG00000184164			28150	protein-coding gene	gene with protein product		607171				12137942	Standard	XM_005261737		Approved	MGC11256	uc010hal.2	Q6UXH1	OTTHUMG00000150292	ENST00000328268.4:c.964G>A	22.37:g.50319160G>A	ENSP00000332223:p.Gly322Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A5GZA2|A5GZA3|A5GZA4|A5GZA5|A5GZA6|Q4W0V0|Q86UC0|Q9BU47	Missense_Mutation	SNP	pfam_DUF3456,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,smart_EGF-like,smart_Furin_repeat,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G371S	ENST00000328268.4	37	c.1111	CCDS14082.1	22	.	.	.	.	.	.	.	.	.	.	G	18.19	3.569645	0.65765	.	.	ENSG00000184164	ENST00000404488;ENST00000328268;ENST00000407217;ENST00000403427	D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04	4.41	4.41	0.53225	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.131331	0.51477	U	0.000098	D	0.96371	0.8816	M	0.87269	2.87	0.58432	D	0.999999	D;D;D;D;D	0.89917	0.988;1.0;1.0;1.0;1.0	P;D;D;D;D	0.97110	0.517;0.998;0.997;1.0;0.999	D	0.97273	0.9912	10	0.87932	D	0	.	15.9609	0.79930	0.0:0.0:1.0:0.0	.	290;371;294;322;322	Q6UXH1-2;Q6UXH1-5;Q6UXH1-4;A5GZA6;Q6UXH1	.;.;.;.;CREL2_HUMAN	S	371;322;290;294	ENSP00000383938:G371S;ENSP00000332223:G322S;ENSP00000386034:G290S;ENSP00000384111:G294S	ENSP00000332223:G322S	G	+	1	0	CRELD2	48705164	1.000000	0.71417	0.406000	0.26421	0.080000	0.17528	5.744000	0.68664	2.051000	0.60960	0.626000	0.83405	GGC	CRELD2	-	pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,pfscan_EG-like_dom	ENSG00000184164		0.572	CRELD2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CRELD2	HGNC	protein_coding	OTTHUMT00000317409.1	140	0.00	0	G	NM_024324		50319160	50319160	+1	no_errors	ENST00000404488	ensembl	human	known	69_37n	missense	117	18.18	26	SNP	0.997	A
CSMD3	114788	genome.wustl.edu	37	8	113314091	113314091	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:113314091G>A	ENST00000297405.5	-	53	8615	c.8371C>T	c.(8371-8373)Ctt>Ttt	p.L2791F	CSMD3_ENST00000455883.2_Missense_Mutation_p.L2622F|CSMD3_ENST00000352409.3_Missense_Mutation_p.L2721F|CSMD3_ENST00000343508.3_Missense_Mutation_p.L2751F	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	2791	Sushi 17. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GAGCCCACAAGCATGAATCCC	0.418										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													130.0	130.0	130.0					8																	113314091		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.8371C>T	8.37:g.113314091G>A	ENSP00000297405:p.Leu2791Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L2791F	ENST00000297405.5	37	c.8371	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	22.5	4.301209	0.81136	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.70749	-0.51;-0.51;-0.51;-0.51;-0.51	5.62	5.62	0.85841	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.64402	D	0.000016	D	0.87406	0.6169	M	0.93978	3.48	0.49687	D	0.999817	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.994	D	0.89477	0.3747	10	0.66056	D	0.02	.	13.2653	0.60131	0.0727:0.0:0.9273:0.0	.	2622;2791;2751	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	F	2751;2791;2061;2622;2721	ENSP00000345799:L2751F;ENSP00000297405:L2791F;ENSP00000341558:L2061F;ENSP00000412263:L2622F;ENSP00000343124:L2721F	ENSP00000297405:L2791F	L	-	1	0	CSMD3	113383267	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	3.402000	0.52608	2.809000	0.96659	0.655000	0.94253	CTT	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.418	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	180	0.00	0	G	NM_052900		113314091	113314091	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	338	11.29	43	SNP	1.000	A
CXorf65	158830	genome.wustl.edu	37	X	70324637	70324637	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:70324637G>A	ENST00000374251.5	-	4	349	c.301C>T	c.(301-303)Ccg>Tcg	p.P101S		NM_001025265.2	NP_001020436.1	A6NEN9	CX065_HUMAN	chromosome X open reading frame 65	101										breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)	10						CAAGGCTCCGGATTCTTGAGG	0.517																																						dbGAP											0													149.0	109.0	122.0					X																	70324637		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC144434	CCDS35324.1	Xq13.1	2009-03-06			ENSG00000204165	ENSG00000204165			33713	protein-coding gene	gene with protein product							Standard	NM_001025265		Approved		uc011mpo.2	A6NEN9	OTTHUMG00000021785	ENST00000374251.5:c.301C>T	X.37:g.70324637G>A	ENSP00000363369:p.Pro101Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.P101S	ENST00000374251.5	37	c.301	CCDS35324.1	X	.	.	.	.	.	.	.	.	.	.	G	15.07	2.724174	0.48728	.	.	ENSG00000204165	ENST00000374251;ENST00000438526	T;T	0.52057	0.8;0.68	4.71	4.71	0.59529	.	0.211539	0.40469	N	0.001087	T	0.58424	0.2121	L	0.42245	1.32	0.37107	D	0.900154	D	0.89917	1.0	D	0.87578	0.998	T	0.62334	-0.6876	10	0.41790	T	0.15	-2.4702	11.9771	0.53098	0.0:0.0:1.0:0.0	.	101	A6NEN9	CX065_HUMAN	S	101	ENSP00000363369:P101S;ENSP00000411354:P101S	ENSP00000363369:P101S	P	-	1	0	CXorf65	70241362	1.000000	0.71417	0.978000	0.43139	0.396000	0.30629	2.822000	0.48073	2.312000	0.78011	0.600000	0.82982	CCG	CXorf65	-	NULL	ENSG00000204165		0.517	CXorf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf65	HGNC	protein_coding	OTTHUMT00000057089.2	309	0.00	0	G	NM_001025265		70324637	70324637	-1	no_errors	ENST00000374251	ensembl	human	known	69_37n	missense	220	20.29	56	SNP	0.985	A
CTAG2	30848	genome.wustl.edu	37	X	153881773	153881773	+	Missense_Mutation	SNP	T	T	C	rs34402964		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:153881773T>C	ENST00000247306.4	-	1	80	c.17A>G	c.(16-18)cAg>cGg	p.Q6R	CTAG2_ENST00000369585.3_Missense_Mutation_p.Q6R	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	6	Gly-rich.		Q -> R (in dbSNP:rs34402964). {ECO:0000269|PubMed:15489334, ECO:0000269|PubMed:17899192, ECO:0000269|PubMed:9626360}.			centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCTGTGCCCTGGCCTTCGGC	0.697													t|||	1726	0.457219	0.6952	0.2435	3775	,	,		5189	0.119		0.1918	False		,,,				2504	0.3323					dbGAP											0													5.0	12.0	10.0					X																	153881773		961	3548	4509	-	-	-	SO:0001583	missense	0			AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.17A>G	X.37:g.153881773T>C	ENSP00000247306:p.Gln6Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	pfam_EKC/KEOPS_Pcc1	p.Q6R	ENST00000247306.4	37	c.17	CCDS14759.1	X	.	.	.	.	.	.	.	.	.	.	t	1.303	-0.604282	0.03717	.	.	ENSG00000126890	ENST00000247306;ENST00000369585	T;T	0.22539	1.95;2.01	2.09	-0.611	0.11601	.	.	.	.	.	T	0.05227	0.0139	N	0.03608	-0.345	0.80722	P	0.0	P;P	0.44344	0.563;0.833	B;B	0.32022	0.044;0.139	T	0.34354	-0.9832	8	0.02654	T	1	.	8.6337	0.33935	0.0:0.0:0.6942:0.3057	rs34402964	6;6	O75638;O75638-2	CTAG2_HUMAN;.	R	6	ENSP00000247306:Q6R;ENSP00000358598:Q6R	ENSP00000247306:Q6R	Q	-	2	0	CTAG2	153534967	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.447000	0.02396	-0.202000	0.10268	-0.721000	0.03606	CAG	CTAG2	-	NULL	ENSG00000126890		0.697	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	CTAG2	HGNC	protein_coding	OTTHUMT00000061176.1	8	0.00	0	T	NM_020994		153881773	153881773	-1	no_errors	ENST00000369585	ensembl	human	known	69_37n	missense	2	66.67	4	SNP	0.001	C
CYP11B2	1585	genome.wustl.edu	37	8	143993470	143993470	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:143993470C>A	ENST00000323110.2	-	9	1440	c.1438G>T	c.(1438-1440)Gac>Tac	p.D480Y		NM_000498.3	NP_000489.3	P19099	C11B2_HUMAN	cytochrome P450, family 11, subfamily B, polypeptide 2	480					aldosterone biosynthetic process (GO:0032342)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|mineralocorticoid biosynthetic process (GO:0006705)|potassium ion homeostasis (GO:0055075)|regulation of blood volume by renal aldosterone (GO:0002017)|renal water homeostasis (GO:0003091)|small molecule metabolic process (GO:0044281)|sodium ion homeostasis (GO:0055078)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	corticosterone 18-monooxygenase activity (GO:0047783)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 11-beta-monooxygenase activity (GO:0004507)			cervix(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(22)|ovary(3)|upper_aerodigestive_tract(3)	39	all_cancers(97;5.56e-11)|all_epithelial(106;2.49e-08)|Lung NSC(106;0.000228)|all_lung(105;0.000633)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)				Eplerenone(DB00700)|Etomidate(DB00292)|Hydrocortisone(DB00741)|Metoclopramide(DB01233)|Metyrapone(DB01011)|Spironolactone(DB00421)	ATCTTTATGTCCTCTTGAGTT	0.547									Familial Hyperaldosteronism type I																													dbGAP											0													206.0	170.0	182.0					8																	143993470		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Dexamethasone Sensitive Aldosteronism, FH-I	X54741	CCDS6393.1	8q21-q22	2013-06-19	2003-01-14		ENSG00000179142	ENSG00000179142	1.14.15.4	"""Cytochrome P450s"""	2592	protein-coding gene	gene with protein product	"""steroid 11-beta-monooxygenase"""	124080	"""cytochrome P450, subfamily XIB (steroid 11-beta-hydroxylase), polypeptide 2"""	CYP11B		1303253	Standard	NM_000498		Approved	CYP11BL, CPN2, P-450C18, P450aldo, ALDOS	uc003yxk.1	P19099	OTTHUMG00000160254	ENST00000323110.2:c.1438G>T	8.37:g.143993470C>A	ENSP00000325822:p.Asp480Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B0ZBE4|Q16726	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_mitochondrial,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450,prints_Cyt_P450_B	p.D480Y	ENST00000323110.2	37	c.1438	CCDS6393.1	8	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726200	0.48833	.	.	ENSG00000179142	ENST00000323110	T	0.71698	-0.59	3.03	3.03	0.35002	.	0.000000	0.48286	D	0.000198	D	0.85418	0.5692	M	0.92412	3.305	0.39314	D	0.965136	D	0.89917	1.0	D	0.91635	0.999	D	0.87894	0.2686	10	0.87932	D	0	.	9.668	0.39996	0.0:1.0:0.0:0.0	.	480	P19099	C11B2_HUMAN	Y	480	ENSP00000325822:D480Y	ENSP00000325822:D480Y	D	-	1	0	CYP11B2	143990472	0.514000	0.26202	0.155000	0.22561	0.004000	0.04260	1.723000	0.38053	1.684000	0.51022	0.563000	0.77884	GAC	CYP11B2	-	pfam_Cyt_P450,superfamily_Cyt_P450	ENSG00000179142		0.547	CYP11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11B2	HGNC	protein_coding	OTTHUMT00000359904.1	290	0.00	0	C			143993470	143993470	-1	no_errors	ENST00000323110	ensembl	human	known	69_37n	missense	152	77.53	528	SNP	0.972	A
DDX24	57062	genome.wustl.edu	37	14	94526604	94526604	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:94526604G>C	ENST00000330836.5	-	5	1884	c.1753C>G	c.(1753-1755)Cag>Gag	p.Q585E	DDX24_ENST00000555054.1_Missense_Mutation_p.Q542E|DDX24_ENST00000544005.1_Missense_Mutation_p.Q335E	NM_020414.3	NP_065147.1	Q9GZR7	DDX24_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 24	585	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				RNA metabolic process (GO:0016070)	membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)|RNA helicase activity (GO:0003724)			cervix(3)|endometrium(4)|kidney(4)|large_intestine(5)|lung(3)|ovary(2)|skin(1)|urinary_tract(1)	23		all_cancers(154;0.12)		Epithelial(152;0.114)|all cancers(159;0.19)|COAD - Colon adenocarcinoma(157;0.207)		CCTGGATACTGCATCAGGAAG	0.498																																						dbGAP											0													165.0	144.0	151.0					14																	94526604		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF214731	CCDS9918.1	14q32	2013-07-16	2013-07-16			ENSG00000089737		"""DEAD-boxes"""	13266	protein-coding gene	gene with protein product		606181	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 24"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 24"""			10936056, 18289627	Standard	NM_020414		Approved		uc001ycj.3	Q9GZR7		ENST00000330836.5:c.1753C>G	14.37:g.94526604G>C	ENSP00000328690:p.Gln585Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EMJ4|Q4V9L5	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.Q585E	ENST00000330836.5	37	c.1753	CCDS9918.1	14	.	.	.	.	.	.	.	.	.	.	G	22.1	4.240723	0.79912	.	.	ENSG00000089737	ENST00000330836;ENST00000544005;ENST00000440370;ENST00000543787;ENST00000555054;ENST00000542247	T;T;T	0.04194	3.68;3.68;3.68	5.74	4.84	0.62591	Helicase, C-terminal (1);	0.109289	0.64402	D	0.000005	T	0.02848	0.0085	N	0.04805	-0.155	0.42635	D	0.993392	B	0.32526	0.374	B	0.24394	0.053	T	0.58555	-0.7616	10	0.23891	T	0.37	-9.8535	16.3465	0.83134	0.0:0.0:0.8667:0.1332	.	585	Q9GZR7	DDX24_HUMAN	E	585;335;530;211;542;542	ENSP00000328690:Q585E;ENSP00000440623:Q335E;ENSP00000452145:Q542E	ENSP00000328690:Q585E	Q	-	1	0	DDX24	93596357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	1.531000	0.49152	0.563000	0.77884	CAG	DDX24	-	pfscan_Helicase_C	ENSG00000089737		0.498	DDX24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX24	HGNC	protein_coding	OTTHUMT00000412861.1	249	0.00	0	G	NM_020414		94526604	94526604	-1	no_errors	ENST00000330836	ensembl	human	known	69_37n	missense	286	14.37	48	SNP	1.000	C
DDX58	23586	genome.wustl.edu	37	9	32491384	32491384	+	Silent	SNP	A	A	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:32491384A>G	ENST00000379883.2	-	5	763	c.606T>C	c.(604-606)gaT>gaC	p.D202D	DDX58_ENST00000379868.1_5'UTR|DDX58_ENST00000542096.1_Silent_p.D131D|DDX58_ENST00000379882.1_Silent_p.D157D|DDX58_ENST00000545044.1_5'UTR	NM_014314.3	NP_055129.2	O95786	DDX58_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 58	202					cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell migration (GO:0030334)|regulation of type III interferon production (GO:0034344)|response to exogenous dsRNA (GO:0043330)|response to virus (GO:0009615)|RIG-I signaling pathway (GO:0039529)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)	ATP binding (GO:0005524)|double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|identical protein binding (GO:0042802)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|liver(1)|lung(9)|ovary(2)|pancreas(1)|prostate(1)	27			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;0.00056)		TTTCCATCTTATCCTCAAGAT	0.343																																						dbGAP											0													98.0	92.0	94.0					9																	32491384		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038963	CCDS6526.1	9p12	2011-08-05			ENSG00000107201	ENSG00000107201		"""DEAD-boxes"""	19102	protein-coding gene	gene with protein product	"""RNA helicase RIG-I"", ""retinoic acid inducible gene I"""	609631				21690088	Standard	NM_014314		Approved	RIG-I, FLJ13599, DKFZp434J1111	uc003zra.3	O95786	OTTHUMG00000019746	ENST00000379883.2:c.606T>C	9.37:g.32491384A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU81|Q5HYE1|Q5VYT1|Q9NT04	Silent	SNP	pfam_RIG-I_C-RD,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,pfam_Helicase_C,superfamily_DEATH-like,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D202	ENST00000379883.2	37	c.606	CCDS6526.1	9																																																																																			DDX58	-	NULL	ENSG00000107201		0.343	DDX58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX58	HGNC	protein_coding	OTTHUMT00000052011.1	156	0.00	0	A	NM_014314		32491384	32491384	-1	no_errors	ENST00000379883	ensembl	human	known	69_37n	silent	91	23.33	28	SNP	0.000	G
DEPDC4	120863	genome.wustl.edu	37	12	100660851	100660851	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:100660851C>T	ENST00000416321.1	-	1	6	c.4G>A	c.(4-6)Gtg>Atg	p.V2M	SCYL2_ENST00000360820.2_5'Flank	NM_152317.2	NP_689530.1	Q8N2C3	DEPD4_HUMAN	DEP domain containing 4	2					intracellular signal transduction (GO:0035556)			p.V2L(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(4)|pancreas(1)|urinary_tract(1)	15						TCCCCTGGCACCATAGCCCCG	0.652																																						dbGAP											1	Substitution - Missense(1)	lung(1)											43.0	51.0	48.0					12																	100660851		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090824	CCDS9075.1	12q23	2006-03-30				ENSG00000166153			22952	protein-coding gene	gene with protein product						12477932	Standard	XM_005268628		Approved	DEP.4, FLJ33505	uc001thi.3	Q8N2C3		ENST00000416321.1:c.4G>A	12.37:g.100660851C>T	ENSP00000396234:p.Val2Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q496C8|Q96BW0	Missense_Mutation	SNP	pfam_DEP_dom,smart_DEP_dom,pfscan_DEP_dom	p.V2M	ENST00000416321.1	37	c.4	CCDS9075.1	12	.	.	.	.	.	.	.	.	.	.	c	11.93	1.787107	0.31593	.	.	ENSG00000166153	ENST00000422147;ENST00000378250;ENST00000416321;ENST00000550587;ENST00000549249	T;T;T	0.37752	1.33;1.35;1.18	3.81	1.45	0.22620	.	2.943110	0.01528	U	0.018678	T	0.21590	0.0520	N	0.14661	0.345	0.09310	N	1	P;P;P	0.39782	0.688;0.688;0.688	B;B;B	0.28784	0.094;0.094;0.094	T	0.30851	-0.9964	10	0.87932	D	0	.	7.8554	0.29478	0.0:0.8491:0.0:0.1509	.	2;2;2	E9PGM3;Q3ZCN8;Q8N2C3	.;.;DEPD4_HUMAN	M	2	ENSP00000396234:V2M;ENSP00000448385:V2M;ENSP00000448338:V2M	ENSP00000299185:V2M	V	-	1	0	DEPDC4	99184982	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.317000	0.08060	0.195000	0.20347	0.651000	0.88453	GTG	DEPDC4	-	NULL	ENSG00000166153		0.652	DEPDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEPDC4	HGNC	protein_coding	OTTHUMT00000408482.1	41	0.00	0	C	NM_152317		100660851	100660851	-1	no_errors	ENST00000378244	ensembl	human	known	69_37n	missense	28	28.21	11	SNP	0.001	T
DLG2	1740	genome.wustl.edu	37	11	83984277	83984277	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:83984277G>A	ENST00000418306.2	-	1	46	c.22C>T	c.(22-24)Cgg>Tgg	p.R8W	DLG2_ENST00000376106.3_5'Flank|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000532653.1_Intron|DLG2_ENST00000398301.2_Intron|DLG2_ENST00000398309.2_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000531015.1_Missense_Mutation_p.R8W|DLG2_ENST00000537455.1_5'Flank|DLG2_ENST00000330014.6_5'Flank|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376104.2_Intron	NM_001142700.1	NP_001136172.1	Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 1. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				TTCTCAGCCCGAGAAACACTT	0.378																																						dbGAP											0													33.0	33.0	33.0					11																	83984277		1568	3580	5148	-	-	-	SO:0001583	missense	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000418306.2:c.22C>T	11.37:g.83984277G>A	ENSP00000402275:p.Arg8Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_PDZ_assoc,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.R8W	ENST00000418306.2	37	c.22	CCDS44691.1	11	.	.	.	.	.	.	.	.	.	.	G	15.78	2.933400	0.52866	.	.	ENSG00000150672	ENST00000418306;ENST00000531015	T;T	0.16897	2.43;2.31	6.1	6.1	0.99115	.	.	.	.	.	T	0.15652	0.0377	.	.	.	0.80722	D	1	D;P	0.58620	0.983;0.947	B;B	0.41202	0.35;0.237	T	0.01156	-1.1434	7	.	.	.	.	13.7987	0.63186	0.0:0.1531:0.8469:0.0	.	8;8	E9PIW2;Q15700-3	.;.	W	8	ENSP00000402275:R8W;ENSP00000433848:R8W	.	R	-	1	2	DLG2	83661925	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	3.244000	0.51399	2.902000	0.99343	0.650000	0.86243	CGG	DLG2	-	pirsf_M-assoc_guanylate_kinase	ENSG00000150672		0.378	DLG2-013	KNOWN	basic|CCDS	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000393436.1	63	0.00	0	G	NM_001364		83984277	83984277	-1	no_errors	ENST00000418306	ensembl	human	known	69_37n	missense	73	18.89	17	SNP	0.996	A
DNAJC14	85406	genome.wustl.edu	37	12	56221462	56221462	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:56221462C>T	ENST00000357606.3	-	3	1270	c.981G>A	c.(979-981)ctG>ctA	p.L327L	DNAJC14_ENST00000317287.5_Silent_p.L327L|TMEM198B_ENST00000478241.1_RNA|RP11-762I7.5_ENST00000546837.1_5'Flank|DNAJC14_ENST00000317269.3_Silent_p.L327L			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	327					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						GCAAAGCACCCAGCAGCTTAA	0.547																																						dbGAP											0													84.0	76.0	78.0					12																	56221462		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.981G>A	12.37:g.56221462C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Silent	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.L327	ENST00000357606.3	37	c.981	CCDS8894.1	12																																																																																			DNAJC14	-	NULL	ENSG00000135392		0.547	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC14	HGNC	protein_coding	OTTHUMT00000409095.1	70	0.00	0	C	NM_032364		56221462	56221462	-1	no_errors	ENST00000317269	ensembl	human	known	69_37n	silent	92	18.58	21	SNP	0.997	T
DOK5	55816	genome.wustl.edu	37	20	53260061	53260061	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr20:53260061C>T	ENST00000262593.5	+	7	1150	c.800C>T	c.(799-801)gCc>gTc	p.A267V	DOK5_ENST00000395939.1_Missense_Mutation_p.A159V	NM_018431.3	NP_060901.2	Q9P104	DOK5_HUMAN	docking protein 5	267					MAPK cascade (GO:0000165)|nervous system development (GO:0007399)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)		receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(2)|skin(1)	19			Colorectal(105;0.202)			CCTCGCAGCGCCTACTGGCAG	0.632																																						dbGAP											0													57.0	51.0	53.0					20																	53260061		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF132732	CCDS13446.1, CCDS13447.1	20q13.2	2013-01-10	2002-11-28	2002-11-29	ENSG00000101134	ENSG00000101134		"""Pleckstrin homology (PH) domain containing"""	16173	protein-coding gene	gene with protein product		608334	"""chromosome 20 open reading frame 180"""	C20orf180		11470823	Standard	XM_005260451		Approved	dJ805C22.1	uc002xwy.3	Q9P104	OTTHUMG00000032778	ENST00000262593.5:c.800C>T	20.37:g.53260061C>T	ENSP00000262593:p.Ala267Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7Y0|Q5TE53|Q8TEW7|Q96H13|Q9BZ24|Q9NQF4|Q9Y411	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.A267V	ENST00000262593.5	37	c.800	CCDS13446.1	20	.	.	.	.	.	.	.	.	.	.	C	17.73	3.462067	0.63513	.	.	ENSG00000101134	ENST00000262593;ENST00000395939	D;D	0.93366	-2.23;-3.21	5.29	4.34	0.51931	.	0.107676	0.64402	D	0.000007	D	0.88876	0.6556	L	0.36672	1.1	0.49798	D	0.999829	B;B	0.13145	0.007;0.0	B;B	0.18871	0.023;0.001	D	0.85099	0.0956	10	0.38643	T	0.18	-23.9289	12.4145	0.55486	0.0:0.919:0.0:0.0809	.	159;267	Q9P104-2;Q9P104	.;DOK5_HUMAN	V	267;159	ENSP00000262593:A267V;ENSP00000379270:A159V	ENSP00000262593:A267V	A	+	2	0	DOK5	52693468	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.662000	0.46766	2.464000	0.83262	0.563000	0.77884	GCC	DOK5	-	NULL	ENSG00000101134		0.632	DOK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK5	HGNC	protein_coding	OTTHUMT00000079777.2	45	0.00	0	C			53260061	53260061	+1	no_errors	ENST00000262593	ensembl	human	known	69_37n	missense	26	21.21	7	SNP	1.000	T
DOPEY2	9980	genome.wustl.edu	37	21	37665636	37665636	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr21:37665636G>A	ENST00000399151.3	+	37	6749	c.6664G>A	c.(6664-6666)Gag>Aag	p.E2222K		NM_005128.2	NP_005119.2	Q9Y3R5	DOP2_HUMAN	dopey family member 2	2222					cognition (GO:0050890)|endoplasmic reticulum organization (GO:0007029)|Golgi to endosome transport (GO:0006895)|multicellular organismal development (GO:0007275)|protein transport (GO:0015031)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)				autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(6)|lung(25)|ovary(2)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	58						TAGCTCTGATGAGATCACCAT	0.438																																						dbGAP											0													76.0	74.0	75.0					21																	37665636		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ237839	CCDS13643.1	21q22.2	2013-03-05	2006-02-02	2006-02-02	ENSG00000142197	ENSG00000142197			1291	protein-coding gene	gene with protein product		604803	"""chromosome 21 open reading frame 5"""	C21orf5		16301316, 16303751, 10931277	Standard	NM_005128		Approved	KIAA0933	uc002yvg.3	Q9Y3R5	OTTHUMG00000086619	ENST00000399151.3:c.6664G>A	21.37:g.37665636G>A	ENSP00000382104:p.Glu2222Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSG5|Q6PJQ7|Q9UEZ3	Missense_Mutation	SNP	pfam_Dopey_N	p.E2222K	ENST00000399151.3	37	c.6664	CCDS13643.1	21	.	.	.	.	.	.	.	.	.	.	G	15.20	2.761695	0.49468	.	.	ENSG00000142197	ENST00000399151	T	0.44482	0.92	5.8	4.87	0.63330	.	0.486385	0.22755	N	0.056032	T	0.31389	0.0795	L	0.40543	1.245	0.32141	N	0.58547	B;B	0.27559	0.181;0.113	B;B	0.26693	0.072;0.033	T	0.19582	-1.0301	10	0.06625	T	0.88	.	14.375	0.66867	0.0:0.1475:0.8525:0.0	.	2215;2222	Q9Y3R5-2;Q9Y3R5	.;DOP2_HUMAN	K	2222	ENSP00000382104:E2222K	ENSP00000382104:E2222K	E	+	1	0	DOPEY2	36587506	0.960000	0.32886	0.261000	0.24466	0.729000	0.41735	1.649000	0.37281	2.748000	0.94277	0.655000	0.94253	GAG	DOPEY2	-	NULL	ENSG00000142197		0.438	DOPEY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOPEY2	HGNC	protein_coding	OTTHUMT00000194636.1	121	0.00	0	G	NM_005128		37665636	37665636	+1	no_errors	ENST00000399151	ensembl	human	known	69_37n	missense	78	15.22	14	SNP	0.706	A
ECM2	1842	genome.wustl.edu	37	9	95263288	95263288	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:95263288G>A	ENST00000344604.5	-	9	1801	c.1652C>T	c.(1651-1653)cCg>cTg	p.P551L	CENPP_ENST00000375587.3_Intron|ECM2_ENST00000444490.2_Missense_Mutation_p.P529L	NM_001197295.1|NM_001393.3	NP_001184224.1|NP_001384.1	O94769	ECM2_HUMAN	extracellular matrix protein 2, female organ and adipocyte specific	551					cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	27						TAGATAGGACGGGACGTGATA	0.478																																						dbGAP											0													141.0	129.0	133.0					9																	95263288		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011792	CCDS6698.1, CCDS56578.1	9q22.3	2008-07-21			ENSG00000106823	ENSG00000106823			3154	protein-coding gene	gene with protein product	"""matrix glycoprotein SC1/ECM2"""	603479				9790758	Standard	NM_001393		Approved		uc011lty.2	O94769	OTTHUMG00000020226	ENST00000344604.5:c.1652C>T	9.37:g.95263288G>A	ENSP00000344758:p.Pro551Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R730|E2PU11|Q5T9F2|Q7Z3D0	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_VWF_C,smart_VWF_C,smart_Leu-rich_rpt_typical-subtyp,pfscan_VWF_C	p.P551L	ENST00000344604.5	37	c.1652	CCDS6698.1	9	.	.	.	.	.	.	.	.	.	.	G	21.3	4.135490	0.77662	.	.	ENSG00000106823	ENST00000444490;ENST00000344604	T;T	0.34859	1.34;5.34	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.73164	0.3552	H	0.95574	3.69	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.81786	-0.0773	10	0.87932	D	0	.	19.4519	0.94871	0.0:0.0:1.0:0.0	.	551;529;529	O94769;B4DK93;O94769-2	ECM2_HUMAN;.;.	L	529;551	ENSP00000393971:P529L;ENSP00000344758:P551L	ENSP00000344758:P551L	P	-	2	0	ECM2	94303109	1.000000	0.71417	0.991000	0.47740	0.827000	0.46813	9.434000	0.97515	2.676000	0.91093	0.591000	0.81541	CCG	ECM2	-	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	ENSG00000106823		0.478	ECM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECM2	HGNC	protein_coding	OTTHUMT00000053091.1	247	0.40	1	G	NM_001393		95263288	95263288	-1	no_errors	ENST00000344604	ensembl	human	known	69_37n	missense	178	20.89	47	SNP	1.000	A
EGFL6	25975	genome.wustl.edu	37	X	13636126	13636126	+	Silent	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:13636126C>A	ENST00000361306.1	+	8	1313	c.1056C>A	c.(1054-1056)gcC>gcA	p.A352A	EGFL6_ENST00000380602.3_Silent_p.A352A	NM_001167890.1|NM_015507.3	NP_001161362.1|NP_056322.2	Q8IUX8	EGFL6_HUMAN	EGF-like-domain, multiple 6	352					cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cell differentiation (GO:0030154)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|extracellular space (GO:0005615)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)			breast(2)|endometrium(2)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)|skin(3)	23						AAGAGAAAGCCCTGAAGAATG	0.388																																						dbGAP											0													51.0	54.0	53.0					X																	13636126		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF186084	CCDS14155.1, CCDS55370.1	Xp22	2008-02-05	2002-10-09		ENSG00000198759	ENSG00000198759			3235	protein-coding gene	gene with protein product		300239	"""MAM and EGF domain containing"""	MAEG		10610727	Standard	NM_015507		Approved		uc004cvj.3	Q8IUX8	OTTHUMG00000021155	ENST00000361306.1:c.1056C>A	X.37:g.13636126C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCB1|Q6UXJ1|Q8NBV0|Q8WYG3|Q9NY67|Q9NZL7|Q9UFK6	Silent	SNP	pfam_MAM_dom,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,superfamily_ConA-like_lec_gl,smart_EGF-like,smart_EGF-like_Ca-bd,smart_MAM_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.A352	ENST00000361306.1	37	c.1056	CCDS14155.1	X																																																																																			EGFL6	-	NULL	ENSG00000198759		0.388	EGFL6-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	EGFL6	HGNC	protein_coding	OTTHUMT00000055800.1	33	0.00	0	C	NM_015507		13636126	13636126	+1	no_errors	ENST00000380602	ensembl	human	known	69_37n	silent	55	25.68	19	SNP	0.074	A
ELL3	80237	genome.wustl.edu	37	15	44066875	44066875	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr15:44066875C>T	ENST00000319359.3	-	7	1383	c.742G>A	c.(742-744)Gat>Aat	p.D248N	SERF2_ENST00000381359.1_5'Flank|RP11-296A16.1_ENST00000417761.2_3'UTR|ELL3_ENST00000497465.1_5'UTR	NM_025165.2	NP_079441.1	Q9HB65	ELL3_HUMAN	elongation factor RNA polymerase II-like 3	248					DNA-templated transcription, elongation (GO:0006354)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of neural precursor cell proliferation (GO:2000179)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of epithelial to mesenchymal transition (GO:0010717)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)	nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	enhancer binding (GO:0035326)			cervix(1)|kidney(1)|large_intestine(5)|lung(4)|ovary(1)|skin(1)	13		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;7.81e-07)		TCTTGTAAATCCTGATTGGTC	0.478																																						dbGAP											0													213.0	202.0	206.0					15																	44066875		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF276512	CCDS10102.1	15q15.1	2008-02-05			ENSG00000128886	ENSG00000128886			23113	protein-coding gene	gene with protein product		609885				10882741	Standard	NM_025165		Approved	FLJ22637	uc001zsw.1	Q9HB65	OTTHUMG00000059936	ENST00000319359.3:c.742G>A	15.37:g.44066875C>T	ENSP00000320346:p.Asp248Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ66|B3KX08|Q6I9Z7|Q9H634	Missense_Mutation	SNP	pfam_RNA_pol_II_elong_fac_ELL,pfam_Occludin_RNApol2_elong_fac_ELL	p.D248N	ENST00000319359.3	37	c.742	CCDS10102.1	15	.	.	.	.	.	.	.	.	.	.	C	12.63	1.996931	0.35226	.	.	ENSG00000128886	ENST00000319359	T	0.35421	1.31	4.71	2.82	0.32997	.	0.201753	0.35677	N	0.003058	T	0.30230	0.0758	L	0.52759	1.655	0.37462	D	0.915253	B;B;B	0.20052	0.023;0.023;0.041	B;B;B	0.23419	0.032;0.032;0.046	T	0.16630	-1.0396	10	0.46703	T	0.11	-0.9008	7.3021	0.26426	0.0:0.7985:0.0:0.2015	.	248;248;202	B3KX08;Q9HB65;B3KQ66	.;ELL3_HUMAN;.	N	248	ENSP00000320346:D248N	ENSP00000320346:D248N	D	-	1	0	ELL3	41854167	0.384000	0.25164	0.993000	0.49108	0.665000	0.39181	0.150000	0.16263	0.704000	0.31869	0.462000	0.41574	GAT	ELL3	-	NULL	ENSG00000128886		0.478	ELL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELL3	HGNC	protein_coding	OTTHUMT00000133236.2	502	0.00	0	C	NM_025165		44066875	44066875	-1	no_errors	ENST00000319359	ensembl	human	known	69_37n	missense	285	19.72	70	SNP	0.990	T
EMR3	84658	genome.wustl.edu	37	19	14748956	14748956	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:14748956G>A	ENST00000253673.5	-	11	1545	c.1445C>T	c.(1444-1446)tCt>tTt	p.S482F	EMR3_ENST00000443157.2_Missense_Mutation_p.S356F|EMR3_ENST00000599900.1_Missense_Mutation_p.S267F|EMR3_ENST00000344373.4_Missense_Mutation_p.S430F	NM_032571.3	NP_115960.2	Q9BY15	EMR3_HUMAN	egf-like module containing, mucin-like, hormone receptor-like 3	482					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(14)|ovary(7)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	50						GGAGGCTGCAGAAATGGCCAC	0.512																																						dbGAP											0													147.0	121.0	130.0					19																	14748956		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF239764	CCDS12315.1, CCDS74296.1, CCDS74297.1	19p13.1	2014-08-08				ENSG00000131355		"""-"", ""GPCR / Class B : Orphans"""	23647	protein-coding gene	gene with protein product		606101				11279179, 12975309	Standard	XM_005260118		Approved		uc002mzi.4	Q9BY15		ENST00000253673.5:c.1445C>T	19.37:g.14748956G>A	ENSP00000253673:p.Ser482Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_Ca-bd,smart_EGF-like,smart_EGF-like_Ca-bd,smart_GPS_dom,pfscan_EG-like_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt,prints_GPCR_2_secretin-like,prints_GPCR_2_CD97	p.S482F	ENST00000253673.5	37	c.1445	CCDS12315.1	19	.	.	.	.	.	.	.	.	.	.	G	16.89	3.246791	0.59103	.	.	ENSG00000131355	ENST00000443157;ENST00000253673;ENST00000344373	T;T;T	0.48201	0.82;0.82;0.82	4.34	3.27	0.37495	GPCR, family 2-like (1);	.	.	.	.	T	0.70334	0.3212	M	0.88704	2.975	0.35034	D	0.759096	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.91635	0.99;0.999;0.986	T	0.80086	-0.1529	9	0.87932	D	0	.	10.4395	0.44457	0.1:0.0:0.9:0.0	.	356;430;482	E7EW83;Q9BY15-2;Q9BY15	.;.;EMR3_HUMAN	F	356;482;430	ENSP00000396208:S356F;ENSP00000253673:S482F;ENSP00000340758:S430F	ENSP00000253673:S482F	S	-	2	0	EMR3	14609956	1.000000	0.71417	0.743000	0.31040	0.614000	0.37383	7.652000	0.83633	2.245000	0.73994	0.650000	0.86243	TCT	EMR3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_EMR1_rcpt	ENSG00000131355		0.512	EMR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMR3	HGNC	protein_coding	OTTHUMT00000466488.1	140	0.00	0	G	NM_032571		14748956	14748956	-1	no_errors	ENST00000253673	ensembl	human	known	69_37n	missense	89	11.88	12	SNP	0.938	A
ERN2	10595	genome.wustl.edu	37	16	23722313	23722313	+	Silent	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr16:23722313G>C	ENST00000457008.2	-	2	158	c.120C>G	c.(118-120)ctC>ctG	p.L40L	CTD-2385L22.1_ENST00000563611.1_RNA|ERN2_ENST00000256797.4_Silent_p.L88L					endoplasmic reticulum to nucleus signaling 2											large_intestine(2)|lung(2)|ovary(2)	6				GBM - Glioblastoma multiforme(48;0.0156)		ACACCAGCAGGAGGTTCTCTG	0.582																																						dbGAP											0													111.0	101.0	104.0					16																	23722313		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			AA527544	CCDS32407.1	16p12.2	2008-02-05	2007-08-14			ENSG00000134398			16942	protein-coding gene	gene with protein product		604034	"""ER to nucleus signalling 2"""			9755171, 11175748	Standard	NM_033266		Approved	IRE1b	uc002dma.4	Q76MJ5		ENST00000457008.2:c.120C>G	16.37:g.23722313G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S68C	ENST00000457008.2	37	c.203		16																																																																																			ERN2	-	NULL	ENSG00000134398		0.582	ERN2-002	NOVEL	basic|exp_conf	protein_coding	ERN2	HGNC	protein_coding	OTTHUMT00000434886.1	151	0.00	0	G			23722313	23722313	-1	no_errors	ENST00000569903	ensembl	human	known	69_37n	missense	86	18.10	19	SNP	0.999	C
ESYT3	83850	genome.wustl.edu	37	3	138180987	138180987	+	Missense_Mutation	SNP	G	G	A	rs557407338		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:138180987G>A	ENST00000389567.4	+	8	1040	c.854G>A	c.(853-855)cGt>cAt	p.R285H	ESYT3_ENST00000289135.4_Missense_Mutation_p.R285H	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	285	Glycerophospholipid-binding barrel-like domain. {ECO:0000250}.				lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						CTGCCCAACCGTGTGACTGTG	0.602																																						dbGAP											0													186.0	134.0	152.0					3																	138180987		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.854G>A	3.37:g.138180987G>A	ENSP00000374218:p.Arg285His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.R285H	ENST00000389567.4	37	c.854	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	G	28.2	4.897396	0.91962	.	.	ENSG00000158220	ENST00000389567;ENST00000289135	T;T	0.26373	1.74;1.74	4.65	4.65	0.58169	.	0.000000	0.85682	D	0.000000	T	0.48732	0.1516	M	0.66439	2.03	0.52501	D	0.999951	D	0.89917	1.0	D	0.72075	0.976	T	0.51434	-0.8706	10	0.87932	D	0	-18.8594	15.0556	0.71910	0.0:0.0:1.0:0.0	.	285	A0FGR9	ESYT3_HUMAN	H	285	ENSP00000374218:R285H;ENSP00000289135:R285H	ENSP00000289135:R285H	R	+	2	0	ESYT3	139663677	1.000000	0.71417	0.998000	0.56505	0.957000	0.61999	8.605000	0.90883	2.419000	0.82065	0.555000	0.69702	CGT	ESYT3	-	NULL	ENSG00000158220		0.602	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	253	0.00	0	G	NM_031913		138180987	138180987	+1	no_errors	ENST00000389567	ensembl	human	known	69_37n	missense	120	16.67	24	SNP	1.000	A
EXOC7	23265	genome.wustl.edu	37	17	74084623	74084623	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr17:74084623C>G	ENST00000335146.7	-	11	1427	c.1374G>C	c.(1372-1374)aaG>aaC	p.K458N	EXOC7_ENST00000607838.1_Missense_Mutation_p.K430N|EXOC7_ENST00000589210.1_Missense_Mutation_p.K407N|EXOC7_ENST00000411744.2_Missense_Mutation_p.K399N|EXOC7_ENST00000332065.5_Missense_Mutation_p.K376N|EXOC7_ENST00000467929.2_Missense_Mutation_p.K366N|EXOC7_ENST00000405575.4_Missense_Mutation_p.K430N			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	458					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			GCAGCTTGTTCTTTGTGCTGG	0.602																																						dbGAP											0													107.0	81.0	90.0					17																	74084623		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.1374G>C	17.37:g.74084623C>G	ENSP00000334100:p.Lys458Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Missense_Mutation	SNP	pfam_Exo70,superfamily_Cullin_repeat-like_dom	p.K458N	ENST00000335146.7	37	c.1374	CCDS45782.1	17	.	.	.	.	.	.	.	.	.	.	C	22.4	4.283133	0.80803	.	.	ENSG00000182473	ENST00000332065;ENST00000351709;ENST00000405575;ENST00000335146;ENST00000357231;ENST00000425372;ENST00000411744	.	.	.	5.41	4.44	0.53790	Cullin repeat-like-containing domain (1);	0.098210	0.64402	D	0.000002	T	0.64649	0.2617	L	0.50333	1.59	0.80722	D	1	P;P;P;P;D;D;D	0.61697	0.953;0.642;0.866;0.842;0.99;0.963;0.957	P;B;P;P;P;P;P	0.58660	0.553;0.208;0.809;0.472;0.843;0.798;0.654	T	0.66536	-0.5899	9	0.62326	D	0.03	-31.5368	11.0368	0.47806	0.0:0.8504:0.0:0.1496	.	399;430;366;366;458;376;407	Q9UPT5-5;Q9UPT5-6;B4DJ07;F5H1P1;Q9UPT5;Q9UPT5-2;Q9UPT5-1	.;.;.;.;EXOC7_HUMAN;.;.	N	376;296;430;458;407;366;399	.	ENSP00000333806:K376N	K	-	3	2	EXOC7	71596218	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	2.491000	0.45303	1.274000	0.44362	0.655000	0.94253	AAG	EXOC7	-	pfam_Exo70,superfamily_Cullin_repeat-like_dom	ENSG00000182473		0.602	EXOC7-006	KNOWN	basic|CCDS	protein_coding	EXOC7	HGNC	protein_coding	OTTHUMT00000319768.2	154	0.00	0	C	NM_015219		74084623	74084623	-1	no_errors	ENST00000335146	ensembl	human	known	69_37n	missense	92	27.56	35	SNP	1.000	G
FAM111B	374393	genome.wustl.edu	37	11	58892505	58892506	+	Frame_Shift_Del	DEL	GA	GA	-			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	GA	GA					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:58892505_58892506delGA	ENST00000343597.3	+	4	1126_1127	c.935_936delGA	c.(934-936)ggafs	p.G312fs	FAM111B_ENST00000529618.1_Frame_Shift_Del_p.G282fs|FAM111B_ENST00000411426.1_Frame_Shift_Del_p.G282fs	NM_198947.3	NP_945185.1	Q6SJ93	F111B_HUMAN	family with sequence similarity 111, member B	312							catalytic activity (GO:0003824)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(12)|ovary(3)|pancreas(1)|skin(1)	40						AAGAAAGATGGAGAGACCAAAG	0.366																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			BC062456	CCDS7972.1, CCDS44611.1	11q12.1	2014-03-13			ENSG00000189057	ENSG00000189057			24200	protein-coding gene	gene with protein product		615584				24268661	Standard	NM_198947		Approved	CANP	uc001nnl.3	Q6SJ93	OTTHUMG00000167279	ENST00000343597.3:c.935_936delGA	11.37:g.58892509_58892510delGA	ENSP00000341565:p.Gly312fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E2G2|Q6P661	Frame_Shift_Del	DEL	superfamily_Pept_cys/ser_Trypsin-like	p.E313fs	ENST00000343597.3	37	c.935_936	CCDS7972.1	11																																																																																			FAM111B	-	NULL	ENSG00000189057		0.366	FAM111B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM111B	HGNC	protein_coding	OTTHUMT00000393974.1	36	0.00	0	GA	NM_198947		58892505	58892506	+1	no_errors	ENST00000343597	ensembl	human	known	69_37n	frame_shift_del	110	12.00	15	DEL	0.000:0.000	-
FAM218A	152756	genome.wustl.edu	37	4	165878596	165878596	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:165878596G>C	ENST00000513876.2	+	1	497	c.422G>C	c.(421-423)aGa>aCa	p.R141T	TRIM61_ENST00000329314.5_Intron	NM_153027.1	NP_694572.1	Q96MZ4	F218A_HUMAN	family with sequence similarity 218, member A	141																	ACAAGGACTAGAGGGTTTGGG	0.557																																						dbGAP											0													69.0	70.0	70.0					4																	165878596		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK056221	CCDS3807.1	4q32.3	2012-03-01	2012-03-01	2012-03-01	ENSG00000250486	ENSG00000250486			26466	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 39"""	C4orf39		12477932	Standard	NM_153027		Approved	FLJ31659	uc003iqx.1	Q96MZ4	OTTHUMG00000161252	ENST00000513876.2:c.422G>C	4.37:g.165878596G>C	ENSP00000427428:p.Arg141Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.R141T	ENST00000513876.2	37	c.422	CCDS3807.1	4	.	.	.	.	.	.	.	.	.	.	g	0.921	-0.715708	0.03206	.	.	ENSG00000250486	ENST00000513876	T	0.55588	0.51	1.24	0.34	0.15985	.	.	.	.	.	T	0.27765	0.0683	N	0.08118	0	0.09310	N	1	B	0.12630	0.006	B	0.06405	0.002	T	0.19679	-1.0298	9	0.87932	D	0	.	3.8113	0.08798	0.2555:0.0:0.7445:0.0	.	141	Q96MZ4	CD039_HUMAN	T	141	ENSP00000427428:R141T	ENSP00000427428:R141T	R	+	2	0	C4orf39	166098046	0.000000	0.05858	0.034000	0.17996	0.024000	0.10985	-1.833000	0.01695	0.092000	0.17331	-1.201000	0.01664	AGA	FAM218A	-	NULL	ENSG00000250486		0.557	FAM218A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM218A	HGNC	protein_coding	OTTHUMT00000364308.1	146	0.68	1	G	NM_153027		165878596	165878596	+1	no_errors	ENST00000513876	ensembl	human	known	69_37n	missense	66	20.48	17	SNP	0.047	C
FAP	2191	genome.wustl.edu	37	2	163072487	163072487	+	Missense_Mutation	SNP	G	G	C	rs373219307		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr2:163072487G>C	ENST00000188790.4	-	10	994	c.787C>G	c.(787-789)Cgg>Ggg	p.R263G	FAP_ENST00000443424.1_Missense_Mutation_p.R238G	NM_004460.2	NP_004451.2			fibroblast activation protein, alpha									p.R263W(1)		NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(5)|lung(34)|ovary(4)|prostate(3)|skin(2)|upper_aerodigestive_tract(4)	63						ATAAATATCCGAACAACGGGA	0.398																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											75.0	75.0	75.0					2																	163072487		2203	4300	6503	-	-	-	SO:0001583	missense	0			U09278	CCDS33311.1	2q23	2008-02-05			ENSG00000078098	ENSG00000078098			3590	protein-coding gene	gene with protein product	"""seprase"""	600403				9247085, 14707457	Standard	NM_004460		Approved	DPPIV	uc002ucd.3	Q12884	OTTHUMG00000153890	ENST00000188790.4:c.787C>G	2.37:g.163072487G>C	ENSP00000188790:p.Arg263Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_S9B,pfam_Peptidase_S9	p.R263G	ENST00000188790.4	37	c.787	CCDS33311.1	2	.	.	.	.	.	.	.	.	.	.	G	21.0	4.082756	0.76528	.	.	ENSG00000078098	ENST00000188790;ENST00000443424	T;T	0.31510	1.49;1.49	5.63	4.68	0.58851	Peptidase S9B, dipeptidylpeptidase IV N-terminal (1);	0.127442	0.56097	D	0.000024	T	0.33904	0.0879	L	0.51422	1.61	0.42632	D	0.993387	B;P;P	0.41947	0.053;0.766;0.766	B;B;P	0.46320	0.078;0.41;0.512	T	0.03473	-1.1033	10	0.40728	T	0.16	-9.8977	11.0785	0.48047	0.0:0.0:0.6107:0.3893	.	238;263;263	B4DLR2;B2RD89;Q12884	.;.;SEPR_HUMAN	G	263;238	ENSP00000188790:R263G;ENSP00000411391:R238G	ENSP00000188790:R263G	R	-	1	2	FAP	162780733	1.000000	0.71417	0.997000	0.53966	0.978000	0.69477	4.451000	0.60047	2.665000	0.90641	0.655000	0.94253	CGG	FAP	-	pfam_Peptidase_S9B	ENSG00000078098		0.398	FAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAP	HGNC	protein_coding	OTTHUMT00000332852.2	109	0.00	0	G			163072487	163072487	-1	no_errors	ENST00000188790	ensembl	human	known	69_37n	missense	77	18.95	18	SNP	0.999	C
FLG2	388698	genome.wustl.edu	37	1	152326999	152326999	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:152326999C>A	ENST00000388718.5	-	3	3335	c.3263G>T	c.(3262-3264)gGc>gTc	p.G1088V	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1088	Ser-rich.				establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)	p.G1088D(1)		NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TTGACCATAGCCAGATGATTG	0.498																																						dbGAP											1	Substitution - Missense(1)	prostate(1)											321.0	323.0	322.0					1																	152326999		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.3263G>T	1.37:g.152326999C>A	ENSP00000373370:p.Gly1088Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.G1088V	ENST00000388718.5	37	c.3263	CCDS30861.1	1	.	.	.	.	.	.	.	.	.	.	C	5.584	0.292613	0.10567	.	.	ENSG00000143520	ENST00000388718	T	0.21543	2.0	3.6	0.479	0.16796	.	.	.	.	.	T	0.04497	0.0123	L	0.46157	1.445	0.09310	N	1	B	0.30193	0.272	B	0.17722	0.019	T	0.37979	-0.9682	9	0.25751	T	0.34	2.797	3.936	0.09305	0.0:0.5591:0.1998:0.2411	.	1088	Q5D862	FILA2_HUMAN	V	1088	ENSP00000373370:G1088V	ENSP00000373370:G1088V	G	-	2	0	FLG2	150593623	0.009000	0.17119	0.000000	0.03702	0.003000	0.03518	0.259000	0.18405	0.221000	0.20879	0.558000	0.71614	GGC	FLG2	-	NULL	ENSG00000143520		0.498	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	449	0.00	0	C	NM_001014342		152326999	152326999	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	missense	313	28.70	126	SNP	0.000	A
FLNC	2318	genome.wustl.edu	37	7	128480154	128480154	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:128480154T>C	ENST00000325888.8	+	9	1750	c.1489T>C	c.(1489-1491)Ttc>Ctc	p.F497L	FLNC_ENST00000346177.6_Missense_Mutation_p.F497L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	497					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GGTGGCTGACTTCAAGGTGTT	0.652																																						dbGAP											0													104.0	116.0	112.0					7																	128480154		2036	4171	6207	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.1489T>C	7.37:g.128480154T>C	ENSP00000327145:p.Phe497Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.F497L	ENST00000325888.8	37	c.1489	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	T	36	5.711514	0.96821	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.93307	-3.2;-3.2	5.5	5.5	0.81552	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97607	0.9216	H	0.94582	3.555	0.58432	D	0.999996	D;P	0.64830	0.994;0.9	D;P	0.79108	0.992;0.619	D	0.98693	1.0697	10	0.72032	D	0.01	.	15.6065	0.76676	0.0:0.0:0.0:1.0	.	497;497	Q14315-2;Q14315	.;FLNC_HUMAN	L	497	ENSP00000327145:F497L;ENSP00000344002:F497L	ENSP00000327145:F497L	F	+	1	0	FLNC	128267390	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	8.013000	0.88655	2.088000	0.63022	0.459000	0.35465	TTC	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.652	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	168	0.59	1	T			128480154	128480154	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	154	14.44	26	SNP	1.000	C
FOSL2	2355	genome.wustl.edu	37	2	28635012	28635012	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr2:28635012G>A	ENST00000264716.4	+	4	1541	c.678G>A	c.(676-678)ctG>ctA	p.L226L	FOSL2_ENST00000545753.1_Silent_p.L187L|FOSL2_ENST00000379619.1_Silent_p.L218L	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	226					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					AGGAGCCCCTGGAAGAGGACA	0.682																																						dbGAP											0													34.0	37.0	36.0					2																	28635012		2202	4295	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.678G>A	2.37:g.28635012G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD58|B3KP27|B4DYV4|Q6FG46	Silent	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.L226	ENST00000264716.4	37	c.678	CCDS1766.1	2																																																																																			FOSL2	-	NULL	ENSG00000075426		0.682	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSL2	HGNC	protein_coding	OTTHUMT00000215116.2	10	0.00	0	G	NM_005253		28635012	28635012	+1	no_errors	ENST00000264716	ensembl	human	known	69_37n	silent	20	25.93	7	SNP	0.754	A
FUK	197258	genome.wustl.edu	37	16	70497598	70497598	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr16:70497598A>C	ENST00000288078.6	+	3	387	c.155A>C	c.(154-156)aAg>aCg	p.K52T	FUK_ENST00000571514.1_Intron|FUK_ENST00000428974.2_Missense_Mutation_p.K52T|FUK_ENST00000378912.2_Missense_Mutation_p.K52T	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	52						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GACCCAGAGAAGCGTGTGGGC	0.642																																						dbGAP											0													37.0	46.0	43.0					16																	70497598		2077	4197	6274	-	-	-	SO:0001583	missense	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.155A>C	16.37:g.70497598A>C	ENSP00000288078:p.Lys52Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Missense_Mutation	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.K52T	ENST00000288078.6	37	c.155	CCDS10891.2	16	.	.	.	.	.	.	.	.	.	.	A	0.085	-1.176506	0.01646	.	.	ENSG00000157353	ENST00000288078;ENST00000378912;ENST00000428974	T;T;T	0.44482	3.34;3.31;0.92	5.05	-5.41	0.02648	.	1.245940	0.05396	N	0.539892	T	0.15955	0.0384	N	0.04132	-0.27	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.18999	-1.0319	10	0.11794	T	0.64	1.0194	5.3244	0.15898	0.2137:0.3487:0.0:0.4376	.	52;52;52	B4DEU5;Q8N0W3-2;Q8N0W3	.;.;FUK_HUMAN	T	52	ENSP00000288078:K52T;ENSP00000368192:K52T;ENSP00000408007:K52T	ENSP00000288078:K52T	K	+	2	0	FUK	69055099	0.000000	0.05858	0.000000	0.03702	0.418000	0.31294	-0.264000	0.08658	-1.310000	0.02312	-0.339000	0.08088	AAG	FUK	-	NULL	ENSG00000157353		0.642	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	40	0.00	0	A	NM_145059		70497598	70497598	+1	no_errors	ENST00000378912	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.004	C
GAPDHS	26330	genome.wustl.edu	37	19	36035879	36035879	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:36035879C>T	ENST00000222286.4	+	10	1241	c.1125C>T	c.(1123-1125)ctC>ctT	p.L375L	AD000090.2_ENST00000589137.1_RNA|AD000090.2_ENST00000588286.1_RNA|AD000090.2_ENST00000590717.1_RNA|AD000090.2_ENST00000444728.1_RNA|TMEM147_ENST00000392205.1_5'Flank|TMEM147_ENST00000392204.2_5'Flank|AD000090.2_ENST00000590125.1_RNA|TMEM147_ENST00000222284.5_5'Flank	NM_014364.4	NP_055179.1	O14556	G3PT_HUMAN	glyceraldehyde-3-phosphate dehydrogenase, spermatogenic	375					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatid development (GO:0007286)	cytosol (GO:0005829)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	glyceraldehyde-3-phosphate dehydrogenase (NAD+) (phosphorylating) activity (GO:0004365)|NAD binding (GO:0051287)|NADP binding (GO:0050661)			endometrium(1)|kidney(1)|large_intestine(1)|lung(8)	11	all_lung(56;1.05e-07)|Lung NSC(56;1.63e-07)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			GCATTGCGCTCAATGACAATT	0.517																																						dbGAP											0													130.0	120.0	124.0					19																	36035879		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ005371	CCDS12465.1	19q13.1	2008-02-05		2005-05-06		ENSG00000105679			24864	protein-coding gene	gene with protein product		609169		GAPDS		10714828	Standard	NM_014364		Approved	GAPDH-2, GAPD2	uc002oaf.1	O14556		ENST00000222286.4:c.1125C>T	19.37:g.36035879C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC82|O60823|Q6JTT9|Q9HCU6	Silent	SNP	pfam_GlycerAld_3-P_DH_cat,pfam_GlycerAld_3-P_DH_NAD(P)-bd,smart_GlycerAld_3-P_DH_NAD(P)-bd,pirsf_GlycerAld/Erythrose_P_DH,prints_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	p.L375	ENST00000222286.4	37	c.1125	CCDS12465.1	19																																																																																			GAPDHS	-	pfam_GlycerAld_3-P_DH_cat,pirsf_GlycerAld/Erythrose_P_DH,tigrfam_Glyceraldehyde-3-P_DH_1	ENSG00000105679		0.517	GAPDHS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAPDHS	HGNC	protein_coding	OTTHUMT00000460423.1	134	0.74	1	C	NM_014364		36035879	36035879	+1	no_errors	ENST00000222286	ensembl	human	known	69_37n	silent	101	20.93	27	SNP	1.000	T
GLRX2	51022	genome.wustl.edu	37	1	193074652	193074652	+	5'Flank	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:193074652C>T	ENST00000367439.3	-	0	0				GLRX2_ENST00000472197.1_Intron|GLRX2_ENST00000367440.3_Silent_p.A39A	NM_197962.2	NP_932066.1	Q9NS18	GLRX2_HUMAN	glutaredoxin 2						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|cell redox homeostasis (GO:0045454)|DNA protection (GO:0042262)|glutathione metabolic process (GO:0006749)|protein folding (GO:0006457)|regulation of signal transduction (GO:0009966)|regulation of transcription, DNA-templated (GO:0006355)|response to hydrogen peroxide (GO:0042542)|response to organic substance (GO:0010033)|response to redox state (GO:0051775)|response to temperature stimulus (GO:0009266)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	2 iron, 2 sulfur cluster binding (GO:0051537)|arsenate reductase (glutaredoxin) activity (GO:0008794)|electron carrier activity (GO:0009055)|glutathione disulfide oxidoreductase activity (GO:0015038)|metal ion binding (GO:0046872)|protein disulfide isomerase activity (GO:0003756)|protein disulfide oxidoreductase activity (GO:0015035)			breast(1)|large_intestine(1)|lung(3)	5					Glutathione(DB00143)	GTCACCTCCTCGCAGCTGAGC	0.736																																						dbGAP											0													19.0	19.0	19.0					1																	193074652		2196	4290	6486	-	-	-	SO:0001631	upstream_gene_variant	0			AF132495	CCDS1380.1, CCDS1381.1	1q31.2	2012-09-20			ENSG00000023572	ENSG00000023572			16065	protein-coding gene	gene with protein product	"""bA101E13.1 (GRX2 glutaredoxin (thioltransferase) 2)"""	606820				11297543	Standard	NM_016066		Approved	GRX2, bA101E13.1	uc001gsz.2	Q9NS18	OTTHUMG00000035677		1.37:g.193074652C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3LR69|Q7L1N7|Q96JC0|Q9Y3D4	Silent	SNP	pfam_Glutaredoxin,superfamily_Thioredoxin-like_fold,prints_Glutaredoxin_subgr,tigrfam_Glutaredoxin_euk/vir	p.A39	ENST00000367439.3	37	c.117	CCDS1381.1	1																																																																																			GLRX2	-	NULL	ENSG00000023572		0.736	GLRX2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GLRX2	HGNC	protein_coding	OTTHUMT00000086699.1	28	0.00	0	C	NM_016066		193074652	193074652	-1	no_errors	ENST00000367440	ensembl	human	known	69_37n	silent	40	14.89	7	SNP	0.001	T
GPRASP2	114928	genome.wustl.edu	37	X	101970776	101970776	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:101970776G>C	ENST00000535209.1	+	4	1810	c.979G>C	c.(979-981)Gaa>Caa	p.E327Q	GPRASP2_ENST00000543253.1_Missense_Mutation_p.E327Q|GPRASP2_ENST00000332262.5_Missense_Mutation_p.E327Q			Q96D09	GASP2_HUMAN	G protein-coupled receptor associated sorting protein 2	327						cytoplasm (GO:0005737)	beta-amyloid binding (GO:0001540)			breast(3)|endometrium(5)|kidney(2)|large_intestine(6)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	30						AGATTGTTTTGAATCTGAGTC	0.438																																						dbGAP											0													105.0	101.0	102.0					X																	101970776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK094646	CCDS14501.1	Xq22.1	2014-03-21			ENSG00000158301	ENSG00000158301		"""Armadillo repeat containing"""	25169	protein-coding gene	gene with protein product						15086532, 16221301	Standard	NM_138437		Approved	GASP2, FLJ37327		Q96D09	OTTHUMG00000022059	ENST00000535209.1:c.979G>C	X.37:g.101970776G>C	ENSP00000437394:p.Glu327Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DXA0|Q8NAB4	Missense_Mutation	SNP	pfam_ARM-rpt_dom,superfamily_ARM-type_fold	p.E327Q	ENST00000535209.1	37	c.979	CCDS14501.1	X	.	.	.	.	.	.	.	.	.	.	G	7.959	0.746657	0.15710	.	.	ENSG00000158301	ENST00000543253;ENST00000535209;ENST00000332262	T;T;T	0.08984	3.03;3.03;3.03	4.2	4.2	0.49525	.	0.000000	0.46442	D	0.000288	T	0.19805	0.0476	L	0.44542	1.39	0.33633	D	0.606311	D	0.76494	0.999	D	0.76071	0.987	T	0.07770	-1.0755	10	0.42905	T	0.14	.	13.4684	0.61268	0.0:0.0:1.0:0.0	.	327	Q96D09	GASP2_HUMAN	Q	327	ENSP00000437872:E327Q;ENSP00000437394:E327Q;ENSP00000339057:E327Q	ENSP00000339057:E327Q	E	+	1	0	GPRASP2	101857432	1.000000	0.71417	0.999000	0.59377	0.242000	0.25591	4.330000	0.59266	2.344000	0.79699	0.600000	0.82982	GAA	GPRASP2	-	NULL	ENSG00000158301		0.438	GPRASP2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRASP2	HGNC	protein_coding	OTTHUMT00000057626.2	128	0.00	0	G	NM_138437		101970776	101970776	+1	no_errors	ENST00000332262	ensembl	human	known	69_37n	missense	103	21.97	29	SNP	0.999	C
GRAMD1A	57655	genome.wustl.edu	37	19	35504261	35504261	+	Silent	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:35504261G>C	ENST00000317991.5	+	8	900	c.708G>C	c.(706-708)ctG>ctC	p.L236L	GRAMD1A_ENST00000504615.2_Intron|GRAMD1A_ENST00000599564.1_Silent_p.L323L|CTD-2527I21.14_ENST00000605640.1_RNA|GRAMD1A_ENST00000411896.2_Silent_p.L229L	NM_020895.3	NP_065946.2	Q96CP6	GRM1A_HUMAN	GRAM domain containing 1A	236						integral component of membrane (GO:0016021)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(1)|lung(10)|prostate(1)|upper_aerodigestive_tract(1)	19	all_lung(56;2.66e-08)|Lung NSC(56;4.13e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			CCTTGCAGCTGAACGGTCTGG	0.627											OREG0025425	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													31.0	34.0	33.0					19																	35504261		2019	4168	6187	-	-	-	SO:0001819	synonymous_variant	0			AK074864	CCDS42546.1, CCDS46046.1	19q13.13	2008-02-05	2005-11-02	2005-11-02		ENSG00000089351			29305	protein-coding gene	gene with protein product			"""KIAA1533"""	KIAA1533		10819331	Standard	NM_020895		Approved	FLJ90346	uc010xse.1	Q96CP6		ENST00000317991.5:c.708G>C	19.37:g.35504261G>C		Somatic	855	WXS	Illumina GAIIx	Phase_IV	A6NKY7|Q8NC77|Q9P1Z5	Silent	SNP	pfam_GRAM,smart_GRAM	p.L236	ENST00000317991.5	37	c.708	CCDS42546.1	19																																																																																			GRAMD1A	-	NULL	ENSG00000089351		0.627	GRAMD1A-003	KNOWN	basic|CCDS	protein_coding	GRAMD1A	HGNC	protein_coding	OTTHUMT00000461557.1	100	0.00	0	G	NM_020895		35504261	35504261	+1	no_errors	ENST00000317991	ensembl	human	known	69_37n	silent	60	17.81	13	SNP	1.000	C
GRB10	2887	genome.wustl.edu	37	7	50680488	50680488	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:50680488C>T	ENST00000401949.1	-	13	1613	c.1144G>A	c.(1144-1146)Gag>Aag	p.E382K	GRB10_ENST00000398812.2_Missense_Mutation_p.E382K|GRB10_ENST00000402578.1_Missense_Mutation_p.E324K|GRB10_ENST00000439599.1_Missense_Mutation_p.E376K|GRB10_ENST00000357271.5_Missense_Mutation_p.E336K|GRB10_ENST00000335866.3_Missense_Mutation_p.E324K|GRB10_ENST00000406641.1_Missense_Mutation_p.E324K|GRB10_ENST00000407526.1_Missense_Mutation_p.E324K|GRB10_ENST00000402497.1_Missense_Mutation_p.E324K|GRB10_ENST00000403097.1_Missense_Mutation_p.E376K|GRB10_ENST00000398810.2_Missense_Mutation_p.E324K			Q13322	GRB10_HUMAN	growth factor receptor-bound protein 10	382	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				insulin receptor signaling pathway (GO:0008286)|insulin-like growth factor receptor signaling pathway (GO:0048009)|negative regulation of glucose import (GO:0046325)|negative regulation of glycogen biosynthetic process (GO:0045719)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of phosphorylation (GO:0042326)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of phosphorylation (GO:0042327)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|response to insulin (GO:0032868)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	insulin receptor binding (GO:0005158)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(19)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	41	Glioma(55;0.08)|all_neural(89;0.245)					TGCTCGTCCTCTGCACAGAGC	0.468									Russell-Silver syndrome																													dbGAP											0													117.0	123.0	121.0					7																	50680488		2152	4256	6408	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Silver-Russell Dwarfism, Silver-Russell syndrome, SRS, Russel-Silver Dwarfism		CCDS43582.1, CCDS43583.1, CCDS47586.1	7p12.2	2013-02-14			ENSG00000106070	ENSG00000106070		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	4564	protein-coding gene	gene with protein product		601523					Standard	NM_005311		Approved		uc003tpi.2	Q13322	OTTHUMG00000150622	ENST00000401949.1:c.1144G>A	7.37:g.50680488C>T	ENSP00000385770:p.Glu382Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D258|A7VJ95|A8K0E6|D3DVM9|O00427|O00701|O75222|Q92606|Q92907|Q92948	Missense_Mutation	SNP	pfam_BPS-dom,pfam_SH2,pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,smart_SH2,pfscan_Pleckstrin_homology,pfscan_Ras-assoc,pfscan_SH2,prints_SH2	p.E382K	ENST00000401949.1	37	c.1144	CCDS43582.1	7	.	.	.	.	.	.	.	.	.	.	C	20.8	4.057303	0.76074	.	.	ENSG00000106070	ENST00000398812;ENST00000439599;ENST00000335866;ENST00000398810;ENST00000402578;ENST00000403097;ENST00000406641;ENST00000357271;ENST00000407526;ENST00000401949;ENST00000402497	T;T;T;T;T;T;T;T;T;T;T	0.78246	-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;-1.16;2.14;-1.16;-1.16;-1.16	5.19	5.19	0.71726	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.046795	0.85682	D	0.000000	D	0.89846	0.6833	M	0.86740	2.835	0.80722	D	1	D;D;D	0.89917	0.991;1.0;0.993	D;D;D	0.76071	0.949;0.987;0.97	D	0.91608	0.5300	10	0.87932	D	0	-39.8392	18.7018	0.91623	0.0:1.0:0.0:0.0	.	376;336;382	Q13322-4;Q13322-2;Q13322	.;.;GRB10_HUMAN	K	382;376;324;324;324;376;324;336;324;382;324	ENSP00000381793:E382K;ENSP00000406716:E376K;ENSP00000338543:E324K;ENSP00000381790:E324K;ENSP00000385189:E324K;ENSP00000385544:E376K;ENSP00000385366:E324K;ENSP00000349818:E336K;ENSP00000385046:E324K;ENSP00000385770:E382K;ENSP00000385748:E324K	ENSP00000338543:E324K	E	-	1	0	GRB10	50647982	1.000000	0.71417	0.273000	0.24645	0.051000	0.14879	7.813000	0.86123	2.414000	0.81942	0.655000	0.94253	GAG	GRB10	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000106070		0.468	GRB10-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GRB10	HGNC	protein_coding	OTTHUMT00000319157.1	320	0.00	0	C			50680488	50680488	-1	no_errors	ENST00000398812	ensembl	human	known	69_37n	missense	247	15.12	44	SNP	1.000	T
HAND2	9464	genome.wustl.edu	37	4	174450130	174450130	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:174450130G>T	ENST00000359562.4	-	1	1250	c.311C>A	c.(310-312)gCc>gAc	p.A104D	HAND2-AS1_ENST00000515741.1_RNA|HAND2-AS1_ENST00000515345.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000504740.1_RNA|HAND2-AS1_ENST00000505817.1_RNA|HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000512209.2_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000503309.1_RNA|HAND2-AS1_ENST00000510268.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000508887.1_RNA|HAND2_ENST00000505300.1_5'UTR|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000514431.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000504429.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000507636.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2	104	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CTTGCGGTTGGCGGTGCCTCG	0.736																																						dbGAP											0													64.0	64.0	64.0					4																	174450130		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.311C>A	4.37:g.174450130G>T	ENSP00000352565:p.Ala104Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B6ECG9|O95300|O95301|P97833|Q494T1	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.A104D	ENST00000359562.4	37	c.311	CCDS3819.1	4	.	.	.	.	.	.	.	.	.	.	G	19.77	3.889049	0.72524	.	.	ENSG00000164107	ENST00000359562;ENST00000393686;ENST00000535864	D	0.98150	-4.75	4.42	4.42	0.53409	Helix-loop-helix DNA-binding (4);	0.170205	0.51477	D	0.000094	D	0.99023	0.9666	M	0.94101	3.495	0.80722	D	1	D;D	0.71674	0.998;0.998	D;D	0.76575	0.988;0.988	D	0.99482	1.0948	10	0.87932	D	0	-11.4543	17.2197	0.86954	0.0:0.0:1.0:0.0	.	104;104	B6ECG9;P61296	.;HAND2_HUMAN	D	104;73;52	ENSP00000352565:A104D	ENSP00000352565:A104D	A	-	2	0	HAND2	174686705	1.000000	0.71417	1.000000	0.80357	0.738000	0.42128	5.176000	0.65026	2.274000	0.75844	0.561000	0.74099	GCC	HAND2	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000164107		0.736	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAND2	HGNC	protein_coding	OTTHUMT00000362241.3	82	0.00	0	G			174450130	174450130	-1	no_errors	ENST00000359562	ensembl	human	known	69_37n	missense	85	14.14	14	SNP	1.000	T
HDAC6	10013	genome.wustl.edu	37	X	48681990	48681990	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:48681990G>A	ENST00000334136.5	+	25	3359	c.3181G>A	c.(3181-3183)Gaa>Aaa	p.E1061K	HDAC6_ENST00000444343.2_Missense_Mutation_p.E1075K|HDAC6_ENST00000376619.2_Missense_Mutation_p.E1061K			Q9UBN7	HDAC6_HUMAN	histone deacetylase 6	1061					aggresome assembly (GO:0070842)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to misfolded protein (GO:0071218)|cellular response to topologically incorrect protein (GO:0035967)|histone deacetylation (GO:0016575)|Hsp90 deacetylation (GO:0070846)|intracellular protein transport (GO:0006886)|lysosome localization (GO:0032418)|macroautophagy (GO:0016236)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|negative regulation of hydrogen peroxide metabolic process (GO:0010727)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of oxidoreductase activity (GO:0051354)|negative regulation of protein complex disassembly (GO:0043242)|negative regulation of proteolysis (GO:0045861)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine deacetylation (GO:0034983)|polyubiquitinated misfolded protein transport (GO:0070845)|positive regulation of chaperone-mediated protein complex assembly (GO:0090035)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of hydrogen peroxide-mediated programmed cell death (GO:1901300)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of signal transduction (GO:0009967)|protein complex disassembly (GO:0043241)|protein deacetylation (GO:0006476)|protein polyubiquitination (GO:0000209)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of establishment of protein localization (GO:0070201)|regulation of gene expression, epigenetic (GO:0040029)|regulation of microtubule-based movement (GO:0060632)|regulation of receptor activity (GO:0010469)|response to growth factor (GO:0070848)|response to misfolded protein (GO:0051788)|response to organic substance (GO:0010033)|response to toxic substance (GO:0009636)|transcription, DNA-templated (GO:0006351)|tubulin deacetylation (GO:0090042)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	aggresome (GO:0016235)|axon (GO:0030424)|caveola (GO:0005901)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|dendrite (GO:0030425)|histone deacetylase complex (GO:0000118)|inclusion body (GO:0016234)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)	alpha-tubulin binding (GO:0043014)|beta-catenin binding (GO:0008013)|core promoter binding (GO:0001047)|dynein complex binding (GO:0070840)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|Hsp90 protein binding (GO:0051879)|microtubule binding (GO:0008017)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|polyubiquitin binding (GO:0031593)|tau protein binding (GO:0048156)|tubulin deacetylase activity (GO:0042903)|zinc ion binding (GO:0008270)			breast(2)|endometrium(6)|kidney(5)|large_intestine(8)|lung(9)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	40					Vorinostat(DB02546)	GCTAGGCAGCGAATCTCAGGT	0.567																																					Pancreas(112;205 1675 2305 8976 15959)	dbGAP											0													24.0	19.0	21.0					X																	48681990		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF132609	CCDS14306.1	Xp11.23	2014-06-12			ENSG00000094631	ENSG00000094631			14064	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 90"""	300272				10220385, 10048485	Standard	NM_006044		Approved	KIAA0901, JM21, HD6, FLJ16239, PPP1R90	uc004dks.1	Q9UBN7	OTTHUMG00000034496	ENST00000334136.5:c.3181G>A	X.37:g.48681990G>A	ENSP00000334061:p.Glu1061Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O94975|Q6NT75|Q7L3E5|Q96CY0	Missense_Mutation	SNP	pfam_His_deacetylse_dom,pfam_Znf_UBP,smart_Znf_UBP,pfscan_Znf_UBP,prints_His_deacetylse	p.E1075K	ENST00000334136.5	37	c.3223	CCDS14306.1	X	.	.	.	.	.	.	.	.	.	.	G	10.82	1.457163	0.26161	.	.	ENSG00000094631	ENST00000444343;ENST00000334136;ENST00000376619	T;T;T	0.60672	0.17;0.17;0.17	5.57	-6.89	0.01660	.	3.227030	0.00639	N	0.000519	T	0.51041	0.1651	L	0.29908	0.895	0.09310	N	1	B;B;B;B	0.18461	0.006;0.028;0.002;0.006	B;B;B;B	0.08055	0.001;0.003;0.001;0.001	T	0.47315	-0.9127	10	0.35671	T	0.21	3.0314	22.9211	0.99977	0.1204:0.0:0.8796:0.0	.	1051;424;709;1061	B4DZN1;B3KY98;B3KVK5;Q9UBN7	.;.;.;HDAC6_HUMAN	K	1075;1061;1061	ENSP00000398566:E1075K;ENSP00000334061:E1061K;ENSP00000365804:E1061K	ENSP00000334061:E1061K	E	+	1	0	HDAC6	48566934	0.000000	0.05858	0.000000	0.03702	0.198000	0.23893	-0.695000	0.05109	-2.298000	0.00660	-2.078000	0.00380	GAA	HDAC6	-	NULL	ENSG00000094631		0.567	HDAC6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HDAC6	HGNC	protein_coding	OTTHUMT00000083394.2	32	0.00	0	G	NM_006044		48681990	48681990	+1	no_errors	ENST00000444343	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	0.000	A
HECTD4	283450	genome.wustl.edu	37	12	112645729	112645729	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:112645729C>G	ENST00000430131.2	-	51	7959	c.6814G>C	c.(6814-6816)Gaa>Caa	p.E2272Q	HECTD4_ENST00000550722.1_Missense_Mutation_p.E2548Q|HECTD4_ENST00000377560.5_Missense_Mutation_p.E2522Q			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	2272					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CGCTCTGCTTCATTGCGGAAG	0.507																																						dbGAP											0													82.0	81.0	82.0					12																	112645729		1890	4110	6000	-	-	-	SO:0001583	missense	0			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.6814G>C	12.37:g.112645729C>G	ENSP00000404379:p.Glu2272Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl,smart_HECT,pfscan_HECT	p.E2522Q	ENST00000430131.2	37	c.7564		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.328069|5.328069	0.95733|0.95733	.|.	.|.	ENSG00000173064|ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722|ENST00000550968	T;T;T|.	0.54479|.	0.57;0.58;0.57|.	6.17|6.17	6.17|6.17	0.99709|0.99709	.|.	.|.	.|.	.|.	.|.	T|T	0.58148|0.58148	0.2102|0.2102	N|N	0.24115|0.24115	0.695|0.695	0.58432|0.58432	D|D	0.999999|0.999999	B|.	0.31318|.	0.319|.	B|.	0.28784|.	0.094|.	T|T	0.48210|0.48210	-0.9055|-0.9055	9|5	0.87932|.	D|.	0|.	.|.	20.8794|20.8794	0.99867|0.99867	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	2272|.	Q9Y4D8|.	K0614_HUMAN|.	Q|I	2522;2272;2548|438	ENSP00000366783:E2522Q;ENSP00000404379:E2272Q;ENSP00000449784:E2548Q|.	ENSP00000366783:E2522Q|.	E|M	-|-	1|3	0|0	C12orf51|C12orf51	111130112|111130112	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.997000|0.997000	0.91878|0.91878	7.212000|7.212000	0.77941|0.77941	2.941000|2.941000	0.99782|0.99782	0.655000|0.655000	0.94253|0.94253	GAA|ATG	HECTD4	-	NULL	ENSG00000173064		0.507	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		160	0.00	0	C	NM_173813		112645729	112645729	-1	no_errors	ENST00000377560	ensembl	human	known	69_37n	missense	105	19.85	26	SNP	1.000	G
HERC2	8924	genome.wustl.edu	37	15	28419644	28419644	+	Silent	SNP	C	C	A	rs77865049	byFrequency	TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr15:28419644C>A	ENST00000261609.7	-	65	10062	c.9954G>T	c.(9952-9954)tcG>tcT	p.S3318S		NM_004667.5	NP_004658.3			HECT and RLD domain containing E3 ubiquitin protein ligase 2											NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(3)|cervix(3)|endometrium(20)|kidney(11)|large_intestine(33)|lung(95)|ovary(7)|prostate(8)|skin(7)|upper_aerodigestive_tract(8)|urinary_tract(4)	204		all_lung(180;1.3e-11)|Breast(32;0.000194)|Colorectal(260;0.227)		all cancers(64;3.93e-09)|Epithelial(43;9.99e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0271)|GBM - Glioblastoma multiforme(186;0.0497)|Lung(196;0.199)		CACTGTGGGACGACCCACAAG	0.592																																						dbGAP											0													82.0	54.0	64.0					15																	28419644		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF071172	CCDS10021.1	15q13	2012-02-23	2012-02-23		ENSG00000128731	ENSG00000128731			4868	protein-coding gene	gene with protein product		605837	"""hect domain and RLD 2"""			9949213	Standard	NM_004667		Approved	jdf2, p528, D15F37S1	uc001zbj.4	O95714	OTTHUMG00000129251	ENST00000261609.7:c.9954G>T	15.37:g.28419644C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Reg_chr_condens,pfam_HECT,pfam_CPH_domain,pfam_Mib_Herc2,pfam_Cyt_B5,pfam_Znf_ZZ,pfam_APC_su10/DOC_dom,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_HECT,superfamily_Galactose-bd-like,superfamily_Cyt_B5,superfamily_UBA-like,superfamily_CUB,smart_Beta-propeller_rpt_TECPR,smart_Znf_ZZ,smart_HECT,pfscan_HECT,pfscan_Znf_ZZ,pfscan_Reg_chr_condens,pfscan_Cyt_B5,prints_Reg_chr_condens	p.S3318	ENST00000261609.7	37	c.9954	CCDS10021.1	15																																																																																			HERC2	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens	ENSG00000128731		0.592	HERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HERC2	HGNC	protein_coding	OTTHUMT00000251358.2	190	0.00	0	C	NM_004667		28419644	28419644	-1	no_errors	ENST00000261609	ensembl	human	known	69_37n	silent	94	18.97	22	SNP	0.521	A
HERC6	55008	genome.wustl.edu	37	4	89326043	89326043	+	Missense_Mutation	SNP	C	C	T	rs115213626	byFrequency	TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:89326043C>T	ENST00000264346.7	+	9	1167	c.1108C>T	c.(1108-1110)Cgt>Tgt	p.R370C	HERC6_ENST00000380265.5_Missense_Mutation_p.R370C	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	370					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		TAGTTCCACACGTGCTCCCGG	0.443													C|||	2	0.000399361	0.0	0.0	5008	,	,		19356	0.0		0.002	False		,,,				2504	0.0					dbGAP											0													118.0	108.0	111.0					4																	89326043		1881	4113	5994	-	-	-	SO:0001583	missense	0			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1108C>T	4.37:g.89326043C>T	ENSP00000264346:p.Arg370Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Missense_Mutation	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.R370C	ENST00000264346.7	37	c.1108	CCDS47098.1	4	2	9.157509157509158E-4	0	0.0	0	0.0	0	0.0	2	0.002638522427440633	C	8.495	0.863016	0.17178	.	.	ENSG00000138642	ENST00000380265;ENST00000264346	T;T	0.39592	1.07;1.07	4.79	-9.58	0.00559	.	2.145410	0.01548	N	0.019559	T	0.11707	0.0285	N	0.02011	-0.69	0.09310	N	1	B;P	0.40931	0.358;0.733	B;B	0.16722	0.006;0.016	T	0.41752	-0.9491	10	0.45353	T	0.12	.	9.1018	0.36673	0.1757:0.11:0.6076:0.1068	.	370;370	Q8IVU3-2;Q8IVU3	.;HERC6_HUMAN	C	370	ENSP00000369617:R370C;ENSP00000264346:R370C	ENSP00000264346:R370C	R	+	1	0	HERC6	89545066	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.908000	0.00700	-1.830000	0.01199	-1.341000	0.01249	CGT	HERC6	-	NULL	ENSG00000138642		0.443	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2	295	0.00	0	C			89326043	89326043	+1	no_errors	ENST00000264346	ensembl	human	known	69_37n	missense	217	17.18	45	SNP	0.000	T
HKR1	284459	genome.wustl.edu	37	19	37853811	37853811	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:37853811C>G	ENST00000324411.4	+	6	1383	c.1114C>G	c.(1114-1116)Ctc>Gtc	p.L372V	HKR1_ENST00000591134.1_Intron|HKR1_ENST00000541583.2_Missense_Mutation_p.L311V|HKR1_ENST00000392153.3_Missense_Mutation_p.L353V|HKR1_ENST00000589392.1_Missense_Mutation_p.L354V|HKR1_ENST00000544914.1_Missense_Mutation_p.L99V|HKR1_ENST00000591471.1_Missense_Mutation_p.L99V	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	372					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GAAGTCAAACCTCATTACCCA	0.527																																						dbGAP											0													91.0	77.0	82.0					19																	37853811		2203	4300	6503	-	-	-	SO:0001583	missense	0			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1114C>G	19.37:g.37853811C>G	ENSP00000315505:p.Leu372Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L372V	ENST00000324411.4	37	c.1114	CCDS12502.1	19	.	.	.	.	.	.	.	.	.	.	C	11.68	1.709650	0.30322	.	.	ENSG00000181666	ENST00000544914;ENST00000392153;ENST00000542144;ENST00000324411;ENST00000541583	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	3.22	2.05	0.26809	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.68091	0.2963	M	0.87328	2.875	0.80722	D	1	D;P;D;D	0.89917	1.0;0.577;1.0;0.969	D;B;D;P	0.97110	1.0;0.403;0.992;0.729	T	0.70022	-0.4986	9	0.36615	T	0.2	.	11.0041	0.47624	0.1864:0.8136:0.0:0.0	.	311;353;372;354	Q7Z6E1;P10072-2;P10072;B4DSY3	.;.;HKR1_HUMAN;.	V	99;353;408;372;311	ENSP00000437774:L99V;ENSP00000375994:L353V;ENSP00000315505:L372V;ENSP00000438261:L311V	ENSP00000315505:L372V	L	+	1	0	HKR1	42545651	0.292000	0.24362	0.971000	0.41717	0.942000	0.58702	0.725000	0.25970	1.805000	0.52779	0.650000	0.86243	CTC	HKR1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000181666		0.527	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HKR1	HGNC	protein_coding	OTTHUMT00000458375.1	117	0.00	0	C	NM_181786		37853811	37853811	+1	no_errors	ENST00000324411	ensembl	human	known	69_37n	missense	88	43.95	69	SNP	0.688	G
HKR1	284459	genome.wustl.edu	37	19	37854586	37854586	+	Missense_Mutation	SNP	C	C	T	rs555809509		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:37854586C>T	ENST00000324411.4	+	6	2158	c.1889C>T	c.(1888-1890)tCa>tTa	p.S630L	HKR1_ENST00000591134.1_Intron|HKR1_ENST00000541583.2_Missense_Mutation_p.S569L|HKR1_ENST00000392153.3_Missense_Mutation_p.S611L|HKR1_ENST00000589392.1_Missense_Mutation_p.S612L|HKR1_ENST00000544914.1_Missense_Mutation_p.S357L|HKR1_ENST00000591471.1_Missense_Mutation_p.S357L	NM_181786.2	NP_861451.1	P10072	HKR1_HUMAN	HKR1, GLI-Kruppel zinc finger family member	630					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	29			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AGGACACATTCAGGAGAGAAG	0.512																																						dbGAP											0													72.0	73.0	73.0					19																	37854586		2203	4300	6503	-	-	-	SO:0001583	missense	0			M20675	CCDS12502.1	19q13.13	2013-01-08	2010-05-04			ENSG00000181666		"""Zinc fingers, C2H2-type"", ""-"""	4928	protein-coding gene	gene with protein product	"""oncogene HKR1"""	165250	"""GLI-Kruppel family member HKR1"""			2850480, 9813242	Standard	NM_181786		Approved	ZNF875	uc002ogb.3	P10072		ENST00000324411.4:c.1889C>T	19.37:g.37854586C>T	ENSP00000315505:p.Ser630Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRS7|Q6PJD0|Q9BSW9|Q9UM09	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S630L	ENST00000324411.4	37	c.1889	CCDS12502.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	22.6|22.6	4.315180|4.315180	0.81358|0.81358	.|.	.|.	ENSG00000181666|ENSG00000181666	ENST00000542144|ENST00000544914;ENST00000414402;ENST00000392153;ENST00000324411;ENST00000541583	.|T;T;T;T	.|0.28069	.|1.63;1.63;1.63;1.63	2.96|2.96	2.96|2.96	0.34315|0.34315	.|Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.|.	.|.	.|.	.|.	.|T	.|0.35595	.|0.0937	L|L	0.47716|0.47716	1.5|1.5	0.80722|0.80722	D|D	1|1	.|B;B;P;P	.|0.51791	.|0.121;0.063;0.624;0.948	.|B;B;B;P	.|0.49421	.|0.215;0.049;0.439;0.61	.|T	.|0.36817	.|-0.9732	.|9	0.87932|0.87932	D|D	0|0	.|.	13.1963|13.1963	0.59740|0.59740	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|569;611;630;612	.|Q7Z6E1;P10072-2;P10072;B4DSY3	.|.;.;HKR1_HUMAN;.	X|L	665|357;409;611;630;569	.|ENSP00000437774:S357L;ENSP00000375994:S611L;ENSP00000315505:S630L;ENSP00000438261:S569L	ENSP00000440633:Q665X|ENSP00000315505:S630L	Q|S	+|+	1|2	0|0	HKR1|HKR1	42546426|42546426	0.023000|0.023000	0.18921|0.18921	0.922000|0.922000	0.36590|0.36590	0.973000|0.973000	0.67179|0.67179	2.898000|2.898000	0.48672|0.48672	1.671000|1.671000	0.50874|0.50874	0.650000|0.650000	0.86243|0.86243	CAG|TCA	HKR1	-	pfscan_Znf_C2H2	ENSG00000181666		0.512	HKR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HKR1	HGNC	protein_coding	OTTHUMT00000458375.1	157	0.00	0	C	NM_181786		37854586	37854586	+1	no_errors	ENST00000324411	ensembl	human	known	69_37n	missense	96	38.06	59	SNP	0.996	T
HTR3D	200909	genome.wustl.edu	37	3	183755826	183755826	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:183755826G>A	ENST00000382489.3	+	6	678	c.678G>A	c.(676-678)agG>agA	p.R226R	HTR3D_ENST00000334128.2_Silent_p.R53R|HTR3D_ENST00000453435.1_Silent_p.R7R|HTR3D_ENST00000428798.2_Silent_p.R178R	NM_001163646.1	NP_001157118.1	Q70Z44	5HT3D_HUMAN	5-hydroxytryptamine (serotonin) receptor 3D, ionotropic	226					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	extracellular ligand-gated ion channel activity (GO:0005230)			large_intestine(3)|lung(3)|prostate(1)|skin(1)|stomach(2)	10	all_cancers(143;2.33e-10)|Ovarian(172;0.0303)		Epithelial(37;6.23e-36)|OV - Ovarian serous cystadenocarcinoma(80;6.48e-22)		Ergoloid mesylate(DB01049)	TCAGGCGCAGGTGCAGGCCCA	0.557																																						dbGAP											0													53.0	44.0	47.0					3																	183755826		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY159812	CCDS3249.1, CCDS46966.1, CCDS54685.1	3q27	2012-05-22	2012-02-03		ENSG00000186090	ENSG00000186090		"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	24004	protein-coding gene	gene with protein product		610122	"""5-hydroxytryptamine (serotonin) receptor 3 family member D"""			12801637	Standard	NM_001145143		Approved		uc011bqv.2	Q70Z44	OTTHUMG00000156858	ENST00000382489.3:c.678G>A	3.37:g.183755826G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J2I6|J3QT78|Q495N5|Q495N6|Q7Z6B3	Silent	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd	p.R226	ENST00000382489.3	37	c.678	CCDS54685.1	3																																																																																			HTR3D	-	superfamily_Neur_chan_lig-bd	ENSG00000186090		0.557	HTR3D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HTR3D	HGNC	protein_coding	OTTHUMT00000346289.1	89	0.00	0	G	NM_182537		183755826	183755826	+1	no_errors	ENST00000382489	ensembl	human	known	69_37n	silent	94	13.76	15	SNP	0.999	A
ICA1	3382	genome.wustl.edu	37	7	8167561	8167561	+	Silent	SNP	A	A	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:8167561A>G	ENST00000402384.3	-	13	1538	c.1272T>C	c.(1270-1272)ggT>ggC	p.G424G	ICA1_ENST00000265577.7_Silent_p.G423G|ICA1_ENST00000396675.3_Silent_p.G424G|ICA1_ENST00000422063.2_Silent_p.G453G|ICA1_ENST00000406470.2_Silent_p.G424G|ICA1_ENST00000401396.1_Silent_p.G412G			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	424					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)				breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		AAGGAAGGAAACCTGAGCCTG	0.527																																						dbGAP											0													141.0	155.0	150.0					7																	8167561		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.1272T>C	7.37:g.8167561A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Silent	SNP	pfam_Arfaptin_homology_dom,pfam_Islet_autoAg_Ica1_C,pfscan_Arfaptin_homology_dom	p.G453	ENST00000402384.3	37	c.1359	CCDS34602.1	7																																																																																			ICA1	-	pfam_Islet_autoAg_Ica1_C	ENSG00000003147		0.527	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ICA1	HGNC	protein_coding	OTTHUMT00000324793.1	137	0.71	1	A	NM_004968		8167561	8167561	-1	no_errors	ENST00000422063	ensembl	human	known	69_37n	silent	152	11.43	20	SNP	0.000	G
IGSF1	3547	genome.wustl.edu	37	X	130412089	130412089	+	Silent	SNP	G	G	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:130412089G>T	ENST00000361420.3	-	13	2140	c.2061C>A	c.(2059-2061)gtC>gtA	p.V687V	IGSF1_ENST00000370904.1_Silent_p.V678V|IGSF1_ENST00000370910.1_Silent_p.V678V|IGSF1_ENST00000370903.3_Silent_p.V692V|IGSF1_ENST00000467244.1_5'Flank			Q8N6C5	IGSF1_HUMAN	immunoglobulin superfamily, member 1	687	Ig-like C2-type 7.				regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	coreceptor activity (GO:0015026)|inhibin binding (GO:0034711)|receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|liver(1)|lung(37)|ovary(4)|skin(3)|upper_aerodigestive_tract(2)	78						AAGCAGAAATGACAGGTTTGG	0.522																																						dbGAP											0													69.0	65.0	66.0					X																	130412089		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF034198	CCDS14629.1, CCDS14630.1, CCDS55490.1, CCDS55491.1	Xq25	2013-01-11			ENSG00000147255	ENSG00000147255		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5948	protein-coding gene	gene with protein product		300137				9521868, 9729118	Standard	NM_001555		Approved	KIAA0364, IGDC1, IGCD1, INHBP, MGC75490, PGSF2	uc004ewe.4	Q8N6C5	OTTHUMG00000022406	ENST00000361420.3:c.2061C>A	X.37:g.130412089G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MEG2|H9KV64|O15070|Q9NTC8	Silent	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.V692	ENST00000361420.3	37	c.2076	CCDS14629.1	X																																																																																			IGSF1	-	NULL	ENSG00000147255		0.522	IGSF1-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	IGSF1	HGNC	protein_coding	OTTHUMT00000058288.1	100	0.00	0	G			130412089	130412089	-1	no_errors	ENST00000370903	ensembl	human	known	69_37n	silent	77	16.30	15	SNP	0.996	T
INMT	11185	genome.wustl.edu	37	7	30793370	30793370	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:30793370A>T	ENST00000013222.5	+	2	194	c.178A>T	c.(178-180)Att>Ttt	p.I60F	INMT_ENST00000484180.1_3'UTR|INMT-FAM188B_ENST00000458257.1_Missense_Mutation_p.I59F|INMT_ENST00000409539.1_Missense_Mutation_p.I59F	NM_001199219.1|NM_006774.4	NP_001186148.1|NP_006765.4	O95050	INMT_HUMAN	indolethylamine N-methyltransferase	60					amine metabolic process (GO:0009308)|methylation (GO:0032259)|response to toxic substance (GO:0009636)	cytosol (GO:0005829)	amine N-methyltransferase activity (GO:0030748)|thioether S-methyltransferase activity (GO:0004790)			kidney(1)|large_intestine(5)|lung(13)|ovary(1)|prostate(2)|stomach(1)	23						GGACACGCTGATTGACATTGG	0.537																																						dbGAP											0													280.0	258.0	265.0					7																	30793370		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5430.1, CCDS56479.1	7p14.3	2011-08-30			ENSG00000241644	ENSG00000241644	2.1.1.49		6069	protein-coding gene	gene with protein product		604854				10552930	Standard	NM_001199219		Approved		uc003tbs.1	O95050	OTTHUMG00000167163	ENST00000013222.5:c.178A>T	7.37:g.30793370A>T	ENSP00000013222:p.Ile60Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B8ZZ69|Q3KP49|Q9P1Y2|Q9UBY4|Q9UHQ0	Missense_Mutation	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.I60F	ENST00000013222.5	37	c.178	CCDS5430.1	7	.	.	.	.	.	.	.	.	.	.	A	13.41	2.228399	0.39399	.	.	ENSG00000241644	ENST00000013222;ENST00000409539	T;T	0.10763	2.84;2.84	4.07	4.07	0.47477	.	0.000000	0.56097	D	0.000028	T	0.35711	0.0941	M	0.86805	2.84	0.47183	D	0.999348	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.30327	-0.9982	10	0.72032	D	0.01	-16.3173	11.3357	0.49503	1.0:0.0:0.0:0.0	.	59;60	B8ZZ69;O95050	.;INMT_HUMAN	F	60;59	ENSP00000013222:I60F;ENSP00000386961:I59F	ENSP00000013222:I60F	I	+	1	0	INMT	30759895	1.000000	0.71417	0.382000	0.26119	0.059000	0.15707	2.782000	0.47758	1.832000	0.53329	0.533000	0.62120	ATT	INMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	ENSG00000241644		0.537	INMT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INMT	HGNC	protein_coding	OTTHUMT00000214993.3	95	0.00	0	A	NM_006774		30793370	30793370	+1	no_errors	ENST00000013222	ensembl	human	known	69_37n	missense	92	16.96	19	SNP	0.998	T
ITIH5	80760	genome.wustl.edu	37	10	7621758	7621758	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr10:7621758G>A	ENST00000256861.6	-	9	1456	c.1378C>T	c.(1378-1380)Cgc>Tgc	p.R460C	ITIH5_ENST00000298441.6_Missense_Mutation_p.R246C|ITIH5_ENST00000397146.2_Missense_Mutation_p.R460C|ITIH5_ENST00000446830.2_Missense_Mutation_p.R242C|ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397145.2_Missense_Mutation_p.R460C	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	460	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						TCGTGCACGCGCCGTGTGAGG	0.627																																						dbGAP											0													103.0	94.0	97.0					10																	7621758		2203	4300	6503	-	-	-	SO:0001583	missense	0					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.1378C>T	10.37:g.7621758G>A	ENSP00000256861:p.Arg460Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Missense_Mutation	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.R460C	ENST00000256861.6	37	c.1378		10	.	.	.	.	.	.	.	.	.	.	G	20.7	4.030716	0.75504	.	.	ENSG00000123243	ENST00000256861;ENST00000397146;ENST00000298441;ENST00000446830;ENST00000397145	T;T;T;T;T	0.78003	-1.14;-1.14;-1.14;-1.14;-1.14	5.2	1.99	0.26369	von Willebrand factor, type A (2);	0.219308	0.45867	N	0.000324	D	0.85314	0.5668	.	.	.	0.40130	D	0.976703	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.997;0.985;0.975	D	0.85787	0.1365	9	0.87932	D	0	-3.2811	8.7977	0.34890	0.073:0.0:0.6856:0.2414	.	460;460;246	G5E9D8;Q86UX2;Q86UX2-3	.;ITIH5_HUMAN;.	C	460;460;246;242;460	ENSP00000256861:R460C;ENSP00000380333:R460C;ENSP00000298441:R246C;ENSP00000387969:R242C;ENSP00000380332:R460C	ENSP00000256861:R460C	R	-	1	0	ITIH5	7661764	0.368000	0.25031	0.045000	0.18777	0.266000	0.26442	3.170000	0.50816	1.185000	0.42971	0.462000	0.41574	CGC	ITIH5	-	smart_VWF_A,pfscan_VWF_A	ENSG00000123243		0.627	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	121	0.00	0	G	NM_030569		7621758	7621758	-1	no_errors	ENST00000256861	ensembl	human	known	69_37n	missense	117	11.36	15	SNP	0.734	A
KIAA0754	643314	genome.wustl.edu	37	1	39877270	39877270	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:39877270G>A	ENST00000530275.1	+	1	1120	c.925G>A	c.(925-927)Gat>Aat	p.D309N	MACF1_ENST00000372915.3_Intron|MACF1_ENST00000289893.4_Intron|MACF1_ENST00000564288.1_Intron|MACF1_ENST00000567887.1_Intron|MACF1_ENST00000317713.7_Intron|MACF1_ENST00000361689.2_Intron|MACF1_ENST00000539005.1_Intron|MACF1_ENST00000545844.1_Intron	NM_015038.1	NP_055853.1	O94854	K0754_HUMAN	KIAA0754	309										central_nervous_system(1)|large_intestine(6)|skin(1)	8	Lung NSC(20;5.57e-06)|Ovarian(52;0.00769)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;7.78e-19)|Epithelial(16;1.73e-17)|all cancers(16;2.49e-16)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			ACTTGTTTCAGATTCAGCATG	0.448											OREG0013393	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													170.0	164.0	166.0					1																	39877270		1952	4153	6105	-	-	-	SO:0001583	missense	0					1p34.2	2009-07-09				ENSG00000255103			29111	protein-coding gene	gene with protein product						9872452	Standard	NM_015038		Approved		uc009vvt.1	O94854		ENST00000530275.1:c.925G>A	1.37:g.39877270G>A	ENSP00000431179:p.Asp309Asn	Somatic	889	WXS	Illumina GAIIx	Phase_IV	E9PMC2|Q6ZSB2	Missense_Mutation	SNP	NULL	p.D309N	ENST00000530275.1	37	c.925		1	.	.	.	.	.	.	.	.	.	.	G	6.966	0.548272	0.13312	.	.	ENSG00000255103	ENST00000530275	D	0.85861	-2.04	4.94	3.07	0.35406	.	.	.	.	.	T	0.76263	0.3963	N	0.24115	0.695	0.09310	N	1	B	0.27140	0.169	B	0.28553	0.091	T	0.64558	-0.6379	9	0.46703	T	0.11	.	11.0199	0.47711	0.1508:0.0:0.8492:0.0	.	309	O94854	K0754_HUMAN	N	309	ENSP00000431179:D309N	ENSP00000431179:D309N	D	+	1	0	RP4-562N20.1	39649857	0.130000	0.22417	0.005000	0.12908	0.015000	0.08874	3.009000	0.49552	0.508000	0.28173	-0.136000	0.14681	GAT	KIAA0754	-	NULL	ENSG00000255103		0.448	KIAA0754-001	KNOWN	basic|appris_principal	protein_coding	KIAA0754	HGNC	protein_coding	OTTHUMT00000392100.1	147	0.00	0	G	NM_015038		39877270	39877270	+1	no_errors	ENST00000530275	ensembl	human	known	69_37n	missense	138	16.87	28	SNP	0.113	A
KIF4A	24137	genome.wustl.edu	37	X	69625735	69625735	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:69625735G>A	ENST00000374403.3	+	26	3038	c.2956G>A	c.(2956-2958)Gag>Aag	p.E986K	KIF4A_ENST00000374388.3_Missense_Mutation_p.E986K	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	986	Interaction with PRC1.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						GCTTCTCCGAGAGAATGAAAT	0.463																																						dbGAP											0													91.0	78.0	82.0					X																	69625735		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.2956G>A	X.37:g.69625735G>A	ENSP00000363524:p.Glu986Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E986K	ENST00000374403.3	37	c.2956	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	G	18.76	3.692874	0.68271	.	.	ENSG00000090889	ENST00000374388;ENST00000374403;ENST00000544650	T;T	0.69561	-0.41;-0.37	4.61	4.61	0.57282	.	0.000000	0.53938	D	0.000047	T	0.69753	0.3146	M	0.62723	1.935	0.49389	D	0.999781	D	0.55800	0.973	P	0.48704	0.587	T	0.71803	-0.4482	9	.	.	.	.	15.1132	0.72375	0.0:0.0:1.0:0.0	.	986	O95239	KIF4A_HUMAN	K	986;986;288	ENSP00000363509:E986K;ENSP00000363524:E986K	.	E	+	1	0	KIF4A	69542460	1.000000	0.71417	0.940000	0.37924	0.982000	0.71751	5.792000	0.69052	2.116000	0.64780	0.600000	0.82982	GAG	KIF4A	-	NULL	ENSG00000090889		0.463	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	203	0.00	0	G	NM_012310		69625735	69625735	+1	no_errors	ENST00000374403	ensembl	human	known	69_37n	missense	138	21.47	38	SNP	0.993	A
KRT86	3892	genome.wustl.edu	37	12	52652197	52652197	+	Intron	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:52652197G>A	ENST00000544024.1	+	1	129				KRT121P_ENST00000529785.1_RNA			O43790	KRT86_HUMAN	keratin 86							extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		CGAAGCCTCCGGTGAGGCCGC	0.771																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000544024.1:c.-5+8985G>A	12.37:g.52652197G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P78387	RNA	SNP	-	NULL	ENST00000544024.1	37	NULL	CCDS41785.1	12																																																																																			KRT121P	-	-	ENSG00000135477		0.771	KRT86-202	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT121P	HGNC	protein_coding		8	0.00	0	G	NM_002284		52652197	52652197	-1	no_errors	ENST00000529785	ensembl	human	known	69_37n	rna	27	20.59	7	SNP	0.000	A
L3MBTL2	83746	genome.wustl.edu	37	22	41626159	41626159	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr22:41626159G>A	ENST00000216237.5	+	17	2180	c.2022G>A	c.(2020-2022)gtG>gtA	p.V674V	CHADL_ENST00000216241.9_Intron	NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	674					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CTGTGCGTGTGAAGGAAGAGC	0.602																																						dbGAP											0													71.0	63.0	66.0					22																	41626159		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.2022G>A	22.37:g.41626159G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Silent	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.V674	ENST00000216237.5	37	c.2022	CCDS14011.1	22																																																																																			L3MBTL2	-	NULL	ENSG00000100395		0.602	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	HGNC	protein_coding	OTTHUMT00000320613.1	57	0.00	0	G	NM_031488		41626159	41626159	+1	no_errors	ENST00000216237	ensembl	human	known	69_37n	silent	44	12.00	6	SNP	1.000	A
L3MBTL3	84456	genome.wustl.edu	37	6	130370912	130370912	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:130370912C>G	ENST00000529410.1	+	7	705	c.226C>G	c.(226-228)Ccc>Gcc	p.P76A	L3MBTL3_ENST00000526019.1_Intron|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.P76A|L3MBTL3_ENST00000533560.1_Intron|L3MBTL3_ENST00000368139.2_Intron|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.P76A			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	76					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		cccgacctctcccccgagctc	0.493																																						dbGAP											0													83.0	76.0	78.0					6																	130370912		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.226C>G	6.37:g.130370912C>G	ENSP00000431962:p.Pro76Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.P76A	ENST00000529410.1	37	c.226	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	C	1.699	-0.501996	0.04261	.	.	ENSG00000198945	ENST00000529410;ENST00000526087;ENST00000361794;ENST00000528385;ENST00000368136	T;T;T;T	0.45276	2.59;2.59;0.9;2.59	4.35	3.46	0.39613	.	0.343557	0.29676	N	0.011500	T	0.09379	0.0231	N	0.22421	0.69	0.26647	N	0.972179	B	0.16396	0.017	B	0.13407	0.009	T	0.27640	-1.0068	10	0.08179	T	0.78	.	10.2521	0.43375	0.0:0.7994:0.2006:0.0	.	76	Q96JM7	LMBL3_HUMAN	A	76;111;76;76;76	ENSP00000431962:P76A;ENSP00000354526:P76A;ENSP00000433257:P76A;ENSP00000357118:P76A	ENSP00000354526:P76A	P	+	1	0	L3MBTL3	130412605	1.000000	0.71417	1.000000	0.80357	1.000000	0.99986	1.700000	0.37815	1.379000	0.46325	0.650000	0.86243	CCC	L3MBTL3	-	NULL	ENSG00000198945		0.493	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	147	0.00	0	C	XM_027074		130370912	130370912	+1	no_errors	ENST00000361794	ensembl	human	known	69_37n	missense	101	22.90	30	SNP	1.000	G
LAMB1	3912	genome.wustl.edu	37	7	107601001	107601001	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:107601001G>T	ENST00000222399.6	-	18	2433	c.2203C>A	c.(2203-2205)Cag>Aag	p.Q735K	LAMB1_ENST00000393561.1_Missense_Mutation_p.Q759K|LAMB1_ENST00000393560.1_Missense_Mutation_p.Q735K	NM_002291.2	NP_002282.2	P07942	LAMB1_HUMAN	laminin, beta 1	735	Laminin IV type B. {ECO:0000255|PROSITE- ProRule:PRU00462}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|embryo implantation (GO:0007566)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|negative regulation of cell adhesion (GO:0007162)|neuron projection development (GO:0031175)|neuronal-glial interaction involved in cerebral cortex radial glia guided migration (GO:0021812)|odontogenesis (GO:0042476)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial cell proliferation (GO:0050679)|substrate adhesion-dependent cell spreading (GO:0034446)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-2 complex (GO:0005607)|laminin-8 complex (GO:0043257)|perinuclear region of cytoplasm (GO:0048471)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)|structural molecule activity (GO:0005198)			NS(3)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(37)|ovary(6)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)	82						CGGTATCTCTGAAAGGTTTCC	0.468																																						dbGAP											0													135.0	118.0	123.0					7																	107601001		2203	4300	6503	-	-	-	SO:0001583	missense	0			M61916	CCDS5750.1	7q22	2013-03-01			ENSG00000091136	ENSG00000091136		"""Laminins"""	6486	protein-coding gene	gene with protein product		150240	"""cutis laxa with marfanoid phenotype"""	CLM		2563160, 2704655, 1864606	Standard	NM_002291		Approved		uc003vew.2	P07942	OTTHUMG00000149966	ENST00000222399.6:c.2203C>A	7.37:g.107601001G>T	ENSP00000222399:p.Gln735Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D91	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EGF-like,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.Q735K	ENST00000222399.6	37	c.2203	CCDS5750.1	7	.	.	.	.	.	.	.	.	.	.	G	26.9	4.779633	0.90195	.	.	ENSG00000091136	ENST00000393561;ENST00000222399;ENST00000393560	T;T;T	0.37058	1.49;1.49;1.22	5.48	5.48	0.80851	Laminin IV (1);	.	.	.	.	T	0.64594	0.2612	M	0.80183	2.485	0.53005	D	0.999961	P;P;D	0.76494	0.932;0.945;0.999	B;P;D	0.87578	0.365;0.459;0.998	T	0.65660	-0.6114	9	0.48119	T	0.1	.	19.3573	0.94420	0.0:0.0:1.0:0.0	.	735;735;759	E7EPA6;P07942;G3XAI2	.;LAMB1_HUMAN;.	K	759;735;735	ENSP00000377191:Q759K;ENSP00000222399:Q735K;ENSP00000377190:Q735K	ENSP00000222399:Q735K	Q	-	1	0	LAMB1	107388237	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.476000	0.97823	2.571000	0.86741	0.563000	0.77884	CAG	LAMB1	-	pfscan_Laminin_IV	ENSG00000091136		0.468	LAMB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB1	HGNC	protein_coding	OTTHUMT00000314584.1	162	0.00	0	G	NM_002291		107601001	107601001	-1	no_errors	ENST00000222399	ensembl	human	known	69_37n	missense	122	17.57	26	SNP	1.000	T
LIMA1	51474	genome.wustl.edu	37	12	50571543	50571543	+	Silent	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:50571543C>A	ENST00000341247.4	-	11	1733	c.1584G>T	c.(1582-1584)ctG>ctT	p.L528L	LIMA1_ENST00000552909.1_Silent_p.L367L|LIMA1_ENST00000552823.1_Silent_p.L368L|LIMA1_ENST00000552491.1_Silent_p.L225L|LIMA1_ENST00000552783.1_Silent_p.L369L|LIMA1_ENST00000394943.3_Silent_p.L529L|LIMA1_ENST00000547825.1_Silent_p.L226L	NM_001113546.1|NM_016357.4	NP_001107018.1|NP_057441.1	Q9UHB6	LIMA1_HUMAN	LIM domain and actin binding 1	528					actin filament bundle assembly (GO:0051017)|negative regulation of actin filament depolymerization (GO:0030835)|ruffle organization (GO:0031529)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(17)|ovary(1)|prostate(2)|skin(2)	44						AGGCGATCCTCAGCTTCTTGG	0.537																																						dbGAP											0													123.0	126.0	125.0					12																	50571543		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF198454	CCDS8802.1, CCDS44877.1, CCDS55826.1, CCDS58230.1	12q13.12	2006-04-12				ENSG00000050405			24636	protein-coding gene	gene with protein product	"""epithelial protein lost in neoplasm beta"""	608364				10806352, 10618726, 12566430	Standard	NM_016357		Approved	EPLIN	uc001rwk.4	Q9UHB6		ENST00000341247.4:c.1584G>T	12.37:g.50571543C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB09|Q2TAN7|Q59FE8|Q9BVF2|Q9H8J1|Q9HBN5|Q9NX96|Q9NXC3|Q9NXU6|Q9P0H8|Q9UHB5	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.L529	ENST00000341247.4	37	c.1587	CCDS8802.1	12																																																																																			LIMA1	-	NULL	ENSG00000050405		0.537	LIMA1-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	LIMA1	HGNC	protein_coding	OTTHUMT00000406235.2	194	0.00	0	C	NM_016357		50571543	50571543	-1	no_errors	ENST00000394943	ensembl	human	known	69_37n	silent	131	18.12	29	SNP	1.000	A
LRP1	4035	genome.wustl.edu	37	12	57532316	57532316	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:57532316G>A	ENST00000243077.3	+	2	608	c.142G>A	c.(142-144)Gac>Aac	p.D48N	LRP1_ENST00000553277.1_Missense_Mutation_p.D48N|LRP1_ENST00000554174.1_Missense_Mutation_p.D48N|LRP1_ENST00000338962.4_Missense_Mutation_p.D48N	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1	48	LDL-receptor class A 1. {ECO:0000255|PROSITE-ProRule:PRU00124}.				aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	CTGGCGGTGCGACGGTGAGAG	0.517																																						dbGAP											0													151.0	153.0	152.0					12																	57532316		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.142G>A	12.37:g.57532316G>A	ENSP00000243077:p.Asp48Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2PP12|Q86SW0|Q8IVG8	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.D48N	ENST00000243077.3	37	c.142	CCDS8932.1	12	.	.	.	.	.	.	.	.	.	.	G	35	5.529628	0.96446	.	.	ENSG00000123384	ENST00000553277;ENST00000243077;ENST00000338962;ENST00000554174	D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89	5.11	5.11	0.69529	Low-density lipoprotein (LDL) receptor class A, conserved site (1);	0.000000	0.64402	D	0.000001	D	0.98871	0.9618	M	0.79693	2.465	0.58432	D	0.999994	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.91635	0.999;0.994;0.999;0.999	D	0.99357	1.0916	10	0.62326	D	0.03	.	16.8396	0.85965	0.0:0.0:1.0:0.0	.	48;48;48;48	Q86SW0;Q07954;Q6PJ72;Q7Z7K9	.;LRP1_HUMAN;.;.	N	48	ENSP00000451449:D48N;ENSP00000243077:D48N;ENSP00000341264:D48N;ENSP00000451737:D48N	ENSP00000243077:D48N	D	+	1	0	LRP1	55818583	1.000000	0.71417	0.998000	0.56505	0.888000	0.51559	9.140000	0.94607	2.768000	0.95171	0.561000	0.74099	GAC	LRP1	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000123384		0.517	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	237	0.00	0	G	NM_002332		57532316	57532316	+1	no_errors	ENST00000243077	ensembl	human	known	69_37n	missense	179	19.37	43	SNP	1.000	A
LRP4	4038	genome.wustl.edu	37	11	46889599	46889599	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:46889599T>C	ENST00000378623.1	-	34	5260	c.5018A>G	c.(5017-5019)aAc>aGc	p.N1673S	LRP4-AS1_ENST00000502049.2_RNA|LRP4-AS1_ENST00000531719.1_RNA	NM_002334.3	NP_002325.2	O75096	LRP4_HUMAN	low density lipoprotein receptor-related protein 4	1673					dendrite morphogenesis (GO:0048813)|dorsal/ventral pattern formation (GO:0009953)|embryonic digit morphogenesis (GO:0042733)|endocytosis (GO:0006897)|extracellular matrix organization (GO:0030198)|hair follicle development (GO:0001942)|kidney development (GO:0001822)|limb development (GO:0060173)|negative regulation of axonogenesis (GO:0050771)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ossification (GO:0030279)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of presynaptic membrane organization (GO:1901631)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein heterotetramerization (GO:0051290)|proximal/distal pattern formation (GO:0009954)|regulation of protein phosphorylation (GO:0001932)|skeletal muscle acetylcholine-gated channel clustering (GO:0071340)|synapse organization (GO:0050808)|synaptic growth at neuromuscular junction (GO:0051124)|Wnt signaling pathway (GO:0016055)	cell surface (GO:0009986)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|synaptic membrane (GO:0097060)	calcium ion binding (GO:0005509)|receptor tyrosine kinase binding (GO:0030971)|scaffold protein binding (GO:0097110)			breast(7)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(24)|ovary(3)|pancreas(2)|prostate(5)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)	70				Lung(87;0.159)		AGGTGGTGTGTTGGGTAGCAC	0.552																																						dbGAP											0													181.0	148.0	159.0					11																	46889599		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB011540	CCDS31478.1	11p11.2	2013-05-29			ENSG00000134569	ENSG00000134569		"""Low density lipoprotein receptors"""	6696	protein-coding gene	gene with protein product		604270				9693030	Standard	NM_002334		Approved	MEGF7, CLSS, LRP-4, SOST2	uc001ndn.4	O75096	OTTHUMG00000166700	ENST00000378623.1:c.5018A>G	11.37:g.46889599T>C	ENSP00000367888:p.Asn1673Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RN39|Q4AC85|Q5KTZ5	Missense_Mutation	SNP	pfam_LDLR_classB_rpt,pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.N1673S	ENST00000378623.1	37	c.5018	CCDS31478.1	11	.	.	.	.	.	.	.	.	.	.	.	10.25	1.297444	0.23650	.	.	ENSG00000134569	ENST00000378623	D	0.89810	-2.57	5.71	4.58	0.56647	.	0.000000	0.85682	D	0.000000	D	0.84343	0.5451	N	0.08118	0	0.41851	D	0.990177	P	0.46578	0.88	P	0.62184	0.899	T	0.78929	-0.2010	10	0.09084	T	0.74	.	9.7702	0.40585	0.0:0.078:0.0:0.922	.	1673	O75096	LRP4_HUMAN	S	1673	ENSP00000367888:N1673S	ENSP00000367888:N1673S	N	-	2	0	LRP4	46846175	1.000000	0.71417	0.998000	0.56505	0.131000	0.20780	3.136000	0.50554	0.993000	0.38866	-0.376000	0.06991	AAC	LRP4	-	NULL	ENSG00000134569		0.552	LRP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP4	HGNC	protein_coding	OTTHUMT00000391133.1	304	0.00	0	T	NM_002334		46889599	46889599	-1	no_errors	ENST00000378623	ensembl	human	known	69_37n	missense	182	21.89	51	SNP	1.000	C
LRRC14B	389257	genome.wustl.edu	37	5	192381	192381	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:192381C>T	ENST00000328278.3	+	1	756	c.728C>T	c.(727-729)tCg>tTg	p.S243L		NM_001080478.1	NP_001073947.1	A6NHZ5	LR14B_HUMAN	leucine rich repeat containing 14B	243										endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	10						CGGCTGGCCTCGCTCACCCTG	0.716																																						dbGAP											0													12.0	16.0	15.0					5																	192381		2086	4186	6272	-	-	-	SO:0001583	missense	0				CCDS47184.1	5p15.33	2010-02-17			ENSG00000185028	ENSG00000185028			37268	protein-coding gene	gene with protein product							Standard	NM_001080478		Approved		uc003jal.1	A6NHZ5	OTTHUMG00000161578	ENST00000328278.3:c.728C>T	5.37:g.192381C>T	ENSP00000327675:p.Ser243Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S243L	ENST00000328278.3	37	c.728	CCDS47184.1	5	.	.	.	.	.	.	.	.	.	.	C	14.86	2.660801	0.47572	.	.	ENSG00000185028	ENST00000328278	T	0.54479	0.57	5.33	5.33	0.75918	.	0.238609	0.44483	D	0.000454	T	0.65821	0.2728	M	0.80183	2.485	0.09310	N	0.999998	D	0.69078	0.997	P	0.55011	0.766	T	0.62515	-0.6838	10	0.39692	T	0.17	.	12.2706	0.54704	0.0:0.8289:0.1711:0.0	.	243	A6NHZ5	LR14B_HUMAN	L	243	ENSP00000327675:S243L	ENSP00000327675:S243L	S	+	2	0	LRRC14B	245381	1.000000	0.71417	0.040000	0.18447	0.877000	0.50540	5.707000	0.68370	2.498000	0.84270	0.462000	0.41574	TCG	LRRC14B	-	NULL	ENSG00000185028		0.716	LRRC14B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRC14B	HGNC	protein_coding	OTTHUMT00000365393.2	15	0.00	0	C	NM_001080478		192381	192381	+1	no_errors	ENST00000328278	ensembl	human	novel	69_37n	missense	34	22.73	10	SNP	0.091	T
LY96	23643	genome.wustl.edu	37	8	74939031	74939031	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:74939031G>A	ENST00000284818.2	+	4	430	c.339G>A	c.(337-339)gtG>gtA	p.V113V	LY96_ENST00000518893.1_Silent_p.V83V	NM_015364.4	NP_056179	Q9Y6Y9	LY96_HUMAN	lymphocyte antigen 96	113					cell surface receptor signaling pathway (GO:0007166)|cellular defense response (GO:0006968)|detection of lipopolysaccharide (GO:0032497)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|response to lipopolysaccharide (GO:0032496)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	endosome membrane (GO:0010008)|extracellular region (GO:0005576)|lipopolysaccharide receptor complex (GO:0046696)|plasma membrane (GO:0005886)	coreceptor activity (GO:0015026)|lipopolysaccharide receptor activity (GO:0001875)			endometrium(1)|large_intestine(2)|lung(1)|upper_aerodigestive_tract(1)	5	Breast(64;0.0311)		Epithelial(68;0.0208)|BRCA - Breast invasive adenocarcinoma(89;0.0499)|all cancers(69;0.0619)			CAGAGACTGTGAATACAACAA	0.313																																					GBM(131;1357 1748 34893 50149 52212)	dbGAP											0													87.0	82.0	84.0					8																	74939031		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			AB018549	CCDS6216.1, CCDS56540.1	8q13.3	2004-01-22			ENSG00000154589	ENSG00000154589			17156	protein-coding gene	gene with protein product		605243				10359581, 11466383	Standard	NM_015364		Approved	MD-2	uc003yad.3	Q9Y6Y9	OTTHUMG00000164504	ENST00000284818.2:c.339G>A	8.37:g.74939031G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3Y6A5|E5RJJ7	Silent	SNP	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	p.V113	ENST00000284818.2	37	c.339	CCDS6216.1	8																																																																																			LY96	-	pfam_MD-2_lipid-recog,superfamily_Ig_E-set,smart_MD-2_lipid-recog	ENSG00000154589		0.313	LY96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LY96	HGNC	protein_coding	OTTHUMT00000379032.2	172	0.00	0	G	NM_015364		74939031	74939031	+1	no_errors	ENST00000284818	ensembl	human	known	69_37n	silent	116	22.67	34	SNP	0.506	A
MARK1	4139	genome.wustl.edu	37	1	220804452	220804452	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:220804452G>A	ENST00000366917.4	+	10	1251	c.985G>A	c.(985-987)Gat>Aat	p.D329N	MARK1_ENST00000402574.1_Missense_Mutation_p.D194N|MARK1_ENST00000366918.4_Missense_Mutation_p.D307N					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GCCTGATCCGGATTTCAATGA	0.363																																						dbGAP											0													102.0	98.0	99.0					1																	220804452		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.985G>A	1.37:g.220804452G>A	ENSP00000355884:p.Asp329Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D329N	ENST00000366917.4	37	c.985	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988947	0.93106	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.32515	1.45;1.45;1.45	5.78	4.87	0.63330	Ubiquitin-associated/translation elongation factor EF1B, N-terminal, eukaryote (1);	0.000000	0.85682	D	0.000000	T	0.56108	0.1963	M	0.77406	2.37	0.80722	D	1	B;B;P;P	0.51351	0.077;0.027;0.608;0.944	B;B;B;D	0.65874	0.031;0.038;0.11;0.939	T	0.61671	-0.7015	10	0.66056	D	0.02	.	15.2203	0.73306	0.0675:0.0:0.9325:0.0	.	329;194;329;307	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	N	194;307;329	ENSP00000386017:D194N;ENSP00000355885:D307N;ENSP00000355884:D329N	ENSP00000355884:D329N	D	+	1	0	MARK1	218871075	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	9.571000	0.98176	1.595000	0.50050	0.655000	0.94253	GAT	MARK1	-	pfscan_UBA/transl_elong_EF1B_N_euk	ENSG00000116141		0.363	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	187	0.00	0	G			220804452	220804452	+1	no_errors	ENST00000366917	ensembl	human	known	69_37n	missense	141	33.80	72	SNP	1.000	A
MESDC2	23184	genome.wustl.edu	37	15	81271807	81271807	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr15:81271807C>G	ENST00000261758.4	-	3	544	c.458G>C	c.(457-459)gGa>gCa	p.G153A	MESDC2_ENST00000560244.1_5'Flank	NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	153	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						ACGGTCTGATCCCACAATGAA	0.498																																						dbGAP											0													67.0	64.0	65.0					15																	81271807		2203	4300	6503	-	-	-	SO:0001583	missense	0			D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.458G>C	15.37:g.81271807C>G	ENSP00000261758:p.Gly153Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	pfam_Mesoderm_development_cand-2	p.G153A	ENST00000261758.4	37	c.458	CCDS32308.1	15	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315315	0.60524	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.9	4.98	0.66077	.	0.000000	0.85682	D	0.000000	T	0.56601	0.1996	L	0.45581	1.43	0.80722	D	1	B	0.24823	0.112	B	0.19666	0.026	T	0.55792	-0.8085	9	0.52906	T	0.07	-0.0096	15.1125	0.72368	0.0:0.9326:0.0:0.0674	.	153	Q14696	MESD_HUMAN	A	153	.	ENSP00000261758:G153A	G	-	2	0	MESDC2	79058862	1.000000	0.71417	0.910000	0.35882	0.972000	0.66771	7.480000	0.81109	1.525000	0.49052	0.650000	0.86243	GGA	MESDC2	-	pfam_Mesoderm_development_cand-2	ENSG00000117899		0.498	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESDC2	HGNC	protein_coding	OTTHUMT00000417673.2	76	0.00	0	C	NM_015154		81271807	81271807	-1	no_errors	ENST00000261758	ensembl	human	known	69_37n	missense	47	25.40	16	SNP	1.000	G
MKRN1	23608	genome.wustl.edu	37	7	140154430	140154430	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:140154430C>T	ENST00000255977.2	-	8	1560	c.1336G>A	c.(1336-1338)Gag>Aag	p.E446K	MKRN1_ENST00000437223.2_Missense_Mutation_p.E180K|MKRN1_ENST00000474576.1_Missense_Mutation_p.E382K	NM_013446.3	NP_038474.2	Q9UHC7	MKRN1_HUMAN	makorin ring finger protein 1	446					protein polyubiquitination (GO:0000209)		chromatin binding (GO:0003682)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E446K(1)		endometrium(1)|kidney(1)|large_intestine(3)|lung(9)|ovary(1)|skin(1)	16	Melanoma(164;0.00956)					AGCAACATCTCGCCCAGCTCA	0.478																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											113.0	90.0	98.0					7																	140154430		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF192784	CCDS5860.1, CCDS47725.1	7q34	2013-01-09	2008-08-13		ENSG00000133606	ENSG00000133606		"""RING-type (C3HC4) zinc fingers"""	7112	protein-coding gene	gene with protein product		607754				10843807	Standard	NM_013446		Approved	RNF61	uc003vvt.2	Q9UHC7	OTTHUMG00000157412	ENST00000255977.2:c.1336G>A	7.37:g.140154430C>T	ENSP00000255977:p.Glu446Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1T7|B3KXB4|Q256Y7|Q59G11|Q6GSF1|Q9H0G0|Q9UEZ7|Q9UHW2	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_Znf_C3HC4_RING-type,smart_Znf_CCCH,smart_Znf_RING,pfscan_Znf_RING	p.E446K	ENST00000255977.2	37	c.1336	CCDS5860.1	7	.	.	.	.	.	.	.	.	.	.	C	18.27	3.586540	0.66105	.	.	ENSG00000133606	ENST00000255977;ENST00000539898;ENST00000437223;ENST00000474576	T;T;T	0.31769	2.85;1.48;2.19	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.31451	0.0797	M	0.67397	2.05	0.80722	D	1	P	0.38788	0.647	B	0.24006	0.05	T	0.32508	-0.9904	10	0.56958	D	0.05	.	19.0564	0.93067	0.0:1.0:0.0:0.0	.	446	Q9UHC7	MKRN1_HUMAN	K	446;382;180;382	ENSP00000255977:E446K;ENSP00000439823:E180K;ENSP00000417863:E382K	ENSP00000255977:E446K	E	-	1	0	MKRN1	139800899	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.266000	0.78452	2.735000	0.93741	0.650000	0.86243	GAG	MKRN1	-	NULL	ENSG00000133606		0.478	MKRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MKRN1	HGNC	protein_coding	OTTHUMT00000348752.1	406	0.00	0	C	NM_013446		140154430	140154430	-1	no_errors	ENST00000255977	ensembl	human	known	69_37n	missense	277	17.31	58	SNP	1.000	T
KMT2B	9757	genome.wustl.edu	37	19	36210398	36210398	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:36210398G>C	ENST00000222270.7	+	2	391	c.391G>C	c.(391-393)Gat>Cat	p.D131H	KMT2B_ENST00000341701.1_Missense_Mutation_p.D131H|KMT2B_ENST00000420124.1_Missense_Mutation_p.D131H|KMT2B_ENST00000607650.1_RNA	NM_014727.1	NP_055542.1	Q9UMN6	KMT2B_HUMAN	lysine (K)-specific methyltransferase 2B	131					chromatin-mediated maintenance of transcription (GO:0048096)|gene silencing (GO:0016458)|histone H3-K4 methylation (GO:0051568)|histone H3-K4 trimethylation (GO:0080182)|oocyte differentiation (GO:0009994)|ovarian follicle development (GO:0001541)|ovulation (GO:0030728)|regulation of histone H3-K4 methylation (GO:0051569)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)										TTCAGATGAAGATGTGGCCCC	0.567																																						dbGAP											0													66.0	67.0	67.0					19																	36210398		1932	4135	6067	-	-	-	SO:0001583	missense	0			AJ007041	CCDS46055.1	19q13.1	2014-02-18			ENSG00000105663	ENSG00000272333		"""Chromatin-modifying enzymes / K-methyltransferases"""	15840	protein-coding gene	gene with protein product	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila) 4"""	606834				10409430, 10637508	Standard	XM_006723513		Approved	KIAA0304, MLL2, TRX2, HRX2, WBP7, MLL1B, MLL4		Q9UMN6	OTTHUMG00000048119	ENST00000222270.7:c.391G>C	19.37:g.36210398G>C	ENSP00000222270:p.Asp131His	Somatic		WXS	Illumina GAIIx	Phase_IV	O15022|O95836|Q96GP2|Q96IP3|Q9UK25|Q9Y668|Q9Y669	Missense_Mutation	SNP	pirsf_MeTrfase_trithorax,pfam_SET_dom,pfam_FYrich_C,pfam_Znf_PHD-finger,pfam_FYrich_N,pfam_Znf_CXXC,superfamily_Znf_FYVE_PHD,superfamily_Bromodomain,smart_Znf_PHD,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.D131H	ENST00000222270.7	37	c.391	CCDS46055.1	19	.	.	.	.	.	.	.	.	.	.	G	16.53	3.149245	0.57151	.	.	ENSG00000105663	ENST00000222270;ENST00000420124;ENST00000341701	D;D;T	0.86097	-2.07;-2.07;0.47	5.35	5.35	0.76521	.	0.188498	0.26251	N	0.025451	T	0.76399	0.3982	N	0.14661	0.345	0.32358	N	0.557599	P	0.50710	0.938	P	0.45946	0.498	T	0.82102	-0.0623	10	0.87932	D	0	.	10.0678	0.42315	0.0915:0.0:0.9085:0.0	.	131	Q9UMN6	MLL4_HUMAN	H	131	ENSP00000222270:D131H;ENSP00000398837:D131H;ENSP00000345761:D131H	ENSP00000222270:D131H	D	+	1	0	AD000671.1	40902238	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	2.941000	0.49011	2.516000	0.84829	0.561000	0.74099	GAT	MLL4	-	pirsf_MeTrfase_trithorax	ENSG00000105663		0.567	KMT2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL4	Clone_based_vega_gene	protein_coding		235	0.00	0	G	NM_014727		36210398	36210398	+1	no_errors	ENST00000222270	ensembl	human	known	69_37n	missense	145	13.17	22	SNP	1.000	C
MRPS14	63931	genome.wustl.edu	37	1	174983888	174983888	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:174983888G>A	ENST00000476371.1	-	3	320	c.304C>T	c.(304-306)Cgg>Tgg	p.R102W	MRPS14_ENST00000498253.1_5'UTR	NM_022100.2	NP_071383.1			mitochondrial ribosomal protein S14											large_intestine(2)|lung(5)|pancreas(1)|prostate(2)	10						CTCCAGCGCCGCTTCACACCA	0.537																																						dbGAP											0													144.0	135.0	138.0					1																	174983888		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051350	CCDS1316.1	1q25.1	2012-09-13			ENSG00000120333	ENSG00000120333		"""Mitochondrial ribosomal proteins / small subunits"""	14049	protein-coding gene	gene with protein product		611978					Standard	NR_037606		Approved	HSMRPS14	uc001gkk.3	O60783	OTTHUMG00000034878	ENST00000476371.1:c.304C>T	1.37:g.174983888G>A	ENSP00000420714:p.Arg102Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_S14	p.R102W	ENST00000476371.1	37	c.304	CCDS1316.1	1	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198999	0.58126	.	.	ENSG00000120333	ENST00000476371	.	.	.	6.07	4.02	0.46733	.	0.000000	0.85682	D	0.000000	T	0.75686	0.3883	H	0.96365	3.81	0.58432	D	0.999999	B	0.18013	0.025	B	0.21546	0.035	T	0.77843	-0.2437	9	0.66056	D	0.02	-21.5772	10.1835	0.42984	0.0668:0.0:0.595:0.3382	.	102	O60783	RT14_HUMAN	W	102	.	ENSP00000420714:R102W	R	-	1	2	MRPS14	173250511	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.603000	0.46266	1.562000	0.49601	0.655000	0.94253	CGG	MRPS14	-	pfam_Ribosomal_S14	ENSG00000120333		0.537	MRPS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPS14	HGNC	protein_coding	OTTHUMT00000084416.2	87	0.00	0	G	NM_022100		174983888	174983888	-1	no_errors	ENST00000476371	ensembl	human	known	69_37n	missense	109	10.66	13	SNP	1.000	A
MTMR9	66036	genome.wustl.edu	37	8	11180245	11180245	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:11180245G>A	ENST00000221086.3	+	10	2071	c.1598G>A	c.(1597-1599)cGa>cAa	p.R533Q	MTMR9_ENST00000526292.1_Missense_Mutation_p.R448Q|AF131216.6_ENST00000498997.2_RNA	NM_015458.3	NP_056273.2	Q96QG7	MTMR9_HUMAN	myotubularin related protein 9	533						cytoplasm (GO:0005737)	enzyme regulator activity (GO:0030234)|phosphatase activity (GO:0016791)			cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(2)	16			STAD - Stomach adenocarcinoma(15;0.215)	COAD - Colon adenocarcinoma(149;0.0678)		AATATCCTTCGAAGGCAGTTG	0.448																																						dbGAP											0													77.0	76.0	76.0					8																	11180245		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ297823	CCDS5979.1	8p23-p22	2011-06-09	2002-09-05	2002-09-06	ENSG00000104643	ENSG00000104643		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	14596	protein-coding gene	gene with protein product		606260	"""myotubularin related protein 8"""	C8orf9, MTMR8		11472061, 11896452, 12890864	Standard	NM_015458		Approved	DKFZp434K171, LIP-STYX	uc003wtm.3	Q96QG7	OTTHUMG00000090647	ENST00000221086.3:c.1598G>A	8.37:g.11180245G>A	ENSP00000221086:p.Arg533Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z291|Q52LU3|Q8WW11|Q96QG6|Q9NX50	Missense_Mutation	SNP	pfam_Myotub-related	p.R533Q	ENST00000221086.3	37	c.1598	CCDS5979.1	8	.	.	.	.	.	.	.	.	.	.	G	33	5.194829	0.94960	.	.	ENSG00000104643	ENST00000221086;ENST00000526292	D;D	0.95205	-3.54;-3.64	5.7	5.7	0.88788	.	0.043939	0.85682	D	0.000000	D	0.89674	0.6783	N	0.24115	0.695	0.80722	D	1	B	0.34264	0.446	B	0.31245	0.126	D	0.87595	0.2493	10	0.22706	T	0.39	.	18.81	0.92054	0.0:0.0:1.0:0.0	.	533	Q96QG7	MTMR9_HUMAN	Q	533;448	ENSP00000221086:R533Q;ENSP00000433239:R448Q	ENSP00000221086:R533Q	R	+	2	0	MTMR9	11217655	1.000000	0.71417	0.967000	0.41034	0.730000	0.41778	9.247000	0.95444	2.678000	0.91216	0.655000	0.94253	CGA	MTMR9	-	NULL	ENSG00000104643		0.448	MTMR9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR9	HGNC	protein_coding	OTTHUMT00000207307.2	148	0.67	1	G	NM_015458		11180245	11180245	+1	no_errors	ENST00000221086	ensembl	human	known	69_37n	missense	79	24.76	26	SNP	0.991	A
NLRP11	204801	genome.wustl.edu	37	19	56297174	56297174	+	Frame_Shift_Del	DEL	T	T	-			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:56297174delT	ENST00000589093.1	-	10	3012	c.2919delA	c.(2917-2919)aaafs	p.K973fs	NLRP11_ENST00000592953.1_Frame_Shift_Del_p.K874fs|NLRP11_ENST00000589824.2_Frame_Shift_Del_p.K919fs|NLRP11_ENST00000443188.1_Frame_Shift_Del_p.K973fs|NLRP11_ENST00000360133.3_Frame_Shift_Del_p.K919fs			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	973							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		TCAAACTGGGTTTTCTTTCCT	0.428																																						dbGAP											0													79.0	76.0	77.0					19																	56297174		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2919delA	19.37:g.56297174delT	ENSP00000466285:p.Lys973fs	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Frame_Shift_Del	DEL	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.K973fs	ENST00000589093.1	37	c.2919	CCDS12935.1	19																																																																																			NLRP11	-	NULL	ENSG00000179873		0.428	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	79	0.00	0	T	NM_145007		56297174	56297174	-1	no_errors	ENST00000443188	ensembl	human	known	69_37n	frame_shift_del	115	10.00	13	DEL	0.001	-
NUP153	9972	genome.wustl.edu	37	6	17637836	17637836	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:17637836T>A	ENST00000262077.2	-	16	2011	c.2012A>T	c.(2011-2013)aAc>aTc	p.N671I	NUP153_ENST00000537253.1_Missense_Mutation_p.N702I	NM_005124.2	NP_005115.2	P49790	NU153_HUMAN	nucleoporin 153kDa	671					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|negative regulation of RNA export from nucleus (GO:0046832)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)|viral penetration into host nucleus (GO:0075732)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|nucleocytoplasmic transporter activity (GO:0005487)|protein anchor (GO:0043495)|structural constituent of nuclear pore (GO:0017056)|transporter activity (GO:0005215)|zinc ion binding (GO:0008270)			NS(2)|breast(6)|endometrium(4)|kidney(3)|large_intestine(7)|lung(23)|ovary(3)|skin(3)|urinary_tract(2)	53	Breast(50;0.0259)|Ovarian(93;0.0584)	all_hematologic(90;0.125)	all cancers(50;0.0981)|Epithelial(50;0.112)			TGTAACTTTGTTCTGGAGTAG	0.413																																						dbGAP											0													233.0	211.0	219.0					6																	17637836		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z25535	CCDS4541.1, CCDS64359.1, CCDS75407.1	6p22.3	2008-07-29	2002-08-29		ENSG00000124789	ENSG00000124789			8062	protein-coding gene	gene with protein product		603948	"""nucleoporin 153kD"""			8110839	Standard	NM_001278209		Approved	HNUP153	uc003ncd.2	P49790	OTTHUMG00000014312	ENST00000262077.2:c.2012A>T	6.37:g.17637836T>A	ENSP00000262077:p.Asn671Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIK2|E7EPX5|F6QR24|Q4LE47|Q5T9I7|Q7Z743	Missense_Mutation	SNP	pfam_Nucleoporin_Nup153,pfam_Znf_RanBP2,pfam_Retro-transposon_transp_CS,smart_Znf_RanBP2,pfscan_Znf_RanBP2	p.N702I	ENST00000262077.2	37	c.2105	CCDS4541.1	6	.	.	.	.	.	.	.	.	.	.	T	25.1	4.599990	0.87055	.	.	ENSG00000124789	ENST00000262077;ENST00000430136;ENST00000537253	D;D	0.99683	-6.39;-6.39	6.11	6.11	0.99139	Zinc finger, RanBP2-type (4);	0.000000	0.56097	D	0.000021	D	0.99736	0.9896	M	0.87971	2.92	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;1.0;0.967	D	0.97368	0.9974	10	0.87932	D	0	-16.3688	16.7021	0.85357	0.0:0.0:0.0:1.0	.	702;651;671	F6QR24;Q4LE47;P49790	.;.;NU153_HUMAN	I	671;651;702	ENSP00000262077:N671I;ENSP00000444029:N702I	ENSP00000262077:N671I	N	-	2	0	NUP153	17745815	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.436000	0.80404	2.343000	0.79666	0.533000	0.62120	AAC	NUP153	-	pfam_Znf_RanBP2,smart_Znf_RanBP2,pfscan_Znf_RanBP2	ENSG00000124789		0.413	NUP153-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP153	HGNC	protein_coding	OTTHUMT00000039953.1	330	0.00	0	T			17637836	17637836	-1	no_errors	ENST00000537253	ensembl	human	known	69_37n	missense	427	10.48	50	SNP	1.000	A
OR2B2	81697	genome.wustl.edu	37	6	27879467	27879467	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:27879467C>T	ENST00000303324.2	-	1	707	c.631G>A	c.(631-633)Gtg>Atg	p.V211M		NM_033057.2	NP_149046.2	Q9GZK3	OR2B2_HUMAN	olfactory receptor, family 2, subfamily B, member 2	211						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(4)|large_intestine(5)|lung(10)|prostate(1)|urinary_tract(1)	22						ATGAGTGTCACGGGTATTAGA	0.453																																						dbGAP											0													122.0	110.0	114.0					6																	27879467		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z98744	CCDS4641.1	6p22.3-p21.3	2014-02-19	2002-02-28		ENSG00000168131	ENSG00000168131		"""GPCR / Class A : Olfactory receptors"""	13966	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily B, member 9"""	OR2B9			Standard	NM_033057		Approved	hs6M1-10, OR6-1, OR2B2Q	uc011dkw.2	Q9GZK3	OTTHUMG00000014495	ENST00000303324.2:c.631G>A	6.37:g.27879467C>T	ENSP00000304419:p.Val211Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNH2|Q9GZL2|Q9Y299	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.V211M	ENST00000303324.2	37	c.631	CCDS4641.1	6	.	.	.	.	.	.	.	.	.	.	C	3.350	-0.132840	0.06711	.	.	ENSG00000168131	ENST00000303324	T	0.38401	1.14	4.32	-1.62	0.08372	GPCR, rhodopsin-like superfamily (1);	0.221639	0.21849	U	0.068205	T	0.09335	0.0230	L	0.33485	1.01	0.09310	N	1	P	0.41784	0.762	B	0.33454	0.164	T	0.20605	-1.0270	10	0.87932	D	0	.	10.3696	0.44046	0.1375:0.2669:0.5956:0.0	.	211	Q9GZK3	OR2B2_HUMAN	M	211	ENSP00000304419:V211M	ENSP00000304419:V211M	V	-	1	0	OR2B2	27987446	0.000000	0.05858	0.004000	0.12327	0.038000	0.13279	-4.401000	0.00240	-0.142000	0.11354	-0.223000	0.12442	GTG	OR2B2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000168131		0.453	OR2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2B2	HGNC	protein_coding	OTTHUMT00000040163.1	208	0.00	0	C			27879467	27879467	-1	no_errors	ENST00000303324	ensembl	human	known	69_37n	missense	83	20.19	21	SNP	0.000	T
OR2L8	391190	genome.wustl.edu	37	1	248112345	248112345	+	Silent	SNP	G	G	A	rs567135028		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:248112345G>A	ENST00000357191.3	+	1	186	c.186G>A	c.(184-186)ctG>ctA	p.L62L	OR2L13_ENST00000366478.2_Intron	NM_001001963.1	NP_001001963.1	Q8NGY9	OR2L8_HUMAN	olfactory receptor, family 2, subfamily L, member 8 (gene/pseudogene)	62						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|kidney(3)|large_intestine(3)|lung(30)|ovary(1)|prostate(1)|skin(3)	42	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ATTTCCTACTGAGTCAGCTCT	0.423																																						dbGAP											0													383.0	334.0	351.0					1																	248112345		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004459	CCDS31101.1	1q44	2013-10-10	2013-10-10		ENSG00000196936	ENSG00000196936		"""GPCR / Class A : Olfactory receptors"""	15014	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily L, member 8"""				Standard	NM_001001963		Approved		uc001idt.1	Q8NGY9	OTTHUMG00000040196	ENST00000357191.3:c.186G>A	1.37:g.248112345G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF03	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L62	ENST00000357191.3	37	c.186	CCDS31101.1	1																																																																																			OR2L8	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000196936		0.423	OR2L8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L8	HGNC	protein_coding	OTTHUMT00000096853.2	461	0.22	1	G			248112345	248112345	+1	no_errors	ENST00000357191	ensembl	human	known	69_37n	silent	532	14.03	87	SNP	0.000	A
OR4C12	283093	genome.wustl.edu	37	11	50003262	50003262	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:50003262G>A	ENST00000335238.4	-	1	809	c.776C>T	c.(775-777)tCa>tTa	p.S259L		NM_001005270.2	NP_001005270.2	Q96R67	OR4CC_HUMAN	olfactory receptor, family 4, subfamily C, member 12	259						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.S259*(1)		NS(1)|kidney(4)|large_intestine(3)|liver(1)|lung(19)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	36						AGTGGTCACTGAGCGCAGATA	0.433																																						dbGAP											1	Substitution - Nonsense(1)	NS(1)											73.0	67.0	69.0					11																	50003262		2201	4296	6497	-	-	-	SO:0001583	missense	0			BK004413	CCDS31496.1	11p11.12	2012-08-09			ENSG00000221954	ENSG00000221954		"""GPCR / Class A : Olfactory receptors"""	15168	protein-coding gene	gene with protein product							Standard	NM_001005270		Approved		uc010ria.2	Q96R67	OTTHUMG00000166687	ENST00000335238.4:c.776C>T	11.37:g.50003262G>A	ENSP00000334418:p.Ser259Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNF0|Q6IF49	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.S259L	ENST00000335238.4	37	c.776	CCDS31496.1	11	.	.	.	.	.	.	.	.	.	.	.	9.178	1.022769	0.19433	.	.	ENSG00000221954	ENST00000335238	T	0.00145	8.67	2.98	2.98	0.34508	GPCR, rhodopsin-like superfamily (1);	0.169924	0.27539	U	0.018908	T	0.00144	0.0004	N	0.21324	0.655	0.09310	N	1	B	0.19706	0.038	B	0.29440	0.102	T	0.34875	-0.9811	10	0.87932	D	0	.	11.934	0.52864	0.0:0.0:1.0:0.0	.	259	Q96R67	OR4CC_HUMAN	L	259	ENSP00000334418:S259L	ENSP00000334418:S259L	S	-	2	0	OR4C12	49959838	0.931000	0.31567	0.185000	0.23176	0.296000	0.27459	3.785000	0.55424	1.698000	0.51180	0.398000	0.26397	TCA	OR4C12	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000221954		0.433	OR4C12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C12	HGNC	protein_coding	OTTHUMT00000391104.1	129	0.00	0	G	NM_001005270		50003262	50003262	-1	no_errors	ENST00000335238	ensembl	human	known	69_37n	missense	183	14.88	32	SNP	0.170	A
OR5B17	219965	genome.wustl.edu	37	11	58126186	58126186	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:58126186G>A	ENST00000357377.3	-	1	356	c.357C>T	c.(355-357)gaC>gaT	p.D119D		NM_001005489.1	NP_001005489.1	Q8NGF7	OR5BH_HUMAN	olfactory receptor, family 5, subfamily B, member 17	119						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|endometrium(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	30	Esophageal squamous(5;0.0027)	Breast(21;0.0778)				CTGCGTAGCGGTCATAGGCCA	0.473																																						dbGAP											0													123.0	111.0	115.0					11																	58126186		2201	4295	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065849	CCDS31548.1	11q12.1	2012-08-09			ENSG00000197786	ENSG00000197786		"""GPCR / Class A : Olfactory receptors"""	15267	protein-coding gene	gene with protein product				OR5B20P			Standard	NM_001005489		Approved		uc010rke.2	Q8NGF7	OTTHUMG00000167465	ENST00000357377.3:c.357C>T	11.37:g.58126186G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEX1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.D119	ENST00000357377.3	37	c.357	CCDS31548.1	11																																																																																			OR5B17	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000197786		0.473	OR5B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5B17	HGNC	protein_coding	OTTHUMT00000394708.2	231	0.00	0	G	NM_001005489		58126186	58126186	-1	no_errors	ENST00000357377	ensembl	human	known	69_37n	silent	151	26.57	55	SNP	0.991	A
OR6K6	128371	genome.wustl.edu	37	1	158724994	158724994	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:158724994A>T	ENST00000368144.2	+	1	485	c.389A>T	c.(388-390)tAc>tTc	p.Y130F		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	130						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					CTGCAGATGTACTTTTTCCAC	0.502																																						dbGAP											0													77.0	75.0	76.0					1																	158724994		2203	4300	6503	-	-	-	SO:0001583	missense	0			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.389A>T	1.37:g.158724994A>T	ENSP00000357126:p.Tyr130Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EIM8|Q5VUU9|Q6IFR4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Y130F	ENST00000368144.2	37	c.389	CCDS30904.1	1	.	.	.	.	.	.	.	.	.	.	A	14.32	2.499203	0.44455	.	.	ENSG00000180433	ENST00000368144	T	0.00932	5.53	5.48	5.48	0.80851	GPCR, rhodopsin-like superfamily (1);	0.000000	0.39909	N	0.001221	T	0.00936	0.0031	N	0.26162	0.8	0.32855	D	0.507124	D	0.89917	1.0	D	0.87578	0.998	T	0.68519	-0.5387	10	0.17832	T	0.49	-16.6487	10.3593	0.43982	0.853:0.0:0.0:0.147	.	130	Q8NGW6	OR6K6_HUMAN	F	130	ENSP00000357126:Y130F	ENSP00000357126:Y130F	Y	+	2	0	OR6K6	156991618	0.476000	0.25901	1.000000	0.80357	0.914000	0.54420	0.890000	0.28295	2.297000	0.77311	0.533000	0.62120	TAC	OR6K6	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000180433		0.502	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	111	0.00	0	A	NM_001005184		158724994	158724994	+1	no_errors	ENST00000368144	ensembl	human	known	69_37n	missense	143	15.38	26	SNP	1.000	T
ORC2	4999	genome.wustl.edu	37	2	201778053	201778053	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr2:201778053C>T	ENST00000234296.2	-	17	1861	c.1612G>A	c.(1612-1614)Gaa>Aaa	p.E538K		NM_006190.4	NP_006181.1	Q13416	ORC2_HUMAN	origin recognition complex, subunit 2	538					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	condensed chromosome inner kinetochore (GO:0000939)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|origin recognition complex (GO:0000808)|plasma membrane (GO:0005886)	DNA replication origin binding (GO:0003688)			breast(1)|endometrium(1)|large_intestine(2)|lung(10)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	20						TCCCTAAATTCAGTTAACTGG	0.428																																						dbGAP											0													111.0	102.0	105.0					2																	201778053		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2334.1	2q33	2010-10-12	2010-10-12	2010-10-12	ENSG00000115942	ENSG00000115942			8488	protein-coding gene	gene with protein product		601182	"""origin recognition complex, subunit 2 (yeast homolog)-like"", ""origin recognition complex, subunit 2-like (yeast)"", ""origin recognition complex, subunit 2 homolog (yeast)"""	ORC2L		8808289	Standard	NM_006190		Approved		uc002uwr.3	Q13416	OTTHUMG00000132783	ENST00000234296.2:c.1612G>A	2.37:g.201778053C>T	ENSP00000234296:p.Glu538Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13204|Q53TX5	Missense_Mutation	SNP	pfam_ORC2	p.E538K	ENST00000234296.2	37	c.1612	CCDS2334.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.752549	0.96890	.	.	ENSG00000115942	ENST00000234296	T	0.80393	-1.37	5.6	5.6	0.85130	.	0.000000	0.85682	D	0.000000	D	0.93041	0.7785	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.94477	0.7690	10	0.87932	D	0	-20.0368	19.62	0.95651	0.0:1.0:0.0:0.0	.	538	Q13416	ORC2_HUMAN	K	538	ENSP00000234296:E538K	ENSP00000234296:E538K	E	-	1	0	ORC2	201486298	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.598000	0.82745	2.618000	0.88619	0.591000	0.81541	GAA	ORC2	-	pfam_ORC2	ENSG00000115942		0.428	ORC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORC2	HGNC	protein_coding	OTTHUMT00000256191.2	93	0.00	0	C	NM_006190		201778053	201778053	-1	no_errors	ENST00000234296	ensembl	human	known	69_37n	missense	67	29.90	29	SNP	1.000	T
PADI6	353238	genome.wustl.edu	37	1	17714946	17714946	+	RNA	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:17714946G>A	ENST00000434762.2	+	0	800							Q6TGC4	PADI6_HUMAN	peptidyl arginine deiminase, type VI						cytoplasm organization (GO:0007028)|cytoskeleton organization (GO:0007010)|protein citrullination (GO:0018101)|regulation of translation by machinery localization (GO:0043143)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|protein-arginine deiminase activity (GO:0004668)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(9)|ovary(2)	29		Colorectal(325;3.46e-05)|Breast(348;0.000162)|all_lung(284;0.000337)|Lung NSC(340;0.000419)|Renal(390;0.000518)|Ovarian(437;0.00409)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00488)|BRCA - Breast invasive adenocarcinoma(304;7.59e-06)|COAD - Colon adenocarcinoma(227;1.18e-05)|Kidney(64;0.000186)|KIRC - Kidney renal clear cell carcinoma(64;0.00272)|STAD - Stomach adenocarcinoma(196;0.0134)|READ - Rectum adenocarcinoma(331;0.0655)|Lung(427;0.189)	L-Citrulline(DB00155)	CCCTCCTCGGGAACCACTTGA	0.542																																						dbGAP											0													55.0	53.0	54.0					1																	17714946		1885	4116	6001	-	-	-			0			AY422079	CCDS72715.1	1p36.13	2014-07-10			ENSG00000256049	ENSG00000276747	3.5.3.15	"""Peptidyl arginine deiminases"""	20449	protein-coding gene	gene with protein product		610363				15087120	Standard	NM_207421		Approved		uc001bak.1	Q6TGC4	OTTHUMG00000002372		1.37:g.17714946G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q330K5|Q70SX3	RNA	SNP	-	NULL	ENST00000434762.2	37	NULL		1																																																																																			PADI6	-	-	ENSG00000256049		0.542	PADI6-001	KNOWN	basic	processed_transcript	PADI6	HGNC	processed_transcript	OTTHUMT00000006804.4	139	0.00	0	G	NM_207421		17714946	17714946	+1	no_errors	ENST00000358481	ensembl	human	known	69_37n	rna	85	20.56	22	SNP	0.000	A
PCDHGA6	56109	genome.wustl.edu	37	5	140755127	140755127	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:140755127G>T	ENST00000517434.1	+	1	1477	c.1477G>T	c.(1477-1479)Gaa>Taa	p.E493*	PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB2_ENST00000522605.1_Intron	NM_018919.2|NM_032086.1	NP_061742.1|NP_114475.1	Q9Y5G7	PCDG6_HUMAN	protocadherin gamma subfamily A, 6	493	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|large_intestine(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTCACTGGCAGAAGACACCCT	0.577																																						dbGAP											0													113.0	129.0	124.0					5																	140755127		2078	4231	6309	-	-	-	SO:0001587	stop_gained	0			AF152513	CCDS54926.1, CCDS75335.1	5q31	2010-01-26				ENSG00000253731		"""Cadherins / Protocadherins : Clustered"""	8704	other	protocadherin		606293				10380929	Standard	NM_018919		Approved	PCDH-GAMMA-A6		Q9Y5G7		ENST00000517434.1:c.1477G>T	5.37:g.140755127G>T	ENSP00000429601:p.Glu493*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8K7|B2RN55|Q9Y5D1	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E493*	ENST00000517434.1	37	c.1477	CCDS54926.1	5	.	.	.	.	.	.	.	.	.	.	.	15.18	2.755798	0.49362	.	.	ENSG00000253731	ENST00000517434	.	.	.	5.13	2.93	0.34026	.	0.654458	0.11243	U	0.584422	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	8.0214	0.30412	0.289:0.0:0.711:0.0	.	.	.	.	X	493	.	ENSP00000429601:E493X	E	+	1	0	PCDHGA6	140735311	0.996000	0.38824	0.011000	0.14972	0.009000	0.06853	2.550000	0.45811	0.605000	0.29947	-0.140000	0.14226	GAA	PCDHGA6	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000253731		0.577	PCDHGA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA6	HGNC	protein_coding	OTTHUMT00000374743.1	81	0.00	0	G	NM_018919		140755127	140755127	+1	no_errors	ENST00000517434	ensembl	human	known	69_37n	nonsense	61	25.61	21	SNP	0.117	T
PCID2	55795	genome.wustl.edu	37	13	113851339	113851339	+	Intron	SNP	G	G	A	rs147592475		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr13:113851339G>A	ENST00000337344.4	-	4	343				PCID2_ENST00000246505.5_Missense_Mutation_p.S140L|PCID2_ENST00000375477.1_Intron|PCID2_ENST00000375479.2_Intron|PCID2_ENST00000375457.2_Intron|PCID2_ENST00000375459.1_Intron	NM_001127202.2	NP_001120674.1	Q5JVF3	PCID2_HUMAN	PCI domain containing 2						negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity (GO:2000117)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of mRNA stability (GO:0043488)|spleen development (GO:0048536)					breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)	20	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_lung(25;0.216)|all_epithelial(44;0.234)	all cancers(43;0.104)			GTACCCAAGTGAAAGAGCTGA	0.438																																						dbGAP											0													91.0	95.0	93.0					13																	113851339		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK002167	CCDS9532.2, CCDS58301.1, CCDS58302.1	13q34	2006-03-31			ENSG00000126226	ENSG00000126226			25653	protein-coding gene	gene with protein product		613713				12477932	Standard	NM_001127203		Approved	FLJ11305	uc031qnm.1	Q5JVF3	OTTHUMG00000017385	ENST00000337344.4:c.266+152C>T	13.37:g.113851339G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NK09|Q3ZCX1|Q5TC57|Q5TC58|Q9H7K1|Q9HBZ7|Q9NUK6|Q9NVY1|Q9NW44|Q9NWH3	Missense_Mutation	SNP	pfam_PCI_dom,smart_PAM	p.S140L	ENST00000337344.4	37	c.419	CCDS9532.2	13	.	.	.	.	.	.	.	.	.	.	G	3.804	-0.041055	0.07452	.	.	ENSG00000126226	ENST00000246505	.	.	.	3.2	-1.16	0.09678	.	.	.	.	.	T	0.16811	0.0404	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.23476	-1.0187	7	0.28530	T	0.3	7.6857	0.1874	0.00130	0.2517:0.235:0.2777:0.2357	.	140	Q5JVF3-4	.	L	140	.	ENSP00000246505:S140L	S	-	2	0	PCID2	112899340	0.001000	0.12720	0.000000	0.03702	0.058000	0.15608	-0.366000	0.07563	-0.011000	0.14247	0.557000	0.71058	TCA	PCID2	-	NULL	ENSG00000126226		0.438	PCID2-002	KNOWN	alternative_3_UTR|non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PCID2	HGNC	protein_coding	OTTHUMT00000045897.1	91	0.00	0	G	NM_018386		113851339	113851339	-1	no_errors	ENST00000246505	ensembl	human	known	69_37n	missense	51	21.54	14	SNP	0.000	A
PDE10A	10846	genome.wustl.edu	37	6	165863749	165863749	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr6:165863749C>T	ENST00000366882.1	-	5	451	c.297G>A	c.(295-297)ctG>ctA	p.L99L	PDE10A_ENST00000539869.2_Silent_p.L109L|PDE10A_ENST00000354448.4_Silent_p.L99L			Q9Y233	PDE10_HUMAN	phosphodiesterase 10A	99	GAF 1.				blood coagulation (GO:0007596)|cAMP catabolic process (GO:0006198)|cGMP catabolic process (GO:0046069)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of protein kinase A signaling (GO:0010738)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|metal ion binding (GO:0046872)			breast(4)|endometrium(5)|kidney(1)|large_intestine(13)|liver(1)|lung(39)|ovary(3)|skin(4)|upper_aerodigestive_tract(1)	71		Breast(66;0.000425)|Prostate(117;0.104)|Ovarian(120;0.221)		OV - Ovarian serous cystadenocarcinoma(33;1.5e-17)|BRCA - Breast invasive adenocarcinoma(81;1.8e-06)|GBM - Glioblastoma multiforme(31;1.92e-05)	Caffeine(DB00201)|Dipyridamole(DB00975)|Papaverine(DB01113)|Tofisopam(DB08811)|Triflusal(DB08814)	TGATGCTGCTCAGTTCATAGA	0.373																																					Esophageal Squamous(22;308 615 5753 12038 40624)	dbGAP											0													185.0	168.0	174.0					6																	165863749		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB020593	CCDS47513.1	6q26	2008-03-18			ENSG00000112541	ENSG00000112541	3.1.4.17	"""Phosphodiesterases"""	8772	protein-coding gene	gene with protein product		610652				10373451	Standard	NM_001130690		Approved		uc003quo.3	Q9Y233	OTTHUMG00000015986	ENST00000366882.1:c.297G>A	6.37:g.165863749C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FHX1|Q9HCP9|Q9NTV4|Q9ULW9|Q9Y5T1	Silent	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.L109	ENST00000366882.1	37	c.327		6																																																																																			PDE10A	-	smart_GAF	ENSG00000112541		0.373	PDE10A-001	PUTATIVE	basic	protein_coding	PDE10A	HGNC	protein_coding	OTTHUMT00000043031.1	257	0.00	0	C			165863749	165863749	-1	no_errors	ENST00000539869	ensembl	human	known	69_37n	silent	194	18.83	45	SNP	0.987	T
PDGFC	56034	genome.wustl.edu	37	4	157689125	157689125	+	Silent	SNP	G	G	A	rs201389930		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:157689125G>A	ENST00000502773.1	-	5	1211	c.721C>T	c.(721-723)Cta>Tta	p.L241L	PDGFC_ENST00000541126.1_Silent_p.L78L|PDGFC_ENST00000542208.1_Silent_p.L86L|PDGFC_ENST00000422544.2_Silent_p.L241L|PDGFC_ENST00000504672.1_5'UTR	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	241					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		TCCTCTGTTAGAAGGTTCAGA	0.383																																						dbGAP											0													143.0	134.0	137.0					4																	157689125		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.721C>T	4.37:g.157689125G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Silent	SNP	pfam_CUB,pfam_PD_growth_factor,superfamily_CUB,smart_CUB,smart_PD_growth_factor,pfscan_CUB,pfscan_PD_growth_factor	p.L241	ENST00000502773.1	37	c.721	CCDS3795.1	4	.	.	.	.	.	.	.	.	.	.	G	8.399	0.841530	0.16963	.	.	ENSG00000145431	ENST00000543489	.	.	.	5.21	5.21	0.72293	.	.	.	.	.	T	0.74703	0.3751	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.73830	-0.3859	5	0.40728	T	0.16	-7.46	18.7512	0.91816	0.0:0.0:1.0:0.0	.	.	.	.	F	155	.	ENSP00000446162:S155F	S	-	2	0	PDGFC	157908575	1.000000	0.71417	0.747000	0.31113	0.955000	0.61496	5.667000	0.68067	2.434000	0.82447	0.655000	0.94253	TCT	PDGFC	-	NULL	ENSG00000145431		0.383	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFC	HGNC	protein_coding	OTTHUMT00000366123.1	167	0.00	0	G			157689125	157689125	-1	no_errors	ENST00000502773	ensembl	human	known	69_37n	silent	106	22.06	30	SNP	1.000	A
PDIK1L	149420	genome.wustl.edu	37	1	26448562	26448562	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:26448562C>T	ENST00000374271.4	+	4	807	c.520C>T	c.(520-522)Caa>Taa	p.Q174*	PDIK1L_ENST00000374269.1_Nonsense_Mutation_p.Q174*	NM_001243532.1|NM_001243533.1|NM_152835.4	NP_001230461.1|NP_001230462.1|NP_690048.1	Q8N165	PDK1L_HUMAN	PDLIM1 interacting kinase 1 like	174	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Renal(390;0.00211)|Lung NSC(340;0.00239)|all_lung(284;0.00366)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.051)|Breast(348;0.0589)|all_neural(195;0.0687)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;7.32e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000735)|BRCA - Breast invasive adenocarcinoma(304;0.000973)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.015)|READ - Rectum adenocarcinoma(331;0.0649)		CCTGATTTCTCAAACCAGGTT	0.463																																						dbGAP											0													145.0	140.0	142.0					1																	26448562		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF411102	CCDS274.1	1p35.1	2008-02-05			ENSG00000175087	ENSG00000175087			18981	protein-coding gene	gene with protein product		610785				14631099	Standard	NM_152835		Approved	CLIK1L	uc009vsb.3	Q8N165	OTTHUMG00000007511	ENST00000374271.4:c.520C>T	1.37:g.26448562C>T	ENSP00000363389:p.Gln174*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R777|D3DPK2|Q5T2I0|Q8NDB3	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q174*	ENST00000374271.4	37	c.520	CCDS274.1	1	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753770	0.89753	.	.	ENSG00000175087	ENST00000444713;ENST00000374271;ENST00000374269	.	.	.	5.96	5.96	0.96718	.	0.048468	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.09590	T	0.72	-10.9887	14.8126	0.70006	0.1442:0.8558:0.0:0.0	.	.	.	.	X	174	.	ENSP00000363387:Q174X	Q	+	1	0	PDIK1L	26321149	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.884000	0.63135	2.826000	0.97356	0.655000	0.94253	CAA	PDIK1L	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000175087		0.463	PDIK1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIK1L	HGNC	protein_coding	OTTHUMT00000019752.1	129	0.00	0	C	NM_152835		26448562	26448562	+1	no_errors	ENST00000374269	ensembl	human	known	69_37n	nonsense	124	18.95	29	SNP	1.000	T
JADE1	79960	genome.wustl.edu	37	4	129770145	129770145	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:129770145G>A	ENST00000226319.6	+	5	587	c.307G>A	c.(307-309)Gaa>Aaa	p.E103K	PHF17_ENST00000413543.2_Missense_Mutation_p.E103K|PHF17_ENST00000511647.1_Missense_Mutation_p.E103K|PHF17_ENST00000512960.1_Missense_Mutation_p.E103K|PHF17_ENST00000452328.2_Intron	NM_199320.2	NP_955352.1														NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(10)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29						GGTTGTGTCTGAAGAGAAATC	0.507																																						dbGAP											0													162.0	146.0	152.0					4																	129770145		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000226319.6:c.307G>A	4.37:g.129770145G>A	ENSP00000226319:p.Glu103Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Enhancer_polycomb-like_N,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E103K	ENST00000226319.6	37	c.307	CCDS34062.1	4	.	.	.	.	.	.	.	.	.	.	G	32	5.151144	0.94645	.	.	ENSG00000077684	ENST00000226319;ENST00000511647;ENST00000504089;ENST00000512960;ENST00000503785;ENST00000535321;ENST00000510308;ENST00000413543;ENST00000507833;ENST00000508997	T;T;T;T;T;T;T;T;T	0.39406	1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08;1.08	4.8	4.8	0.61643	Enhancer of polycomb-like, N-terminal (1);	0.000000	0.44285	D	0.000476	T	0.48277	0.1491	L	0.41236	1.265	0.58432	D	0.999993	P;B	0.47253	0.892;0.371	P;B	0.52031	0.688;0.198	T	0.31586	-0.9938	9	.	.	.	.	18.4115	0.90552	0.0:0.0:1.0:0.0	.	103;103	Q6IE81;Q6IE81-3	JADE1_HUMAN;.	K	103	ENSP00000226319:E103K;ENSP00000423737:E103K;ENSP00000426590:E103K;ENSP00000425730:E103K;ENSP00000422445:E103K;ENSP00000421265:E103K;ENSP00000404211:E103K;ENSP00000424280:E103K;ENSP00000425535:E103K	.	E	+	1	0	PHF17	129989595	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.744000	0.74854	2.634000	0.89283	0.655000	0.94253	GAA	PHF17	-	pfam_Enhancer_polycomb-like_N	ENSG00000077684		0.507	PHF17-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHF17	HGNC	protein_coding	OTTHUMT00000364280.1	190	0.00	0	G			129770145	129770145	+1	no_errors	ENST00000226319	ensembl	human	known	69_37n	missense	182	12.08	25	SNP	1.000	A
PJA2	9867	genome.wustl.edu	37	5	108714379	108714379	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:108714379T>A	ENST00000361189.2	-	4	1048	c.809A>T	c.(808-810)cAa>cTa	p.Q270L	PJA2_ENST00000361557.3_Missense_Mutation_p.Q270L|PJA2_ENST00000511624.1_5'Flank	NM_014819.4	NP_055634.3	O43164	PJA2_HUMAN	praja ring finger 2, E3 ubiquitin protein ligase	270					long-term memory (GO:0007616)|protein ubiquitination (GO:0016567)|regulation of protein kinase A signaling (GO:0010738)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ligase activity (GO:0016874)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(2)|large_intestine(5)|lung(8)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21		all_cancers(142;4.4e-06)|all_epithelial(76;8.17e-08)|Prostate(80;0.00676)|Lung NSC(167;0.0436)|Ovarian(225;0.0443)|all_lung(232;0.053)|Colorectal(57;0.0946)|Breast(839;0.151)		OV - Ovarian serous cystadenocarcinoma(64;3.46e-10)|Epithelial(69;6.02e-09)|COAD - Colon adenocarcinoma(37;0.224)		AGTATTATTTTGTTGTTTCGT	0.403																																						dbGAP											0													123.0	141.0	135.0					5																	108714379		2202	4300	6502	-	-	-	SO:0001583	missense	0			AB007898	CCDS4099.1	5q22.1	2013-01-09	2012-02-23	2003-06-05	ENSG00000198961	ENSG00000198961		"""RING-type (C3HC4) zinc fingers"""	17481	protein-coding gene	gene with protein product			"""ring finger protein 131"", ""praja ring finger 2"""	RNF131			Standard	NM_014819		Approved	KIAA0438, Neurodap1	uc003kos.4	O43164	OTTHUMG00000128750	ENST00000361189.2:c.809A>T	5.37:g.108714379T>A	ENSP00000354775:p.Gln270Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6U4|D3DSZ5|Q68D49|Q8N1G5	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q270L	ENST00000361189.2	37	c.809	CCDS4099.1	5	.	.	.	.	.	.	.	.	.	.	T	8.679	0.904677	0.17760	.	.	ENSG00000198961	ENST00000361189;ENST00000361557	T;T	0.05513	3.43;3.43	5.33	4.02	0.46733	.	0.631544	0.15269	N	0.271340	T	0.04452	0.0122	N	0.25144	0.715	0.21604	N	0.999624	B	0.02656	0.0	B	0.04013	0.001	T	0.39143	-0.9628	10	0.19147	T	0.46	0.2094	8.3205	0.32126	0.392:0.0:0.0:0.608	.	270	O43164	PJA2_HUMAN	L	270	ENSP00000354775:Q270L;ENSP00000355284:Q270L	ENSP00000354775:Q270L	Q	-	2	0	PJA2	108742278	0.000000	0.05858	0.934000	0.37439	0.509000	0.34042	0.326000	0.19646	2.137000	0.66172	0.533000	0.62120	CAA	PJA2	-	NULL	ENSG00000198961		0.403	PJA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PJA2	HGNC	protein_coding	OTTHUMT00000250663.1	347	0.00	0	T	NM_014819		108714379	108714379	-1	no_errors	ENST00000361189	ensembl	human	known	69_37n	missense	224	18.84	52	SNP	0.690	A
PKHD1L1	93035	genome.wustl.edu	37	8	110463293	110463294	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:110463293_110463294delCT	ENST00000378402.5	+	41	6369_6370	c.6265_6266delCT	c.(6265-6267)ctgfs	p.L2089fs		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	2089					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CGCAGTGTCACTGACTCCACTC	0.515										HNSCC(38;0.096)	OREG0018931	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.6265_6266delCT	8.37:g.110463293_110463294delCT	ENSP00000367655:p.Leu2089fs	Somatic	1427	WXS	Illumina GAIIx	Phase_IV	Q567P2|Q9UF27	Frame_Shift_Del	DEL	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.L2089fs	ENST00000378402.5	37	c.6265_6266	CCDS47911.1	8																																																																																			PKHD1L1	-	NULL	ENSG00000205038		0.515	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	127	0.00	0	CT	NM_177531		110463293	110463294	+1	no_errors	ENST00000378402	ensembl	human	known	69_37n	frame_shift_del	59	79.05	283	DEL	0.734:0.995	-
PLXNA1	5361	genome.wustl.edu	37	3	126707486	126707488	+	In_Frame_Del	DEL	TGC	TGC	-			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	TGC	TGC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:126707486_126707488delTGC	ENST00000393409.2	+	1	50_52	c.50_52delTGC	c.(49-54)ttgctg>ttg	p.17_18LL>L	PLXNA1_ENST00000251772.4_5'UTR	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	17					axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		ctgctgctgttgctgctgctgct	0.709																																						dbGAP											0										76,3996		2,72,1962						-1.0	0.0			11	188,7724		2,184,3770	no	coding	PLXNA1	NM_032242.3		4,256,5732	A1A1,A1R,RR		2.3761,1.8664,2.2029				264,11720				-	-	-	SO:0001651	inframe_deletion	0			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.50_52delTGC	3.37:g.126707495_126707497delTGC	ENSP00000377061:p.Leu21del	Somatic		WXS	Illumina GAIIx	Phase_IV		In_Frame_Del	DEL	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.L21in_frame_del	ENST00000393409.2	37	c.50_52	CCDS33847.2	3																																																																																			PLXNA1	-	NULL	ENSG00000114554		0.709	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	8	0.00	0	TGC	NM_032242		126707486	126707488	+1	no_errors	ENST00000393409	ensembl	human	known	69_37n	in_frame_del	4	33.33	2	DEL	0.001:0.000:0.000	-
POM121	9883	genome.wustl.edu	37	7	72413723	72413724	+	In_Frame_Ins	INS	-	-	CTC	rs67569765|rs148686669	byFrequency	TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:72413723_72413724insCTC	ENST00000434423.2	+	11	3191_3192	c.3191_3192insCTC	c.(3190-3195)ttcttc>ttCTCcttc	p.1064_1065FF>FSF	POM121_ENST00000358357.3_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000395270.1_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000257622.4_In_Frame_Ins_p.799_800FF>FSF|POM121_ENST00000446813.1_In_Frame_Ins_p.799_800FF>FSF			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	1064	Pore side. {ECO:0000255}.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				ACTGCTGTCTTCTTCGGTGCAG	0.663																																						dbGAP											0																																										-	-	-	SO:0001652	inframe_insertion	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	Exception_encountered	7.37:g.72413723_72413724insCTC	ENSP00000405562:p.Phe1064_Phe1065insSer	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	In_Frame_Ins	INS	NULL	p.1065in_frame_insS	ENST00000434423.2	37	c.3191_3192		7																																																																																			POM121	-	NULL	ENSG00000196313		0.663	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	18	0.00	0	-			72413723	72413724	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	in_frame_ins	32	11.11	4	INS	0.980:0.870	CTC
POTEA	340441	genome.wustl.edu	37	8	43211970	43211970	+	RNA	SNP	A	A	C	rs534445172		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:43211970A>C	ENST00000522175.2	+	0	1293							Q6S8J7	POTEA_HUMAN	POTE ankyrin domain family, member A											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(27)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46						ACTCAAAAATAGCCACTATGA	0.358													A|||	1	0.000199681	0.0	0.0	5008	,	,		17937	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													82.0	73.0	76.0					8																	43211970		1825	4094	5919	-	-	-			0			AY462869		8p11.1	2013-01-11	2008-11-26	2008-11-26	ENSG00000188877	ENSG00000188877		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33893	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 3"""	608915	"""ANKRD26-like family A, member 1"""	A26A1			Standard	NM_001002920		Approved	POTE8, POTE-8, CT104.3	uc003xpz.1	Q6S8J7	OTTHUMG00000164111		8.37:g.43211970A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND17|A6ND71|Q6S8J6	RNA	SNP	-	NULL	ENST00000522175.2	37	NULL		8																																																																																			POTEA	-	-	ENSG00000188877		0.358	POTEA-003	KNOWN	basic	processed_transcript	POTEA	HGNC	pseudogene	OTTHUMT00000383492.1	118	0.00	0	A	NM_001002920		43211970	43211970	+1	no_errors	ENST00000522175	ensembl	human	known	69_37n	rna	61	62.80	103	SNP	0.001	C
POU6F2	11281	genome.wustl.edu	37	7	39503976	39503976	+	Silent	SNP	T	T	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:39503976T>C	ENST00000403058.1	+	11	1921	c.1767T>C	c.(1765-1767)caT>caC	p.H589H	POU6F2_ENST00000559001.1_Silent_p.H534H|POU6F2_ENST00000518318.2_Silent_p.H553H	NM_001166018.1|NM_007252.3	NP_001159490.1|NP_009183.3	P78424	PO6F2_HUMAN	POU class 6 homeobox 2	589					central nervous system development (GO:0007417)|ganglion mother cell fate determination (GO:0007402)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(3)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(16)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	42						AGGCCCGCCATCGAGCAGGTA	0.567																																						dbGAP											0													60.0	61.0	60.0					7																	39503976		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U91934	CCDS34620.2, CCDS55103.1	7p14.1	2011-06-20	2007-07-13		ENSG00000106536	ENSG00000106536		"""Homeoboxes / POU class"""	21694	protein-coding gene	gene with protein product	"""Retina-derived POU-domain factor-1"""	609062	"""POU domain, class 6, transcription factor 2"""			8601806	Standard	NM_007252		Approved	RPF-1	uc003thb.2	P78424	OTTHUMG00000150803	ENST00000403058.1:c.1767T>C	7.37:g.39503976T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1W2|C4AMB9|P78425|Q75ME8|Q86UM6|Q9UDS7	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.H589	ENST00000403058.1	37	c.1767	CCDS34620.2	7																																																																																			POU6F2	-	NULL	ENSG00000106536		0.567	POU6F2-002	KNOWN	basic|CCDS	protein_coding	POU6F2	HGNC	protein_coding	OTTHUMT00000320146.3	93	0.00	0	T	NM_007252		39503976	39503976	+1	no_errors	ENST00000403058	ensembl	human	known	69_37n	silent	139	11.46	18	SNP	1.000	C
PREX2	80243	genome.wustl.edu	37	8	69017562	69017562	+	Intron	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:69017562C>G	ENST00000288368.4	+	24	2992				PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2						adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						CCTTCCTTCTCAAGAAATGCT	0.517																																						dbGAP											0													82.0	69.0	73.0					8																	69017562		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.2716-2782C>G	8.37:g.69017562C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	RNA	SNP	-	NULL	ENST00000288368.4	37	NULL	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	3.680	-0.065627	0.07273	.	.	ENSG00000046889	ENST00000354677	.	.	.	2.08	1.18	0.20946	.	.	.	.	.	T	0.28366	0.0701	.	.	.	0.09310	N	1	B	0.22983	0.078	B	0.17979	0.02	T	0.27054	-1.0085	7	0.87932	D	0	.	4.5982	0.12340	0.0:0.8067:0.0:0.1933	.	969	Q70Z35-3	.	E	969	.	ENSP00000346707:Q969E	Q	+	1	0	PREX2	69180116	0.117000	0.22190	0.009000	0.14445	0.027000	0.11550	0.203000	0.17315	0.433000	0.26313	0.460000	0.39030	CAA	PREX2	-	-	ENSG00000046889		0.517	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	93	0.00	0	C	NM_025170		69017562	69017562	+1	no_errors	ENST00000529398	ensembl	human	known	69_37n	rna	87	17.92	19	SNP	0.012	G
PRG2	5553	genome.wustl.edu	37	11	57156722	57156722	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:57156722C>T	ENST00000311862.5	-	3	200	c.127G>A	c.(127-129)Gag>Aag	p.E43K	PRG2_ENST00000525955.1_Missense_Mutation_p.E43K|RP11-872D17.8_ENST00000529411.1_Missense_Mutation_p.E148K|PRG2_ENST00000533605.1_Missense_Mutation_p.E43K	NM_001243245.1|NM_002728.4	NP_001230174.1|NP_002719.3	P13727	PRG2_HUMAN	proteoglycan 2, bone marrow (natural killer cell activator, eosinophil granule major basic protein)	43					defense response to bacterium (GO:0042742)|defense response to nematode (GO:0002215)|immune response (GO:0006955)|negative regulation of interleukin-10 production (GO:0032693)|positive regulation of interleukin-4 production (GO:0032753)	cytoplasmic vesicle (GO:0031410)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	carbohydrate binding (GO:0030246)|heparin binding (GO:0008201)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)	10				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)	Sargramostim(DB00020)	ATCTCCTGCTCTGGTGTCTCC	0.567																																						dbGAP											0													76.0	76.0	76.0					11																	57156722		2201	4296	6497	-	-	-	SO:0001583	missense	0			BC005929	CCDS7955.1, CCDS58133.1	11q12	2005-11-25				ENSG00000186652			9362	protein-coding gene	gene with protein product		605601				1565101	Standard	NM_001243245		Approved	MBP, BMPG		P13727		ENST00000311862.5:c.127G>A	11.37:g.57156722C>T	ENSP00000312134:p.Glu43Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6XMW0|B2R5I1|P81448|Q14227|Q6ICT2	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_Eosinophil_major_basic	p.E43K	ENST00000311862.5	37	c.127	CCDS7955.1	11	.	.	.	.	.	.	.	.	.	.	C	16.87	3.240939	0.58995	.	.	ENSG00000186652;ENSG00000186652;ENSG00000186652;ENSG00000254979	ENST00000311862;ENST00000533605;ENST00000525955;ENST00000529411	T;T;T;T	0.32515	3.04;2.87;3.04;1.45	4.75	0.444	0.16592	.	0.758594	0.11211	N	0.587716	T	0.21468	0.0517	L	0.50333	1.59	0.09310	N	1	P;P	0.35575	0.51;0.51	B;B	0.32211	0.142;0.142	T	0.17776	-1.0358	10	0.44086	T	0.13	-7.3343	2.4644	0.04549	0.1538:0.5311:0.1497:0.1654	.	43;43	A6XMW0;P13727	.;PRG2_HUMAN	K	43;43;43;148	ENSP00000312134:E43K;ENSP00000433231:E43K;ENSP00000433016:E43K;ENSP00000431536:E148K	ENSP00000312134:E43K	E	-	1	0	RP11-872D17.8;PRG2	56913298	0.001000	0.12720	0.000000	0.03702	0.072000	0.16883	0.149000	0.16243	-0.015000	0.14150	0.655000	0.94253	GAG	PRG2	-	NULL	ENSG00000186652		0.567	PRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRG2	HGNC	protein_coding	OTTHUMT00000392468.1	124	0.00	0	C	NM_002728		57156722	57156722	-1	no_errors	ENST00000311862	ensembl	human	known	69_37n	missense	108	28.00	42	SNP	0.000	T
PRKAA1	5562	genome.wustl.edu	37	5	40798178	40798178	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:40798178G>A	ENST00000397128.2	-	1	122	c.114C>T	c.(112-114)ttC>ttT	p.F38F	PRKAA1_ENST00000354209.3_Silent_p.F38F|PRKAA1_ENST00000296800.4_Silent_p.F29F	NM_006251.5|NM_206907.3	NP_006242.5|NP_996790.3	Q13131	AAPK1_HUMAN	protein kinase, AMP-activated, alpha 1 catalytic subunit	38	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|autophagy (GO:0006914)|cell cycle arrest (GO:0007050)|cellular response to ethanol (GO:0071361)|cellular response to glucose starvation (GO:0042149)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to hypoxia (GO:0071456)|cellular response to nutrient levels (GO:0031669)|cholesterol biosynthetic process (GO:0006695)|cold acclimation (GO:0009631)|fatty acid biosynthetic process (GO:0006633)|fatty acid homeostasis (GO:0055089)|fatty acid oxidation (GO:0019395)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|lipid biosynthetic process (GO:0008610)|negative regulation of apoptotic process (GO:0043066)|negative regulation of glucose import in response to insulin stimulus (GO:2001274)|negative regulation of glucosylceramide biosynthetic process (GO:0046318)|negative regulation of lipid catabolic process (GO:0050995)|negative regulation of TOR signaling (GO:0032007)|positive regulation of autophagy (GO:0010508)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cholesterol biosynthetic process (GO:0045542)|positive regulation of gene expression (GO:0010628)|positive regulation of glycolytic process (GO:0045821)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of circadian rhythm (GO:0042752)|regulation of energy homeostasis (GO:2000505)|regulation of transcription, DNA-templated (GO:0006355)|regulation of vesicle-mediated transport (GO:0060627)|response to activity (GO:0014823)|response to caffeine (GO:0031000)|response to camptothecin (GO:1901563)|response to gamma radiation (GO:0010332)|response to hypoxia (GO:0001666)|response to UV (GO:0009411)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	AMP-activated protein kinase complex (GO:0031588)|apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	[acetyl-CoA carboxylase] kinase activity (GO:0050405)|[hydroxymethylglutaryl-CoA reductase (NADPH)] kinase activity (GO:0047322)|AMP-activated protein kinase activity (GO:0004679)|ATP binding (GO:0005524)|cAMP-dependent protein kinase activity (GO:0004691)|chromatin binding (GO:0003682)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|tau-protein kinase activity (GO:0050321)			breast(1)	1					Acetylsalicylic acid(DB00945)|Adenosine monophosphate(DB00131)|Adenosine triphosphate(DB00171)|Phenformin(DB00914)	TCACTTTGCCGAAGGTGCCGA	0.637																																						dbGAP											0													53.0	68.0	63.0					5																	40798178		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS3932.2, CCDS3933.2	5p13.1	2012-10-03			ENSG00000132356	ENSG00000132356			9376	protein-coding gene	gene with protein product	"""AMPK, alpha, 1"""	602739				8557660	Standard	XM_006714481		Approved	AMPKa1	uc003jmb.3	Q13131	OTTHUMG00000162269	ENST00000397128.2:c.114C>T	5.37:g.40798178G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTQ6|B2R7E1|O00286|Q5D0E1|Q86VS1|Q9UNQ4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F38	ENST00000397128.2	37	c.114	CCDS3932.2	5																																																																																			PRKAA1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000132356		0.637	PRKAA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKAA1	HGNC	protein_coding	OTTHUMT00000253833.2	88	0.00	0	G	NM_006251		40798178	40798178	-1	no_errors	ENST00000354209	ensembl	human	known	69_37n	silent	58	22.67	17	SNP	1.000	A
PTGER3	5733	genome.wustl.edu	37	1	71478130	71478130	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:71478130A>T	ENST00000306666.5	-	2	1145	c.935T>A	c.(934-936)gTt>gAt	p.V312D	PTGER3_ENST00000356595.4_Missense_Mutation_p.V312D|PTGER3_ENST00000354608.5_Missense_Mutation_p.V312D|PTGER3_ENST00000460330.1_Missense_Mutation_p.V312D|PTGER3_ENST00000351052.5_Missense_Mutation_p.V312D|PTGER3_ENST00000370932.2_Missense_Mutation_p.V312D|PTGER3_ENST00000414819.1_Missense_Mutation_p.V312D|PTGER3_ENST00000370931.3_Missense_Mutation_p.V312D|PTGER3_ENST00000370924.4_Missense_Mutation_p.V312D	NM_198719.1	NP_942012.1	P43115	PE2R3_HUMAN	prostaglandin E receptor 3 (subtype EP3)	312					cell death (GO:0008219)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular receptor signaling pathway (GO:0030522)|positive regulation of fever generation (GO:0031622)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|prostaglandin E receptor activity (GO:0004957)			endometrium(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	25					Bimatoprost(DB00905)|Dinoprostone(DB00917)|Misoprostol(DB00929)	GCAGTGCTCAACTGATGTCTG	0.398																																						dbGAP											0													112.0	105.0	108.0					1																	71478130		2203	4300	6503	-	-	-	SO:0001583	missense	0			X83863	CCDS652.1, CCDS655.1, CCDS656.1, CCDS657.1, CCDS658.1	1p31.2	2012-08-08			ENSG00000050628	ENSG00000050628		"""GPCR / Class A : Prostanoid receptors"""	9595	protein-coding gene	gene with protein product		176806				7759114, 9073510	Standard	NM_001126044		Approved	EP3	uc001dfo.3	P43115	OTTHUMG00000009399	ENST00000306666.5:c.935T>A	1.37:g.71478130A>T	ENSP00000302313:p.Val312Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B0AZN4|B1AK19|B5BUP5|O00326|Q12943|Q12944|Q12945|Q16546|Q5CZ59|Q5CZ61|Q5CZ62|Q5CZ63|Q5CZ64	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfam_7TM_GPCR_serpentine_rcpt_Srbc,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP3_rcpt,prints_Prostanoid_rcpt,prints_EP3_rcpt_2,prints_Prostglndn_DP_rcpt,prints_7TM_GPCR_Rhodpsn,prints_Thbox_rcpt	p.V312D	ENST00000306666.5	37	c.935	CCDS657.1	1	.	.	.	.	.	.	.	.	.	.	A	14.27	2.484751	0.44147	.	.	ENSG00000050628	ENST00000370931;ENST00000370932;ENST00000351052;ENST00000460330;ENST00000370934;ENST00000354608;ENST00000356595;ENST00000414819;ENST00000306666;ENST00000370924	T;T;T;T;T;T;T;T;T	0.37752	2.31;2.23;2.3;2.22;1.18;2.55;2.31;2.31;2.18	5.65	5.65	0.86999	GPCR, rhodopsin-like superfamily (1);	0.357940	0.30374	N	0.009769	T	0.15392	0.0371	L	0.27053	0.805	0.51233	D	0.999917	B;B;B;P;B;B;B;B	0.39862	0.179;0.357;0.216;0.692;0.279;0.307;0.307;0.357	B;B;B;B;B;B;B;B	0.35859	0.076;0.126;0.135;0.212;0.076;0.077;0.077;0.126	T	0.03268	-1.1054	10	0.40728	T	0.16	-12.3869	15.525	0.75898	1.0:0.0:0.0:0.0	.	312;312;312;312;312;312;312;312	Q147U0;Q6TTN3;F5H821;B1AK19;Q147X8;P43115-3;P43115-4;P43115	.;.;.;.;.;.;.;PE2R3_HUMAN	D	312	ENSP00000359969:V312D;ENSP00000359970:V312D;ENSP00000280208:V312D;ENSP00000418073:V312D;ENSP00000346624:V312D;ENSP00000349003:V312D;ENSP00000401423:V312D;ENSP00000302313:V312D;ENSP00000359962:V312D	ENSP00000302313:V312D	V	-	2	0	PTGER3	71250718	0.938000	0.31826	0.997000	0.53966	0.794000	0.44872	5.206000	0.65192	2.156000	0.67533	0.402000	0.26972	GTT	PTGER3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Prostglndn_EP3_rcpt	ENSG00000050628		0.398	PTGER3-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTGER3	HGNC	protein_coding	OTTHUMT00000026076.1	162	0.00	0	A	NM_000957		71478130	71478130	-1	no_errors	ENST00000354608	ensembl	human	known	69_37n	missense	117	18.75	27	SNP	0.861	T
PRPF38B	55119	genome.wustl.edu	37	1	109241882	109241882	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:109241882A>T	ENST00000370025.4	+	6	1150	c.881A>T	c.(880-882)gAa>gTa	p.E294V	PRPF38B_ENST00000370021.1_Missense_Mutation_p.E183V	NM_018061.2	NP_060531.2	Q5VTL8	PR38B_HUMAN	pre-mRNA processing factor 38B	294	Arg-rich.			EL -> DR (in Ref. 3; AAH40127). {ECO:0000305}.	mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	spliceosomal complex (GO:0005681)	poly(A) RNA binding (GO:0044822)			NS(1)|kidney(3)|large_intestine(5)|lung(8)|prostate(1)|skin(1)	19		all_epithelial(167;0.000154)|all_lung(203;0.00026)|Lung NSC(277;0.000508)		Colorectal(144;0.0149)|Lung(183;0.0888)|COAD - Colon adenocarcinoma(174;0.113)|Epithelial(280;0.161)		TTTGACAGAGAATTAGAAAGA	0.507																																						dbGAP											0													64.0	69.0	67.0					1																	109241882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833950	CCDS788.1	1p13.3	2013-10-03	2013-10-03		ENSG00000134186	ENSG00000134186			25512	protein-coding gene	gene with protein product			"""PRP38 pre-mRNA processing factor 38 (yeast) domain containing B"""				Standard	NM_018061		Approved	FLJ10330, NET1	uc001dvv.4	Q5VTL8	OTTHUMG00000010991	ENST00000370025.4:c.881A>T	1.37:g.109241882A>T	ENSP00000359042:p.Glu294Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q05DD6|Q32Q58|Q5VTL9|Q6PK39|Q7Z6E2|Q86WF3|Q8IWG9|Q9NW40	Missense_Mutation	SNP	pfam_PRP38	p.E294V	ENST00000370025.4	37	c.881	CCDS788.1	1	.	.	.	.	.	.	.	.	.	.	A	15.17	2.753187	0.49362	.	.	ENSG00000134186	ENST00000370025;ENST00000370021	T;T	0.23147	1.92;2.54	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.27489	0.0675	L	0.27053	0.805	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.05225	-1.0898	10	0.36615	T	0.2	.	15.9384	0.79734	1.0:0.0:0.0:0.0	.	294	Q5VTL8	PR38B_HUMAN	V	294;183	ENSP00000359042:E294V;ENSP00000359038:E183V	ENSP00000359038:E183V	E	+	2	0	PRPF38B	109043405	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.483000	0.90442	2.178000	0.69098	0.482000	0.46254	GAA	PRPF38B	-	NULL	ENSG00000134186		0.507	PRPF38B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF38B	HGNC	protein_coding	OTTHUMT00000030231.1	53	0.00	0	A	NM_018061		109241882	109241882	+1	no_errors	ENST00000370025	ensembl	human	known	69_37n	missense	34	30.61	15	SNP	1.000	T
PTPN13	5783	genome.wustl.edu	37	4	87696433	87696433	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:87696433G>A	ENST00000411767.2	+	34	5681	c.5618G>A	c.(5617-5619)aGa>aAa	p.R1873K	PTPN13_ENST00000511467.1_Missense_Mutation_p.R1878K|PTPN13_ENST00000316707.6_Missense_Mutation_p.R1682K|PTPN13_ENST00000436978.1_Missense_Mutation_p.R1878K|PTPN13_ENST00000427191.2_Missense_Mutation_p.R1854K			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1873					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		GAATTACCCAGAATACCAATG	0.383																																						dbGAP											0													83.0	77.0	79.0					4																	87696433		1875	4114	5989	-	-	-	SO:0001583	missense	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5618G>A	4.37:g.87696433G>A	ENSP00000407249:p.Arg1873Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.R1878K	ENST00000411767.2	37	c.5633	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	G	1.413	-0.574964	0.03882	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.46063	0.89;0.89;0.95;0.88;0.89	5.15	3.0	0.34707	PDZ/DHR/GLGF (1);	0.293471	0.24647	N	0.036742	T	0.13243	0.0321	N	0.02751	-0.505	0.31814	N	0.626901	B;B;B;B	0.09022	0.001;0.002;0.001;0.002	B;B;B;B	0.13407	0.003;0.009;0.004;0.009	T	0.29181	-1.0020	10	0.02654	T	1	.	4.3501	0.11151	0.4733:0.0:0.5267:0.0	.	1682;1854;1873;1878	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	K	1854;1878;1682;1873;1878;1822	ENSP00000408368:R1854K;ENSP00000394794:R1878K;ENSP00000322675:R1682K;ENSP00000407249:R1873K;ENSP00000426626:R1878K	ENSP00000322675:R1682K	R	+	2	0	PTPN13	87915457	1.000000	0.71417	0.967000	0.41034	0.145000	0.21501	4.690000	0.61731	1.289000	0.44618	0.460000	0.39030	AGA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,superfamily_PDZ	ENSG00000163629		0.383	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	130	0.00	0	G			87696433	87696433	+1	no_errors	ENST00000436978	ensembl	human	known	69_37n	missense	134	22.54	39	SNP	0.996	A
PYHIN1	149628	genome.wustl.edu	37	1	158914788	158914788	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:158914788C>A	ENST00000368140.1	+	7	1560	c.1315C>A	c.(1315-1317)Cct>Act	p.P439T	PYHIN1_ENST00000392252.3_Missense_Mutation_p.P430T|PYHIN1_ENST00000368138.3_Missense_Mutation_p.P430T|PYHIN1_ENST00000392254.2_Missense_Mutation_p.P439T|PYHIN1_ENST00000485134.1_3'UTR	NM_152501.4|NM_198928.4|NM_198929.4	NP_689714.2|NP_945146.1|NP_945147.1	Q6K0P9	IFIX_HUMAN	pyrin and HIN domain family, member 1	439					cell cycle (GO:0007049)	nucleus (GO:0005634)				breast(2)|endometrium(3)|large_intestine(10)|lung(32)|ovary(3)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_hematologic(112;0.0378)					TCTCAAGACTCCTCAGATGCC	0.493																																						dbGAP											0													154.0	150.0	152.0					1																	158914788		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY185344	CCDS1178.1, CCDS1179.1, CCDS30907.1, CCDS30908.1	1q23.1	2008-02-05			ENSG00000163564	ENSG00000163564			28894	protein-coding gene	gene with protein product		612677				15122330	Standard	NM_152501		Approved	IFIX, MGC23885	uc001ftb.3	Q6K0P9	OTTHUMG00000037109	ENST00000368140.1:c.1315C>A	1.37:g.158914788C>A	ENSP00000357122:p.Pro439Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3W6|Q6K0P6|Q6K0P7|Q6K0P8|Q8WW65	Missense_Mutation	SNP	pfam_HIN200/IF120x,pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN,pfscan_HIN200/IF120x	p.P439T	ENST00000368140.1	37	c.1315	CCDS1178.1	1	.	.	.	.	.	.	.	.	.	.	C	11.46	1.646631	0.29246	.	.	ENSG00000163564	ENST00000368140;ENST00000368138;ENST00000392254;ENST00000392252	T;T;T;T	0.10005	3.0;2.92;2.95;2.95	2.32	0.322	0.15888	.	.	.	.	.	T	0.05777	0.0151	L	0.32530	0.975	0.09310	N	0.999996	D;D;D;D	0.56968	0.978;0.978;0.978;0.963	P;P;P;P	0.57620	0.824;0.824;0.824;0.672	T	0.21759	-1.0236	9	0.72032	D	0.01	.	3.4264	0.07412	0.0:0.5616:0.2723:0.166	.	430;439;430;439	Q6K0P9-4;Q6K0P9-3;Q6K0P9-2;Q6K0P9	.;.;.;IFIX_HUMAN	T	439;430;439;430	ENSP00000357122:P439T;ENSP00000357120:P430T;ENSP00000376083:P439T;ENSP00000376082:P430T	ENSP00000357120:P430T	P	+	1	0	PYHIN1	157181412	0.000000	0.05858	0.041000	0.18516	0.026000	0.11368	-0.794000	0.04584	0.082000	0.17018	-0.283000	0.09986	CCT	PYHIN1	-	NULL	ENSG00000163564		0.493	PYHIN1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PYHIN1	HGNC	protein_coding	OTTHUMT00000090110.1	220	0.00	0	C	NM_152501		158914788	158914788	+1	no_errors	ENST00000368140	ensembl	human	known	69_37n	missense	342	23.15	103	SNP	0.050	A
PZP	5858	genome.wustl.edu	37	12	9317892	9317892	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:9317892C>G	ENST00000261336.2	-	19	2358	c.2330G>C	c.(2329-2331)tGc>tCc	p.C777S	PZP_ENST00000381997.2_Missense_Mutation_p.C646S|PZP_ENST00000539983.1_5'UTR	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	777					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						TTCGGACAGGCAGAAGGCCCC	0.552																																					Melanoma(125;1402 1695 4685 34487 38571)	dbGAP											0													93.0	80.0	84.0					12																	9317892		2203	4300	6503	-	-	-	SO:0001583	missense	0			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.2330G>C	12.37:g.9317892C>G	ENSP00000261336:p.Cys777Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.C777S	ENST00000261336.2	37	c.2330	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083770	0.36758	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.21543	2.0;2.0	3.7	3.7	0.42460	Alpha-2-macroglobulin (1);	0.000000	0.64402	U	0.000003	T	0.37679	0.1012	L	0.41356	1.27	0.33068	D	0.535021	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.53056	-0.8492	10	0.87932	D	0	.	15.9293	0.79646	0.0:1.0:0.0:0.0	.	777;646;777	B2R950;P20742-2;P20742	.;.;PZP_HUMAN	S	777;646	ENSP00000261336:C777S;ENSP00000371427:C646S	ENSP00000261336:C777S	C	-	2	0	PZP	9209159	1.000000	0.71417	1.000000	0.80357	0.043000	0.13939	5.604000	0.67626	2.017000	0.59298	0.467000	0.42956	TGC	PZP	-	pfam_Macroglobln_a2	ENSG00000126838		0.552	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	108	0.00	0	C	NM_002864		9317892	9317892	-1	no_errors	ENST00000261336	ensembl	human	known	69_37n	missense	130	14.47	22	SNP	1.000	G
QSER1	79832	genome.wustl.edu	37	11	32955856	32955856	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr11:32955856C>G	ENST00000399302.2	+	4	3000	c.2665C>G	c.(2665-2667)Cat>Gat	p.H889D	QSER1_ENST00000527788.1_Missense_Mutation_p.H650D	NM_001076786.1	NP_001070254.1	Q2KHR3	QSER1_HUMAN	glutamine and serine rich 1	889										breast(5)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	48	Breast(20;0.158)					TTCTAAATCTCATTTTCAGCA	0.388																																						dbGAP											0													78.0	73.0	75.0					11																	32955856		1876	4114	5990	-	-	-	SO:0001583	missense	0			AL834141	CCDS41631.1	11p13	2014-02-12			ENSG00000060749	ENSG00000060749			26154	protein-coding gene	gene with protein product							Standard	XM_006718323		Approved	FLJ21924	uc001mty.3	Q2KHR3		ENST00000399302.2:c.2665C>G	11.37:g.32955856C>G	ENSP00000382241:p.His889Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU30|Q6ZUR5	Missense_Mutation	SNP	NULL	p.H889D	ENST00000399302.2	37	c.2665	CCDS41631.1	11	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876735	0.33162	.	.	ENSG00000060749	ENST00000399302;ENST00000078652;ENST00000527788	T;T	0.23147	2.24;1.92	5.84	4.93	0.64822	.	0.613409	0.16994	N	0.191200	T	0.25195	0.0612	L	0.48362	1.52	0.31940	N	0.611055	P;P;P	0.41848	0.763;0.763;0.651	B;B;B	0.36608	0.229;0.229;0.115	T	0.32161	-0.9917	10	0.66056	D	0.02	.	14.9022	0.70687	0.0:0.9316:0.0:0.0684	.	650;650;889	C9JJ88;Q2KHR3-2;Q2KHR3	.;.;QSER1_HUMAN	D	889;650;650	ENSP00000382241:H889D;ENSP00000432766:H650D	ENSP00000078652:H650D	H	+	1	0	QSER1	32912432	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	5.611000	0.67674	1.485000	0.48380	0.561000	0.74099	CAT	QSER1	-	NULL	ENSG00000060749		0.388	QSER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	QSER1	HGNC	protein_coding	OTTHUMT00000388448.1	100	0.00	0	C	NM_024774		32955856	32955856	+1	no_errors	ENST00000399302	ensembl	human	known	69_37n	missense	65	20.73	17	SNP	0.998	G
RASA1	5921	genome.wustl.edu	37	5	86633865	86633865	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:86633865C>G	ENST00000274376.6	+	5	1538	c.974C>G	c.(973-975)aCa>aGa	p.T325R	RASA1_ENST00000456692.2_Missense_Mutation_p.T148R|RASA1_ENST00000506290.1_Missense_Mutation_p.T159R|RASA1_ENST00000512763.1_Missense_Mutation_p.T158R	NM_002890.2	NP_002881.1	P20936	RASA1_HUMAN	RAS p21 protein activator (GTPase activating protein) 1	325	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				blood vessel morphogenesis (GO:0048514)|embryo development (GO:0009790)|intracellular signal transduction (GO:0035556)|mitotic cytokinesis (GO:0000281)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|regulation of RNA metabolic process (GO:0051252)|signal transduction (GO:0007165)|vasculogenesis (GO:0001570)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|ruffle (GO:0001726)	glycoprotein binding (GO:0001948)|GTPase binding (GO:0051020)|potassium channel inhibitor activity (GO:0019870)|Ras GTPase activator activity (GO:0005099)|receptor binding (GO:0005102)			NS(1)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(12)|lung(13)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	48		all_cancers(142;8.25e-07)|Lung NSC(167;0.000185)|all_lung(232;0.000222)|Colorectal(57;0.00542)|Ovarian(174;0.0423)		OV - Ovarian serous cystadenocarcinoma(54;4.72e-41)|Epithelial(54;1.51e-36)|all cancers(79;3.76e-31)		AATTTAAGAACAGATGAACAA	0.284																																						dbGAP											0													115.0	124.0	121.0					5																	86633865		2203	4295	6498	-	-	-	SO:0001583	missense	0				CCDS34200.1, CCDS47243.1	5q13	2013-02-14			ENSG00000145715	ENSG00000145715		"""Pleckstrin homology (PH) domain containing"", ""SH2 domain containing"""	9871	protein-coding gene	gene with protein product	"""capillary malformation-arteriovenous malformation"""	139150		RASA		15917201	Standard	NM_022650		Approved	GAP, CM-AVM, p120GAP, p120RASGAP	uc003kiw.3	P20936	OTTHUMG00000162605	ENST00000274376.6:c.974C>G	5.37:g.86633865C>G	ENSP00000274376:p.Thr325Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6W3|Q9UDI1	Missense_Mutation	SNP	pfam_SH2,pfam_RasGAP,pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_SH2,smart_SH3_domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_RasGAP,prints_SH2	p.T325R	ENST00000274376.6	37	c.974	CCDS34200.1	5	.	.	.	.	.	.	.	.	.	.	C	18.14	3.558155	0.65538	.	.	ENSG00000145715	ENST00000274376;ENST00000534133;ENST00000456692;ENST00000512763;ENST00000506290	T;T;T;T	0.30714	1.52;1.52;1.52;1.52	5.57	5.57	0.84162	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.51686	0.1689	M	0.88979	2.995	0.80722	D	1	B;B;B;B;P	0.34864	0.096;0.096;0.213;0.078;0.473	B;B;B;B;B	0.41088	0.18;0.149;0.149;0.092;0.347	T	0.59134	-0.7511	10	0.87932	D	0	.	19.9024	0.96993	0.0:1.0:0.0:0.0	.	159;158;159;148;325	E9PGC0;B4DTL2;B4DTX4;P20936-2;P20936	.;.;.;.;RASA1_HUMAN	R	325;358;148;158;159	ENSP00000274376:T325R;ENSP00000411221:T148R;ENSP00000422008:T158R;ENSP00000420905:T159R	ENSP00000274376:T325R	T	+	2	0	RASA1	86669621	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.587000	0.82613	2.775000	0.95449	0.650000	0.86243	ACA	RASA1	-	pfam_SH3_domain,smart_SH3_domain,pfscan_SH3_domain	ENSG00000145715		0.284	RASA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASA1	HGNC	protein_coding	OTTHUMT00000369729.1	243	0.00	0	C	NM_002890		86633865	86633865	+1	no_errors	ENST00000274376	ensembl	human	known	69_37n	missense	257	19.18	61	SNP	1.000	G
RHOB	388	genome.wustl.edu	37	2	20647544	20647544	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr2:20647544C>T	ENST00000272233.4	+	1	710	c.318C>T	c.(316-318)ttC>ttT	p.F106F		NM_004040.2	NP_004031.1	P62745	RHOB_HUMAN	ras homolog family member B	106					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to ionizing radiation (GO:0071479)|cytokinesis (GO:0000910)|endosome to lysosome transport (GO:0008333)|GTP catabolic process (GO:0006184)|negative regulation of cell cycle (GO:0045786)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|transformed cell apoptotic process (GO:0006927)	cleavage furrow (GO:0032154)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			breast(1)|kidney(1)|lung(2)|ovary(1)|urinary_tract(2)	7	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)	all_epithelial(98;4.19e-09)|Lung NSC(108;0.00452)|Ovarian(717;0.0164)		OV - Ovarian serous cystadenocarcinoma(76;1.14e-22)|Epithelial(75;7.84e-19)	Botulinum Toxin Type A(DB00083)	TGAAGCACTTCTGTCCCAATG	0.607																																						dbGAP											0													84.0	94.0	91.0					2																	20647544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1699.1	2p24	2012-02-27	2012-02-27	2004-03-24	ENSG00000143878	ENSG00000143878			668	protein-coding gene	gene with protein product	"""oncogene RHO H6"""	165370	"""ras homolog gene family, member B"""	ARH6, ARHB		3283705, 16278215	Standard	NM_004040		Approved	RhoB, RHOH6, MST081	uc002rdv.3	P62745	OTTHUMG00000090755	ENST00000272233.4:c.318C>T	2.37:g.20647544C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R692|P01121|Q5U0H6|Q7RTN5|Q7RTR9|Q9CUV7	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.F106	ENST00000272233.4	37	c.318	CCDS1699.1	2																																																																																			RHOB	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_ProtSyn_GTP-bd,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom	ENSG00000143878		0.607	RHOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOB	HGNC	protein_coding	OTTHUMT00000207500.1	47	0.00	0	C	NM_004040		20647544	20647544	+1	no_errors	ENST00000272233	ensembl	human	known	69_37n	silent	81	15.62	15	SNP	1.000	T
RNASE3	6037	genome.wustl.edu	37	14	21360155	21360155	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:21360155C>T	ENST00000304639.3	+	2	368	c.310C>T	c.(310-312)Cgg>Tgg	p.R104W		NM_002935.2	NP_002926.2	P12724	ECP_HUMAN	ribonuclease, RNase A family, 3	104					antibacterial humoral response (GO:0019731)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endonuclease activity (GO:0004519)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)			endometrium(1)|large_intestine(1)|lung(6)|ovary(1)	9	all_cancers(95;0.00453)		OV - Ovarian serous cystadenocarcinoma(11;6.3e-09)|Epithelial(56;1.42e-07)|all cancers(55;5.48e-07)	GBM - Glioblastoma multiforme(265;0.0187)	Pranlukast(DB01411)	GAGTAGATTCCGGGTGCCTTT	0.428																																						dbGAP											0													100.0	103.0	102.0					14																	21360155		2191	4300	6491	-	-	-	SO:0001583	missense	0			X55990	CCDS9560.1	14q11.2	2014-03-13	2010-05-07		ENSG00000169397	ENSG00000169397	3.1.27.-	"""Ribonucleases, RNase A"""	10046	protein-coding gene	gene with protein product	"""eosinophil cationic protein"""	131398		RNS3		1577491	Standard	NM_002935		Approved	ECP	uc001vyj.3	P12724	OTTHUMG00000029604	ENST00000304639.3:c.310C>T	14.37:g.21360155C>T	ENSP00000302324:p.Arg104Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VBC1|Q8WTP7|Q8WZ62|Q9GZN9	Missense_Mutation	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	p.R104W	ENST00000304639.3	37	c.310	CCDS9560.1	14	.	.	.	.	.	.	.	.	.	.	c	12.33	1.904464	0.33628	.	.	ENSG00000169397	ENST00000304639	T	0.74002	-0.8	2.38	1.45	0.22620	Ribonuclease A, domain (4);	0.858191	0.09014	U	0.861087	T	0.75398	0.3844	L	0.61036	1.89	0.09310	N	1	D	0.71674	0.998	P	0.50896	0.653	T	0.62746	-0.6789	10	0.66056	D	0.02	.	6.5242	0.22293	0.284:0.716:0.0:0.0	.	104	P12724	ECP_HUMAN	W	104	ENSP00000302324:R104W	ENSP00000302324:R104W	R	+	1	2	RNASE3	20429995	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.008000	0.12788	0.536000	0.28733	0.537000	0.68136	CGG	RNASE3	-	pfam_RNaseA_domain,superfamily_RNaseA_domain,smart_RNaseA_domain,prints_RNaseA	ENSG00000169397		0.428	RNASE3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE3	HGNC	protein_coding	OTTHUMT00000073795.2	180	0.00	0	C	NM_002935		21360155	21360155	+1	no_errors	ENST00000304639	ensembl	human	known	69_37n	missense	145	24.08	46	SNP	0.000	T
RNF32	140545	genome.wustl.edu	37	7	156437412	156437412	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:156437412G>C	ENST00000405335.1	+	4	644	c.235G>C	c.(235-237)Gaa>Caa	p.E79Q	RNF32_ENST00000392741.2_Missense_Mutation_p.E79Q|RNF32_ENST00000480011.1_3'UTR|RNF32_ENST00000317955.5_Missense_Mutation_p.E79Q|RNF32_ENST00000392743.2_Missense_Mutation_p.E79Q|RNF32_ENST00000311822.8_Missense_Mutation_p.E79Q|RNF32_ENST00000432459.2_Missense_Mutation_p.E79Q|RNF32_ENST00000343665.4_Missense_Mutation_p.E79Q|RNF32_ENST00000392740.1_Missense_Mutation_p.E79Q			Q9H0A6	RNF32_HUMAN	ring finger protein 32	79						aggresome (GO:0016235)|endosome (GO:0005768)	zinc ion binding (GO:0008270)			cervix(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(2)	15	Ovarian(565;0.218)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.00291)	UCEC - Uterine corpus endometrioid carcinoma (81;0.169)		CTCAGAAAAAGAATATGTTCT	0.358																																						dbGAP											0													75.0	78.0	77.0					7																	156437412		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5944.1	7q36	2013-08-05			ENSG00000105982	ENSG00000105982		"""RING-type (C3HC4) zinc fingers"""	17118	protein-coding gene	gene with protein product		610241				11890671	Standard	NM_001184996		Approved	FKSG33, HSD15, LMBR2	uc003wmr.3	Q9H0A6	OTTHUMG00000151440	ENST00000405335.1:c.235G>C	7.37:g.156437412G>C	ENSP00000385285:p.Glu79Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FIB3|Q6X7T4|Q8N6V8|Q8TDG0|Q96BM5|Q9Y6U1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_IQ_motif_EF-hand-BS,smart_Znf_RING,pfscan_IQ_motif_EF-hand-BS,pfscan_Znf_RING	p.E79Q	ENST00000405335.1	37	c.235	CCDS5944.1	7	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036269	0.75617	.	.	ENSG00000105982	ENST00000404282;ENST00000432459;ENST00000317955;ENST00000405335;ENST00000311822;ENST00000392743;ENST00000392741;ENST00000343665;ENST00000392740	D;D;D;D;D;D;D;T	0.92249	-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;-3.0;1.48	5.17	5.17	0.71159	.	0.047203	0.85682	D	0.000000	D	0.95809	0.8636	M	0.80746	2.51	0.58432	D	0.999993	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	0.998;1.0;0.999;0.999	D	0.96098	0.9067	10	0.72032	D	0.01	-33.1117	13.971	0.64240	0.0748:0.0:0.9252:0.0	.	79;79;79;79	Q9H0A6-4;G5E940;Q9H0A6-2;Q9H0A6	.;.;.;RNF32_HUMAN	Q	79	ENSP00000385815:E79Q;ENSP00000405588:E79Q;ENSP00000315950:E79Q;ENSP00000385285:E79Q;ENSP00000308894:E79Q;ENSP00000376499:E79Q;ENSP00000376497:E79Q;ENSP00000341185:E79Q	ENSP00000308894:E79Q	E	+	1	0	RNF32	156130173	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	4.708000	0.61859	2.403000	0.81681	0.655000	0.94253	GAA	RNF32	-	NULL	ENSG00000105982		0.358	RNF32-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RNF32	HGNC	protein_coding	OTTHUMT00000322660.2	60	0.00	0	G	NM_030936		156437412	156437412	+1	no_errors	ENST00000317955	ensembl	human	known	69_37n	missense	96	14.91	17	SNP	1.000	C
RPS6	6194	genome.wustl.edu	37	9	19378776	19378776	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:19378776C>G	ENST00000380394.4	-	3	337	c.279G>C	c.(277-279)aaG>aaC	p.K93N	RP11-513M16.8_ENST00000609982.1_RNA|RPS6_ENST00000315377.4_Missense_Mutation_p.K62N|RPS6_ENST00000498815.1_5'Flank|RPS6_ENST00000380384.1_Missense_Mutation_p.K62N|RPS6_ENST00000380381.3_3'UTR	NM_001010.2	NP_001001.2	P62753	RS6_HUMAN	ribosomal protein S6	93					activation-induced cell death of T cells (GO:0006924)|cellular protein metabolic process (GO:0044267)|erythrocyte development (GO:0048821)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|oogenesis stage (GO:0022605)|placenta development (GO:0001890)|positive regulation of apoptotic process (GO:0043065)|ribosomal small subunit assembly (GO:0000028)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|T cell differentiation in thymus (GO:0033077)|T cell proliferation involved in immune response (GO:0002309)|TOR signaling (GO:0031929)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|dendrite (GO:0030425)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural constituent of ribosome (GO:0003735)			endometrium(3)|lung(2)|ovary(1)|urinary_tract(1)	7		Colorectal(97;3.46e-05)|Myeloproliferative disorder(762;0.0255)		Lung(42;0.161)|LUSC - Lung squamous cell carcinoma(42;0.234)		CTGATTTTCTCTTTCTTTCTC	0.458																																						dbGAP											0													47.0	45.0	46.0					9																	19378776		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6492.1	9p21	2011-04-05			ENSG00000137154	ENSG00000137154		"""S ribosomal proteins"""	10429	protein-coding gene	gene with protein product	"""40S ribosomal protein S6"", ""phosphoprotein NP33"""	180460				1577483	Standard	NM_001010		Approved	S6	uc003znv.1	P62753	OTTHUMG00000019642	ENST00000380394.4:c.279G>C	9.37:g.19378776C>G	ENSP00000369757:p.Lys93Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	P08227|P10660|Q4VBY7|Q8N6Z7	Missense_Mutation	SNP	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	p.K93N	ENST00000380394.4	37	c.279	CCDS6492.1	9	.	.	.	.	.	.	.	.	.	.	C	16.45	3.126122	0.56721	.	.	ENSG00000137154	ENST00000380394;ENST00000380384;ENST00000315377	T;T;T	0.54866	0.6;0.55;0.55	5.54	2.66	0.31614	.	0.000000	0.85682	D	0.000000	T	0.71584	0.3357	H	0.98333	4.205	0.80722	D	1	P;P	0.45594	0.753;0.862	P;P	0.45681	0.49;0.49	T	0.80322	-0.1431	9	.	.	.	-5.7216	11.0592	0.47938	0.0:0.6875:0.0:0.3125	.	62;93	A2A3R5;P62753	.;RS6_HUMAN	N	93;62;62	ENSP00000369757:K93N;ENSP00000369745:K62N;ENSP00000369743:K62N	.	K	-	3	2	RPS6	19368776	0.959000	0.32827	1.000000	0.80357	0.909000	0.53808	0.094000	0.15107	0.805000	0.34159	0.655000	0.94253	AAG	RPS6	-	pfam_Ribosomal_S6e,pirsf_Ribosomal_S6_euk	ENSG00000137154		0.458	RPS6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6	HGNC	protein_coding	OTTHUMT00000051858.1	88	0.00	0	C	NM_001010		19378776	19378776	-1	no_errors	ENST00000380394	ensembl	human	known	69_37n	missense	63	16.00	12	SNP	1.000	G
RYR2	6262	genome.wustl.edu	37	1	237532863	237532863	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:237532863C>T	ENST00000366574.2	+	6	656	c.339C>T	c.(337-339)ctC>ctT	p.L113L	RYR2_ENST00000360064.6_Silent_p.L111L|RYR2_ENST00000542537.1_Silent_p.L97L	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	113	MIR 1. {ECO:0000255|PROSITE- ProRule:PRU00131}.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			ATCGAACACTCCTCTACGGAC	0.433																																						dbGAP											0													156.0	129.0	138.0					1																	237532863		1940	4145	6085	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.339C>T	1.37:g.237532863C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L111	ENST00000366574.2	37	c.333	CCDS55691.1	1																																																																																			RYR2	-	pfam_Ins145_P3_rcpt,smart_MIR_motif,prints_Ryan_recept,pfscan_MIR_motif	ENSG00000198626		0.433	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	341	0.00	0	C	NM_001035		237532863	237532863	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	298	26.78	109	SNP	0.999	T
SACM1L	22908	genome.wustl.edu	37	3	45746631	45746631	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:45746631G>C	ENST00000389061.5	+	3	339	c.135G>C	c.(133-135)aaG>aaC	p.K45N	SACM1L_ENST00000541314.1_Missense_Mutation_p.R27T|SACM1L_ENST00000464524.1_3'UTR|SACM1L_ENST00000418611.1_5'UTR	NM_014016.3	NP_054735.3	Q9NTJ5	SAC1_HUMAN	SAC1 suppressor of actin mutations 1-like (yeast)	45				K -> E (in Ref. 4; BAF83831). {ECO:0000305}.	phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of endoplasmic reticulum membrane (GO:0030176)	phosphatase activity (GO:0016791)|phosphatidylinositol bisphosphate phosphatase activity (GO:0034593)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(1)	23				BRCA - Breast invasive adenocarcinoma(193;0.0102)|KIRC - Kidney renal clear cell carcinoma(197;0.0234)|Kidney(197;0.0277)		TTAAAGTCAAGAAAGATGTTC	0.363																																						dbGAP											0													80.0	86.0	84.0					3																	45746631		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB020658	CCDS33745.1	3p21.3	2010-03-11			ENSG00000211456	ENSG00000211456			17059	protein-coding gene	gene with protein product		606569				10048485, 11352561	Standard	NM_014016		Approved	SAC1, KIAA0851	uc003cos.2	Q9NTJ5	OTTHUMG00000156653	ENST00000389061.5:c.135G>C	3.37:g.45746631G>C	ENSP00000373713:p.Lys45Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K527|B4DK71|O94935|Q7LA14|Q7LA22|Q96AX7|Q9NQ46|Q9NQ57	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.K45N	ENST00000389061.5	37	c.135	CCDS33745.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.61|14.61	2.587550|2.587550	0.46110|0.46110	.|.	.|.	ENSG00000211456|ENSG00000211456	ENST00000389061|ENST00000438671;ENST00000541314	T|T	0.44482|0.44083	0.92|0.93	5.7|5.7	3.88|3.88	0.44766|0.44766	.|.	0.109405|.	0.64402|.	D|.	0.000009|.	T|T	0.33381|0.33381	0.0861|0.0861	L|L	0.37561|0.37561	1.115|1.115	0.23192|0.23192	N|N	0.998143|0.998143	B|B	0.15141|0.25048	0.012|0.117	B|B	0.17433|0.27608	0.018|0.081	T|T	0.30416|0.30416	-0.9979|-0.9979	10|9	0.17832|0.87932	T|D	0.49|0	-13.775|-13.775	7.4111|7.4111	0.27017|0.27017	0.3258:0.0:0.6742:0.0|0.3258:0.0:0.6742:0.0	.|.	45|27	Q9NTJ5|B4DK71	SAC1_HUMAN|.	N|T	45|27	ENSP00000373713:K45N|ENSP00000443373:R27T	ENSP00000373713:K45N|ENSP00000411966:R27T	K|R	+|+	3|2	2|0	SACM1L|SACM1L	45721635|45721635	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.982000|0.982000	0.71751|0.71751	1.178000|1.178000	0.31981|0.31981	1.385000|1.385000	0.46445|0.46445	0.467000|0.467000	0.42956|0.42956	AAG|AGA	SACM1L	-	NULL	ENSG00000211456		0.363	SACM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SACM1L	HGNC	protein_coding	OTTHUMT00000345065.2	150	0.00	0	G	NM_014016		45746631	45746631	+1	no_errors	ENST00000389061	ensembl	human	known	69_37n	missense	98	22.22	28	SNP	1.000	C
SCG5	6447	genome.wustl.edu	37	15	32936016	32936016	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr15:32936016G>A	ENST00000300175.4	+	2	333	c.223G>A	c.(223-225)Gaa>Aaa	p.E75K	SCG5_ENST00000413748.2_Missense_Mutation_p.E75K|SCG5_ENST00000494364.1_Missense_Mutation_p.E75K|SCG5_ENST00000497208.1_Missense_Mutation_p.E75K	NM_001144757.1	NP_001138229.1	P05408	7B2_HUMAN	secretogranin V (7B2 protein)	75					intracellular protein transport (GO:0006886)|neuropeptide signaling pathway (GO:0007218)|peptide hormone processing (GO:0016486)|regulation of hormone secretion (GO:0046883)	extracellular region (GO:0005576)|secretory granule (GO:0030141)	enzyme inhibitor activity (GO:0004857)|GTP binding (GO:0005525)|unfolded protein binding (GO:0051082)			lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	6		all_lung(180;7.32e-08)		all cancers(64;6.48e-17)|Epithelial(43;1.23e-11)|GBM - Glioblastoma multiforme(186;1.39e-05)|BRCA - Breast invasive adenocarcinoma(123;0.0212)		CCAGAGCATTGAAGGTATTTA	0.438																																						dbGAP											0													31.0	31.0	31.0					15																	32936016		1853	4100	5953	-	-	-	SO:0001583	missense	0			Y00757	CCDS45207.1, CCDS45208.1	15q13-q14	2006-03-20	2006-03-20	2006-03-20	ENSG00000166922	ENSG00000166922			10816	protein-coding gene	gene with protein product	"""prohormone convertase chaperone"""	173120	"""secretory granule, neuroendocrine protein 1 (7B2 protein)"""	SGNE1		8162254, 12646671	Standard	NM_003020		Approved	7B2, SgV	uc001zha.2	P05408	OTTHUMG00000159447	ENST00000300175.4:c.223G>A	15.37:g.32936016G>A	ENSP00000300175:p.Glu75Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P01164|Q6FHD0|Q9BS38	Missense_Mutation	SNP	pfam_Secretogranin_V	p.E75K	ENST00000300175.4	37	c.223	CCDS45207.1	15	.	.	.	.	.	.	.	.	.	.	G	25.8	4.672816	0.88445	.	.	ENSG00000166922	ENST00000300175;ENST00000413748;ENST00000494364;ENST00000497208;ENST00000471027	.	.	.	5.83	5.83	0.93111	.	0.044457	0.85682	D	0.000000	T	0.66519	0.2797	M	0.62723	1.935	0.80722	D	1	P;P	0.43578	0.811;0.811	B;B	0.43838	0.433;0.433	T	0.64537	-0.6384	9	0.35671	T	0.21	-14.6811	20.1047	0.97888	0.0:0.0:1.0:0.0	.	75;75	P05408;Q6FHD0	7B2_HUMAN;.	K	75;75;75;75;65	.	ENSP00000300175:E75K	E	+	1	0	SCG5	30723308	1.000000	0.71417	0.998000	0.56505	0.983000	0.72400	6.887000	0.75616	2.762000	0.94881	0.655000	0.94253	GAA	SCG5	-	pfam_Secretogranin_V	ENSG00000166922		0.438	SCG5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCG5	HGNC	protein_coding	OTTHUMT00000355438.1	28	0.00	0	G	NM_003020		32936016	32936016	+1	no_errors	ENST00000300175	ensembl	human	known	69_37n	missense	33	15.38	6	SNP	1.000	A
SCN1A	6323	genome.wustl.edu	37	2	166903316	166903316	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr2:166903316C>G	ENST00000303395.4	-	9	1340	c.1341G>C	c.(1339-1341)atG>atC	p.M447I	SCN1A_ENST00000375405.3_Missense_Mutation_p.M447I|AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.M447I|SCN1A_ENST00000423058.2_Missense_Mutation_p.M447I|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	447					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)	p.M447I(1)		NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	GCTGTTCAATCATCTGCTGAA	0.453																																						dbGAP											1	Substitution - Missense(1)	NS(1)											120.0	107.0	111.0					2																	166903316		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.1341G>C	2.37:g.166903316C>G	ENSP00000303540:p.Met447Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.M447I	ENST00000303395.4	37	c.1341	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	25.8	4.675665	0.88445	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	T;T;T;T	0.72282	-0.64;-0.64;-0.64;1.88	5.31	5.31	0.75309	.	0.000000	0.85682	D	0.000000	D	0.83101	0.5181	M	0.67700	2.07	0.80722	D	1	P;P;P	0.52577	0.954;0.924;0.525	D;P;P	0.66351	0.943;0.878;0.48	D	0.84208	0.0454	10	0.72032	D	0.01	.	19.3428	0.94350	0.0:1.0:0.0:0.0	.	447;447;447	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	I	447	ENSP00000407030:M447I;ENSP00000303540:M447I;ENSP00000364554:M447I;ENSP00000386312:M447I	ENSP00000303540:M447I	M	-	3	0	SCN1A	166611562	1.000000	0.71417	0.995000	0.50966	0.928000	0.56348	4.849000	0.62882	2.637000	0.89404	0.655000	0.94253	ATG	SCN1A	-	NULL	ENSG00000144285		0.453	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	297	0.00	0	C	NM_006920		166903316	166903316	-1	no_errors	ENST00000303395	ensembl	human	known	69_37n	missense	151	17.93	33	SNP	1.000	G
SETD2	29072	genome.wustl.edu	37	3	47058665	47058665	+	Frame_Shift_Del	DEL	T	T	-			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:47058665delT	ENST00000409792.3	-	21	7655	c.7613delA	c.(7612-7614)cacfs	p.H2538fs		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2538	Interaction with POLR2A.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTTGGTTTTGTGTTTCACATT	0.468			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													268.0	252.0	257.0					3																	47058665		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.7613delA	3.37:g.47058665delT	ENSP00000386759:p.His2538fs	Somatic		WXS	Illumina GAIIx	Phase_IV	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Frame_Shift_Del	DEL	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.H2538fs	ENST00000409792.3	37	c.7613	CCDS2749.2	3																																																																																			SETD2	-	pfam_SRI	ENSG00000181555		0.468	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	602	0.00	0	T	NM_014159		47058665	47058665	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	frame_shift_del	338	22.47	102	DEL	1.000	-
SF3B4	10262	genome.wustl.edu	37	1	149898614	149898614	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:149898614G>C	ENST00000271628.8	-	3	944	c.360C>G	c.(358-360)ttC>ttG	p.F120L	MTMR11_ENST00000492824.1_5'Flank	NM_005850.4	NP_005841.1	Q15427	SF3B4_HUMAN	splicing factor 3b, subunit 4, 49kDa	120	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)|U12-type spliceosomal complex (GO:0005689)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(4)|lung(7)|ovary(2)|prostate(1)|skin(1)	17	Breast(34;0.0009)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.221)|STAD - Stomach adenocarcinoma(528;0.247)			CAAAGGCGCTGAAAGTATCAT	0.433																																						dbGAP											0													87.0	87.0	87.0					1																	149898614		2203	4300	6503	-	-	-	SO:0001583	missense	0			L35013	CCDS72900.1	1q21.2	2013-02-12	2002-08-29		ENSG00000143368	ENSG00000143368		"""RNA binding motif (RRM) containing"""	10771	protein-coding gene	gene with protein product		605593	"""splicing factor 3b, subunit 4, 49kD"""			7958871	Standard	NM_005850		Approved	SAP49, SF3b49, Hsh49	uc001etk.2	Q15427	OTTHUMG00000012208	ENST00000271628.8:c.360C>G	1.37:g.149898614G>C	ENSP00000271628:p.Phe120Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SZ63	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.F120L	ENST00000271628.8	37	c.360	CCDS941.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.125114	0.77436	.	.	ENSG00000143368	ENST00000271628;ENST00000457312	T;T	0.43294	0.95;0.95	4.91	0.768	0.18487	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.51432	0.1674	M	0.84082	2.675	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.56703	-0.7935	10	0.87932	D	0	.	8.9943	0.36043	0.3193:0.0:0.6807:0.0	.	120;120	Q53FG6;Q15427	.;SF3B4_HUMAN	L	120;77	ENSP00000271628:F120L;ENSP00000391114:F77L	ENSP00000271628:F120L	F	-	3	2	SF3B4	148165238	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.414000	0.52693	-0.014000	0.14175	0.643000	0.83706	TTC	SF3B4	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000143368		0.433	SF3B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SF3B4	HGNC	protein_coding	OTTHUMT00000033753.1	177	0.00	0	G	NM_005850		149898614	149898614	-1	no_errors	ENST00000271628	ensembl	human	known	69_37n	missense	227	45.19	188	SNP	1.000	C
SH3BGR	6450	genome.wustl.edu	37	21	40834433	40834433	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr21:40834433C>G	ENST00000333634.4	+	2	445	c.367C>G	c.(367-369)Caa>Gaa	p.Q123E	SH3BGR_ENST00000380637.3_Missense_Mutation_p.Q12E|SH3BGR_ENST00000458295.1_Missense_Mutation_p.Q12E|SH3BGR_ENST00000380634.1_Missense_Mutation_p.Q12E|SH3BGR_ENST00000380631.1_Missense_Mutation_p.Q12E	NM_007341.2	NP_031367	P55822	SH3BG_HUMAN	SH3 domain binding glutamate-rich protein	123					positive regulation of signal transduction (GO:0009967)|protein complex assembly (GO:0006461)	cytosol (GO:0005829)	SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(2)	8		all_cancers(19;1.16e-23)|all_epithelial(19;1.22e-20)|Prostate(19;2.55e-06)|Breast(209;0.0133)		STAD - Stomach adenocarcinoma(101;0.00151)		GAAAAAACCTCAAAATGGGAT	0.408																																						dbGAP											0													92.0	102.0	98.0					21																	40834433		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13666.1, CCDS33560.1	21q22.3	2014-02-19	2014-02-19		ENSG00000185437	ENSG00000185437			10822	protein-coding gene	gene with protein product	"""21-glutamic acid-rich protein"""	602230	"""SH3 domain binding glutamic acid-rich protein"""			9050928	Standard	NM_007341		Approved	21-GARP	uc002yya.3	P55822	OTTHUMG00000074113	ENST00000333634.4:c.367C>G	21.37:g.40834433C>G	ENSP00000332513:p.Gln123Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND59|D3DSI2|Q9BRB8	Nonsense_Mutation	SNP	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	p.S51*	ENST00000333634.4	37	c.152	CCDS13666.1	21	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.559|7.559	0.664409|0.664409	0.14710|0.14710	.|.	.|.	ENSG00000185437|ENSG00000185437	ENST00000380637;ENST00000380634;ENST00000458295;ENST00000440288;ENST00000380631;ENST00000333634|ENST00000452550	T;T;T;T;T;T|.	0.76186|.	-1.0;-1.0;-1.0;-1.0;-1.0;2.03|.	4.98|4.98	4.98|4.98	0.66077|0.66077	Thioredoxin-like fold (2);|.	0.422934|.	0.27787|.	N|.	0.017848|.	T|.	0.15089|.	0.0364|.	N|N	0.01188|0.01188	-0.97|-0.97	0.29542|0.29542	N|N	0.852011|0.852011	B|.	0.17852|.	0.024|.	B|.	0.24701|.	0.055|.	T|.	0.07539|.	-1.0767|.	10|.	0.02654|.	T|.	1|.	.|.	14.285|14.285	0.66240|0.66240	0.0:0.8515:0.1485:0.0|0.0:0.8515:0.1485:0.0	.|.	123|.	P55822|.	SH3BG_HUMAN|.	E|X	12;12;12;12;12;123|51	ENSP00000370011:Q12E;ENSP00000370008:Q12E;ENSP00000404980:Q12E;ENSP00000401572:Q12E;ENSP00000370005:Q12E;ENSP00000332513:Q123E|.	ENSP00000332513:Q123E|.	Q|S	+|+	1|2	0|0	SH3BGR|SH3BGR	39756303|39756303	0.982000|0.982000	0.34865|0.34865	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	1.918000|1.918000	0.40006|0.40006	2.479000|2.479000	0.83701|0.83701	0.655000|0.655000	0.94253|0.94253	CAA|TCA	SH3BGR	-	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	ENSG00000185437		0.408	SH3BGR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGR	HGNC	protein_coding	OTTHUMT00000157377.6	178	0.00	0	C	NM_007341		40834433	40834433	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000452550	ensembl	human	novel	69_37n	nonsense	272	13.06	41	SNP	1.000	G
SLC17A7	57030	genome.wustl.edu	37	19	49938086	49938086	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:49938086G>A	ENST00000221485.3	-	4	659	c.488C>T	c.(487-489)tCa>tTa	p.S163L	SLC17A7_ENST00000543531.1_Missense_Mutation_p.S151L|SLC17A7_ENST00000600601.1_Missense_Mutation_p.S96L	NM_020309.3	NP_064705.1	Q9P2U7	VGLU1_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 7	163					glutamate secretion (GO:0014047)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|long-term memory (GO:0007616)|neurotransmitter secretion (GO:0007269)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|sequestering of neurotransmitter (GO:0042137)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|cerebellar mossy fiber (GO:0044300)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|synaptic vesicle membrane (GO:0030672)	inorganic phosphate transmembrane transporter activity (GO:0005315)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:inorganic phosphate symporter activity (GO:0015319)			autonomic_ganglia(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(8)|lung(7)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	26		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(486;0.0245)		GCGGGCAGCTGAGGGGATCAG	0.542																																						dbGAP											0													73.0	66.0	68.0					19																	49938086		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032436	CCDS12764.1	19q13.33	2013-07-18	2013-07-18		ENSG00000104888	ENSG00000104888		"""Solute carriers"""	16704	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 1"""	605208	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 7"""			8632143, 10820226	Standard	NM_020309		Approved	BNPI, VGLUT1	uc002pnp.3	Q9P2U7		ENST00000221485.3:c.488C>T	19.37:g.49938086G>A	ENSP00000221485:p.Ser163Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFR9|B4DG46|Q6PCD0	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.S163L	ENST00000221485.3	37	c.488	CCDS12764.1	19	.	.	.	.	.	.	.	.	.	.	G	11.17	1.559499	0.27827	.	.	ENSG00000104888	ENST00000221485;ENST00000543531	T;T	0.52057	0.68;0.68	4.84	4.84	0.62591	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.51477	D	0.000083	T	0.20333	0.0489	N	0.01267	-0.92	0.51767	D	0.999933	B;B	0.09022	0.002;0.002	B;B	0.15052	0.008;0.012	T	0.16188	-1.0411	10	0.10902	T	0.67	.	15.8417	0.78852	0.0:0.0:1.0:0.0	.	96;163	B4DFR9;Q9P2U7	.;VGLU1_HUMAN	L	163;151	ENSP00000221485:S163L;ENSP00000441767:S151L	ENSP00000221485:S163L	S	-	2	0	SLC17A7	54629898	0.999000	0.42202	0.995000	0.50966	0.968000	0.65278	7.199000	0.77831	2.685000	0.91497	0.585000	0.79938	TCA	SLC17A7	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000104888		0.542	SLC17A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A7	HGNC	protein_coding	OTTHUMT00000465367.2	161	0.00	0	G			49938086	49938086	-1	no_errors	ENST00000221485	ensembl	human	known	69_37n	missense	97	21.14	26	SNP	0.997	A
SLC25A32	81034	genome.wustl.edu	37	8	104419920	104419920	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:104419920G>C	ENST00000297578.4	-	2	413	c.247C>G	c.(247-249)Caa>Gaa	p.Q83E	SLC25A32_ENST00000543107.1_De_novo_Start_InFrame	NM_030780.3	NP_110407.2	Q9H2D1	MFTC_HUMAN	solute carrier family 25 (mitochondrial folate carrier), member 32	83					folic acid metabolic process (GO:0046655)|folic acid transport (GO:0015884)|mitochondrial transport (GO:0006839)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	folic acid transporter activity (GO:0008517)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(2)	9			OV - Ovarian serous cystadenocarcinoma(57;2.79e-06)|STAD - Stomach adenocarcinoma(118;0.197)		Folic Acid(DB00158)	GTTACTCCTTGATAAAGTCCC	0.383																																						dbGAP											0													155.0	158.0	157.0					8																	104419920		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF283645	CCDS6300.1	8q22.3	2013-05-22	2013-03-15		ENSG00000164933	ENSG00000164933		"""Solute carriers"""	29683	protein-coding gene	gene with protein product		610815	"""solute carrier family 25, member 32"""			10978331	Standard	NM_030780		Approved	MFTC	uc003yll.4	Q9H2D1	OTTHUMG00000164790	ENST00000297578.4:c.247C>G	8.37:g.104419920G>C	ENSP00000297578:p.Gln83Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96JZ6|Q96SU7	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_uncoupling	p.Q83E	ENST00000297578.4	37	c.247	CCDS6300.1	8	.	.	.	.	.	.	.	.	.	.	G	29.9	5.044772	0.93685	.	.	ENSG00000164933	ENST00000297578;ENST00000424899	T	0.78816	-1.21	6.05	6.05	0.98169	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.82861	0.5129	M	0.85630	2.765	0.80722	D	1	P	0.41188	0.741	B	0.39771	0.309	D	0.85036	0.0920	10	0.72032	D	0.01	-24.5641	20.6013	0.99457	0.0:0.0:1.0:0.0	.	83	Q9H2D1	MFTC_HUMAN	E	83;67	ENSP00000297578:Q83E	ENSP00000297578:Q83E	Q	-	1	0	SLC25A32	104489096	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.335000	0.79234	2.878000	0.98634	0.650000	0.86243	CAA	SLC25A32	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier	ENSG00000164933		0.383	SLC25A32-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A32	HGNC	protein_coding	OTTHUMT00000380290.2	201	0.00	0	G	NM_030780		104419920	104419920	-1	no_errors	ENST00000297578	ensembl	human	known	69_37n	missense	184	28.68	74	SNP	1.000	C
SLCO2A1	6578	genome.wustl.edu	37	3	133664066	133664066	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:133664066C>G	ENST00000310926.4	-	10	1607	c.1334G>C	c.(1333-1335)cGc>cCc	p.R445P	SLCO2A1_ENST00000493729.1_Missense_Mutation_p.R369P	NM_005630.2	NP_005621.2	Q92959	SO2A1_HUMAN	solute carrier organic anion transporter family, member 2A1	445	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.		R -> C (in dbSNP:rs146970901). {ECO:0000269|PubMed:22553128}.		lipid transport (GO:0006869)|sodium-independent organic anion transport (GO:0043252)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid transporter activity (GO:0005319)|prostaglandin transmembrane transporter activity (GO:0015132)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|skin(2)|stomach(2)	30					Alprostadil(DB00770)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Furosemide(DB00695)|Iloprost(DB01088)|Phenobarbital(DB01174)|Pyruvic acid(DB00119)	GCAGTCCCTGCGGCAGGCAGG	0.527																																						dbGAP											0													140.0	152.0	148.0					3																	133664066		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3084.1	3q21	2013-05-22	2003-11-25	2003-11-26	ENSG00000174640	ENSG00000174640		"""Solute carriers"""	10955	protein-coding gene	gene with protein product		601460	"""solute carrier family 21 (prostaglandin transporter), member 2"", ""matrin F/G 1"""	SLC21A2, MATR1		8787677, 9618293	Standard	NM_005630		Approved	PGT, OATP2A1	uc003eqa.4	Q92959	OTTHUMG00000159745	ENST00000310926.4:c.1334G>C	3.37:g.133664066C>G	ENSP00000311291:p.Arg445Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86V98|Q8IUN2	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.R445P	ENST00000310926.4	37	c.1334	CCDS3084.1	3	.	.	.	.	.	.	.	.	.	.	C	11.22	1.575003	0.28092	.	.	ENSG00000174640	ENST00000310926;ENST00000493729	T;T	0.39787	1.06;1.06	5.63	1.4	0.22301	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.904937	0.09867	N	0.745385	T	0.36991	0.0987	L	0.29908	0.895	0.09310	N	1	B;P;B	0.52577	0.062;0.954;0.007	B;P;B	0.47786	0.051;0.557;0.012	T	0.23655	-1.0182	10	0.56958	D	0.05	.	9.5225	0.39145	0.4245:0.5031:0.0:0.0725	.	264;369;445	B7Z8J8;E7EU40;Q92959	.;.;SO2A1_HUMAN	P	445;369	ENSP00000311291:R445P;ENSP00000418893:R369P	ENSP00000311291:R445P	R	-	2	0	SLCO2A1	135146756	0.002000	0.14202	1.000000	0.80357	0.942000	0.58702	-0.932000	0.03963	0.731000	0.32448	-0.500000	0.04577	CGC	SLCO2A1	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	ENSG00000174640		0.527	SLCO2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLCO2A1	HGNC	protein_coding	OTTHUMT00000357131.1	94	0.00	0	C	NM_005630		133664066	133664066	-1	no_errors	ENST00000310926	ensembl	human	known	69_37n	missense	45	21.05	12	SNP	0.069	G
STYX	6815	genome.wustl.edu	37	14	53211599	53211599	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:53211599G>A	ENST00000354586.4	+	2	380	c.87G>A	c.(85-87)atG>atA	p.M29I	STYX_ENST00000442123.2_Missense_Mutation_p.M29I|STYX_ENST00000556861.1_Intron	NM_145251.3	NP_660294.1	Q8WUJ0	STYX_HUMAN	serine/threonine/tyrosine interacting protein	29					MAPK export from nucleus (GO:0045204)|protein dephosphorylation (GO:0006470)|regulation of ERK1 and ERK2 cascade (GO:0070372)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(1)|large_intestine(2)|lung(1)	5	Breast(41;0.176)					GACGAGAGATGCAGGTATGGC	0.363																																						dbGAP											0													189.0	173.0	179.0					14																	53211599		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS9711.1	14q22.1	2011-06-09	2001-11-29		ENSG00000198252	ENSG00000198252		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	11447	protein-coding gene	gene with protein product		615814	"""serine/threonine/tyrosine-interacting protein"""			7592916	Standard	NM_145251		Approved		uc010tqy.2	Q8WUJ0	OTTHUMG00000140306	ENST00000354586.4:c.87G>A	14.37:g.53211599G>A	ENSP00000346599:p.Met29Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJG0|Q99850	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.M29I	ENST00000354586.4	37	c.87	CCDS9711.1	14	.	.	.	.	.	.	.	.	.	.	G	18.24	3.581126	0.65992	.	.	ENSG00000198252	ENST00000442123;ENST00000354586	T;T	0.59638	0.25;0.25	5.52	5.52	0.82312	Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.39687	U	0.001293	T	0.58977	0.2160	M	0.71581	2.175	0.80722	D	1	B	0.28820	0.224	B	0.29267	0.1	T	0.56263	-0.8008	10	0.15066	T	0.55	.	19.7889	0.96450	0.0:0.0:1.0:0.0	.	29	Q8WUJ0	STYX_HUMAN	I	29	ENSP00000403214:M29I;ENSP00000346599:M29I	ENSP00000346599:M29I	M	+	3	0	STYX	52281349	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	8.026000	0.88783	2.734000	0.93682	0.655000	0.94253	ATG	STYX	-	smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat	ENSG00000198252		0.363	STYX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STYX	HGNC	protein_coding	OTTHUMT00000276902.1	322	0.00	0	G	NM_145251		53211599	53211599	+1	no_errors	ENST00000354586	ensembl	human	known	69_37n	missense	269	19.22	64	SNP	1.000	A
SULT1E1	6783	genome.wustl.edu	37	4	70709918	70709918	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:70709918C>T	ENST00000226444.3	-	7	845	c.733G>A	c.(733-735)Gaa>Aaa	p.E245K		NM_005420.2	NP_005411.1	P49888	ST1E1_HUMAN	sulfotransferase family 1E, estrogen-preferring, member 1	245					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|estrogen metabolic process (GO:0008210)|female pregnancy (GO:0007565)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	estrone sulfotransferase activity (GO:0004304)|flavonol 3-sulfotransferase activity (GO:0047894)|steroid binding (GO:0005496)|steroid sulfotransferase activity (GO:0050294)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|prostate(1)|skin(1)	10					Acetaminophen(DB00316)|Cyclizine(DB01176)	TTCATAATTTCGTCTGGCAGT	0.428																																						dbGAP											0													278.0	244.0	255.0					4																	70709918		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC027956	CCDS3531.1	4q13.1	2008-02-05	2004-02-06	2004-02-04	ENSG00000109193	ENSG00000109193	2.8.2.4	"""Sulfotransferases, cytosolic"""	11377	protein-coding gene	gene with protein product		600043	"""sulfotransferase, estrogen-preferring"""	STE		7961757	Standard	NM_005420		Approved	EST	uc003heo.3	P49888	OTTHUMG00000129403	ENST00000226444.3:c.733G>A	4.37:g.70709918C>T	ENSP00000226444:p.Glu245Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6X5	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.E245K	ENST00000226444.3	37	c.733	CCDS3531.1	4	.	.	.	.	.	.	.	.	.	.	C	1.321	-0.599418	0.03744	.	.	ENSG00000109193	ENST00000226444	D	0.82526	-1.62	3.94	2.19	0.27852	Sulfotransferase domain (1);	0.489229	0.17821	N	0.160856	T	0.72269	0.3439	L	0.39692	1.235	0.09310	N	0.999996	B	0.18461	0.028	B	0.15870	0.014	T	0.55075	-0.8197	10	0.19590	T	0.45	.	8.8232	0.35039	0.0:0.807:0.0:0.193	.	245	P49888	ST1E1_HUMAN	K	245	ENSP00000226444:E245K	ENSP00000226444:E245K	E	-	1	0	SULT1E1	70744507	0.000000	0.05858	0.001000	0.08648	0.002000	0.02628	0.084000	0.14891	0.612000	0.30071	0.655000	0.94253	GAA	SULT1E1	-	pfam_Sulfotransferase_dom	ENSG00000109193		0.428	SULT1E1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1E1	HGNC	protein_coding	OTTHUMT00000251559.1	489	0.00	0	C	NM_005420		70709918	70709918	-1	no_errors	ENST00000226444	ensembl	human	known	69_37n	missense	252	21.98	71	SNP	0.005	T
SURF2	6835	genome.wustl.edu	37	9	136227991	136227991	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:136227991C>T	ENST00000371964.4	+	6	788	c.747C>T	c.(745-747)ttC>ttT	p.F249F	SURF4_ENST00000467910.1_5'Flank	NM_017503.3	NP_059973.4	Q15527	SURF2_HUMAN	surfeit 2	249						nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6				OV - Ovarian serous cystadenocarcinoma(145;4.87e-07)|Epithelial(140;4.02e-06)|all cancers(34;3.71e-05)		CCAAGAGCTTCAGCTCCTGTA	0.453																																						dbGAP											0													152.0	155.0	154.0					9																	136227991		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6967.1	9q33-q34	2008-07-21			ENSG00000148291	ENSG00000148291			11475	protein-coding gene	gene with protein product	"""surfeit locus protein 2"""	185630					Standard	NM_017503		Approved		uc004cdi.2	Q15527	OTTHUMG00000020867	ENST00000371964.4:c.747C>T	9.37:g.136227991C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IBP9|Q96CD1	Silent	SNP	pfam_Surf2	p.F249	ENST00000371964.4	37	c.747	CCDS6967.1	9																																																																																			SURF2	-	pfam_Surf2	ENSG00000148291		0.453	SURF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SURF2	HGNC	protein_coding	OTTHUMT00000054883.1	134	0.00	0	C	NM_017503		136227991	136227991	+1	no_errors	ENST00000371964	ensembl	human	known	69_37n	silent	65	41.96	47	SNP	0.184	T
SYNE2	23224	genome.wustl.edu	37	14	64600841	64600841	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:64600841C>T	ENST00000344113.4	+	78	14781	c.14569C>T	c.(14569-14571)Ctt>Ttt	p.L4857F	SYNE2_ENST00000357395.3_Missense_Mutation_p.L1242F|SYNE2_ENST00000358025.3_Missense_Mutation_p.L4857F|SYNE2_ENST00000394768.2_Missense_Mutation_p.L1242F|SYNE2_ENST00000555002.1_Missense_Mutation_p.L1491F|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000554584.1_Missense_Mutation_p.L4774F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4857					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCTGGAAATTCTTATATCTAC	0.353																																						dbGAP											0													139.0	145.0	143.0					14																	64600841		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14569C>T	14.37:g.64600841C>T	ENSP00000341781:p.Leu4857Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.L4857F	ENST00000344113.4	37	c.14569	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	12.45	1.941985	0.34283	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768	T;T;T;T;T;T	0.60548	0.54;3.85;0.54;0.18;3.92;3.85	5.95	5.95	0.96441	.	0.000000	0.47455	D	0.000227	T	0.73289	0.3568	M	0.71581	2.175	0.80722	D	1	P;P;D	0.61697	0.86;0.877;0.99	P;P;D	0.64144	0.743;0.715;0.922	T	0.73987	-0.3809	10	0.56958	D	0.05	.	15.4468	0.75238	0.0:0.932:0.0:0.068	.	1242;4857;4857	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	F	4857;1242;4857;4774;4774;1491;1242	ENSP00000350719:L4857F;ENSP00000349969:L1242F;ENSP00000341781:L4857F;ENSP00000452570:L4774F;ENSP00000450831:L1491F;ENSP00000378249:L1242F	ENSP00000261678:L4774F	L	+	1	0	SYNE2	63670594	0.994000	0.37717	0.960000	0.40013	0.769000	0.43574	2.870000	0.48451	2.821000	0.97095	0.561000	0.74099	CTT	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.353	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	184	0.00	0	C	NM_182914		64600841	64600841	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	242	16.26	47	SNP	0.998	T
TAS2R50	259296	genome.wustl.edu	37	12	11138561	11138561	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr12:11138561C>T	ENST00000506868.1	-	1	950	c.899G>A	c.(898-900)tGa>tAa	p.*300*	PRR4_ENST00000536668.1_Intron|TAS2R14_ENST00000381852.4_Intron	NM_176890.2	NP_795371.2	P59544	T2R50_HUMAN	taste receptor, type 2, member 50	0					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bitter taste receptor activity (GO:0033038)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(4)|ovary(2)|pancreas(1)	17						GTCTTTTACTCAGCACCTAAT	0.363																																						dbGAP											0													77.0	86.0	83.0					12																	11138561		2156	4283	6439	-	-	-	SO:0001819	synonymous_variant	0			AF494235	CCDS8638.1	12p13.2	2012-08-22			ENSG00000212126	ENSG00000212126		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	18882	protein-coding gene	gene with protein product		609627				12379855, 12584440, 16175505	Standard	NM_176890		Approved	T2R51	uc001qzl.2	P59544	OTTHUMG00000162719	ENST00000506868.1:c.899G>A	12.37:g.11138561C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P59545|Q2M255|Q645Y0	Silent	SNP	pfam_TAS2_rcpt	p.*300	ENST00000506868.1	37	c.899	CCDS8638.1	12																																																																																			TAS2R50	-	NULL	ENSG00000212126		0.363	TAS2R50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R50	HGNC	protein_coding	OTTHUMT00000370192.2	67	0.00	0	C	NM_176890		11138561	11138561	-1	no_errors	ENST00000506868	ensembl	human	known	69_37n	silent	104	14.05	17	SNP	0.001	T
TBL1X	6907	genome.wustl.edu	37	X	9621720	9621720	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:9621720C>T	ENST00000217964.7	+	4	734	c.94C>T	c.(94-96)Cga>Tga	p.R32*	TBL1X_ENST00000424279.1_Intron|TBL1X_ENST00000380961.1_Intron|TBL1X_ENST00000536365.1_5'UTR|TBL1X_ENST00000407597.2_Nonsense_Mutation_p.R32*	NM_005647.3	NP_005638.1	O60907	TBL1X_HUMAN	transducin (beta)-like 1X-linked	32					canonical Wnt signaling pathway (GO:0060070)|cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|proteolysis (GO:0006508)|sensory perception of sound (GO:0007605)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcriptional repressor complex (GO:0017053)	beta-catenin binding (GO:0008013)|histone binding (GO:0042393)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|cervix(1)|endometrium(5)|large_intestine(7)|lung(2)|ovary(1)|skin(2)	20		Hepatocellular(5;0.000888)				TCAACGTTTGCGAGGGAGAGG	0.602																																						dbGAP											0													91.0	69.0	77.0					X																	9621720		2169	4213	6382	-	-	-	SO:0001587	stop_gained	0			Y12781	CCDS14133.1, CCDS48078.1	Xp22.3	2013-01-10	2002-05-22	2002-05-24	ENSG00000101849	ENSG00000101849		"""WD repeat domain containing"""	11585	protein-coding gene	gene with protein product		300196	"""transducin (beta)-like 1"""	TBL1		10330347	Standard	NM_005647		Approved	EBI	uc004csr.3	O60907	OTTHUMG00000021117	ENST00000217964.7:c.94C>T	X.37:g.9621720C>T	ENSP00000217964:p.Arg32*	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K044|A8K4J7|Q86UY2	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R32*	ENST00000217964.7	37	c.94	CCDS14133.1	X	.	.	.	.	.	.	.	.	.	.	C	8.514	0.867275	0.17250	.	.	ENSG00000101849	ENST00000407597;ENST00000441088;ENST00000217964;ENST00000452824	.	.	.	1.75	-3.2	0.05156	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	.	.	.	.	0.21540	T	0.41	.	8.5094	0.33208	0.0:0.7531:0.0:0.2469	.	.	.	.	X	32	.	ENSP00000217964:R32X	R	+	1	2	TBL1X	9581720	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-2.506000	0.00962	-1.297000	0.02351	-0.912000	0.02778	CGA	TBL1X	-	NULL	ENSG00000101849		0.602	TBL1X-003	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	TBL1X	HGNC	protein_coding	OTTHUMT00000055709.1	174	0.00	0	C	NM_005647		9621720	9621720	+1	no_errors	ENST00000217964	ensembl	human	known	69_37n	nonsense	93	16.22	18	SNP	0.000	T
TBL2	26608	genome.wustl.edu	37	7	72984983	72984983	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:72984983G>C	ENST00000305632.5	-	7	1439	c.1198C>G	c.(1198-1200)Cac>Gac	p.H400D	TBL2_ENST00000459913.1_5'UTR|TBL2_ENST00000432538.1_Missense_Mutation_p.H364D	NM_012453.2	NP_036585.1	Q9Y4P3	TBL2_HUMAN	transducin (beta)-like 2	400							poly(A) RNA binding (GO:0044822)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	19		Lung NSC(55;0.0659)|all_lung(88;0.152)				GGAGTGTTGTGAAACAGCCGC	0.637																																						dbGAP											0													34.0	35.0	35.0					7																	72984983		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF056183	CCDS5551.1	7q11.23	2013-01-10			ENSG00000106638	ENSG00000106638		"""WD repeat domain containing"""	11586	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 13"""	605842				9860302, 10575226	Standard	XM_006715923		Approved	WS-betaTRP, WBSCR13, DKFZP43N024	uc003tyh.3	Q9Y4P3	OTTHUMG00000023427	ENST00000305632.5:c.1198C>G	7.37:g.72984983G>C	ENSP00000307260:p.His400Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQE2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.H400D	ENST00000305632.5	37	c.1198	CCDS5551.1	7	.	.	.	.	.	.	.	.	.	.	G	17.47	3.397180	0.62177	.	.	ENSG00000106638	ENST00000305632;ENST00000541783;ENST00000432538	T;T	0.54071	0.59;3.71	5.98	5.98	0.97165	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.52901	0.1763	N	0.16307	0.4	0.80722	D	1	D;D	0.76494	0.999;0.998	D;D	0.66979	0.948;0.919	T	0.39761	-0.9598	10	0.05620	T	0.96	-28.8659	17.9231	0.88973	0.0:0.0:1.0:0.0	.	364;400	E9PF19;Q9Y4P3	.;TBL2_HUMAN	D	400;400;364	ENSP00000307260:H400D;ENSP00000413979:H364D	ENSP00000307260:H400D	H	-	1	0	TBL2	72622919	1.000000	0.71417	1.000000	0.80357	0.153000	0.21895	9.476000	0.97823	2.833000	0.97629	0.655000	0.94253	CAC	TBL2	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000106638		0.637	TBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBL2	HGNC	protein_coding	OTTHUMT00000252233.3	36	0.00	0	G	NM_012453		72984983	72984983	-1	no_errors	ENST00000305632	ensembl	human	known	69_37n	missense	44	11.76	6	SNP	1.000	C
TLN1	7094	genome.wustl.edu	37	9	35711069	35711069	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:35711069C>T	ENST00000314888.9	-	31	4383	c.4030G>A	c.(4030-4032)Gac>Aac	p.D1344N	TLN1_ENST00000540444.1_Missense_Mutation_p.D1344N	NM_006289.3	NP_006280.3	Q9Y490	TLN1_HUMAN	talin 1	1344	Interaction with SYNM.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-cell junction assembly (GO:0007043)|cell-substrate junction assembly (GO:0007044)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cortical actin cytoskeleton organization (GO:0030866)|cytoskeletal anchoring at plasma membrane (GO:0007016)|endoplasmic reticulum unfolded protein response (GO:0030968)|muscle contraction (GO:0006936)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	integrin binding (GO:0005178)|LIM domain binding (GO:0030274)|structural constituent of cytoskeleton (GO:0005200)|vinculin binding (GO:0017166)			NS(2)|breast(8)|central_nervous_system(2)|endometrium(10)|kidney(5)|large_intestine(9)|lung(32)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(6)	85	all_epithelial(49;0.167)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			TTGATGCTGTCAGTTACTGCC	0.493																																						dbGAP											0													91.0	87.0	88.0					9																	35711069		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028950	CCDS35009.1	9p23-p21	2008-02-05			ENSG00000137076	ENSG00000137076			11845	protein-coding gene	gene with protein product		186745		TLN		7635475, 10610730	Standard	NM_006289		Approved	ILWEQ	uc003zxt.2	Q9Y490	OTTHUMG00000019874	ENST00000314888.9:c.4030G>A	9.37:g.35711069C>T	ENSP00000316029:p.Asp1344Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMY0|Q86YD0|Q9NZQ2|Q9UHH8|Q9UPX3	Missense_Mutation	SNP	pfam_Talin_cent,pfam_Vinculin-bd_dom,pfam_ILWEQ,pfam_FERM_N,pfam_FERM_central,pfam_Insln_rcpt_S1,superfamily_Talin_cent,superfamily_Vinculin/catenin,superfamily_FERM_central,smart_Band_41_domain,smart_ILWEQ,pfscan_FERM_domain,pfscan_ILWEQ	p.D1344N	ENST00000314888.9	37	c.4030	CCDS35009.1	9	.	.	.	.	.	.	.	.	.	.	C	33	5.200453	0.94997	.	.	ENSG00000137076	ENST00000314888;ENST00000540444	T;T	0.30182	1.54;1.54	5.85	5.85	0.93711	Vinculin-binding site-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.56455	0.1986	M	0.76328	2.33	0.80722	D	1	D	0.57571	0.98	D	0.64321	0.924	T	0.49969	-0.8882	10	0.38643	T	0.18	-16.2368	20.1577	0.98120	0.0:1.0:0.0:0.0	.	1344	Q9Y490	TLN1_HUMAN	N	1344	ENSP00000316029:D1344N;ENSP00000442981:D1344N	ENSP00000316029:D1344N	D	-	1	0	TLN1	35701069	1.000000	0.71417	0.981000	0.43875	0.889000	0.51656	7.818000	0.86416	2.767000	0.95098	0.655000	0.94253	GAC	TLN1	-	pfam_Vinculin-bd_dom,superfamily_Vinculin/catenin	ENSG00000137076		0.493	TLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLN1	HGNC	protein_coding	OTTHUMT00000052353.2	289	0.34	1	C	NM_006289		35711069	35711069	-1	no_errors	ENST00000314888	ensembl	human	known	69_37n	missense	258	14.85	45	SNP	1.000	T
TNN	63923	genome.wustl.edu	37	1	175116123	175116123	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:175116123G>C	ENST00000239462.4	+	19	3929	c.3816G>C	c.(3814-3816)ttG>ttC	p.L1272F		NM_022093.1	NP_071376.1	Q9UQP3	TENN_HUMAN	tenascin N	1272	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axonogenesis (GO:0007409)|cell growth (GO:0016049)|cell migration (GO:0016477)|cell-matrix adhesion (GO:0007160)	cell surface (GO:0009986)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|liver(1)|lung(81)|ovary(5)|prostate(6)|skin(5)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	156		Breast(1374;0.000962)		KIRC - Kidney renal clear cell carcinoma(1967;0.00198)		ACGTGGAGTTGAAAATCCGCC	0.517											OREG0013992	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													64.0	63.0	64.0					1																	175116123		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK127044	CCDS30943.1	1q23-q24	2013-02-11			ENSG00000120332	ENSG00000120332		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	22942	protein-coding gene	gene with protein product							Standard	NM_022093		Approved		uc001gkl.1	Q9UQP3	OTTHUMG00000034882	ENST00000239462.4:c.3816G>C	1.37:g.175116123G>C	ENSP00000239462:p.Leu1272Phe	Somatic	1921	WXS	Illumina GAIIx	Phase_IV	B9EGP3|Q5R360	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_Fibronectin_type3	p.L1272F	ENST00000239462.4	37	c.3816	CCDS30943.1	1	.	.	.	.	.	.	.	.	.	.	G	22.3	4.269656	0.80469	.	.	ENSG00000120332	ENST00000239462;ENST00000539081	D	0.83335	-1.71	5.8	4.87	0.63330	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (4);	0.225079	0.43416	N	0.000566	D	0.85292	0.5663	N	0.25890	0.77	0.37122	D	0.90086	D	0.69078	0.997	D	0.70227	0.968	D	0.89111	0.3496	10	0.87932	D	0	.	14.8972	0.70651	0.0701:0.0:0.9299:0.0	.	1272	Q9UQP3	TENN_HUMAN	F	1272;1095	ENSP00000239462:L1272F	ENSP00000239462:L1272F	L	+	3	2	TNN	173382746	1.000000	0.71417	0.978000	0.43139	0.995000	0.86356	4.980000	0.63812	1.423000	0.47198	0.579000	0.79373	TTG	TNN	-	pfam_Fibrinogen_a/b/g_C,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	ENSG00000120332		0.517	TNN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNN	HGNC	protein_coding	OTTHUMT00000084422.1	71	0.00	0	G	XM_040527		175116123	175116123	+1	no_errors	ENST00000239462	ensembl	human	known	69_37n	missense	87	14.71	15	SNP	1.000	C
TOX	9760	genome.wustl.edu	37	8	59764365	59764365	+	Splice_Site	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr8:59764365C>G	ENST00000361421.1	-	4	632		c.e4-1			NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box							nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				TATCTGGCATCTACaataaat	0.353																																					Pancreas(161;610 1969 17913 21374 22725)	dbGAP											0													51.0	45.0	47.0					8																	59764365		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.412-1G>C	8.37:g.59764365C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96AV5	Splice_Site	SNP	-	e4-1	ENST00000361421.1	37	c.412-1	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	C	15.56	2.870551	0.51588	.	.	ENSG00000198846	ENST00000361421	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.0846	0.97795	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TOX	59926919	1.000000	0.71417	0.998000	0.56505	0.456000	0.32438	6.220000	0.72237	2.750000	0.94351	0.549000	0.68633	.	TOX	-	-	ENSG00000198846		0.353	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	31	0.00	0	C	NM_014729	Intron	59764365	59764365	-1	no_errors	ENST00000361421	ensembl	human	known	69_37n	splice_site	38	13.64	6	SNP	1.000	G
TP53	7157	genome.wustl.edu	37	17	7577539	7577539	+	Missense_Mutation	SNP	G	G	A	rs397516437|rs121912651		TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr17:7577539G>A	ENST00000269305.4	-	7	931	c.742C>T	c.(742-744)Cgg>Tgg	p.R248W	TP53_ENST00000359597.4_Missense_Mutation_p.R248W|TP53_ENST00000455263.2_Missense_Mutation_p.R248W|TP53_ENST00000445888.2_Missense_Mutation_p.R248W|TP53_ENST00000420246.2_Missense_Mutation_p.R248W|TP53_ENST00000413465.2_Missense_Mutation_p.R248W|TP53_ENST00000574684.1_5'Flank	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	248	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Interacts with the 53BP2 SH3 domain.|Required for interaction with ZNF385A.		NR -> IP (in a sporadic cancer; somatic mutation).|NR -> KW (in sporadic cancers; somatic mutation).|R -> C (in a sporadic cancer; somatic mutation).|R -> G (in sporadic cancers; somatic mutation).|R -> L (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:1394225, ECO:0000269|PubMed:7682763}.|R -> P (in sporadic cancers; somatic mutation).|R -> Q (in LFS; germline mutation and in sporadic cancers; somatic mutation; dbSNP:rs11540652). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:2263646, ECO:0000269|PubMed:7682763, ECO:0000269|PubMed:7887414}.|R -> W (in LFS; germline mutation and in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:16959974, ECO:0000269|PubMed:1978757, ECO:0000269|PubMed:8829627}.		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.R248W(544)|p.R155W(28)|p.R248G(12)|p.0?(8)|p.?(5)|p.N247_R248delNR(2)|p.R248fs*16(2)|p.N247_R248>KW(2)|p.M246_P250delMNRRP(2)|p.R248fs*97(2)|p.R248R(2)|p.R248fs*>39(1)|p.R248_P250delRRP(1)|p.unknown(1)|p.N247_R249delNRR(1)|p.N247_P250delNRRP(1)|p.R248C(1)|p.G245fs*14(1)|p.N247_R248>IP(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	ATGGGCCTCCGGTTCATGCCG	0.577	R248W(786O_KIDNEY)|R248W(CAS1_CENTRAL_NERVOUS_SYSTEM)|R248W(COLO320_LARGE_INTESTINE)|R248W(COLO680N_OESOPHAGUS)|R248W(DB_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(GCT_SOFT_TISSUE)|R248W(HCC2157_BREAST)|R248W(JIMT1_BREAST)|R248W(KO52_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|R248W(LUDLU1_LUNG)|R248W(LXF289_LUNG)|R248W(MIAPACA2_PANCREAS)|R248W(RD_SOFT_TISSUE)|R248W(SW837_LARGE_INTESTINE)|R248W(VCAP_PROSTATE)	111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	617	Substitution - Missense(585)|Whole gene deletion(8)|Deletion - In frame(7)|Unknown(6)|Insertion - Frameshift(3)|Deletion - Frameshift(3)|Complex - compound substitution(3)|Substitution - coding silent(2)	large_intestine(156)|breast(72)|ovary(42)|endometrium(38)|oesophagus(38)|skin(37)|haematopoietic_and_lymphoid_tissue(37)|central_nervous_system(35)|stomach(27)|lung(26)|upper_aerodigestive_tract(25)|urinary_tract(19)|biliary_tract(17)|pancreas(12)|prostate(10)|soft_tissue(6)|bone(6)|thyroid(4)|liver(4)|penis(2)|peritoneum(1)|vulva(1)|kidney(1)|cervix(1)	GRCh37	CM010465|CM900211	TP53	M	rs121912651						151.0	112.0	125.0					17																	7577539		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.742C>T	17.37:g.7577539G>A	ENSP00000269305:p.Arg248Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.R248W	ENST00000269305.4	37	c.742	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	G	18.84	3.710019	0.68730	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944	D;D;D;D;D;D;D;D	0.99869	-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34;-7.34	4.62	2.56	0.30785	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99843	0.9928	M	0.92507	3.315	0.58432	A	0.999997	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0;1.0	D	0.97208	0.9869	9	0.87932	D	0	-9.5643	7.568	0.27890	0.0893:0.0:0.7471:0.1636	.	248;248;155;248;248;248	P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;P53_HUMAN;.;.	W	248;248;248;248;248;248;237;155;116;155	ENSP00000410739:R248W;ENSP00000352610:R248W;ENSP00000269305:R248W;ENSP00000398846:R248W;ENSP00000391127:R248W;ENSP00000391478:R248W;ENSP00000425104:R116W;ENSP00000423862:R155W	ENSP00000269305:R248W	R	-	1	2	TP53	7518264	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	1.447000	0.35101	0.644000	0.30656	0.462000	0.41574	CGG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.577	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	150	0.00	0	G	NM_000546		7577539	7577539	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	55	33.73	28	SNP	1.000	A
TRIM42	287015	genome.wustl.edu	37	3	140397118	140397118	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr3:140397118G>C	ENST00000286349.3	+	1	238	c.47G>C	c.(46-48)aGa>aCa	p.R16T		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	16	Cys-rich.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACATGGCAGAGATGTTGTCCT	0.522																																						dbGAP											0													372.0	315.0	334.0					3																	140397118		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.47G>C	3.37:g.140397118G>C	ENSP00000286349:p.Arg16Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4B4|Q8N832|Q8NDL3	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R16T	ENST00000286349.3	37	c.47	CCDS3113.1	3	.	.	.	.	.	.	.	.	.	.	G	14.01	2.407946	0.42715	.	.	ENSG00000155890	ENST00000286349	T	0.38240	1.15	5.37	4.48	0.54585	.	0.194216	0.36555	N	0.002538	T	0.36331	0.0963	N	0.14661	0.345	0.29684	N	0.84144	D	0.69078	0.997	P	0.60789	0.879	T	0.21280	-1.0250	10	0.72032	D	0.01	-6.3628	10.4983	0.44791	0.0928:0.0:0.9072:0.0	.	16	Q8IWZ5	TRI42_HUMAN	T	16	ENSP00000286349:R16T	ENSP00000286349:R16T	R	+	2	0	TRIM42	141879808	0.421000	0.25465	1.000000	0.80357	0.628000	0.37860	1.063000	0.30567	2.514000	0.84764	0.563000	0.77884	AGA	TRIM42	-	NULL	ENSG00000155890		0.522	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	410	0.00	0	G	NM_152616		140397118	140397118	+1	no_errors	ENST00000286349	ensembl	human	known	69_37n	missense	218	14.17	36	SNP	0.979	C
TRIM9	114088	genome.wustl.edu	37	14	51448553	51448553	+	Silent	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr14:51448553C>G	ENST00000298355.3	-	8	2993	c.1872G>C	c.(1870-1872)cgG>cgC	p.R624R	TRIM9_ENST00000557456.1_5'Flank|TRIM9_ENST00000338969.5_Silent_p.R705R	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9	624	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					TGAACCAGCTCCGGTTATTGT	0.527																																						dbGAP											0													288.0	254.0	265.0					14																	51448553		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1872G>C	14.37:g.51448553C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Silent	SNP	pfam_SPRY_rcpt,pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R705	ENST00000298355.3	37	c.2115	CCDS9703.1	14																																																																																			TRIM9	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY	ENSG00000100505		0.527	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	407	0.00	0	C	NM_015163		51448553	51448553	-1	no_errors	ENST00000338969	ensembl	human	known	69_37n	silent	305	20.37	78	SNP	1.000	G
TTC16	158248	genome.wustl.edu	37	9	130486524	130486524	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:130486524C>G	ENST00000373289.3	+	8	1078	c.998C>G	c.(997-999)aCc>aGc	p.T333S	TTC16_ENST00000393748.4_Missense_Mutation_p.T157S|PTRH1_ENST00000429848.1_Intron|TTC16_ENST00000489226.1_3'UTR|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16	333										central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CTGTTGCTGACCTACAACGAC	0.627																																						dbGAP											0													99.0	74.0	83.0					9																	130486524		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.998C>G	9.37:g.130486524C>G	ENSP00000362386:p.Thr333Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T333S	ENST00000373289.3	37	c.998	CCDS6875.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.93|16.93	3.258595|3.258595	0.59321|0.59321	.|.	.|.	ENSG00000167094|ENSG00000167094	ENST00000373288;ENST00000316259|ENST00000373289;ENST00000393748	.|T;T	.|0.62941	.|-0.01;1.2	5.58|5.58	5.58|5.58	0.84498|0.84498	.|Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	.|0.423693	.|0.22305	.|N	.|0.061806	T|T	0.59088|0.59088	0.2168|0.2168	N|N	0.21194|0.21194	0.64|0.64	0.41921|0.41921	D|D	0.990519|0.990519	.|P;P;P	.|0.46859	.|0.885;0.803;0.885	.|P;B;P	.|0.48770	.|0.589;0.338;0.589	T|T	0.59096|0.59096	-0.7518|-0.7518	6|10	0.33141|0.38643	T|T	0.24|0.18	-11.4723|-11.4723	18.1225|18.1225	0.89576|0.89576	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|320;285;333	.|B4DZ42;B4DH05;Q8NEE8	.|.;.;TTC16_HUMAN	E|S	158;277|333;157	.|ENSP00000362386:T333S;ENSP00000377349:T157S	ENSP00000319048:D277E|ENSP00000362386:T333S	D|T	+|+	3|2	2|0	TTC16|TTC16	129526345|129526345	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.210000|0.210000	0.24377|0.24377	4.939000|4.939000	0.63526|0.63526	2.626000|2.626000	0.88956|0.88956	0.313000|0.313000	0.20887|0.20887	GAC|ACC	TTC16	-	pfscan_TPR-contain_dom	ENSG00000167094		0.627	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	35	0.00	0	C	NM_144965		130486524	130486524	+1	no_errors	ENST00000373289	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	1.000	G
UBA1	7317	genome.wustl.edu	37	X	47073983	47073983	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:47073983G>A	ENST00000335972.6	+	25	3171	c.2988G>A	c.(2986-2988)atG>atA	p.M996I	UBA1_ENST00000377351.4_Missense_Mutation_p.M996I|UBA1_ENST00000377269.3_Missense_Mutation_p.M444I	NM_003334.3	NP_003325.2	P22314	UBA1_HUMAN	ubiquitin-like modifier activating enzyme 1	996					cell death (GO:0008219)|cellular response to DNA damage stimulus (GO:0006974)|modification-dependent protein catabolic process (GO:0019941)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin activating enzyme activity (GO:0004839)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(7)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						GCGTGTCCATGCTCTATTCCT	0.582																																						dbGAP											0													125.0	74.0	91.0					X																	47073983		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF258566	CCDS14275.1	Xp11.23	2014-08-13	2007-11-30	2007-11-30	ENSG00000130985	ENSG00000130985	6.3.2.19	"""Ubiquitin-like modifier activating enzymes"""	12469	protein-coding gene	gene with protein product	"""UBA1, ubiquitin-activating enzyme E1 homolog (yeast)"", ""POC20 centriolar protein homolog (Chlamydomonas)"""	314370	"""ubiquitin-activating enzyme E1 (A1S9T and BN75 temperature sensitivity complementing)"", ""ubiquitin-activating enzyme E1"""	A1S9T, GXP1, UBE1		1845793	Standard	NM_153280		Approved	UBE1X, POC20, CFAP124	uc004dhj.4	P22314	OTTHUMG00000021436	ENST00000335972.6:c.2988G>A	X.37:g.47073983G>A	ENSP00000338413:p.Met996Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JRR8|Q96E13	Missense_Mutation	SNP	pfam_ThiF_NAD_FAD-bd,pfam_Ub-activating_enz_e1_C,pfam_UBact_repeat,pfam_Ubiquitin-activating_enzyme,superfamily_Molybdenum_cofac_synth_MoeB,prints_UBQ/SUMO-activ_enz_E1-like,tigrfam_UBQ-activ_enz_E1	p.M996I	ENST00000335972.6	37	c.2988	CCDS14275.1	X	.	.	.	.	.	.	.	.	.	.	g	23.7	4.452663	0.84209	.	.	ENSG00000130985	ENST00000377351;ENST00000335972;ENST00000377269	T;T;T	0.41400	1.0;1.0;1.58	5.38	5.38	0.77491	Ubiquitin-activating enzyme e1, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.50309	0.1608	M	0.76727	2.345	0.80722	D	1	P;B	0.38677	0.642;0.394	B;B	0.41135	0.348;0.237	T	0.53760	-0.8393	10	0.46703	T	0.11	-26.1805	17.1756	0.86841	0.0:0.0:1.0:0.0	.	444;996	Q5JRR6;P22314	.;UBA1_HUMAN	I	996;996;444	ENSP00000366568:M996I;ENSP00000338413:M996I;ENSP00000366481:M444I	ENSP00000338413:M996I	M	+	3	0	UBA1	46958927	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.021000	0.70832	2.409000	0.81822	0.525000	0.51046	ATG	UBA1	-	pfam_Ub-activating_enz_e1_C,tigrfam_UBQ-activ_enz_E1	ENSG00000130985		0.582	UBA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA1	HGNC	protein_coding	OTTHUMT00000056389.1	185	0.00	0	G	NM_003334		47073983	47073983	+1	no_errors	ENST00000335972	ensembl	human	known	69_37n	missense	143	20.11	36	SNP	1.000	A
UBAP2	55833	genome.wustl.edu	37	9	33944419	33944419	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:33944419G>A	ENST00000379238.1	-	14	1606	c.1489C>T	c.(1489-1491)Cag>Tag	p.Q497*	UBAP2_ENST00000539807.1_Nonsense_Mutation_p.Q252*|UBAP2_ENST00000418786.2_Nonsense_Mutation_p.Q444*|UBAP2_ENST00000360802.1_Nonsense_Mutation_p.Q497*|UBAP2_ENST00000379225.1_Nonsense_Mutation_p.Q130*|UBAP2_ENST00000449054.1_Nonsense_Mutation_p.Q497*|UBAP2_ENST00000379239.4_Nonsense_Mutation_p.Q230*					ubiquitin associated protein 2											endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(13)|ovary(3)|stomach(1)	32			LUSC - Lung squamous cell carcinoma(29;0.00575)	GBM - Glioblastoma multiforme(74;0.168)		GGCTGTGGCTGGTGGACAGAC	0.483																																						dbGAP											0													120.0	114.0	116.0					9																	33944419		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB040924	CCDS6547.1, CCDS75828.1	9p11.2	2008-02-05			ENSG00000137073	ENSG00000137073			14185	protein-coding gene	gene with protein product						8871400	Standard	NM_018449		Approved	KIAA1491, bA176F3.5, FLJ22435	uc003ztq.1	Q5T6F2	OTTHUMG00000000427	ENST00000379238.1:c.1489C>T	9.37:g.33944419G>A	ENSP00000368540:p.Gln497*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	pfam_DUF3697_Uba2,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk	p.Q497*	ENST00000379238.1	37	c.1489	CCDS6547.1	9	.	.	.	.	.	.	.	.	.	.	G	36	5.622829	0.96660	.	.	ENSG00000137073	ENST00000379238;ENST00000449054;ENST00000360802;ENST00000431417;ENST00000379239;ENST00000539807;ENST00000418786;ENST00000379225	.	.	.	5.16	5.16	0.70880	.	0.053373	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.26408	T	0.33	-3.2382	18.6589	0.91465	0.0:0.0:1.0:0.0	.	.	.	.	X	497;497;497;406;230;252;444;130	.	ENSP00000354039:Q497X	Q	-	1	0	UBAP2	33934419	1.000000	0.71417	1.000000	0.80357	0.450000	0.32258	7.869000	0.87170	2.402000	0.81655	0.650000	0.86243	CAG	UBAP2	-	NULL	ENSG00000137073		0.483	UBAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBAP2	HGNC	protein_coding	OTTHUMT00000001071.1	192	0.00	0	G	NM_018449		33944419	33944419	-1	no_errors	ENST00000360802	ensembl	human	known	69_37n	nonsense	250	12.89	37	SNP	1.000	A
UBR4	23352	genome.wustl.edu	37	1	19487440	19487440	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr1:19487440C>T	ENST00000375254.3	-	38	5404	c.5377G>A	c.(5377-5379)Gag>Aag	p.E1793K	UBR4_ENST00000375226.2_Missense_Mutation_p.E1793K|UBR4_ENST00000375267.2_Missense_Mutation_p.E1793K|UBR4_ENST00000375217.2_Missense_Mutation_p.E1793K	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	1793					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CGGCAGCCCTCTACTGTGCGG	0.532																																						dbGAP											0													53.0	52.0	52.0					1																	19487440		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.5377G>A	1.37:g.19487440C>T	ENSP00000364403:p.Glu1793Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E1793K	ENST00000375254.3	37	c.5377	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	34	5.298510	0.95574	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226;ENST00000417040;ENST00000419533	T;T;T;T	0.27890	1.65;1.64;1.65;1.64	5.78	5.78	0.91487	.	0.053862	0.64402	D	0.000001	T	0.31513	0.0799	L	0.55213	1.73	0.80722	D	1	P	0.34522	0.455	B	0.27076	0.076	T	0.04203	-1.0969	10	0.34782	T	0.22	.	20.0124	0.97464	0.0:1.0:0.0:0.0	.	1793	Q5T4S7	UBR4_HUMAN	K	1793;1793;1793;1793;503;1009	ENSP00000364403:E1793K;ENSP00000364416:E1793K;ENSP00000364365:E1793K;ENSP00000364374:E1793K	ENSP00000364365:E1793K	E	-	1	0	UBR4	19360027	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	7.482000	0.81143	2.749000	0.94314	0.655000	0.94253	GAG	UBR4	-	superfamily_ARM-type_fold	ENSG00000127481		0.532	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	174	0.00	0	C	NM_020765		19487440	19487440	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	81	22.12	23	SNP	1.000	T
VCAN	1462	genome.wustl.edu	37	5	82833462	82833462	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:82833462C>G	ENST00000265077.3	+	8	5205	c.4640C>G	c.(4639-4641)tCt>tGt	p.S1547C	VCAN_ENST00000512590.2_Intron|VCAN_ENST00000502527.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.S560C	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1547	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CCTGAAGAGTCTTCAGGAGAG	0.423																																						dbGAP											0													68.0	69.0	69.0					5																	82833462		2203	4300	6503	-	-	-	SO:0001583	missense	0			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.4640C>G	5.37:g.82833462C>G	ENSP00000265077:p.Ser1547Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EGF-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.S1547C	ENST00000265077.3	37	c.4640	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	C	17.76	3.467700	0.63625	.	.	ENSG00000038427	ENST00000265077;ENST00000343200;ENST00000513960	D;D;T	0.89196	-2.46;-2.48;2.63	5.78	1.72	0.24424	.	0.359095	0.24708	N	0.036259	D	0.90686	0.7078	M	0.72894	2.215	0.58432	D	0.999997	D;D	0.76494	0.998;0.999	P;P	0.61592	0.891;0.862	D	0.86981	0.2104	10	0.62326	D	0.03	.	4.6172	0.12432	0.3028:0.4847:0.0:0.2124	.	560;1547	P13611-2;P13611	.;CSPG2_HUMAN	C	1547;560;560	ENSP00000265077:S1547C;ENSP00000340062:S560C;ENSP00000426251:S560C	ENSP00000265077:S1547C	S	+	2	0	VCAN	82869218	0.946000	0.32159	0.788000	0.31933	0.989000	0.77384	0.245000	0.18142	-0.003000	0.14444	0.655000	0.94253	TCT	VCAN	-	NULL	ENSG00000038427		0.423	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	127	0.00	0	C	NM_004385		82833462	82833462	+1	no_errors	ENST00000265077	ensembl	human	known	69_37n	missense	109	18.66	25	SNP	0.889	G
WDR17	116966	genome.wustl.edu	37	4	177046468	177046468	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr4:177046468C>T	ENST00000280190.4	+	6	980	c.824C>T	c.(823-825)gCc>gTc	p.A275V	WDR17_ENST00000508596.1_Missense_Mutation_p.A251V|WDR17_ENST00000393643.2_Missense_Mutation_p.A251V|WDR17_ENST00000507824.2_Missense_Mutation_p.A258V			Q8IZU2	WDR17_HUMAN	WD repeat domain 17	275										breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(18)|lung(46)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	92		Breast(14;0.00015)|Melanoma(52;0.00886)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;2.21e-20)|Epithelial(43;9.71e-18)|OV - Ovarian serous cystadenocarcinoma(60;2.38e-09)|GBM - Glioblastoma multiforme(59;0.000295)|STAD - Stomach adenocarcinoma(60;0.000703)|LUSC - Lung squamous cell carcinoma(193;0.0232)		CAGTGCTTAGCCTGGGTTCCC	0.398																																						dbGAP											0													124.0	130.0	128.0					4																	177046468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF492460	CCDS3825.1, CCDS43284.1, CCDS43284.2	4q34	2013-01-09			ENSG00000150627	ENSG00000150627		"""WD repeat domain containing"""	16661	protein-coding gene	gene with protein product		609005				12401215	Standard	NM_170710		Approved		uc003iuj.3	Q8IZU2	OTTHUMG00000160791	ENST00000280190.4:c.824C>T	4.37:g.177046468C>T	ENSP00000280190:p.Ala275Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQX0|Q0QD35	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A275V	ENST00000280190.4	37	c.824	CCDS3825.1	4	.	.	.	.	.	.	.	.	.	.	C	24.7	4.561576	0.86335	.	.	ENSG00000150627	ENST00000508596;ENST00000393643;ENST00000280190;ENST00000507824	T;T;T	0.66638	-0.22;-0.22;-0.22	5.23	4.37	0.52481	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.118496	0.56097	D	0.000032	T	0.81128	0.4758	M	0.75447	2.3	0.58432	D	0.999999	D;D	0.76494	0.999;0.999	D;D	0.79784	0.993;0.993	D	0.84011	0.0348	10	0.72032	D	0.01	-5.5414	15.7428	0.77914	0.0:0.8633:0.1367:0.0	.	251;275	E7EQX0;Q8IZU2	.;WDR17_HUMAN	V	251;251;275;258	ENSP00000422763:A251V;ENSP00000377258:A251V;ENSP00000280190:A275V	ENSP00000280190:A275V	A	+	2	0	WDR17	177283462	1.000000	0.71417	0.978000	0.43139	0.993000	0.82548	6.993000	0.76245	1.399000	0.46721	0.650000	0.86243	GCC	WDR17	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000150627		0.398	WDR17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR17	HGNC	protein_coding	OTTHUMT00000362334.2	244	0.00	0	C			177046468	177046468	+1	no_errors	ENST00000280190	ensembl	human	known	69_37n	missense	158	21.39	43	SNP	1.000	T
WDR31	114987	genome.wustl.edu	37	9	116094279	116094279	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr9:116094279C>T	ENST00000374193.4	-	3	270	c.24G>A	c.(22-24)ctG>ctA	p.L8L	WDR31_ENST00000341761.4_Silent_p.L8L|WDR31_ENST00000374195.3_5'UTR|WDR31_ENST00000461942.1_5'UTR	NM_001012361.2|NM_145241.3	NP_001012361.1|NP_660284.1	Q8NA23	WDR31_HUMAN	WD repeat domain 31	8										NS(1)|large_intestine(1)|lung(2)|prostate(2)	6						GAGCTTGTTTCAGTTGGCACC	0.418																																						dbGAP											0													140.0	119.0	126.0					9																	116094279		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC012352	CCDS6792.1, CCDS35110.1	9q33.1	2013-01-09			ENSG00000148225	ENSG00000148225		"""WD repeat domain containing"""	21421	protein-coding gene	gene with protein product	"""similar to spermatid WD-repeat protein"""						Standard	NM_145241		Approved	FLJ35921	uc004bhb.3	Q8NA23	OTTHUMG00000020525	ENST00000374193.4:c.24G>A	9.37:g.116094279C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W0T9|Q96EG8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L8	ENST00000374193.4	37	c.24	CCDS35110.1	9																																																																																			WDR31	-	NULL	ENSG00000148225		0.418	WDR31-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR31	HGNC	protein_coding	OTTHUMT00000053734.2	260	0.00	0	C	NM_145241		116094279	116094279	-1	no_errors	ENST00000374193	ensembl	human	known	69_37n	silent	103	48.76	98	SNP	0.001	T
WHAMMP2	440253	genome.wustl.edu	37	15	28991133	28991133	+	RNA	SNP	A	A	G	rs200163148	byFrequency	TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr15:28991133A>G	ENST00000512149.2	+	0	0					NR_026589.1				WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 2																		CAGGAATGCAAAAAGAAATGG	0.378																																						dbGAP											0																																										-	-	-			0			BC035099		15q13.1	2014-03-20	2011-06-24	2011-06-24	ENSG00000248334	ENSG00000248334			32360	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 2 (pseudogene)"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 2 (pseudogene)"""	WHDC1L2, WHAMML2			Standard	NR_026589		Approved		uc010uap.2		OTTHUMG00000176340		15.37:g.28991133A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000512149.2	37	NULL		15																																																																																			WHAMMP2	-	-	ENSG00000248334		0.378	WHAMMP2-003	PUTATIVE	basic	processed_transcript	WHAMMP2	HGNC	pseudogene	OTTHUMT00000431783.1	9	0.00	0	A	NR_026589		28991133	28991133	+1	no_errors	ENST00000508764	ensembl	human	putative	69_37n	rna	2	77.78	7	SNP	1.000	G
WNK3	65267	genome.wustl.edu	37	X	54263733	54263733	+	Silent	SNP	G	G	A			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chrX:54263733G>A	ENST00000375159.2	-	19	4265	c.4266C>T	c.(4264-4266)ttC>ttT	p.F1422F	WNK3_ENST00000375169.3_Silent_p.F1375F|WNK3_ENST00000354646.2_Silent_p.F1422F			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	1422					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						AAGCTGCGCTGAAAGATAAGA	0.403																																						dbGAP											0													85.0	73.0	77.0					X																	54263733		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.4266C>T	X.37:g.54263733G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F1422	ENST00000375159.2	37	c.4266	CCDS14357.1	X																																																																																			WNK3	-	NULL	ENSG00000196632		0.403	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	197	0.00	0	G	NM_020922		54263733	54263733	-1	no_errors	ENST00000354646	ensembl	human	known	69_37n	silent	170	22.37	49	SNP	1.000	A
ZAN	7455	genome.wustl.edu	37	7	100382296	100382296	+	RNA	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr7:100382296C>T	ENST00000348028.3	+	0	6838				ZAN_ENST00000546213.1_RNA|ZAN_ENST00000421100.1_RNA|ZAN_ENST00000449052.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000443370.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CCCTCCTGCTCACCCTCCTGC	0.627																																						dbGAP											0													60.0	63.0	62.0					7																	100382296		2102	4221	6323	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100382296C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.S2224L	ENST00000348028.3	37	c.6671		7	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813655	0.70912	.	.	ENSG00000146839	ENST00000546292;ENST00000538115;ENST00000542585;ENST00000546213	D;D;D;D	0.90732	-2.72;-2.72;-2.72;-2.72	4.34	1.37	0.22104	Protease inhibitor I8, cysteine-rich trypsin inhibitor-like (2);	1.951610	0.03251	N	0.181784	D	0.82440	0.5037	.	.	.	0.09310	N	1	B;B;B	0.10296	0.002;0.002;0.003	B;B;B	0.15052	0.007;0.007;0.012	T	0.66594	-0.5884	9	0.23302	T	0.38	.	4.1287	0.10139	0.1836:0.6093:0.0:0.207	.	698;2224;2225	F5GX59;F5H0T8;Q9Y493	.;.;ZAN_HUMAN	L	2224;2224;2224;698	ENSP00000445943:S2224L;ENSP00000445091:S2224L;ENSP00000444427:S2224L;ENSP00000441117:S698L	ENSP00000445091:S2224L	S	+	2	0	ZAN	100220232	0.005000	0.15991	0.003000	0.11579	0.658000	0.38924	0.564000	0.23563	0.145000	0.18977	0.655000	0.94253	TCA	ZAN	-	pfam_TIL_dom,superfamily_TIL_dom,smart_EGF-like	ENSG00000146839		0.627	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	145	0.00	0	C	NM_003386		100382296	100382296	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	missense	103	10.43	12	SNP	0.141	T
ZNF536	9745	genome.wustl.edu	37	19	31039202	31039202	+	Silent	SNP	C	C	T			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:31039202C>T	ENST00000355537.3	+	4	2823	c.2676C>T	c.(2674-2676)tcC>tcT	p.S892S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	892					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					ACCTTCCTTCCAAAAGCACCC	0.527																																						dbGAP											0													126.0	128.0	128.0					19																	31039202		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.2676C>T	19.37:g.31039202C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S892	ENST00000355537.3	37	c.2676	CCDS32984.1	19																																																																																			ZNF536	-	NULL	ENSG00000198597		0.527	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	75	0.00	0	C	NM_014717		31039202	31039202	+1	no_errors	ENST00000355537	ensembl	human	known	69_37n	silent	70	15.66	13	SNP	1.000	T
ZNF829	374899	genome.wustl.edu	37	19	37383084	37383084	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:37383084C>G	ENST00000391711.3	-	6	973	c.609G>C	c.(607-609)caG>caC	p.Q203H	ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron|ZNF829_ENST00000520965.1_Missense_Mutation_p.Q284H	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	203					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGTGAATCCTCTGATGTCGAG	0.383																																						dbGAP											0													66.0	67.0	67.0					19																	37383084		2177	4286	6463	-	-	-	SO:0001583	missense	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.609G>C	19.37:g.37383084C>G	ENSP00000429266:p.Gln203His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q284H	ENST00000391711.3	37	c.852	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	C	5.867	0.344122	0.11126	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.18502	2.21	3.41	1.25	0.21368	Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17280	0.0415	M	0.71920	2.185	0.22317	N	0.999209	B	0.14438	0.01	B	0.09377	0.004	T	0.29027	-1.0025	9	0.54805	T	0.06	.	3.5682	0.07908	0.0:0.4768:0.193:0.3302	.	203	Q3KNS6	ZN829_HUMAN	H	203	ENSP00000429266:Q203H	ENSP00000429266:Q203H	Q	-	3	2	ZNF829	42074924	0.000000	0.05858	0.948000	0.38648	0.300000	0.27592	-0.107000	0.10873	0.443000	0.26582	-0.142000	0.14014	CAG	ZNF829	-	pfscan_Znf_C2H2	ENSG00000185869		0.383	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	129	0.00	0	C	NM_001037232		37383084	37383084	-1	no_errors	ENST00000520965	ensembl	human	known	69_37n	missense	53	38.37	33	SNP	0.911	G
ZNF829	374899	genome.wustl.edu	37	19	37383374	37383374	+	Splice_Site	SNP	C	C	G			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr19:37383374C>G	ENST00000391711.3	-	6	684		c.e6-1		ZNF345_ENST00000526123.1_Intron|ZNF345_ENST00000432005.2_Intron|ZNF829_ENST00000520965.1_Splice_Site	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			GATTCCAGATCTGAAAGAAAA	0.308																																						dbGAP											0													42.0	38.0	39.0					19																	37383374		1799	4081	5880	-	-	-	SO:0001630	splice_region_variant	0			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.320-1G>C	19.37:g.37383374C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3KNS7|Q6ZNN0|Q7Z657	Splice_Site	SNP	-	e6-1	ENST00000391711.3	37	c.563-1	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	C	16.46	3.129434	0.56721	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	.	.	.	3.99	3.99	0.46301	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.4592	0.61217	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ZNF829	42075214	0.998000	0.40836	1.000000	0.80357	0.961000	0.63080	1.622000	0.36997	2.231000	0.72958	0.650000	0.86243	.	ZNF829	-	-	ENSG00000185869		0.308	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	50	0.00	0	C	NM_001037232	Intron	37383374	37383374	-1	no_errors	ENST00000520965	ensembl	human	known	69_37n	splice_site	44	18.52	10	SNP	1.000	G
ZRSR1	7310	genome.wustl.edu	37	5	112227496	112227496	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12P-01A-11D-A10Y-09	TCGA-C8-A12P-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	540fe594-0186-40d3-b519-c1ccebe82247	323e0bfd-8f8f-41a8-a94a-8d2d862a15b1	g.chr5:112227496G>C	ENST00000391338.1	+	1	184	c.160G>C	c.(160-162)Gag>Cag	p.E54Q	REEP5_ENST00000513339.1_Intron|REEP5_ENST00000379638.4_Intron|REEP5_ENST00000504247.1_Intron|CTC-487M23.5_ENST00000602872.1_RNA|CTC-487M23.8_ENST00000506997.1_3'UTR|CTC-487M23.8_ENST00000512790.1_3'UTR|REEP5_ENST00000545426.1_Intron|REEP5_ENST00000474542.2_Intron	NM_001204199.1	NP_001191128.1	Q15695	U2AFL_HUMAN	zinc finger (CCCH type), RNA-binding motif and serine/arginine rich 1	54						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|skin(1)|stomach(2)	4						GGAGGAGGAAGAGGACACTTT	0.483																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			D49676		5q22.2	2013-02-12	2006-09-26	2006-09-26	ENSG00000212643	ENSG00000212643		"""Zinc fingers, CCCH-type domain containing"", ""RNA binding motif (RRM) containing"""	12456	protein-coding gene	gene with protein product	"""U2(RNU2) small nuclear RNA auxiliary factor pseudogene 1"""	601079	"""U2(RNU2) small nuclear RNA auxiliary factor binding protein-like"", ""U2(RNU2) small nuclear RNA auxillary factor 1-like 1"", ""U2 small nuclear RNA auxillary factor 1-like 1"""	U2AFBPL, U2AF1P, U2AF1L1		7956352	Standard	NG_005419		Approved	U2AF1-RS1, U2AF1RS1	uc021ycm.1	Q15695	OTTHUMG00000163143	ENST00000391338.1:c.160G>C	5.37:g.112227496G>C	ENSP00000375133:p.Glu54Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R901|Q13570|Q2M3R8	Missense_Mutation	SNP	pfam_Znf_CCCH,pfam_RRM_dom,smart_Znf_CCCH,smart_RRM_dom_euk,pfscan_RRM_dom,prints_U2_small	p.E54Q	ENST00000391338.1	37	c.160		5	.	.	.	.	.	.	.	.	.	.	G	10.99	1.508353	0.27036	.	.	ENSG00000212643	ENST00000391338	T	0.02446	4.29	1.76	0.84	0.18912	.	0.100044	0.64402	D	0.000003	T	0.01592	0.0051	.	.	.	0.09310	N	1	B	0.21225	0.053	B	0.14578	0.011	T	0.48103	-0.9064	9	0.20046	T	0.44	.	4.1975	0.10450	0.2218:0.0:0.7782:0.0	.	54	Q15695	U2AFL_HUMAN	Q	54	ENSP00000375133:E54Q	ENSP00000375133:E54Q	E	+	1	0	ZRSR1	112255395	0.973000	0.33851	0.003000	0.11579	0.720000	0.41350	2.549000	0.45803	0.275000	0.22094	0.467000	0.42956	GAG	ZRSR1	-	NULL	ENSG00000212643		0.483	ZRSR1-001	KNOWN	basic|appris_principal	protein_coding	ZRSR1	HGNC	protein_coding	OTTHUMT00000371801.1	229	0.00	0	G	NM_005083		112227496	112227496	+1	no_errors	ENST00000391338	ensembl	human	known	69_37n	missense	232	19.93	58	SNP	0.011	C
