#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
APLP2	334	genome.wustl.edu	37	11	130007179	130007180	+	Frame_Shift_Ins	INS	-	-	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr11:130007179_130007180insA	ENST00000263574.5	+	14	1938_1939	c.1866_1867insA	c.(1867-1869)aaafs	p.K623fs	APLP2_ENST00000338167.5_Intron|APLP2_ENST00000528499.1_Intron|APLP2_ENST00000539648.1_Frame_Shift_Ins_p.K411fs|APLP2_ENST00000278756.7_Intron|APLP2_ENST00000345598.5_Intron|APLP2_ENST00000543137.1_Intron	NM_001642.2	NP_001633.1	Q06481	APLP2_HUMAN	amyloid beta (A4) precursor-like protein 2	623					cellular copper ion homeostasis (GO:0006878)|cholesterol metabolic process (GO:0008203)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotory behavior (GO:0007626)|mating behavior (GO:0007617)|midbrain development (GO:0030901)|neuromuscular process controlling balance (GO:0050885)|regulation of epidermal growth factor-activated receptor activity (GO:0007176)|regulation of protein binding (GO:0043393)|suckling behavior (GO:0001967)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|serine-type endopeptidase inhibitor activity (GO:0004867)|transition metal ion binding (GO:0046914)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(6)|ovary(4)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_hematologic(175;0.0429)	Breast(109;0.00586)|Lung NSC(97;0.00785)|all_lung(97;0.0154)|Medulloblastoma(222;0.0523)|all_neural(223;0.186)		OV - Ovarian serous cystadenocarcinoma(99;0.0197)|Lung(977;0.24)		ACCACCCAATGAAAAAAGGTTG	0.396																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			L19597	CCDS8486.1, CCDS44773.1, CCDS44774.1, CCDS44775.1, CCDS58196.1	11q24	2008-02-05			ENSG00000084234	ENSG00000084234			598	protein-coding gene	gene with protein product		104776		APPL2		10702673	Standard	NM_001642		Approved	APPH	uc021qsg.1	Q06481	OTTHUMG00000165767	ENST00000263574.5:c.1872dupA	11.37:g.130007185_130007185dupA	ENSP00000263574:p.Lys623fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXX9|H7BXI4|Q13861|Q14594|Q14662|Q71U10|Q7M4L3|Q9BT36	Frame_Shift_Ins	INS	pfam_Amyloid_glyco_heparin-bd,pfam_APP_amyloid_C,pfam_Prot_inh_Kunz-m,superfamily_Amyloid_glyco_E2_domain,superfamily_Amyloid_glyco_heparin-bd,superfamily_Amyloid_glyco_Cu-bd,superfamily_Prot_inh_Kunz-m,smart_Amyloid_glyco_extra,smart_Prot_inh_Kunz-m,prints_Amyloid_glyco,prints_Prot_inh_Kunz-m,pfscan_Prot_inh_Kunz-m	p.G624fs	ENST00000263574.5	37	c.1866_1867	CCDS8486.1	11																																																																																			APLP2	-	NULL	ENSG00000084234		0.396	APLP2-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APLP2	HGNC	protein_coding	OTTHUMT00000386109.1	227	0.00	0	-	NM_001642		130007179	130007180	+1	no_errors	ENST00000263574	ensembl	human	known	69_37n	frame_shift_ins	264	35.92	148	INS	1.000:1.000	A
ATP10B	23120	genome.wustl.edu	37	5	160059168	160059168	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr5:160059168A>G	ENST00000327245.5	-	13	2434	c.1588T>C	c.(1588-1590)Tca>Cca	p.S530P	CTC-348L5.1_ENST00000523598.1_RNA	NM_025153.2	NP_079429.2	O94823	AT10B_HUMAN	ATPase, class V, type 10B	530					phospholipid translocation (GO:0045332)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(2)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(37)|ovary(4)|pancreas(1)|prostate(5)|skin(3)|stomach(1)	75	Renal(175;0.00196)	Medulloblastoma(196;0.0377)|all_neural(177;0.121)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			GGAGGCTGTGAGCTTTCACGG	0.567																																						dbGAP											0													58.0	61.0	60.0					5																	160059168		1916	4132	6048	-	-	-	SO:0001583	missense	0			AB018258	CCDS43394.1	5q34	2010-04-20	2007-09-19		ENSG00000118322	ENSG00000118322		"""ATPases / P-type"""	13543	protein-coding gene	gene with protein product			"""ATPase, Class V, type 10B"""			9872452, 11015572	Standard	NM_025153		Approved	ATPVB, KIAA0715, FLJ21477	uc003lym.1	O94823	OTTHUMG00000163551	ENST00000327245.5:c.1588T>C	5.37:g.160059168A>G	ENSP00000313600:p.Ser530Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H725	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.S530P	ENST00000327245.5	37	c.1588	CCDS43394.1	5	.	.	.	.	.	.	.	.	.	.	A	5.743	0.321541	0.10845	.	.	ENSG00000118322	ENST00000327245;ENST00000520108	D;D	0.85088	-1.94;-1.94	5.45	-1.91	0.07641	HAD-like domain (1);	0.322570	0.27912	N	0.017359	T	0.71676	0.3368	L	0.28115	0.83	0.09310	N	1	B;P	0.47484	0.004;0.896	B;P	0.46629	0.007;0.522	T	0.64236	-0.6455	9	.	.	.	.	1.5369	0.02547	0.3947:0.202:0.0777:0.3256	.	138;530	Q2YDW8;O94823	.;AT10B_HUMAN	P	530;138	ENSP00000313600:S530P;ENSP00000431081:S138P	.	S	-	1	0	ATP10B	159991746	0.000000	0.05858	0.007000	0.13788	0.163000	0.22366	-0.958000	0.03857	0.061000	0.16311	0.533000	0.62120	TCA	ATP10B	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000118322		0.567	ATP10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10B	HGNC	protein_coding	OTTHUMT00000374127.1	24	0.00	0	A	NM_025153		160059168	160059168	-1	no_errors	ENST00000327245	ensembl	human	known	69_37n	missense	33	44.07	26	SNP	0.000	G
SIMC1	375484	genome.wustl.edu	37	5	175717093	175717093	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr5:175717093G>A	ENST00000443967.1	+	4	916	c.509G>A	c.(508-510)aGc>aAc	p.S170N	SIMC1_ENST00000429602.2_Missense_Mutation_p.S189N|SIMC1_ENST00000430704.2_Intron|SIMC1_ENST00000341199.6_Intron|SIMC1_ENST00000503595.1_3'UTR			Q8NDZ2	SIMC1_HUMAN	SUMO-interacting motifs containing 1	170	Ser-rich.						SUMO polymer binding (GO:0032184)										TCCCCAACAagcaataatagt	0.527																																						dbGAP											0													30.0	27.0	28.0					5																	175717093		2202	4298	6500	-	-	-	SO:0001583	missense	0			BC037298	CCDS4398.2	5q35.2	2013-08-14	2012-11-14	2012-11-14	ENSG00000170085	ENSG00000170085			24779	protein-coding gene	gene with protein product	"""oocyte maturation associated 1"", ""platform element for inhibition of autolytic degradation"""		"""chromosome 5 open reading frame 25"""	C5orf25		23086935, 23707407	Standard	NM_198567		Approved	FLJ44216, OOMA1, PLEIAD	uc003mds.4	Q8NDZ2	OTTHUMG00000130663	ENST00000443967.1:c.509G>A	5.37:g.175717093G>A	ENSP00000406571:p.Ser170Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQQ8|Q6NXN8|Q6ZTU4|Q8IZ15	Missense_Mutation	SNP	NULL	p.S170N	ENST00000443967.1	37	c.509		5	.	.	.	.	.	.	.	.	.	.	G	10.75	1.438313	0.25900	.	.	ENSG00000170085	ENST00000443967;ENST00000429602;ENST00000377277	T;T	0.50001	1.48;0.76	4.23	3.36	0.38483	.	0.241914	0.29806	N	0.011153	T	0.35278	0.0926	.	.	.	0.22866	N	0.998636	B;B	0.19331	0.035;0.004	B;B	0.18263	0.021;0.008	T	0.32052	-0.9921	9	0.66056	D	0.02	-4.7684	7.8119	0.29237	0.1146:0.0:0.8854:0.0	.	189;170	B4DRM7;Q8NDZ2	.;CE025_HUMAN	N	170;189;81	ENSP00000406571:S170N;ENSP00000410552:S189N	ENSP00000366489:S81N	S	+	2	0	C5orf25	175649699	1.000000	0.71417	0.884000	0.34674	0.634000	0.38068	4.799000	0.62517	0.990000	0.38787	-0.199000	0.12753	AGC	C5orf25	-	NULL	ENSG00000170085		0.527	SIMC1-001	KNOWN	basic	protein_coding	C5orf25	HGNC	protein_coding	OTTHUMT00000253155.2	58	0.00	0	G	NM_198567		175717093	175717093	+1	no_errors	ENST00000443967	ensembl	human	known	69_37n	missense	113	22.60	33	SNP	0.986	A
CACHD1	57685	genome.wustl.edu	37	1	65124496	65124496	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:65124496C>T	ENST00000371073.2	+	13	1891	c.1891C>T	c.(1891-1893)Cgg>Tgg	p.R631W	CACHD1_ENST00000290039.5_Missense_Mutation_p.R580W|CACHD1_ENST00000495994.1_3'UTR			Q5VU97	CAHD1_HUMAN	cache domain containing 1	631					calcium ion transport (GO:0006816)	integral component of membrane (GO:0016021)				breast(4)|endometrium(3)|kidney(3)|large_intestine(20)|lung(14)|ovary(2)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						GCTGTACCACCGGCTGGATCT	0.483																																						dbGAP											0													51.0	48.0	49.0					1																	65124496		2203	4299	6502	-	-	-	SO:0001583	missense	0			AB046793	CCDS628.2	1p31.3	2008-02-05	2005-10-11	2005-10-11	ENSG00000158966	ENSG00000158966			29314	protein-coding gene	gene with protein product			"""von Willebrand factor type A and cache domain containing 1"""	VWCD1		10997877	Standard	NM_020925		Approved	KIAA1573	uc001dbo.1	Q5VU97	OTTHUMG00000009030	ENST00000371073.2:c.1891C>T	1.37:g.65124496C>T	ENSP00000360113:p.Arg631Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AE9|Q658T4|Q7Z3P2|Q9H7W4|Q9H9W3|Q9HCJ9	Missense_Mutation	SNP	pfam_VWA_N,pfam_Cache_domain,pfscan_VWF_A	p.R631W	ENST00000371073.2	37	c.1891		1	.	.	.	.	.	.	.	.	.	.	C	23.5	4.429110	0.83667	.	.	ENSG00000158966	ENST00000371073;ENST00000290039	T;T	0.33216	1.42;1.43	5.61	4.69	0.59074	.	0.000000	0.85682	D	0.000000	T	0.41858	0.1177	L	0.58510	1.815	0.80722	D	1	D	0.89917	1.0	D	0.74023	0.982	T	0.46484	-0.9188	10	0.87932	D	0	-20.3043	15.0624	0.71964	0.2568:0.7432:0.0:0.0	.	631	Q5VU97	CAHD1_HUMAN	W	631;580	ENSP00000360113:R631W;ENSP00000290039:R580W	ENSP00000290039:R580W	R	+	1	2	CACHD1	64897084	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.878000	0.48515	1.342000	0.45619	0.655000	0.94253	CGG	CACHD1	-	NULL	ENSG00000158966		0.483	CACHD1-201	KNOWN	basic	protein_coding	CACHD1	HGNC	protein_coding		94	0.00	0	C	NM_020925		65124496	65124496	+1	no_errors	ENST00000371073	ensembl	human	known	69_37n	missense	60	35.48	33	SNP	1.000	T
CAP2	10486	genome.wustl.edu	37	6	17421790	17421790	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr6:17421790G>T	ENST00000229922.2	+	2	536	c.4G>T	c.(4-6)Gcc>Tcc	p.A2S	CAP2_ENST00000493172.1_Missense_Mutation_p.A2S|CAP2_ENST00000489374.1_Missense_Mutation_p.A2S|CAP2_ENST00000378990.2_Missense_Mutation_p.A2S|CAP2_ENST00000465994.1_Missense_Mutation_p.A2S	NM_006366.2	NP_006357.1	P40123	CAP2_HUMAN	CAP, adenylate cyclase-associated protein, 2 (yeast)	2					activation of adenylate cyclase activity (GO:0007190)|axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|establishment or maintenance of cell polarity (GO:0007163)|signal transduction (GO:0007165)	plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|skin(4)|urinary_tract(1)	27	Breast(50;0.0333)|Ovarian(93;0.0386)	all_hematologic(90;0.0466)	all cancers(50;0.194)|Epithelial(50;0.227)			TTCTAGAATGGCCAACATGCA	0.567																																						dbGAP											0													82.0	81.0	81.0					6																	17421790		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008481	CCDS4539.1	6p22.3	2008-02-05			ENSG00000112186	ENSG00000112186			20039	protein-coding gene	gene with protein product						7962207, 8761950	Standard	NM_006366		Approved		uc003ncb.3	P40123	OTTHUMG00000014311	ENST00000229922.2:c.4G>T	6.37:g.17421790G>T	ENSP00000229922:p.Ala2Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y3|B7Z1C4|B7Z214|Q6IAY2	Missense_Mutation	SNP	pfam_Adenylate_cyclase-assoc_CAP_N,pfam_Adenylate_cyclase-assoc_CAP_C,superfamily_Adenylate_cyclase-assoc_CAP_N,superfamily_Adenylate_cyclase-assoc_CAP_C,smart_CARP_motif	p.A2S	ENST00000229922.2	37	c.4	CCDS4539.1	6	.	.	.	.	.	.	.	.	.	.	G	10.39	1.335793	0.24253	.	.	ENSG00000112186	ENST00000229922;ENST00000378994;ENST00000489374;ENST00000378990;ENST00000493172;ENST00000465994	T;T;T;T	0.09723	3.07;2.99;2.95;3.07	5.42	3.64	0.41730	.	0.750946	0.12899	N	0.429911	T	0.03263	0.0095	L	0.29908	0.895	0.19945	N	0.999948	B;P;B;B;B	0.47762	0.037;0.9;0.037;0.403;0.191	B;B;B;B;B	0.43990	0.034;0.438;0.034;0.297;0.061	T	0.40175	-0.9577	10	0.28530	T	0.3	-3.5146	8.3065	0.32045	0.182:0.0:0.818:0.0	.	2;2;2;2;2	B7Z214;B7Z385;B7Z1C4;E9PDI2;P40123	.;.;.;.;CAP2_HUMAN	S	2	ENSP00000229922:A2S;ENSP00000417705:A2S;ENSP00000368275:A2S;ENSP00000418604:A2S	ENSP00000229922:A2S	A	+	1	0	CAP2	17529769	1.000000	0.71417	0.965000	0.40720	0.404000	0.30871	1.838000	0.39211	0.779000	0.33543	-0.140000	0.14226	GCC	CAP2	-	NULL	ENSG00000112186		0.567	CAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAP2	HGNC	protein_coding	OTTHUMT00000039952.2	64	0.00	0	G			17421790	17421790	+1	no_errors	ENST00000229922	ensembl	human	known	69_37n	missense	125	12.59	18	SNP	0.999	T
CCNB3	85417	genome.wustl.edu	37	X	50090648	50090648	+	Silent	SNP	A	A	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chrX:50090648A>G	ENST00000376042.1	+	11	4132	c.3834A>G	c.(3832-3834)acA>acG	p.T1278T	CCNB3_ENST00000276014.7_Silent_p.T1278T|CCNB3_ENST00000376038.1_Silent_p.T174T|CCNB3_ENST00000348603.2_Silent_p.T174T			Q8WWL7	CCNB3_HUMAN	cyclin B3	1278					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					ACATGAAGACACTGACCTTGT	0.507																																						dbGAP											0													123.0	92.0	103.0					X																	50090648		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.3834A>G	X.37:g.50090648A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Silent	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.T1278	ENST00000376042.1	37	c.3834	CCDS14331.1	X																																																																																			CCNB3	-	pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	ENSG00000147082		0.507	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	87	0.00	0	A			50090648	50090648	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	silent	47	34.72	25	SNP	0.815	G
CLIP4	79745	genome.wustl.edu	37	2	29386783	29386783	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr2:29386783A>T	ENST00000320081.5	+	13	1876	c.1621A>T	c.(1621-1623)Aga>Tga	p.R541*	CLIP4_ENST00000401617.2_Nonsense_Mutation_p.R434*|CLIP4_ENST00000401605.1_Nonsense_Mutation_p.R541*|CLIP4_ENST00000404424.1_Nonsense_Mutation_p.R541*	NM_024692.4	NP_078968.3	Q8N3C7	CLIP4_HUMAN	CAP-GLY domain containing linker protein family, member 4	541	CAP-Gly 2. {ECO:0000255|PROSITE- ProRule:PRU00045}.									endometrium(4)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|prostate(1)|skin(1)	26	Acute lymphoblastic leukemia(172;0.155)					CTGTTCTCCAAGATATGGAAT	0.378																																						dbGAP											0													125.0	114.0	118.0					2																	29386783		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK024722	CCDS1770.1, CCDS74502.1	2p23	2013-01-10	2007-01-04	2007-01-04	ENSG00000115295	ENSG00000115295		"""Ankyrin repeat domain containing"""	26108	protein-coding gene	gene with protein product			"""restin-like 2"""	RSNL2			Standard	XM_005264562		Approved	FLJ21069	uc002rmv.3	Q8N3C7	OTTHUMG00000097837	ENST00000320081.5:c.1621A>T	2.37:g.29386783A>T	ENSP00000327009:p.Arg541*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AV10|B2RMQ3|B7Z7N8|Q7Z4U3|Q96BR7|Q96MA5|Q9H7C0	Nonsense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.R543*	ENST00000320081.5	37	c.1627	CCDS1770.1	2	.	.	.	.	.	.	.	.	.	.	A	42	9.574673	0.99208	.	.	ENSG00000115295	ENST00000401605;ENST00000401617;ENST00000404424;ENST00000402240;ENST00000320081;ENST00000379543;ENST00000530644	.	.	.	6.06	6.06	0.98353	.	0.048668	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.16420	T	0.52	.	15.6071	0.76682	1.0:0.0:0.0:0.0	.	.	.	.	X	541;434;541;543;541;559;501	.	ENSP00000327009:R541X	R	+	1	2	CLIP4	29240287	0.999000	0.42202	1.000000	0.80357	0.984000	0.73092	3.981000	0.56902	2.323000	0.78572	0.528000	0.53228	AGA	CLIP4	-	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	ENSG00000115295		0.378	CLIP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP4	HGNC	protein_coding	OTTHUMT00000215123.2	225	0.00	0	A	NM_024692		29386783	29386783	+1	no_errors	ENST00000402240	ensembl	human	known	69_37n	nonsense	133	18.40	30	SNP	1.000	T
CROCCP2	84809	genome.wustl.edu	37	1	16946407	16946407	+	lincRNA	SNP	T	T	G	rs10796418		TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:16946407T>G	ENST00000412962.1	-	0	1112				RP5-1182A14.5_ENST00000607700.1_lincRNA			Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGCAATCTCCTCACTCAGCTG	0.672																																						dbGAP											0																																										-	-	-			0			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16946407T>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-	ENSG00000215908		0.672	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	15	0.00	0	T	NR_026752.1		16946407	16946407	-1	no_errors	ENST00000412962	ensembl	human	known	69_37n	rna	53	19.70	13	SNP	1.000	G
CSMD2	114784	genome.wustl.edu	37	1	34254255	34254255	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:34254255G>A	ENST00000338325.1	-	6	845	c.433C>T	c.(433-435)Ctc>Ttc	p.L145F	CSMD2_ENST00000373381.4_Missense_Mutation_p.L537F			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	497	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GTCTGGAAGAGGAGCCACATT	0.507																																						dbGAP											0													123.0	109.0	114.0					1																	34254255		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000338325.1:c.433C>T	1.37:g.34254255G>A	ENSP00000340311:p.Leu145Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.L537F	ENST00000338325.1	37	c.1609		1	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363601	0.41902	.	.	ENSG00000121904	ENST00000373381;ENST00000338325	T;T	0.29917	1.55;1.55	5.57	5.57	0.84162	CUB (5);	0.139842	0.48286	D	0.000197	T	0.46580	0.1400	L	0.43757	1.38	0.80722	D	1	P;P	0.52842	0.736;0.956	P;D	0.65573	0.718;0.936	T	0.11084	-1.0602	10	0.28530	T	0.3	.	17.0563	0.86534	0.0:0.0:1.0:0.0	.	497;537	Q7Z408;E7EUA6	CSMD2_HUMAN;.	F	537;145	ENSP00000362479:L537F;ENSP00000340311:L145F	ENSP00000241312:L497F	L	-	1	0	CSMD2	34026842	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.374000	0.66167	2.620000	0.88729	0.563000	0.77884	CTC	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.507	CSMD2-004	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000036404.2	69	0.00	0	G	NM_052896		34254255	34254255	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	69	20.69	18	SNP	1.000	A
CSTF2	1478	genome.wustl.edu	37	X	100078982	100078982	+	Silent	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chrX:100078982G>A	ENST00000372972.2	+	5	568	c.552G>A	c.(550-552)ccG>ccA	p.P184P	CSTF2_ENST00000415585.2_Silent_p.P184P|SNORA9_ENST00000365361.1_RNA	NM_001325.2	NP_001316.1	P33240	CSTF2_HUMAN	cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kDa	184	Interactions with CSTF3 and SYMPK.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	cleavage body (GO:0071920)|mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|skin(2)|stomach(1)	13						TTGTGGATCCGGAAATTGCCC	0.463																																						dbGAP											0													177.0	153.0	161.0					X																	100078982		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017712	CCDS14473.1	Xq22.1	2013-02-12	2002-08-29		ENSG00000101811	ENSG00000101811		"""RNA binding motif (RRM) containing"""	2484	protein-coding gene	gene with protein product		300907	"""cleavage stimulation factor, 3' pre-RNA, subunit 2, 64kD"""			1741396	Standard	XM_006724622		Approved		uc004egh.3	P33240	OTTHUMG00000022709	ENST00000372972.2:c.552G>A	X.37:g.100078982G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5H951|Q6LA74|Q8N502	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.P184	ENST00000372972.2	37	c.552	CCDS14473.1	X																																																																																			CSTF2	-	NULL	ENSG00000101811		0.463	CSTF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSTF2	HGNC	protein_coding	OTTHUMT00000058926.1	260	0.00	0	G	NM_001325		100078982	100078982	+1	no_errors	ENST00000415585	ensembl	human	known	69_37n	silent	259	19.57	63	SNP	0.951	A
CYP1B1-AS1	285154	genome.wustl.edu	37	2	38408256	38408256	+	RNA	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr2:38408256G>A	ENST00000413828.2	+	0	1016					NR_027252.1				CYP1B1 antisense RNA 1																		TTACACTGACGCCAAGAATTC	0.428																																						dbGAP											0																																										-	-	-			0			BC031410		2p22.2	2012-10-12	2012-08-15	2011-04-28	ENSG00000232973	ENSG00000232973		"""Long non-coding RNAs"""	28543	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 58"", ""CYP1B1 antisense RNA 1 (non-protein coding)"""	C2orf58		12477932	Standard	NR_027252		Approved	MGC34824	uc010faj.2		OTTHUMG00000128569		2.37:g.38408256G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000413828.2	37	NULL		2																																																																																			CYP1B1-AS1	-	-	ENSG00000232973		0.428	CYP1B1-AS1-001	KNOWN	basic	antisense	CYP1B1-AS1	HGNC	antisense	OTTHUMT00000250420.2	44	0.00	0	G			38408256	38408256	+1	no_errors	ENST00000413828	ensembl	human	known	69_37n	rna	45	29.69	19	SNP	0.000	A
DNAH10	196385	genome.wustl.edu	37	12	124349182	124349182	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr12:124349182G>A	ENST00000409039.3	+	39	6620	c.6595G>A	c.(6595-6597)Gaa>Aaa	p.E2199K		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	2199	AAA 2. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		TCTATGGGTGGAAAACATGAA	0.478																																						dbGAP											0													153.0	150.0	151.0					12																	124349182		2002	4185	6187	-	-	-	SO:0001583	missense	0			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.6595G>A	12.37:g.124349182G>A	ENSP00000386770:p.Glu2199Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Missense_Mutation	SNP	pfam_Dynein_heavy,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.E2199K	ENST00000409039.3	37	c.6595	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	G	36	5.774128	0.96922	.	.	ENSG00000197653	ENST00000409039	D	0.97089	-4.24	5.46	5.46	0.80206	ATPase, AAA+ type, core (1);ATPase, dynein-related, AAA domain (1);	0.000000	0.64402	U	0.000001	D	0.99336	0.9767	H	0.99675	4.695	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.98249	1.0492	10	0.87932	D	0	.	19.3147	0.94207	0.0:0.0:1.0:0.0	.	2199	Q8IVF4	DYH10_HUMAN	K	2199	ENSP00000386770:E2199K	ENSP00000386770:E2199K	E	+	1	0	DNAH10	122915135	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	9.869000	0.99810	2.559000	0.86315	0.563000	0.77884	GAA	DNAH10	-	pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	ENSG00000197653		0.478	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	274	0.00	0	G			124349182	124349182	+1	no_errors	ENST00000409039	ensembl	human	known	69_37n	missense	154	42.11	112	SNP	1.000	A
DPYSL5	56896	genome.wustl.edu	37	2	27154529	27154529	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr2:27154529C>T	ENST00000288699.6	+	6	849	c.691C>T	c.(691-693)Cgt>Tgt	p.R231C	DPYSL5_ENST00000401478.1_Missense_Mutation_p.R231C	NM_001253724.1|NM_020134.3	NP_001240653.1|NP_064519.2	Q9BPU6	DPYL5_HUMAN	dihydropyrimidinase-like 5	231					axon guidance (GO:0007411)|nervous system development (GO:0007399)|pyrimidine nucleobase catabolic process (GO:0006208)|signal transduction (GO:0007165)	cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			breast(1)|endometrium(5)|large_intestine(2)|lung(13)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	27	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGCCACTCATCGTGTTATCAC	0.502																																						dbGAP											0													219.0	188.0	198.0					2																	27154529		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF264015	CCDS1730.1	2p23.3	2008-02-05			ENSG00000157851	ENSG00000157851			20637	protein-coding gene	gene with protein product		608383				10851247, 11034345	Standard	NM_020134		Approved	CRMP5, Ulip6, CRMP-5, CRAM	uc002rhu.4	Q9BPU6	OTTHUMG00000097071	ENST00000288699.6:c.691C>T	2.37:g.27154529C>T	ENSP00000288699:p.Arg231Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TCL6|Q9NQC4|Q9NRY9	Missense_Mutation	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.R231C	ENST00000288699.6	37	c.691	CCDS1730.1	2	.	.	.	.	.	.	.	.	.	.	C	21.7	4.192943	0.78902	.	.	ENSG00000157851	ENST00000288699;ENST00000401478	D;D	0.90444	-2.67;-2.67	6.08	5.21	0.72293	Amidohydrolase 1 (1);	0.051474	0.85682	D	0.000000	D	0.96639	0.8903	H	0.97365	3.99	0.58432	D	0.999992	D	0.89917	1.0	D	0.97110	1.0	D	0.96668	0.9494	10	0.87932	D	0	-9.7859	9.0728	0.36502	0.1467:0.779:0.0:0.0743	.	231	Q9BPU6	DPYL5_HUMAN	C	231	ENSP00000288699:R231C;ENSP00000385549:R231C	ENSP00000288699:R231C	R	+	1	0	DPYSL5	27008033	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	3.570000	0.53834	1.589000	0.49982	0.591000	0.81541	CGT	DPYSL5	-	pfam_Amidohydro_1,tigrfam_Hydantoinase/dihydroPyrase	ENSG00000157851		0.502	DPYSL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPYSL5	HGNC	protein_coding	OTTHUMT00000214187.2	131	0.00	0	C	NM_020134		27154529	27154529	+1	no_errors	ENST00000288699	ensembl	human	known	69_37n	missense	236	27.16	88	SNP	1.000	T
FBXO6	26270	genome.wustl.edu	37	1	11732060	11732060	+	Silent	SNP	G	G	A	rs144511138	byFrequency	TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:11732060G>A	ENST00000376753.4	+	4	624	c.489G>A	c.(487-489)ccG>ccA	p.P163P		NM_018438.5	NP_060908.1	Q9NRD1	FBX6_HUMAN	F-box protein 6	163	FBA. {ECO:0000255|PROSITE- ProRule:PRU00482}.				DNA damage checkpoint (GO:0000077)|DNA repair (GO:0006281)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|glycoprotein catabolic process (GO:0006516)|proteolysis (GO:0006508)|response to unfolded protein (GO:0006986)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	cytoplasm (GO:0005737)|SCF ubiquitin ligase complex (GO:0019005)	carbohydrate binding (GO:0030246)|glycoprotein binding (GO:0001948)|ubiquitin-protein transferase activity (GO:0004842)			breast(1)|large_intestine(1)|lung(1)|ovary(1)|upper_aerodigestive_tract(2)	6	Ovarian(185;0.249)	Lung NSC(185;4.15e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;5.25e-06)|COAD - Colon adenocarcinoma(227;0.000251)|BRCA - Breast invasive adenocarcinoma(304;0.000297)|Kidney(185;0.000747)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00727)|READ - Rectum adenocarcinoma(331;0.0649)		CATTCCGGCCGGACATCGTGG	0.577													G|||	8	0.00159744	0.0	0.0	5008	,	,		20484	0.0079		0.0	False		,,,				2504	0.0				NSCLC(54;506 1562 46490 51389)	dbGAP											0													212.0	142.0	166.0					1																	11732060		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF129536	CCDS133.1	1p36.22	2008-05-14	2004-06-15		ENSG00000116663	ENSG00000116663		"""F-boxes /  ""other"""""	13585	protein-coding gene	gene with protein product		605647	"""F-box only protein 6"""			10531035, 10945468	Standard	NM_018438		Approved	FBX6, FBG2, FBS2, Fbx6b	uc001aso.3	Q9NRD1	OTTHUMG00000002229	ENST00000376753.4:c.489G>A	1.37:g.11732060G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AK42|B2RC88|Q9UKT3	Silent	SNP	pfam_F-box-assoc_dom,pfam_F-box_dom_cyclin-like,superfamily_Galactose-bd-like,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,pfscan_F-box_dom_cyclin-like,pfscan_F-box-assoc_dom	p.P163	ENST00000376753.4	37	c.489	CCDS133.1	1																																																																																			FBXO6	-	pfam_F-box-assoc_dom,superfamily_Galactose-bd-like,pfscan_F-box-assoc_dom	ENSG00000116663		0.577	FBXO6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO6	HGNC	protein_coding	OTTHUMT00000006332.1	94	0.00	0	G	NM_018438		11732060	11732060	+1	no_errors	ENST00000376753	ensembl	human	known	69_37n	silent	98	16.10	19	SNP	0.001	A
ESRRG	2104	genome.wustl.edu	37	1	216850754	216850754	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:216850754G>T	ENST00000408911.3	-	2	289	c.136C>A	c.(136-138)Cca>Aca	p.P46T	ESRRG_ENST00000493603.1_Missense_Mutation_p.P23T|ESRRG_ENST00000463665.1_Missense_Mutation_p.P23T|ESRRG_ENST00000359162.2_Missense_Mutation_p.P23T|ESRRG_ENST00000366938.2_Missense_Mutation_p.P23T|ESRRG_ENST00000487276.1_Missense_Mutation_p.P23T|ESRRG_ENST00000361395.2_Missense_Mutation_p.P23T|ESRRG_ENST00000493748.1_Missense_Mutation_p.P23T|ESRRG_ENST00000361525.3_Missense_Mutation_p.P23T|ESRRG_ENST00000391890.3_Missense_Mutation_p.P23T|ESRRG_ENST00000360012.3_Missense_Mutation_p.P23T|ESRRG_ENST00000366937.1_Missense_Mutation_p.P51T|ESRRG_ENST00000366940.2_Missense_Mutation_p.P23T	NM_001438.3	NP_001429.2	P62508	ERR3_HUMAN	estrogen-related receptor gamma	46					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	AF-2 domain binding (GO:0050682)|retinoic acid receptor activity (GO:0003708)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|steroid binding (GO:0005496)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(1)|large_intestine(8)|liver(1)|lung(29)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	49				OV - Ovarian serous cystadenocarcinoma(81;0.0358)|all cancers(67;0.0693)|GBM - Glioblastoma multiforme(131;0.0713)	Diethylstilbestrol(DB00255)	AGGGAGGCTGGGCTGGAAGGT	0.522																																						dbGAP											0													98.0	88.0	91.0					1																	216850754		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF058291	CCDS1517.1, CCDS41468.1, CCDS58060.1, CCDS58061.1	1q41	2014-02-18			ENSG00000196482	ENSG00000196482		"""Nuclear hormone receptors"""	3474	protein-coding gene	gene with protein product		602969				9676434, 10072763	Standard	NM_001243505		Approved	NR3B3	uc001hkw.2	P62508	OTTHUMG00000037025	ENST00000408911.3:c.136C>A	1.37:g.216850754G>T	ENSP00000386171:p.Pro46Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4I0|A8K6I2|B3KY84|E9PGB7|F8W8J3|O75454|O96021|Q68DA0|Q6P274|Q6PK28|Q6TS38|Q9R1F3|Q9UNJ4	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Retinoic_acid_rcpt	p.P46T	ENST00000408911.3	37	c.136	CCDS41468.1	1	.	.	.	.	.	.	.	.	.	.	G	19.80	3.894691	0.72639	.	.	ENSG00000196482	ENST00000361525;ENST00000366940;ENST00000366937;ENST00000408911;ENST00000359162;ENST00000361395;ENST00000366938;ENST00000360012;ENST00000493603;ENST00000391890;ENST00000463665;ENST00000487276;ENST00000354407;ENST00000493748;ENST00000475275;ENST00000469486;ENST00000459955;ENST00000481543	D;D;D;D;D;D;D;D;D;D;D;D;D;D;T;T;T	0.95821	-3.24;-3.24;-3.28;-3.25;-3.24;-3.24;-3.24;-3.24;-3.24;-3.26;-3.82;-3.24;-3.24;-3.07;0.23;0.11;0.07	6.16	6.16	0.99307	.	0.000000	0.85682	D	0.000000	D	0.97473	0.9173	M	0.61703	1.905	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.998	D;D;D	0.91635	0.999;0.994;0.981	D	0.97379	0.9981	10	0.87932	D	0	.	20.8598	0.99761	0.0:0.0:1.0:0.0	.	23;51;46	E9PGB7;F8W8J3;P62508	.;.;ERR3_HUMAN	T	23;23;51;46;23;23;23;23;23;23;23;23;23;23;23;23;23;23	ENSP00000355225:P23T;ENSP00000355907:P23T;ENSP00000355904:P51T;ENSP00000386171:P46T;ENSP00000352077:P23T;ENSP00000354584:P23T;ENSP00000355905:P23T;ENSP00000353108:P23T;ENSP00000419594:P23T;ENSP00000375761:P23T;ENSP00000418629:P23T;ENSP00000419155:P23T;ENSP00000417374:P23T;ENSP00000419514:P23T;ENSP00000417900:P23T;ENSP00000420370:P23T;ENSP00000418895:P23T	ENSP00000346386:P23T	P	-	1	0	ESRRG	214917377	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.869000	0.99810	2.937000	0.99478	0.650000	0.86243	CCA	ESRRG	-	NULL	ENSG00000196482		0.522	ESRRG-001	KNOWN	basic|CCDS	protein_coding	ESRRG	HGNC	protein_coding	OTTHUMT00000089882.2	76	0.00	0	G	NM_206595		216850754	216850754	-1	no_errors	ENST00000408911	ensembl	human	known	69_37n	missense	129	16.23	25	SNP	1.000	T
GSPT1	2935	genome.wustl.edu	37	16	11976892	11976892	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr16:11976892G>A	ENST00000563468.1	-	9	1020	c.994C>T	c.(994-996)Ctt>Ttt	p.L332F	GSPT1_ENST00000434724.2_Missense_Mutation_p.L470F|GSPT1_ENST00000420576.2_Missense_Mutation_p.L332F|GSPT1_ENST00000439887.2_Missense_Mutation_p.L469F|GSPT1_ENST00000564790.1_5'UTR|RP11-166B2.3_ENST00000568144.1_RNA|RP11-166B2.8_ENST00000574364.1_RNA			P15170	ERF3A_HUMAN	G1 to S phase transition 1	332					G1/S transition of mitotic cell cycle (GO:0000082)|GTP catabolic process (GO:0006184)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|protein methylation (GO:0006479)|translational termination (GO:0006415)	intracellular (GO:0005622)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|translation release factor activity (GO:0003747)			breast(1)|central_nervous_system(1)|kidney(4)|lung(4)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	14						ATCATCACAAGCTGCTGGCCT	0.373																																						dbGAP											0													90.0	92.0	91.0					16																	11976892		2105	4254	6359	-	-	-	SO:0001583	missense	0			BC008391	CCDS45412.1, CCDS45413.1, CCDS45414.1	16p13.1	2008-08-01							4621	protein-coding gene	gene with protein product		139259				2511002, 17700517	Standard	NM_002094		Approved	GST1, ETF3A, eRF3a	uc002dbt.3	P15170		ENST00000563468.1:c.994C>T	16.37:g.11976892G>A	ENSP00000454351:p.Leu332Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KQG6|Q96GF2	Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Ataxin-2_C,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_ProtSyn_GTP-bd	p.L470F	ENST00000563468.1	37	c.1408	CCDS45414.1	16	.	.	.	.	.	.	.	.	.	.	G	18.92	3.726439	0.69074	.	.	ENSG00000103342	ENST00000434724;ENST00000439887;ENST00000420576	T;T;T	0.66815	-0.23;-0.23;-0.23	4.97	4.97	0.65823	Translation elongation factor EFTu/EF1A, domain 2 (1);Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.64402	U	0.000001	T	0.79082	0.4386	M	0.92317	3.295	0.80722	D	1	B;B;B	0.33964	0.3;0.434;0.022	B;B;B	0.40444	0.246;0.329;0.062	D	0.83635	0.0147	10	0.87932	D	0	-2.2458	16.8885	0.86081	0.0:0.0:1.0:0.0	.	469;466;332	E7EQZ3;Q96GF2;P15170	.;.;ERF3A_HUMAN	F	470;469;332	ENSP00000398131:L470F;ENSP00000408399:L469F;ENSP00000399539:L332F	ENSP00000399539:L332F	L	-	1	0	GSPT1	11884393	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	7.658000	0.83755	2.318000	0.78349	0.456000	0.33151	CTT	GSPT1	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel	ENSG00000103342		0.373	GSPT1-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	GSPT1	HGNC	protein_coding	OTTHUMT00000421513.1	217	0.00	0	G	NM_002094		11976892	11976892	-1	no_errors	ENST00000434724	ensembl	human	known	69_37n	missense	204	17.41	43	SNP	1.000	A
HDAC1	3065	genome.wustl.edu	37	1	32798618	32798618	+	Splice_Site	SNP	G	G	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:32798618G>A	ENST00000373548.3	+	14	1506	c.1422G>A	c.(1420-1422)ggG>ggA	p.G474G	HDAC1_ENST00000373541.2_Splice_Site_p.G281G	NM_004964.2	NP_004955.2	Q13547	HDAC1_HUMAN	histone deacetylase 1	474					ATP-dependent chromatin remodeling (GO:0043044)|blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|chromatin remodeling (GO:0006338)|circadian regulation of gene expression (GO:0032922)|embryonic digit morphogenesis (GO:0042733)|epidermal cell differentiation (GO:0009913)|eyelid development in camera-type eye (GO:0061029)|fungiform papilla formation (GO:0061198)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|histone deacetylation (GO:0016575)|histone H3 deacetylation (GO:0070932)|histone H4 deacetylation (GO:0070933)|mitotic cell cycle (GO:0000278)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell cycle (GO:0045786)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of cell proliferation (GO:0008284)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein deacetylation (GO:0006476)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|histone deacetylase complex (GO:0000118)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|NuRD complex (GO:0016581)|protein complex (GO:0043234)|Sin3 complex (GO:0016580)	activating transcription factor binding (GO:0033613)|core promoter binding (GO:0001047)|deacetylase activity (GO:0019213)|enzyme binding (GO:0019899)|histone deacetylase activity (GO:0004407)|histone deacetylase binding (GO:0042826)|NAD-dependent histone deacetylase activity (H3-K14 specific) (GO:0032041)|NAD-dependent histone deacetylase activity (H3-K18 specific) (GO:0097372)|NAD-dependent histone deacetylase activity (H3-K9 specific) (GO:0046969)|NAD-dependent histone deacetylase activity (H4-K16 specific) (GO:0046970)|protein deacetylase activity (GO:0033558)|repressing transcription factor binding (GO:0070491)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(3)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	18		Breast(348;0.000523)|Lung NSC(340;0.000992)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Lung SC(1967;0.113)		KIRC - Kidney renal clear cell carcinoma(1967;0.138)	Vorinostat(DB02546)	CTCTCCACAGGGTCAAGGAGG	0.542																																						dbGAP											0													108.0	86.0	93.0					1																	32798618		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			D50405	CCDS360.1	1p34	2008-02-05			ENSG00000116478	ENSG00000116478			4852	protein-coding gene	gene with protein product		601241		RPD3L1		8602529	Standard	NM_004964		Approved	HD1, GON-10	uc001bvb.1	Q13547	OTTHUMG00000007529	ENST00000373548.3:c.1422-1G>A	1.37:g.32798618G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q92534	Silent	SNP	pfam_His_deacetylse_dom,pirsf_His_deacetylse_1,prints_His_deacetylse_1,prints_His_deacetylse	p.G474	ENST00000373548.3	37	c.1422	CCDS360.1	1																																																																																			HDAC1	-	NULL	ENSG00000116478		0.542	HDAC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HDAC1	HGNC	protein_coding	OTTHUMT00000019815.3	122	0.00	0	G	NM_004964	Silent	32798618	32798618	+1	no_errors	ENST00000373548	ensembl	human	known	69_37n	silent	92	40.26	62	SNP	1.000	A
HEPACAM2	253012	genome.wustl.edu	37	7	92826860	92826860	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr7:92826860G>C	ENST00000394468.2	-	5	1153	c.1076C>G	c.(1075-1077)tCa>tGa	p.S359*	HEPACAM2_ENST00000440868.1_Nonsense_Mutation_p.S347*|HEPACAM2_ENST00000492616.1_5'UTR|HEPACAM2_ENST00000453812.2_Nonsense_Mutation_p.S382*|HEPACAM2_ENST00000341723.4_Nonsense_Mutation_p.S347*	NM_001039372.1	NP_001034461.1	A8MVW5	HECA2_HUMAN	HEPACAM family member 2	359					centrosome organization (GO:0051297)|mitotic nuclear division (GO:0007067)	centrosome (GO:0005813)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|midbody (GO:0030496)|spindle (GO:0005819)				breast(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(12)|ovary(4)|skin(1)	28						CAAAAATAGTGATATTCCAGT	0.284																																						dbGAP											0													79.0	86.0	83.0					7																	92826860		2203	4298	6501	-	-	-	SO:0001587	stop_gained	0			AK096002	CCDS5629.1, CCDS43616.1, CCDS75631.1, CCDS75632.1	7q21.3	2013-01-29	2008-07-11		ENSG00000188175	ENSG00000188175		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27364	protein-coding gene	gene with protein product		614133				12975309	Standard	NM_001288804		Approved	FLJ38683	uc003umm.3	A8MVW5	OTTHUMG00000131732	ENST00000394468.2:c.1076C>G	7.37:g.92826860G>C	ENSP00000377980:p.Ser359*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTT4|B4DPJ1|B9EG93|E9PDV5|Q6UXI0	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S359*	ENST00000394468.2	37	c.1076	CCDS43616.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.771046	0.96914	.	.	ENSG00000188175	ENST00000394468;ENST00000341723;ENST00000440868;ENST00000453812	.	.	.	5.26	5.26	0.73747	.	0.061993	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.21014	T	0.42	-12.3726	17.4267	0.87528	0.0:0.0:1.0:0.0	.	.	.	.	X	359;347;347;382	.	ENSP00000340532:S347X	S	-	2	0	HEPACAM2	92664796	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.159000	0.71856	2.626000	0.88956	0.561000	0.74099	TCA	HEPACAM2	-	NULL	ENSG00000188175		0.284	HEPACAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEPACAM2	HGNC	protein_coding	OTTHUMT00000254651.1	285	0.00	0	G	NM_198151		92826860	92826860	-1	no_errors	ENST00000394468	ensembl	human	known	69_37n	nonsense	146	37.45	88	SNP	1.000	C
IKZF2	22807	genome.wustl.edu	37	2	213872500	213872500	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr2:213872500G>T	ENST00000434687.1	-	9	1474	c.1165C>A	c.(1165-1167)Cca>Aca	p.P389T	AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000374327.4_Missense_Mutation_p.P244T|IKZF2_ENST00000413091.3_3'UTR|IKZF2_ENST00000421754.2_Missense_Mutation_p.P315T|IKZF2_ENST00000342002.2_Missense_Mutation_p.P395T|IKZF2_ENST00000451136.2_Missense_Mutation_p.P317T|IKZF2_ENST00000457361.1_Missense_Mutation_p.P389T|IKZF2_ENST00000374319.4_Missense_Mutation_p.P363T			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	389					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		CGACTCTTTGGTCTGATGAGA	0.493																																						dbGAP											0													109.0	104.0	106.0					2																	213872500		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1165C>A	2.37:g.213872500G>T	ENSP00000412869:p.Pro389Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P389T	ENST00000434687.1	37	c.1165	CCDS2395.1	2	.	.	.	.	.	.	.	.	.	.	G	10.07	1.250058	0.22880	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	T;T;T;T;T;T;T	0.13657	3.32;3.3;3.32;3.37;3.28;3.32;2.57	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	T	0.35307	0.0927	M	0.65975	2.015	0.80722	D	1	D;P;D;B;P;B	0.76494	0.999;0.925;0.998;0.049;0.952;0.017	D;P;D;B;P;B	0.73708	0.981;0.621;0.914;0.022;0.606;0.008	T	0.00939	-1.1507	10	0.62326	D	0.03	-4.7959	13.9957	0.64397	0.0685:0.0:0.9315:0.0	.	317;315;244;363;389;167	C9JCG7;C9JTM9;F5H8M1;Q9UKS7-2;Q9UKS7;Q96LD7	.;.;.;.;IKZF2_HUMAN;.	T	389;395;389;363;317;315;244;93	ENSP00000410447:P389T;ENSP00000342876:P395T;ENSP00000412869:P389T;ENSP00000363439:P363T;ENSP00000395203:P317T;ENSP00000399574:P315T;ENSP00000363447:P244T	ENSP00000342876:P395T	P	-	1	0	IKZF2	213580745	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.173000	0.71937	2.941000	0.99782	0.655000	0.94253	CCA	IKZF2	-	NULL	ENSG00000030419		0.493	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	125	0.00	0	G	NM_016260		213872500	213872500	-1	no_errors	ENST00000434687	ensembl	human	known	69_37n	missense	99	28.26	39	SNP	1.000	T
ISL1	3670	genome.wustl.edu	37	5	50687262	50687262	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr5:50687262C>T	ENST00000230658.7	+	5	1505	c.920C>T	c.(919-921)gCt>gTt	p.A307V	ISL1_ENST00000511384.1_Missense_Mutation_p.A284V|ISL1_ENST00000505475.2_3'UTR	NM_002202.2	NP_002193.2	P61371	ISL1_HUMAN	ISL LIM homeobox 1	307	Gln-rich.				atrial septum morphogenesis (GO:0060413)|axon regeneration (GO:0031103)|cardiac cell fate determination (GO:0060913)|cardiac muscle cell myoblast differentiation (GO:0060379)|cardiac right ventricle morphogenesis (GO:0003215)|cellular response to glucocorticoid stimulus (GO:0071385)|endocardial cushion morphogenesis (GO:0003203)|innervation (GO:0060384)|mesenchymal cell differentiation (GO:0048762)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of inflammatory response (GO:0050728)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of protein homodimerization activity (GO:0090074)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural crest cell migration (GO:0001755)|neuron fate specification (GO:0048665)|outflow tract morphogenesis (GO:0003151)|outflow tract septum morphogenesis (GO:0003148)|pancreas development (GO:0031016)|peripheral nervous system neuron axonogenesis (GO:0048936)|pharyngeal system development (GO:0060037)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of granulocyte colony-stimulating factor production (GO:0071657)|positive regulation of granulocyte macrophage colony-stimulating factor production (GO:0032725)|positive regulation of insulin secretion (GO:0032024)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-1 alpha production (GO:0032730)|positive regulation of interleukin-1 beta production (GO:0032731)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of macrophage colony-stimulating factor production (GO:1901258)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|retinal ganglion cell axon guidance (GO:0031290)|secondary heart field specification (GO:0003139)|sensory system development (GO:0048880)|spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron differentiation (GO:0021522)|trigeminal nerve development (GO:0021559)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral motor neuron differentiation (GO:0021524)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	bHLH transcription factor binding (GO:0043425)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor binding (GO:0016922)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II transcription coactivator activity (GO:0001105)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(11)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	31		Lung NSC(810;0.000845)|Breast(144;0.0411)				GATCAGCCTGCTTTTCAGCAA	0.493																																						dbGAP											0													71.0	68.0	69.0					5																	50687262		1935	4155	6090	-	-	-	SO:0001583	missense	0			BC031213	CCDS43314.1	5q11.2	2012-03-09	2007-07-13		ENSG00000016082	ENSG00000016082		"""Homeoboxes / LIM class"""	6132	protein-coding gene	gene with protein product		600366	"""ISL1 transcription factor, LIM/homeodomain, (islet-1)"""			7912209	Standard	NM_002202		Approved	Isl-1, ISLET1	uc003jor.3	P61371	OTTHUMG00000162281	ENST00000230658.7:c.920C>T	5.37:g.50687262C>T	ENSP00000230658:p.Ala307Val	Somatic		WXS	Illumina GAIIx	Phase_IV	P20663|P47894	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.A307V	ENST00000230658.7	37	c.920	CCDS43314.1	5	.	.	.	.	.	.	.	.	.	.	C	33	5.228740	0.95173	.	.	ENSG00000016082	ENST00000230658;ENST00000511384	D;D	0.85411	-1.98;-1.97	5.63	5.63	0.86233	.	0.117588	0.56097	D	0.000031	D	0.89719	0.6796	M	0.78637	2.42	0.80722	D	1	D	0.53619	0.961	P	0.49829	0.623	D	0.90601	0.4544	10	0.72032	D	0.01	.	20.0345	0.97552	0.0:1.0:0.0:0.0	.	307	P61371	ISL1_HUMAN	V	307;284	ENSP00000230658:A307V;ENSP00000422676:A284V	ENSP00000230658:A307V	A	+	2	0	ISL1	50723019	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.797000	0.96272	0.655000	0.94253	GCT	ISL1	-	NULL	ENSG00000016082		0.493	ISL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL1	HGNC	protein_coding	OTTHUMT00000368413.3	33	0.00	0	C	NM_002202		50687262	50687262	+1	no_errors	ENST00000230658	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	T
IL6ST	3572	genome.wustl.edu	37	5	55251984	55251984	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr5:55251984T>C	ENST00000381298.2	-	10	1448	c.1136A>G	c.(1135-1137)aAt>aGt	p.N379S	IL6ST_ENST00000381286.3_Intron|IL6ST_ENST00000336909.5_Missense_Mutation_p.N379S|IL6ST_ENST00000381293.2_Intron|IL6ST_ENST00000536319.1_3'UTR|IL6ST_ENST00000381294.3_Missense_Mutation_p.N379S|IL6ST_ENST00000522633.2_3'UTR|IL6ST_ENST00000502326.3_Missense_Mutation_p.N379S|IL6ST_ENST00000381287.4_3'UTR	NM_001190981.1|NM_002184.3|NM_175767.2	NP_001177910.1|NP_002175.2|NP_786943.1	P40189	IL6RB_HUMAN	interleukin 6 signal transducer	379	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				ciliary neurotrophic factor-mediated signaling pathway (GO:0070120)|cytokine-mediated signaling pathway (GO:0019221)|glycogen metabolic process (GO:0005977)|interleukin-27-mediated signaling pathway (GO:0070106)|interleukin-6-mediated signaling pathway (GO:0070102)|leukemia inhibitory factor signaling pathway (GO:0048861)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|oncostatin-M-mediated signaling pathway (GO:0038165)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of adaptive immune response (GO:0002821)|positive regulation of astrocyte differentiation (GO:0048711)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell proliferation (GO:0008284)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of Notch signaling pathway (GO:0008593)|response to cytokine (GO:0034097)|viral process (GO:0016032)	ciliary neurotrophic factor receptor complex (GO:0070110)|dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-6 receptor complex (GO:0005896)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|oncostatin-M receptor complex (GO:0005900)|plasma membrane (GO:0005886)	ciliary neurotrophic factor receptor activity (GO:0004897)|ciliary neurotrophic factor receptor binding (GO:0005127)|growth factor binding (GO:0019838)|interleukin-11 receptor activity (GO:0004921)|interleukin-27 receptor activity (GO:0045509)|protein homodimerization activity (GO:0042803)			breast(2)|endometrium(5)|kidney(5)|large_intestine(4)|liver(2)|lung(1)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	26		Lung NSC(810;8.69e-05)|Prostate(74;0.00308)|Breast(144;0.0544)|Ovarian(174;0.223)				AACTGTGTAATTTTGTAAATG	0.343			O		hepatocellular ca																																	dbGAP		Dom	yes		5	5q11	3572	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""		E	0													163.0	155.0	158.0					5																	55251984		2203	4300	6503	-	-	-	SO:0001583	missense	0			M57230	CCDS3971.1, CCDS47209.1, CCDS54856.1	5q11.2	2014-04-04	2014-04-04		ENSG00000134352	ENSG00000134352		"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	6021	protein-coding gene	gene with protein product	"""gp130, oncostatin M receptor"""	600694	"""interleukin 6 signal transducer (gp130, oncostatin M receptor)"""			2261637	Standard	NM_002184		Approved	GP130, CD130	uc003jqq.3	P40189	OTTHUMG00000097043	ENST00000381298.2:c.1136A>G	5.37:g.55251984T>C	ENSP00000370698:p.Asn379Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0L4|Q5FC04|Q9UQ41	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,pfam_Fibronectin_type3,pfam_IL6_recept-bd,pfam_Growth/epo_recpt_lig-bind,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.N379S	ENST00000381298.2	37	c.1136	CCDS3971.1	5	.	.	.	.	.	.	.	.	.	.	T	5.878	0.346064	0.11126	.	.	ENSG00000134352	ENST00000381298;ENST00000336909;ENST00000381294	T;T;T	0.39787	1.06;1.06;1.06	5.86	-1.79	0.07932	Fibronectin, type III (3);Immunoglobulin-like fold (1);	1.141540	0.06148	N	0.673608	T	0.27027	0.0662	L	0.38531	1.155	0.18873	N	0.999987	B;B;B	0.10296	0.003;0.001;0.003	B;B;B	0.06405	0.001;0.002;0.001	T	0.19516	-1.0303	10	0.19147	T	0.46	.	3.2702	0.06879	0.2052:0.0629:0.3319:0.4001	.	379;379;379	Q17RA0;Q5FC04;P40189	.;.;IL6RB_HUMAN	S	379	ENSP00000370698:N379S;ENSP00000338799:N379S;ENSP00000370694:N379S	ENSP00000338799:N379S	N	-	2	0	IL6ST	55287741	0.096000	0.21769	0.903000	0.35520	0.781000	0.44180	-0.155000	0.10115	-0.086000	0.12550	0.528000	0.53228	AAT	IL6ST	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000134352		0.343	IL6ST-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	IL6ST	HGNC	protein_coding	OTTHUMT00000214146.3	329	0.00	0	T	NM_002184		55251984	55251984	-1	no_errors	ENST00000336909	ensembl	human	known	69_37n	missense	41	76.70	135	SNP	0.022	C
KRT81	3887	genome.wustl.edu	37	12	52681497	52681497	+	Silent	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr12:52681497C>T	ENST00000327741.5	-	6	977	c.909G>A	c.(907-909)gaG>gaA	p.E303E	KRT86_ENST00000423955.2_Intron|KRT86_ENST00000544024.1_Intron	NM_002281.3	NP_002272.2	Q14533	KRT81_HUMAN	keratin 81	303	Coil 2.|Rod.					extracellular space (GO:0005615)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(2)|endometrium(3)|large_intestine(3)|lung(6)|prostate(1)|stomach(1)	16				BRCA - Breast invasive adenocarcinoma(357;0.189)		TGGCCTTCATCTCCTCACACT	0.572																																						dbGAP											0													74.0	62.0	66.0					12																	52681497		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			X81420	CCDS31805.1	12q13	2013-01-16	2006-07-17	2006-07-17	ENSG00000205426	ENSG00000205426		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6458	protein-coding gene	gene with protein product	"""hard keratin type II 1"""	602153	"""keratin, hair, basic, 1"""	KRTHB1		7556444, 16831889	Standard	NM_002281		Approved	Hb-1	uc001sab.3	Q14533	OTTHUMG00000167574	ENST00000327741.5:c.909G>A	12.37:g.52681497C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14846|Q16274|Q17R48|Q8WU52|Q9BR74	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.E303	ENST00000327741.5	37	c.909	CCDS31805.1	12																																																																																			KRT81	-	pfam_F,superfamily_Prefoldin	ENSG00000205426		0.572	KRT81-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT81	HGNC	protein_coding	OTTHUMT00000395128.2	35	0.00	0	C	NM_002281		52681497	52681497	-1	no_errors	ENST00000327741	ensembl	human	known	69_37n	silent	73	41.60	52	SNP	1.000	T
LPPR2	64748	genome.wustl.edu	37	19	11474496	11474496	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr19:11474496G>C	ENST00000591608.1	+	8	1137	c.873G>C	c.(871-873)aaG>aaC	p.K291N	DKFZP761J1410_ENST00000251473.5_Splice_Site																							CCCTCGAAAAGTTAAGTGTGG	0.652																																						dbGAP											0													25.0	26.0	26.0					19																	11474496		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000591608.1:c.873G>C	19.37:g.11474496G>C	ENSP00000466898:p.Lys291Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Splice_Site	SNP	-	e6+1	ENST00000591608.1	37	c.947+1	CCDS59352.1	19	.	.	.	.	.	.	.	.	.	.	G	18.16	3.561089	0.65538	.	.	ENSG00000105520	ENST00000251473	.	.	.	5.84	5.84	0.93424	.	.	.	.	.	.	.	.	L	0.27053	0.805	0.58432	D	0.999996	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.9398	0.58335	0.0776:0.0:0.9223:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AC024575.1	11335496	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.309000	0.65774	2.765000	0.95021	0.655000	0.94253	.	LPPR2	-	-	ENSG00000105520		0.652	DKFZP761J1410-002	KNOWN	basic|CCDS	protein_coding	LPPR2	Clone_based_vega_gene	protein_coding	OTTHUMT00000458784.1	21	0.00	0	G			11474496	11474496	+1	no_errors	ENST00000251473	ensembl	human	known	69_37n	splice_site	25	35.90	14	SNP	1.000	C
MADD	8567	genome.wustl.edu	37	11	47306022	47306022	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr11:47306022A>T	ENST00000311027.5	+	12	2228	c.2063A>T	c.(2062-2064)gAc>gTc	p.D688V	MADD_ENST00000402192.2_Missense_Mutation_p.D688V|MADD_ENST00000407859.3_Missense_Mutation_p.D688V|MADD_ENST00000349238.3_Missense_Mutation_p.D688V|MADD_ENST00000395336.3_Missense_Mutation_p.D688V|MADD_ENST00000395344.3_Missense_Mutation_p.D688V|MADD_ENST00000402799.1_Missense_Mutation_p.D688V|MADD_ENST00000406482.1_Missense_Mutation_p.D688V|MADD_ENST00000342922.4_Missense_Mutation_p.D688V	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		CCTGGCCCAGACAGTGAGAAC	0.587																																						dbGAP											0													79.0	84.0	82.0					11																	47306022		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.2063A>T	11.37:g.47306022A>T	ENSP00000310933:p.Asp688Val	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.D688V	ENST00000311027.5	37	c.2063	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	A	14.20	2.463409	0.43736	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192	T;T;T;T;T;T;T;T;T	0.08008	3.28;3.25;3.25;3.24;3.24;3.14;3.22;3.24;3.28	5.96	2.37	0.29283	.	0.493637	0.24930	N	0.034462	T	0.14614	0.0353	L	0.44542	1.39	0.20638	N	0.999873	D;P;P;P;P;D;B;B;B;D	0.59357	0.974;0.954;0.821;0.911;0.948;0.985;0.083;0.367;0.042;0.977	P;P;P;P;P;P;B;B;B;P	0.58620	0.572;0.572;0.579;0.549;0.549;0.754;0.283;0.429;0.051;0.842	T	0.03354	-1.1045	10	0.72032	D	0.01	-7.0745	8.2131	0.31494	0.6813:0.2541:0.0647:0.0	.	688;688;688;688;688;688;688;688;688;688	B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;MADD_HUMAN;.	V	688	ENSP00000343902:D688V;ENSP00000385585:D688V;ENSP00000384435:D688V;ENSP00000304505:D688V;ENSP00000310933:D688V;ENSP00000384204:D688V;ENSP00000378753:D688V;ENSP00000378745:D688V;ENSP00000384287:D688V	ENSP00000310933:D688V	D	+	2	0	MADD	47262598	0.974000	0.33945	0.002000	0.10522	0.606000	0.37113	2.920000	0.48844	0.483000	0.27608	-0.264000	0.10439	GAC	MADD	-	NULL	ENSG00000110514		0.587	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	63	0.00	0	A			47306022	47306022	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	missense	107	17.05	22	SNP	0.019	T
MAGEB4	4115	genome.wustl.edu	37	X	30260918	30260918	+	Silent	SNP	A	A	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chrX:30260918A>G	ENST00000378982.2	+	1	862	c.666A>G	c.(664-666)gaA>gaG	p.E222E	MAGEB1_ENST00000397550.1_5'Flank|MAGEB1_ENST00000378981.3_5'Flank	NM_002367.3	NP_002358.1	O15481	MAGB4_HUMAN	melanoma antigen family B, 4	222	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	27						AAATCTGGGAATTCCTGAATA	0.483																																						dbGAP											0													81.0	77.0	78.0					X																	30260918		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS14221.1	Xp21.3	2009-03-17			ENSG00000120289	ENSG00000120289			6811	protein-coding gene	gene with protein product	"""melanoma-associated antigen B4"", ""cancer/testis antigen family 3, member 6"""	300153				9441743	Standard	NM_002367		Approved	MGC33144, CT3.6	uc004dcb.3	O15481	OTTHUMG00000021321	ENST00000378982.2:c.666A>G	X.37:g.30260918A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9G0|Q6FHH4|Q8IZ00	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E222	ENST00000378982.2	37	c.666	CCDS14221.1	X																																																																																			MAGEB4	-	pfam_MAGE,pfscan_MAGE	ENSG00000120289		0.483	MAGEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB4	HGNC	protein_coding	OTTHUMT00000056159.1	93	0.00	0	A	NM_002367		30260918	30260918	+1	no_errors	ENST00000378982	ensembl	human	known	69_37n	silent	188	16.07	36	SNP	0.004	G
MARK1	4139	genome.wustl.edu	37	1	220835233	220835233	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:220835233A>G	ENST00000366917.4	+	18	2379	c.2113A>G	c.(2113-2115)Agt>Ggt	p.S705G	RP11-322F10.2_ENST00000446040.1_RNA|MARK1_ENST00000366918.4_Missense_Mutation_p.S668G|MARK1_ENST00000402574.1_Missense_Mutation_p.S555G					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GTTCACATGGAGTATGAAGAC	0.418																																						dbGAP											0													71.0	69.0	70.0					1																	220835233		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.2113A>G	1.37:g.220835233A>G	ENSP00000355884:p.Ser705Gly	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S705G	ENST00000366917.4	37	c.2113	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	A	32	5.116902	0.94385	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.53206	0.63;0.63;0.63	5.92	5.92	0.95590	Kinase-associated KA1 (2);	0.000000	0.85682	D	0.000000	T	0.74382	0.3709	M	0.88105	2.93	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;0.999	D;D;D;D	0.91635	0.999;0.991;0.983;0.992	T	0.79845	-0.1631	10	0.87932	D	0	.	16.3782	0.83418	1.0:0.0:0.0:0.0	.	690;555;705;668	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	G	555;668;705	ENSP00000386017:S555G;ENSP00000355885:S668G;ENSP00000355884:S705G	ENSP00000355884:S705G	S	+	1	0	MARK1	218901856	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.339000	0.96797	2.277000	0.76020	0.528000	0.53228	AGT	MARK1	-	superfamily_Kinase-assoc_KA1	ENSG00000116141		0.418	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	80	0.00	0	A			220835233	220835233	+1	no_errors	ENST00000366917	ensembl	human	known	69_37n	missense	62	16.00	12	SNP	1.000	G
MEPE	56955	genome.wustl.edu	37	4	88766794	88766794	+	Silent	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr4:88766794C>T	ENST00000424957.3	+	4	847	c.774C>T	c.(772-774)gaC>gaT	p.D258D	MEPE_ENST00000361056.3_Silent_p.D258D|MEPE_ENST00000497649.2_Silent_p.D234D|MEPE_ENST00000508016.1_3'UTR|MEPE_ENST00000540395.1_Silent_p.D145D|MEPE_ENST00000395102.4_Silent_p.D289D|MEPE_ENST00000560249.1_Silent_p.D145D	NM_001184694.1	NP_001171623.1	Q9NQ76	MEPE_HUMAN	matrix extracellular phosphoglycoprotein	258					biomineral tissue development (GO:0031214)|negative regulation of bone mineralization (GO:0030502)|regulation of bone remodeling (GO:0046850)|skeletal system development (GO:0001501)	proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)			cervix(1)|endometrium(1)|kidney(3)|large_intestine(5)|lung(19)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	36		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000432)		TCAGTGGGGACGGCCAACCTT	0.448																																						dbGAP											0													62.0	62.0	62.0					4																	88766794		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ276396	CCDS3625.1, CCDS54776.1	4q21.1	2008-08-29	2008-08-29		ENSG00000152595	ENSG00000152595			13361	protein-coding gene	gene with protein product		605912	"""matrix, extracellular phosphoglycoprotein with ASARM motif (bone)"""			10945470	Standard	NM_020203		Approved		uc003hqy.3	Q9NQ76	OTTHUMG00000130592	ENST00000424957.3:c.774C>T	4.37:g.88766794C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X9|A8MTA3|D2CFR4|F5H5C5	Silent	SNP	pfam_Osteoregulin	p.D258	ENST00000424957.3	37	c.774	CCDS3625.1	4	.	.	.	.	.	.	.	.	.	.	C	7.891	0.732391	0.15507	.	.	ENSG00000152595	ENST00000535138	.	.	.	3.84	-1.52	0.08637	.	.	.	.	.	T	0.60287	0.2257	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.61372	-0.7076	5	0.87932	D	0	-36.4916	7.7745	0.29029	0.0:0.255:0.0:0.745	.	.	.	.	M	258	.	ENSP00000445423:T258M	T	+	2	0	MEPE	88985818	0.955000	0.32602	0.983000	0.44433	0.910000	0.53928	-0.444000	0.06854	-0.238000	0.09724	-0.224000	0.12420	ACG	MEPE	-	NULL	ENSG00000152595		0.448	MEPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPE	HGNC	protein_coding	OTTHUMT00000253038.1	57	0.00	0	C			88766794	88766794	+1	no_errors	ENST00000361056	ensembl	human	known	69_37n	silent	114	15.56	21	SNP	0.985	T
OASL	8638	genome.wustl.edu	37	12	121461839	121461839	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr12:121461839C>T	ENST00000257570.5	-	5	1271	c.1001G>A	c.(1000-1002)tGt>tAt	p.C334Y	OASL_ENST00000339275.5_Silent_p.L253L	NM_003733.3	NP_003724.1	Q15646	OASL_HUMAN	2'-5'-oligoadenylate synthetase-like	334					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of viral genome replication (GO:0045071)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|transferase activity (GO:0016740)			NS(1)|endometrium(3)|large_intestine(4)|lung(4)|skin(2)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					GTCATAGCAACAGTCCTGTTT	0.562																																					Colon(192;517 2041 31392 31913 39966)	dbGAP											0													157.0	121.0	133.0					12																	121461839		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063611	CCDS9211.1, CCDS9212.1, CCDS73536.1	12q24.2	2008-08-05			ENSG00000135114	ENSG00000135114			8090	protein-coding gene	gene with protein product		603281				10087211	Standard	NM_003733		Approved	TRIP14, p59OASL	uc001tzj.2	Q15646	OTTHUMG00000154981	ENST00000257570.5:c.1001G>A	12.37:g.121461839C>T	ENSP00000257570:p.Cys334Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RAZ2|I1YDD2|O75686|Q17R95|Q9Y6K6|Q9Y6K7	Missense_Mutation	SNP	pfam_2-5-oligoAdlate_synth_1_dom2/C,pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_2-5-oligoadenylate_synth_N,pfscan_Ubiquitin_supergroup	p.C334Y	ENST00000257570.5	37	c.1001	CCDS9211.1	12	.	.	.	.	.	.	.	.	.	.	C	16.89	3.247871	0.59103	.	.	ENSG00000135114	ENST00000257570;ENST00000543677	T	0.47869	0.83	5.74	5.74	0.90152	-oligoadenylate synthetase 1, domain 2/C-terminal (2);-5&apos (2);2&apos (2);	0.814873	0.11169	N	0.592244	T	0.70806	0.3266	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67768	-0.5585	9	0.72032	D	0.01	-11.7833	15.4358	0.75146	0.0:1.0:0.0:0.0	.	334	Q15646	OASL_HUMAN	Y	334;151	ENSP00000257570:C334Y	ENSP00000257570:C334Y	C	-	2	0	OASL	119946222	1.000000	0.71417	1.000000	0.80357	0.414000	0.31173	4.083000	0.57643	2.715000	0.92844	0.655000	0.94253	TGT	OASL	-	pfam_2-5-oligoAdlate_synth_1_dom2/C	ENSG00000135114		0.562	OASL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OASL	HGNC	protein_coding	OTTHUMT00000337875.2	68	0.00	0	C	NM_003733		121461839	121461839	-1	no_errors	ENST00000257570	ensembl	human	known	69_37n	missense	88	16.19	17	SNP	1.000	T
PREX2	80243	genome.wustl.edu	37	8	69031699	69031699	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr8:69031699C>G	ENST00000288368.4	+	28	3731	c.3454C>G	c.(3454-3456)Cat>Gat	p.H1152D		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1152					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TCGCATATCTCATGATAAACA	0.378																																						dbGAP											0													192.0	173.0	179.0					8																	69031699		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.3454C>G	8.37:g.69031699C>G	ENSP00000288368:p.His1152Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.H1152D	ENST00000288368.4	37	c.3454	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	C	17.25	3.342722	0.61073	.	.	ENSG00000046889	ENST00000288368;ENST00000396539	T	0.36340	1.26	5.39	5.39	0.77823	.	0.112610	0.64402	D	0.000012	T	0.37265	0.0997	L	0.44542	1.39	0.80722	D	1	B	0.31581	0.329	B	0.34873	0.191	T	0.09509	-1.0671	10	0.35671	T	0.21	.	19.5223	0.95190	0.0:1.0:0.0:0.0	.	1152	Q70Z35	PREX2_HUMAN	D	1152;1158	ENSP00000288368:H1152D	ENSP00000288368:H1152D	H	+	1	0	PREX2	69194253	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.423000	0.66458	2.697000	0.92050	0.650000	0.86243	CAT	PREX2	-	NULL	ENSG00000046889		0.378	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	197	0.00	0	C	NM_025170		69031699	69031699	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	223	16.48	44	SNP	1.000	G
PRKCG	5582	genome.wustl.edu	37	19	54403952	54403952	+	Silent	SNP	C	C	T	rs115736276	byFrequency	TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr19:54403952C>T	ENST00000263431.3	+	14	1806	c.1524C>T	c.(1522-1524)ccC>ccT	p.P508P	PRKCG_ENST00000540413.1_Silent_p.P508P|PRKCG_ENST00000542049.1_Silent_p.P395P	NM_002739.3	NP_002730.1	P05129	KPCG_HUMAN	protein kinase C, gamma	508	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|cell death (GO:0008219)|chemosensory behavior (GO:0007635)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|learning or memory (GO:0007611)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of protein ubiquitination (GO:0031397)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphorylation (GO:0016310)|platelet activation (GO:0030168)|positive regulation of mismatch repair (GO:0032425)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to morphine (GO:0043278)|response to pain (GO:0048265)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cell-cell junction (GO:0005911)|cytosol (GO:0005829)|dendrite (GO:0030425)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|synaptic membrane (GO:0097060)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|zinc ion binding (GO:0008270)	p.P508P(1)		large_intestine(1)|lung(4)|ovary(2)|pancreas(2)|skin(1)	10	all_cancers(19;0.0462)|all_epithelial(19;0.0258)|all_lung(19;0.185)|Ovarian(34;0.19)|Lung NSC(19;0.218)			GBM - Glioblastoma multiforme(134;0.0521)	Tamoxifen(DB00675)	ACGTCTTCCCCGGGACGACAA	0.577																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											238.0	231.0	233.0					19																	54403952		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M13977	CCDS12867.1	19q13.4	2014-09-17			ENSG00000126583	ENSG00000126583	2.7.11.1		9402	protein-coding gene	gene with protein product	"""PKC-gamma"""	176980		PKCG, SCA14		8432525, 3755548	Standard	NM_002739		Approved	PKCC, MGC57564	uc002qcq.1	P05129	OTTHUMG00000064846	ENST00000263431.3:c.1524C>T	19.37:g.54403952C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8Q0	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.P508	ENST00000263431.3	37	c.1524	CCDS12867.1	19																																																																																			PRKCG	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Protein_kinase_C_a/b/g,pfscan_Prot_kinase_cat_dom	ENSG00000126583		0.577	PRKCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCG	HGNC	protein_coding	OTTHUMT00000139233.3	55	0.00	0	C	NM_002739		54403952	54403952	+1	no_errors	ENST00000540413	ensembl	human	known	69_37n	silent	73	36.52	42	SNP	0.650	T
PSMC6	5706	genome.wustl.edu	37	14	53184856	53184856	+	Nonsense_Mutation	SNP	T	T	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr14:53184856T>G	ENST00000606149.1	+	8	603	c.587T>G	c.(586-588)tTa>tGa	p.L196*	PSMC6_ENST00000445930.2_Nonsense_Mutation_p.L210*	NM_002806.3	NP_002797.3	P62333	PRS10_HUMAN	proteasome (prosome, macropain) 26S subunit, ATPase, 6	196					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|ATP catabolic process (GO:0006200)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|protein binding, bridging (GO:0030674)			breast(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)	19	Breast(41;0.176)					TGCAATTTCTTAAAGGTAAAG	0.328																																						dbGAP											0													104.0	109.0	107.0					14																	53184856		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS9710.2	14q22.1	2010-04-21			ENSG00000100519	ENSG00000100519		"""Proteasome (prosome, macropain) subunits"", ""ATPases / AAA-type"""	9553	protein-coding gene	gene with protein product		602708				8674546, 9473509	Standard	NM_002806		Approved	p42	uc010tqx.2	P62333	OTTHUMG00000152333	ENST00000606149.1:c.587T>G	14.37:g.53184856T>G	ENSP00000475721:p.Leu196*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R975|P49719|Q6IBU3|Q92524	Nonsense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	p.L210*	ENST00000606149.1	37	c.629		14	.	.	.	.	.	.	.	.	.	.	T	29.0	4.972707	0.92919	.	.	ENSG00000100519	ENST00000445930	.	.	.	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	14.8417	0.70230	0.0:0.0:0.0:1.0	.	.	.	.	X	210	.	ENSP00000401802:L210X	L	+	2	0	PSMC6	52254606	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	7.666000	0.83877	1.978000	0.57642	0.482000	0.46254	TTA	PSMC6	-	pfam_ATPase_AAA_core,pfam_ATPase_AAA-2,pfam_DNA_helicase_Holl-junc_RuvB_N,smart_AAA+_ATPase,tigrfam_26S_Psome_P45	ENSG00000100519		0.328	PSMC6-018	KNOWN	basic|appris_candidate	protein_coding	PSMC6	HGNC	protein_coding	OTTHUMT00000470741.1	226	0.44	1	T	NM_002806		53184856	53184856	+1	no_errors	ENST00000445930	ensembl	human	known	69_37n	nonsense	136	20.47	35	SNP	1.000	G
PTBP3	9991	genome.wustl.edu	37	9	115038244	115038244	+	Silent	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr9:115038244C>T	ENST00000374255.2	-	4	315	c.168G>A	c.(166-168)tcG>tcA	p.S56S	PTBP3_ENST00000334318.6_Silent_p.S59S|PTBP3_ENST00000458258.1_Silent_p.S62S|PTBP3_ENST00000343327.2_Intron|PTBP3_ENST00000487997.1_Intron|PTBP3_ENST00000374257.1_Silent_p.S28S			O95758	PTBP3_HUMAN	polypyrimidine tract binding protein 3	56					anatomical structure morphogenesis (GO:0009653)|erythrocyte maturation (GO:0043249)|mRNA processing (GO:0006397)|negative regulation of RNA splicing (GO:0033119)|regulation of cell differentiation (GO:0045595)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										CACGGGAAGGCGAACAGGGAG	0.368																																						dbGAP											0													117.0	109.0	112.0					9																	115038244		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023967	CCDS6784.1, CCDS55332.1, CCDS55333.1, CCDS59140.1, CCDS59141.1	9q32	2013-07-16	2011-11-16	2011-11-16	ENSG00000119314	ENSG00000119314		"""RNA binding motif (RRM) containing"""	10253	protein-coding gene	gene with protein product		607527	"""regulator of differentiation (in S. pombe) 1"", ""ROD1 regulator of differentiation 1 (S. pombe)"""	ROD1		10207106	Standard	NM_005156		Approved	DKFZp781I1117	uc004bfx.3	O95758	OTTHUMG00000020503	ENST00000374255.2:c.168G>A	9.37:g.115038244C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALY2|B1ALY3|B1ALY5|B1ALY6|B3KME7|Q68DB9|Q86YB3|Q86YH9	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP-L_PTB	p.S62	ENST00000374255.2	37	c.186	CCDS6784.1	9																																																																																			PTBP3	-	NULL	ENSG00000119314		0.368	PTBP3-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTBP3	HGNC	protein_coding	OTTHUMT00000053679.1	179	0.00	0	C			115038244	115038244	-1	no_errors	ENST00000458258	ensembl	human	known	69_37n	silent	108	16.79	22	SNP	0.051	T
ROBO4	54538	genome.wustl.edu	37	11	124757090	124757090	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr11:124757090C>G	ENST00000306534.3	-	15	2703	c.2218G>C	c.(2218-2220)Gct>Cct	p.A740P	RP11-664I21.5_ENST00000524453.1_RNA|ROBO4_ENST00000533054.1_Missense_Mutation_p.A595P	NM_019055.5	NP_061928.4	Q8WZ75	ROBO4_HUMAN	roundabout, axon guidance receptor, homolog 4 (Drosophila)	740	Pro/Ser-rich.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of cell migration (GO:0030336)|regulation of cell migration (GO:0030334)	external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(2)|breast(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(42)|ovary(1)|prostate(4)|skin(5)|urinary_tract(3)	76	all_hematologic(175;0.215)	Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|Breast(109;0.171)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;1.5e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0301)		GAGGAGGGAGCCTGTGGTGCC	0.642																																						dbGAP											0													75.0	77.0	76.0					11																	124757090		2200	4298	6498	-	-	-	SO:0001583	missense	0			AF361473	CCDS8455.1, CCDS73409.1	11q24.2	2013-02-11	2011-12-09		ENSG00000154133	ENSG00000154133		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	17985	protein-coding gene	gene with protein product	"""magic roundabout"""	607528	"""roundabout homolog 4 (Drosophila)"""			11076864	Standard	NM_019055		Approved	FLJ20798, MRB, ECSM4	uc001qbg.3	Q8WZ75	OTTHUMG00000165936	ENST00000306534.3:c.2218G>C	11.37:g.124757090C>G	ENSP00000304945:p.Ala740Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K154|Q14DU7|Q8TEG1|Q96JV6|Q9H718|Q9NWJ8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A740P	ENST00000306534.3	37	c.2218	CCDS8455.1	11	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747568	0.49257	.	.	ENSG00000154133	ENST00000306534;ENST00000374963;ENST00000533054	T;T	0.65549	-0.16;0.21	4.97	0.0372	0.14195	.	0.237642	0.21929	N	0.067055	T	0.50922	0.1644	M	0.63428	1.95	0.09310	N	1	B;B;B	0.14805	0.002;0.011;0.002	B;B;B	0.17433	0.005;0.018;0.005	T	0.47724	-0.9095	10	0.59425	D	0.04	.	3.0515	0.06171	0.1578:0.4163:0.3113:0.1145	.	740;630;740	Q8WZ75-2;Q8WZ75-3;Q8WZ75	.;.;ROBO4_HUMAN	P	740;630;595	ENSP00000304945:A740P;ENSP00000437129:A595P	ENSP00000304945:A740P	A	-	1	0	ROBO4	124262300	0.000000	0.05858	0.002000	0.10522	0.001000	0.01503	-0.609000	0.05635	0.115000	0.18071	-0.224000	0.12420	GCT	ROBO4	-	NULL	ENSG00000154133		0.642	ROBO4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO4	HGNC	protein_coding	OTTHUMT00000387111.1	23	0.00	0	C	NM_019055		124757090	124757090	-1	no_errors	ENST00000306534	ensembl	human	known	69_37n	missense	33	46.77	29	SNP	0.000	G
RPH3A	22895	genome.wustl.edu	37	12	113306329	113306329	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr12:113306329C>A	ENST00000389385.4	+	8	1036	c.539C>A	c.(538-540)cCt>cAt	p.P180H	RPH3A_ENST00000420983.2_Missense_Mutation_p.P180H|RPH3A_ENST00000549913.2_3'UTR|RPH3A_ENST00000447659.2_Missense_Mutation_p.P131H|RPH3A_ENST00000543106.2_Missense_Mutation_p.P180H|RPH3A_ENST00000548866.1_Missense_Mutation_p.P131H|RPH3A_ENST00000551052.1_Missense_Mutation_p.P176H|RPH3A_ENST00000415485.3_Missense_Mutation_p.P180H	NM_001143854.1|NM_014954.3	NP_001137326.1|NP_055769.2	Q9Y2J0	RP3A_HUMAN	rabphilin 3A	180	Pro-rich.				intracellular protein transport (GO:0006886)	cell junction (GO:0030054)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|phosphatidylinositol phosphate binding (GO:1901981)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(2)|endometrium(2)|kidney(1)|large_intestine(8)|lung(16)|ovary(3)|prostate(4)|skin(6)|urinary_tract(1)	47				BRCA - Breast invasive adenocarcinoma(302;0.00453)		CCCCAGCAGCCTGTCAGTGAG	0.587																																						dbGAP											0													45.0	45.0	45.0					12																	113306329		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023202	CCDS31904.1, CCDS44979.1	12q24.13	2014-07-02	2014-07-02		ENSG00000089169	ENSG00000089169		"""Synaptotagmins"""	17056	protein-coding gene	gene with protein product		612159	"""rabphilin 3A homolog (mouse)"""			10231032, 7822236	Standard	NM_014954		Approved	KIAA0985, rabphilin, exophilin-1	uc001ttz.3	Q9Y2J0	OTTHUMG00000169713	ENST00000389385.4:c.539C>A	12.37:g.113306329C>A	ENSP00000374036:p.Pro180His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3C3|Q96AE0	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Rabphilin3A_effector_Zn-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,smart_C2_Ca-dep,prints_Synaptotagmin,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.P180H	ENST00000389385.4	37	c.539	CCDS44979.1	12	.	.	.	.	.	.	.	.	.	.	C	15.19	2.761379	0.49468	.	.	ENSG00000089169	ENST00000543106;ENST00000551593;ENST00000389385;ENST00000447659;ENST00000551052;ENST00000415485;ENST00000548866;ENST00000420983	T;T;T;T;T;T;T	0.62941	-0.01;-0.01;0.0;-0.01;-0.01;0.0;-0.01	5.05	5.05	0.67936	.	0.205916	0.33005	N	0.005381	T	0.73521	0.3597	L	0.54323	1.7	0.36623	D	0.875897	D;D;D;D	0.76494	0.995;0.998;0.998;0.999	P;P;P;D	0.65874	0.847;0.87;0.87;0.939	T	0.75491	-0.3299	10	0.32370	T	0.25	.	17.1808	0.86854	0.0:1.0:0.0:0.0	.	131;180;180;176	F8VP47;B7Z9Z7;Q9Y2J0;Q9Y2J0-2	.;.;RP3A_HUMAN;.	H	180;180;180;131;176;180;131;180	ENSP00000440384:P180H;ENSP00000374036:P180H;ENSP00000413254:P131H;ENSP00000448297:P176H;ENSP00000405357:P180H;ENSP00000450347:P131H;ENSP00000408889:P180H	ENSP00000374036:P180H	P	+	2	0	RPH3A	111790712	0.495000	0.26051	0.943000	0.38184	0.275000	0.26752	2.932000	0.48940	2.356000	0.79943	0.655000	0.94253	CCT	RPH3A	-	NULL	ENSG00000089169		0.587	RPH3A-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPH3A	HGNC	protein_coding	OTTHUMT00000405561.1	32	0.00	0	C	NM_014954		113306329	113306329	+1	no_errors	ENST00000389385	ensembl	human	known	69_37n	missense	34	38.18	21	SNP	0.001	A
STH	246744	genome.wustl.edu	37	17	44076959	44076959	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr17:44076959G>T	ENST00000537309.1	+	1	344	c.314G>T	c.(313-315)tGt>tTt	p.C105F	MAPT_ENST00000574436.1_Intron|MAPT_ENST00000446361.3_Intron|MAPT_ENST00000535772.1_Intron|MAPT_ENST00000347967.5_Intron|MAPT_ENST00000576518.1_Intron|MAPT_ENST00000571987.1_Intron|MAPT_ENST00000420682.2_Intron|MAPT_ENST00000415613.2_Intron|MAPT_ENST00000334239.8_Intron|MAPT_ENST00000351559.5_Intron|MAPT_ENST00000344290.5_Intron|MAPT_ENST00000340799.5_Intron|MAPT_ENST00000431008.3_Intron|MAPT_ENST00000262410.5_Intron|MAPT_ENST00000570299.1_Intron	NM_001007532.2	NP_001007533.1	Q8IWL8	STH_HUMAN	saitohin	105						cytoplasm (GO:0005737)|nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						GGCCAGAACTGTCCCTCCCAC	0.582																																						dbGAP											0													30.0	33.0	32.0					17																	44076959		1942	4147	6089	-	-	-	SO:0001583	missense	0			AA325304	CCDS54136.1	17q21.1	2008-01-22				ENSG00000256762			18839	protein-coding gene	gene with protein product	"""microtubule-associated protein tau (MAPT) intronic transcript"""	607067				12032355, 16186110	Standard	NM_001007532		Approved	MAPTIT	uc002ijy.2	Q8IWL8		ENST00000537309.1:c.314G>T	17.37:g.44076959G>T	ENSP00000443168:p.Cys105Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3X7	Missense_Mutation	SNP	NULL	p.C105F	ENST00000537309.1	37	c.314	CCDS54136.1	17	.	.	.	.	.	.	.	.	.	.	G	5.112	0.206267	0.09704	.	.	ENSG00000256762	ENST00000537309	T	0.56103	0.48	2.68	-5.37	0.02681	.	.	.	.	.	T	0.33818	0.0876	N	0.08118	0	0.09310	N	1	D	0.53151	0.958	P	0.50934	0.654	T	0.36261	-0.9755	9	0.87932	D	0	.	5.0096	0.14306	0.2736:0.0:0.5758:0.1507	.	105	Q8IWL8	STH_HUMAN	F	105	ENSP00000443168:C105F	ENSP00000443168:C105F	C	+	2	0	STH	41432796	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.862000	0.04263	-1.270000	0.02433	-0.291000	0.09656	TGT	STH	-	NULL	ENSG00000256762		0.582	STH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STH	HGNC	protein_coding	OTTHUMT00000400444.1	36	0.00	0	G			44076959	44076959	+1	no_errors	ENST00000537309	ensembl	human	known	69_37n	missense	41	16.33	8	SNP	0.000	T
TBC1D21	161514	genome.wustl.edu	37	15	74177364	74177364	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr15:74177364G>T	ENST00000300504.2	+	6	582	c.499G>T	c.(499-501)Gag>Tag	p.E167*	TBC1D21_ENST00000562056.1_Nonsense_Mutation_p.E130*|TBC1D21_ENST00000535547.2_Nonsense_Mutation_p.E131*	NM_153356.1	NP_699187.1	Q8IYX1	TBC21_HUMAN	TBC1 domain family, member 21	167	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					acrosomal vesicle (GO:0001669)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(2)|large_intestine(2)|lung(6)|ovary(3)|skin(1)|stomach(1)|urinary_tract(1)	17						GGGCTTCCATGAGATGATGAT	0.602																																						dbGAP											0													110.0	100.0	103.0					15																	74177364		2198	4297	6495	-	-	-	SO:0001587	stop_gained	0			BC033516	CCDS10252.1, CCDS66822.1	15q24	2013-07-09			ENSG00000167139	ENSG00000167139			28536	protein-coding gene	gene with protein product	"""male germ cell-specific expressed, containing a RabGAP domain"""					21128978	Standard	XR_243080		Approved	MGC34741, MgcRabGAP	uc002avz.3	Q8IYX1	OTTHUMG00000137594	ENST00000300504.2:c.499G>T	15.37:g.74177364G>T	ENSP00000300504:p.Glu167*	Somatic		WXS	Illumina GAIIx	Phase_IV	B9A6M2	Nonsense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E167*	ENST00000300504.2	37	c.499	CCDS10252.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.207721	0.95033	.	.	ENSG00000167139	ENST00000300504;ENST00000535547	.	.	.	5.01	4.08	0.47627	.	0.000000	0.56097	D	0.000030	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.4615	0.50213	0.0:0.182:0.818:0.0	.	.	.	.	X	167;131	.	ENSP00000300504:E167X	E	+	1	0	TBC1D21	71964417	0.999000	0.42202	0.976000	0.42696	0.987000	0.75469	3.466000	0.53071	1.086000	0.41228	0.561000	0.74099	GAG	TBC1D21	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	ENSG00000167139		0.602	TBC1D21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D21	HGNC	protein_coding	OTTHUMT00000268994.1	74	0.00	0	G	NM_153356		74177364	74177364	+1	no_errors	ENST00000300504	ensembl	human	known	69_37n	nonsense	30	26.83	11	SNP	0.988	T
TMEM53	79639	genome.wustl.edu	37	1	45120323	45120323	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr1:45120323C>T	ENST00000372237.3	-	3	905	c.742G>A	c.(742-744)Gtg>Atg	p.V248M	TMEM53_ENST00000372242.3_Intron|TMEM53_ENST00000372244.3_Intron|TMEM53_ENST00000372243.3_Intron|TMEM53_ENST00000372235.3_Missense_Mutation_p.V218M|TMEM53_ENST00000476724.1_5'UTR	NM_024587.2	NP_078863.2	Q6P2H8	TMM53_HUMAN	transmembrane protein 53	248						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|liver(1)|lung(3)|ovary(2)|urinary_tract(1)	10	Acute lymphoblastic leukemia(166;0.155)					GCAGATGACACGAAATCCACA	0.592																																						dbGAP											0													104.0	112.0	109.0					1																	45120323		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS511.1, CCDS72773.1	1p34.1	2008-02-26			ENSG00000126106	ENSG00000126106			26186	protein-coding gene	gene with protein product						12958361	Standard	XR_425151		Approved	FLJ22353, NET4	uc001cmc.3	Q6P2H8	OTTHUMG00000007833	ENST00000372237.3:c.742G>A	1.37:g.45120323C>T	ENSP00000361311:p.Val248Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKG0|Q5JPH2|Q6IA07|Q9H6E2	Missense_Mutation	SNP	pfam_DUF829_TMEM53	p.V248M	ENST00000372237.3	37	c.742	CCDS511.1	1	.	.	.	.	.	.	.	.	.	.	C	13.03	2.116368	0.37339	.	.	ENSG00000126106	ENST00000372237;ENST00000372235	.	.	.	5.54	0.414	0.16406	.	0.743551	0.13401	N	0.390652	T	0.52208	0.1720	M	0.65975	2.015	0.09310	N	1	D	0.76494	0.999	D	0.65010	0.931	T	0.33343	-0.9872	9	0.54805	T	0.06	.	4.1819	0.10380	0.2971:0.3804:0.0:0.3225	.	248	Q6P2H8	TMM53_HUMAN	M	248;218	.	ENSP00000361309:V218M	V	-	1	0	TMEM53	44892910	0.000000	0.05858	0.643000	0.29450	0.550000	0.35303	0.118000	0.15605	0.703000	0.31848	0.563000	0.77884	GTG	TMEM53	-	pfam_DUF829_TMEM53	ENSG00000126106		0.592	TMEM53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM53	HGNC	protein_coding	OTTHUMT00000021599.1	55	0.00	0	C	NM_024587		45120323	45120323	-1	no_errors	ENST00000372237	ensembl	human	known	69_37n	missense	24	27.27	9	SNP	0.002	T
USP25	29761	genome.wustl.edu	37	21	17199314	17199314	+	Silent	SNP	A	A	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr21:17199314A>T	ENST00000285679.6	+	14	1854	c.1485A>T	c.(1483-1485)ggA>ggT	p.G495G	USP25_ENST00000400183.2_Silent_p.G495G|USP25_ENST00000285681.2_Silent_p.G495G|USP25_ENST00000351097.5_Intron	NM_013396.3	NP_037528.3	Q9UHP3	UBP25_HUMAN	ubiquitin specific peptidase 25	495	USP.				cellular protein modification process (GO:0006464)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|proteolysis (GO:0006508)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)|SUMO binding (GO:0032183)|ubiquitin-specific protease activity (GO:0004843)			breast(4)|endometrium(6)|kidney(2)|large_intestine(13)|liver(5)|lung(14)|ovary(4)|prostate(1)|skin(1)|urinary_tract(2)	52				Epithelial(23;7.55e-05)|all cancers(11;0.000429)|COAD - Colon adenocarcinoma(22;0.00543)|OV - Ovarian serous cystadenocarcinoma(11;0.00743)|Colorectal(24;0.0116)|Lung(58;0.0853)|LUSC - Lung squamous cell carcinoma(23;0.0889)		AACAACAGGGAGCCCTATCTT	0.418																																						dbGAP											0													126.0	115.0	119.0					21																	17199314		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF170562	CCDS33515.1, CCDS63336.1, CCDS63337.1	21q11.2	2011-02-24	2005-08-08		ENSG00000155313	ENSG00000155313		"""Ubiquitin-specific peptidases"""	12624	protein-coding gene	gene with protein product		604736	"""ubiquitin specific protease 25"""			12838346, 10612803	Standard	NM_013396		Approved	USP21	uc002yjy.1	Q9UHP3	OTTHUMG00000074343	ENST00000285679.6:c.1485A>T	21.37:g.17199314A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C0LSZ0|Q6DHZ9|Q9H9W1	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E24V	ENST00000285679.6	37	c.71	CCDS33515.1	21	.	.	.	.	.	.	.	.	.	.	A	6.148	0.395562	0.11638	.	.	ENSG00000155313	ENST00000453553	.	.	.	4.5	4.5	0.54988	.	.	.	.	.	T	0.53769	0.1817	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.53005	-0.8499	4	.	.	.	.	5.2699	0.15618	0.7605:0.0:0.2395:0.0	.	.	.	.	V	24	.	.	E	+	2	0	USP25	16121185	0.306000	0.24490	0.900000	0.35374	0.574000	0.36063	0.732000	0.26072	1.967000	0.57214	0.455000	0.32223	GAG	USP25	-	pfscan_Peptidase_C19	ENSG00000155313		0.418	USP25-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP25	HGNC	protein_coding	OTTHUMT00000157964.1	91	0.00	0	A			17199314	17199314	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000453553	ensembl	human	putative	69_37n	missense	90	17.43	19	SNP	0.719	T
VLDLR	7436	genome.wustl.edu	37	9	2643294	2643294	+	Missense_Mutation	SNP	G	G	A	rs201652132		TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr9:2643294G>A	ENST00000382100.3	+	5	939	c.583G>A	c.(583-585)Gcc>Acc	p.A195T	VLDLR_ENST00000382099.2_Missense_Mutation_p.A195T|RP11-125B21.2_ENST00000599229.1_RNA	NM_003383.3	NP_003374.3	P98155	VLDLR_HUMAN	very low density lipoprotein receptor	195	LDL-receptor class A 5. {ECO:0000255|PROSITE-ProRule:PRU00124}.				cholesterol metabolic process (GO:0008203)|glycoprotein transport (GO:0034436)|lipid transport (GO:0006869)|memory (GO:0007613)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|positive regulation of dendrite development (GO:1900006)|positive regulation of protein kinase activity (GO:0045860)|receptor-mediated endocytosis (GO:0006898)|reelin-mediated signaling pathway (GO:0038026)|signal transduction (GO:0007165)|ventral spinal cord development (GO:0021517)|very-low-density lipoprotein particle clearance (GO:0034447)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|very-low-density lipoprotein particle (GO:0034361)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|calcium-dependent protein binding (GO:0048306)|glycoprotein binding (GO:0001948)|glycoprotein transporter activity (GO:0034437)|low-density lipoprotein receptor activity (GO:0005041)|reelin receptor activity (GO:0038025)|very-low-density lipoprotein particle binding (GO:0034189)|very-low-density lipoprotein particle receptor activity (GO:0030229)			breast(1)|central_nervous_system(2)|endometrium(1)|kidney(3)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	24				GBM - Glioblastoma multiforme(50;0.0668)|Lung(218;0.123)		AACCTGTGGCGCCCATGAGTT	0.592																																						dbGAP											0													86.0	74.0	78.0					9																	2643294		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6446.1, CCDS34979.1	9p24	2014-01-24			ENSG00000147852	ENSG00000147852		"""Low density lipoprotein receptors"""	12698	protein-coding gene	gene with protein product		192977				8294473	Standard	XM_006716864		Approved	CARMQ1, CHRMQ1, VLDLRCH	uc003zhk.1	P98155	OTTHUMG00000019447	ENST00000382100.3:c.583G>A	9.37:g.2643294G>A	ENSP00000371532:p.Ala195Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMZ7|D3DRH6|Q5VVF6	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_Ca-bd,superfamily_LDrepeatLR_classA_rpt,superfamily_Growth_fac_rcpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.A195T	ENST00000382100.3	37	c.583	CCDS6446.1	9	.	.	.	.	.	.	.	.	.	.	G	12.16	1.855136	0.32791	.	.	ENSG00000147852	ENST00000382100;ENST00000382096;ENST00000382099;ENST00000382092	D;D;D	0.95724	-3.79;-3.79;-3.79	5.5	-3.42	0.04825	.	0.722053	0.12545	N	0.459531	D	0.88351	0.6413	N	0.20881	0.62	0.09310	N	1	B;B;B	0.12630	0.005;0.006;0.0	B;B;B	0.10450	0.002;0.004;0.005	T	0.77016	-0.2744	10	0.41790	T	0.15	.	7.3636	0.26760	0.2906:0.2814:0.428:0.0	.	195;195;195	P98155-2;Q5VVF5;P98155	.;.;VLDLR_HUMAN	T	195;154;195;74	ENSP00000371532:A195T;ENSP00000371528:A154T;ENSP00000371531:A195T	ENSP00000371524:A74T	A	+	1	0	VLDLR	2633294	0.008000	0.16893	0.001000	0.08648	0.566000	0.35808	0.164000	0.16542	-0.575000	0.05982	-0.794000	0.03295	GCC	VLDLR	-	pfam_LDrepeatLR_classA_rpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt	ENSG00000147852		0.592	VLDLR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VLDLR	HGNC	protein_coding	OTTHUMT00000051519.2	23	0.00	0	G	NM_003383		2643294	2643294	+1	no_errors	ENST00000382100	ensembl	human	known	69_37n	missense	6	66.67	14	SNP	0.019	A
VPS41	27072	genome.wustl.edu	37	7	38768370	38768370	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr7:38768370T>C	ENST00000310301.4	-	26	2335	c.2281A>G	c.(2281-2283)Aag>Gag	p.K761E	VPS41_ENST00000395969.2_Missense_Mutation_p.K736E	NM_014396.3	NP_055211.2	P49754	VPS41_HUMAN	vacuolar protein sorting 41 homolog (S. cerevisiae)	761					Golgi vesicle transport (GO:0048193)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	cytosol (GO:0005829)|early endosome (GO:0005769)|Golgi-associated vesicle (GO:0005798)|HOPS complex (GO:0030897)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(5)|lung(17)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	44						AGAATCTTCTTGCAGCCTTCA	0.393																																						dbGAP											0													104.0	99.0	101.0					7																	38768370		2203	4300	6503	-	-	-	SO:0001583	missense	0			U87309	CCDS5457.1, CCDS5458.2	7p14.1-p13	2009-05-08	2006-12-19		ENSG00000006715	ENSG00000006715			12713	protein-coding gene	gene with protein product		605485	"""vacuolar protein sorting 41 (yeast homolog)"", ""vacuolar protein sorting 41 (yeast)"""			9159129	Standard	NM_080631		Approved	HVSP41	uc003tgy.3	P49754	OTTHUMG00000023629	ENST00000310301.4:c.2281A>G	7.37:g.38768370T>C	ENSP00000309457:p.Lys761Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PF36|Q86TP8|Q99851|Q99852	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_VPS41,pfscan_Znf_RING	p.K761E	ENST00000310301.4	37	c.2281	CCDS5457.1	7	.	.	.	.	.	.	.	.	.	.	T	29.8	5.038858	0.93630	.	.	ENSG00000006715	ENST00000310301;ENST00000395969	T;T	0.30981	1.51;1.51	5.71	5.71	0.89125	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.44074	0.1276	L	0.55103	1.725	0.58432	D	0.999999	D;D;D	0.67145	0.996;0.996;0.996	P;P;P	0.62813	0.907;0.907;0.907	T	0.31392	-0.9945	10	0.06494	T	0.89	-22.1923	15.635	0.76944	0.0:0.0:0.0:1.0	.	761;736;761	B2RB94;E9PF36;P49754	.;.;VPS41_HUMAN	E	761;736	ENSP00000309457:K761E;ENSP00000379297:K736E	ENSP00000309457:K761E	K	-	1	0	VPS41	38734895	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.358000	0.79466	2.165000	0.68154	0.533000	0.62120	AAG	VPS41	-	pirsf_VPS41	ENSG00000006715		0.393	VPS41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS41	HGNC	protein_coding	OTTHUMT00000226986.3	218	0.00	0	T			38768370	38768370	-1	no_errors	ENST00000310301	ensembl	human	known	69_37n	missense	182	12.50	26	SNP	1.000	C
WDR72	256764	genome.wustl.edu	37	15	53908085	53908085	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr15:53908085T>G	ENST00000396328.1	-	15	2557	c.2318A>C	c.(2317-2319)aAg>aCg	p.K773T	WDR72_ENST00000360509.5_Missense_Mutation_p.K773T|WDR72_ENST00000559418.1_Missense_Mutation_p.K783T|WDR72_ENST00000557913.1_Missense_Mutation_p.K770T	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	773										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		TTTGGAGATCTTCATTTTCTT	0.413																																						dbGAP											0													167.0	158.0	161.0					15																	53908085		2194	4293	6487	-	-	-	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.2318A>C	15.37:g.53908085T>G	ENSP00000379619:p.Lys773Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.K773T	ENST00000396328.1	37	c.2318	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	T	19.40	3.820921	0.71028	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.39056	1.1;1.1	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.50343	0.1610	L	0.36672	1.1	0.41683	D	0.989306	D	0.69078	0.997	P	0.59643	0.861	T	0.45804	-0.9236	10	0.37606	T	0.19	.	15.2791	0.73767	0.0:0.0:0.0:1.0	.	773	Q3MJ13	WDR72_HUMAN	T	773	ENSP00000379619:K773T;ENSP00000353699:K773T	ENSP00000353699:K773T	K	-	2	0	WDR72	51695377	1.000000	0.71417	0.998000	0.56505	0.911000	0.54048	3.268000	0.51585	2.210000	0.71456	0.460000	0.39030	AAG	WDR72	-	NULL	ENSG00000166415		0.413	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	165	0.00	0	T	NM_182758		53908085	53908085	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	missense	143	20.11	36	SNP	1.000	G
WDR72	256764	genome.wustl.edu	37	15	54015098	54015098	+	Missense_Mutation	SNP	G	G	A	rs200899249		TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr15:54015098G>A	ENST00000396328.1	-	3	400	c.161C>T	c.(160-162)gCg>gTg	p.A54V	WDR72_ENST00000360509.5_Missense_Mutation_p.A54V|WDR72_ENST00000559418.1_Missense_Mutation_p.A54V|WDR72_ENST00000557913.1_Missense_Mutation_p.A54V	NM_001277176.1|NM_182758.2	NP_001264105.1|NP_877435.3	Q3MJ13	WDR72_HUMAN	WD repeat domain 72	54										NS(1)|breast(1)|endometrium(4)|kidney(4)|large_intestine(18)|lung(29)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	71				all cancers(107;0.0511)		GAGTTCTTTCGCTGAAATCTG	0.353																																						dbGAP											0													90.0	87.0	88.0					15																	54015098		2194	4293	6487	-	-	-	SO:0001583	missense	0			BX537884	CCDS10151.1, CCDS73730.1	15q21.3	2013-01-09			ENSG00000166415	ENSG00000166415		"""WD repeat domain containing"""	26790	protein-coding gene	gene with protein product		613214					Standard	NM_182758		Approved	FLJ38736	uc002acj.2	Q3MJ13	OTTHUMG00000131939	ENST00000396328.1:c.161C>T	15.37:g.54015098G>A	ENSP00000379619:p.Ala54Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3I3|Q8N8X2	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A54V	ENST00000396328.1	37	c.161	CCDS10151.1	15	.	.	.	.	.	.	.	.	.	.	G	16.54	3.152146	0.57259	.	.	ENSG00000166415	ENST00000396328;ENST00000360509	T;T	0.01234	5.13;5.13	5.79	4.86	0.63082	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.075277	0.56097	D	0.000040	T	0.04588	0.0125	L	0.36672	1.1	0.35246	D	0.778234	D	0.71674	0.998	D	0.62955	0.909	T	0.46400	-0.9194	10	0.72032	D	0.01	.	15.8328	0.78769	0.0:0.1361:0.8639:0.0	.	54	Q3MJ13	WDR72_HUMAN	V	54	ENSP00000379619:A54V;ENSP00000353699:A54V	ENSP00000353699:A54V	A	-	2	0	WDR72	51802390	1.000000	0.71417	0.928000	0.36995	0.250000	0.25880	7.154000	0.77437	1.414000	0.47017	0.563000	0.77884	GCG	WDR72	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000166415		0.353	WDR72-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR72	HGNC	protein_coding	OTTHUMT00000254893.2	134	0.00	0	G	NM_182758		54015098	54015098	-1	no_errors	ENST00000360509	ensembl	human	known	69_37n	missense	114	17.39	24	SNP	0.998	A
XRN1	54464	genome.wustl.edu	37	3	142123820	142123820	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr3:142123820A>T	ENST00000264951.4	-	16	1929	c.1812T>A	c.(1810-1812)gaT>gaA	p.D604E	XRN1_ENST00000392981.2_Missense_Mutation_p.D604E|RNU6-1294P_ENST00000515995.1_RNA	NM_019001.3	NP_061874.3	Q8IZH2	XRN1_HUMAN	5'-3' exoribonuclease 1	604					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA metabolic process (GO:0016071)|nuclear mRNA surveillance (GO:0071028)|nuclear-transcribed mRNA catabolic process (GO:0000956)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)|rRNA catabolic process (GO:0016075)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|membrane (GO:0016020)	5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|endometrium(6)|kidney(12)|large_intestine(11)|liver(1)|lung(17)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	61						CTGTGTCTCTATCATACCAGC	0.408																																						dbGAP											0													166.0	147.0	154.0					3																	142123820		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY137776	CCDS3123.1, CCDS63801.1, CCDS75028.1	3q23	2008-02-05			ENSG00000114127	ENSG00000114127			30654	protein-coding gene	gene with protein product		607994				12515382	Standard	XM_005247544		Approved	SEP1	uc003eus.3	Q8IZH2	OTTHUMG00000159251	ENST00000264951.4:c.1812T>A	3.37:g.142123820A>T	ENSP00000264951:p.Asp604Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0S3|Q68D88|Q6AI24|Q6MZS8|Q86WS7|Q8N8U4|Q9UF39	Missense_Mutation	SNP	pfam_Put_53exo,pirsf_5_3_exoribonuclease_1	p.D604E	ENST00000264951.4	37	c.1812	CCDS3123.1	3	.	.	.	.	.	.	.	.	.	.	A	13.33	2.204465	0.38905	.	.	ENSG00000114127	ENST00000264951;ENST00000392981	T;T	0.34072	1.38;1.38	5.53	-4.77	0.03219	.	0.106709	0.64402	D	0.000009	T	0.25195	0.0612	L	0.40543	1.245	0.80722	D	1	B;B;B	0.23058	0.01;0.079;0.047	B;B;B	0.29176	0.019;0.099;0.046	T	0.02789	-1.1110	10	0.39692	T	0.17	-21.0736	10.9071	0.47086	0.3313:0.0:0.5657:0.103	.	465;604;604	B3KW17;Q8IZH2-2;Q8IZH2	.;.;XRN1_HUMAN	E	604	ENSP00000264951:D604E;ENSP00000376707:D604E	ENSP00000264951:D604E	D	-	3	2	XRN1	143606510	0.203000	0.23435	0.111000	0.21465	0.778000	0.44026	0.290000	0.18975	-0.594000	0.05836	-0.924000	0.02725	GAT	XRN1	-	pirsf_5_3_exoribonuclease_1	ENSG00000114127		0.408	XRN1-001	KNOWN	basic|CCDS	protein_coding	XRN1	HGNC	protein_coding	OTTHUMT00000354087.2	177	0.00	0	A	NM_019001		142123820	142123820	-1	no_errors	ENST00000264951	ensembl	human	known	69_37n	missense	167	39.71	110	SNP	0.002	T
ZNF202	7753	genome.wustl.edu	37	11	123596728	123596728	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr11:123596728T>A	ENST00000529691.1	-	7	2143	c.1924A>T	c.(1924-1926)Acc>Tcc	p.T642S	ZNF202_ENST00000336139.4_Missense_Mutation_p.T642S|ZNF202_ENST00000530393.1_Missense_Mutation_p.T642S			O95125	ZN202_HUMAN	zinc finger protein 202	642					lipid metabolic process (GO:0006629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;5.1e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.03)		TCTGAGTGGGTCCTCTGATGC	0.512																																						dbGAP											0													117.0	110.0	112.0					11																	123596728		2202	4299	6501	-	-	-	SO:0001583	missense	0			AF027219	CCDS8443.1	11q23.3	2013-01-09				ENSG00000166261		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12994	protein-coding gene	gene with protein product		603430				9790754	Standard	XM_005271659		Approved	ZKSCAN10, ZSCAN42	uc001pzd.1	O95125		ENST00000529691.1:c.1924A>T	11.37:g.123596728T>A	ENSP00000433881:p.Thr642Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B0LPH9|Q4JG21|Q9H1B9|Q9NSM4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.T642S	ENST00000529691.1	37	c.1924	CCDS8443.1	11	.	.	.	.	.	.	.	.	.	.	T	14.18	2.458200	0.43634	.	.	ENSG00000166261	ENST00000336139;ENST00000530393;ENST00000529691	T;T;T	0.30182	1.54;1.54;1.54	4.75	3.58	0.41010	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.267312	0.26757	N	0.022642	T	0.23210	0.0561	L	0.37750	1.13	0.22918	N	0.998567	B	0.10296	0.003	B	0.04013	0.001	T	0.18745	-1.0327	10	0.56958	D	0.05	-1.9031	8.8424	0.35151	0.0:0.0914:0.0:0.9086	.	642	O95125	ZN202_HUMAN	S	642	ENSP00000337724:T642S;ENSP00000432504:T642S;ENSP00000433881:T642S	ENSP00000337724:T642S	T	-	1	0	ZNF202	123101938	0.000000	0.05858	1.000000	0.80357	0.977000	0.68977	0.268000	0.18571	0.796000	0.33947	0.533000	0.62120	ACC	ZNF202	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000166261		0.512	ZNF202-003	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF202	HGNC	protein_coding	OTTHUMT00000387419.1	137	0.00	0	T	NM_003455		123596728	123596728	-1	no_errors	ENST00000336139	ensembl	human	known	69_37n	missense	196	16.53	39	SNP	1.000	A
ZNF786	136051	genome.wustl.edu	37	7	148769113	148769113	+	Silent	SNP	G	G	T			TCGA-C8-A12X-01A-11D-A10Y-09	TCGA-C8-A12X-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	f133a2e3-73a2-40b8-855f-e819e4d11630	8a015260-3f5f-4130-adb3-d15881d67e08	g.chr7:148769113G>T	ENST00000491431.1	-	4	815	c.751C>A	c.(751-753)Cgg>Agg	p.R251R	ZNF786_ENST00000316286.9_Silent_p.R165R|ZNF786_ENST00000451334.3_Silent_p.R214R	NM_152411.3	NP_689624.2	Q8N393	ZN786_HUMAN	zinc finger protein 786	251					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(2)	26	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00463)			CACAGCTTCCGGCGGAAGCTC	0.642																																						dbGAP											0													24.0	30.0	28.0					7																	148769113		2128	4247	6375	-	-	-	SO:0001819	synonymous_variant	0			AK095701, AL834510	CCDS47738.1	7q36.1	2013-01-08			ENSG00000197362	ENSG00000197362		"""Zinc fingers, C2H2-type"", ""-"""	21806	protein-coding gene	gene with protein product							Standard	NM_152411		Approved	DKFZp762I137	uc003wfh.2	Q8N393	OTTHUMG00000158975	ENST00000491431.1:c.751C>A	7.37:g.148769113G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A568|B4DMI1	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R251	ENST00000491431.1	37	c.751	CCDS47738.1	7																																																																																			ZNF786	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000197362		0.642	ZNF786-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF786	HGNC	protein_coding	OTTHUMT00000352751.1	34	0.00	0	G	NM_152411		148769113	148769113	-1	no_errors	ENST00000491431	ensembl	human	known	69_37n	silent	12	40.00	8	SNP	0.004	T
