#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ARSJ	79642	genome.wustl.edu	37	4	114823652	114823652	+	Silent	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr4:114823652G>A	ENST00000315366.7	-	2	2444	c.1578C>T	c.(1576-1578)ttC>ttT	p.F526F	ARSJ_ENST00000541197.1_Silent_p.F526F	NM_024590.3	NP_078866.3	Q5FYB0	ARSJ_HUMAN	arylsulfatase family, member J	526					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	21		Ovarian(17;0.0035)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00194)		CAGTTTTGTTGAACTGTGAGA	0.512																																						dbGAP											0													74.0	66.0	69.0					4																	114823652		1858	4101	5959	-	-	-	SO:0001819	synonymous_variant	0				CCDS43264.1	4q26	2013-02-14	2006-03-07		ENSG00000180801	ENSG00000180801		"""Arylsulfatase family"""	26286	protein-coding gene	gene with protein product		610010	"""arylsulfatase J"""			12975309, 16174644	Standard	NM_024590		Approved	FLJ23548	uc003ibq.1	Q5FYB0	OTTHUMG00000161067	ENST00000315366.7:c.1578C>T	4.37:g.114823652G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUG0|B7ZM45|Q1HA39|Q5FWE4|Q6UWT9	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.F526	ENST00000315366.7	37	c.1578	CCDS43264.1	4																																																																																			ARSJ	-	superfamily_Alkaline_phosphatase_core	ENSG00000180801		0.512	ARSJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSJ	HGNC	protein_coding	OTTHUMT00000363650.1	155	0.00	0	G	NM_024590		114823652	114823652	-1	no_errors	ENST00000315366	ensembl	human	known	69_37n	silent	125	12.59	18	SNP	1.000	A
ATP11A	23250	genome.wustl.edu	37	13	113485824	113485824	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr13:113485824A>G	ENST00000487903.1	+	13	1445	c.1357A>G	c.(1357-1359)Atc>Gtc	p.I453V	ATP11A_ENST00000283558.8_Missense_Mutation_p.I453V|ATP11A_ENST00000375645.3_Missense_Mutation_p.I453V|ATP11A_ENST00000375630.2_Missense_Mutation_p.I453V			P98196	AT11A_HUMAN	ATPase, class VI, type 11A	453					phospholipid translocation (GO:0045332)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(12)|lung(17)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	51	all_lung(23;0.000374)|Lung NSC(43;0.0107)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)	all_lung(25;0.134)|all_epithelial(44;0.141)				GTCGTCAGGAATCGACATGAT	0.597																																						dbGAP											0													147.0	104.0	119.0					13																	113485824		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028944	CCDS32011.1	13q34	2010-04-20	2007-09-19		ENSG00000068650	ENSG00000068650	3.6.3.1	"""ATPases / P-type"""	13552	protein-coding gene	gene with protein product	"""potential phospholipid-transporting ATPase IH"", ""phospholipid-translocating ATPase"""	605868	"""ATPase, Class VI, type 11A"""			11015572	Standard	NM_032189		Approved	ATPIH, ATPIS, KIAA1021	uc001vsj.4	P98196	OTTHUMG00000017371	ENST00000487903.1:c.1357A>G	13.37:g.113485824A>G	ENSP00000420387:p.Ile453Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXT2	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.I453V	ENST00000487903.1	37	c.1357	CCDS32011.1	13	.	.	.	.	.	.	.	.	.	.	A	8.815	0.936179	0.18206	.	.	ENSG00000068650	ENST00000487903;ENST00000375630;ENST00000375645;ENST00000283558	D;D;D;D	0.81908	-1.55;-1.55;-1.55;-1.55	5.45	5.45	0.79879	ATPase, cation-transporting, domain N (1);HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.170468	0.64402	D	0.000018	T	0.72558	0.3475	N	0.16602	0.42	0.53688	D	0.999979	B;B;B	0.26363	0.0;0.001;0.147	B;B;B	0.33454	0.004;0.006;0.164	T	0.67665	-0.5612	10	0.10636	T	0.68	.	15.5186	0.75846	1.0:0.0:0.0:0.0	.	453;453;453	E9PCW5;E9PEJ6;P98196	.;.;AT11A_HUMAN	V	453	ENSP00000420387:I453V;ENSP00000364781:I453V;ENSP00000364796:I453V;ENSP00000283558:I453V	ENSP00000283558:I453V	I	+	1	0	ATP11A	112533825	1.000000	0.71417	0.990000	0.47175	0.152000	0.21847	8.184000	0.89702	2.077000	0.62373	0.459000	0.35465	ATC	ATP11A	-	superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000068650		0.597	ATP11A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATP11A	HGNC	protein_coding	OTTHUMT00000045834.3	78	0.00	0	A	NM_015205		113485824	113485824	+1	no_errors	ENST00000375630	ensembl	human	known	69_37n	missense	40	10.87	5	SNP	1.000	G
BACE2	25825	genome.wustl.edu	37	21	42617984	42617984	+	Silent	SNP	A	A	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr21:42617984A>G	ENST00000330333.6	+	6	1441	c.978A>G	c.(976-978)gcA>gcG	p.A326A	BACE2_ENST00000347667.5_Silent_p.A326A|BACE2_ENST00000466122.1_3'UTR|BACE2_ENST00000328735.6_Silent_p.A326A	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2	326					membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				TGGCCCGCGCATCTCTGGTGA	0.587																																						dbGAP											0													49.0	37.0	41.0					21																	42617984		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.978A>G	21.37:g.42617984A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	Silent	SNP	pfam_Peptidase_A1,superfamily_Peptidase_aspartic,prints_Pept_A1_BACE,prints_Pept_A1_BACE2,prints_Peptidase_A1,prints_Pept_A1_BACE1	p.A326	ENST00000330333.6	37	c.978	CCDS13668.1	21																																																																																			BACE2	-	pfam_Peptidase_A1,superfamily_Peptidase_aspartic,prints_Pept_A1_BACE2	ENSG00000182240		0.587	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BACE2	HGNC	protein_coding	OTTHUMT00000195056.1	47	0.00	0	A			42617984	42617984	+1	no_errors	ENST00000330333	ensembl	human	known	69_37n	silent	32	11.11	4	SNP	0.822	G
BCORL1	63035	genome.wustl.edu	37	X	129149801	129149801	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chrX:129149801C>T	ENST00000218147.7	+	4	3250	c.3053C>T	c.(3052-3054)cCc>cTc	p.P1018L	BCORL1_ENST00000303743.5_Missense_Mutation_p.P1018L|BCORL1_ENST00000540052.1_Missense_Mutation_p.P1018L|BCORL1_ENST00000359304.2_Missense_Mutation_p.P1018L			Q5H9F3	BCORL_HUMAN	BCL6 corepressor-like 1	1018					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|liver(3)|lung(30)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	75						GACAGCCACCCCAAGGAACTT	0.597																																						dbGAP											0													79.0	76.0	77.0					X																	129149801		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136450	CCDS14616.1	Xq25-q26.1	2014-09-17	2010-06-10		ENSG00000085185	ENSG00000085185		"""Ankyrin repeat domain containing"""	25657	protein-coding gene	gene with protein product		300688	"""chromosome X open reading frame 10"", ""BCL6 co-repressor-like 1"""	CXorf10			Standard	NM_021946		Approved	FLJ11362	uc022cdu.1	Q5H9F3	OTTHUMG00000022379	ENST00000218147.7:c.3053C>T	X.37:g.129149801C>T	ENSP00000218147:p.Pro1018Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ8|Q5H9F2|Q5H9F4|Q6ZVE0|Q8TEN3|Q9Y528	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.P1018L	ENST00000218147.7	37	c.3053	CCDS14616.1	X	.	.	.	.	.	.	.	.	.	.	C	6.617	0.482194	0.12581	.	.	ENSG00000085185	ENST00000218147;ENST00000303743;ENST00000359304;ENST00000540052;ENST00000456822	T;T;T;T;T	0.39229	1.1;1.45;1.09;1.1;1.51	5.17	4.1	0.47936	.	0.316644	0.19132	N	0.121917	T	0.21186	0.0510	N	0.14661	0.345	0.28584	N	0.909984	B;B	0.29136	0.234;0.005	B;B	0.28465	0.09;0.003	T	0.06232	-1.0838	10	0.25751	T	0.34	-6.5825	4.1324	0.10156	0.1297:0.457:0.3146:0.0987	.	1018;1018	Q5H9F3-2;Q5H9F3	.;BCORL_HUMAN	L	1018;1018;1018;1018;618	ENSP00000218147:P1018L;ENSP00000307541:P1018L;ENSP00000352253:P1018L;ENSP00000437775:P1018L;ENSP00000399483:P618L	ENSP00000218147:P1018L	P	+	2	0	BCORL1	128977482	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	1.378000	0.34328	2.147000	0.66899	0.529000	0.55759	CCC	BCORL1	-	NULL	ENSG00000085185		0.597	BCORL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCORL1	HGNC	protein_coding	OTTHUMT00000058223.1	98	0.00	0	C	NM_021946		129149801	129149801	+1	no_errors	ENST00000303743	ensembl	human	known	69_37n	missense	62	11.43	8	SNP	0.995	T
BPTF	2186	genome.wustl.edu	37	17	65914927	65914927	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:65914927C>A	ENST00000321892.4	+	14	5840	c.5779C>A	c.(5779-5781)Cct>Act	p.P1927T	BPTF_ENST00000306378.6_Missense_Mutation_p.P1801T|BPTF_ENST00000335221.5_Missense_Mutation_p.P1927T|BPTF_ENST00000424123.3_Missense_Mutation_p.P1788T			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1927					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GGCCAAGGCTCCTCCAGGAGG	0.493																																						dbGAP											0													130.0	125.0	127.0					17																	65914927		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5779C>A	17.37:g.65914927C>A	ENSP00000315454:p.Pro1927Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.P1927T	ENST00000321892.4	37	c.5779		17	.	.	.	.	.	.	.	.	.	.	C	17.06	3.292453	0.59976	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.11930	2.73;2.73;2.73	5.53	5.53	0.82687	.	.	.	.	.	T	0.31295	0.0792	L	0.44542	1.39	0.53005	D	0.999969	D;D	0.89917	0.988;1.0	P;D	0.87578	0.908;0.998	T	0.00692	-1.1607	9	0.27082	T	0.32	-9.1826	19.5221	0.95189	0.0:1.0:0.0:0.0	.	1801;1927	Q12830-2;Q12830-4	.;.	T	1801;1927;1927	ENSP00000307208:P1801T;ENSP00000334351:P1927T;ENSP00000315454:P1927T	ENSP00000307208:P1801T	P	+	1	0	BPTF	63345389	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.610000	0.61155	2.610000	0.88304	0.650000	0.86243	CCT	BPTF	-	NULL	ENSG00000171634		0.493	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		162	0.00	0	C	NM_182641, NM_004459		65914927	65914927	+1	no_errors	ENST00000321892	ensembl	human	known	69_37n	missense	88	35.51	49	SNP	1.000	A
ERICH3	127254	genome.wustl.edu	37	1	75038620	75038620	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr1:75038620G>A	ENST00000326665.5	-	14	2992	c.2774C>T	c.(2773-2775)gCa>gTa	p.A925V	C1orf173_ENST00000433746.2_5'UTR	NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		925	Glu-rich.									NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CGATGTCGCTGCCTCTCTCAG	0.552																																						dbGAP											0													156.0	157.0	157.0					1																	75038620		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000326665.5:c.2774C>T	1.37:g.75038620G>A	ENSP00000322609:p.Ala925Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Missense_Mutation	SNP	NULL	p.A925V	ENST00000326665.5	37	c.2774	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	12.91	2.078082	0.36662	.	.	ENSG00000178965	ENST00000326665	T	0.14893	2.47	5.1	-1.38	0.09027	.	.	.	.	.	T	0.02533	0.0077	L	0.29908	0.895	0.09310	N	1	B	0.24721	0.11	B	0.21151	0.033	T	0.44817	-0.9303	9	0.24483	T	0.36	-0.2794	1.0827	0.01646	0.2815:0.1181:0.3721:0.2282	.	925	Q5RHP9	CA173_HUMAN	V	925	ENSP00000322609:A925V	ENSP00000322609:A925V	A	-	2	0	C1orf173	74811208	0.003000	0.15002	0.000000	0.03702	0.019000	0.09904	0.649000	0.24843	0.142000	0.18901	0.563000	0.77884	GCA	C1orf173	-	NULL	ENSG00000178965		0.552	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	251	0.00	0	G			75038620	75038620	-1	no_errors	ENST00000326665	ensembl	human	known	69_37n	missense	160	10.61	19	SNP	0.000	A
CFAP61	26074	genome.wustl.edu	37	20	20269280	20269280	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr20:20269280G>T	ENST00000245957.5	+	23	2900	c.2824G>T	c.(2824-2826)Gtg>Ttg	p.V942L	C20orf26_ENST00000377309.2_Intron	NM_015585.3	NP_056400.3	Q8NHU2	CT026_HUMAN		942										NS(2)|breast(3)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(42)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	77				READ - Rectum adenocarcinoma(2;0.171)		TGAGAAGAATGTGGATTATGA	0.393																																						dbGAP											0													196.0	188.0	191.0					20																	20269280		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000245957.5:c.2824G>T	20.37:g.20269280G>T	ENSP00000245957:p.Val942Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHA1|Q5JXV4|Q5TE18|Q8N5R9|Q96M59|Q9BQL2|Q9H127|Q9H128|Q9NQH4|Q9UFV8|Q9Y4V7	Missense_Mutation	SNP	superfamily_Acyl_CoA_acyltransferase	p.V942L	ENST00000245957.5	37	c.2824	CCDS33447.1	20	.	.	.	.	.	.	.	.	.	.	G	22.1	4.241576	0.79912	.	.	ENSG00000089101	ENST00000343997;ENST00000389655;ENST00000245957	T	0.11930	2.73	5.6	5.6	0.85130	.	0.065343	0.64402	D	0.000011	T	0.19967	0.0480	M	0.75777	2.31	0.80722	D	1	P	0.45474	0.859	B	0.38458	0.274	T	0.02411	-1.1163	10	0.56958	D	0.05	.	16.5992	0.84807	0.0:0.1299:0.8701:0.0	.	942	Q8NHU2	CT026_HUMAN	L	882;908;942	ENSP00000245957:V942L	ENSP00000245957:V942L	V	+	1	0	C20orf26	20217280	1.000000	0.71417	0.987000	0.45799	0.877000	0.50540	5.382000	0.66213	2.652000	0.90054	0.650000	0.86243	GTG	C20orf26	-	NULL	ENSG00000089101		0.393	C20orf26-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf26	HGNC	protein_coding	OTTHUMT00000078228.3	91	0.00	0	G			20269280	20269280	+1	no_errors	ENST00000245957	ensembl	human	known	69_37n	missense	87	15.53	16	SNP	0.997	T
CDH17	1015	genome.wustl.edu	37	8	95172379	95172379	+	Silent	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr8:95172379C>G	ENST00000027335.3	-	12	1495	c.1371G>C	c.(1369-1371)ctG>ctC	p.L457L	CDH17_ENST00000441892.2_Silent_p.L243L|CDH17_ENST00000450165.2_Silent_p.L457L	NM_004063.3	NP_004054.3	Q12864	CAD17_HUMAN	cadherin 17, LI cadherin (liver-intestine)	457	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|oligopeptide transmembrane transport (GO:0035672)|oligopeptide transport (GO:0006857)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|proton-dependent oligopeptide secondary active transmembrane transporter activity (GO:0005427)|transporter activity (GO:0005215)			NS(1)|endometrium(5)|kidney(3)|large_intestine(10)|lung(18)|ovary(6)|prostate(3)|skin(4)|stomach(2)	52	Breast(36;4.65e-06)		BRCA - Breast invasive adenocarcinoma(8;0.00691)			CAGCAAGAGTCAGGTTTCCAT	0.418																																						dbGAP											0													91.0	89.0	90.0					8																	95172379		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X83228	CCDS6260.1	8q22.1	2010-01-26			ENSG00000079112	ENSG00000079112		"""Cadherins / Major cadherins"""	1756	protein-coding gene	gene with protein product		603017				9615235, 10191097	Standard	NM_004063		Approved	HPT-1, cadherin	uc003ygh.2	Q12864	OTTHUMG00000164391	ENST00000027335.3:c.1371G>C	8.37:g.95172379C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15336|Q2M2E0	Missense_Mutation	SNP	superfamily_Cadherin-like,pfscan_Cadherin	p.D19H	ENST00000027335.3	37	c.55	CCDS6260.1	8																																																																																			CDH17	-	superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000079112		0.418	CDH17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH17	HGNC	protein_coding	OTTHUMT00000378560.1	197	0.00	0	C	NM_004063		95172379	95172379	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000520952	ensembl	human	known	69_37n	missense	175	24.24	56	SNP	0.976	G
CHI3L1	1116	genome.wustl.edu	37	1	203151921	203151921	+	Silent	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr1:203151921G>A	ENST00000255409.3	-	6	650	c.525C>T	c.(523-525)agC>agT	p.S175S		NM_001276.2	NP_001267.2	P36222	CH3L1_HUMAN	chitinase 3-like 1 (cartilage glycoprotein-39)	175					activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cellular response to tumor necrosis factor (GO:0071356)|chitin catabolic process (GO:0006032)|inflammatory response (GO:0006954)|interleukin-8 secretion (GO:0072606)|lung development (GO:0030324)|positive regulation of angiogenesis (GO:0045766)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase B signaling (GO:0051897)|response to interleukin-1 (GO:0070555)|response to interleukin-6 (GO:0070741)|response to mechanical stimulus (GO:0009612)|response to tumor necrosis factor (GO:0034612)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|chitin binding (GO:0008061)|extracellular matrix structural constituent (GO:0005201)|hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(3)|ovary(1)|pancreas(1)|skin(1)	18						ACAGTGCTGCGCTGAGCAGGA	0.552																																						dbGAP											0													99.0	88.0	92.0					1																	203151921		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC008568	CCDS1435.1	1q32.1	2008-02-05			ENSG00000133048	ENSG00000133048			1932	protein-coding gene	gene with protein product		601525				8245017, 9244440	Standard	NM_001276		Approved	GP39, YKL40	uc001gzi.2	P36222	OTTHUMG00000042122	ENST00000255409.3:c.525C>T	1.37:g.203151921G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7B0|P30923|Q8IVA4|Q96HI7	Missense_Mutation	SNP	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	p.R5C	ENST00000255409.3	37	c.13	CCDS1435.1	1	.	.	.	.	.	.	.	.	.	.	g	0.509	-0.867498	0.02590	.	.	ENSG00000133048	ENST00000404436	.	.	.	5.51	-8.37	0.00976	.	.	.	.	.	T	0.64853	0.2636	.	.	.	0.54753	D	0.999984	.	.	.	.	.	.	T	0.71955	-0.4436	4	.	.	.	-27.8497	18.1982	0.89830	0.7025:0.0:0.2975:0.0	.	.	.	.	C	5	.	.	R	-	1	0	CHI3L1	201418544	0.033000	0.19621	0.023000	0.16930	0.079000	0.17450	-0.915000	0.04033	-2.143000	0.00803	-2.299000	0.00261	CGC	CHI3L1	-	pfam_Glyco_hydro18cat,superfamily_Glycoside_hydrolase_SF,smart_Chitinase_II	ENSG00000133048		0.552	CHI3L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHI3L1	HGNC	protein_coding	OTTHUMT00000100265.1	108	0.00	0	G	NM_001276		203151921	203151921	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000404436	ensembl	human	known	69_37n	missense	90	18.92	21	SNP	0.385	A
COL1A1	1277	genome.wustl.edu	37	17	48263242	48263242	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:48263242C>T	ENST00000225964.5	-	50	4263	c.4145G>A	c.(4144-4146)gGc>gAc	p.G1382D		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1382	Fibrillar collagen NC1. {ECO:0000255|PROSITE-ProRule:PRU00793}.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CTTGAGGTTGCCAGTCTGCTG	0.617			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															dbGAP		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0													105.0	81.0	89.0					17																	48263242		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.4145G>A	17.37:g.48263242C>T	ENSP00000225964:p.Gly1382Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G1382D	ENST00000225964.5	37	c.4145	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	16.56	3.157959	0.57368	.	.	ENSG00000108821	ENST00000225964	T	0.73681	-0.77	4.07	4.07	0.47477	Fibrillar collagen, C-terminal (4);	0.000000	0.85682	D	0.000000	D	0.86518	0.5952	M	0.83774	2.66	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.89083	0.3477	10	0.87932	D	0	.	15.1789	0.72938	0.0:1.0:0.0:0.0	.	1382	P02452	CO1A1_HUMAN	D	1382	ENSP00000225964:G1382D	ENSP00000225964:G1382D	G	-	2	0	COL1A1	45618241	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.559000	0.82265	2.094000	0.63399	0.313000	0.20887	GGC	COL1A1	-	pfam_Fib_collagen_C,smart_Fib_collagen_C	ENSG00000108821		0.617	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	112	0.00	0	C			48263242	48263242	-1	no_errors	ENST00000225964	ensembl	human	known	69_37n	missense	202	15.06	36	SNP	1.000	T
COL1A1	1277	genome.wustl.edu	37	17	48264447	48264447	+	Missense_Mutation	SNP	C	C	G	rs72656322		TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:48264447C>G	ENST00000225964.5	-	47	3578	c.3460G>C	c.(3460-3462)Gga>Cga	p.G1154R		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	1154	Triple-helical region.		G -> R (in OI2). {ECO:0000269|PubMed:2777764}.		blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CCGTTGAGTCCATCTTTGCCA	0.617			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															dbGAP		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0			GRCh37	CM890034	COL1A1	M	rs72656322						34.0	37.0	36.0					17																	48264447		2203	4299	6502	-	-	-	SO:0001583	missense	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.3460G>C	17.37:g.48264447C>G	ENSP00000225964:p.Gly1154Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.G1154R	ENST00000225964.5	37	c.3460	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	17.28	3.348362	0.61183	.	.	ENSG00000108821	ENST00000225964	D	0.99353	-5.77	3.7	3.7	0.42460	.	0.000000	0.85682	D	0.000000	D	0.99560	0.9842	H	0.95611	3.695	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.97718	1.0195	10	0.87932	D	0	.	14.7392	0.69440	0.0:1.0:0.0:0.0	.	1154	P02452	CO1A1_HUMAN	R	1154	ENSP00000225964:G1154R	ENSP00000225964:G1154R	G	-	1	0	COL1A1	45619446	1.000000	0.71417	0.998000	0.56505	0.946000	0.59487	7.562000	0.82300	2.051000	0.60960	0.462000	0.41574	GGA	COL1A1	-	pfam_Collagen	ENSG00000108821		0.617	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	47	0.00	0	C			48264447	48264447	-1	no_errors	ENST00000225964	ensembl	human	known	69_37n	missense	97	21.77	27	SNP	1.000	G
COL1A1	1277	genome.wustl.edu	37	17	48266586	48266586	+	Silent	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:48266586C>T	ENST00000225964.5	-	40	2998	c.2880G>A	c.(2878-2880)gtG>gtA	p.V960V		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	960	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	GCAGGCCGACCACACCACGCT	0.632			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															dbGAP		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0													39.0	42.0	41.0					17																	48266586		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2880G>A	17.37:g.48266586C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Silent	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.V960	ENST00000225964.5	37	c.2880	CCDS11561.1	17																																																																																			COL1A1	-	NULL	ENSG00000108821		0.632	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	57	0.00	0	C			48266586	48266586	-1	no_errors	ENST00000225964	ensembl	human	known	69_37n	silent	134	14.65	23	SNP	1.000	T
COL1A1	1277	genome.wustl.edu	37	17	48267243	48267243	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:48267243C>T	ENST00000225964.5	-	37	2708	c.2590G>A	c.(2590-2592)Gct>Act	p.A864T		NM_000088.3	NP_000079	P02452	CO1A1_HUMAN	collagen, type I, alpha 1	864	Triple-helical region.				blood coagulation (GO:0007596)|blood vessel development (GO:0001568)|bone trabecula formation (GO:0060346)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|cellular response to amino acid stimulus (GO:0071230)|cellular response to mechanical stimulus (GO:0071260)|cellular response to retinoic acid (GO:0071300)|cellular response to transforming growth factor beta stimulus (GO:0071560)|collagen biosynthetic process (GO:0032964)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|embryonic skeletal system development (GO:0048706)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|face morphogenesis (GO:0060325)|intramembranous ossification (GO:0001957)|leukocyte migration (GO:0050900)|negative regulation of cell-substrate adhesion (GO:0010812)|osteoblast differentiation (GO:0001649)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell migration (GO:0030335)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|protein heterotrimerization (GO:0070208)|protein localization to nucleus (GO:0034504)|protein transport (GO:0015031)|response to cAMP (GO:0051591)|response to corticosteroid (GO:0031960)|response to estradiol (GO:0032355)|response to hydrogen peroxide (GO:0042542)|response to nutrient (GO:0007584)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|skin morphogenesis (GO:0043589)|tooth mineralization (GO:0034505)|visual perception (GO:0007601)	collagen type I trimer (GO:0005584)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	extracellular matrix structural constituent (GO:0005201)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|platelet-derived growth factor binding (GO:0048407)		COL1A1/PDGFB(429)	NS(1)|breast(3)|central_nervous_system(8)|endometrium(3)|kidney(4)|large_intestine(17)|liver(3)|lung(18)|ovary(1)|pancreas(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	71					Collagenase(DB00048)	CTGCCGCGAGCACCTTTGGCT	0.662			T	"""PDGFB, USP6"""	"""dermatofibrosarcoma protuberans, aneurysmal bone cyst """		Osteogenesis imperfecta																															dbGAP		Dom	yes		17	17q21.31-q22	1277	"""collagen, type I, alpha 1"""	yes	M	0													31.0	31.0	31.0					17																	48267243		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z74615	CCDS11561.1	17q21.33	2014-09-17			ENSG00000108821	ENSG00000108821		"""Collagens"""	2197	protein-coding gene	gene with protein product		120150				3178743, 2857713	Standard	NM_000088		Approved	OI4	uc002iqm.3	P02452	OTTHUMG00000148674	ENST00000225964.5:c.2590G>A	17.37:g.48267243C>T	ENSP00000225964:p.Ala864Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O76045|P78441|Q13896|Q13902|Q13903|Q14037|Q14992|Q15176|Q15201|Q16050|Q59F64|Q7KZ30|Q7KZ34|Q8IVI5|Q8N473|Q9UML6|Q9UMM7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_VWF_C,superfamily_Fibrinogen_a/b/g_C,smart_VWF_C,smart_Fib_collagen_C,pfscan_VWF_C	p.A864T	ENST00000225964.5	37	c.2590	CCDS11561.1	17	.	.	.	.	.	.	.	.	.	.	C	16.75	3.210382	0.58343	.	.	ENSG00000108821	ENST00000225964	D	0.93547	-3.24	5.41	3.39	0.38822	.	0.213578	0.38111	N	0.001820	D	0.87091	0.6091	N	0.20610	0.595	0.49130	D	0.999757	B	0.27013	0.166	B	0.31869	0.137	T	0.81254	-0.1016	10	0.41790	T	0.15	.	9.6892	0.40118	0.2814:0.5824:0.1362:0.0	.	864	P02452	CO1A1_HUMAN	T	864	ENSP00000225964:A864T	ENSP00000225964:A864T	A	-	1	0	COL1A1	45622242	1.000000	0.71417	1.000000	0.80357	0.759000	0.43091	1.669000	0.37492	0.645000	0.30675	0.313000	0.20887	GCT	COL1A1	-	pfam_Collagen	ENSG00000108821		0.662	COL1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL1A1	HGNC	protein_coding	OTTHUMT00000309036.2	42	0.00	0	C			48267243	48267243	-1	no_errors	ENST00000225964	ensembl	human	known	69_37n	missense	71	17.44	15	SNP	1.000	T
COL8A1	1295	genome.wustl.edu	37	3	99513747	99513747	+	Silent	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr3:99513747G>A	ENST00000261037.3	+	5	1382	c.1002G>A	c.(1000-1002)ggG>ggA	p.G334G	COL8A1_ENST00000273342.4_Silent_p.G334G	NM_001850.4	NP_001841.2	P27658	CO8A1_HUMAN	collagen, type VIII, alpha 1	334	Triple-helical region (COL1).				angiogenesis (GO:0001525)|camera-type eye morphogenesis (GO:0048593)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epithelial cell proliferation (GO:0050673)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	collagen type VIII trimer (GO:0005591)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)				breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(15)|skin(5)|upper_aerodigestive_tract(1)	27						GTGGCAAAGGGGAGCAAGGAC	0.627																																						dbGAP											0													28.0	33.0	31.0					3																	99513747		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AF170702	CCDS2934.1	3q11.1-q13.2	2013-01-16			ENSG00000144810	ENSG00000144810		"""Collagens"""	2215	protein-coding gene	gene with protein product		120251	"""chromosome 3 open reading frame 7"""	C3orf7		2029894	Standard	NM_001850		Approved	MGC9568	uc003dth.2	P27658	OTTHUMG00000148669	ENST00000261037.3:c.1002G>A	3.37:g.99513747G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DN42|Q53XI6|Q96D07	Silent	SNP	pfam_Collagen,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,prints_C1q	p.G334	ENST00000261037.3	37	c.1002	CCDS2934.1	3																																																																																			COL8A1	-	NULL	ENSG00000144810		0.627	COL8A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL8A1	HGNC	protein_coding	OTTHUMT00000309001.1	38	0.00	0	G	NM_001850		99513747	99513747	+1	no_errors	ENST00000261037	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.994	A
CPEB2	132864	genome.wustl.edu	37	4	15060048	15060048	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr4:15060048A>G	ENST00000507071.1	+	8	1217	c.1130A>G	c.(1129-1131)tAt>tGt	p.Y377C	CPEB2_ENST00000382401.3_Missense_Mutation_p.Y350C|CPEB2_ENST00000541112.1_Missense_Mutation_p.Y814C|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000345451.3_Missense_Mutation_p.Y347C|CPEB2_ENST00000259997.5_Missense_Mutation_p.Y385C|CPEB2_ENST00000538197.1_Missense_Mutation_p.Y822C|RP11-665G4.1_ENST00000513384.1_RNA|CPEB2_ENST00000442003.2_Missense_Mutation_p.Y795C|CPEB2_ENST00000382395.3_Missense_Mutation_p.Y355C			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2	377	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						ATTCCAGGCTATGCATTTCTT	0.348																																						dbGAP											0													130.0	130.0	130.0					4																	15060048		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669	ENST00000507071.1:c.1130A>G	4.37:g.15060048A>G	ENSP00000424084:p.Tyr377Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Y822C	ENST00000507071.1	37	c.2465		4	.	.	.	.	.	.	.	.	.	.	A	21.4	4.140167	0.77775	.	.	ENSG00000137449	ENST00000538197;ENST00000541112;ENST00000442003;ENST00000507071;ENST00000345451;ENST00000382395;ENST00000382401;ENST00000259997;ENST00000382391;ENST00000509684	T;T;T;T;T;T;T;T;T	0.08008	3.14;3.14;3.14;3.14;3.14;3.14;3.14;3.14;3.14	5.63	5.63	0.86233	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.29389	0.0732	M	0.71296	2.17	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.91635	0.997;0.999;0.997;0.998;0.999;0.999	T	0.01393	-1.1366	10	0.87932	D	0	-16.3888	15.8332	0.78773	1.0:0.0:0.0:0.0	.	350;355;795;822;347;377	Q7Z5Q1-4;Q7Z5Q1-6;E7EPM3;F5H160;Q7Z5Q1-5;Q7Z5Q1	.;.;.;.;.;CPEB2_HUMAN	C	822;814;795;377;347;355;350;385;364;30	ENSP00000443985:Y822C;ENSP00000437884:Y814C;ENSP00000414270:Y795C;ENSP00000424084:Y377C;ENSP00000334058:Y347C;ENSP00000371832:Y355C;ENSP00000371838:Y350C;ENSP00000259997:Y385C;ENSP00000423890:Y30C	ENSP00000259997:Y385C	Y	+	2	0	CPEB2	14669146	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	9.339000	0.96797	2.145000	0.66743	0.528000	0.53228	TAT	CPEB2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	ENSG00000137449		0.348	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	218	0.00	0	A	XM_059607		15060048	15060048	+1	no_errors	ENST00000538197	ensembl	human	known	69_37n	missense	268	10.03	30	SNP	1.000	G
CR1	1378	genome.wustl.edu	37	1	207697209	207697209	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr1:207697209A>G	ENST00000367049.4	+	5	741	c.741A>G	c.(739-741)atA>atG	p.I247M	CR1_ENST00000367052.1_Missense_Mutation_p.I247M|CR1_ENST00000367053.1_Missense_Mutation_p.I247M|CR1_ENST00000367050.4_3'UTR|CR1_ENST00000400960.2_Missense_Mutation_p.I247M|CR1_ENST00000367051.1_Intron	NM_000651.4	NP_000642.3	P17927	CR1_HUMAN	complement component (3b/4b) receptor 1 (Knops blood group)	247	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.				complement activation, classical pathway (GO:0006958)|complement receptor mediated signaling pathway (GO:0002430)|innate immune response (GO:0045087)|negative regulation of complement activation, alternative pathway (GO:0045957)|negative regulation of complement activation, classical pathway (GO:0045959)|negative regulation of serine-type endopeptidase activity (GO:1900004)|positive regulation of serine-type endopeptidase activity (GO:1900005)|regulation of complement activation (GO:0030449)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	complement component C3b binding (GO:0001851)|complement component C3b receptor activity (GO:0004877)|complement component C4b binding (GO:0001855)|complement component C4b receptor activity (GO:0001861)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(9)|kidney(11)|large_intestine(13)|lung(33)|ovary(3)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						AAAATGGAATATTGGTATCTG	0.488																																						dbGAP											0													11.0	13.0	13.0					1																	207697209		1602	3596	5198	-	-	-	SO:0001583	missense	0			Y00816	CCDS44308.1, CCDS44309.1	1q32	2014-07-19	2006-01-12		ENSG00000203710	ENSG00000203710		"""CD molecules"", ""Blood group antigens"", ""Complement system"""	2334	protein-coding gene	gene with protein product		120620	"""complement component (3b/4b) receptor 1, including Knops blood group system"""			1708809	Standard	XM_005273064		Approved	CD35, KN	uc001hfx.3	P17927	OTTHUMG00000036311	ENST00000367049.4:c.741A>G	1.37:g.207697209A>G	ENSP00000356016:p.Ile247Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16744|Q16745|Q5SR43|Q5SR45|Q9UQV2	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.I247M	ENST00000367049.4	37	c.741	CCDS44308.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	10.94|10.94	1.493016|1.493016	0.26774|0.26774	.|.	.|.	ENSG00000203710|ENSG00000203710	ENST00000367052;ENST00000367053;ENST00000400960;ENST00000534202;ENST00000367049|ENST00000529814	T;T;T;T;T|.	0.50277|.	0.75;0.75;0.75;0.75;0.75|.	4.02|4.02	-8.04|-8.04	0.01110|0.01110	Complement control module (2);Sushi/SCR/CCP (3);|.	.|.	.|.	.|.	.|.	T|T	0.41050|0.41050	0.1142|0.1142	L|L	0.43757|0.43757	1.38|1.38	0.09310|0.09310	N|N	1|1	P;P;B;P;P|.	0.52316|.	0.903;0.736;0.346;0.903;0.952|.	P;P;B;P;P|.	0.53062|.	0.669;0.566;0.202;0.669;0.717|.	T|T	0.45366|0.45366	-0.9266|-0.9266	9|5	0.34782|.	T|.	0.22|.	.|.	13.8298|13.8298	0.63373|0.63373	0.1594:0.759:0.0816:0.0|0.1594:0.759:0.0816:0.0	.|.	697;247;222;247;247|.	Q5SR44;E9PQN4;Q5SR42;P17927;E9PDY4|.	.;.;.;CR1_HUMAN;.|.	M|C	247|223	ENSP00000356019:I247M;ENSP00000356020:I247M;ENSP00000383744:I247M;ENSP00000436139:I247M;ENSP00000356016:I247M|.	ENSP00000356016:I247M|.	I|Y	+|+	3|2	3|0	CR1|CR1	205763832|205763832	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.049000|0.049000	0.14656|0.14656	-1.280000|-1.280000	0.02804|0.02804	-2.297000|-2.297000	0.00661|0.00661	-0.644000|-0.644000	0.03951|0.03951	ATA|TAT	CR1	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000203710		0.488	CR1-012	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1	HGNC	protein_coding	OTTHUMT00000382527.1	93	0.00	0	A	NM_000573		207697209	207697209	+1	no_errors	ENST00000367049	ensembl	human	known	69_37n	missense	81	16.49	16	SNP	0.000	G
DIDO1	11083	genome.wustl.edu	37	20	61523338	61523338	+	Splice_Site	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr20:61523338C>G	ENST00000266070.4	-	14	3671		c.e14+1		DIDO1_ENST00000395340.1_Splice_Site|DIDO1_ENST00000395335.2_Splice_Site|DIDO1_ENST00000395343.1_Splice_Site	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1						apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					TAAGCAGGTACCTTAGACACA	0.378																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)	dbGAP											0													101.0	87.0	92.0					20																	61523338		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.3345+1G>C	20.37:g.61523338C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Splice_Site	SNP	-	e12+1	ENST00000266070.4	37	c.3345+1	CCDS33506.1	20	.	.	.	.	.	.	.	.	.	.	C	22.8	4.335218	0.81801	.	.	ENSG00000101191	ENST00000266070;ENST00000395343;ENST00000395340;ENST00000395335	.	.	.	5.23	5.23	0.72850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.8025	0.92023	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DIDO1	60993783	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	7.449000	0.80643	2.443000	0.82685	0.591000	0.81541	.	DIDO1	-	-	ENSG00000101191		0.378	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	107	0.00	0	C	NM_080796	Intron	61523338	61523338	-1	no_errors	ENST00000266070	ensembl	human	known	69_37n	splice_site	87	11.22	11	SNP	1.000	G
DNTT	1791	genome.wustl.edu	37	10	98078170	98078170	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr10:98078170C>G	ENST00000371174.2	+	2	367	c.265C>G	c.(265-267)Caa>Gaa	p.Q89E	DNTT_ENST00000419175.1_Missense_Mutation_p.Q89E			P04053	TDT_HUMAN	DNA nucleotidylexotransferase	89	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA modification (GO:0006304)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA nucleotidylexotransferase activity (GO:0003912)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	27		Colorectal(252;0.0815)|all_hematologic(284;0.224)		Epithelial(162;7.97e-08)|all cancers(201;1.89e-06)		GGAGTGGCTTCAAGCACAGAA	0.483																																						dbGAP											0													173.0	165.0	168.0					10																	98078170		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB046378	CCDS7447.1	10q23-q24	2013-05-21	2013-05-21		ENSG00000107447	ENSG00000107447	2.7.7.31	"""DNA polymerases"""	2983	protein-coding gene	gene with protein product	"""Terminal deoxynucleotidyltransferase"""	187410	"""deoxynucleotidyltransferase, terminal"""				Standard	NM_004088		Approved	TDT	uc001kmf.3	P04053	OTTHUMG00000018832	ENST00000371174.2:c.265C>G	10.37:g.98078170C>G	ENSP00000360216:p.Gln89Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53FH1|Q5W103|Q96E50	Missense_Mutation	SNP	pfam_DNA_pol_lambd_fingers_domain,pfam_BRCT_dom,pfam_Nucleotidyltransferase,superfamily_DNA-dir_DNA_pol_X_beta-like_N,superfamily_DNA_pol_lambd_fingers_domain,superfamily_BRCT_dom,smart_BRCT_dom,smart_DNA-dir_DNA_pol_X,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom,prints_DNA_nucleotidylexotransferase,prints_DNA_pol_X,prints_DNA_pol_X_beta-like	p.Q89E	ENST00000371174.2	37	c.265	CCDS7447.1	10	.	.	.	.	.	.	.	.	.	.	C	1.139	-0.650107	0.03506	.	.	ENSG00000107447	ENST00000419175;ENST00000371174	T;T	0.39229	1.09;1.09	5.62	2.54	0.30619	BRCT (4);	0.291638	0.37219	N	0.002198	T	0.30103	0.0754	L	0.49350	1.555	0.24621	N	0.993673	B;B	0.06786	0.0;0.001	B;B	0.15052	0.007;0.012	T	0.23904	-1.0175	10	0.06891	T	0.86	-13.6125	9.2743	0.37690	0.2891:0.5822:0.1287:0.0	.	89;89	P04053-2;P04053	.;TDT_HUMAN	E	89	ENSP00000401169:Q89E;ENSP00000360216:Q89E	ENSP00000360216:Q89E	Q	+	1	0	DNTT	98068160	0.133000	0.22466	0.963000	0.40424	0.529000	0.34654	0.562000	0.23531	1.359000	0.45940	0.563000	0.77884	CAA	DNTT	-	pfam_BRCT_dom,superfamily_BRCT_dom,smart_BRCT_dom,pirsf_DNA_nucleotidylexotransferase,pfscan_BRCT_dom	ENSG00000107447		0.483	DNTT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DNTT	HGNC	protein_coding	OTTHUMT00000049607.1	121	0.00	0	C	NM_004088		98078170	98078170	+1	no_errors	ENST00000371174	ensembl	human	known	69_37n	missense	94	17.54	20	SNP	0.401	G
EARS2	124454	genome.wustl.edu	37	16	23546520	23546520	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr16:23546520T>C	ENST00000563459.1	-	4	653	c.647A>G	c.(646-648)gAc>gGc	p.D216G	EARS2_ENST00000564987.1_5'UTR|EARS2_ENST00000564501.1_Missense_Mutation_p.D216G|EARS2_ENST00000449606.1_Missense_Mutation_p.D216G|EARS2_ENST00000563232.1_Missense_Mutation_p.D216G			Q5JPH6	SYEM_HUMAN	glutamyl-tRNA synthetase 2, mitochondrial	216					gene expression (GO:0010467)|glutamyl-tRNA aminoacylation (GO:0006424)|tRNA aminoacylation for mitochondrial protein translation (GO:0070127)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|glutamate-tRNA ligase activity (GO:0004818)|glutamate-tRNA(Gln) ligase activity (GO:0050561)|tRNA binding (GO:0000049)			central_nervous_system(1)|endometrium(1)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	8				GBM - Glioblastoma multiforme(48;0.0353)		GATGACTGGGTCTCCCTCCAC	0.632																																						dbGAP											0													44.0	48.0	47.0					16																	23546520		2120	4232	6352	-	-	-	SO:0001583	missense	0			AB075850	CCDS42132.1	16p12.2	2014-05-06	2012-10-26		ENSG00000103356	ENSG00000103356	6.1.1.17	"""Aminoacyl tRNA synthetases / Class I"""	29419	protein-coding gene	gene with protein product	"""glutamate tRNA ligase 2, mitochondrial"""	612799	"""glutamyl-tRNA synthetase 2, mitochondrial (putative)"""			15779907, 19805282, 22492562	Standard	NM_001083614		Approved	KIAA1970, MSE1	uc002dlt.4	Q5JPH6	OTTHUMG00000177018	ENST00000563459.1:c.647A>G	16.37:g.23546520T>C	ENSP00000456467:p.Asp216Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTT2|D3DWF1|Q86YH3|Q8TF31	Missense_Mutation	SNP	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,superfamily_aa-tRNA-synth_I_codon-bd,prints_Glu/Gln-tRNA-synth_Ib,tigrfam_Glu-tRNA-synth_Ib_bac/mito	p.D216G	ENST00000563459.1	37	c.647	CCDS42132.1	16	.	.	.	.	.	.	.	.	.	.	T	28.2	4.902985	0.92035	.	.	ENSG00000103356	ENST00000449606;ENST00000341597	T	0.30981	1.51	5.56	5.56	0.83823	Glutamyl/glutaminyl-tRNA synthetase, class Ib, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.73908	0.3647	H	0.99705	4.715	0.80722	D	1	P;D	0.61697	0.827;0.99	P;D	0.69654	0.498;0.965	D	0.86224	0.1633	10	0.87932	D	0	-4.184	14.8938	0.70627	0.0:0.0:0.0:1.0	.	216;216	Q86YH3;Q5JPH6	.;SYEM_HUMAN	G	216	ENSP00000395196:D216G	ENSP00000343488:D216G	D	-	2	0	EARS2	23454021	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.659000	0.83766	2.123000	0.65237	0.533000	0.62120	GAC	EARS2	-	pfam_Glu/Gln-tRNA-synth_Ib_cat-dom,tigrfam_Glu-tRNA-synth_Ib_bac/mito	ENSG00000103356		0.632	EARS2-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	EARS2	HGNC	protein_coding	OTTHUMT00000434844.1	46	0.00	0	T	NM_133451		23546520	23546520	-1	no_errors	ENST00000341597	ensembl	human	known	69_37n	missense	44	15.09	8	SNP	1.000	C
ENPP3	5169	genome.wustl.edu	37	6	132014640	132014640	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr6:132014640C>G	ENST00000414305.1	+	16	1616	c.1288C>G	c.(1288-1290)Cga>Gga	p.R430G	ENPP3_ENST00000357639.3_Missense_Mutation_p.R430G|ENPP3_ENST00000358229.5_Missense_Mutation_p.R430G			O14638	ENPP3_HUMAN	ectonucleotide pyrophosphatase/phosphodiesterase 3	430	Phosphodiesterase.				immune response (GO:0006955)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleoside triphosphate catabolic process (GO:0009143)|phosphate-containing compound metabolic process (GO:0006796)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|perinuclear region of cytoplasm (GO:0048471)	metal ion binding (GO:0046872)|NADH pyrophosphatase activity (GO:0035529)|nucleic acid binding (GO:0003676)|nucleoside-triphosphate diphosphatase activity (GO:0047429)|nucleotide diphosphatase activity (GO:0004551)|phosphodiesterase I activity (GO:0004528)|polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)	p.R430*(1)		NS(1)|breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(24)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	53	Breast(56;0.0753)			GBM - Glioblastoma multiforme(226;0.0252)|OV - Ovarian serous cystadenocarcinoma(155;0.0511)		TTTTCAGTGCCGAAAACCTGA	0.338																																						dbGAP											1	Substitution - Nonsense(1)	kidney(1)											126.0	116.0	119.0					6																	132014640		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF005632	CCDS5148.1	6q22	2010-06-23			ENSG00000154269	ENSG00000154269	3.1.4.1, 3.6.1.9	"""CD molecules"""	3358	protein-coding gene	gene with protein product		602182		PDNP3		9344668	Standard	NM_005021		Approved	PD-IBETA, gp130RB13-6, B10, CD203c	uc003qcv.3	O14638	OTTHUMG00000016292	ENST00000414305.1:c.1288C>G	6.37:g.132014640C>G	ENSP00000406261:p.Arg430Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTL3	Missense_Mutation	SNP	pfam_Phosphodiest/P_Trfase,pfam_Somatomedin_B_dom,pfam_DNA/RNA_non-sp_Endonuclease,superfamily_Alkaline_phosphatase_core,smart_Somatomedin_B_dom,smart_DNA/RNA_non-sp_Endonuclease,smart_Extracellular_endonuc_su_A,pfscan_Somatomedin_B_dom	p.R430G	ENST00000414305.1	37	c.1288	CCDS5148.1	6	.	.	.	.	.	.	.	.	.	.	C	13.82	2.351841	0.41700	.	.	ENSG00000154269	ENST00000414305;ENST00000357639;ENST00000358229	T;T;T	0.72167	-0.63;-0.63;-0.63	5.92	4.04	0.47022	Alkaline-phosphatase-like, core domain (1);	0.323129	0.24590	N	0.037226	T	0.67683	0.2919	L	0.46567	1.45	0.80722	D	1	P	0.38992	0.653	P	0.52481	0.7	T	0.73372	-0.4003	10	0.87932	D	0	-1.0105	13.1591	0.59535	0.4127:0.5873:0.0:0.0	.	430	O14638	ENPP3_HUMAN	G	430	ENSP00000406261:R430G;ENSP00000350265:R430G;ENSP00000350964:R430G	ENSP00000350265:R430G	R	+	1	2	ENPP3	132056333	0.274000	0.24191	0.927000	0.36925	0.289000	0.27227	0.849000	0.27723	1.435000	0.47434	0.650000	0.86243	CGA	ENPP3	-	pfam_Phosphodiest/P_Trfase,superfamily_Alkaline_phosphatase_core	ENSG00000154269		0.338	ENPP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENPP3	HGNC	protein_coding	OTTHUMT00000043627.2	188	0.00	0	C			132014640	132014640	+1	no_errors	ENST00000357639	ensembl	human	known	69_37n	missense	197	17.84	43	SNP	0.916	G
ERCC1	2067	genome.wustl.edu	37	19	45924518	45924518	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr19:45924518G>C	ENST00000300853.3	-	3	830	c.239C>G	c.(238-240)tCa>tGa	p.S80*	ERCC1_ENST00000423698.2_Intron|ERCC1_ENST00000013807.5_Nonsense_Mutation_p.S80*|ERCC1_ENST00000589165.1_Nonsense_Mutation_p.S80*|ERCC1_ENST00000340192.7_Nonsense_Mutation_p.S80*|ERCC1_ENST00000591636.1_Nonsense_Mutation_p.S80*	NM_001983.3	NP_001974.1	P07992	ERCC1_HUMAN	excision repair cross-complementation group 1	80					cell proliferation (GO:0008283)|chromosome organization (GO:0051276)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|interstrand cross-link repair (GO:0036297)|isotype switching (GO:0045190)|male gonad development (GO:0008584)|mitotic recombination (GO:0006312)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|negative regulation of telomere maintenance (GO:0032205)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|nucleotide-excision repair, DNA incision, 3'-to lesion (GO:0006295)|nucleotide-excision repair, DNA incision, 5'-to lesion (GO:0006296)|oogenesis (GO:0048477)|post-embryonic hemopoiesis (GO:0035166)|pyrimidine dimer repair by nucleotide-excision repair (GO:0000720)|replicative cell aging (GO:0001302)|response to nutrient (GO:0007584)|response to oxidative stress (GO:0006979)|response to sucrose (GO:0009744)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)|syncytium formation (GO:0006949)|transcription-coupled nucleotide-excision repair (GO:0006283)|UV protection (GO:0009650)	cytoplasm (GO:0005737)|nuclear chromosome, telomeric region (GO:0000784)|nucleoplasm (GO:0005654)|nucleotide-excision repair complex (GO:0000109)|nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|single-stranded DNA binding (GO:0003697)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(2)|ovary(2)|skin(1)	15		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.0247)		CAGGGGCTCTGACCCTGTGGG	0.657								Nucleotide excision repair (NER)																														dbGAP											0													88.0	80.0	82.0					19																	45924518		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0				CCDS12662.1, CCDS12663.1, CCDS54279.1	19q13.32	2014-03-07	2014-03-07			ENSG00000012061			3433	protein-coding gene	gene with protein product		126380	"""excision repair cross-complementing rodent repair deficiency, complementation group 1 (includes overlapping antisense sequence)"""			6462228	Standard	NM_001983		Approved	RAD10	uc002pbs.2	P07992		ENST00000300853.3:c.239C>G	19.37:g.45924518G>C	ENSP00000300853:p.Ser80*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC01|B3KRR0|Q7Z7F5|Q96S40	Nonsense_Mutation	SNP	pfam_DNA_repair_Rad10,superfamily_Restrct_endonuc-II-like,superfamily_RuvA_2-like,tigrfam_DNA_repair_Rad10	p.S80*	ENST00000300853.3	37	c.239	CCDS12662.1	19	.	.	.	.	.	.	.	.	.	.	G	34	5.314829	0.95655	.	.	ENSG00000012061	ENST00000300853;ENST00000340192;ENST00000013807	.	.	.	4.87	2.64	0.31445	.	1.351290	0.04886	N	0.448604	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	0.2619	6.8579	0.24050	0.0982:0.1754:0.7264:0.0	.	.	.	.	X	80	.	ENSP00000013807:S80X	S	-	2	0	ERCC1	50616358	0.434000	0.25570	0.014000	0.15608	0.469000	0.32828	1.683000	0.37638	1.059000	0.40554	0.491000	0.48974	TCA	ERCC1	-	NULL	ENSG00000012061		0.657	ERCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC1	HGNC	protein_coding	OTTHUMT00000459542.1	112	0.00	0	G	NM_001983		45924518	45924518	-1	no_errors	ENST00000013807	ensembl	human	known	69_37n	nonsense	69	10.39	8	SNP	0.004	C
FLG2	388698	genome.wustl.edu	37	1	152324739	152324739	+	Silent	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr1:152324739G>A	ENST00000388718.5	-	3	5595	c.5523C>T	c.(5521-5523)gaC>gaT	p.D1841D	FLG-AS1_ENST00000445097.1_RNA|FLG-AS1_ENST00000392688.2_RNA	NM_001014342.2	NP_001014364.1	Q5D862	FILA2_HUMAN	filaggrin family member 2	1841					establishment of skin barrier (GO:0061436)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			NS(2)|breast(7)|cervix(3)|endometrium(11)|kidney(9)|large_intestine(24)|liver(1)|lung(85)|ovary(12)|pancreas(1)|prostate(6)|skin(17)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	188	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CATGTCTCTCGTCAACTATGG	0.502																																						dbGAP											0													311.0	273.0	286.0					1																	152324739		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY827490	CCDS30861.1	1q21.3	2013-01-10			ENSG00000143520	ENSG00000143520		"""EF-hand domain containing"""	33276	protein-coding gene	gene with protein product						12477932	Standard	NM_001014342		Approved	IFPS	uc001ezw.4	Q5D862	OTTHUMG00000012245	ENST00000388718.5:c.5523C>T	1.37:g.152324739G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H4U1	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.D1841	ENST00000388718.5	37	c.5523	CCDS30861.1	1																																																																																			FLG2	-	NULL	ENSG00000143520		0.502	FLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG2	HGNC	protein_coding	OTTHUMT00000034018.5	675	0.15	1	G	NM_001014342		152324739	152324739	-1	no_errors	ENST00000388718	ensembl	human	known	69_37n	silent	469	23.50	145	SNP	0.000	A
GARS	2617	genome.wustl.edu	37	7	30649281	30649281	+	Silent	SNP	A	A	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr7:30649281A>G	ENST00000389266.3	+	7	1057	c.816A>G	c.(814-816)ctA>ctG	p.L272L		NM_002047.2	NP_002038.2	P41250	SYG_HUMAN	glycyl-tRNA synthetase	272					cell death (GO:0008219)|diadenosine tetraphosphate biosynthetic process (GO:0015966)|gene expression (GO:0010467)|glycyl-tRNA aminoacylation (GO:0006426)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|secretory granule (GO:0030141)	ATP binding (GO:0005524)|glycine-tRNA ligase activity (GO:0004820)|protein dimerization activity (GO:0046983)			breast(3)|endometrium(2)|kidney(1)|large_intestine(4)|lung(9)|ovary(1)|skin(3)|urinary_tract(1)	24					Glycine(DB00145)	GAAATGATCTATCCCCTCCAG	0.353																																						dbGAP											0													115.0	112.0	113.0					7																	30649281		1830	4072	5902	-	-	-	SO:0001819	synonymous_variant	0			AK074524	CCDS43564.1	7p15	2014-09-17	2004-02-13		ENSG00000106105	ENSG00000106105	6.1.1.14	"""Aminoacyl tRNA synthetases / Class II"""	4162	protein-coding gene	gene with protein product	"""glycine tRNA ligase"""	600287	"""Charcot-Marie-Tooth neuropathy 2D"""	CMT2D		8595897, 8872480	Standard	NM_002047		Approved	GlyRS, DSMAV, SMAD1	uc003tbm.3	P41250	OTTHUMG00000152769	ENST00000389266.3:c.816A>G	7.37:g.30649281A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQA2|B4DIA0|Q969Y1	Silent	SNP	pfam_aa-tRNA-synt_IIb_cons-dom,pfam_Anticodon-bd,pfam_WHEP-TRS,superfamily_Anticodon-bd,superfamily_S15_NS1_RNA-bd,pfscan_aa-tRNA-synth_II,pfscan_WHEP-TRS,prints_tRNA-synt_gly,tigrfam_tRNA-synt_gly	p.L272	ENST00000389266.3	37	c.816	CCDS43564.1	7																																																																																			GARS	-	pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_tRNA-synt_gly	ENSG00000106105		0.353	GARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GARS	HGNC	protein_coding	OTTHUMT00000327735.1	150	0.00	0	A	NM_002047		30649281	30649281	+1	no_errors	ENST00000389266	ensembl	human	known	69_37n	silent	123	26.63	45	SNP	0.370	G
GAS6	2621	genome.wustl.edu	37	13	114535690	114535690	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr13:114535690C>G	ENST00000327773.6	-	9	1016	c.870G>C	c.(868-870)aaG>aaC	p.K290N	GAS6_ENST00000450766.1_Missense_Mutation_p.K17N|GAS6_ENST00000355761.4_Missense_Mutation_p.K236N|GAS6-AS1_ENST00000458001.1_RNA|GAS6_ENST00000357389.3_Missense_Mutation_p.K333N|GAS6_ENST00000418959.3_5'UTR	NM_000820.2	NP_000811.1	Q14393	GAS6_HUMAN	growth arrest-specific 6	333					activation of protein kinase B activity (GO:0032148)|apoptotic cell clearance (GO:0043277)|B cell chemotaxis (GO:0035754)|blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell-substrate adhesion (GO:0031589)|cellular protein metabolic process (GO:0044267)|cellular response to drug (GO:0035690)|cellular response to glucose stimulus (GO:0071333)|cellular response to growth factor stimulus (GO:0071363)|cellular response to interferon-alpha (GO:0035457)|cellular response to starvation (GO:0009267)|cellular response to vitamin K (GO:0071307)|dendritic cell differentiation (GO:0097028)|enzyme linked receptor protein signaling pathway (GO:0007167)|extracellular matrix assembly (GO:0085029)|fusion of virus membrane with host plasma membrane (GO:0019064)|hematopoietic stem cell migration to bone marrow (GO:0097241)|leukocyte migration (GO:0050900)|macrophage cytokine production (GO:0010934)|negative regulation of apoptotic process (GO:0043066)|negative regulation of biomineral tissue development (GO:0070168)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of dendritic cell apoptotic process (GO:2000669)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of interferon-gamma production (GO:0032689)|negative regulation of interleukin-1 secretion (GO:0050711)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of interleukin-6 secretion (GO:1900165)|negative regulation of oligodendrocyte apoptotic process (GO:1900142)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of renal albumin absorption (GO:2000533)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor production (GO:0032720)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|neuron migration (GO:0001764)|organ regeneration (GO:0031100)|peptidyl-glutamic acid carboxylation (GO:0017187)|peptidyl-serine phosphorylation (GO:0018105)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of cytokine-mediated signaling pathway (GO:0001961)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of gene expression (GO:0010628)|positive regulation of glomerular filtration (GO:0003104)|positive regulation of natural killer cell differentiation (GO:0032825)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of phagocytosis (GO:0050766)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of TOR signaling (GO:0032008)|post-translational protein modification (GO:0043687)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|protein targeting to plasma membrane (GO:0072661)|proteolysis (GO:0006508)|receptor-mediated virion attachment to host cell (GO:0046813)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)|viral entry into host cell (GO:0046718)|viral genome replication (GO:0019079)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|platelet alpha granule lumen (GO:0031093)	binding, bridging (GO:0060090)|calcium ion binding (GO:0005509)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|phosphatidylserine binding (GO:0001786)|protein tyrosine kinase activator activity (GO:0030296)|receptor agonist activity (GO:0048018)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|voltage-gated calcium channel activity (GO:0005245)			central_nervous_system(4)|ovary(1)	5	Lung NSC(43;0.00976)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0176)|all_epithelial(44;0.0104)|all_lung(25;0.0249)|Lung NSC(25;0.0908)|Breast(118;0.188)				ACTTCACACTCTTGGCCACGC	0.657																																						dbGAP											0													153.0	100.0	118.0					13																	114535690		2202	4294	6496	-	-	-	SO:0001583	missense	0				CCDS45072.1	13q34	2008-07-18			ENSG00000183087	ENSG00000183087			4168	protein-coding gene	gene with protein product	"""AXL stimulatory factor"""	600441		AXLLG		8336730	Standard	NM_000820		Approved	AXSF, FLJ34709, DKFZp666G247	uc001vud.3	Q14393	OTTHUMG00000017395	ENST00000327773.6:c.870G>C	13.37:g.114535690C>G	ENSP00000331831:p.Lys290Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRQ7|B3KVL4|E9PBL7|Q6IMN1|Q7Z7N3	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF-like_Ca-bd,pfam_GLA_domain,superfamily_ConA-like_lec_gl,superfamily_GLA_domain,smart_GLA_domain,smart_EGF-like_Ca-bd,smart_EGF-like,smart_Laminin_G,pfscan_EG-like_dom,pfscan_GLA_domain,pfscan_Laminin_G,prints_GLA_domain	p.K333N	ENST00000327773.6	37	c.999	CCDS45072.1	13	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504712	0.64410	.	.	ENSG00000183087	ENST00000357389;ENST00000355761;ENST00000450766;ENST00000327773	T;T;T;T	0.79352	-1.26;-1.26;-1.26;-1.26	4.75	1.19	0.21007	.	.	.	.	.	T	0.72120	0.3421	L	0.43923	1.385	0.80722	D	1	D;D	0.56035	0.959;0.974	P;P	0.51777	0.529;0.679	T	0.65763	-0.6089	9	0.42905	T	0.14	-16.5452	3.7169	0.08441	0.1598:0.3285:0.0:0.5117	.	17;290	B3KVL4;Q14393-2	.;.	N	333;236;17;290	ENSP00000349962:K333N;ENSP00000348003:K236N;ENSP00000416498:K17N;ENSP00000331831:K290N	ENSP00000331831:K290N	K	-	3	2	GAS6	113578253	1.000000	0.71417	0.387000	0.26183	0.834000	0.47266	0.836000	0.27545	-0.027000	0.13873	0.462000	0.41574	AAG	GAS6	-	superfamily_ConA-like_lec_gl	ENSG00000183087		0.657	GAS6-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GAS6	HGNC	protein_coding	OTTHUMT00000045946.2	36	0.00	0	C	NM_000820		114535690	114535690	-1	no_errors	ENST00000357389	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.975	G
HTT	3064	genome.wustl.edu	37	4	3190715	3190715	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr4:3190715A>G	ENST00000355072.5	+	40	5408	c.5263A>G	c.(5263-5265)Att>Gtt	p.I1755V		NM_002111.6	NP_002102	P42858	HD_HUMAN	huntingtin	1755					anterior/posterior pattern specification (GO:0009952)|axon cargo transport (GO:0008088)|cell aging (GO:0007569)|citrulline metabolic process (GO:0000052)|determination of adult lifespan (GO:0008340)|dopamine receptor signaling pathway (GO:0007212)|endoplasmic reticulum organization (GO:0007029)|endosomal transport (GO:0016197)|ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|Golgi organization (GO:0007030)|grooming behavior (GO:0007625)|hormone metabolic process (GO:0042445)|insulin secretion (GO:0030073)|iron ion homeostasis (GO:0055072)|L-glutamate import (GO:0051938)|lactate biosynthetic process from pyruvate (GO:0019244)|locomotory behavior (GO:0007626)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of neuron apoptotic process (GO:0043524)|neural plate formation (GO:0021990)|neuron apoptotic process (GO:0051402)|neuron development (GO:0048666)|olfactory lobe development (GO:0021988)|organ development (GO:0048513)|paraxial mesoderm formation (GO:0048341)|positive regulation of inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0031587)|protein import into nucleus (GO:0006606)|quinolinate biosynthetic process (GO:0019805)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane potential (GO:0051881)|regulation of protein phosphatase type 2A activity (GO:0034047)|regulation of synaptic plasticity (GO:0048167)|response to calcium ion (GO:0051592)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|social behavior (GO:0035176)|spermatogenesis (GO:0007283)|striatum development (GO:0021756)|urea cycle (GO:0000050)|vesicle transport along microtubule (GO:0047496)|visual learning (GO:0008542)	autophagic vacuole (GO:0005776)|axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|protein complex (GO:0043234)	beta-tubulin binding (GO:0048487)|diazepam binding (GO:0050809)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|transcription factor binding (GO:0008134)			breast(1)|cervix(2)|endometrium(14)|kidney(5)|large_intestine(23)|lung(28)|ovary(4)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	87		all_epithelial(65;0.18)		UCEC - Uterine corpus endometrioid carcinoma (64;0.187)		TTTAGAAGACATTGTTACAAA	0.383																																						dbGAP											0													179.0	166.0	170.0					4																	3190715		1883	4112	5995	-	-	-	SO:0001583	missense	0			L12392	CCDS43206.1	4p16.3	2014-09-17	2007-12-04	2007-12-04	ENSG00000197386	ENSG00000197386		"""Endogenous ligands"""	4851	protein-coding gene	gene with protein product		613004	"""huntingtin (Huntington disease)"""	HD		8458085	Standard	NM_002111		Approved	IT15	uc021xkv.1	P42858	OTTHUMG00000159916	ENST00000355072.5:c.5263A>G	4.37:g.3190715A>G	ENSP00000347184:p.Ile1755Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UQB7	Missense_Mutation	SNP	pfam_Huntingtin_middle-repeat,pfam_HEAT,superfamily_ARM-type_fold,prints_Huntingtin	p.I1755V	ENST00000355072.5	37	c.5263	CCDS43206.1	4	.	.	.	.	.	.	.	.	.	.	A	18.08	3.543819	0.65198	.	.	ENSG00000197386	ENST00000355072	T	0.05786	3.39	5.29	4.12	0.48240	.	0.058374	0.64402	N	0.000002	T	0.16471	0.0396	L	0.50993	1.605	0.51233	D	0.999911	P	0.49961	0.93	D	0.63877	0.919	T	0.00373	-1.1781	10	0.48119	T	0.1	.	11.0127	0.47671	0.9267:0.0:0.0733:0.0	.	1755	P42858	HD_HUMAN	V	1755	ENSP00000347184:I1755V	ENSP00000347184:I1755V	I	+	1	0	HTT	3160513	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.110000	0.71535	0.961000	0.38030	0.533000	0.62120	ATT	HTT	-	NULL	ENSG00000197386		0.383	HTT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HTT	HGNC	protein_coding	OTTHUMT00000358234.2	252	0.00	0	A	NM_002111		3190715	3190715	+1	no_errors	ENST00000355072	ensembl	human	known	69_37n	missense	226	20.00	57	SNP	1.000	G
IARS	3376	genome.wustl.edu	37	9	95003139	95003139	+	Splice_Site	SNP	T	T	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr9:95003139T>A	ENST00000375643.3	-	30	3548	c.3282A>T	c.(3280-3282)caA>caT	p.Q1094H	IARS_ENST00000443024.2_Splice_Site_p.Q1094H|IARS_ENST00000474340.1_5'UTR|IARS_ENST00000375627.1_Splice_Site_p.Q147H|IARS_ENST00000447699.2_Splice_Site_p.Q984H|IARS_ENST00000375629.3_Splice_Site_p.Q147H	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	1094					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	TACTCTTACCTTGTTCACTGC	0.353																																						dbGAP											0													108.0	91.0	97.0					9																	95003139		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.3283+1A>T	9.37:g.95003139T>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,prints_Ile-tRNA-synt,tigrfam_Ile-tRNA-synt	p.Q1094H	ENST00000375643.3	37	c.3282	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	T	15.20	2.761637	0.49468	.	.	ENSG00000196305	ENST00000375643;ENST00000451588;ENST00000375629;ENST00000443024;ENST00000543028;ENST00000447699;ENST00000375660;ENST00000421189;ENST00000436450;ENST00000375627	T;T;T;T;T	0.58940	0.3;0.3;0.3;0.3;0.3	5.87	3.56	0.40772	.	0.151061	0.64402	D	0.000011	T	0.53465	0.1798	M	0.62723	1.935	0.46654	D	0.999145	B;B;B	0.20368	0.044;0.001;0.001	B;B;B	0.21917	0.037;0.002;0.003	T	0.51004	-0.8760	10	0.62326	D	0.03	-16.6958	9.9148	0.41427	0.0:0.1382:0.0:0.8618	.	604;1094;939	F5H1M4;P41252;Q6P0M4	.;SYIC_HUMAN;.	H	1094;111;147;1094;103;984;1094;103;111;147	ENSP00000364794:Q1094H;ENSP00000364780:Q147H;ENSP00000406448:Q1094H;ENSP00000415020:Q984H;ENSP00000364778:Q147H	ENSP00000364778:Q147H	Q	-	3	2	IARS	94042960	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	3.872000	0.56085	0.500000	0.27991	0.482000	0.46254	CAA	IARS	-	NULL	ENSG00000196305		0.353	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	131	0.00	0	T	NM_002161	Missense_Mutation	95003139	95003139	-1	no_errors	ENST00000375643	ensembl	human	known	69_37n	missense	147	16.48	29	SNP	1.000	A
IKBKAP	8518	genome.wustl.edu	37	9	111659236	111659236	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr9:111659236G>C	ENST00000374647.5	-	24	2891	c.2584C>G	c.(2584-2586)Caa>Gaa	p.Q862E	IKBKAP_ENST00000537196.1_Missense_Mutation_p.Q513E	NM_003640.3	NP_003631.2	O95163	ELP1_HUMAN	inhibitor of kappa light polypeptide gene enhancer in B-cells, kinase complex-associated protein	862					chromatin organization (GO:0006325)|immune response (GO:0006955)|positive regulation of cell migration (GO:0030335)|protein complex assembly (GO:0006461)|protein phosphorylation (GO:0006468)|regulation of protein kinase activity (GO:0045859)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription elongation from RNA polymerase II promoter (GO:0006368)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase II, holoenzyme (GO:0016591)|Elongator holoenzyme complex (GO:0033588)|nucleolus (GO:0005730)|transcription elongation factor complex (GO:0008023)	phosphorylase kinase regulator activity (GO:0008607)|signal transducer activity (GO:0004871)	p.Q862*(1)		NS(2)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(7)|large_intestine(4)|lung(13)|ovary(2)|pancreas(1)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	53						TCTCTACCTTGAAGCTCGTGT	0.443																																						dbGAP											1	Substitution - Nonsense(1)	kidney(1)											114.0	111.0	112.0					9																	111659236		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF044195	CCDS6773.1	9q31	2014-09-17	2003-12-02		ENSG00000070061	ENSG00000070061		"""Elongator acetyltransferase complex subunits"""	5959	protein-coding gene	gene with protein product	"""elongator acetyltransferase complex subunit 1"""	603722	"""dysautonomia (Riley-Day syndrome, hereditary sensory autonomic neuropathy type III)"""	DYS		9751059, 11179008	Standard	NM_003640		Approved	IKAP, TOT1, ELP1, IKI3	uc004bdm.4	O95163	OTTHUMG00000020465	ENST00000374647.5:c.2584C>G	9.37:g.111659236G>C	ENSP00000363779:p.Gln862Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JSV2|Q9H327|Q9UG87	Missense_Mutation	SNP	pfam_IKI3,superfamily_ARM-type_fold,superfamily_UBA-like,pirsf_IKI3	p.Q862E	ENST00000374647.5	37	c.2584	CCDS6773.1	9	.	.	.	.	.	.	.	.	.	.	G	14.57	2.575576	0.45902	.	.	ENSG00000070061	ENST00000374647;ENST00000537196	T;T	0.25912	1.77;1.77	5.59	5.59	0.84812	.	0.083020	0.64402	D	0.000018	T	0.22166	0.0534	L	0.37630	1.12	0.34841	D	0.74067	P	0.35124	0.485	B	0.37387	0.248	T	0.26360	-1.0105	10	0.26408	T	0.33	.	12.0846	0.53690	0.0:0.0:0.8282:0.1718	.	862	O95163	ELP1_HUMAN	E	862;513	ENSP00000363779:Q862E;ENSP00000439367:Q513E	ENSP00000363779:Q862E	Q	-	1	0	IKBKAP	110699057	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	3.719000	0.54926	2.625000	0.88918	0.467000	0.42956	CAA	IKBKAP	-	pfam_IKI3,pirsf_IKI3	ENSG00000070061		0.443	IKBKAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKBKAP	HGNC	protein_coding	OTTHUMT00000053574.1	177	0.00	0	G			111659236	111659236	-1	no_errors	ENST00000374647	ensembl	human	known	69_37n	missense	119	33.52	60	SNP	1.000	C
KRT32	3882	genome.wustl.edu	37	17	39623317	39623317	+	Silent	SNP	G	G	A	rs371994109		TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:39623317G>A	ENST00000225899.3	-	1	364	c.261C>T	c.(259-261)taC>taT	p.Y87Y	RNU2-32P_ENST00000411193.1_RNA	NM_002278.3	NP_002269.3	Q14532	K1H2_HUMAN	keratin 32	87	Head.				epidermis development (GO:0008544)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21		Breast(137;0.000812)				CCCCTTCGCTGTACCAGCTGC	0.617																																						dbGAP											0													64.0	65.0	65.0					17																	39623317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X90761	CCDS11393.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000108759	ENSG00000108759		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6449	protein-coding gene	gene with protein product	"""hard keratin type I"""	602760	"""keratin, hair, acidic, 2"""	KRTHA2		7556444, 8823373, 16831889	Standard	NM_002278		Approved	Ha-2	uc002hwr.3	Q14532	OTTHUMG00000133430	ENST00000225899.3:c.261C>T	17.37:g.39623317G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.Y87	ENST00000225899.3	37	c.261	CCDS11393.1	17																																																																																			KRT32	-	NULL	ENSG00000108759		0.617	KRT32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT32	HGNC	protein_coding	OTTHUMT00000257293.1	77	0.00	0	G	NM_002278		39623317	39623317	-1	no_errors	ENST00000225899	ensembl	human	known	69_37n	silent	42	12.50	6	SNP	0.000	A
LRRK2	120892	genome.wustl.edu	37	12	40687422	40687422	+	Nonsense_Mutation	SNP	T	T	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr12:40687422T>A	ENST00000298910.7	+	21	2823	c.2765T>A	c.(2764-2766)tTa>tAa	p.L922*	LRRK2_ENST00000343742.2_Nonsense_Mutation_p.L922*	NM_198578.3	NP_940980	Q5S007	LRRK2_HUMAN	leucine-rich repeat kinase 2	922					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|autophagy (GO:0006914)|cellular protein localization (GO:0034613)|cellular response to dopamine (GO:1903351)|cellular response to manganese ion (GO:0071287)|cellular response to oxidative stress (GO:0034599)|determination of adult lifespan (GO:0008340)|endocytosis (GO:0006897)|exploration behavior (GO:0035640)|GTP catabolic process (GO:0006184)|intracellular distribution of mitochondria (GO:0048312)|intracellular signal transduction (GO:0035556)|locomotory exploration behavior (GO:0035641)|MAPK cascade (GO:0000165)|negative regulation of GTPase activity (GO:0034260)|negative regulation of hydrogen peroxide-induced cell death (GO:1903206)|negative regulation of late endosome to lysosome transport (GO:1902823)|negative regulation of peroxidase activity (GO:2000469)|negative regulation of protein binding (GO:0032091)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein processing (GO:0010955)|negative regulation of protein processing involved in protein targeting to mitochondrion (GO:1903217)|negative regulation of protein targeting to mitochondrion (GO:1903215)|negative regulation of thioredoxin peroxidase activity by peptidyl-threonine phosphorylation (GO:1903125)|neuromuscular junction development (GO:0007528)|neuron death (GO:0070997)|neuron projection morphogenesis (GO:0048812)|olfactory bulb development (GO:0021772)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of autophagy (GO:0010508)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of GTPase activity (GO:0043547)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of programmed cell death (GO:0043068)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein autoubiquitination (GO:1902499)|positive regulation of protein binding (GO:0032092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reactive oxygen species metabolic process (GO:0072593)|regulation of branching morphogenesis of a nerve (GO:2000172)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of dopamine receptor signaling pathway (GO:0060159)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of kidney size (GO:0035564)|regulation of locomotion (GO:0040012)|regulation of membrane potential (GO:0042391)|regulation of mitochondrial depolarization (GO:0051900)|regulation of neuroblast proliferation (GO:1902692)|regulation of neuron death (GO:1901214)|regulation of neuron maturation (GO:0014041)|regulation of protein kinase A signaling (GO:0010738)|regulation of synaptic transmission, glutamatergic (GO:0051966)|regulation of synaptic vesicle exocytosis (GO:2000300)|regulation of synaptic vesicle transport (GO:1902803)|response to oxidative stress (GO:0006979)|small GTPase mediated signal transduction (GO:0007264)|tangential migration from the subventricular zone to the olfactory bulb (GO:0022028)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytoplasmic side of mitochondrial outer membrane (GO:0032473)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|dendrite cytoplasm (GO:0032839)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|inclusion body (GO:0016234)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial membrane (GO:0031966)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)|trans-Golgi network (GO:0005802)	actin binding (GO:0003779)|ATP binding (GO:0005524)|clathrin binding (GO:0030276)|glycoprotein binding (GO:0001948)|GTP binding (GO:0005525)|GTP-dependent protein kinase activity (GO:0034211)|GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|MAP kinase kinase activity (GO:0004708)|peroxidase inhibitor activity (GO:0036479)|protein homodimerization activity (GO:0042803)|protein kinase A binding (GO:0051018)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|Rho GTPase binding (GO:0017048)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|tubulin binding (GO:0015631)			NS(3)|biliary_tract(1)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(23)|large_intestine(31)|lung(55)|ovary(15)|pancreas(2)|prostate(4)|skin(4)|stomach(9)|upper_aerodigestive_tract(7)|urinary_tract(2)	181	all_cancers(12;0.00108)|Breast(8;0.218)	Lung NSC(34;0.0942)|all_lung(34;0.11)				GATGCCGTATTACAGCGTTGC	0.333																																						dbGAP											0													97.0	91.0	93.0					12																	40687422		2202	4300	6502	-	-	-	SO:0001587	stop_gained	0			AK026776	CCDS31774.1	12q12	2011-07-21			ENSG00000188906	ENSG00000188906		"""Parkinson disease"""	18618	protein-coding gene	gene with protein product		609007	"""Parkinson disease (autosomal dominant) 8"""	PARK8		15541308	Standard	NM_198578		Approved	ROCO2, DKFZp434H2111, FLJ45829, RIPK7	uc001rmg.4	Q5S007	OTTHUMG00000059742	ENST00000298910.7:c.2765T>A	12.37:g.40687422T>A	ENSP00000298910:p.Leu922*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJU2|Q6ZS50|Q8NCX9	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_MIRO-like,pfam_Small_GTPase,pfam_Leu-rich_rpt,pfam_Small_GTPase_ARF/SAR,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Small_GTPase_Rab_type,smart_Tyr_kinase_cat_dom,smart_Ser/Thr_dual-sp_kinase_dom,prints_Small_GTPase,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,tigrfam_Small_GTP-bd_dom	p.L922*	ENST00000298910.7	37	c.2765	CCDS31774.1	12	.	.	.	.	.	.	.	.	.	.	T	35	5.550316	0.96501	.	.	ENSG00000188906	ENST00000343742;ENST00000298910	.	.	.	5.03	5.03	0.67393	.	0.555436	0.17497	N	0.172127	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.9941	0.47565	0.0:0.0:0.1553:0.8447	.	.	.	.	X	922	.	ENSP00000298910:L922X	L	+	2	0	LRRK2	38973689	0.998000	0.40836	0.932000	0.37286	0.015000	0.08874	2.536000	0.45693	2.000000	0.58554	0.528000	0.53228	TTA	LRRK2	-	NULL	ENSG00000188906		0.333	LRRK2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRK2	HGNC	protein_coding	OTTHUMT00000277179.1	120	0.00	0	T	XM_058513		40687422	40687422	+1	no_errors	ENST00000298910	ensembl	human	known	69_37n	nonsense	110	15.38	20	SNP	0.605	A
MCC	4163	genome.wustl.edu	37	5	112420867	112420867	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr5:112420867G>C	ENST00000302475.4	-	7	1532	c.969C>G	c.(967-969)atC>atG	p.I323M	MCC_ENST00000514701.3_5'UTR|MCC_ENST00000515367.2_Missense_Mutation_p.I260M|MCC_ENST00000408903.3_Missense_Mutation_p.I513M	NM_002387.2	NP_002378	P23508	CRCM_HUMAN	mutated in colorectal cancers	323					negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			endometrium(4)|kidney(3)|large_intestine(15)|liver(2)|lung(8)|ovary(2)|pancreas(1)|prostate(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42		all_cancers(142;5.89e-08)|all_epithelial(76;3.57e-11)|all_lung(232;0.000605)|Lung NSC(810;0.000697)|Colorectal(10;0.00146)|Prostate(80;0.00174)|Ovarian(225;0.0175)|Breast(839;0.198)		OV - Ovarian serous cystadenocarcinoma(64;2.04e-54)|Epithelial(69;9.69e-49)|all cancers(49;6.25e-44)|COAD - Colon adenocarcinoma(37;0.0432)|Colorectal(14;0.0766)		TCACCTTGGCGATGGGAATGT	0.602																																						dbGAP											0													172.0	161.0	165.0					5																	112420867		2202	4300	6502	-	-	-	SO:0001583	missense	0				CCDS4111.1, CCDS43351.1	5q21-q22	2013-01-10			ENSG00000171444	ENSG00000171444		"""EF-hand domain containing"""	6935	protein-coding gene	gene with protein product		159350				1848370	Standard	NM_002387		Approved		uc003kql.4	P23508	OTTHUMG00000128804	ENST00000302475.4:c.969C>G	5.37:g.112420867G>C	ENSP00000305617:p.Ile323Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DT05|Q6ZR04	Missense_Mutation	SNP	pfam_USH1C-bd_PDZ_domain,superfamily_tRNA-bd_arm	p.I323M	ENST00000302475.4	37	c.969	CCDS4111.1	5	.	.	.	.	.	.	.	.	.	.	G	16.45	3.126947	0.56721	.	.	ENSG00000171444	ENST00000302475;ENST00000515367;ENST00000408903	T;T;T	0.40476	2.19;2.19;1.03	5.73	-2.79	0.05841	.	0.000000	0.85682	D	0.000000	T	0.42675	0.1213	N	0.24115	0.695	0.45046	D	0.998068	D;D;D;D	0.65815	0.992;0.992;0.995;0.992	D;D;D;D	0.76071	0.957;0.957;0.987;0.957	T	0.25710	-1.0124	10	0.52906	T	0.07	-26.3679	10.3282	0.43807	0.5189:0.0:0.3953:0.0859	.	323;285;513;323	B7Z6G0;B3KTX0;P23508-2;P23508	.;.;.;CRCM_HUMAN	M	323;260;513	ENSP00000305617:I323M;ENSP00000421615:I260M;ENSP00000386227:I513M	ENSP00000305617:I323M	I	-	3	3	MCC	112448766	0.794000	0.28838	0.940000	0.37924	0.877000	0.50540	-0.172000	0.09868	-0.705000	0.05035	-0.797000	0.03246	ATC	MCC	-	NULL	ENSG00000171444		0.602	MCC-001	KNOWN	basic|CCDS	protein_coding	MCC	HGNC	protein_coding	OTTHUMT00000250736.3	188	0.00	0	G	NM_001085377		112420867	112420867	-1	no_errors	ENST00000302475	ensembl	human	known	69_37n	missense	168	18.84	39	SNP	0.518	C
MTTP	4547	genome.wustl.edu	37	4	100530060	100530060	+	Silent	SNP	G	G	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr4:100530060G>T	ENST00000265517.5	+	12	1898	c.1695G>T	c.(1693-1695)ggG>ggT	p.G565G	MTTP_ENST00000457717.1_Silent_p.G565G|RP11-766F14.1_ENST00000508578.1_RNA|MTTP_ENST00000511045.1_Silent_p.G592G			P55157	MTP_HUMAN	microsomal triglyceride transfer protein	565	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				cholesterol homeostasis (GO:0042632)|lipid metabolic process (GO:0006629)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|protein lipidation (GO:0006497)|response to calcium ion (GO:0051592)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|endoplasmic reticulum lumen (GO:0005788)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|microvillus membrane (GO:0031528)|receptor complex (GO:0043235)|rough endoplasmic reticulum (GO:0005791)	lipid binding (GO:0008289)|lipid transporter activity (GO:0005319)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(14)|lung(19)|ovary(4)|prostate(5)|skin(1)|urinary_tract(1)	57				OV - Ovarian serous cystadenocarcinoma(123;6.04e-09)	Hesperetin(DB01094)|Lomitapide(DB08827)	TGTCTATTGGGGAGCTTCCCC	0.413																																						dbGAP											0													136.0	135.0	135.0					4																	100530060		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3651.1, CCDS75169.1	4q24	2008-02-05	2005-11-04	2005-11-04	ENSG00000138823	ENSG00000138823			7467	protein-coding gene	gene with protein product		157147	"""microsomal triglyceride transfer protein (large polypeptide, 88kD)"", ""microsomal triglyceride transfer protein (large polypeptide, 88kDa)"""	MTP		8111381	Standard	XM_005263025		Approved	ABL	uc003hvc.4	P55157	OTTHUMG00000131023	ENST00000265517.5:c.1695G>T	4.37:g.100530060G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K428|Q08AM4|Q6P5T3	Silent	SNP	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,superfamily_Lipid_transp_b-sht_shell,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.G565	ENST00000265517.5	37	c.1695	CCDS3651.1	4																																																																																			MTTP	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	ENSG00000138823		0.413	MTTP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTTP	HGNC	protein_coding	OTTHUMT00000253662.3	106	0.00	0	G			100530060	100530060	+1	no_errors	ENST00000265517	ensembl	human	known	69_37n	silent	122	12.86	18	SNP	0.995	T
MYH6	4624	genome.wustl.edu	37	14	23863422	23863422	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr14:23863422G>A	ENST00000356287.3	-	20	2569	c.2540C>T	c.(2539-2541)aCg>aTg	p.T847M	MYH6_ENST00000405093.3_Missense_Mutation_p.T847M			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	847					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		CTCCTTCTCCGTCTCTGCGCT	0.562																																						dbGAP											0													123.0	111.0	115.0					14																	23863422		2203	4300	6503	-	-	-	SO:0001583	missense	0			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.2540C>T	14.37:g.23863422G>A	ENSP00000348634:p.Thr847Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T847M	ENST00000356287.3	37	c.2540	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	g	21.6	4.178844	0.78564	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.93659	-3.26;-3.26	4.57	4.57	0.56435	.	.	.	.	.	D	0.93549	0.7941	L	0.60012	1.86	0.50313	D	0.99986	P	0.44690	0.841	P	0.47744	0.556	D	0.93578	0.6910	9	0.45353	T	0.12	.	17.7489	0.88428	0.0:0.0:1.0:0.0	.	847	P13533	MYH6_HUMAN	M	847	ENSP00000386041:T847M;ENSP00000348634:T847M	ENSP00000348634:T847M	T	-	2	0	MYH6	22933262	0.990000	0.36364	0.937000	0.37676	0.921000	0.55340	6.413000	0.73308	2.274000	0.75844	0.555000	0.69702	ACG	MYH6	-	NULL	ENSG00000197616		0.562	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	249	0.00	0	G			23863422	23863422	-1	no_errors	ENST00000356287	ensembl	human	known	69_37n	missense	112	29.56	47	SNP	1.000	A
PCDHB5	26167	genome.wustl.edu	37	5	140517348	140517348	+	Missense_Mutation	SNP	G	G	C	rs372115621		TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr5:140517348G>C	ENST00000231134.5	+	1	2549	c.2332G>C	c.(2332-2334)Gct>Cct	p.A778P		NM_015669.2	NP_056484.1	Q9Y5E4	PCDB5_HUMAN	protocadherin beta 5	778					calcium-dependent cell-cell adhesion (GO:0016339)|homophilic cell adhesion (GO:0007156)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(12)|kidney(1)|large_intestine(18)|lung(25)|ovary(3)|prostate(6)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(2)	81			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			GCCCCAGGGCGCTGGTGAAGA	0.493																																						dbGAP											0													99.0	119.0	112.0					5																	140517348		2196	4299	6495	-	-	-	SO:0001583	missense	0			AF152498	CCDS4247.1	5q31	2010-01-26			ENSG00000113209	ENSG00000113209		"""Cadherins / Protocadherins : Clustered"""	8690	other	protocadherin		606331				10380929	Standard	NM_015669		Approved	DKFZp586B0217, PCDH-BETA5	uc003liq.3	Q9Y5E4	OTTHUMG00000129616	ENST00000231134.5:c.2332G>C	5.37:g.140517348G>C	ENSP00000231134:p.Ala778Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q549F4|Q9UFU9	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A778P	ENST00000231134.5	37	c.2332	CCDS4247.1	5	.	.	.	.	.	.	.	.	.	.	G	3.730	-0.055841	0.07362	.	.	ENSG00000113209	ENST00000231134	T	0.52295	0.67	4.71	-9.42	0.00610	.	.	.	.	.	T	0.13927	0.0337	N	0.02296	-0.605	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.14924	-1.0455	9	0.26408	T	0.33	.	1.5186	0.02511	0.3399:0.0791:0.2652:0.3159	.	778	Q9Y5E4	PCDB5_HUMAN	P	778	ENSP00000231134:A778P	ENSP00000231134:A778P	A	+	1	0	PCDHB5	140497532	0.262000	0.24073	0.000000	0.03702	0.011000	0.07611	0.095000	0.15127	-2.524000	0.00495	-2.617000	0.00157	GCT	PCDHB5	-	NULL	ENSG00000113209		0.493	PCDHB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB5	HGNC	protein_coding	OTTHUMT00000251811.1	134	0.00	0	G	NM_015669		140517348	140517348	+1	no_errors	ENST00000231134	ensembl	human	known	69_37n	missense	93	12.26	13	SNP	0.000	C
PLXNB2	23654	genome.wustl.edu	37	22	50719581	50719583	+	In_Frame_Del	DEL	TCT	TCT	-			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	TCT	TCT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr22:50719581_50719583delTCT	ENST00000449103.1	-	23	3838_3840	c.3698_3700delAGA	c.(3697-3702)aagatc>atc	p.K1233del	PLXNB2_ENST00000496720.1_5'Flank|PLXNB2_ENST00000359337.4_In_Frame_Del_p.K1233del			O15031	PLXB2_HUMAN	plexin B2	1233					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)			breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		TGGGACTTGATCTTCTCATACTC	0.66																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3698_3700delAGA	22.37:g.50719584_50719586delTCT	ENSP00000409171:p.Lys1233del	Somatic		WXS	Illumina GAIIx	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	In_Frame_Del	DEL	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.K1233in_frame_del	ENST00000449103.1	37	c.3700_3698	CCDS43035.1	22																																																																																			PLXNB2	-	NULL	ENSG00000196576		0.660	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	50	0.00	0	TCT	NM_012401		50719581	50719583	-1	no_errors	ENST00000359337	ensembl	human	known	69_37n	in_frame_del	22	21.43	6	DEL	1.000:1.000:1.000	-
PPP1R3A	5506	genome.wustl.edu	37	7	113518116	113518116	+	Frame_Shift_Del	DEL	T	T	-			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr7:113518116delT	ENST00000284601.3	-	4	3099	c.3031delA	c.(3031-3033)atgfs	p.M1011fs		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	1011					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						ATTAAAATCATTGGCCCTAGA	0.378																																						dbGAP											0													133.0	131.0	132.0					7																	113518116		2203	4298	6501	-	-	-	SO:0001589	frameshift_variant	0			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.3031delA	7.37:g.113518116delT	ENSP00000284601:p.Met1011fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Frame_Shift_Del	DEL	pfam_CBM_21,pfscan_CBM_21	p.M1011fs	ENST00000284601.3	37	c.3031	CCDS5759.1	7																																																																																			PPP1R3A	-	NULL	ENSG00000154415		0.378	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	221	0.00	0	T	NM_002711		113518116	113518116	-1	no_errors	ENST00000284601	ensembl	human	known	69_37n	frame_shift_del	206	11.86	28	DEL	0.002	-
PRPF8	10594	genome.wustl.edu	37	17	1557290	1557290	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:1557290G>A	ENST00000572621.1	-	37	6273	c.6008C>T	c.(6007-6009)aCa>aTa	p.T2003I	PRPF8_ENST00000575116.1_5'Flank|PRPF8_ENST00000304992.6_Missense_Mutation_p.T2003I			Q6P2Q9	PRP8_HUMAN	pre-mRNA processing factor 8	2003	Involved in interaction with pre-mRNA 5' splice site.|RNase H homology domain.				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|U5 snRNP (GO:0005682)	poly(A) RNA binding (GO:0044822)|U5 snRNA binding (GO:0030623)|U6 snRNA binding (GO:0017070)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(13)|lung(24)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(3)	77				UCEC - Uterine corpus endometrioid carcinoma (25;0.0855)		TTCTGATTGTGTCAGTGATGC	0.512																																						dbGAP											0													281.0	240.0	254.0					17																	1557290		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB007510	CCDS11010.1	17p13.3	2013-07-16	2013-06-10		ENSG00000174231	ENSG00000174231			17340	protein-coding gene	gene with protein product		607300	"""PRP8 pre-mRNA processing factor 8 homolog (yeast)"", ""PRP8 pre-mRNA processing factor 8 homolog (S. cerevisiae)"""	RP13		11468273, 10411133	Standard	NM_006445		Approved	PRPC8, Prp8, hPrp8, SNRNP220	uc002fte.3	Q6P2Q9	OTTHUMG00000090553	ENST00000572621.1:c.6008C>T	17.37:g.1557290G>A	ENSP00000460348:p.Thr2003Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O14547|O75965	Missense_Mutation	SNP	pfam_PROCN,pfam_PRP8_domainIV,pfam_Prp8_U6-snRNA-bd,pfam_Pre-mRNA-splicing_factor-8,pfam_Prp8_U5-snRNA-bd,pfam_PRO_C,pfam_RRM_spliceosomal_PrP8,pfam_JAB1_Mov34_MPN_PAD1,superfamily_Cupredoxin,superfamily_Histone-fold,smart_JAB1_Mov34_MPN_PAD1	p.T2003I	ENST00000572621.1	37	c.6008	CCDS11010.1	17	.	.	.	.	.	.	.	.	.	.	G	20.9	4.058542	0.76074	.	.	ENSG00000174231	ENST00000304992	D	0.84730	-1.89	6.17	6.17	0.99709	.	0.000000	0.85682	D	0.000000	D	0.95040	0.8394	H	0.94808	3.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95381	0.8473	10	0.87932	D	0	-18.2836	19.8676	0.96824	0.0:0.0:1.0:0.0	.	2003	Q6P2Q9	PRP8_HUMAN	I	2003	ENSP00000304350:T2003I	ENSP00000304350:T2003I	T	-	2	0	PRPF8	1504040	1.000000	0.71417	1.000000	0.80357	0.274000	0.26718	9.586000	0.98226	2.941000	0.99782	0.655000	0.94253	ACA	PRPF8	-	NULL	ENSG00000174231		0.512	PRPF8-002	NOVEL	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	PRPF8	HGNC	protein_coding	OTTHUMT00000438412.2	229	0.00	0	G			1557290	1557290	-1	no_errors	ENST00000304992	ensembl	human	known	69_37n	missense	200	10.67	24	SNP	1.000	A
PRX	57716	genome.wustl.edu	37	19	40902578	40902578	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr19:40902578C>G	ENST00000324001.7	-	7	1951	c.1681G>C	c.(1681-1683)Gag>Cag	p.E561Q	PRX_ENST00000291825.7_3'UTR	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin	561	55 X 5 AA approximate tandem repeats of [LVMAG]-[PSREQC]-[EDKL]-[LIVMAP]- [AQKHRPE]; that may have a tripeptide spacer of [LV]-P-[KER].				axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			ACAGCCACCTCTGACACCTCT	0.562																																						dbGAP											0													97.0	111.0	107.0					19																	40902578		2200	4297	6497	-	-	-	SO:0001583	missense	0			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.1681G>C	19.37:g.40902578C>G	ENSP00000326018:p.Glu561Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BXL9|Q9HCF2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E561Q	ENST00000324001.7	37	c.1681	CCDS33028.1	19	.	.	.	.	.	.	.	.	.	.	C	4.977	0.181465	0.09495	.	.	ENSG00000105227	ENST00000324001;ENST00000341562	T	0.02103	4.45	4.58	4.58	0.56647	.	0.124126	0.36591	N	0.002507	T	0.08537	0.0212	M	0.70595	2.14	0.20873	N	0.999835	D	0.71674	0.998	D	0.67900	0.954	T	0.23119	-1.0197	10	0.19590	T	0.45	.	10.713	0.45995	0.0:0.8065:0.1935:0.0	.	561	Q9BXM0	PRAX_HUMAN	Q	561	ENSP00000326018:E561Q	ENSP00000326018:E561Q	E	-	1	0	PRX	45594418	.	.	1.000000	0.80357	0.039000	0.13416	.	.	2.359000	0.80004	0.563000	0.77884	GAG	PRX	-	NULL	ENSG00000105227		0.562	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	76	0.00	0	C	NM_020956		40902578	40902578	-1	no_errors	ENST00000324001	ensembl	human	known	69_37n	missense	40	21.57	11	SNP	0.232	G
QRICH2	84074	genome.wustl.edu	37	17	74277976	74277976	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr17:74277976C>T	ENST00000262765.5	-	8	3913	c.3734G>A	c.(3733-3735)cGa>cAa	p.R1245Q		NM_032134.1	NP_115510.1	Q9H0J4	QRIC2_HUMAN	glutamine rich 2	1245										breast(3)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(17)|ovary(4)|pancreas(2)|prostate(3)|skin(2)|stomach(4)	62						CTTGGAGGGTCGGGAGACGGC	0.642																																						dbGAP											0													65.0	49.0	55.0					17																	74277976		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK058102	CCDS32741.1	17q25.1	2009-03-19			ENSG00000129646	ENSG00000129646			25326	protein-coding gene	gene with protein product							Standard	NM_032134		Approved	DKFZP434P0316	uc002jrd.1	Q9H0J4	OTTHUMG00000167578	ENST00000262765.5:c.3734G>A	17.37:g.74277976C>T	ENSP00000262765:p.Arg1245Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE1|Q96LM3	Missense_Mutation	SNP	NULL	p.R1245Q	ENST00000262765.5	37	c.3734	CCDS32741.1	17	.	.	.	.	.	.	.	.	.	.	C	14.80	2.644307	0.47258	.	.	ENSG00000129646	ENST00000262765;ENST00000447564;ENST00000301613	T;T	0.45668	3.02;0.89	5.55	4.58	0.56647	.	.	.	.	.	T	0.44498	0.1296	N	0.20986	0.625	0.25619	N	0.986425	D;D	0.67145	0.996;0.988	P;P	0.60682	0.878;0.711	T	0.20638	-1.0269	9	0.37606	T	0.19	-30.6379	10.7092	0.45973	0.0:0.9097:0.0:0.0903	.	1245;1245	B5MD94;Q9H0J4	.;QRIC2_HUMAN	Q	1245;253;1245	ENSP00000262765:R1245Q;ENSP00000394461:R253Q	ENSP00000262765:R1245Q	R	-	2	0	QRICH2	71789571	0.847000	0.29606	1.000000	0.80357	0.595000	0.36748	0.922000	0.28734	2.617000	0.88574	0.650000	0.86243	CGA	QRICH2	-	NULL	ENSG00000129646		0.642	QRICH2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	QRICH2	HGNC	protein_coding	OTTHUMT00000395140.1	45	0.00	0	C	NM_032134		74277976	74277976	-1	no_errors	ENST00000262765	ensembl	human	known	69_37n	missense	23	14.81	4	SNP	0.989	T
RGMB	285704	genome.wustl.edu	37	5	98129189	98129190	+	Frame_Shift_Del	DEL	AC	AC	-	rs377028475		TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	AC	AC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr5:98129189_98129190delAC	ENST00000513185.1	+	3	1482_1483	c.1046_1047delAC	c.(1045-1047)tacfs	p.Y349fs	RGMB_ENST00000308234.7_Frame_Shift_Del_p.Y390fs			Q6NW40	RGMB_HUMAN	repulsive guidance molecule family member b	349					axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell adhesion (GO:0007155)|positive regulation of transcription, DNA-templated (GO:0045893)|signal transduction (GO:0007165)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)	identical protein binding (GO:0042802)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(2)|upper_aerodigestive_tract(1)	10		all_cancers(142;2.76e-08)|all_epithelial(76;2.98e-11)|all_lung(232;0.000485)|Lung NSC(167;0.000693)|Prostate(80;0.000986)|Ovarian(225;0.024)|Colorectal(57;0.117)		COAD - Colon adenocarcinoma(37;0.0587)		TGGCCTGGCTACACACTGGAGA	0.589																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AK074887	CCDS47251.1	5q21.1	2013-11-06	2013-11-06		ENSG00000174136	ENSG00000174136			26896	protein-coding gene	gene with protein product		612687	"""RGM domain family, member B"""			19324014	Standard	NM_001012761		Approved	FLJ90406, DRAGON	uc003knc.3	Q6NW40	OTTHUMG00000162745	ENST00000513185.1:c.1046_1047delAC	5.37:g.98129193_98129194delAC	ENSP00000423256:p.Tyr349fs	Somatic		WXS	Illumina GAIIx	Phase_IV	D6R9A0|Q8NC92	Frame_Shift_Del	DEL	pfam_RGM_C,pfam_RGM_N	p.L392fs	ENST00000513185.1	37	c.1169_1170		5																																																																																			RGMB	-	pfam_RGM_C	ENSG00000174136		0.589	RGMB-003	KNOWN	basic	protein_coding	RGMB	HGNC	protein_coding	OTTHUMT00000370308.1	85	0.00	0	AC	NM_173670		98129189	98129190	+1	no_errors	ENST00000308234	ensembl	human	known	69_37n	frame_shift_del	53	24.66	18	DEL	1.000:1.000	-
SKOR1	390598	genome.wustl.edu	37	15	68122564	68122564	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr15:68122564G>A	ENST00000380035.2	+	4	2501	c.2443G>A	c.(2443-2445)Gat>Aat	p.D815N	RP11-34F13.3_ENST00000558889.1_RNA|SKOR1_ENST00000389002.1_Missense_Mutation_p.D771N|SKOR1_ENST00000554054.1_Missense_Mutation_p.D787N|SKOR1_ENST00000341418.5_Missense_Mutation_p.D718N|SKOR1_ENST00000554240.1_Missense_Mutation_p.D776N			P84550	SKOR1_HUMAN	SKI family transcriptional corepressor 1	815					negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	SMAD binding (GO:0046332)|transcription corepressor activity (GO:0003714)			endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(4)|lung(7)|urinary_tract(1)	23						GCCCGCCGATGATTTGGAAAC	0.512																																						dbGAP											0													83.0	74.0	77.0					15																	68122564		2200	4298	6498	-	-	-	SO:0001583	missense	0				CCDS58374.1	15q23	2011-08-04	2010-06-23	2010-06-23	ENSG00000188779	ENSG00000188779		"""SKI transcriptional corepressors"""	21326	protein-coding gene	gene with protein product	"""transcriptional corepressor CORL1"", ""functional smad suppressing element 15"", ""corepressor for LBX1"""	611273	"""Lbxcor1 homolog (mouse)"""	LBXCOR1		15528197	Standard	NM_001258024		Approved	CORL1, FUSSEL15	uc031qsn.1	P84550		ENST00000380035.2:c.2443G>A	15.37:g.68122564G>A	ENSP00000369374:p.Asp815Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIP4|A6NJY0|Q2VWA5	Missense_Mutation	SNP	pfam_Transform_Ski,pfam_c-SKI_SMAD4-bd_dom,superfamily_DNA-bd_dom_put,superfamily_SAND_dom-like	p.D815N	ENST00000380035.2	37	c.2443		15	.	.	.	.	.	.	.	.	.	.	G	24.7	4.557715	0.86231	.	.	ENSG00000188779	ENST00000341418;ENST00000554240;ENST00000554054;ENST00000380035;ENST00000389002	T;T;T;T;T	0.42900	0.96;0.96;0.96;0.96;0.96	5.79	4.87	0.63330	.	0.122334	0.53938	D	0.000042	T	0.33235	0.0856	L	0.29908	0.895	0.32358	N	0.557506	B	0.31680	0.335	B	0.32465	0.146	T	0.46470	-0.9189	10	0.46703	T	0.11	-23.9727	13.4561	0.61199	0.0759:0.0:0.9241:0.0	.	771	P84550-3	.	N	718;776;787;815;771	ENSP00000343200:D718N;ENSP00000451193:D776N;ENSP00000452361:D787N;ENSP00000369374:D815N;ENSP00000373654:D771N	ENSP00000343200:D718N	D	+	1	0	SKOR1	65909618	1.000000	0.71417	0.868000	0.34077	0.961000	0.63080	6.796000	0.75145	1.440000	0.47531	0.655000	0.94253	GAT	SKOR1	-	NULL	ENSG00000188779		0.512	SKOR1-003	KNOWN	not_organism_supported|basic|appris_candidate_longest	protein_coding	SKOR1	HGNC	protein_coding	OTTHUMT00000410832.1	64	0.00	0	G	NM_001031807		68122564	68122564	+1	no_errors	ENST00000380035	ensembl	human	known	69_37n	missense	70	21.35	19	SNP	0.992	A
SLC39A14	23516	genome.wustl.edu	37	8	22277089	22277089	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr8:22277089C>G	ENST00000381237.1	+	9	1476	c.1357C>G	c.(1357-1359)Caa>Gaa	p.Q453E	SLC39A14_ENST00000240095.6_Intron|SLC39A14_ENST00000289952.5_Missense_Mutation_p.Q453E|SLC39A14_ENST00000359741.5_Missense_Mutation_p.Q453E	NM_001128431.2	NP_001121903.1	Q15043	S39AE_HUMAN	solute carrier family 39 (zinc transporter), member 14	453					cellular zinc ion homeostasis (GO:0006882)|transmembrane transport (GO:0055085)|zinc ion transmembrane import (GO:0071578)|zinc ion transmembrane transport (GO:0071577)	cell projection (GO:0042995)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ferrous iron transmembrane transporter activity (GO:0015093)|zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|endometrium(4)|large_intestine(2)|lung(4)|prostate(1)	12				Colorectal(74;0.019)|COAD - Colon adenocarcinoma(73;0.0731)		TGAGGTCTGTCAAGAGGATGA	0.468																																						dbGAP											0													221.0	194.0	203.0					8																	22277089		2203	4300	6503	-	-	-	SO:0001583	missense	0			D31887	CCDS6030.1, CCDS47822.1, CCDS47823.1	8p21.2	2013-05-22			ENSG00000104635	ENSG00000104635		"""Solute carriers"""	20858	protein-coding gene	gene with protein product		608736	"""solute carrier family 39 (metal ion transporter), member 14"""			12659941	Standard	NM_015359		Approved	KIAA0062, NET34, ZIP14	uc011kzh.2	Q15043	OTTHUMG00000097791	ENST00000381237.1:c.1357C>G	8.37:g.22277089C>G	ENSP00000370635:p.Gln453Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH98|B4DIW3|B6EU88|D3DSR4|Q6ZME8|Q96BB3	Missense_Mutation	SNP	pfam_ZIP	p.Q453E	ENST00000381237.1	37	c.1357	CCDS47823.1	8	.	.	.	.	.	.	.	.	.	.	C	7.933	0.741071	0.15642	.	.	ENSG00000104635	ENST00000359741;ENST00000381237;ENST00000289952	T;T;T	0.44482	0.92;0.92;0.92	5.72	5.72	0.89469	.	0.464992	0.23466	N	0.047877	T	0.14527	0.0351	N	0.00972	-1.085	0.32022	N	0.600636	B;B	0.06786	0.001;0.001	B;B	0.08055	0.003;0.003	T	0.08371	-1.0725	10	0.02654	T	1	-7.8071	13.924	0.63950	0.1523:0.8477:0.0:0.0	.	453;453	Q15043;B6EU88	S39AE_HUMAN;.	E	453	ENSP00000352779:Q453E;ENSP00000370635:Q453E;ENSP00000289952:Q453E	ENSP00000289952:Q453E	Q	+	1	0	SLC39A14	22333034	0.912000	0.30974	0.949000	0.38748	0.992000	0.81027	4.017000	0.57167	2.865000	0.98341	0.655000	0.94253	CAA	SLC39A14	-	pfam_ZIP	ENSG00000104635		0.468	SLC39A14-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A14	HGNC	protein_coding	OTTHUMT00000215039.2	170	0.00	0	C	XM_046677		22277089	22277089	+1	no_errors	ENST00000359741	ensembl	human	known	69_37n	missense	121	18.24	27	SNP	0.736	G
SNX21	90203	genome.wustl.edu	37	20	44463689	44463689	+	Silent	SNP	A	A	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr20:44463689A>C	ENST00000491381.1	+	3	449	c.381A>C	c.(379-381)gcA>gcC	p.A127A	SNX21_ENST00000372541.1_Silent_p.A118A|SNX21_ENST00000342644.5_Silent_p.A127A|SNX21_ENST00000372542.1_Silent_p.A118A|SNX21_ENST00000462307.1_Silent_p.A127A|SNX21_ENST00000344780.4_3'UTR|TNNC2_ENST00000372557.1_5'Flank			Q969T3	SNX21_HUMAN	sorting nexin family member 21	127					protein transport (GO:0015031)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)	phosphatidylinositol binding (GO:0035091)			breast(1)|endometrium(2)|large_intestine(1)|lung(2)|pancreas(1)	7		Myeloproliferative disorder(115;0.0122)				ACACCTTGGCACCCCAGCGGC	0.622																																						dbGAP											0													67.0	64.0	65.0					20																	44463689		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095851	CCDS13376.1, CCDS13377.1, CCDS42883.1	20q13.12	2013-01-10	2006-07-24	2006-07-24	ENSG00000124104	ENSG00000124104		"""Sorting nexins"", ""Tetratricopeptide (TTC) repeat domain containing"""	16154	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 161"""	C20orf161		12461558, 12459172	Standard	NM_152897		Approved	dJ337O18.4, SNX-L	uc002xpv.1	Q969T3	OTTHUMG00000032624	ENST00000491381.1:c.381A>C	20.37:g.44463689A>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JZH5|Q5JZH6|Q5JZH7|Q8WUR6|Q9BR16	Silent	SNP	pfam_Phox,pfam_TPR-1,superfamily_Phox,smart_Phox,pfscan_Phox	p.A127	ENST00000491381.1	37	c.381	CCDS13377.1	20																																																																																			SNX21	-	superfamily_Phox	ENSG00000124104		0.622	SNX21-010	KNOWN	basic|CCDS	protein_coding	SNX21	HGNC	protein_coding	OTTHUMT00000079534.1	48	0.00	0	A	NM_033421		44463689	44463689	+1	no_errors	ENST00000491381	ensembl	human	known	69_37n	silent	32	15.38	6	SNP	0.936	C
SORBS1	10580	genome.wustl.edu	37	10	97157022	97157022	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr10:97157022C>T	ENST00000361941.3	-	11	1203	c.1177G>A	c.(1177-1179)Gac>Aac	p.D393N	SORBS1_ENST00000353505.5_Missense_Mutation_p.D324N|SORBS1_ENST00000306402.6_Missense_Mutation_p.D270N|SORBS1_ENST00000371241.1_Missense_Mutation_p.D229N|SORBS1_ENST00000371249.2_Missense_Mutation_p.D361N|SORBS1_ENST00000371239.1_Missense_Mutation_p.D238N|SORBS1_ENST00000347291.4_Missense_Mutation_p.D261N|SORBS1_ENST00000371245.3_Missense_Mutation_p.D324N|SORBS1_ENST00000277982.5_Missense_Mutation_p.D393N|SORBS1_ENST00000607232.1_Missense_Mutation_p.D228N|SORBS1_ENST00000371247.2_Missense_Mutation_p.D393N|SORBS1_ENST00000371246.2_Missense_Mutation_p.D393N|SORBS1_ENST00000474353.2_5'UTR|SORBS1_ENST00000354106.3_Missense_Mutation_p.D384N|SORBS1_ENST00000393949.1_Missense_Mutation_p.D384N|SORBS1_ENST00000371227.4_Missense_Mutation_p.D393N	NM_001034954.1	NP_001030126			sorbin and SH3 domain containing 1											NS(1)|breast(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(19)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	42		Colorectal(252;0.0429)		Epithelial(162;1.7e-06)|all cancers(201;6.52e-05)		TTGTACCAGTCTTTTGATCTC	0.353																																						dbGAP											0													203.0	199.0	200.0					10																	97157022		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF136381	CCDS7442.1, CCDS31252.1, CCDS31253.1, CCDS31254.1, CCDS31255.1, CCDS31256.1, CCDS73169.1	10q23.33	2011-07-25	2002-05-08		ENSG00000095637	ENSG00000095637			14565	protein-coding gene	gene with protein product	"""c-Cbl-associated protein"""	605264	"""SH3-domain protein 5 (ponsin)"""	SH3D5		10085297, 11001060	Standard	XM_005269405		Approved	FLJ12406, CAP, sh3p12, ponsin, KIAA1296	uc001kkp.3	Q9BX66	OTTHUMG00000018812	ENST00000361941.3:c.1177G>A	10.37:g.97157022C>T	ENSP00000355136:p.Asp393Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Sorb,superfamily_SH3_domain,smart_Sorb,smart_SH3_domain,pfscan_Sorb,pfscan_SH3_domain	p.D393N	ENST00000361941.3	37	c.1177	CCDS31255.1	10	.	.	.	.	.	.	.	.	.	.	C	29.3	4.990270	0.93106	.	.	ENSG00000095637	ENST00000371245;ENST00000306402;ENST00000371249;ENST00000371247;ENST00000371227;ENST00000371246;ENST00000393949;ENST00000353505;ENST00000347291;ENST00000361941;ENST00000277982;ENST00000371241;ENST00000354106;ENST00000371239	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.51325	1.24;1.24;1.24;0.75;1.24;1.25;0.71;1.24;0.94;0.75;1.25;1.24;0.71;1.24	5.89	5.89	0.94794	Sorbin-like (3);	0.000000	0.43110	D	0.000607	T	0.69860	0.3158	M	0.68593	2.085	0.58432	D	0.999997	D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;0.997;1.0;1.0;1.0;1.0;0.998;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.948;0.999;0.999;0.999;0.997;0.998;0.999;1.0;0.999;0.994;0.999	T	0.70400	-0.4882	10	0.87932	D	0	-18.7445	20.2562	0.98421	0.0:1.0:0.0:0.0	.	591;238;393;361;270;229;238;324;393;393;261;384	B7Z9B7;B4DTX5;Q9BX66-11;Q9BX66-10;Q9BX66-9;Q9BX66-4;Q9BX66-8;Q9BX66-3;Q9BX66;Q9BX66-2;Q9BX66-6;Q9BX66-5	.;.;.;.;.;.;.;.;SRBS1_HUMAN;.;.;.	N	324;270;361;393;393;393;384;324;261;393;393;229;384;238	ENSP00000360291:D324N;ENSP00000302556:D270N;ENSP00000360295:D361N;ENSP00000360293:D393N;ENSP00000360271:D393N;ENSP00000360292:D393N;ENSP00000377521:D384N;ENSP00000343998:D324N;ENSP00000277985:D261N;ENSP00000355136:D393N;ENSP00000277982:D393N;ENSP00000360285:D229N;ENSP00000277984:D384N;ENSP00000360283:D238N	ENSP00000277982:D393N	D	-	1	0	SORBS1	97147012	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.314000	0.72848	2.797000	0.96272	0.563000	0.77884	GAC	SORBS1	-	pfam_Sorb,smart_Sorb,pfscan_Sorb	ENSG00000095637		0.353	SORBS1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SORBS1	HGNC	protein_coding	OTTHUMT00000049517.1	211	0.00	0	C			97157022	97157022	-1	no_errors	ENST00000361941	ensembl	human	known	69_37n	missense	155	25.24	53	SNP	1.000	T
TBX19	9095	genome.wustl.edu	37	1	168262381	168262381	+	Splice_Site	SNP	G	G	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr1:168262381G>C	ENST00000367821.3	+	3	519		c.e3-1			NM_005149.2	NP_005140.1	O60806	TBX19_HUMAN	T-box 19						anatomical structure morphogenesis (GO:0009653)|cell fate commitment (GO:0045165)|pituitary gland development (GO:0021983)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell differentiation (GO:0045595)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	enhancer sequence-specific DNA binding (GO:0001158)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|liver(1)|lung(11)|prostate(2)|skin(2)|urinary_tract(1)	34	all_hematologic(923;0.215)					TGCCTCGACAGATAATGTTGA	0.488																																						dbGAP											0													123.0	117.0	119.0					1																	168262381		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ010277	CCDS1272.1	1q23-q24	2008-02-05			ENSG00000143178	ENSG00000143178		"""T-boxes"""	11596	protein-coding gene	gene with protein product	"""TBS 19"""	604614				9888994	Standard	NM_005149		Approved	dj747L4.1, TPIT	uc001gfl.3	O60806	OTTHUMG00000034648	ENST00000367821.3:c.469-1G>C	1.37:g.168262381G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52M53	Splice_Site	SNP	-	e3-1	ENST00000367821.3	37	c.469-1	CCDS1272.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.936102	0.73442	.	.	ENSG00000143178	ENST00000367821;ENST00000367828;ENST00000431969	.	.	.	4.92	4.92	0.64577	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7412	0.88407	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TBX19	166529005	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	9.236000	0.95360	2.275000	0.75901	0.563000	0.77884	.	TBX19	-	-	ENSG00000143178		0.488	TBX19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX19	HGNC	protein_coding	OTTHUMT00000083825.1	189	0.00	0	G	NM_005149	Intron	168262381	168262381	+1	no_errors	ENST00000367821	ensembl	human	known	69_37n	splice_site	199	12.28	28	SNP	1.000	C
TIFA	92610	genome.wustl.edu	37	4	113199046	113199046	+	Missense_Mutation	SNP	G	G	C	rs144405805	byFrequency	TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr4:113199046G>C	ENST00000361717.3	-	2	808	c.527C>G	c.(526-528)cCg>cGg	p.P176R	TIFA_ENST00000500655.2_Missense_Mutation_p.P176R	NM_052864.2	NP_443096.1	Q96CG3	TIFA_HUMAN	TRAF-interacting protein with forkhead-associated domain	176					I-kappaB kinase/NF-kappaB signaling (GO:0007249)					breast(2)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)	6		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00172)		CATTTCTGTCGGAGAACTGCT	0.433																																						dbGAP											0													84.0	81.0	82.0					4																	113199046		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008294	CCDS34051.1	4q25	2008-03-17				ENSG00000145365			19075	protein-coding gene	gene with protein product	"""TRAF2 binding protein"", ""TRAF6 binding protein"""	609028				1179819	Standard	NM_052864		Approved	MGC20791, T2BP, T6BP, TIFAA	uc003ial.3	Q96CG3		ENST00000361717.3:c.527C>G	4.37:g.113199046G>C	ENSP00000354911:p.Pro176Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,pfscan_FHA_dom	p.P176R	ENST00000361717.3	37	c.527	CCDS34051.1	4	.	.	.	.	.	.	.	.	.	.	G	34	5.411192	0.96072	.	.	ENSG00000145365	ENST00000361717;ENST00000500655	T;T	0.66460	-0.21;-0.21	5.79	5.79	0.91817	.	0.051681	0.85682	D	0.000000	T	0.81786	0.4896	M	0.68952	2.095	0.50039	D	0.999847	D	0.89917	1.0	D	0.80764	0.994	T	0.82414	-0.0469	10	0.87932	D	0	-16.4714	20.0313	0.97540	0.0:0.0:1.0:0.0	.	176	Q96CG3	TIFA_HUMAN	R	176	ENSP00000354911:P176R;ENSP00000424231:P176R	ENSP00000354911:P176R	P	-	2	0	TIFA	113418495	1.000000	0.71417	0.487000	0.27428	0.796000	0.44982	5.064000	0.64338	2.746000	0.94184	0.655000	0.94253	CCG	TIFA	-	NULL	ENSG00000145365		0.433	TIFA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIFA	HGNC	protein_coding	OTTHUMT00000363647.2	198	0.00	0	G	NM_052864		113199046	113199046	-1	no_errors	ENST00000361717	ensembl	human	known	69_37n	missense	154	13.97	25	SNP	0.869	C
TMEM191A	84222	genome.wustl.edu	37	22	21055899	21055899	+	RNA	SNP	G	G	C			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr22:21055899G>C	ENST00000450925.2	+	0	498					NR_026815.1		Q9H0A3	T191A_HUMAN	transmembrane protein 191A (pseudogene)							integral component of membrane (GO:0016021)											TTTTTCACTAGACATCATAAT	0.328																																						dbGAP											0													132.0	101.0	111.0					22																	21055899		692	1591	2283	-	-	-			0			AL136879		22q11.21	2012-04-20	2012-04-20		ENSG00000226287	ENSG00000226287			25317	pseudogene	pseudogene			"""transmembrane protein 191A"""			11230166	Standard	NR_026815		Approved	DKFZp434N035, TMEM191AP	uc002zsx.1	Q9H0A3	OTTHUMG00000150164		22.37:g.21055899G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8E2	RNA	SNP	-	NULL	ENST00000450925.2	37	NULL		22																																																																																			TMEM191A	-	-	ENSG00000226287		0.328	TMEM191A-001	KNOWN	basic	processed_transcript	TMEM191A	HGNC	processed_transcript	OTTHUMT00000316649.1	179	0.00	0	G			21055899	21055899	+1	no_errors	ENST00000359859	ensembl	human	known	69_37n	rna	178	11.44	23	SNP	0.009	C
YDJC	150223	genome.wustl.edu	37	22	21982871	21982871	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr22:21982871G>A	ENST00000292778.6	-	5	857	c.808C>T	c.(808-810)Cgg>Tgg	p.R270W	YDJC_ENST00000398873.3_3'UTR	NM_001017964.1	NP_001017964.1	A8MPS7	YDJC_HUMAN	YdjC homolog (bacterial)	270					carbohydrate metabolic process (GO:0005975)		hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds (GO:0016810)					Colorectal(54;0.105)					TCATGCAGCCGCTCCCAAGAG	0.697																																						dbGAP											0													16.0	18.0	17.0					22																	21982871		2194	4295	6489	-	-	-	SO:0001583	missense	0				CCDS33613.1	22q11.21	2008-02-26			ENSG00000161179	ENSG00000161179			27158	protein-coding gene	gene with protein product						18177738	Standard	XM_005261347		Approved		uc002zvb.2	A8MPS7	OTTHUMG00000150822	ENST00000292778.6:c.808C>T	22.37:g.21982871G>A	ENSP00000292778:p.Arg270Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YDT4|Q4V9R7	Missense_Mutation	SNP	pfam_Uncharacterised_UPF0249/HpnK	p.R270W	ENST00000292778.6	37	c.808	CCDS33613.1	22	.	.	.	.	.	.	.	.	.	.	G	23.2	4.386453	0.82902	.	.	ENSG00000161179	ENST00000292778	T	0.72167	-0.63	4.32	0.608	0.17569	Polysaccharide deacetylase (1);	0.000000	0.85682	D	0.000000	D	0.82728	0.5100	M	0.86268	2.805	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82991	-0.0182	10	0.54805	T	0.06	-9.8037	11.4137	0.49939	0.0:0.0:0.5587:0.4413	.	270	A8MPS7	YDJC_HUMAN	W	270	ENSP00000292778:R270W	ENSP00000292778:R270W	R	-	1	2	YDJC	20312871	1.000000	0.71417	0.996000	0.52242	0.962000	0.63368	2.731000	0.47343	0.408000	0.25621	0.650000	0.86243	CGG	YDJC	-	pfam_Uncharacterised_UPF0249/HpnK	ENSG00000161179		0.697	YDJC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YDJC	HGNC	protein_coding	OTTHUMT00000320213.1	25	0.00	0	G			21982871	21982871	-1	no_errors	ENST00000292778	ensembl	human	known	69_37n	missense	11	31.25	5	SNP	0.989	A
ZNF407	55628	genome.wustl.edu	37	18	72347051	72347051	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr18:72347051C>G	ENST00000299687.5	+	1	4076	c.4076C>G	c.(4075-4077)tCc>tGc	p.S1359C	ZNF407_ENST00000582337.1_Missense_Mutation_p.S1359C|ZNF407_ENST00000309902.6_Missense_Mutation_p.S1359C|ZNF407_ENST00000577538.1_Missense_Mutation_p.S1359C	NM_017757.2	NP_060227.2	Q9C0G0	ZN407_HUMAN	zinc finger protein 407	1359					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(21)|lung(23)|ovary(4)|prostate(3)|upper_aerodigestive_tract(2)	67		Esophageal squamous(42;0.131)|Prostate(75;0.173)		BRCA - Breast invasive adenocarcinoma(31;0.184)		TTTGACTCCTCCATAATAAGA	0.408																																						dbGAP											0													112.0	114.0	114.0					18																	72347051		1876	4119	5995	-	-	-	SO:0001583	missense	0			AB051490	CCDS45885.1, CCDS54191.1, CCDS58634.1	18q23	2013-01-08			ENSG00000215421	ENSG00000215421		"""Zinc fingers, C2H2-type"""	19904	protein-coding gene	gene with protein product		615894				11214970	Standard	NM_017757		Approved	FLJ20307, FLJ13839, KIAA1703	uc002llw.2	Q9C0G0		ENST00000299687.5:c.4076C>G	18.37:g.72347051C>G	ENSP00000299687:p.Ser1359Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD54|Q96MY0|Q9H8A1|Q9NXD4|Q9NXD7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_U1,pfscan_Znf_C2H2	p.S1359C	ENST00000299687.5	37	c.4076	CCDS45885.1	18	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450425	0.63290	.	.	ENSG00000215421	ENST00000299687;ENST00000309902	T;T	0.21031	2.03;2.35	5.84	5.84	0.93424	.	0.214824	0.40908	D	0.000993	T	0.32585	0.0834	N	0.19112	0.55	0.31384	N	0.678694	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.70935	0.971;0.971;0.963	T	0.40308	-0.9570	10	0.72032	D	0.01	.	15.6045	0.76652	0.0:0.8631:0.1369:0.0	.	1359;1359;1359	Q9C0G0-3;Q9C0G0-2;Q9C0G0	.;.;ZN407_HUMAN	C	1359	ENSP00000299687:S1359C;ENSP00000310359:S1359C	ENSP00000299687:S1359C	S	+	2	0	ZNF407	70476039	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.430000	0.66501	0.803000	0.34113	0.655000	0.94253	TCC	ZNF407	-	NULL	ENSG00000215421		0.408	ZNF407-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF407	HGNC	protein_coding	OTTHUMT00000444903.1	57	0.00	0	C	NM_017757		72347051	72347051	+1	no_errors	ENST00000299687	ensembl	human	known	69_37n	missense	40	37.50	24	SNP	1.000	G
ZNF687	57592	genome.wustl.edu	37	1	151261136	151261136	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr1:151261136C>A	ENST00000368879.2	+	3	2346	c.2248C>A	c.(2248-2250)Cat>Aat	p.H750N		NM_020832.1	NP_065883.1	Q8N1G0	ZN687_HUMAN	zinc finger protein 687	750					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|ovary(1)|upper_aerodigestive_tract(2)	32	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			TTTTCAGACCCATCTCCGGGA	0.582																																						dbGAP											0													126.0	111.0	116.0					1																	151261136		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS992.1	1q21.2	2008-05-02			ENSG00000143373	ENSG00000143373			29277	protein-coding gene	gene with protein product		610568				10718198	Standard	NM_020832		Approved	KIAA1441	uc001exq.3	Q8N1G0	OTTHUMG00000012347	ENST00000368879.2:c.2248C>A	1.37:g.151261136C>A	ENSP00000357874:p.His750Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV17|Q68DQ8|Q9H937|Q9P2A7	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H750N	ENST00000368879.2	37	c.2248		1	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928874	0.92389	.	.	ENSG00000143373	ENST00000336715;ENST00000324048;ENST00000368879	T;T;T	0.02050	4.48;4.48;4.48	4.98	4.98	0.66077	Zinc finger, C2H2-like (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.36268	N	0.002684	T	0.13329	0.0323	M	0.93939	3.475	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.74023	0.97;0.982	T	0.02220	-1.1193	10	0.87932	D	0	.	17.1904	0.86878	0.0:1.0:0.0:0.0	.	750;750	Q8N1G0-2;Q8N1G0	.;ZN687_HUMAN	N	750	ENSP00000336620:H750N;ENSP00000319829:H750N;ENSP00000357874:H750N	ENSP00000319829:H750N	H	+	1	0	ZNF687	149527760	1.000000	0.71417	0.999000	0.59377	0.998000	0.95712	7.588000	0.82629	2.595000	0.87683	0.561000	0.74099	CAT	ZNF687	-	smart_Znf_C2H2-like	ENSG00000143373		0.582	ZNF687-201	KNOWN	basic	protein_coding	ZNF687	HGNC	protein_coding		68	0.00	0	C	NM_020832		151261136	151261136	+1	no_errors	ENST00000324048	ensembl	human	known	69_37n	missense	60	24.05	19	SNP	1.000	A
ZNF710	374655	genome.wustl.edu	37	15	90611078	90611078	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A132-01A-31D-A10Y-09	TCGA-C8-A132-10A-01D-A110-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	c038ab30-af2f-4771-bf82-dcf19f32efab	57984eb7-bce9-4b03-8aa3-014ee4014165	g.chr15:90611078C>T	ENST00000268154.4	+	2	960	c.709C>T	c.(709-711)Ccg>Tcg	p.P237S		NM_198526.2	NP_940928.2	Q8N1W2	ZN710_HUMAN	zinc finger protein 710	237	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(1)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	19	Melanoma(11;0.00551)|Lung NSC(78;0.0196)|all_lung(78;0.04)		BRCA - Breast invasive adenocarcinoma(143;0.00769)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.129)			CATGGAGTCCCCGGAGCCTGT	0.682																																						dbGAP											0													23.0	28.0	26.0					15																	90611078		2186	4285	6471	-	-	-	SO:0001583	missense	0			AK094712	CCDS10358.1	15q26.1	2013-01-08			ENSG00000140548	ENSG00000140548		"""Zinc fingers, C2H2-type"""	25352	protein-coding gene	gene with protein product							Standard	XM_005254905		Approved	DKFZp547K1113, FLJ37393, FLJ00306	uc002bov.2	Q8N1W2	OTTHUMG00000149812	ENST00000268154.4:c.709C>T	15.37:g.90611078C>T	ENSP00000268154:p.Pro237Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVS3|Q6ZMK9|Q8NDU0	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P237S	ENST00000268154.4	37	c.709	CCDS10358.1	15	.	.	.	.	.	.	.	.	.	.	C	8.297	0.819134	0.16607	.	.	ENSG00000140548	ENST00000268154	T	0.08720	3.06	5.22	3.28	0.37604	.	1.148130	0.06507	N	0.737283	T	0.10035	0.0246	L	0.36672	1.1	0.28402	N	0.918575	B	0.25667	0.131	B	0.19666	0.026	T	0.34775	-0.9815	10	0.54805	T	0.06	-31.7203	12.916	0.58207	0.305:0.695:0.0:0.0	.	237	Q8N1W2	ZN710_HUMAN	S	237	ENSP00000268154:P237S	ENSP00000268154:P237S	P	+	1	0	ZNF710	88412082	.	.	0.689000	0.30133	0.745000	0.42441	.	.	0.717000	0.32145	0.561000	0.74099	CCG	ZNF710	-	NULL	ENSG00000140548		0.682	ZNF710-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF710	HGNC	protein_coding	OTTHUMT00000313423.1	16	0.00	0	C	NM_198526		90611078	90611078	+1	no_errors	ENST00000268154	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	0.999	T
