#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC9	10060	genome.wustl.edu	37	12	21953991	21953991	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr12:21953991C>T	ENST00000261200.4	-	38	4636	c.4637G>A	c.(4636-4638)cGc>cAc	p.R1546H		NM_020297.2	NP_064693.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	0	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)	p.R1546H(1)		NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CATGTCTGCGCGAACAAAAGA	0.383																																						dbGAP											1	Substitution - Missense(1)	ovary(1)											89.0	83.0	85.0					12																	21953991		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261200.4:c.4637G>A	12.37:g.21953991C>T	ENSP00000261200:p.Arg1546His	Somatic		WXS	Illumina GAIIx	Phase_IV	O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R1546H	ENST00000261200.4	37	c.4637	CCDS8693.1	12	.	.	.	.	.	.	.	.	.	.	C	16.42	3.119438	0.56505	.	.	ENSG00000069431	ENST00000261200	D	0.90676	-2.71	4.88	4.88	0.63580	.	0.116707	0.56097	D	0.000021	D	0.88104	0.6347	L	0.31926	0.97	0.80722	D	1	P;B	0.44627	0.839;0.004	B;B	0.43445	0.42;0.008	D	0.89795	0.3971	10	0.72032	D	0.01	-2.9795	18.5784	0.91163	0.0:1.0:0.0:0.0	.	1546;117	O60706-2;Q8N9N1	.;.	H	1546	ENSP00000261200:R1546H	ENSP00000261200:R1546H	R	-	2	0	ABCC9	21845258	0.822000	0.29219	1.000000	0.80357	0.945000	0.59286	1.588000	0.36633	2.695000	0.91970	0.650000	0.86243	CGC	ABCC9	-	pfscan_ABC_transporter-like	ENSG00000069431		0.383	ABCC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402228.1	41	0.00	0	C	NM_005691		21953991	21953991	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	1.000	T
BIRC6	57448	genome.wustl.edu	37	2	32824940	32824940	+	Silent	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr2:32824940C>T	ENST00000421745.2	+	70	14099	c.13965C>T	c.(13963-13965)ttC>ttT	p.F4655F		NM_016252.3	NP_057336	Q9NR09	BIRC6_HUMAN	baculoviral IAP repeat containing 6	4655	Ubiquitin-conjugating.				apoptotic process (GO:0006915)|labyrinthine layer development (GO:0060711)|mitotic nuclear division (GO:0007067)|negative regulation of apoptotic process (GO:0043066)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|positive regulation of cell proliferation (GO:0008284)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell proliferation (GO:0042127)|regulation of cytokinesis (GO:0032465)|spongiotrophoblast layer development (GO:0060712)	endosome (GO:0005768)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|midbody (GO:0030496)|spindle pole (GO:0000922)|trans-Golgi network (GO:0005802)	acid-amino acid ligase activity (GO:0016881)|cysteine-type endopeptidase inhibitor activity (GO:0004869)|ubiquitin-protein transferase activity (GO:0004842)			NS(4)|breast(8)|central_nervous_system(3)|endometrium(21)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(31)|lung(65)|ovary(7)|pancreas(1)|prostate(5)|skin(5)|stomach(1)|urinary_tract(5)	172	Acute lymphoblastic leukemia(172;0.155)					GCGTGCGATTCAATCCAAACC	0.353																																					Pancreas(94;175 1509 16028 18060 45422)	dbGAP											0													98.0	93.0	95.0					2																	32824940		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF265555	CCDS33175.2	2p22.3	2011-01-25	2011-01-25		ENSG00000115760	ENSG00000115760		"""Baculoviral IAP repeat containing"", ""Ubiquitin-conjugating enzymes E2"""	13516	protein-coding gene	gene with protein product	"""apollon"""	605638	"""baculoviral IAP repeat-containing 6"""			10544019	Standard	NM_016252		Approved	BRUCE	uc010ezu.3	Q9NR09	OTTHUMG00000150528	ENST00000421745.2:c.13965C>T	2.37:g.32824940C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULD1	Silent	SNP	pfam_DUF3643,pfam_UBQ-conjugat_E2,pfam_BIR,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,superfamily_Galactose-bd-like,superfamily_WD40_repeat_dom,smart_BIR,pfscan_BIR,pfscan_UBQ-conjugat_E2	p.F4655	ENST00000421745.2	37	c.13965	CCDS33175.2	2																																																																																			BIRC6	-	pfam_UBQ-conjugat_E2,pfam_UEV_N,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	ENSG00000115760		0.353	BIRC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BIRC6	HGNC	protein_coding	OTTHUMT00000318769.3	82	0.00	0	C	NM_016252		32824940	32824940	+1	no_errors	ENST00000421745	ensembl	human	known	69_37n	silent	41	33.87	21	SNP	1.000	T
BRWD1	54014	genome.wustl.edu	37	21	40670464	40670464	+	Silent	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr21:40670464G>A	ENST00000333229.2	-	5	570	c.243C>T	c.(241-243)atC>atT	p.I81I	BRWD1_ENST00000341322.4_Silent_p.I81I|BRWD1_ENST00000342449.3_Silent_p.I81I|BRWD1_ENST00000470108.1_5'UTR|BRWD1_ENST00000380800.3_Silent_p.I81I	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	81					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				TGCGCTGGCAGATTTGCAAAA	0.398																																					Melanoma(170;988 1986 4794 16843 39731)	dbGAP											0													118.0	123.0	121.0					21																	40670464		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.243C>T	21.37:g.40670464G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Silent	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I81	ENST00000333229.2	37	c.243	CCDS13662.1	21																																																																																			BRWD1	-	NULL	ENSG00000185658		0.398	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	47	0.00	0	G	NM_033656		40670464	40670464	-1	no_errors	ENST00000333229	ensembl	human	known	69_37n	silent	35	20.45	9	SNP	1.000	A
CCDC180	100499483	genome.wustl.edu	37	9	100090372	100090372	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr9:100090372A>G	ENST00000357054.1	+	30	3216	c.2281A>G	c.(2281-2283)Aac>Gac	p.N761D	CCDC180_ENST00000395220.1_3'UTR|CCDC180_ENST00000411667.2_Missense_Mutation_p.N619D|CCDC180_ENST00000529487.1_Missense_Mutation_p.N622D|CCDC180_ENST00000460482.2_3'UTR|CCDC180_ENST00000375202.2_Missense_Mutation_p.N622D|RP11-23J9.4_ENST00000534123.1_RNA			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	761						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GAAAGAACTCAACTCCTACAG	0.483																																						dbGAP											0													191.0	169.0	176.0					9																	100090372		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.2281A>G	9.37:g.100090372A>G	ENSP00000349562:p.Asn761Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Missense_Mutation	SNP	NULL	p.N622D	ENST00000357054.1	37	c.1864		9	.	.	.	.	.	.	.	.	.	.	A	14.33	2.502286	0.44455	.	.	ENSG00000197816	ENST00000357054;ENST00000375202;ENST00000411667;ENST00000541524;ENST00000529487	T;T;T;T	0.22134	1.97;1.97;1.97;1.97	5.18	2.72	0.32119	.	0.273770	0.31872	N	0.006925	T	0.26702	0.0653	M	0.63428	1.95	0.28303	N	0.923046	P;P;P;P	0.50156	0.932;0.884;0.932;0.932	P;B;P;P	0.53450	0.726;0.297;0.726;0.726	T	0.10109	-1.0644	10	0.12766	T	0.61	-13.8291	6.1192	0.20144	0.6693:0.169:0.0:0.1617	.	619;761;622;761	F5H149;B7ZMG3;Q9P1Z9-2;Q9P1Z9	.;.;.;CI174_HUMAN	D	761;622;619;645;622	ENSP00000349562:N761D;ENSP00000364348:N622D;ENSP00000414000:N619D;ENSP00000434727:N622D	ENSP00000349562:N761D	N	+	1	0	C9orf174	99130193	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	1.431000	0.34925	0.449000	0.26747	0.533000	0.62120	AAC	C9orf174	-	NULL	ENSG00000197816		0.483	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		36	0.00	0	A	NM_020893		100090372	100090372	+1	no_errors	ENST00000375202	ensembl	human	known	69_37n	missense	36	10.00	4	SNP	1.000	G
CHSY1	22856	genome.wustl.edu	37	15	101718167	101718167	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr15:101718167A>T	ENST00000254190.3	-	3	2310	c.1835T>A	c.(1834-1836)cTg>cAg	p.L612Q	CHSY1_ENST00000543813.1_5'UTR	NM_014918.4	NP_055733.2	Q86X52	CHSS1_HUMAN	chondroitin sulfate synthase 1	612					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of ossification (GO:0030279)|response to nutrient levels (GO:0031667)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyl-N-acetylgalactosaminyl-proteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047238)|metal ion binding (GO:0046872)|N-acetylgalactosaminyl-proteoglycan 3-beta-glucuronosyltransferase activity (GO:0050510)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(5)|skin(1)	24	Lung NSC(78;0.00217)|all_lung(78;0.00271)|Melanoma(26;0.00505)		OV - Ovarian serous cystadenocarcinoma(32;0.000932)|LUSC - Lung squamous cell carcinoma(107;0.187)|Lung(145;0.23)			TTCCAGGGCCAGGGCTCTTGA	0.468																																						dbGAP											0													55.0	53.0	53.0					15																	101718167		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023207	CCDS10390.1	15q26.3	2013-02-19	2008-01-24	2008-01-24	ENSG00000131873	ENSG00000131873	2.4.1.175, 2.4.1.226	"""Beta 3-glycosyltransferases"", ""Beta 4-glycosyltransferases"""	17198	protein-coding gene	gene with protein product		608183	"""carbohydrate (chondroitin) synthase 1"""			11514575	Standard	NM_014918		Approved	KIAA0990, CSS1	uc021sxt.1	Q86X52	OTTHUMG00000149873	ENST00000254190.3:c.1835T>A	15.37:g.101718167A>T	ENSP00000254190:p.Leu612Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UX38|Q7LFU5|Q9Y2J5	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_Fringe-like	p.L612Q	ENST00000254190.3	37	c.1835	CCDS10390.1	15	.	.	.	.	.	.	.	.	.	.	A	18.61	3.660585	0.67586	.	.	ENSG00000131873	ENST00000254190;ENST00000543813	T	0.34859	1.34	5.8	5.8	0.92144	.	0.000000	0.64402	D	0.000003	T	0.60157	0.2247	M	0.79475	2.455	0.80722	D	1	D	0.67145	0.996	D	0.72982	0.979	T	0.58126	-0.7691	10	0.25106	T	0.35	-34.926	16.1549	0.81657	1.0:0.0:0.0:0.0	.	612	Q86X52	CHSS1_HUMAN	Q	612;340	ENSP00000254190:L612Q	ENSP00000254190:L612Q	L	-	2	0	CHSY1	99535690	1.000000	0.71417	0.938000	0.37757	0.772000	0.43724	7.081000	0.76844	2.209000	0.71365	0.533000	0.62120	CTG	CHSY1	-	pfam_Chond_GalNAc	ENSG00000131873		0.468	CHSY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHSY1	HGNC	protein_coding	OTTHUMT00000313624.1	33	0.00	0	A	NM_014918		101718167	101718167	-1	no_errors	ENST00000254190	ensembl	human	known	69_37n	missense	25	24.24	8	SNP	1.000	T
CREBBP	1387	genome.wustl.edu	37	16	3808953	3808953	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr16:3808953G>A	ENST00000262367.5	-	17	4080	c.3271C>T	c.(3271-3273)Cgc>Tgc	p.R1091C	CREBBP_ENST00000382070.3_Missense_Mutation_p.R1053C	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1091					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGGGCCTGGCGTAACTCCTCT	0.488			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																															dbGAP		Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													96.0	90.0	92.0					16																	3808953		2197	4300	6497	-	-	-	SO:0001583	missense	0			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.3271C>T	16.37:g.3808953G>A	ENSP00000262367:p.Arg1091Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.R1091C	ENST00000262367.5	37	c.3271	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392533	0.42410	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	T;T	0.19394	2.15;2.15	5.05	5.05	0.67936	Bromodomain (3);	0.000000	0.64402	D	0.000001	T	0.52980	0.1768	M	0.85710	2.77	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.79108	0.992;0.992	T	0.60702	-0.7211	10	0.72032	D	0.01	-20.2699	18.7675	0.91879	0.0:0.0:1.0:0.0	.	1121;1091	Q4LE28;Q92793	.;CBP_HUMAN	C	1091;1121;1053	ENSP00000262367:R1091C;ENSP00000371502:R1053C	ENSP00000262367:R1091C	R	-	1	0	CREBBP	3748954	1.000000	0.71417	0.998000	0.56505	0.868000	0.49771	5.965000	0.70387	2.499000	0.84300	0.561000	0.74099	CGC	CREBBP	-	superfamily_Bromodomain,smart_Bromodomain	ENSG00000005339		0.488	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	40	0.00	0	G	NM_004380		3808953	3808953	-1	no_errors	ENST00000262367	ensembl	human	known	69_37n	missense	19	44.44	16	SNP	1.000	A
CUL3	8452	genome.wustl.edu	37	2	225362533	225362533	+	Silent	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr2:225362533G>A	ENST00000264414.4	-	12	1982	c.1644C>T	c.(1642-1644)ctC>ctT	p.L548L	CUL3_ENST00000409777.1_Silent_p.L524L|CUL3_ENST00000409096.1_Silent_p.L524L|CUL3_ENST00000344951.4_Silent_p.L482L	NM_003590.4	NP_003581.1	Q13618	CUL3_HUMAN	cullin 3	548					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|COPII vesicle coating (GO:0048208)|cyclin catabolic process (GO:0008054)|embryonic cleavage (GO:0040016)|ER to Golgi vesicle-mediated transport (GO:0006888)|G1/S transition of mitotic cell cycle (GO:0000082)|gastrulation (GO:0007369)|integrin-mediated signaling pathway (GO:0007229)|intrinsic apoptotic signaling pathway (GO:0097193)|mitotic metaphase plate congression (GO:0007080)|negative regulation of Rho protein signal transduction (GO:0035024)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of mitotic metaphase/anaphase transition (GO:0045842)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|stem cell division (GO:0017145)|stress fiber assembly (GO:0043149)|trophectodermal cellular morphogenesis (GO:0001831)|Wnt signaling pathway (GO:0016055)	Cul3-RING ubiquitin ligase complex (GO:0031463)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|nucleus (GO:0005634)|polar microtubule (GO:0005827)	POZ domain binding (GO:0031208)			endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(2)|liver(1)|lung(19)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	46		all_lung(227;0.00877)|Lung NSC(271;0.011)|Renal(207;0.0112)|all_hematologic(139;0.138)		Epithelial(121;1.58e-11)|all cancers(144;1.43e-08)|Lung(261;0.00863)|LUSC - Lung squamous cell carcinoma(224;0.00902)		GCTGGAGTGTGAGCTGTCGAC	0.348																																						dbGAP											0													151.0	142.0	145.0					2																	225362533		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U58089	CCDS2462.1, CCDS58751.1	2q36.2	2011-05-24			ENSG00000036257	ENSG00000036257			2553	protein-coding gene	gene with protein product		603136				8681378, 17192413	Standard	NM_003590		Approved		uc002vny.3	Q13618	OTTHUMG00000133167	ENST00000264414.4:c.1644C>T	2.37:g.225362533G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K536|B8ZZC3|O75415|Q569L3|Q9UBI8|Q9UET7	Missense_Mutation	SNP	pfam_Cullin_neddylation_domain,pfam_Cullin_N,superfamily_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.H2Y	ENST00000264414.4	37	c.4	CCDS2462.1	2	.	.	.	.	.	.	.	.	.	.	G	10.27	1.305100	0.23736	.	.	ENSG00000036257	ENST00000451538	.	.	.	6.16	3.36	0.38483	.	.	.	.	.	T	0.54679	0.1873	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49380	-0.8946	4	.	.	.	.	5.9585	0.19287	0.2564:0.2364:0.5072:0.0	.	.	.	.	Y	2	.	.	H	-	1	0	CUL3	225070777	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.101000	0.31037	0.948000	0.37687	0.650000	0.86243	CAC	CUL3	-	pfam_Cullin_N,superfamily_Cullin_homology,pfscan_Cullin_homology	ENSG00000036257		0.348	CUL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL3	HGNC	protein_coding	OTTHUMT00000256871.2	96	0.00	0	G			225362533	225362533	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000451538	ensembl	human	novel	69_37n	missense	71	13.41	11	SNP	1.000	A
DCLK1	9201	genome.wustl.edu	37	13	36367617	36367617	+	Splice_Site	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr13:36367617C>T	ENST00000360631.3	-	16	2156		c.e16-1		DCLK1_ENST00000379893.1_Splice_Site|DCLK1_ENST00000255448.4_Splice_Site			O15075	DCLK1_HUMAN	doublecortin-like kinase 1						axon extension (GO:0048675)|central nervous system development (GO:0007417)|central nervous system projection neuron axonogenesis (GO:0021952)|dendrite morphogenesis (GO:0048813)|endosomal transport (GO:0016197)|forebrain development (GO:0030900)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|response to virus (GO:0009615)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein activity (GO:0005057)			breast(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(18)|lung(17)|ovary(2)|prostate(3)|skin(4)|stomach(6)|urinary_tract(1)	64		Breast(139;0.0147)|Lung SC(185;0.0685)|Prostate(109;0.122)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;1.72e-06)|Epithelial(112;4.24e-05)|BRCA - Breast invasive adenocarcinoma(63;0.00159)|OV - Ovarian serous cystadenocarcinoma(117;0.0158)|GBM - Glioblastoma multiforme(144;0.0638)		GGCCATCATCCTGGAGAaaaa	0.398																																						dbGAP											0													149.0	145.0	146.0					13																	36367617		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002367	CCDS9354.1, CCDS55895.1, CCDS73561.1	13q13.3	2008-02-05	2007-04-02	2007-04-02	ENSG00000133083	ENSG00000133083			2700	protein-coding gene	gene with protein product		604742	"""doublecortin and CaM kinase-like 1"""	DCAMKL1		9747029, 10036192	Standard	NM_004734		Approved	KIAA0369, DCLK, DCDC3A	uc001uvf.3	O15075	OTTHUMG00000016729	ENST00000360631.3:c.1945-1G>A	13.37:g.36367617C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z3E9|Q5VZY8|Q5VZZ0|Q5VZZ1	Splice_Site	SNP	-	e15-1	ENST00000360631.3	37	c.1945-1		13	.	.	.	.	.	.	.	.	.	.	C	17.62	3.434703	0.62955	.	.	ENSG00000133083	ENST00000399319;ENST00000255448;ENST00000360631;ENST00000379893;ENST00000539451	.	.	.	5.49	5.49	0.81192	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.3844	0.94551	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DCLK1	35265617	1.000000	0.71417	0.997000	0.53966	0.967000	0.64934	7.400000	0.79949	2.575000	0.86900	0.650000	0.86243	.	DCLK1	-	-	ENSG00000133083		0.398	DCLK1-010	KNOWN	basic	protein_coding	DCLK1	HGNC	protein_coding	OTTHUMT00000044487.1	132	0.00	0	C	NM_004734	Intron	36367617	36367617	-1	no_errors	ENST00000360631	ensembl	human	known	69_37n	splice_site	64	33.33	32	SNP	1.000	T
EFHC1	114327	genome.wustl.edu	37	6	52329847	52329847	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr6:52329847G>C	ENST00000371068.5	+	6	1174	c.1071G>C	c.(1069-1071)gaG>gaC	p.E357D	EFHC1_ENST00000433625.2_Missense_Mutation_p.E266D|EFHC1_ENST00000538167.1_Missense_Mutation_p.E338D	NM_018100.3	NP_060570.2	Q5JVL4	EFHC1_HUMAN	EF-hand domain (C-terminal) containing 1	357	DM10 2. {ECO:0000255|PROSITE- ProRule:PRU00665}.		E -> K (in dbSNP:rs505760).			axoneme (GO:0005930)|neuronal cell body (GO:0043025)	calcium ion binding (GO:0005509)|protein C-terminus binding (GO:0008022)			breast(3)|central_nervous_system(1)|endometrium(4)|large_intestine(8)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(1)	27	Lung NSC(77;0.109)					ATTACAAAGAGAAGTTTGGAA	0.393																																						dbGAP											0													93.0	85.0	88.0					6																	52329847		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK001328	CCDS4942.1, CCDS55021.1	6p12.3	2014-02-04			ENSG00000096093	ENSG00000096093		"""EF-hand domain containing"""	16406	protein-coding gene	gene with protein product	"""myoclonin-1"""	608815	"""epilepsy, juvenile myoclonic 1"""	EJM1, EJM		15258581	Standard	NM_018100		Approved	FLJ10466	uc003pap.4	Q5JVL4	OTTHUMG00000014848	ENST00000371068.5:c.1071G>C	6.37:g.52329847G>C	ENSP00000360107:p.Glu357Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMU3|F5GZD8|Q5XKM4|Q6E1U7|Q6E1U8|Q8WUL2|Q9NVW6	Missense_Mutation	SNP	pfam_DUF1126,smart_Uncharacterised_DM10,pfscan_EF_HAND_2	p.E357D	ENST00000371068.5	37	c.1071	CCDS4942.1	6	.	.	.	.	.	.	.	.	.	.	G	8.541	0.873175	0.17322	.	.	ENSG00000096093	ENST00000371068;ENST00000433625;ENST00000538167	T;T;T	0.68903	-0.11;-0.36;-0.31	5.38	-2.01	0.07410	Uncharacterised domain DM10 (2);	0.615460	0.19068	N	0.123572	T	0.16128	0.0388	N	0.13003	0.285	0.23254	N	0.998036	B;B;B	0.06786	0.001;0.0;0.001	B;B;B	0.13407	0.009;0.001;0.003	T	0.17961	-1.0352	10	0.20519	T	0.43	-10.8625	0.956	0.01385	0.4487:0.1772:0.1989:0.1752	.	338;266;357	F5GZD8;B7Z2S4;Q5JVL4	.;.;EFHC1_HUMAN	D	357;266;338	ENSP00000360107:E357D;ENSP00000416492:E266D;ENSP00000444521:E338D	ENSP00000360107:E357D	E	+	3	2	EFHC1	52437806	0.641000	0.27251	0.995000	0.50966	0.969000	0.65631	-0.300000	0.08243	-0.128000	0.11641	0.585000	0.79938	GAG	EFHC1	-	smart_Uncharacterised_DM10	ENSG00000096093		0.393	EFHC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFHC1	HGNC	protein_coding	OTTHUMT00000040905.2	60	0.00	0	G	NM_018100		52329847	52329847	+1	no_errors	ENST00000371068	ensembl	human	known	69_37n	missense	29	38.30	18	SNP	0.839	C
HOMEZ	57594	genome.wustl.edu	37	14	23745649	23745649	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr14:23745649G>A	ENST00000357460.5	-	2	952	c.788C>T	c.(787-789)cCc>cTc	p.P263L	HOMEZ_ENST00000431326.2_Missense_Mutation_p.P265L|HOMEZ_ENST00000561013.1_Missense_Mutation_p.P265L	NM_020834.2	NP_065885.2	Q8IX15	HOMEZ_HUMAN	homeobox and leucine zipper encoding	263					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(5)|lung(7)	12	all_cancers(95;5.54e-06)			GBM - Glioblastoma multiforme(265;0.00643)		AATTGGTGGGGGTTTATCCCG	0.527																																						dbGAP											0													66.0	70.0	69.0					14																	23745649		2127	4237	6364	-	-	-	SO:0001583	missense	0			AB037864	CCDS45085.1	14q11.2	2011-06-20	2007-02-15	2007-02-15		ENSG00000215271		"""Homeoboxes / ZF class"""	20164	protein-coding gene	gene with protein product		608119	"""KIAA1443"""	KIAA1443		12925734	Standard	NM_020834		Approved		uc001wja.2	Q8IX15		ENST00000357460.5:c.788C>T	14.37:g.23745649G>A	ENSP00000350049:p.Pro263Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L445|B4DZ80|F8WCA3|Q6P049|Q86XB6|Q9P2A5	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.P265L	ENST00000357460.5	37	c.794	CCDS45085.1	14	.	.	.	.	.	.	.	.	.	.	G	3.737	-0.054366	0.07362	.	.	ENSG00000215271	ENST00000357460;ENST00000431326	T;T	0.22134	1.97;1.97	5.65	4.76	0.60689	.	0.725126	0.13464	N	0.385921	T	0.13756	0.0333	N	0.17082	0.46	0.37749	D	0.925903	B;B	0.12630	0.006;0.004	B;B	0.10450	0.005;0.002	T	0.07790	-1.0754	10	0.59425	D	0.04	-1.6903	8.3621	0.32365	0.1698:0.0:0.8302:0.0	.	265;263	F8WCA3;Q8IX15	.;HOMEZ_HUMAN	L	263;265	ENSP00000350049:P263L;ENSP00000406579:P265L	ENSP00000350049:P263L	P	-	2	0	HOMEZ	22815489	0.992000	0.36948	0.665000	0.29768	0.214000	0.24535	2.579000	0.46059	1.633000	0.50488	0.655000	0.94253	CCC	RP11-124D2.6	-	NULL	ENSG00000260175		0.527	HOMEZ-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000260175	Clone_based_vega_gene	protein_coding	OTTHUMT00000416939.2	45	0.00	0	G	NM_020834		23745649	23745649	-1	no_errors	ENST00000431326	ensembl	human	known	69_37n	missense	32	38.46	20	SNP	0.629	A
EZR	7430	genome.wustl.edu	37	6	159197489	159197489	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr6:159197489G>A	ENST00000367075.3	-	8	914	c.746C>T	c.(745-747)tCt>tTt	p.S249F	EZR_ENST00000337147.7_Missense_Mutation_p.S249F|EZR_ENST00000392177.4_Missense_Mutation_p.S217F	NM_001111077.1	NP_001104547.1	P15311	EZRI_HUMAN	ezrin	249	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.|Interaction with SCYL3.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of endothelial barrier (GO:0061028)|establishment or maintenance of apical/basal cell polarity (GO:0035088)|filopodium assembly (GO:0046847)|leukocyte cell-cell adhesion (GO:0007159)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|receptor internalization (GO:0031623)|regulation of cell shape (GO:0008360)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|astrocyte projection (GO:0097449)|basolateral plasma membrane (GO:0016323)|cell body (GO:0044297)|cell tip (GO:0051286)|ciliary basal body (GO:0036064)|cortical cytoskeleton (GO:0030863)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|membrane (GO:0016020)|membrane raft (GO:0045121)|microspike (GO:0044393)|microvillus (GO:0005902)|microvillus membrane (GO:0031528)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|Schwann cell microvillus (GO:0097454)|T-tubule (GO:0030315)|uropod (GO:0001931)|vesicle (GO:0031982)	actin filament binding (GO:0051015)|cell adhesion molecule binding (GO:0050839)|poly(A) RNA binding (GO:0044822)		EZR/ROS1(4)	breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(2)|lung(1)|ovary(1)|prostate(2)	15		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.16e-17)|BRCA - Breast invasive adenocarcinoma(81;6.58e-06)		GTCATTGAAAGAGATGTTCCT	0.373			T	ROS1	NSCLC																																	dbGAP		Dom	yes		6	6q25.3	7430	ezrin		E	0													129.0	127.0	128.0					6																	159197489		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187552	CCDS5258.1	6q25.3	2010-12-10	2007-11-29	2007-11-29	ENSG00000092820	ENSG00000092820		"""A-kinase anchor proteins"""	12691	protein-coding gene	gene with protein product	"""cytovillin 2"""	123900	"""villin 2 (ezrin)"""	VIL2			Standard	NM_003379		Approved		uc003qrt.4	P15311	OTTHUMG00000015917	ENST00000367075.3:c.746C>T	6.37:g.159197489G>A	ENSP00000356042:p.Ser249Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5A8|P23714|Q4VX75|Q96CU8|Q9NSJ4	Missense_Mutation	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,smart_Band_41_domain,prints_Ez/rad/moesin,prints_Band_41_fam,pfscan_FERM_domain	p.S249F	ENST00000367075.3	37	c.746	CCDS5258.1	6	.	.	.	.	.	.	.	.	.	.	G	22.3	4.265156	0.80358	.	.	ENSG00000092820	ENST00000337147;ENST00000367075;ENST00000392177	D;D;D	0.89939	-2.59;-2.59;-2.59	4.83	3.96	0.45880	FERM, C-terminal PH-like domain (1);FERM domain (1);Pleckstrin homology-type (1);	0.049885	0.85682	N	0.000000	D	0.94755	0.8307	M	0.93283	3.4	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	D	0.95774	0.8811	10	0.87932	D	0	.	13.3501	0.60597	0.0766:0.0:0.9234:0.0	.	217;249	E7EQR4;P15311	.;EZRI_HUMAN	F	249;249;217	ENSP00000338934:S249F;ENSP00000356042:S249F;ENSP00000376016:S217F	ENSP00000338934:S249F	S	-	2	0	EZR	159117477	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.666000	0.98612	1.171000	0.42768	0.655000	0.94253	TCT	EZR	-	pirsf_ERM,pfam_FERM_PH-like_C,pfscan_FERM_domain	ENSG00000092820		0.373	EZR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EZR	HGNC	protein_coding	OTTHUMT00000042878.1	75	0.00	0	G	NM_003379		159197489	159197489	-1	no_errors	ENST00000337147	ensembl	human	known	69_37n	missense	38	39.68	25	SNP	1.000	A
FAM124A	220108	genome.wustl.edu	37	13	51855093	51855093	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr13:51855093G>A	ENST00000322475.8	+	4	1477	c.1342G>A	c.(1342-1344)Gaa>Aaa	p.E448K	FAM124A_ENST00000280057.6_Missense_Mutation_p.E484K	NM_001242312.1	NP_001229241.1	Q86V42	F124A_HUMAN	family with sequence similarity 124A	448										breast(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(7)|lung(6)|ovary(1)|prostate(2)|skin(1)	26		Acute lymphoblastic leukemia(7;0.000334)|Breast(56;0.00156)|Prostate(109;0.00538)|Lung NSC(96;0.0216)|Hepatocellular(98;0.152)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(99;4.25e-07)		CCTCCCCTCCGAAAGATGCAG	0.622																																						dbGAP											0													46.0	46.0	46.0					13																	51855093		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096364	CCDS9427.1, CCDS55900.1	13q14.3	2006-08-11			ENSG00000150510	ENSG00000150510			26413	protein-coding gene	gene with protein product						12975309	Standard	NM_145019		Approved	FLJ30707	uc001vff.2	Q86V42	OTTHUMG00000016942	ENST00000322475.8:c.1342G>A	13.37:g.51855093G>A	ENSP00000324625:p.Glu448Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A324|Q8N8P9|Q8NE66|Q96NJ9	Missense_Mutation	SNP	NULL	p.E484K	ENST00000322475.8	37	c.1450	CCDS55900.1	13	.	.	.	.	.	.	.	.	.	.	G	12.23	1.875663	0.33162	.	.	ENSG00000150510	ENST00000322475;ENST00000280057	T;T	0.45276	0.91;0.9	4.85	2.77	0.32553	.	0.543063	0.17528	N	0.170993	T	0.25865	0.0630	L	0.47716	1.5	0.09310	N	1	B;P	0.37398	0.086;0.593	B;B	0.28465	0.008;0.09	T	0.08617	-1.0713	10	0.11485	T	0.65	-5.4251	7.6473	0.28327	0.1064:0.2629:0.6307:0.0	.	448;484	Q86V42;Q86V42-2	F124A_HUMAN;.	K	448;484	ENSP00000324625:E448K;ENSP00000280057:E484K	ENSP00000280057:E484K	E	+	1	0	FAM124A	50753094	0.032000	0.19561	0.005000	0.12908	0.075000	0.17131	1.788000	0.38714	2.213000	0.71641	0.650000	0.86243	GAA	FAM124A	-	NULL	ENSG00000150510		0.622	FAM124A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM124A	HGNC	protein_coding	OTTHUMT00000045019.3	15	0.00	0	G	NM_145019		51855093	51855093	+1	no_errors	ENST00000280057	ensembl	human	known	69_37n	missense	12	36.84	7	SNP	0.000	A
FAM133B	257415	genome.wustl.edu	37	7	92207495	92207495	+	Splice_Site	SNP	C	C	G			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr7:92207495C>G	ENST00000445716.1	-	5	380	c.278G>C	c.(277-279)aGa>aCa	p.R93T	FAM133B_ENST00000427372.1_Splice_Site_p.R83T|FAM133B_ENST00000438306.1_Splice_Site_p.R83T	NM_152789.2	NP_690002.2	Q5BKY9	F133B_HUMAN	family with sequence similarity 133, member B	93	Lys-rich.|Ser-rich.						poly(A) RNA binding (GO:0044822)			endometrium(1)|large_intestine(1)|ovary(1)|upper_aerodigestive_tract(1)	4	all_cancers(62;7.39e-11)|all_epithelial(64;7.03e-10)|Breast(17;0.00201)|all_lung(186;0.0384)|Lung NSC(181;0.053)|all_hematologic(106;0.237)		STAD - Stomach adenocarcinoma(4;6.16e-07)|GBM - Glioblastoma multiforme(5;9.78e-06)|all cancers(6;1.67e-05)|Epithelial(20;0.113)|LUSC - Lung squamous cell carcinoma(200;0.225)|Lung(22;0.23)			TTTTTTCTTTCTCTAAATGGA	0.284																																						dbGAP											0													52.0	48.0	49.0					7																	92207495		1795	4066	5861	-	-	-	SO:0001630	splice_region_variant	0				CCDS47640.1, CCDS47641.1	7q21.2	2014-02-12	2007-04-26		ENSG00000234545	ENSG00000234545			28629	protein-coding gene	gene with protein product						12477932	Standard	NM_152789		Approved	MGC40405	uc003umc.3	Q5BKY9	OTTHUMG00000155863	ENST00000445716.1:c.277-1G>C	7.37:g.92207495C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R994|Q05D67|Q6P5S6|Q8N0W8	Missense_Mutation	SNP	NULL	p.R93T	ENST00000445716.1	37	c.278	CCDS47640.1	7	.	.	.	.	.	.	.	.	.	.	C	15.35	2.807324	0.50421	.	.	ENSG00000234545	ENST00000438306;ENST00000445716;ENST00000427372	T;T;T	0.38887	1.11;1.11;1.11	5.63	3.81	0.43845	.	.	.	.	.	T	0.37839	0.1018	L	0.57536	1.79	0.80722	D	1	B	0.25609	0.13	B	0.27076	0.076	T	0.28522	-1.0041	9	0.72032	D	0.01	-0.4935	6.8069	0.23782	0.0:0.6021:0.0:0.3979	.	93	Q5BKY9	F133B_HUMAN	T	83;93;83	ENSP00000389783:R83T;ENSP00000398401:R93T;ENSP00000402843:R83T	ENSP00000389559:R93T	R	-	2	0	FAM133B	92045431	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.812000	0.38952	0.832000	0.34804	0.555000	0.69702	AGA	FAM133B	-	NULL	ENSG00000234545		0.284	FAM133B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM133B	HGNC	protein_coding	OTTHUMT00000342181.2	87	0.00	0	C	NM_001040057	Missense_Mutation	92207495	92207495	-1	no_errors	ENST00000445716	ensembl	human	known	69_37n	missense	48	37.66	29	SNP	1.000	G
HJURP	55355	genome.wustl.edu	37	2	234749835	234749835	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr2:234749835G>A	ENST00000411486.2	-	8	1656	c.1591C>T	c.(1591-1593)Cac>Tac	p.H531Y	HJURP_ENST00000432087.1_Missense_Mutation_p.H477Y|HJURP_ENST00000434039.1_5'Flank|HJURP_ENST00000441687.1_Missense_Mutation_p.H446Y	NM_018410.3	NP_060880.3	Q8NCD3	HJURP_HUMAN	Holliday junction recognition protein	531					cell cycle (GO:0007049)|CENP-A containing nucleosome assembly (GO:0034080)|chromosome segregation (GO:0007059)|nucleosome assembly (GO:0006334)|regulation of DNA binding (GO:0051101)|regulation of protein complex assembly (GO:0043254)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|identical protein binding (GO:0042802)			NS(2)|breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(3)|lung(11)|ovary(2)|prostate(3)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38		Breast(86;0.00204)|all_lung(227;0.00433)|Renal(207;0.00685)|all_hematologic(139;0.0116)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0719)|Lung SC(224;0.128)		Epithelial(121;2.01e-18)|BRCA - Breast invasive adenocarcinoma(100;0.000186)|Lung(119;0.00521)|LUSC - Lung squamous cell carcinoma(224;0.00829)		GTTGCGCTGTGTGTGGGGTTG	0.478																																						dbGAP											0													147.0	149.0	148.0					2																	234749835		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33406.1, CCDS63166.1, CCDS63167.1	2q37.1	2007-12-06			ENSG00000123485	ENSG00000123485			25444	protein-coding gene	gene with protein product		612667				17823411	Standard	NM_001282962		Approved	DKFZp762E1312, URLC9, hFLEG1, FAKTS	uc002vvg.3	Q8NCD3	OTTHUMG00000059125	ENST00000411486.2:c.1591C>T	2.37:g.234749835G>A	ENSP00000414109:p.His531Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8IRH5|B4DWR0|B4DZV4|Q9BUT2|Q9NSL8	Missense_Mutation	SNP	pfam_HJURP,pfam_HJURP_C,pfam_Centromere_Scm3_N	p.H531Y	ENST00000411486.2	37	c.1591	CCDS33406.1	2	.	.	.	.	.	.	.	.	.	.	G	0.020	-1.443017	0.01089	.	.	ENSG00000123485	ENST00000411486;ENST00000432087;ENST00000441687;ENST00000414924	T;T;T;T	0.10005	3.23;3.23;3.23;2.92	4.35	-3.4	0.04853	.	4.455080	0.00166	N	0.000002	T	0.07413	0.0187	L	0.40543	1.245	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.04013	0.001;0.001;0.001	T	0.25745	-1.0123	10	0.11485	T	0.65	10.2501	1.0599	0.01598	0.3431:0.2645:0.2575:0.1349	.	446;477;531	Q8NCD3-3;Q8NCD3-2;Q8NCD3	.;.;HJURP_HUMAN	Y	531;477;446;446	ENSP00000414109:H531Y;ENSP00000407208:H477Y;ENSP00000401944:H446Y;ENSP00000393253:H446Y	ENSP00000414109:H531Y	H	-	1	0	HJURP	234414574	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.826000	0.04429	-0.739000	0.04809	-0.861000	0.03010	CAC	HJURP	-	NULL	ENSG00000123485		0.478	HJURP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HJURP	HGNC	protein_coding	OTTHUMT00000130996.6	113	0.00	0	G	NM_018410		234749835	234749835	-1	no_errors	ENST00000411486	ensembl	human	known	69_37n	missense	36	40.98	25	SNP	0.000	A
HOXB13	10481	genome.wustl.edu	37	17	46805422	46805422	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr17:46805422C>T	ENST00000290295.7	-	1	1118	c.534G>A	c.(532-534)tgG>tgA	p.W178*	PRAC2_ENST00000422730.2_RNA	NM_006361.5	NP_006352.2	Q92826	HXB13_HUMAN	homeobox B13	178					angiogenesis (GO:0001525)|epidermis development (GO:0008544)|epithelial cell maturation involved in prostate gland development (GO:0060743)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|response to wounding (GO:0009611)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|lung(6)|prostate(1)	11						TCTGGCTGTTCCAGCCACCAG	0.572																																						dbGAP											0													74.0	69.0	71.0					17																	46805422		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U57052	CCDS11536.1	17q21.32	2014-09-17	2005-12-22		ENSG00000159184	ENSG00000159184		"""Homeoboxes / ANTP class : HOXL subclass"""	5112	protein-coding gene	gene with protein product		604607	"""homeo box B13"""			8756292, 9665387	Standard	NM_006361		Approved		uc002ioa.3	Q92826	OTTHUMG00000159900	ENST00000290295.7:c.534G>A	17.37:g.46805422C>T	ENSP00000290295:p.Trp178*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R878|Q96QM4|Q99810	Nonsense_Mutation	SNP	pfam_HoxA13_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.W178*	ENST00000290295.7	37	c.534	CCDS11536.1	17	.	.	.	.	.	.	.	.	.	.	C	42	9.450797	0.99174	.	.	ENSG00000159184	ENST00000290295	.	.	.	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	17.1727	0.86834	0.0:1.0:0.0:0.0	.	.	.	.	X	178	.	ENSP00000290295:W178X	W	-	3	0	HOXB13	44160421	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.320000	0.79064	2.648000	0.89879	0.561000	0.74099	TGG	HOXB13	-	NULL	ENSG00000159184		0.572	HOXB13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB13	HGNC	protein_coding	OTTHUMT00000358087.3	33	0.00	0	C	NM_006361		46805422	46805422	-1	no_errors	ENST00000290295	ensembl	human	known	69_37n	nonsense	17	37.04	10	SNP	1.000	T
MAP3K4	4216	genome.wustl.edu	37	6	161502011	161502011	+	Silent	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr6:161502011C>T	ENST00000392142.4	+	6	2344	c.2196C>T	c.(2194-2196)ttC>ttT	p.F732F	MAP3K4_ENST00000366920.2_Silent_p.F732F|MAP3K4_ENST00000348824.7_Silent_p.F732F|MAP3K4_ENST00000366919.2_Silent_p.F732F	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	732					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		AATGGAATTTCACCAAAGAAA	0.428																																						dbGAP											0													67.0	67.0	67.0					6																	161502011		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.2196C>T	6.37:g.161502011C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.F732	ENST00000392142.4	37	c.2196	CCDS34565.1	6																																																																																			MAP3K4	-	NULL	ENSG00000085511		0.428	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	45	0.00	0	C			161502011	161502011	+1	no_errors	ENST00000392142	ensembl	human	known	69_37n	silent	23	32.35	11	SNP	1.000	T
MLH1	4292	genome.wustl.edu	37	3	37089169	37089169	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr3:37089169G>C	ENST00000231790.2	+	16	2107	c.1891G>C	c.(1891-1893)Gat>Cat	p.D631H	MLH1_ENST00000539477.1_Missense_Mutation_p.D390H|MLH1_ENST00000536378.1_Missense_Mutation_p.D390H|MLH1_ENST00000458205.2_Missense_Mutation_p.D390H|MLH1_ENST00000435176.1_Missense_Mutation_p.D533H|MLH1_ENST00000455445.2_Missense_Mutation_p.D390H	NM_000249.3|NM_001258273.1	NP_000240.1|NP_001245202.1	P40692	MLH1_HUMAN	mutL homolog 1	631	Interaction with EXO1.		D -> A (in HNPCC2; unknown pathological significance). {ECO:0000269|PubMed:12132870}.		ATP catabolic process (GO:0006200)|double-strand break repair via nonhomologous end joining (GO:0006303)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|isotype switching (GO:0045190)|male meiosis chromosome segregation (GO:0007060)|meiotic metaphase I plate congression (GO:0043060)|mismatch repair (GO:0006298)|negative regulation of mitotic recombination (GO:0045950)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|oogenesis (GO:0048477)|resolution of meiotic recombination intermediates (GO:0000712)|somatic hypermutation of immunoglobulin genes (GO:0016446)|spermatogenesis (GO:0007283)|spindle midzone assembly involved in meiosis (GO:0051257)|synapsis (GO:0007129)	chiasma (GO:0005712)|male germ cell nucleus (GO:0001673)|membrane (GO:0016020)|MutLalpha complex (GO:0032389)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|guanine/thymine mispair binding (GO:0032137)	p.0?(1)		NS(1)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(12)|kidney(2)|large_intestine(54)|lung(13)|oesophagus(7)|ovary(6)|pancreas(5)|prostate(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	127						TTTGGAAATTGATGAGGTGTG	0.438		1	"""D, Mis, N, F, S"""		"""colorectal, endometrial, ovarian, CNS"""	"""colorectal, endometrial, ovarian, CNS"""		Mismatch excision repair (MMR)	Turcot syndrome;Muir-Torre syndrome;Lynch syndrome;Constitutional Mismatch Repair Deficiency Syndrome																													dbGAP	yes	Rec	yes	"""Hereditary non-polyposis colorectal cancer, Turcot syndrome"""	3	3p21.3	4292	E.coli MutL homolog gene		"""E, O"""	1	Whole gene deletion(1)	ovary(1)											138.0	143.0	142.0					3																	37089169		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Brain tumor-colorectal polyp(osis) syndrome; ;Hereditary Non-Polyposis Colorectal Cancer, HNPCC, Lynch syndromes 1 and 2 (= Cancer Family Syndrome), Hereditary Mismatch Repair Deficiency syndrome, HMRDS;Mismatch Repair Cancer syndrome, MMRCS, Childhood Cancer Syndrome, CCS, Biallelic Mismatch Repair Gene Mutations Associated Early Onset Cancer, Lynch syndrome type III	U07418	CCDS2663.1, CCDS54562.1, CCDS54563.1	3p22.3	2014-09-17	2013-09-12		ENSG00000076242	ENSG00000076242			7127	protein-coding gene	gene with protein product		120436	"""mutL (E. coli) homolog 1 (colon cancer, nonpolyposis type 2)"", ""mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli)"""	COCA2		7903889	Standard	NM_000249		Approved	HNPCC, FCC2, HNPCC2	uc003cgl.3	P40692	OTTHUMG00000130797	ENST00000231790.2:c.1891G>C	3.37:g.37089169G>C	ENSP00000231790:p.Asp631His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DI13|B4DQ11|E9PCU2	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,tigrfam_DNA_mismatch_repair_N	p.D631H	ENST00000231790.2	37	c.1891	CCDS2663.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	28.3|28.3	4.906551|4.906551	0.92107|0.92107	.|.	.|.	ENSG00000076242|ENSG00000076242	ENST00000231790;ENST00000383761;ENST00000458205;ENST00000539477;ENST00000455445;ENST00000435176;ENST00000536378|ENST00000456676	D;D;D;D;D;D|.	0.93953|.	-3.32;-3.32;-3.32;-3.32;-3.32;-3.32|.	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.85457|0.85457	0.5701|0.5701	M|M	0.90019|0.90019	3.08|3.08	0.80722|0.80722	D|D	1|1	D;D;D;D|.	0.89917|.	1.0;1.0;1.0;1.0|.	D;D;D;D|.	0.79784|.	0.993;0.988;0.988;0.988|.	D|D	0.87698|0.87698	0.2558|0.2558	10|5	0.72032|.	D|.	0.01|.	-23.9279|-23.9279	19.4502|19.4502	0.94863|0.94863	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	533;631;631;631|.	E9PCU2;B2R6K0;Q53GX1;P40692|.	.;.;.;MLH1_HUMAN|.	H|F	631;495;390;390;390;533;390|622	ENSP00000231790:D631H;ENSP00000402667:D390H;ENSP00000443665:D390H;ENSP00000398272:D390H;ENSP00000402564:D533H;ENSP00000444286:D390H|.	ENSP00000231790:D631H|.	D|L	+|+	1|3	0|2	MLH1|MLH1	37064173|37064173	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	9.602000|9.602000	0.98312|0.98312	2.604000|2.604000	0.88044|0.88044	0.585000|0.585000	0.79938|0.79938	GAT|TTG	MLH1	-	NULL	ENSG00000076242		0.438	MLH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLH1	HGNC	protein_coding	OTTHUMT00000253337.2	66	0.00	0	G	NM_000249		37089169	37089169	+1	no_errors	ENST00000231790	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	1.000	C
MYBPC2	4606	genome.wustl.edu	37	19	50946815	50946815	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr19:50946815G>A	ENST00000357701.5	+	10	1018	c.967G>A	c.(967-969)Gac>Aac	p.D323N		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	323	Ig-like C2-type 2.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		GCTGGCGGATGACGCTGCCTA	0.502																																						dbGAP											0													51.0	51.0	51.0					19																	50946815		2115	4249	6364	-	-	-	SO:0001583	missense	0				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.967G>A	19.37:g.50946815G>A	ENSP00000350332:p.Asp323Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D323N	ENST00000357701.5	37	c.967	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	g	18.60	3.658301	0.67586	.	.	ENSG00000086967	ENST00000357701	T	0.66995	-0.24	3.91	3.91	0.45181	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.000000	0.35772	U	0.003000	T	0.81365	0.4807	M	0.79926	2.475	0.46521	D	0.999085	D	0.71674	0.998	D	0.79108	0.992	T	0.82788	-0.0284	10	0.42905	T	0.14	.	15.5505	0.76148	0.0:0.0:1.0:0.0	.	323	Q14324	MYPC2_HUMAN	N	323	ENSP00000350332:D323N	ENSP00000350332:D323N	D	+	1	0	MYBPC2	55638627	1.000000	0.71417	0.743000	0.31040	0.297000	0.27493	8.936000	0.92931	2.128000	0.65567	0.205000	0.17691	GAC	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub	ENSG00000086967		0.502	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	35	0.00	0	G	NM_004533		50946815	50946815	+1	no_errors	ENST00000357701	ensembl	human	known	69_37n	missense	12	40.00	8	SNP	1.000	A
NACA2	342538	genome.wustl.edu	37	17	59668409	59668409	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr17:59668409G>A	ENST00000521764.1	-	1	154	c.133C>T	c.(133-135)Cag>Tag	p.Q45*		NM_199290.3	NP_954984.1	Q9H009	NACA2_HUMAN	nascent polypeptide-associated complex alpha subunit 2	45					myoblast migration (GO:0051451)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			large_intestine(1)|lung(5)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	12	all_epithelial(1;3.12e-14)					GTGGTGGTCTGGGTGGAATCC	0.517																																						dbGAP											0													109.0	97.0	101.0					17																	59668409		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			BC062710	CCDS11630.1	17q23.3	2014-01-28	2007-04-20	2007-04-20		ENSG00000253506			23290	protein-coding gene	gene with protein product	"""alpha-NAC protein"""	609274	"""nascent-polypeptide-associated complex alpha polypeptide-like"""	NACAL		12406326	Standard	NM_199290		Approved	MGC71999	uc002izj.2	Q9H009		ENST00000521764.1:c.133C>T	17.37:g.59668409G>A	ENSP00000427802:p.Gln45*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2VIR9	Nonsense_Mutation	SNP	pfam_Nas_poly-pep-assoc_cplx,superfamily_UBA-like,pirsf_Nas_poly-pep-assoc_cplx_asu,pfscan_Nas_poly-pep-assoc_cplx	p.Q45*	ENST00000521764.1	37	c.133	CCDS11630.1	17	.	.	.	.	.	.	.	.	.	.	G	13.22	2.173366	0.38413	.	.	ENSG00000253506	ENST00000521764	.	.	.	0.753	0.753	0.18404	.	0.000000	0.56097	U	0.000021	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3227	0.26536	0.0:0.0:1.0:0.0	.	.	.	.	X	45	.	.	Q	-	1	0	NACA2	57023191	1.000000	0.71417	0.595000	0.28798	0.133000	0.20885	6.376000	0.73141	0.702000	0.31825	0.411000	0.27672	CAG	NACA2	-	pirsf_Nas_poly-pep-assoc_cplx_asu	ENSG00000253506		0.517	NACA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NACA2	HGNC	protein_coding	OTTHUMT00000255437.2	88	0.00	0	G	NM_199290		59668409	59668409	-1	no_errors	ENST00000521764	ensembl	human	known	69_37n	nonsense	34	44.26	27	SNP	1.000	A
NGFRAP1	27018	genome.wustl.edu	37	X	102632641	102632641	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chrX:102632641G>A	ENST00000372645.3	+	3	549	c.222G>A	c.(220-222)atG>atA	p.M74I	NGFRAP1_ENST00000299872.7_Missense_Mutation_p.M74I|NGFRAP1_ENST00000361298.4_Missense_Mutation_p.M64I|NGFRAP1_ENST00000372635.1_Missense_Mutation_p.M74I|NGFRAP1_ENST00000372634.1_Missense_Mutation_p.M64I			Q00994	BEX3_HUMAN	nerve growth factor receptor (TNFRSF16) associated protein 1	74	Interaction with 14-3-3 epsilon. {ECO:0000250}.|Interaction with p75NTR/NGFR. {ECO:0000250}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic signaling pathway (GO:0097190)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|metal ion binding (GO:0046872)			NS(2)|endometrium(1)|large_intestine(2)|lung(4)|urinary_tract(1)	10						TGGAGGAGATGAGAGAAATCA	0.448																																						dbGAP											0													155.0	150.0	152.0					X																	102632641		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF187064	CCDS14508.1, CCDS14509.1	Xq22.2	2014-03-21			ENSG00000166681	ENSG00000166681			13388	protein-coding gene	gene with protein product	"""brain expressed, X-linked 3"""	300361				10764727, 16221301, 2171551	Standard	NM_206915		Approved	BEX3, HGR74, Bex, NADE, DXS6984E	uc004ekj.1	Q00994	OTTHUMG00000022099	ENST00000372645.3:c.222G>A	X.37:g.102632641G>A	ENSP00000361728:p.Met74Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD17|D3DXA3|Q5JQT4|Q5JQT5	Missense_Mutation	SNP	pfam_TF_A-like/BEX-like,pirsf_BEX	p.M74I	ENST00000372645.3	37	c.222	CCDS14508.1	X	.	.	.	.	.	.	.	.	.	.	G	11.03	1.519041	0.27211	.	.	ENSG00000166681	ENST00000361298;ENST00000372645;ENST00000372635;ENST00000372634;ENST00000299872	T;T;T;T;T	0.09255	3.0;3.0;3.0;3.0;3.0	4.1	2.29	0.28610	.	0.000000	0.53938	D	0.000048	T	0.08537	0.0212	L	0.51914	1.62	0.25692	N	0.985672	B	0.02656	0.0	B	0.01281	0.0	T	0.31696	-0.9934	10	0.23891	T	0.37	-9.7113	4.5425	0.12066	0.1272:0.2253:0.6474:0.0	.	74	Q00994	BEX3_HUMAN	I	64;74;74;64;74	ENSP00000354843:M64I;ENSP00000361728:M74I;ENSP00000361718:M74I;ENSP00000361717:M64I;ENSP00000299872:M74I	ENSP00000299872:M74I	M	+	3	0	NGFRAP1	102519297	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.304000	0.33482	0.483000	0.27608	0.600000	0.82982	ATG	NGFRAP1	-	pfam_TF_A-like/BEX-like,pirsf_BEX	ENSG00000166681		0.448	NGFRAP1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NGFRAP1	HGNC	protein_coding	OTTHUMT00000057709.1	50	0.00	0	G	NM_014380		102632641	102632641	+1	no_errors	ENST00000299872	ensembl	human	known	69_37n	missense	21	41.67	15	SNP	1.000	A
TENM2	57451	genome.wustl.edu	37	5	167673880	167673880	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr5:167673880C>T	ENST00000518659.1	+	27	5975	c.5936C>T	c.(5935-5937)tCc>tTc	p.S1979F	TENM2_ENST00000519204.1_Missense_Mutation_p.S1858F|TENM2_ENST00000520394.1_Missense_Mutation_p.S1740F|TENM2_ENST00000545108.1_Missense_Mutation_p.S1978F|TENM2_ENST00000403607.2_Missense_Mutation_p.S1803F	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1979					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										ACACACACCTCCATCGGCTAC	0.527																																						dbGAP											0													125.0	133.0	130.0					5																	167673880		2115	4236	6351	-	-	-	SO:0001583	missense	0			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.5936C>T	5.37:g.167673880C>T	ENSP00000429430:p.Ser1979Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl,superfamily_Cytokine_IL1-like,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.S1979F	ENST00000518659.1	37	c.5936		5	.	.	.	.	.	.	.	.	.	.	C	21.4	4.137623	0.77775	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.91124	-2.32;-2.31;-2.43;-2.76;-2.79	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	D	0.95462	0.8526	M	0.78916	2.43	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.999;0.992	D	0.95770	0.8808	10	0.87932	D	0	.	19.0388	0.92989	0.0:1.0:0.0:0.0	.	1978;1979;1740	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	F	1979;1978;1858;1740;1803	ENSP00000429430:S1979F;ENSP00000438635:S1978F;ENSP00000428964:S1858F;ENSP00000427874:S1740F;ENSP00000384905:S1803F	ENSP00000384905:S1803F	S	+	2	0	ODZ2	167606458	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	7.818000	0.86416	2.512000	0.84698	0.491000	0.48974	TCC	ODZ2	-	superfamily_ConA-like_lec_gl	ENSG00000145934		0.527	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	ODZ2	HGNC	protein_coding	OTTHUMT00000376096.1	42	0.00	0	C	NM_001122679		167673880	167673880	+1	no_errors	ENST00000518659	ensembl	human	known	69_37n	missense	20	42.86	15	SNP	1.000	T
PDE1C	5137	genome.wustl.edu	37	7	31864536	31864536	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr7:31864536T>C	ENST00000396191.1	-	13	1806	c.1351A>G	c.(1351-1353)Agt>Ggt	p.S451G	PDE1C_ENST00000396193.1_Missense_Mutation_p.S511G|PDE1C_ENST00000396184.3_Missense_Mutation_p.S451G|PDE1C_ENST00000396182.2_Missense_Mutation_p.S451G|PDE1C_ENST00000321453.7_Missense_Mutation_p.S451G	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	451	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	ATTAATGGACTCACAATCTTC	0.507																																						dbGAP											0													187.0	157.0	167.0					7																	31864536		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.1351A>G	7.37:g.31864536T>C	ENSP00000379494:p.Ser451Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.S451G	ENST00000396191.1	37	c.1351	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	T	13.37	2.216884	0.39201	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03	5.82	4.56	0.56223	5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.397992	0.32093	N	0.006585	T	0.61961	0.2389	L	0.28115	0.83	0.31983	N	0.605646	B;B;B	0.15719	0.0;0.001;0.014	B;B;B	0.18263	0.003;0.008;0.021	T	0.59721	-0.7401	10	0.22706	T	0.39	.	7.616	0.28158	0.1358:0.0736:0.0:0.7906	.	451;511;451	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	G	511;451;451;451;451	ENSP00000379496:S511G;ENSP00000379494:S451G;ENSP00000318105:S451G;ENSP00000379487:S451G;ENSP00000379485:S451G	ENSP00000318105:S451G	S	-	1	0	PDE1C	31831061	1.000000	0.71417	1.000000	0.80357	0.925000	0.55904	4.577000	0.60922	2.228000	0.72767	0.533000	0.62120	AGT	PDE1C	-	pfam_PDEase_catalytic_dom	ENSG00000154678		0.507	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	57	0.00	0	T			31864536	31864536	-1	no_errors	ENST00000321453	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.997	C
PARP12	64761	genome.wustl.edu	37	7	139756696	139756696	+	Silent	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr7:139756696G>A	ENST00000263549.3	-	3	1593	c.720C>T	c.(718-720)ccC>ccT	p.P240P		NM_022750.2	NP_073587.1	Q9H0J9	PAR12_HUMAN	poly (ADP-ribose) polymerase family, member 12	240						nucleus (GO:0005634)	metal ion binding (GO:0046872)|NAD+ ADP-ribosyltransferase activity (GO:0003950)|poly(A) RNA binding (GO:0044822)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(1)	19	Melanoma(164;0.0142)					GCACTCTGCTGGGGGCAGAGC	0.547																																						dbGAP											0													73.0	77.0	76.0					7																	139756696		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136766	CCDS5857.1	7q34	2014-01-28	2005-06-02	2005-06-02	ENSG00000059378	ENSG00000059378		"""Zinc fingers, CCCH-type domain containing"", ""Poly (ADP-ribose) polymerases"""	21919	protein-coding gene	gene with protein product		612481	"""zinc finger CCCH-type domain containing 1"""	ZC3HDC1		11230166, 12851707	Standard	NM_022750		Approved	FLJ22693, PARP-12, ZC3H1	uc003vvl.1	Q9H0J9	OTTHUMG00000157315	ENST00000263549.3:c.720C>T	7.37:g.139756696G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H610|Q9NP36|Q9NTI3	Silent	SNP	pfam_Poly(ADP-ribose)pol_cat_dom,pfam_Znf_CCCH,smart_Znf_CCCH,pfscan_WWE-dom,pfscan_Poly(ADP-ribose)pol_cat_dom	p.P240	ENST00000263549.3	37	c.720	CCDS5857.1	7																																																																																			PARP12	-	NULL	ENSG00000059378		0.547	PARP12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PARP12	HGNC	protein_coding	OTTHUMT00000348413.1	42	0.00	0	G	NM_022750		139756696	139756696	-1	no_errors	ENST00000263549	ensembl	human	known	69_37n	silent	17	22.73	5	SNP	0.012	A
PDS5A	23244	genome.wustl.edu	37	4	39846302	39846302	+	Silent	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr4:39846302C>T	ENST00000303538.8	-	30	4061	c.3522G>A	c.(3520-3522)ctG>ctA	p.L1174L		NM_001100399.1	NP_001093869.1			PDS5, regulator of cohesion maintenance, homolog A (S. cerevisiae)											breast(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(9)|lung(14)|prostate(3)|skin(1)|urinary_tract(1)	39						TTGAAGGGTTCAGCTCTGAAT	0.393																																						dbGAP											0													181.0	179.0	180.0					4																	39846302		1869	4109	5978	-	-	-	SO:0001819	synonymous_variant	0			AF294791	CCDS47045.1, CCDS54759.1	4p14	2007-06-20			ENSG00000121892	ENSG00000121892			29088	protein-coding gene	gene with protein product		613200				11076961, 15855230	Standard	NM_001100399		Approved	KIAA0648, PIG54, SCC-112	uc003guv.4	Q29RF7	OTTHUMG00000160582	ENST00000303538.8:c.3522G>A	4.37:g.39846302C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_ARM-type_fold	p.L1174	ENST00000303538.8	37	c.3522	CCDS47045.1	4																																																																																			PDS5A	-	NULL	ENSG00000121892		0.393	PDS5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDS5A	HGNC	protein_coding	OTTHUMT00000361287.1	112	0.00	0	C	NM_015200		39846302	39846302	-1	no_errors	ENST00000303538	ensembl	human	known	69_37n	silent	62	27.06	23	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	27	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	22	53.19	25	SNP	1.000	G
PREX1	57580	genome.wustl.edu	37	20	47254270	47254270	+	Silent	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr20:47254270G>A	ENST00000371941.3	-	31	3947	c.3925C>T	c.(3925-3927)Ctg>Ttg	p.L1309L	PREX1_ENST00000396220.1_Silent_p.L1309L	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	1309					actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			AGCAAGGCCAGGAGCAGCTGG	0.647																																						dbGAP											0													54.0	41.0	46.0					20																	47254270		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.3925C>T	20.37:g.47254270G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Silent	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.L1309	ENST00000371941.3	37	c.3925	CCDS13410.1	20																																																																																			PREX1	-	NULL	ENSG00000124126		0.647	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	24	0.00	0	G	NM_020820		47254270	47254270	-1	no_errors	ENST00000371941	ensembl	human	known	69_37n	silent	19	26.92	7	SNP	0.995	A
PRG4	10216	genome.wustl.edu	37	1	186276542	186276544	+	In_Frame_Del	DEL	CTC	CTC	-			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	CTC	CTC					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr1:186276542_186276544delCTC	ENST00000445192.2	+	7	1736_1738	c.1691_1693delCTC	c.(1690-1695)actccc>acc	p.P565del	PRG4_ENST00000367486.3_In_Frame_Del_p.P522del|PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367485.4_In_Frame_Del_p.P472del|PRG4_ENST00000367483.4_In_Frame_Del_p.P524del	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	565	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						GCACCCACCACTCCCAAGGAGCC	0.64																																						dbGAP											0																																										-	-	-	SO:0001651	inframe_deletion	0			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1691_1693delCTC	1.37:g.186276542_186276544delCTC	ENSP00000399679:p.Pro565del	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	In_Frame_Del	DEL	pfam_Somatomedin_B_dom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Somatomedin_B_dom,smart_Hemopexin/matrixin_repeat,prints_Somatomedin_B_chordata,pfscan_Somatomedin_B_dom	p.P565in_frame_del	ENST00000445192.2	37	c.1691_1693	CCDS1369.1	1																																																																																			PRG4	-	NULL	ENSG00000116690		0.640	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	87	0.00	0	CTC	NM_005807		186276542	186276544	+1	no_errors	ENST00000445192	ensembl	human	known	69_37n	in_frame_del	78	10.34	9	DEL	0.000:0.001:0.001	-
RRNAD1	51093	genome.wustl.edu	37	1	156702141	156702141	+	Missense_Mutation	SNP	G	G	T	rs199633845	byFrequency	TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr1:156702141G>T	ENST00000368216.4	+	3	935	c.305G>T	c.(304-306)cGg>cTg	p.R102L	RRNAD1_ENST00000476229.1_5'UTR|RRNAD1_ENST00000368218.4_Missense_Mutation_p.R102L|RRNAD1_ENST00000524343.1_Silent_p.P60P	NM_015997.3	NP_057081.3	Q96FB5	RRNAD_HUMAN	ribosomal RNA adenine dimethylase domain containing 1	102						integral component of membrane (GO:0016021)	rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(3)	9						GCCTTTACCCGGATGCCTGGC	0.597																																						dbGAP											0													54.0	59.0	57.0					1																	156702141		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC011382	CCDS1154.1, CCDS44246.1	1q23.1	2011-01-28	2011-01-28	2011-01-28	ENSG00000143303	ENSG00000143303			24273	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 66"""	C1orf66		10810093, 310876	Standard	NM_015997		Approved	CGI-41	uc001fpu.3	Q96FB5	OTTHUMG00000041302	ENST00000368216.4:c.305G>T	1.37:g.156702141G>T	ENSP00000357199:p.Arg102Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVC7|Q4VX71|Q5SZ03|Q9Y358	Missense_Mutation	SNP	NULL	p.R102L	ENST00000368216.4	37	c.305	CCDS1154.1	1	.	.	.	.	.	.	.	.	.	.	G	20.8	4.051953	0.75960	.	.	ENSG00000143303	ENST00000368218;ENST00000368216;ENST00000519086	T	0.52754	0.65	4.63	4.63	0.57726	.	0.000000	0.64402	D	0.000001	T	0.64897	0.2640	M	0.79693	2.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.77557	0.99;0.99	T	0.70890	-0.4749	10	0.87932	D	0	-25.0114	16.1874	0.81962	0.0:0.0:1.0:0.0	.	102;102	Q4VX71;Q96FB5	.;RRNAD_HUMAN	L	102	ENSP00000357199:R102L	ENSP00000357199:R102L	R	+	2	0	RRNAD1	154968765	1.000000	0.71417	0.992000	0.48379	0.848000	0.48234	8.849000	0.92178	2.397000	0.81536	0.561000	0.74099	CGG	RRNAD1	-	NULL	ENSG00000143303		0.597	RRNAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRNAD1	HGNC	protein_coding	OTTHUMT00000098973.1	40	0.00	0	G	NM_015997		156702141	156702141	+1	no_errors	ENST00000368216	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	1.000	T
SDK2	54549	genome.wustl.edu	37	17	71427712	71427712	+	Missense_Mutation	SNP	G	G	C	rs572942777		TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr17:71427712G>C	ENST00000392650.3	-	11	1409	c.1409C>G	c.(1408-1410)gCg>gGg	p.A470G	SDK2_ENST00000388726.3_Missense_Mutation_p.A470G	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	470	Ig-like C2-type 5.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)		p.A470V(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GTAGGTCCCCGCATCGGAGAT	0.627																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											133.0	132.0	133.0					17																	71427712		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1409C>G	17.37:g.71427712G>C	ENSP00000376421:p.Ala470Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A470G	ENST00000392650.3	37	c.1409	CCDS45769.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.15|13.15	2.151700|2.151700	0.38021|0.38021	.|.	.|.	ENSG00000069188|ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893|ENST00000416616	T;T|.	0.68624|.	-0.34;-0.34|.	4.75|4.75	4.75|4.75	0.60458|0.60458	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);|.	0.132848|.	0.50627|.	D|.	0.000111|.	T|T	0.68632|0.68632	0.3022|0.3022	L|L	0.49513|0.49513	1.565|1.565	0.58432|0.58432	D|D	0.999998|0.999998	B;B|.	0.21905|.	0.058;0.062|.	B;B|.	0.35413|.	0.056;0.202|.	T|T	0.66929|0.66929	-0.5799|-0.5799	10|5	0.54805|.	T|.	0.06|.	.|.	17.3273|17.3273	0.87252|0.87252	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	470;470|.	Q58EX2-2;Q58EX2|.	.;SDK2_HUMAN|.	G|W	94;470;470;470|374	ENSP00000376421:A470G;ENSP00000373378:A470G|.	ENSP00000324967:A470G|.	A|C	-|-	2|3	0|2	SDK2|SDK2	68939307|68939307	1.000000|1.000000	0.71417|0.71417	0.072000|0.072000	0.20136|0.20136	0.021000|0.021000	0.10359|0.10359	7.146000|7.146000	0.77373|0.77373	2.165000|2.165000	0.68154|0.68154	0.467000|0.467000	0.42956|0.42956	GCG|TGC	SDK2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000069188		0.627	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	26	0.00	0	G	NM_019064		71427712	71427712	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	0.985	C
SLC5A11	115584	genome.wustl.edu	37	16	24869995	24869995	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr16:24869995C>A	ENST00000347898.3	+	2	653	c.31C>A	c.(31-33)Cca>Aca	p.P11T	SLC5A11_ENST00000539472.1_Intron|SLC5A11_ENST00000568579.1_Missense_Mutation_p.P11T|SLC5A11_ENST00000545376.1_Missense_Mutation_p.P11T|SLC5A11_ENST00000449109.2_Intron|SLC5A11_ENST00000424767.2_Missense_Mutation_p.P11T|SLC5A11_ENST00000565769.1_Intron|SLC5A11_ENST00000569071.1_Intron|SLC5A11_ENST00000567758.1_Missense_Mutation_p.P11T	NM_052944.3	NP_443176.2			solute carrier family 5 (sodium/inositol cotransporter), member 11											endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(30)|ovary(2)|prostate(2)|urinary_tract(1)	49				GBM - Glioblastoma multiforme(48;0.0365)		CCCTCAGCCTCCACAGTTAGA	0.562																																						dbGAP											0													101.0	81.0	88.0					16																	24869995		2197	4300	6497	-	-	-	SO:0001583	missense	0			AF292385	CCDS10625.1, CCDS58437.1, CCDS58438.1, CCDS58439.1, CCDS58440.1	16p12.1	2013-07-19	2013-07-19		ENSG00000158865	ENSG00000158865		"""Solute carriers"""	23091	protein-coding gene	gene with protein product		610238	"""solute carrier family 5 (sodium/glucose cotransporter), member 11"""			12039040, 12133831	Standard	NM_001258414		Approved	KST1, SMIT2, SGLT6	uc002dmu.4	Q8WWX8	OTTHUMG00000097003	ENST00000347898.3:c.31C>A	16.37:g.24869995C>A	ENSP00000289932:p.Pro11Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.P11T	ENST00000347898.3	37	c.31	CCDS10625.1	16	.	.	.	.	.	.	.	.	.	.	C	4.590	0.109540	0.08780	.	.	ENSG00000158865	ENST00000347898;ENST00000424767;ENST00000545376	D;D;D	0.86030	-1.92;-2.06;-2.04	5.59	-3.99	0.04069	.	1.162690	0.06057	N	0.657579	T	0.61073	0.2318	N	0.05158	-0.105	0.25789	N	0.984638	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.06405	0.0;0.002;0.001	T	0.50346	-0.8839	10	0.13853	T	0.58	.	0.7209	0.00940	0.2693:0.325:0.2001:0.2057	.	11;11;11	B7Z329;Q8WWX8-2;Q8WWX8	.;.;SC5AB_HUMAN	T	11	ENSP00000289932:P11T;ENSP00000416782:P11T;ENSP00000441384:P11T	ENSP00000289932:P11T	P	+	1	0	SLC5A11	24777496	0.000000	0.05858	0.003000	0.11579	0.225000	0.24961	-0.084000	0.11268	-0.546000	0.06216	-0.291000	0.09656	CCA	SLC5A11	-	NULL	ENSG00000158865		0.562	SLC5A11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A11	HGNC	protein_coding	OTTHUMT00000214091.3	43	0.00	0	C	NM_052944		24869995	24869995	+1	no_errors	ENST00000347898	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	0.008	A
SNTB1	6641	genome.wustl.edu	37	8	121644761	121644761	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr8:121644761C>T	ENST00000395601.3	-	4	1333	c.919G>A	c.(919-921)Gag>Aag	p.E307K	SNTB1_ENST00000519177.1_5'UTR|SNTB1_ENST00000517992.1_Missense_Mutation_p.E307K	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)	307					muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			TCTCTGACCTCAGCAATCACT	0.537																																						dbGAP											0													102.0	86.0	92.0					8																	121644761		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.919G>A	8.37:g.121644761C>T	ENSP00000378965:p.Glu307Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9E0|O14912|Q4KMG8	Missense_Mutation	SNP	pfam_PDZ,pfam_Pleckstrin_homology,superfamily_PDZ,smart_Pleckstrin_homology,smart_PDZ,pfscan_PDZ,pfscan_Pleckstrin_homology	p.E307K	ENST00000395601.3	37	c.919	CCDS6334.1	8	.	.	.	.	.	.	.	.	.	.	C	28.4	4.919657	0.92249	.	.	ENSG00000172164	ENST00000395601;ENST00000517992	T;T	0.40756	1.02;1.02	6.04	5.16	0.70880	.	0.139970	0.64402	D	0.000005	T	0.55130	0.1901	M	0.84948	2.725	0.80722	D	1	P;B	0.50066	0.931;0.161	P;B	0.48089	0.566;0.049	T	0.59354	-0.7470	10	0.25106	T	0.35	.	15.1963	0.73092	0.0:0.9328:0.0:0.0672	.	307;307	Q13884;Q13884-2	SNTB1_HUMAN;.	K	307	ENSP00000378965:E307K;ENSP00000431124:E307K	ENSP00000378965:E307K	E	-	1	0	SNTB1	121713942	0.958000	0.32768	0.876000	0.34364	0.987000	0.75469	2.010000	0.40913	1.557000	0.49525	0.561000	0.74099	GAG	SNTB1	-	NULL	ENSG00000172164		0.537	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTB1	HGNC	protein_coding	OTTHUMT00000381535.1	47	0.00	0	C	NM_021021		121644761	121644761	-1	no_errors	ENST00000395601	ensembl	human	known	69_37n	missense	18	43.75	14	SNP	0.989	T
ST7	7982	genome.wustl.edu	37	7	116863013	116863013	+	Silent	SNP	A	A	G			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr7:116863013A>G	ENST00000265437.5	+	16	1951	c.1737A>G	c.(1735-1737)caA>caG	p.Q579Q	ST7_ENST00000393451.3_Intron|ST7_ENST00000393447.4_Intron|ST7_ENST00000393444.3_Intron|ST7_ENST00000422922.1_Intron|ST7_ENST00000432298.1_Intron|ST7_ENST00000393446.2_Intron|ST7_ENST00000393449.1_Intron|ST7_ENST00000323984.3_Intron|ST7_ENST00000393443.1_Intron	NM_021908.2	NP_068708.1	Q9Y561	LRP12_HUMAN	suppression of tumorigenicity 7	0					endocytosis (GO:0006897)|receptor-mediated endocytosis (GO:0006898)|regulation of growth (GO:0040008)|signal transduction (GO:0007165)	coated pit (GO:0005905)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	low-density lipoprotein receptor activity (GO:0005041)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(2)|lung(5)|ovary(1)|skin(1)	21	all_cancers(3;3.88e-07)|all_epithelial(6;3.42e-07)|Lung NSC(10;0.00072)|all_lung(10;0.000847)		STAD - Stomach adenocarcinoma(10;0.000512)	LUSC - Lung squamous cell carcinoma(290;0.133)		Cggcacctcaatctcaacatt	0.498																																						dbGAP											0													101.0	99.0	100.0					7																	116863013		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ277291	CCDS5769.1, CCDS5770.1	7q31.2	2008-06-06			ENSG00000004866	ENSG00000004866			11351	protein-coding gene	gene with protein product		600833		FAM4A1		8105370, 8938430	Standard	NM_021908		Approved	TSG7, SEN4, ETS7q, HELG, RAY1, FAM4A	uc003vin.3	Q9NRC1	OTTHUMG00000023888	ENST00000265437.5:c.1737A>G	7.37:g.116863013A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K137|B4DRQ2	Silent	SNP	pfam_ST7	p.Q579	ENST00000265437.5	37	c.1737	CCDS5770.1	7																																																																																			ST7	-	NULL	ENSG00000004866		0.498	ST7-002	KNOWN	basic|CCDS	protein_coding	ST7	HGNC	protein_coding	OTTHUMT00000141622.1	68	0.00	0	A	NM_021908		116863013	116863013	+1	no_errors	ENST00000265437	ensembl	human	known	69_37n	silent	25	51.92	27	SNP	0.047	G
STOX2	56977	genome.wustl.edu	37	4	184922544	184922544	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr4:184922544T>A	ENST00000308497.4	+	2	1668	c.233T>A	c.(232-234)cTc>cAc	p.L78H	STOX2_ENST00000438269.1_Missense_Mutation_p.L78H|STOX2_ENST00000511250.1_3'UTR	NM_020225.1	NP_064610.1	Q9P2F5	STOX2_HUMAN	storkhead box 2	78					embryo development (GO:0009790)|maternal placenta development (GO:0001893)					breast(1)|endometrium(7)|lung(6)	14		all_lung(41;1.89e-12)|Lung NSC(41;3.48e-12)|Colorectal(36;0.00435)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|all_hematologic(60;0.027)|Prostate(90;0.0283)		all cancers(43;2.85e-26)|Epithelial(43;2.27e-22)|OV - Ovarian serous cystadenocarcinoma(60;3.4e-10)|Colorectal(24;8.23e-06)|GBM - Glioblastoma multiforme(59;1.64e-05)|STAD - Stomach adenocarcinoma(60;3.6e-05)|COAD - Colon adenocarcinoma(29;4.37e-05)|LUSC - Lung squamous cell carcinoma(40;0.008)|READ - Rectum adenocarcinoma(43;0.227)		GGGGAGATCCTCTGCTTGGCC	0.507																																						dbGAP											0													95.0	92.0	93.0					4																	184922544		2050	4201	6251	-	-	-	SO:0001583	missense	0			AB037813	CCDS47167.1	4q35.1	2014-09-11			ENSG00000173320	ENSG00000173320			25450	protein-coding gene	gene with protein product							Standard	XM_005263142		Approved	DKFZp762K222	uc003ivz.1	Q9P2F5	OTTHUMG00000160618	ENST00000308497.4:c.233T>A	4.37:g.184922544T>A	ENSP00000311257:p.Leu78His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8U4|Q9NPS8	Missense_Mutation	SNP	pfam_Storkhead-box_winged-helix	p.L78H	ENST00000308497.4	37	c.233	CCDS47167.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	27.9|27.9	4.871442|4.871442	0.91587|0.91587	.|.	.|.	ENSG00000173320|ENSG00000173320	ENST00000308497;ENST00000438269;ENST00000512520|ENST00000513034	D;D;D|.	0.84223|.	-1.82;-1.82;-1.82|.	5.81|5.81	5.81|5.81	0.92471|0.92471	Storkhead-box protein, winged-helix domain (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.74336|0.74336	0.3703|0.3703	M|M	0.71206|0.71206	2.165|2.165	0.80722|0.80722	D|D	1|1	D|.	0.89917|.	1.0|.	D|.	0.91635|.	0.999|.	T|T	0.74147|0.74147	-0.3759|-0.3759	10|5	0.87932|.	D|.	0|.	-13.5722|-13.5722	16.1721|16.1721	0.81825|0.81825	0.0:0.0:0.0:1.0|0.0:0.0:0.0:1.0	.|.	78|.	Q9P2F5|.	STOX2_HUMAN|.	H|T	78;78;16|23	ENSP00000311257:L78H;ENSP00000390127:L78H;ENSP00000425388:L16H|.	ENSP00000311257:L78H|.	L|S	+|+	2|1	0|0	STOX2|STOX2	185159538|185159538	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	8.010000|8.010000	0.88615|0.88615	2.232000|2.232000	0.73038|0.73038	0.533000|0.533000	0.62120|0.62120	CTC|TCT	STOX2	-	pfam_Storkhead-box_winged-helix	ENSG00000173320		0.507	STOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STOX2	HGNC	protein_coding	OTTHUMT00000361433.3	35	0.00	0	T	NM_020225		184922544	184922544	+1	no_errors	ENST00000308497	ensembl	human	known	69_37n	missense	7	75.86	22	SNP	1.000	A
TBC1D17	79735	genome.wustl.edu	37	19	50381800	50381800	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr19:50381800G>A	ENST00000221543.5	+	3	465	c.166G>A	c.(166-168)Gat>Aat	p.D56N	TBC1D17_ENST00000598789.1_3'UTR|AKT1S1_ENST00000482622.1_5'Flank|AKT1S1_ENST00000391834.2_5'Flank|AKT1S1_ENST00000344175.5_5'Flank|AKT1S1_ENST00000391831.1_5'Flank|AKT1S1_ENST00000391832.3_5'Flank|TBC1D17_ENST00000535102.2_Missense_Mutation_p.D23N|AKT1S1_ENST00000391835.1_5'Flank	NM_024682.2	NP_078958	Q9HA65	TBC17_HUMAN	TBC1 domain family, member 17	56					autophagy (GO:0006914)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	Rab GTPase activator activity (GO:0005097)			NS(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	15		all_lung(116;0.000338)|Lung NSC(112;0.000446)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0116)|OV - Ovarian serous cystadenocarcinoma(262;0.017)		GGAGGCTGGAGATTCCACCCA	0.542																																						dbGAP											0													103.0	97.0	99.0					19																	50381800		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK090606	CCDS12785.1, CCDS54294.1	19q13.33	2013-07-09				ENSG00000104946			25699	protein-coding gene	gene with protein product						22854040	Standard	NM_024682		Approved	FLJ12168	uc002pqo.3	Q9HA65		ENST00000221543.5:c.166G>A	19.37:g.50381800G>A	ENSP00000221543:p.Asp56Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DT12|B9A6L8|F5H1W7	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.D56N	ENST00000221543.5	37	c.166	CCDS12785.1	19	.	.	.	.	.	.	.	.	.	.	G	32	5.126197	0.94429	.	.	ENSG00000104946	ENST00000221543;ENST00000535102	T;T	0.37752	1.18;1.18	5.82	5.82	0.92795	Domain of unknown function DUF3548 (1);	0.301676	0.36740	N	0.002422	T	0.50565	0.1623	L	0.43152	1.355	0.42286	D	0.992114	D;P	0.69078	0.997;0.943	D;P	0.71184	0.972;0.775	T	0.29912	-0.9996	10	0.28530	T	0.3	-16.8197	15.597	0.76590	0.0:0.0:1.0:0.0	.	23;56	F5H1W7;Q9HA65	.;TBC17_HUMAN	N	56;23	ENSP00000221543:D56N;ENSP00000446323:D23N	ENSP00000221543:D56N	D	+	1	0	TBC1D17	55073612	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.836000	0.69375	2.761000	0.94854	0.561000	0.74099	GAT	TBC1D17	-	pfam_DUF3548	ENSG00000104946		0.542	TBC1D17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D17	HGNC	protein_coding	OTTHUMT00000466404.1	39	0.00	0	G	NM_024682		50381800	50381800	+1	no_errors	ENST00000221543	ensembl	human	known	69_37n	missense	24	46.67	21	SNP	1.000	A
TCF20	6942	genome.wustl.edu	37	22	42608681	42608681	+	Silent	SNP	G	G	A			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr22:42608681G>A	ENST00000359486.3	-	1	2767	c.2631C>T	c.(2629-2631)gtC>gtT	p.V877V	TCF20_ENST00000404876.1_5'Flank|TCF20_ENST00000335626.4_Silent_p.V877V	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	877					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						CTGGGTCCCTGACAATCTGTC	0.488																																						dbGAP											0													67.0	67.0	67.0					22																	42608681		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.2631C>T	22.37:g.42608681G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Silent	SNP	smart_Znf_PHD	p.V877	ENST00000359486.3	37	c.2631	CCDS14033.1	22																																																																																			TCF20	-	NULL	ENSG00000100207		0.488	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	36	0.00	0	G	NM_181492		42608681	42608681	-1	no_errors	ENST00000359486	ensembl	human	known	69_37n	silent	13	43.48	10	SNP	1.000	A
TSPYL1	7259	genome.wustl.edu	37	6	116600543	116600543	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr6:116600543C>T	ENST00000368608.3	-	1	523	c.451G>A	c.(451-453)Gag>Aag	p.E151K	RP1-93H18.1_ENST00000449314.1_lincRNA|DSE_ENST00000452085.3_5'Flank|DSE_ENST00000540275.1_Intron	NM_003309.3	NP_003300.1	Q9H0U9	TSYL1_HUMAN	TSPY-like 1	151					nucleosome assembly (GO:0006334)	nucleus (GO:0005634)	enzyme binding (GO:0019899)			breast(1)|endometrium(2)|large_intestine(2)|lung(2)|ovary(3)|urinary_tract(1)	11		all_cancers(87;0.0144)|all_epithelial(87;0.021)|Colorectal(196;0.234)		all cancers(137;0.0235)|OV - Ovarian serous cystadenocarcinoma(136;0.0469)|GBM - Glioblastoma multiforme(226;0.0503)|Epithelial(106;0.094)		TCCTCCGCCTCAGCCTCCGCC	0.647																																						dbGAP											0													50.0	56.0	54.0					6																	116600543		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF042181	CCDS34518.1	6q22.1	2014-09-17	2004-04-05	2004-04-07	ENSG00000189241	ENSG00000189241			12382	protein-coding gene	gene with protein product		604714	"""TSPY-like"""	TSPYL		9730615	Standard	NM_003309		Approved		uc003pwp.4	Q9H0U9	OTTHUMG00000015427	ENST00000368608.3:c.451G>A	6.37:g.116600543C>T	ENSP00000357597:p.Glu151Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O75885|Q5TFE6	Missense_Mutation	SNP	pfam_NAP_family	p.E151K	ENST00000368608.3	37	c.451	CCDS34518.1	6	.	.	.	.	.	.	.	.	.	.	C	5.480	0.273570	0.10403	.	.	ENSG00000189241	ENST00000368608;ENST00000545830	T	0.18016	2.24	3.86	-6.56	0.01848	.	.	.	.	.	T	0.00754	0.0025	N	0.00729	-1.24	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.44452	-0.9327	9	0.02654	T	1	-5.1004	7.7437	0.28856	0.0:0.4718:0.3448:0.1834	.	151	Q9H0U9	TSYL1_HUMAN	K	151	ENSP00000357597:E151K	ENSP00000357597:E151K	E	-	1	0	TSPYL1	116707236	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.092000	0.11129	-1.328000	0.02261	0.313000	0.20887	GAG	TSPYL1	-	NULL	ENSG00000189241		0.647	TSPYL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPYL1	HGNC	protein_coding	OTTHUMT00000041929.1	17	0.00	0	C			116600543	116600543	-1	no_errors	ENST00000368608	ensembl	human	known	69_37n	missense	12	42.86	9	SNP	0.000	T
ZFAND2B	130617	genome.wustl.edu	37	2	220073995	220073995	+	Silent	SNP	C	C	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr2:220073995C>T	ENST00000289528.5	+	9	936	c.741C>T	c.(739-741)cgC>cgT	p.R247R	ZFAND2B_ENST00000409336.1_Silent_p.R247R|ZFAND2B_ENST00000409594.1_3'UTR|ZFAND2B_ENST00000444522.2_3'UTR|ZFAND2B_ENST00000409097.1_3'UTR	NM_001270998.1|NM_001270999.1|NM_138802.2	NP_001257927.1|NP_001257928.1|NP_620157.1	Q8WV99	ZFN2B_HUMAN	zinc finger, AN1-type domain 2B	247						endoplasmic reticulum (GO:0005783)	zinc ion binding (GO:0008270)			endometrium(2)|kidney(4)|lung(4)|upper_aerodigestive_tract(1)	11		Renal(207;0.0915)		Epithelial(149;1.16e-06)|all cancers(144;0.000191)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		CCCAGAGCCGCAGCTCGAAGC	0.602																																						dbGAP											0													58.0	56.0	56.0					2																	220073995		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK074571	CCDS2435.1, CCDS74656.1	2q35	2010-04-23	2005-08-22		ENSG00000158552	ENSG00000158552		"""Zinc fingers, AN1-type domain containing"""	25206	protein-coding gene	gene with protein product	"""arsenite inducible RNA associated protein-like"""	613474	"""zinc finger, AN1-type 2B"""			18467495	Standard	NM_138802		Approved	AIRAPL	uc002vka.4	Q8WV99	OTTHUMG00000133135	ENST00000289528.5:c.741C>T	2.37:g.220073995C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NB98	Nonsense_Mutation	SNP	pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif	p.Q37*	ENST00000289528.5	37	c.109	CCDS2435.1	2	.	.	.	.	.	.	.	.	.	.	C	10.92	1.486066	0.26686	.	.	ENSG00000158552	ENST00000425849	.	.	.	5.54	1.28	0.21552	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-18.3019	6.9638	0.24611	0.1479:0.616:0.0:0.236	.	.	.	.	X	37	.	.	Q	+	1	0	ZFAND2B	219782239	0.996000	0.38824	1.000000	0.80357	0.633000	0.38033	0.233000	0.17911	0.297000	0.22615	-1.008000	0.02478	CAG	ZFAND2B	-	NULL	ENSG00000158552		0.602	ZFAND2B-001	KNOWN	basic|CCDS	protein_coding	ZFAND2B	HGNC	protein_coding	OTTHUMT00000256824.2	38	0.00	0	C	NM_138802		220073995	220073995	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000425849	ensembl	human	putative	69_37n	nonsense	27	20.59	7	SNP	0.997	T
ZNF442	79973	genome.wustl.edu	37	19	12461860	12461860	+	Missense_Mutation	SNP	C	C	T	rs547916207		TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr19:12461860C>T	ENST00000242804.4	-	6	1121	c.539G>A	c.(538-540)cGc>cAc	p.R180H	ZNF442_ENST00000438182.1_Missense_Mutation_p.R111H	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	180					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						ACAATCATAGCGTTTCTTTCC	0.413													C|||	1	0.000199681	0.0008	0.0	5008	,	,		22417	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													223.0	206.0	212.0					19																	12461860		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.539G>A	19.37:g.12461860C>T	ENSP00000242804:p.Arg180His	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DJ48	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R180H	ENST00000242804.4	37	c.539	CCDS12271.1	19	.	.	.	.	.	.	.	.	.	.	C	12.85	2.062478	0.36373	.	.	ENSG00000198342	ENST00000242804;ENST00000438182;ENST00000424168	T;T;T	0.28666	1.6;4.72;2.43	0.832	-1.66	0.08265	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.17704	0.0425	N	0.20483	0.58	0.09310	N	1	D	0.57571	0.98	B	0.44163	0.443	T	0.12091	-1.0561	9	0.72032	D	0.01	.	3.8229	0.08843	0.0:0.4926:0.2865:0.2209	.	180	Q9H7R0	ZN442_HUMAN	H	180;111;111	ENSP00000242804:R180H;ENSP00000388634:R111H;ENSP00000404935:R111H	ENSP00000242804:R180H	R	-	2	0	ZNF442	12322860	0.013000	0.17824	0.006000	0.13384	0.708000	0.40852	0.344000	0.19962	-0.913000	0.03832	0.313000	0.20887	CGC	ZNF442	-	NULL	ENSG00000198342		0.413	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF442	HGNC	protein_coding	OTTHUMT00000344109.1	117	0.00	0	C	NM_030824		12461860	12461860	-1	no_errors	ENST00000242804	ensembl	human	known	69_37n	missense	61	29.07	25	SNP	0.005	T
ZNF585A	199704	genome.wustl.edu	37	19	37643456	37643456	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr19:37643456A>C	ENST00000356958.4	-	5	1603	c.1345T>G	c.(1345-1347)Tcc>Gcc	p.S449A	ZNF585A_ENST00000292841.5_Missense_Mutation_p.S394A|ZNF585A_ENST00000588723.1_Intron|ZNF585A_ENST00000392157.2_Missense_Mutation_p.S394A|ZNF585A_ENST00000355533.2_Intron			Q6P3V2	Z585A_HUMAN	zinc finger protein 585A	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|central_nervous_system(1)|endometrium(2)|large_intestine(17)|lung(11)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TGCGACTTGGAGGTAAACAAT	0.418																																						dbGAP											0													122.0	118.0	119.0					19																	37643456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK074345	CCDS12499.1, CCDS74353.1	19q13.13	2013-01-08				ENSG00000196967		"""Zinc fingers, C2H2-type"", ""-"""	26305	protein-coding gene	gene with protein product						12477932	Standard	NM_199126		Approved	FLJ23765	uc002ofn.1	Q6P3V2		ENST00000356958.4:c.1345T>G	19.37:g.37643456A>C	ENSP00000349440:p.Ser449Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TE95|Q96MV3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S449A	ENST00000356958.4	37	c.1345		19	.	.	.	.	.	.	.	.	.	.	A	8.511	0.866507	0.17250	.	.	ENSG00000196967	ENST00000356958;ENST00000292841;ENST00000392157	T;T;T	0.20069	2.1;2.1;2.1	2.72	1.54	0.23209	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.37012	N	0.002286	T	0.24160	0.0585	L	0.39397	1.21	0.09310	N	1	P	0.50819	0.939	P	0.60012	0.867	T	0.07635	-1.0762	10	0.19147	T	0.46	.	5.2369	0.15450	0.6966:0.3034:0.0:0.0	.	449	Q6P3V2	Z585A_HUMAN	A	449;394;394	ENSP00000349440:S449A;ENSP00000292841:S394A;ENSP00000375998:S394A	ENSP00000292841:S394A	S	-	1	0	ZNF585A	42335296	0.000000	0.05858	0.993000	0.49108	0.837000	0.47467	-0.427000	0.06999	1.244000	0.43870	0.459000	0.35465	TCC	ZNF585A	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196967		0.418	ZNF585A-001	KNOWN	basic|appris_principal	protein_coding	ZNF585A	HGNC	protein_coding	OTTHUMT00000457980.2	73	0.00	0	A	NM_152655		37643456	37643456	-1	no_errors	ENST00000356958	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	0.001	C
ZNF525	170958	genome.wustl.edu	37	19	53885220	53885220	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A1HE-01A-11D-A188-09	TCGA-C8-A1HE-10A-01D-A13O-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	8314bada-5bd3-4cd2-b308-4cb2db64de94	73d1406e-7588-4ba8-9900-8ff69d65b2bd	g.chr19:53885220G>T	ENST00000355326.3	+	1	542	c.542G>T	c.(541-543)gGa>gTa	p.G181V	ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000467003.1_Missense_Mutation_p.G427V|ZNF525_ENST00000475179.1_Intron|ZNF525_ENST00000474037.1_Missense_Mutation_p.G463V			Q8N782	ZN525_HUMAN	zinc finger protein 525	181					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						CTTCATAGTGGAGAGAAACCT	0.378																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277	ENST00000355326.3:c.542G>T	19.37:g.53885220G>T	ENSP00000408929:p.Gly181Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TF23	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G181V	ENST00000355326.3	37	c.542		19	.	.	.	.	.	.	.	.	.	.	G	13.07	2.126362	0.37533	.	.	ENSG00000203326	ENST00000474037;ENST00000467003;ENST00000355326	T;T;T	0.23552	1.9;1.9;1.9	1.49	0.263	0.15602	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.44435	0.1293	.	.	.	0.42989	D	0.994485	D	0.89917	1.0	D	0.87578	0.998	T	0.34875	-0.9811	8	0.87932	D	0	.	6.7679	0.23576	0.1737:0.0:0.8263:0.0	.	181	Q8N782	ZN525_HUMAN	V	463;427;181	ENSP00000417696:G463V;ENSP00000419136:G427V;ENSP00000408929:G181V	ENSP00000408929:G181V	G	+	2	0	ZNF525	58577032	0.964000	0.33143	0.000000	0.03702	0.016000	0.09150	1.622000	0.36997	-0.050000	0.13356	0.195000	0.17529	GGA	ZNF525	-	pfscan_Znf_C2H2	ENSG00000203326		0.378	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		22	0.00	0	G	NR_003699		53885220	53885220	+1	no_errors	ENST00000355326	ensembl	human	known	69_37n	missense	15	31.82	7	SNP	0.995	T
