#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCC9	10060	genome.wustl.edu	37	12	22063221	22063221	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr12:22063221C>G	ENST00000261201.4	-	8	1189	c.1190G>C	c.(1189-1191)aGg>aCg	p.R397T	ABCC9_ENST00000261200.4_Missense_Mutation_p.R397T|ABCC9_ENST00000345162.2_Missense_Mutation_p.R397T	NM_005691.2	NP_005682.2	O60706	ABCC9_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 9	397	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				defense response to virus (GO:0051607)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	ATP-sensitive potassium channel complex (GO:0008282)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcomere (GO:0030017)|voltage-gated potassium channel complex (GO:0008076)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|ion channel binding (GO:0044325)|potassium channel activity (GO:0005267)|potassium channel regulator activity (GO:0015459)|sulfonylurea receptor activity (GO:0008281)|transporter activity (GO:0005215)			NS(2)|breast(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(15)|lung(56)|ovary(4)|pancreas(1)|prostate(4)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(5)	118					Adenosine triphosphate(DB00171)|Glyburide(DB01016)	CGTAGAGAGCCTAAGGATTTT	0.343																																						dbGAP											0													88.0	89.0	89.0					12																	22063221		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061323	CCDS8693.1, CCDS8694.1	12p12.1	2014-09-17			ENSG00000069431	ENSG00000069431		"""ATP binding cassette transporters / subfamily C"""	60	protein-coding gene	gene with protein product	"""sulfonylurea receptor 2"""	601439				9457174, 15034580	Standard	NM_020297		Approved	SUR2, CMD1O	uc001rfh.3	O60706	OTTHUMG00000169094	ENST00000261201.4:c.1190G>C	12.37:g.22063221C>G	ENSP00000261201:p.Arg397Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O60707	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_Sulphorea_rcpt,prints_Sulphonylurea_rcpt-2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.R397T	ENST00000261201.4	37	c.1190	CCDS8694.1	12	.	.	.	.	.	.	.	.	.	.	C	17.08	3.298270	0.60195	.	.	ENSG00000069431	ENST00000261200;ENST00000544039;ENST00000261201;ENST00000345162	D;D;D;D	0.95272	-3.66;-3.66;-3.66;-3.66	5.66	5.66	0.87406	ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);ABC transporter, transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.96510	0.8861	L	0.58669	1.825	0.58432	D	0.99999	D;D	0.76494	0.958;0.999	P;D	0.71184	0.875;0.972	D	0.95507	0.8582	10	0.38643	T	0.18	-15.8242	19.7509	0.96268	0.0:1.0:0.0:0.0	.	397;397	O60706;O60706-2	ABCC9_HUMAN;.	T	397;60;397;397	ENSP00000261200:R397T;ENSP00000440521:R60T;ENSP00000261201:R397T;ENSP00000261202:R397T	ENSP00000261200:R397T	R	-	2	0	ABCC9	21954488	1.000000	0.71417	0.930000	0.37139	0.898000	0.52572	4.044000	0.57361	2.664000	0.90586	0.650000	0.86243	AGG	ABCC9	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000069431		0.343	ABCC9-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	ABCC9	HGNC	protein_coding	OTTHUMT00000402230.1	67	0.00	0	C	NM_005691		22063221	22063221	-1	no_errors	ENST00000261200	ensembl	human	known	69_37n	missense	28	47.17	25	SNP	1.000	G
ALMS1	7840	genome.wustl.edu	37	2	73659408	73659408	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr2:73659408A>C	ENST00000264448.6	+	7	1532	c.1421A>C	c.(1420-1422)cAt>cCt	p.H474P	ALMS1_ENST00000377715.1_Missense_Mutation_p.H474P|ALMS1_ENST00000409009.1_Missense_Mutation_p.H432P	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	474					endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						GCTCCTAAACATTTAAAAGCA	0.363																																						dbGAP											0													75.0	70.0	72.0					2																	73659408		1842	4090	5932	-	-	-	SO:0001583	missense	0			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.1421A>C	2.37:g.73659408A>C	ENSP00000264448:p.His474Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Missense_Mutation	SNP	NULL	p.H474P	ENST00000264448.6	37	c.1421	CCDS42697.1	2	.	.	.	.	.	.	.	.	.	.	A	9.607	1.130212	0.21041	.	.	ENSG00000116127	ENST00000409009;ENST00000264448;ENST00000377715	T;T;T	0.21932	2.87;2.86;1.98	4.41	1.93	0.25924	.	0.885835	0.09553	N	0.786640	T	0.19046	0.0457	N	0.22421	0.69	0.09310	N	1	D;D	0.60160	0.987;0.987	P;P	0.52217	0.693;0.693	T	0.13442	-1.0509	10	0.56958	D	0.05	.	3.1771	0.06572	0.6798:0.0:0.1168:0.2034	.	432;474	B8ZZJ3;Q8TCU4	.;ALMS1_HUMAN	P	432;474;474	ENSP00000386627:H432P;ENSP00000264448:H474P;ENSP00000366944:H474P	ENSP00000264448:H474P	H	+	2	0	ALMS1	73512916	0.004000	0.15560	0.001000	0.08648	0.264000	0.26372	0.590000	0.23954	0.426000	0.26116	0.379000	0.24179	CAT	ALMS1	-	NULL	ENSG00000116127		0.363	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	41	0.00	0	A	NM_015120		73659408	73659408	+1	no_errors	ENST00000264448	ensembl	human	known	69_37n	missense	37	19.57	9	SNP	0.001	C
AMPD1	270	genome.wustl.edu	37	1	115223011	115223011	+	Silent	SNP	G	G	A	rs181412206		TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr1:115223011G>A	ENST00000520113.2	-	6	750	c.735C>T	c.(733-735)gaC>gaT	p.D245D	AMPD1_ENST00000369538.3_Silent_p.D241D|AMPD1_ENST00000353928.6_Silent_p.D212D			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	245					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	AAACTACACCGTCCTTCATTT	0.448													G|||	1	0.000199681	0.0	0.0	5008	,	,		19198	0.0		0.001	False		,,,				2504	0.0					dbGAP											0													169.0	159.0	163.0					1																	115223011		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.735C>T	1.37:g.115223011G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Silent	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.D245	ENST00000520113.2	37	c.735	CCDS876.2	1																																																																																			AMPD1	-	pirsf_AMP_deaminase,tigrfam_AMP_deaminase	ENSG00000116748		0.448	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	61	0.00	0	G			115223011	115223011	-1	no_errors	ENST00000520113	ensembl	human	known	69_37n	silent	26	29.73	11	SNP	0.460	A
ARNTL2	56938	genome.wustl.edu	37	12	27533206	27533206	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr12:27533206G>A	ENST00000266503.5	+	5	371	c.353G>A	c.(352-354)cGg>cAg	p.R118Q	ARNTL2_ENST00000546179.1_Missense_Mutation_p.R81Q|ARNTL2_ENST00000395901.2_Missense_Mutation_p.R81Q|ARNTL2_ENST00000311001.5_Missense_Mutation_p.R104Q|ARNTL2_ENST00000542388.1_Missense_Mutation_p.R33Q|ARNTL2_ENST00000261178.5_Missense_Mutation_p.R70Q|ARNTL2_ENST00000544915.1_Missense_Mutation_p.R84Q			Q8WYA1	BMAL2_HUMAN	aryl hydrocarbon receptor nuclear translocator-like 2	118	Interaction with PER2. {ECO:0000250|UniProtKB:Q2VPD4}.|bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				circadian rhythm (GO:0007623)|entrainment of circadian clock (GO:0009649)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	E-box binding (GO:0070888)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity (GO:0000982)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(1)|skin(2)|urinary_tract(1)	21	Colorectal(261;0.0847)|Lung SC(9;0.184)					ACTGAAAAGCGGAGGAGAGAT	0.443																																						dbGAP											0													85.0	77.0	80.0					12																	27533206		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF246961	CCDS8712.1, CCDS58219.1, CCDS58220.1, CCDS58221.1, CCDS58222.1	12p12.2-p11.2	2013-05-21			ENSG00000029153	ENSG00000029153		"""Basic helix-loop-helix proteins"""	18984	protein-coding gene	gene with protein product		614517				10864977, 10964693	Standard	NM_020183		Approved	BMAL2, MOP9, CLIF, PASD9, bHLHe6	uc001rht.2	Q8WYA1	OTTHUMG00000169257	ENST00000266503.5:c.353G>A	12.37:g.27533206G>A	ENSP00000266503:p.Arg118Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z429|F5H402|Q8WYA2|Q8WYA3|Q8WYA4|Q96J63|Q9H2M4|Q9NS70|Q9NYQ4|Q9NYQ5	Missense_Mutation	SNP	pfam_PAS_fold,pfam_PAS_fold_3,pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_DNA-bd,tigrfam_PAS	p.R118Q	ENST00000266503.5	37	c.353	CCDS8712.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	26.7|26.7	4.764290|4.764290	0.89932|0.89932	.|.	.|.	ENSG00000029153|ENSG00000029153	ENST00000457040|ENST00000544915;ENST00000395901;ENST00000546179;ENST00000311001;ENST00000261178;ENST00000266503;ENST00000542388	.|D;D;D;D;D;D;D	.|0.98280	.|-4.84;-4.84;-4.84;-4.84;-4.84;-4.84;-4.84	3.33|3.33	3.33|3.33	0.38152|0.38152	.|Helix-loop-helix DNA-binding (5);	.|0.088650	.|0.46145	.|D	.|0.000317	D|D	0.98460|0.98460	0.9487|0.9487	M|M	0.68317|0.68317	2.08|2.08	0.53005|0.53005	D|D	0.999965|0.999965	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;1.0;1.0;1.0;1.0	.|D;D;D;D;D;D	.|0.79784	.|0.981;0.989;0.981;0.981;0.954;0.993	D|D	0.98891|0.98891	1.0773|1.0773	5|10	.|0.87932	.|D	.|0	.|.	13.3852|13.3852	0.60791|0.60791	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|81;84;81;70;104;118	.|F5H402;Q8WYA1-5;Q8WYA1-3;Q8WYA1-4;Q8WYA1-2;Q8WYA1	.|.;.;.;.;.;BMAL2_HUMAN	R|Q	70|84;81;81;104;70;118;33	.|ENSP00000442438:R84Q;ENSP00000379238:R81Q;ENSP00000438545:R81Q;ENSP00000312247:R104Q;ENSP00000261178:R70Q;ENSP00000266503:R118Q;ENSP00000445836:R33Q	.|ENSP00000261178:R70Q	G|R	+|+	1|2	0|0	ARNTL2|ARNTL2	27424473|27424473	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.982000|0.982000	0.71751|0.71751	6.612000|6.612000	0.74187|0.74187	1.888000|1.888000	0.54679|0.54679	0.655000|0.655000	0.94253|0.94253	GGA|CGG	ARNTL2	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000029153		0.443	ARNTL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARNTL2	HGNC	protein_coding	OTTHUMT00000403162.1	72	0.00	0	G	NM_020183		27533206	27533206	+1	no_errors	ENST00000266503	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	1.000	A
CDH24	64403	genome.wustl.edu	37	14	23521744	23521744	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr14:23521744G>T	ENST00000267383.5	-	7	1393	c.1301C>A	c.(1300-1302)gCa>gAa	p.A434E	CDH24_ENST00000485922.1_5'Flank|CDH24_ENST00000554034.1_Missense_Mutation_p.A434E|CDH24_ENST00000487137.2_Missense_Mutation_p.A434E|CDH24_ENST00000397359.3_Missense_Mutation_p.A434E			Q86UP0	CAD24_HUMAN	cadherin 24, type 2	434	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|delta-catenin binding (GO:0070097)			breast(1)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(6)|lung(5)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	26	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.00654)		CAGGGGTGCTGCTGTATGGAT	0.637																																						dbGAP											0													82.0	75.0	77.0					14																	23521744		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL137477	CCDS9585.1, CCDS9586.1	14q11.2	2010-08-20	2009-11-20		ENSG00000139880	ENSG00000139880		"""Cadherins / Major cadherins"""	14265	protein-coding gene	gene with protein product			"""cadherin-like 24"""			12734196	Standard	NM_022478		Approved	CDH11L	uc001wil.3	Q86UP0	OTTHUMG00000028715	ENST00000267383.5:c.1301C>A	14.37:g.23521744G>T	ENSP00000267383:p.Ala434Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS44|Q86UP1|Q9NT84	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A434E	ENST00000267383.5	37	c.1301	CCDS9585.1	14	.	.	.	.	.	.	.	.	.	.	G	10.43	1.347259	0.24426	.	.	ENSG00000139880	ENST00000397359;ENST00000487137;ENST00000554034;ENST00000267383	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	4.83	2.94	0.34122	Cadherin (4);Cadherin-like (1);	0.413925	0.23924	N	0.043208	T	0.40398	0.1115	L	0.50919	1.6	0.09310	N	1	B;P;P	0.45986	0.063;0.87;0.615	B;P;P	0.45577	0.188;0.474;0.486	T	0.16100	-1.0414	10	0.21540	T	0.41	.	5.6399	0.17559	0.1868:0.1601:0.6531:0.0	.	434;434;434	Q86UP0-2;Q96LQ7;Q86UP0	.;.;CAD24_HUMAN	E	434	ENSP00000380517:A434E;ENSP00000434821:A434E;ENSP00000452493:A434E;ENSP00000267383:A434E	ENSP00000267383:A434E	A	-	2	0	CDH24	22591584	0.009000	0.17119	0.578000	0.28575	0.255000	0.26057	1.688000	0.37690	0.591000	0.29711	0.561000	0.74099	GCA	CDH24	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000139880		0.637	CDH24-006	KNOWN	basic|CCDS	protein_coding	CDH24	HGNC	protein_coding	OTTHUMT00000257241.2	36	0.00	0	G	NM_022478		23521744	23521744	-1	no_errors	ENST00000267383	ensembl	human	known	69_37n	missense	16	23.81	5	SNP	0.018	T
CSHL1	1444	genome.wustl.edu	37	17	61987302	61987302	+	Intron	SNP	C	C	T	rs61762517	byFrequency	TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr17:61987302C>T	ENST00000309894.5	-	5	471				CSHL1_ENST00000346606.6_Intron|CSHL1_ENST00000558099.1_5'UTR|CSHL1_ENST00000392824.4_3'UTR|CSHL1_ENST00000259003.10_Intron|CSHL1_ENST00000450719.3_Missense_Mutation_p.A137T|CSHL1_ENST00000438387.2_Intron|CSHL1_ENST00000561003.1_Missense_Mutation_p.A148T	NM_022579.1	NP_072101.1	Q14406	CSHL_HUMAN	chorionic somatomammotropin hormone-like 1							extracellular region (GO:0005576)	hormone activity (GO:0005179)|metal ion binding (GO:0046872)			endometrium(3)|lung(6)	9						AGAGACCAAGCGCTTGGGCAC	0.527																																						dbGAP											0													110.0	104.0	106.0					17																	61987302		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			BC029365	CCDS11652.1, CCDS42370.1, CCDS45759.1	17q22-q24	2012-10-02							2442	protein-coding gene	gene with protein product	"""chorionic somatomammotropin CS-5"""	603515		CSHP1		8083227	Standard	NM_001318		Approved	hCS-L, CSL, CS-5, MGC149868	uc002jda.1	Q14406		ENST00000309894.5:c.472-34G>A	17.37:g.61987302C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU26|D3DU27|Q0VDB2	Missense_Mutation	SNP	pfam_Somatotropin,superfamily_4_helix_cytokine-like_core	p.A148T	ENST00000309894.5	37	c.442	CCDS11652.1	17	.	.	.	.	.	.	.	.	.	.	c	13.54	2.267389	0.40095	.	.	ENSG00000204414	ENST00000450719	.	.	.	1.61	-3.23	0.05109	.	.	.	.	.	T	0.35508	0.0934	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.40979	-0.9534	5	0.87932	D	0	.	4.3002	0.10922	0.4427:0.4126:0.0:0.1447	rs61762517	.	.	.	T	226	.	ENSP00000413501:A226T	A	-	1	0	GH1	59341034	0.000000	0.05858	0.000000	0.03702	0.037000	0.13140	-2.588000	0.00901	-1.284000	0.02390	0.305000	0.20034	GCT	CSHL1	-	NULL	ENSG00000204414		0.527	CSHL1-009	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	CSHL1	HGNC	protein_coding	OTTHUMT00000444557.1	87	0.00	0	C	NM_022579		61987302	61987302	-1	no_errors	ENST00000561003	ensembl	human	novel	69_37n	missense	50	25.37	17	SNP	0.001	T
DEGS1	8560	genome.wustl.edu	37	1	224377282	224377282	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr1:224377282A>G	ENST00000323699.4	+	2	252	c.86A>G	c.(85-87)aAg>aGg	p.K29R	DEGS1_ENST00000465848.1_3'UTR|DEGS1_ENST00000391877.3_Missense_Mutation_p.K29R	NM_003676.3	NP_003667.1	O15121	DEGS1_HUMAN	delta(4)-desaturase, sphingolipid 1	29					small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|unsaturated fatty acid biosynthetic process (GO:0006636)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)	electron carrier activity (GO:0009055)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|kidney(3)|large_intestine(2)|lung(4)	10	Breast(184;0.193)			GBM - Glioblastoma multiforme(131;0.00643)		TTTACAGCAAAGTATCCAGAG	0.284																																						dbGAP											0													48.0	52.0	50.0					1																	224377282		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF002668	CCDS1540.1	1q42.11	2013-09-02	2011-12-09	2004-12-14	ENSG00000143753	ENSG00000143753		"""Fatty acid desaturases"""	13709	protein-coding gene	gene with protein product	"""sphingolipid delta(4)-desaturase 1"", ""dihydroceramide desaturase 1"""	615843	"""degenerative spermatocyte homolog 1, lipid desaturase (Drosophila)"""			9188692, 20105137	Standard	NM_003676		Approved	MLD, Des-1, DES1, FADS7, DEGS-1	uc001hoj.3	O15121	OTTHUMG00000037496	ENST00000323699.4:c.86A>G	1.37:g.224377282A>G	ENSP00000316476:p.Lys29Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	p.K29R	ENST00000323699.4	37	c.86	CCDS1540.1	1	.	.	.	.	.	.	.	.	.	.	A	22.7	4.327120	0.81690	.	.	ENSG00000143753	ENST00000415210;ENST00000323699;ENST00000391877	T;T;T	0.61158	0.13;0.13;0.13	5.45	5.45	0.79879	Sphingolipid delta4-desaturase, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.80374	0.4611	M	0.90309	3.105	0.80722	D	1	D;D	0.76494	0.989;0.999	D;D	0.83275	0.967;0.996	D	0.83809	0.0240	10	0.52906	T	0.07	.	15.8229	0.78673	1.0:0.0:0.0:0.0	.	29;8	O15121;E7EMA0	DEGS1_HUMAN;.	R	8;29;29	ENSP00000400545:K8R;ENSP00000316476:K29R;ENSP00000375749:K29R	ENSP00000316476:K29R	K	+	2	0	DEGS1	222443905	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	9.339000	0.96797	2.193000	0.70182	0.448000	0.29417	AAG	DEGS1	-	pfam_Sphingolipid_d4-desaturase_N,pirsf_Sphingolipid_d4-desaturase	ENSG00000143753		0.284	DEGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEGS1	HGNC	protein_coding	OTTHUMT00000091285.2	38	0.00	0	A			224377282	224377282	+1	no_errors	ENST00000323699	ensembl	human	known	69_37n	missense	45	13.46	7	SNP	1.000	G
DNAJC3	5611	genome.wustl.edu	37	13	96412387	96412387	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr13:96412387G>A	ENST00000602402.1	+	6	757	c.640G>A	c.(640-642)Gcg>Acg	p.A214T	DNAJC3_ENST00000376795.6_Missense_Mutation_p.A163T	NM_006260.4	NP_006251.1	Q13217	DNJC3_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 3	214					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|defense response to virus (GO:0051607)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of protein kinase activity (GO:0006469)|proteolysis involved in cellular protein catabolic process (GO:0051603)	cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum Sec complex (GO:0031205)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|vesicle (GO:0031982)	protein kinase inhibitor activity (GO:0004860)			NS(1)|breast(1)|kidney(4)|large_intestine(1)|lung(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.126)			CTTAAAAGCTGCGTCAAAGTT	0.403																																						dbGAP											0													114.0	115.0	115.0					13																	96412387		2203	4300	6503	-	-	-	SO:0001583	missense	0			U28424	CCDS9479.1	13q32	2013-01-10			ENSG00000102580	ENSG00000102580		"""Heat shock proteins / DNAJ (HSP40)"", ""Tetratricopeptide (TTC) repeat domain containing"""	9439	protein-coding gene	gene with protein product		601184		PRKRI		7511204, 8824806	Standard	NM_006260		Approved	P58, P58IPK, HP58	uc001vmq.3	Q13217	OTTHUMG00000017227	ENST00000602402.1:c.640G>A	13.37:g.96412387G>A	ENSP00000473631:p.Ala214Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86WT9|Q8N4N2	Missense_Mutation	SNP	pfam_TPR-1,pfam_DnaJ_N,smart_TPR_repeat,smart_DnaJ_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.A214T	ENST00000602402.1	37	c.640	CCDS9479.1	13	.	.	.	.	.	.	.	.	.	.	G	8.971	0.972874	0.18736	.	.	ENSG00000102580	ENST00000376795	.	.	.	5.56	2.89	0.33648	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.153974	0.56097	N	0.000024	T	0.28896	0.0717	N	0.11560	0.145	0.58432	D	0.999993	B;B	0.11235	0.004;0.004	B;B	0.10450	0.005;0.005	T	0.03993	-1.0986	9	0.20046	T	0.44	-8.8617	8.4392	0.32805	0.1334:0.0:0.7407:0.1259	.	214;214	A8KA82;Q13217	.;DNJC3_HUMAN	T	214	.	ENSP00000365991:A214T	A	+	1	0	DNAJC3	95210388	1.000000	0.71417	0.994000	0.49952	0.966000	0.64601	2.883000	0.48554	0.301000	0.22738	0.561000	0.74099	GCG	DNAJC3	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000102580		0.403	DNAJC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC3	HGNC	protein_coding	OTTHUMT00000045504.3	127	0.00	0	G			96412387	96412387	+1	no_errors	ENST00000376795	ensembl	human	known	69_37n	missense	89	25.83	31	SNP	1.000	A
EBP	10682	genome.wustl.edu	37	X	48385405	48385405	+	Silent	SNP	A	A	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chrX:48385405A>T	ENST00000495186.1	+	3	1153	c.330A>T	c.(328-330)cgA>cgT	p.R110R	EBP_ENST00000276096.6_3'UTR	NM_006579.2	NP_006570.1	Q15125	EBP_HUMAN	emopamil binding protein (sterol isomerase)	110			R -> Q (in CDPX2). {ECO:0000269|PubMed:10391218}.		cholesterol biosynthetic process (GO:0006695)|cholesterol metabolic process (GO:0008203)|drug transmembrane transport (GO:0006855)|hemopoiesis (GO:0030097)|signal transduction (GO:0007165)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)	C-8 sterol isomerase activity (GO:0000247)|cholestenol delta-isomerase activity (GO:0047750)|drug transmembrane transporter activity (GO:0015238)|steroid delta-isomerase activity (GO:0004769)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|endometrium(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|stomach(1)	11					Tamoxifen(DB00675)	GAGACAGCCGATACATCCTGT	0.488																																					Ovarian(41;550 1000 33077 33474 52335)	dbGAP											0													201.0	175.0	184.0					X																	48385405		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Z37986	CCDS14300.1	Xp11.23-p11.22	2013-05-22	2001-11-28		ENSG00000147155	ENSG00000147155			3133	protein-coding gene	gene with protein product	"""3-beta-hydroxysteroid-delta-8,delta-7-isomerase"", ""Chondrodysplasia punctata-2, X-linked dominant (Happle syndrome)"", ""sterol 8-isomerase"""	300205	"""emopamil-binding protein (sterol isomerase)"""	CDPX2		7706302, 8938429	Standard	NM_006579		Approved	CPX, CPXD, CHO2	uc004djx.4	Q15125	OTTHUMG00000034482	ENST00000495186.1:c.330A>T	X.37:g.48385405A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6FGL3|Q6IBI9	Silent	SNP	pfam_EBP	p.R110	ENST00000495186.1	37	c.330	CCDS14300.1	X																																																																																			EBP	-	pfam_EBP	ENSG00000147155		0.488	EBP-004	KNOWN	basic|appris_principal|CCDS	protein_coding	EBP	HGNC	protein_coding	OTTHUMT00000083372.1	172	0.00	0	A	NM_006579		48385405	48385405	+1	no_errors	ENST00000495186	ensembl	human	known	69_37n	silent	73	52.29	80	SNP	0.990	T
EFR3A	23167	genome.wustl.edu	37	8	132962331	132962331	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr8:132962331G>A	ENST00000254624.5	+	5	707	c.482G>A	c.(481-483)cGa>cAa	p.R161Q	EFR3A_ENST00000519656.1_Missense_Mutation_p.R125Q|EFR3A_ENST00000334503.4_Missense_Mutation_p.R161Q	NM_015137.4	NP_055952.2	Q14156	EFR3A_HUMAN	EFR3 homolog A (S. cerevisiae)	161						extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(14)|ovary(3)|skin(1)|stomach(2)	35	Esophageal squamous(12;0.00693)|Ovarian(258;0.00769)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.000805)|LUAD - Lung adenocarcinoma(14;0.102)			CCAGAAATACGAACAGAGTAT	0.318																																						dbGAP											0													86.0	73.0	77.0					8																	132962331		2202	4300	6502	-	-	-	SO:0001583	missense	0			D63477	CCDS34942.2	8q24.22	2008-10-23			ENSG00000132294	ENSG00000132294			28970	protein-coding gene	gene with protein product		611798				15363888	Standard	NM_015137		Approved	KIAA0143	uc003yte.3	Q14156	OTTHUMG00000150552	ENST00000254624.5:c.482G>A	8.37:g.132962331G>A	ENSP00000254624:p.Arg161Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A7MD19|Q2VPK2|Q63HL7|Q68DX1|Q6IQ18	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.R161Q	ENST00000254624.5	37	c.482	CCDS34942.2	8	.	.	.	.	.	.	.	.	.	.	G	15.39	2.820117	0.50633	.	.	ENSG00000132294	ENST00000254624;ENST00000522709;ENST00000377917;ENST00000334503;ENST00000519656	T;T;T;T	0.72835	3.58;0.63;3.58;-0.69	5.7	2.94	0.34122	Armadillo-like helical (1);Armadillo-type fold (1);	0.270692	0.35466	N	0.003192	T	0.57533	0.2060	L	0.32530	0.975	0.41256	D	0.986743	B	0.17852	0.024	B	0.21151	0.033	T	0.53954	-0.8365	10	0.48119	T	0.1	-5.532	9.3902	0.38367	0.3056:0.0:0.6944:0.0	.	161	Q14156	EFR3A_HUMAN	Q	161;125;161;161;125	ENSP00000254624:R161Q;ENSP00000430512:R125Q;ENSP00000334769:R161Q;ENSP00000428086:R125Q	ENSP00000254624:R161Q	R	+	2	0	EFR3A	133031513	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.675000	0.46875	0.767000	0.33267	0.557000	0.71058	CGA	EFR3A	-	superfamily_ARM-type_fold	ENSG00000132294		0.318	EFR3A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EFR3A	HGNC	protein_coding	OTTHUMT00000318886.1	99	0.00	0	G	NM_015137		132962331	132962331	+1	no_errors	ENST00000254624	ensembl	human	known	69_37n	missense	100	20.00	25	SNP	0.999	A
AGO1	26523	genome.wustl.edu	37	1	36358211	36358211	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr1:36358211G>A	ENST00000373204.4	+	3	476	c.263G>A	c.(262-264)cGc>cAc	p.R88H	AGO1_ENST00000373206.1_Missense_Mutation_p.R13H	NM_012199.2	NP_036331.1	Q9UL18	AGO1_HUMAN	argonaute RISC catalytic component 1	88					epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|innate immune response (GO:0045087)|negative regulation of translation involved in gene silencing by miRNA (GO:0035278)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch signaling pathway (GO:0007219)|nuclear-transcribed mRNA catabolic process (GO:0000956)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|micro-ribonucleoprotein complex (GO:0035068)|polysome (GO:0005844)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)										TTTGGTGATCGCAAGCCTGTG	0.522																																						dbGAP											0													116.0	100.0	105.0					1																	36358211		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF093097	CCDS398.1	1p34.3	2013-02-15	2013-02-15	2013-02-15	ENSG00000092847	ENSG00000092847		"""Argonaute/PIWI family"""	3262	protein-coding gene	gene with protein product	"""argonaute 1"""	606228	"""eukaryotic translation initiation factor 2C, 1"""	EIF2C1		10534406, 12906857	Standard	NM_012199		Approved	hAGO1	uc001bzl.3	Q9UL18	OTTHUMG00000007381	ENST00000373204.4:c.263G>A	1.37:g.36358211G>A	ENSP00000362300:p.Arg88His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TA57|Q6P4S0	Missense_Mutation	SNP	pfam_Piwi,pfam_PAZ,pfam_DUF1785,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.R88H	ENST00000373204.4	37	c.263	CCDS398.1	1	.	.	.	.	.	.	.	.	.	.	G	18.93	3.727350	0.69074	.	.	ENSG00000092847	ENST00000373206;ENST00000373204	T;T	0.11063	2.81;2.9	5.73	5.73	0.89815	Argonaute/Dicer protein, PAZ (1);	0.053692	0.64402	D	0.000001	T	0.20251	0.0487	M	0.75884	2.315	0.80722	D	1	B	0.31599	0.33	B	0.33042	0.157	T	0.01249	-1.1406	10	0.54805	T	0.06	-21.5631	19.8779	0.96885	0.0:0.0:1.0:0.0	.	88	Q9UL18	AGO1_HUMAN	H	13;88	ENSP00000362302:R13H;ENSP00000362300:R88H	ENSP00000362300:R88H	R	+	2	0	EIF2C1	36130798	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.704000	0.92352	0.591000	0.81541	CGC	EIF2C1	-	superfamily_PAZ	ENSG00000092847		0.522	AGO1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF2C1	HGNC	protein_coding	OTTHUMT00000019337.3	66	0.00	0	G			36358211	36358211	+1	no_errors	ENST00000373204	ensembl	human	known	69_37n	missense	55	16.18	11	SNP	1.000	A
ERBB3	2065	genome.wustl.edu	37	12	56487649	56487649	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr12:56487649G>T	ENST00000267101.3	+	13	2022	c.1582G>T	c.(1582-1584)Gtc>Ttc	p.V528F	ERBB3_ENST00000450146.2_Intron|ERBB3_ENST00000553131.1_5'Flank|ERBB3_ENST00000415288.2_Missense_Mutation_p.V469F	NM_001982.3	NP_001973.2	P21860	ERBB3_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 3	528					cranial nerve development (GO:0021545)|endocardial cushion development (GO:0003197)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|negative regulation of cell adhesion (GO:0007162)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of secretion (GO:0051048)|negative regulation of signal transduction (GO:0009968)|neuron apoptotic process (GO:0051402)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell proliferation (GO:0042127)|Schwann cell differentiation (GO:0014037)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein tyrosine kinase activator activity (GO:0030296)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(2)|lung(3)|ovary(1)|skin(1)|stomach(1)	8			OV - Ovarian serous cystadenocarcinoma(18;0.112)			CCGAGGAGGTGTCTGTGTGAC	0.587																																						dbGAP											0													83.0	89.0	87.0					12																	56487649		2203	4300	6503	-	-	-	SO:0001583	missense	0			M34309	CCDS31833.1, CCDS44918.1	12q13	2013-07-09	2013-07-09			ENSG00000065361			3431	protein-coding gene	gene with protein product		190151	"""lethal congenital contracture syndrome 2"""	LCCS2			Standard	NM_001982		Approved	HER3	uc001sjh.3	P21860	OTTHUMG00000170140	ENST00000267101.3:c.1582G>T	12.37:g.56487649G>T	ENSP00000267101:p.Val528Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6L6|B4DIK7|B4DV32|E9PDT8|Q9BUD7	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Furin-like_Cys-rich_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V528F	ENST00000267101.3	37	c.1582	CCDS31833.1	12	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466422	0.63625	.	.	ENSG00000065361	ENST00000267101;ENST00000415288	T;T	0.42900	0.96;0.96	5.39	4.5	0.54988	Growth factor, receptor (1);	0.105878	0.39407	N	0.001366	T	0.34483	0.0899	L	0.32530	0.975	0.80722	D	1	D;D	0.59357	0.97;0.985	B;P	0.45474	0.431;0.482	T	0.09185	-1.0686	10	0.45353	T	0.12	.	10.043	0.42169	0.1633:0.0:0.8367:0.0	.	528;528	B4DGQ7;P21860	.;ERBB3_HUMAN	F	528;469	ENSP00000267101:V528F;ENSP00000408340:V469F	ENSP00000267101:V528F	V	+	1	0	ERBB3	54773916	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.708000	0.37899	1.276000	0.44395	-0.136000	0.14681	GTC	ERBB3	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,superfamily_Growth_fac_rcpt,smart_Furin_repeat	ENSG00000065361		0.587	ERBB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB3	HGNC	protein_coding	OTTHUMT00000407619.3	39	0.00	0	G			56487649	56487649	+1	no_errors	ENST00000267101	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	T
FAM135B	51059	genome.wustl.edu	37	8	139165210	139165210	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr8:139165210G>A	ENST00000395297.1	-	13	1678	c.1508C>T	c.(1507-1509)tCa>tTa	p.S503L		NM_015912.3	NP_056996.2	Q49AJ0	F135B_HUMAN	family with sequence similarity 135, member B	503										NS(3)|breast(9)|endometrium(21)|kidney(5)|large_intestine(28)|liver(1)|lung(135)|ovary(9)|pancreas(1)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(1)	238	all_epithelial(106;8.29e-14)|Lung NSC(106;6.88e-06)|all_lung(105;1.44e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0805)			TTCACCAATTGATATATACAC	0.428										HNSCC(54;0.14)																												dbGAP											0													129.0	125.0	126.0					8																	139165210		1948	4148	6096	-	-	-	SO:0001583	missense	0			AB196635	CCDS6375.2	8q24.23	2008-11-05			ENSG00000147724	ENSG00000147724			28029	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_015912		Approved	C8ORFK32	uc003yuy.3	Q49AJ0	OTTHUMG00000149864	ENST00000395297.1:c.1508C>T	8.37:g.139165210G>A	ENSP00000378710:p.Ser503Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDB3|O95879|Q2WGJ7|Q3KP46	Missense_Mutation	SNP	pfam_DUF676_lipase-like,pfam_DUF3657,pfam_PGAP1-like	p.S503L	ENST00000395297.1	37	c.1508	CCDS6375.2	8	.	.	.	.	.	.	.	.	.	.	G	12.80	2.047186	0.36085	.	.	ENSG00000147724	ENST00000395297	T	0.14144	2.53	5.75	4.87	0.63330	.	0.567836	0.19144	N	0.121631	T	0.09992	0.0245	N	0.24115	0.695	0.09310	N	1	B;B;B	0.14012	0.009;0.009;0.001	B;B;B	0.13407	0.009;0.006;0.0	T	0.11767	-1.0574	10	0.62326	D	0.03	-13.4188	9.6695	0.40004	0.1432:0.0:0.8568:0.0	.	503;503;503	Q49AJ0-3;Q49AJ0-4;Q49AJ0	.;.;F135B_HUMAN	L	503	ENSP00000378710:S503L	ENSP00000276737:S503L	S	-	2	0	FAM135B	139234392	0.994000	0.37717	0.965000	0.40720	0.461000	0.32589	3.486000	0.53215	2.725000	0.93324	0.655000	0.94253	TCA	FAM135B	-	NULL	ENSG00000147724		0.428	FAM135B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM135B	HGNC	protein_coding	OTTHUMT00000313590.3	91	0.00	0	G	NM_015912		139165210	139165210	-1	no_errors	ENST00000395297	ensembl	human	known	69_37n	missense	71	21.11	19	SNP	0.066	A
FXYD3	5349	genome.wustl.edu	37	19	35610312	35610312	+	Missense_Mutation	SNP	T	T	G			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr19:35610312T>G	ENST00000344013.6	+	3	228	c.32T>G	c.(31-33)tTc>tGc	p.F11C	FXYD3_ENST00000406988.1_Missense_Mutation_p.F11C|FXYD3_ENST00000406242.3_Missense_Mutation_p.F11C|FXYD3_ENST00000605552.1_Missense_Mutation_p.F11C|FXYD3_ENST00000535103.1_Missense_Mutation_p.F68C|FXYD3_ENST00000605677.1_Missense_Mutation_p.F11C|FXYD3_ENST00000435734.2_Missense_Mutation_p.F11C|FXYD3_ENST00000604255.1_Missense_Mutation_p.F68C|FXYD3_ENST00000604621.1_Missense_Mutation_p.F11C|FXYD3_ENST00000605550.1_Missense_Mutation_p.F11C|FXYD3_ENST00000604404.1_Missense_Mutation_p.F11C|FXYD3_ENST00000603524.1_Missense_Mutation_p.F11C|FXYD3_ENST00000346446.5_Missense_Mutation_p.F11C|FXYD3_ENST00000604804.1_Missense_Mutation_p.F11C|FXYD3_ENST00000454903.2_Missense_Mutation_p.F11C|FXYD3_ENST00000603181.1_Missense_Mutation_p.F11C|FXYD3_ENST00000603449.1_Missense_Mutation_p.F11C			Q14802	FXYD3_HUMAN	FXYD domain containing ion transport regulator 3	11					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of catalytic activity (GO:0050790)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	chloride channel activity (GO:0005254)			endometrium(1)|lung(2)|prostate(1)	4	all_lung(56;5.38e-08)|Lung NSC(56;8.61e-08)|Esophageal squamous(110;0.162)		Epithelial(14;5.54e-20)|OV - Ovarian serous cystadenocarcinoma(14;1.33e-18)|all cancers(14;4.27e-17)|LUSC - Lung squamous cell carcinoma(66;0.0849)			CTGCTTGTGTTCCTGGCAGGT	0.632																																						dbGAP											0													209.0	168.0	182.0					19																	35610312		2203	4300	6503	-	-	-	SO:0001583	missense	0			X93036	CCDS12442.1, CCDS12443.1, CCDS46048.1, CCDS46049.1, CCDS46050.1	19q13.11-q13.12	2008-05-14	2002-01-14			ENSG00000089356			4027	protein-coding gene	gene with protein product		604996	"""FXYD domain-containing ion transport regulator 3"""	PLML		7836447, 10950925	Standard	NM_005971		Approved	MAT-8	uc010xsm.2	Q14802		ENST00000344013.6:c.32T>G	19.37:g.35610312T>G	ENSP00000339499:p.Phe11Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDE0|C9JDU2|F5H174|F8WB34|Q13211|Q6IB59	Missense_Mutation	SNP	pfam_Ion-transport_regulator_FXYD	p.F68C	ENST00000344013.6	37	c.203	CCDS12442.1	19	.	.	.	.	.	.	.	.	.	.	T	10.50	1.366564	0.24771	.	.	ENSG00000089356	ENST00000406242;ENST00000454903;ENST00000435734;ENST00000346446;ENST00000344013;ENST00000406988;ENST00000535103	T;T;T;T;T	0.65178	-0.14;-0.14;-0.12;-0.12;-0.13	4.01	4.01	0.46588	.	0.552015	0.16017	N	0.233501	T	0.61912	0.2385	L	0.38175	1.15	0.20638	N	0.999876	D;D;D;P;P	0.69078	0.997;0.991;0.972;0.924;0.875	P;P;P;P;B	0.54460	0.753;0.673;0.46;0.534;0.431	T	0.53968	-0.8363	10	0.72032	D	0.01	-4.1006	9.4796	0.38893	0.0:0.0:0.0:1.0	.	68;11;11;11;11	F5H174;F8WB34;C9JDU2;Q14802-2;Q14802	.;.;.;.;FXYD3_HUMAN	C	11;11;68;11;11;11;68	ENSP00000385412:F11C;ENSP00000328259:F11C;ENSP00000339499:F11C;ENSP00000385200:F11C;ENSP00000443953:F68C	ENSP00000339499:F11C	F	+	2	0	FXYD3	40302152	0.866000	0.29940	0.863000	0.33907	0.160000	0.22226	2.187000	0.42602	1.810000	0.52873	0.482000	0.46254	TTC	FXYD3	-	NULL	ENSG00000089356		0.632	FXYD3-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FXYD3	HGNC	protein_coding	OTTHUMT00000468985.1	95	0.00	0	T	NM_021910		35610312	35610312	+1	no_errors	ENST00000435734	ensembl	human	known	69_37n	missense	72	20.00	18	SNP	0.683	G
FUZ	80199	genome.wustl.edu	37	19	50315962	50315962	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr19:50315962C>T	ENST00000313777.4	-	2	306	c.143G>A	c.(142-144)gGa>gAa	p.G48E	FUZ_ENST00000533418.1_5'UTR|FUZ_ENST00000534008.1_5'UTR|FUZ_ENST00000528094.1_Missense_Mutation_p.G48E|AC006942.4_ENST00000600669.1_RNA|FUZ_ENST00000445575.2_Missense_Mutation_p.G48E|FUZ_ENST00000526575.1_Missense_Mutation_p.G48E	NM_025129.4	NP_079405.2	Q9BT04	FUZZY_HUMAN	fuzzy planar cell polarity protein	48					cilium assembly (GO:0042384)|embryonic body morphogenesis (GO:0010172)|embryonic skeletal system morphogenesis (GO:0048704)|establishment of planar polarity (GO:0001736)|hair follicle development (GO:0001942)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fibroblast growth factor receptor signaling pathway involved in neural plate anterior/posterior pattern formation (GO:2000314)|negative regulation of neural crest formation (GO:0090301)|neural tube closure (GO:0001843)|nonmotile primary cilium assembly (GO:0035058)|positive regulation of cilium assembly (GO:0045724)|protein transport (GO:0015031)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(3)	4		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00793)|GBM - Glioblastoma multiforme(134;0.0116)		CATGTGGACTCCATTGAGGGA	0.572																																						dbGAP											0													105.0	93.0	97.0					19																	50315962		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016793	CCDS12781.1, CCDS54293.1	19q13.33	2013-03-05	2013-03-05			ENSG00000010361			26219	protein-coding gene	gene with protein product		610622	"""fuzzy homolog (Drosophila)"""			21761479	Standard	NM_001171937		Approved	FLJ22688, Fy	uc002ppq.2	Q9BT04		ENST00000313777.4:c.143G>A	19.37:g.50315962C>T	ENSP00000313309:p.Gly48Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD86|B5MDH0|Q6PJY0|Q9H613	Missense_Mutation	SNP	NULL	p.G48E	ENST00000313777.4	37	c.143	CCDS12781.1	19	.	.	.	.	.	.	.	.	.	.	C	29.1	4.976507	0.92982	.	.	ENSG00000010361	ENST00000525130;ENST00000528094;ENST00000529634;ENST00000525370;ENST00000313777;ENST00000445575;ENST00000421740;ENST00000526575	D;D;D;T;T;D	0.87966	-2.12;-2.32;-2.12;-1.47;-1.48;-2.12	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	D	0.93070	0.7794	M	0.76170	2.325	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.93656	0.6977	10	0.87932	D	0	-10.0082	16.1722	0.81825	0.0:1.0:0.0:0.0	.	48;48;48	B4DHF8;Q9BT04-3;Q9BT04	.;.;FUZZY_HUMAN	E	48	ENSP00000433492:G48E;ENSP00000435177:G48E;ENSP00000431420:G48E;ENSP00000313309:G48E;ENSP00000408018:G48E;ENSP00000433164:G48E	ENSP00000313309:G48E	G	-	2	0	FUZ	55007774	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	5.182000	0.65059	2.567000	0.86603	0.456000	0.33151	GGA	FUZ	-	NULL	ENSG00000010361		0.572	FUZ-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FUZ	HGNC	protein_coding	OTTHUMT00000393986.1	41	0.00	0	C	NM_025129		50315962	50315962	-1	no_errors	ENST00000313777	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	1.000	T
IGHV3-72	28410	genome.wustl.edu	37	14	107199193	107199193	+	RNA	SNP	C	C	G			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr14:107199193C>G	ENST00000433072.2	-	0	175									immunoglobulin heavy variable 3-72																		ACCCTCCAGGCTGGACCAAGC	0.587																																						dbGAP											0													99.0	96.0	97.0					14																	107199193		1894	4097	5991	-	-	-			0			X92206		14q32.33	2012-02-08			ENSG00000225698	ENSG00000225698		"""Immunoglobulins / IGH locus"""	5622	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151865		14.37:g.107199193C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_V-set_subgr,pfscan_Ig-like	p.Q32H	ENST00000433072.2	37	c.96		14																																																																																			IGHV3-72	-	pfam_Ig_V-set,pfscan_Ig-like	ENSG00000225698		0.587	IGHV3-72-001	KNOWN	mRNA_end_NF|cds_end_NF|basic|appris_principal	IG_V_gene	IGHV3-72	HGNC	IG_V_gene	OTTHUMT00000324210.1	99	0.00	0	C	NG_001019		107199193	107199193	-1	no_stop_codon	ENST00000433072	ensembl	human	known	69_37n	missense	47	38.16	29	SNP	0.705	G
KCNK18	338567	genome.wustl.edu	37	10	118969342	118969342	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr10:118969342G>T	ENST00000334549.1	+	3	687	c.687G>T	c.(685-687)gaG>gaT	p.E229D		NM_181840.1	NP_862823.1	Q7Z418	KCNKI_HUMAN	potassium channel, subfamily K, member 18	229					cellular response to pH (GO:0071467)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium-activated potassium channel activity (GO:0015269)|outward rectifier potassium channel activity (GO:0015271)|potassium channel activity (GO:0005267)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(24)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	41		Colorectal(252;0.19)		all cancers(201;0.0211)		AGCTGTTTGAGAGATCTCATG	0.527																																						dbGAP											0													98.0	95.0	96.0					10																	118969342		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB087138	CCDS7598.1	10q26.11	2012-03-07			ENSG00000186795	ENSG00000186795		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	19439	protein-coding gene	gene with protein product	"""TWIK related spinal cord K+ channel"""	613655				16382106	Standard	NM_181840		Approved	K2p18.1, TRESK-2, TRESK2, TRESK, TRIK	uc010qsr.2	Q7Z418	OTTHUMG00000019120	ENST00000334549.1:c.687G>T	10.37:g.118969342G>T	ENSP00000334650:p.Glu229Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQQ8	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl	p.E229D	ENST00000334549.1	37	c.687	CCDS7598.1	10	.	.	.	.	.	.	.	.	.	.	G	14.73	2.623610	0.46840	.	.	ENSG00000186795	ENST00000334549	T	0.15834	2.39	5.4	3.52	0.40303	.	0.210851	0.48767	D	0.000175	T	0.15652	0.0377	N	0.24115	0.695	0.28508	N	0.913677	D	0.54047	0.964	P	0.50860	0.652	T	0.05716	-1.0868	10	0.20519	T	0.43	.	11.234	0.48929	0.2426:0.0:0.7574:0.0	.	229	Q7Z418	KCNKI_HUMAN	D	229	ENSP00000334650:E229D	ENSP00000334650:E229D	E	+	3	2	KCNK18	118959332	0.361000	0.24972	0.466000	0.27168	0.026000	0.11368	0.453000	0.21811	1.428000	0.47296	0.655000	0.94253	GAG	KCNK18	-	NULL	ENSG00000186795		0.527	KCNK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK18	HGNC	protein_coding	OTTHUMT00000050562.2	83	0.00	0	G	NM_181840		118969342	118969342	+1	no_errors	ENST00000334549	ensembl	human	known	69_37n	missense	25	32.43	12	SNP	0.401	T
KIAA1549	57670	genome.wustl.edu	37	7	138593769	138593769	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr7:138593769G>A	ENST00000422774.1	-	5	3292	c.3244C>T	c.(3244-3246)Cac>Tac	p.H1082Y	KIAA1549_ENST00000242365.4_Missense_Mutation_p.H1032Y|KIAA1549_ENST00000440172.1_Missense_Mutation_p.H1082Y			Q9HCM3	K1549_HUMAN	KIAA1549	1082						integral component of membrane (GO:0016021)			KIAA1549/BRAF(703)	large_intestine(4)|pancreas(1)|upper_aerodigestive_tract(2)	7						CCCTGGTGGTGTTTTCTCACT	0.473			O	BRAF	pilocytic astrocytoma																																NSCLC(119;1534 1718 44213 46230 50068)	dbGAP		Dom	yes		7	7q34	57670	KIAA1549		O	0													107.0	104.0	105.0					7																	138593769		1929	4146	6075	-	-	-	SO:0001583	missense	0				CCDS47723.1, CCDS47723.2, CCDS56513.1	7q34	2009-10-09			ENSG00000122778	ENSG00000122778			22219	protein-coding gene	gene with protein product		613344					Standard	NM_020910		Approved		uc011kql.2	Q9HCM3	OTTHUMG00000157214	ENST00000422774.1:c.3244C>T	7.37:g.138593769G>A	ENSP00000416040:p.His1082Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B6HY55|B6HY56|B6HY58|B6HY60|B6HY61|B6HY62|B6HY63|B6HY64|B6HY65|B6HY66|Q5BJD6|Q8IY15|Q9H0M3	Missense_Mutation	SNP	NULL	p.H1082Y	ENST00000422774.1	37	c.3244	CCDS56513.1	7	.	.	.	.	.	.	.	.	.	.	G	13.28	2.190148	0.38707	.	.	ENSG00000122778	ENST00000440172;ENST00000242365;ENST00000422774	T;T;T	0.24151	1.87;1.87;1.87	4.73	3.84	0.44239	.	0.313936	0.26096	N	0.026374	T	0.14399	0.0348	N	0.22421	0.69	0.31889	N	0.617404	P;P	0.39535	0.677;0.627	B;B	0.33121	0.158;0.098	T	0.12400	-1.0549	10	0.48119	T	0.1	.	8.6255	0.33886	0.1729:0.0:0.8271:0.0	.	1082;1082	Q9HCM3;Q9HCM3-2	K1549_HUMAN;.	Y	1082;1032;1082	ENSP00000406661:H1082Y;ENSP00000242365:H1032Y;ENSP00000416040:H1082Y	ENSP00000242365:H1032Y	H	-	1	0	KIAA1549	138244309	1.000000	0.71417	0.984000	0.44739	0.975000	0.68041	4.195000	0.58400	1.342000	0.45619	0.585000	0.79938	CAC	KIAA1549	-	NULL	ENSG00000122778		0.473	KIAA1549-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1549	HGNC	protein_coding	OTTHUMT00000348092.1	88	0.00	0	G			138593769	138593769	-1	no_errors	ENST00000422774	ensembl	human	known	69_37n	missense	57	19.44	14	SNP	1.000	A
KIAA2026	158358	genome.wustl.edu	37	9	5968121	5968121	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr9:5968121G>A	ENST00000399933.3	-	3	2109	c.2110C>T	c.(2110-2112)Cgt>Tgt	p.R704C	KIAA2026_ENST00000381461.2_Missense_Mutation_p.R704C	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	704	Lys-rich.									breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		AGACCTTCACGCTTTCTCTGT	0.318																																						dbGAP											0													37.0	36.0	36.0					9																	5968121		1825	4084	5909	-	-	-	SO:0001583	missense	0			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2110C>T	9.37:g.5968121G>A	ENSP00000382815:p.Arg704Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.R704C	ENST00000399933.3	37	c.2110		9	.	.	.	.	.	.	.	.	.	.	G	9.234	1.036488	0.19669	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	6.02	6.02	0.97574	.	.	.	.	.	T	0.36608	0.0973	N	0.03608	-0.345	0.40079	D	0.976112	B	0.19331	0.035	B	0.17098	0.017	T	0.33471	-0.9867	8	0.87932	D	0	.	13.6926	0.62556	0.0702:0.0:0.9298:0.0	.	704	Q5HYC2	K2026_HUMAN	C	704	.	ENSP00000370870:R704C	R	-	1	0	KIAA2026	5958121	0.990000	0.36364	1.000000	0.80357	0.835000	0.47333	3.589000	0.53972	2.859000	0.98148	0.591000	0.81541	CGT	KIAA2026	-	NULL	ENSG00000183354		0.318	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	78	0.00	0	G	NM_001017969		5968121	5968121	-1	no_errors	ENST00000399933	ensembl	human	novel	69_37n	missense	87	16.35	17	SNP	1.000	A
KRTAP19-4	337971	genome.wustl.edu	37	21	31869332	31869332	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr21:31869332G>A	ENST00000334058.2	-	1	119	c.97C>T	c.(97-99)Cgc>Tgc	p.R33C		NM_181610.1	NP_853641.1	Q3LI73	KR194_HUMAN	keratin associated protein 19-4	33						intermediate filament (GO:0005882)		p.R33C(1)		central_nervous_system(1)|large_intestine(2)|lung(1)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	9						CCCAGTCTGCGGAAGCTGCCA	0.532																																						dbGAP											1	Substitution - Missense(1)	central_nervous_system(1)											126.0	130.0	129.0					21																	31869332		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001708	CCDS33534.1	21q22.1	2011-02-10			ENSG00000186967	ENSG00000186967		"""Keratin associated proteins"""	18939	protein-coding gene	gene with protein product						12359730	Standard	NM_181610		Approved	KAP19.4	uc011acz.2	Q3LI73	OTTHUMG00000057767	ENST00000334058.2:c.97C>T	21.37:g.31869332G>A	ENSP00000335567:p.Arg33Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RT4|Q17RT6	Missense_Mutation	SNP	pfam_KRTAP	p.R33C	ENST00000334058.2	37	c.97	CCDS33534.1	21	.	.	.	.	.	.	.	.	.	.	G	5.415	0.261727	0.10239	.	.	ENSG00000186967	ENST00000334058	T	0.10477	2.87	4.54	-1.56	0.08532	.	.	.	.	.	T	0.13072	0.0317	.	.	.	0.09310	N	1	D	0.56035	0.974	P	0.48114	0.567	T	0.16928	-1.0386	8	0.87932	D	0	.	7.3204	0.26523	0.0:0.2703:0.2662:0.4635	.	33	Q3LI73	KR194_HUMAN	C	33	ENSP00000335567:R33C	ENSP00000335567:R33C	R	-	1	0	KRTAP19-4	30791203	0.000000	0.05858	0.000000	0.03702	0.421000	0.31385	-0.849000	0.04322	-0.393000	0.07739	0.585000	0.79938	CGC	KRTAP19-4	-	pfam_KRTAP	ENSG00000186967		0.532	KRTAP19-4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP19-4	HGNC	protein_coding	OTTHUMT00000128219.2	81	0.00	0	G			31869332	31869332	-1	no_errors	ENST00000334058	ensembl	human	known	69_37n	missense	54	28.00	21	SNP	0.001	A
MAP1A	4130	genome.wustl.edu	37	15	43816672	43816672	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr15:43816672G>T	ENST00000300231.5	+	4	3451	c.3001G>T	c.(3001-3003)Ggc>Tgc	p.G1001C	MAP1A_ENST00000382031.1_Missense_Mutation_p.G1239C|MAP1A_ENST00000399453.1_Missense_Mutation_p.G1001C			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1001					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TCCACCATCTGGCCCACCCAG	0.572																																						dbGAP											0													79.0	82.0	81.0					15																	43816672		2058	4190	6248	-	-	-	SO:0001583	missense	0			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.3001G>T	15.37:g.43816672G>T	ENSP00000300231:p.Gly1001Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.G1001C	ENST00000300231.5	37	c.3001	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	13.04	2.118519	0.37436	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.01854	4.6;4.61;4.61	5.55	5.55	0.83447	.	0.000000	0.34700	N	0.003759	T	0.14614	0.0353	M	0.80847	2.515	0.58432	D	0.999992	D	0.89917	1.0	D	0.76071	0.987	T	0.00013	-1.2421	10	0.72032	D	0.01	-18.0444	18.6751	0.91526	0.0:0.0:1.0:0.0	.	1001	P78559	MAP1A_HUMAN	C	1239;1001;1001	ENSP00000371462:G1239C;ENSP00000382380:G1001C;ENSP00000300231:G1001C	ENSP00000300231:G1001C	G	+	1	0	MAP1A	41603964	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.129000	0.77225	2.894000	0.99253	0.655000	0.94253	GGC	MAP1A	-	NULL	ENSG00000166963		0.572	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	45	0.00	0	G	NM_002373		43816672	43816672	+1	no_errors	ENST00000399453	ensembl	human	known	69_37n	missense	28	22.22	8	SNP	0.999	T
MAPK8IP1	9479	genome.wustl.edu	37	11	45926335	45926335	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr11:45926335G>A	ENST00000241014.2	+	9	2013	c.1843G>A	c.(1843-1845)Gtg>Atg	p.V615M	MAPK8IP1_ENST00000395629.2_Missense_Mutation_p.V605M|RP11-618K13.2_ENST00000533218.1_RNA	NM_005456.3	NP_005447.1	Q9UQF2	JIP1_HUMAN	mitogen-activated protein kinase 8 interacting protein 1	615	Interaction with VRK2.|PID. {ECO:0000255|PROSITE- ProRule:PRU00148}.				JUN phosphorylation (GO:0007258)|negative regulation of apoptotic process (GO:0043066)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|positive regulation of signal transduction (GO:0009967)|regulation of JNK cascade (GO:0046328)|regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic growth cone (GO:0044294)|dentate gyrus mossy fiber (GO:0044302)|endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|synapse (GO:0045202)	kinesin binding (GO:0019894)|MAP-kinase scaffold activity (GO:0005078)|protein kinase inhibitor activity (GO:0004860)			breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(2)	24				GBM - Glioblastoma multiforme(35;0.231)		GGAGATCAGCGTGCGGGGTGT	0.617																																						dbGAP											0													84.0	91.0	89.0					11																	45926335		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS7916.1	11p11.2	2009-07-24			ENSG00000121653	ENSG00000121653			6882	protein-coding gene	gene with protein product		604641		PRKM8IP		9235893, 9442013	Standard	NM_005456		Approved	IB1, JIP-1, JIP1	uc001nbr.3	Q9UQF2	OTTHUMG00000134324	ENST00000241014.2:c.1843G>A	11.37:g.45926335G>A	ENSP00000241014:p.Val615Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQP4|O43407	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_SH3_domain,superfamily_SH3_domain,smart_SH3_domain,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom,pfscan_SH3_domain	p.V615M	ENST00000241014.2	37	c.1843	CCDS7916.1	11	.	.	.	.	.	.	.	.	.	.	G	15.80	2.939927	0.52972	.	.	ENSG00000121653	ENST00000241014;ENST00000395629	T;T	0.19806	2.12;2.12	5.31	3.45	0.39498	Phosphotyrosine interaction domain (3);Pleckstrin homology-type (1);	0.188257	0.46758	N	0.000264	T	0.14141	0.0342	L	0.31526	0.94	0.51767	D	0.999938	B	0.29612	0.251	B	0.29524	0.103	T	0.08472	-1.0720	10	0.35671	T	0.21	-21.8231	8.1107	0.30914	0.3025:0.0:0.6975:0.0	.	615	Q9UQF2	JIP1_HUMAN	M	615;605	ENSP00000241014:V615M;ENSP00000378991:V605M	ENSP00000241014:V615M	V	+	1	0	MAPK8IP1	45882911	0.974000	0.33945	0.991000	0.47740	0.991000	0.79684	1.379000	0.34340	0.821000	0.34540	0.561000	0.74099	GTG	MAPK8IP1	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000121653		0.617	MAPK8IP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPK8IP1	HGNC	protein_coding	OTTHUMT00000259405.1	46	0.00	0	G	NM_005456		45926335	45926335	+1	no_errors	ENST00000241014	ensembl	human	known	69_37n	missense	37	11.63	5	SNP	0.999	A
OR6K3	391114	genome.wustl.edu	37	1	158687491	158687491	+	Missense_Mutation	SNP	G	G	A	rs550637792		TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr1:158687491G>A	ENST00000368146.1	-	1	462	c.463C>T	c.(463-465)Cgg>Tgg	p.R155W	OR6K3_ENST00000368145.1_Missense_Mutation_p.R139W			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.R155R(1)|p.R155W(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					GCACAGAGCCGGGGGGTCATG	0.517																																						dbGAP											2	Substitution - Missense(1)|Substitution - coding silent(1)	large_intestine(1)|lung(1)											86.0	93.0	91.0					1																	158687491		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.463C>T	1.37:g.158687491G>A	ENSP00000357128:p.Arg155Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.R155W	ENST00000368146.1	37	c.463		1	.	.	.	.	.	.	.	.	.	.	G	12.42	1.933544	0.34096	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.01629	4.72;4.72	4.04	-4.12	0.03916	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.02119	0.0066	M	0.63843	1.955	0.09310	N	1	D	0.89917	1.0	D	0.67725	0.953	T	0.28902	-1.0029	9	0.59425	D	0.04	.	6.8375	0.23945	0.176:0.0:0.1793:0.6447	.	155	Q8NGY3	OR6K3_HUMAN	W	139;155	ENSP00000357127:R139W;ENSP00000357128:R155W	ENSP00000357127:R139W	R	-	1	2	OR6K3	156954115	.	.	0.001000	0.08648	0.222000	0.24845	.	.	-0.530000	0.06349	0.411000	0.27672	CGG	OR6K3	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000203757		0.517	OR6K3-201	KNOWN	basic	protein_coding	OR6K3	HGNC	protein_coding		51	0.00	0	G			158687491	158687491	-1	no_errors	ENST00000368146	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	0.000	A
POTEI	653269	genome.wustl.edu	37	2	131258114	131258114	+	Silent	SNP	A	A	G			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr2:131258114A>G	ENST00000451531.2	-	4	1342	c.912T>C	c.(910-912)taT>taC	p.Y304Y	RNU6-473P_ENST00000516164.1_RNA	NM_001277406.1	NP_001264335.1	P0CG38	POTEI_HUMAN	POTE ankyrin domain family, member I	304					retina homeostasis (GO:0001895)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.Y304Y(2)		lung(11)	11						TATACCTTCCATATCTATCCA	0.333																																						dbGAP											2	Substitution - coding silent(2)	lung(2)																																								-	-	-	SO:0001819	synonymous_variant	0				CCDS59431.1	2q21.1	2013-01-10			ENSG00000196834	ENSG00000196834		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37093	protein-coding gene	gene with protein product						16364570	Standard	NM_001277406		Approved	POTE2beta	uc031rpa.1	P0CG38	OTTHUMG00000153925	ENST00000451531.2:c.912T>C	2.37:g.131258114A>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,prints_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.Y304	ENST00000451531.2	37	c.912	CCDS59431.1	2																																																																																			POTEI	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000196834		0.333	POTEI-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	POTEI	HGNC	protein_coding	OTTHUMT00000333222.2	248	0.00	0	A	XM_928585		131258114	131258114	-1	no_errors	ENST00000451531	ensembl	human	novel	69_37n	silent	113	11.72	15	SNP	0.000	G
POU4F2	5458	genome.wustl.edu	37	4	147561516	147561516	+	Silent	SNP	C	C	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr4:147561516C>T	ENST00000281321.3	+	2	1034	c.786C>T	c.(784-786)gcC>gcT	p.A262A	AC093887.1_ENST00000584185.1_RNA	NM_004575.2	NP_004566.2	Q12837	PO4F2_HUMAN	POU class 4 homeobox 2	262	POU-specific. {ECO:0000255|PROSITE- ProRule:PRU00530}.				axon extension (GO:0048675)|axon guidance (GO:0007411)|intracellular estrogen receptor signaling pathway (GO:0030520)|MAPK cascade (GO:0000165)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular process controlling balance (GO:0050885)|neuron differentiation (GO:0030182)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|retinal ganglion cell axon guidance (GO:0031290)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|endometrium(7)|kidney(3)|large_intestine(11)|lung(8)|skin(1)|upper_aerodigestive_tract(1)	33	all_hematologic(180;0.151)					AGGCATTCGCCGAGCGCTTCA	0.692																																						dbGAP											0													25.0	27.0	26.0					4																	147561516		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			U06233	CCDS34074.1	4q31.22	2011-06-20	2007-07-13					"""Homeoboxes / POU class"""	9219	protein-coding gene	gene with protein product		113725	"""POU domain, class 4, transcription factor 2"", ""POU domain class 4, transcription factor 2"""	BRN3B		8332509	Standard	NM_004575		Approved	Brn-3b	uc003ikv.3	Q12837		ENST00000281321.3:c.786C>T	4.37:g.147561516C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1PJR6|B2RC84|Q13883|Q14987	Silent	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.A262	ENST00000281321.3	37	c.786	CCDS34074.1	4																																																																																			POU4F2	-	pfam_POU_specific,superfamily_Lambda_DNA-bd_dom,smart_POU_specific,pfscan_POU_specific	ENSG00000151615		0.692	POU4F2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU4F2	HGNC	protein_coding	OTTHUMT00000367020.1	24	0.00	0	C	NM_004575		147561516	147561516	+1	no_errors	ENST00000281321	ensembl	human	known	69_37n	silent	6	40.00	4	SNP	1.000	T
PTPRB	5787	genome.wustl.edu	37	12	71016202	71016202	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr12:71016202T>C	ENST00000550358.1	-	3	701	c.676A>G	c.(676-678)Act>Gct	p.T226A	PTPRB_ENST00000334414.6_Missense_Mutation_p.T226A|PTPRB_ENST00000551525.1_Missense_Mutation_p.T225A|PTPRB_ENST00000538174.2_5'UTR			P23467	PTPRB_HUMAN	protein tyrosine phosphatase, receptor type, B	0	Fibronectin type-III 3. {ECO:0000255|PROSITE-ProRule:PRU00316}.				angiogenesis (GO:0001525)|dephosphorylation (GO:0016311)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphate-containing compound metabolic process (GO:0006796)|protein dephosphorylation (GO:0006470)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			breast(4)|central_nervous_system(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(46)|prostate(4)|skin(18)|upper_aerodigestive_tract(1)|urinary_tract(3)	107	Renal(347;0.236)		GBM - Glioblastoma multiforme(2;2.17e-05)|Lung(24;0.000636)|OV - Ovarian serous cystadenocarcinoma(12;0.00306)|STAD - Stomach adenocarcinoma(21;0.149)			GGCTGAGTAGTCGACAAAACC	0.498																																						dbGAP											0													162.0	174.0	170.0					12																	71016202		2050	4197	6247	-	-	-	SO:0001583	missense	0			X54131	CCDS44943.1, CCDS44944.1, CCDS55845.1, CCDS55846.1	12q15-q21	2013-02-11						"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9665	protein-coding gene	gene with protein product		176882		PTPB		2169617	Standard	NM_001109754		Approved		uc001swc.4	P23467	OTTHUMG00000169499	ENST00000550358.1:c.676A>G	12.37:g.71016202T>C	ENSP00000448058:p.Thr226Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKS8|B7ZKT0|C9JX87|F5H3G6|Q14D85|Q3MIV7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Ricin_B_lectin,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt	p.T226A	ENST00000550358.1	37	c.676		12	.	.	.	.	.	.	.	.	.	.	T	15.70	2.909648	0.52439	.	.	ENSG00000127329	ENST00000334414;ENST00000550358;ENST00000544694;ENST00000551525;ENST00000548122	T;T;T;T	0.05258	4.19;4.14;3.67;3.47	5.71	4.57	0.56435	.	.	.	.	.	T	0.06188	0.0160	L	0.41236	1.265	0.80722	D	1	B;B;B;B;B	0.31931	0.032;0.125;0.01;0.031;0.347	B;B;B;B;B	0.28638	0.019;0.092;0.006;0.026;0.069	T	0.37220	-0.9715	9	0.39692	T	0.17	.	10.0682	0.42317	0.0:0.0764:0.0:0.9236	.	105;226;225;226;226	Q6ZR19;Q6ZTX7;F8VSD5;P23467-3;F8VU56	.;.;.;.;.	A	226;226;226;225;105	ENSP00000334928:T226A;ENSP00000448058:T226A;ENSP00000448349:T225A;ENSP00000446982:T105A	ENSP00000334928:T226A	T	-	1	0	PTPRB	69302469	0.918000	0.31147	0.024000	0.17045	0.438000	0.31896	1.508000	0.35769	0.997000	0.38969	0.528000	0.53228	ACT	PTPRB	-	NULL	ENSG00000127329		0.498	PTPRB-003	NOVEL	basic|exp_conf	protein_coding	PTPRB	HGNC	protein_coding	OTTHUMT00000404436.1	119	0.00	0	T			71016202	71016202	-1	no_errors	ENST00000334414	ensembl	human	known	69_37n	missense	93	16.81	19	SNP	0.404	C
RP1	6101	genome.wustl.edu	37	8	55537775	55537775	+	Missense_Mutation	SNP	C	C	T	rs575855591		TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr8:55537775C>T	ENST00000220676.1	+	4	1481	c.1333C>T	c.(1333-1335)Cgt>Tgt	p.R445C		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	445					axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			AGCAAAGCATCGTTTTTATAG	0.438													C|||	1	0.000199681	0.0	0.0	5008	,	,		21014	0.0		0.0	False		,,,				2504	0.001				Colon(91;1014 1389 7634 14542 40420)	dbGAP											0													85.0	87.0	86.0					8																	55537775		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.1333C>T	8.37:g.55537775C>T	ENSP00000220676:p.Arg445Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.R445C	ENST00000220676.1	37	c.1333	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	13.64	2.296168	0.40594	.	.	ENSG00000104237	ENST00000220676	T	0.33216	1.42	5.25	4.36	0.52297	.	1.463730	0.04110	N	0.314533	T	0.37376	0.1001	L	0.34521	1.04	0.09310	N	1	D	0.69078	0.997	P	0.47299	0.543	T	0.50833	-0.8781	10	0.72032	D	0.01	.	15.1321	0.72533	0.1425:0.8575:0.0:0.0	.	445	P56715	RP1_HUMAN	C	445	ENSP00000220676:R445C	ENSP00000220676:R445C	R	+	1	0	RP1	55700328	0.313000	0.24554	0.080000	0.20451	0.893000	0.52053	4.503000	0.60407	1.196000	0.43129	0.650000	0.86243	CGT	RP1	-	NULL	ENSG00000104237		0.438	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	43	0.00	0	C	NM_006269		55537775	55537775	+1	no_errors	ENST00000220676	ensembl	human	known	69_37n	missense	36	28.00	14	SNP	0.034	T
RUNX2	860	genome.wustl.edu	37	6	45399750	45399750	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr6:45399750G>T	ENST00000371438.1	+	3	932	c.574G>T	c.(574-576)Gga>Tga	p.G192*	RUNX2_ENST00000465038.2_Nonsense_Mutation_p.G192*|RUNX2_ENST00000359524.5_Nonsense_Mutation_p.G178*|RUNX2_ENST00000371436.6_Nonsense_Mutation_p.G192*|RUNX2_ENST00000576263.1_Nonsense_Mutation_p.G192*|RUNX2_ENST00000352853.5_Nonsense_Mutation_p.G260*|RUNX2_ENST00000371432.3_Nonsense_Mutation_p.G178*|RUNX2_ENST00000541979.1_Nonsense_Mutation_p.G260*	NM_001024630.3	NP_001019801.3	Q13950	RUNX2_HUMAN	runt-related transcription factor 2	192	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				BMP signaling pathway (GO:0030509)|cell maturation (GO:0048469)|cellular response to BMP stimulus (GO:0071773)|chondrocyte development (GO:0002063)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic forelimb morphogenesis (GO:0035115)|endochondral ossification (GO:0001958)|gene expression (GO:0010467)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription, DNA-templated (GO:0045892)|odontogenesis of dentin-containing tooth (GO:0042475)|ossification (GO:0001503)|osteoblast development (GO:0002076)|osteoblast differentiation (GO:0001649)|osteoblast fate commitment (GO:0002051)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|stem cell differentiation (GO:0048863)|T cell differentiation (GO:0030217)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(18)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	34						GGGCCGGAGTGGACGAGGTAG	0.423																																						dbGAP											0			GRCh37	CM056382	RUNX2	M							66.0	68.0	67.0					6																	45399750		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF001450	CCDS43467.1, CCDS43468.1, CCDS43467.2, CCDS43468.2	6p21	2010-08-20			ENSG00000124813	ENSG00000124813			10472	protein-coding gene	gene with protein product		600211		CCD, CBFA1, CCD1		7835892	Standard	NM_001024630		Approved	AML3, PEBP2A1, PEBP2aA1	uc011dvx.2	Q13950	OTTHUMG00000014774	ENST00000371438.1:c.574G>T	6.37:g.45399750G>T	ENSP00000360493:p.Gly192*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14614|O14615|O95181	Nonsense_Mutation	SNP	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pfscan_AML1/Runt_N,prints_AML1_Runt	p.G260*	ENST00000371438.1	37	c.778	CCDS43467.2	6	.	.	.	.	.	.	.	.	.	.	G	38	7.170817	0.98111	.	.	ENSG00000124813	ENST00000465038;ENST00000352853;ENST00000541979;ENST00000371438;ENST00000371436;ENST00000359524;ENST00000371432	.	.	.	5.23	5.23	0.72850	.	0.094310	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-0.494	19.1642	0.93548	0.0:0.0:1.0:0.0	.	.	.	.	X	192;260;260;192;192;178;178	.	ENSP00000319087:G260X	G	+	1	0	RUNX2	45507728	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.375000	0.97178	2.600000	0.87896	0.650000	0.86243	GGA	RUNX2	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000124813		0.423	RUNX2-003	KNOWN	not_organism_supported|upstream_ATG|basic|appris_candidate_longest|CCDS	protein_coding	RUNX2	HGNC	protein_coding	OTTHUMT00000040755.2	78	0.00	0	G	NM_004348		45399750	45399750	+1	no_errors	ENST00000352853	ensembl	human	known	69_37n	nonsense	65	24.42	21	SNP	1.000	T
SDK2	54549	genome.wustl.edu	37	17	71346499	71346499	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr17:71346499G>T	ENST00000392650.3	-	43	5915	c.5915C>A	c.(5914-5916)tCt>tAt	p.S1972Y	SDK2_ENST00000388726.3_Missense_Mutation_p.S1953Y|SDK2_ENST00000410094.1_5'UTR	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	1972					cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						TAGGGCTCCAGACTTGGCACT	0.572																																						dbGAP											0													90.0	72.0	78.0					17																	71346499		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.5915C>A	17.37:g.71346499G>T	ENSP00000376421:p.Ser1972Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S1972Y	ENST00000392650.3	37	c.5915	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	G	19.61	3.859383	0.71834	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000424778;ENST00000316893;ENST00000410094	T;T;T	0.61742	0.08;0.11;1.43	5.54	5.54	0.83059	.	0.181933	0.49916	D	0.000121	T	0.53562	0.1804	N	0.22421	0.69	0.42638	D	0.993405	B;P	0.35982	0.306;0.531	B;B	0.42282	0.11;0.382	T	0.58115	-0.7693	10	0.62326	D	0.03	.	19.0904	0.93224	0.0:0.0:1.0:0.0	.	1972;1953	Q58EX2;Q58EX2-3	SDK2_HUMAN;.	Y	1596;1972;1953;1129;1972;313	ENSP00000376421:S1972Y;ENSP00000373378:S1953Y;ENSP00000407098:S1129Y	ENSP00000324967:S1972Y	S	-	2	0	SDK2	68858094	0.999000	0.42202	0.805000	0.32314	0.964000	0.63967	4.431000	0.59915	2.606000	0.88127	0.655000	0.94253	TCT	SDK2	-	NULL	ENSG00000069188		0.572	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	52	0.00	0	G	NM_019064		71346499	71346499	-1	no_errors	ENST00000392650	ensembl	human	known	69_37n	missense	34	10.53	4	SNP	0.994	T
SENP6	26054	genome.wustl.edu	37	6	76412369	76412369	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr6:76412369G>A	ENST00000447266.2	+	19	2775	c.2297G>A	c.(2296-2298)tGg>tAg	p.W766*	SENP6_ENST00000541192.1_Intron|SENP6_ENST00000370010.2_Nonsense_Mutation_p.W759*|SENP6_ENST00000370014.3_Nonsense_Mutation_p.W766*	NM_015571.2	NP_056386.2	Q9GZR1	SENP6_HUMAN	SUMO1/sentrin specific peptidase 6	766	Protease.				protein desumoylation (GO:0016926)|protein modification by small protein removal (GO:0070646)|protein sumoylation (GO:0016925)|regulation of kinetochore assembly (GO:0090234)|regulation of spindle assembly (GO:0090169)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	SUMO-specific protease activity (GO:0016929)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(2)|lung(12)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27		all_hematologic(105;0.189)				AGTGCACACTGGTTTTTGGCT	0.294																																						dbGAP											0													49.0	45.0	47.0					6																	76412369		1826	4068	5894	-	-	-	SO:0001587	stop_gained	0				CCDS43483.1, CCDS47454.1	6q13-q14.3	2008-02-05	2005-08-17		ENSG00000112701	ENSG00000112701			20944	protein-coding gene	gene with protein product		605003	"""SUMO1/sentrin specific protease 6"""				Standard	NM_015571		Approved	SUSP1, KIAA0797	uc003pid.4	Q9GZR1	OTTHUMG00000015060	ENST00000447266.2:c.2297G>A	6.37:g.76412369G>A	ENSP00000402527:p.Trp766*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNY9|O94891|Q5VUL3|Q5VUL4|Q8TBY4|Q9UJV5	Nonsense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.W766*	ENST00000447266.2	37	c.2297	CCDS47454.1	6	.	.	.	.	.	.	.	.	.	.	G	48	14.480999	0.99797	.	.	ENSG00000112701	ENST00000370010;ENST00000370014;ENST00000447266	.	.	.	5.9	5.9	0.94986	.	0.058943	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.2731	20.3396	0.98756	0.0:0.0:1.0:0.0	.	.	.	.	X	759;766;766	.	ENSP00000359027:W759X	W	+	2	0	SENP6	76469089	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.513000	0.90542	2.817000	0.96982	0.551000	0.68910	TGG	SENP6	-	pfam_Peptidase_C48,pfscan_Peptidase_C48	ENSG00000112701		0.294	SENP6-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP6	HGNC	protein_coding	OTTHUMT00000041272.2	70	0.00	0	G	NM_015571		76412369	76412369	+1	no_errors	ENST00000370014	ensembl	human	known	69_37n	nonsense	25	52.73	29	SNP	1.000	A
SH3GLB1	51100	genome.wustl.edu	37	1	87207920	87207920	+	Missense_Mutation	SNP	A	A	G	rs533090731		TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr1:87207920A>G	ENST00000370558.4	+	8	1115	c.791A>G	c.(790-792)aAt>aGt	p.N264S	SH3GLB1_ENST00000535010.1_Missense_Mutation_p.N164S|SH3GLB1_ENST00000482504.1_Missense_Mutation_p.N285S	NM_001206651.1|NM_001206653.1|NM_016009.4	NP_001193580.1|NP_001193582.1|NP_057093.1	Q9Y371	SHLB1_HUMAN	SH3-domain GRB2-like endophilin B1	264					'de novo' posttranslational protein folding (GO:0051084)|apoptotic process (GO:0006915)|phosphatidic acid biosynthetic process (GO:0006654)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrial outer membrane (GO:0005741)|protein complex (GO:0043234)	fatty acid binding (GO:0005504)|identical protein binding (GO:0042802)|lysophosphatidic acid acyltransferase activity (GO:0042171)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(4)|lung(3)|stomach(1)	11		Lung NSC(277;0.209)		all cancers(265;0.0136)|Epithelial(280;0.0414)		AGTAACAACAATCAGACTTCT	0.413													A|||	1	0.000199681	0.0	0.0	5008	,	,		16387	0.001		0.0	False		,,,				2504	0.0					dbGAP											0													125.0	112.0	116.0					1																	87207920		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF263293	CCDS710.1, CCDS55612.1, CCDS55613.1, CCDS72819.1	1p22.3	2012-04-17	2001-12-04		ENSG00000097033	ENSG00000097033		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	10833	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 70"""	609287	"""SH3-domain, GRB2-like, endophilin B1"""			11161816, 11259440	Standard	NM_016009		Approved	CGI-61, KIAA0491, Bif-1, PPP1R70	uc001dly.3	Q9Y371	OTTHUMG00000010257	ENST00000370558.4:c.791A>G	1.37:g.87207920A>G	ENSP00000473267:p.Asn264Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E182|Q5H8U5|Q9H3Z0|Q9NR47|Q9NYA9	Missense_Mutation	SNP	pfam_BAR_dom,pfam_BAR_dom-cont,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain	p.N285S	ENST00000370558.4	37	c.854	CCDS710.1	1	.	.	.	.	.	.	.	.	.	.	A	7.759	0.705016	0.15172	.	.	ENSG00000097033	ENST00000212369;ENST00000535010;ENST00000482504	T;T	0.15718	2.4;2.4	5.83	3.49	0.39957	Src homology-3 domain (1);	0.185982	0.56097	N	0.000029	T	0.02418	0.0074	N	0.08118	0	0.54753	D	0.999984	B;B;B	0.21688	0.035;0.059;0.0	B;B;B	0.20384	0.019;0.029;0.001	T	0.33033	-0.9884	10	0.08837	T	0.75	-0.1646	10.3034	0.43665	0.8644:0.0:0.1356:0.0	.	164;285;264	B4E182;Q9Y371-2;Q9Y371	.;.;SHLB1_HUMAN	S	264;164;285	ENSP00000441355:N164S;ENSP00000418744:N285S	ENSP00000212369:N264S	N	+	2	0	SH3GLB1	86980508	1.000000	0.71417	1.000000	0.80357	0.913000	0.54294	5.098000	0.64548	1.026000	0.39733	0.455000	0.32223	AAT	SH3GLB1	-	superfamily_SH3_domain	ENSG00000097033		0.413	SH3GLB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3GLB1	HGNC	protein_coding	OTTHUMT00000028287.2	116	0.00	0	A	NM_016009		87207920	87207920	+1	no_errors	ENST00000482504	ensembl	human	known	69_37n	missense	14	79.71	55	SNP	1.000	G
SH3PXD2B	285590	genome.wustl.edu	37	5	171766138	171766138	+	Silent	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr5:171766138G>A	ENST00000311601.5	-	13	2141	c.1971C>T	c.(1969-1971)ggC>ggT	p.G657G	SH3PXD2B_ENST00000519643.1_Intron	NM_001017995.2	NP_001017995.1	A1X283	SPD2B_HUMAN	SH3 and PX domains 2B	657					adipose tissue development (GO:0060612)|bone development (GO:0060348)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|eye development (GO:0001654)|heart development (GO:0007507)|podosome assembly (GO:0071800)|positive regulation of fat cell differentiation (GO:0045600)|protein localization to membrane (GO:0072657)|skeletal system development (GO:0001501)|superoxide metabolic process (GO:0006801)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|podosome (GO:0002102)	phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|SH2 domain binding (GO:0042169)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(12)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	36	Renal(175;0.000159)|Lung NSC(126;0.011)|all_lung(126;0.0175)	Medulloblastoma(196;0.0207)|all_neural(177;0.0625)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTTGGTCTTCGCCCTGAGGTG	0.582																																						dbGAP											0													105.0	100.0	102.0					5																	171766138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK095834	CCDS34291.1	5q35.2	2008-02-05	2006-02-13	2006-02-13	ENSG00000174705	ENSG00000174705			29242	protein-coding gene	gene with protein product		613293	"""KIAA1295"""	KIAA1295		10718198	Standard	NM_001017995		Approved	FLJ20831	uc003mbr.3	A1X283	OTTHUMG00000163280	ENST00000311601.5:c.1971C>T	5.37:g.171766138G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B6F0V2|Q9P2Q1	Silent	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_Phox,pfam_SH3-like_bac,pfam_DUF1058,superfamily_Phox,superfamily_SH3_domain,smart_Phox,smart_SH3_domain,pfscan_Phox,pfscan_SH3_domain	p.G657	ENST00000311601.5	37	c.1971	CCDS34291.1	5																																																																																			SH3PXD2B	-	NULL	ENSG00000174705		0.582	SH3PXD2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3PXD2B	HGNC	protein_coding	OTTHUMT00000372449.1	89	0.00	0	G	NM_017963		171766138	171766138	-1	no_errors	ENST00000311601	ensembl	human	known	69_37n	silent	33	42.62	26	SNP	0.552	A
SLC24A3	57419	genome.wustl.edu	37	20	19665914	19665915	+	Frame_Shift_Del	DEL	AG	AG	-			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr20:19665914_19665915delAG	ENST00000328041.6	+	12	1430_1431	c.1233_1234delAG	c.(1231-1236)acagagfs	p.E412fs		NM_020689.3	NP_065740.2	Q9HC58	NCKX3_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 3	412					ion transport (GO:0006811)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(10)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GCAACGAAACAgagaatgaaaa	0.55																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF169257	CCDS13140.1	20p13	2013-05-22			ENSG00000185052	ENSG00000185052		"""Solute carriers"""	10977	protein-coding gene	gene with protein product		609839					Standard	NM_020689		Approved		uc002wrl.3	Q9HC58	OTTHUMG00000031993	ENST00000328041.6:c.1233_1234delAG	20.37:g.19665916_19665917delAG	ENSP00000333519:p.Glu412fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKV7|Q9BQJ9|Q9BQL7|Q9BQY3|Q9H519	Frame_Shift_Del	DEL	pfam_NaCa_Exmemb,tigrfam_K-dep_Na/Ca-exchanger-like	p.N413fs	ENST00000328041.6	37	c.1233_1234	CCDS13140.1	20																																																																																			SLC24A3	-	tigrfam_K-dep_Na/Ca-exchanger-like	ENSG00000185052		0.550	SLC24A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A3	HGNC	protein_coding	OTTHUMT00000078207.4	85	0.00	0	AG	NM_020689		19665914	19665915	+1	no_errors	ENST00000328041	ensembl	human	known	69_37n	frame_shift_del	39	11.36	5	DEL	0.306:0.999	-
STAG3	10734	genome.wustl.edu	37	7	99802723	99802723	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr7:99802723C>T	ENST00000426455.1	+	28	3454	c.3047C>T	c.(3046-3048)tCc>tTc	p.S1016F	STAG3_ENST00000394018.2_Missense_Mutation_p.S958F|GATS_ENST00000543273.1_RNA|GATS_ENST00000436886.2_Intron|STAG3_ENST00000317296.5_Missense_Mutation_p.S1016F|STAG3_ENST00000440830.1_3'UTR	NM_001282716.1	NP_001269645.1	Q9UJ98	STAG3_HUMAN	stromal antigen 3	1016					chromosome segregation (GO:0007059)|synaptonemal complex assembly (GO:0007130)	chromosome, centromeric region (GO:0000775)|extracellular space (GO:0005615)|lateral element (GO:0000800)|male germ cell nucleus (GO:0001673)|meiotic cohesin complex (GO:0030893)|nuclear meiotic cohesin complex (GO:0034991)|nucleolus (GO:0005730)|nucleus (GO:0005634)|synaptonemal complex (GO:0000795)|transverse filament (GO:0000802)				breast(1)|central_nervous_system(2)|endometrium(6)|kidney(3)|large_intestine(11)|lung(30)|ovary(5)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)	66	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TCAGAGTTTTCCCCCCGACTC	0.547																																						dbGAP											0													147.0	154.0	151.0					7																	99802723		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ007798	CCDS34703.1, CCDS64730.1, CCDS75642.1	7q22	2008-02-01			ENSG00000066923	ENSG00000066923			11356	protein-coding gene	gene with protein product		608489				10698974	Standard	XM_005250116		Approved		uc003utx.1	Q9UJ98	OTTHUMG00000155183	ENST00000426455.1:c.3047C>T	7.37:g.99802723C>T	ENSP00000400359:p.Ser1016Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8Z1|B4DZ10|D6W5U8|H7BYK9|Q8NDP3	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.S1016F	ENST00000426455.1	37	c.3047	CCDS34703.1	7	.	.	.	.	.	.	.	.	.	.	.	19.79	3.893694	0.72639	.	.	ENSG00000066923	ENST00000426455;ENST00000394018;ENST00000379577;ENST00000317296	D;D;D	0.84589	-1.87;-1.87;-1.87	5.28	5.28	0.74379	.	0.000000	0.46145	D	0.000302	D	0.92747	0.7694	M	0.82323	2.585	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	D;D;D	0.87578	0.99;0.998;0.998	D	0.93690	0.7006	10	0.87932	D	0	-15.9625	16.4332	0.83860	0.0:1.0:0.0:0.0	.	958;1016;1016	B4DZ10;D6W5U7;Q9UJ98	.;.;STAG3_HUMAN	F	1016;958;36;1016	ENSP00000400359:S1016F;ENSP00000377586:S958F;ENSP00000319318:S1016F	ENSP00000319318:S1016F	S	+	2	0	STAG3	99640659	1.000000	0.71417	0.999000	0.59377	0.794000	0.44872	5.485000	0.66850	2.455000	0.83008	0.655000	0.94253	TCC	STAG3	-	NULL	ENSG00000066923		0.547	STAG3-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	STAG3	HGNC	protein_coding	OTTHUMT00000338734.2	75	0.00	0	C	NM_012447		99802723	99802723	+1	no_errors	ENST00000317296	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	1.000	T
TECPR2	9895	genome.wustl.edu	37	14	102916920	102916920	+	Frame_Shift_Del	DEL	C	C	-			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr14:102916920delC	ENST00000359520.7	+	15	3566	c.3340delC	c.(3340-3342)cccfs	p.P1114fs	TECPR2_ENST00000558678.1_Frame_Shift_Del_p.P1114fs	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	1114					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						TCATGTGGTTCCCCGTGGGAC	0.463																																						dbGAP											0													108.0	88.0	95.0					14																	102916920		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.3340delC	14.37:g.102916920delC	ENSP00000352510:p.Pro1114fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Frame_Shift_Del	DEL	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.R1115fs	ENST00000359520.7	37	c.3340	CCDS32162.1	14																																																																																			TECPR2	-	superfamily_Reg_csome_cond/b-lactamase_inh	ENSG00000196663		0.463	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	85	0.00	0	C	NM_014844		102916920	102916920	+1	no_errors	ENST00000359520	ensembl	human	known	69_37n	frame_shift_del	54	29.49	23	DEL	1.000	-
TEX15	56154	genome.wustl.edu	37	8	30694937	30694937	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr8:30694937G>C	ENST00000256246.2	-	3	7788	c.7714C>G	c.(7714-7716)Cag>Gag	p.Q2572E		NM_031271.3	NP_112561.2	Q9BXT5	TEX15_HUMAN	testis expressed 15	2572					fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		TCTGTAGGCTGTAGTTTGTTT	0.368																																						dbGAP											0													83.0	83.0	83.0					8																	30694937		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000256246.2:c.7714C>G	8.37:g.30694937G>C	ENSP00000256246:p.Gln2572Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.Q2572E	ENST00000256246.2	37	c.7714	CCDS6080.1	8	.	.	.	.	.	.	.	.	.	.	G	2.356	-0.347723	0.05208	.	.	ENSG00000133863	ENST00000256246	T	0.13538	2.58	4.71	0.796	0.18648	.	0.731639	0.11836	N	0.524709	T	0.09291	0.0229	L	0.32530	0.975	0.09310	N	1	B	0.17038	0.02	B	0.15484	0.013	T	0.32903	-0.9889	10	0.87932	D	0	.	3.0599	0.06196	0.0993:0.3668:0.3653:0.1686	.	2572	Q9BXT5	TEX15_HUMAN	E	2572	ENSP00000256246:Q2572E	ENSP00000256246:Q2572E	Q	-	1	0	TEX15	30814479	0.001000	0.12720	0.002000	0.10522	0.087000	0.18053	0.251000	0.18257	0.259000	0.21709	0.650000	0.86243	CAG	TEX15	-	NULL	ENSG00000133863		0.368	TEX15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEX15	HGNC	protein_coding	OTTHUMT00000376193.1	61	0.00	0	G			30694937	30694937	-1	no_errors	ENST00000256246	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	0.002	C
TRANK1	9881	genome.wustl.edu	37	3	36900329	36900329	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr3:36900329G>T	ENST00000429976.2	-	11	1667	c.1420C>A	c.(1420-1422)Cat>Aat	p.H474N	TRANK1_ENST00000301807.6_5'UTR|TRANK1_ENST00000428977.2_5'UTR	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	474							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						AAGTCCTCATGTTTCAGGCAC	0.562																																						dbGAP											0													92.0	83.0	86.0					3																	36900329		692	1591	2283	-	-	-	SO:0001583	missense	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.1420C>A	3.37:g.36900329G>T	ENSP00000416168:p.His474Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8K0	Missense_Mutation	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.H474N	ENST00000429976.2	37	c.1420	CCDS46789.2	3	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.766264	0.00651	.	.	ENSG00000168016	ENST00000429976	T	0.50548	0.74	4.68	-0.859	0.10685	.	.	.	.	.	T	0.19525	0.0469	N	0.11313	0.125	0.09310	N	0.999999	.	.	.	.	.	.	T	0.27468	-1.0073	7	0.02654	T	1	.	5.6852	0.17799	0.2321:0.0:0.4288:0.3391	.	.	.	.	N	474	ENSP00000416168:H474N	ENSP00000416168:H474N	H	-	1	0	TRANK1	36875333	0.001000	0.12720	0.000000	0.03702	0.025000	0.11179	0.651000	0.24873	-0.193000	0.10415	-1.119000	0.02030	CAT	TRANK1	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000168016		0.562	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		44	0.00	0	G	NM_014831		36900329	36900329	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	missense	30	11.76	4	SNP	0.000	T
VPS35	55737	genome.wustl.edu	37	16	46694483	46694484	+	Frame_Shift_Del	DEL	CT	CT	-			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr16:46694483_46694484delCT	ENST00000299138.7	-	17	2349_2350	c.2291_2292delAG	c.(2290-2292)gagfs	p.E764fs	RP11-93O14.2_ENST00000569353.1_RNA	NM_018206.4	NP_060676.2	Q96QK1	VPS35_HUMAN	vacuolar protein sorting 35 homolog (S. cerevisiae)	764					cell death (GO:0008219)|protein transport (GO:0015031)|retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|retromer complex (GO:0030904)				breast(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(11)|pancreas(1)|prostate(1)|urinary_tract(1)	23		all_cancers(37;7.65e-05)|all_epithelial(9;0.000154)|all_lung(18;0.00585)|Lung NSC(13;0.0496)|Breast(268;0.116)				TGTTAATCTGCTCTGTTTCTTC	0.401																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			AF175265	CCDS10721.1	16q12	2012-06-27	2006-12-19		ENSG00000069329	ENSG00000069329		"""Parkinson disease"""	13487	protein-coding gene	gene with protein product		601501	"""vacuolar protein sorting 35 (yeast homolog)"", ""vacuolar protein sorting 35 (yeast)"""			11112353, 21763482	Standard	NM_018206		Approved	FLJ10752, MEM3, PARK17	uc002eef.4	Q96QK1	OTTHUMG00000132542	ENST00000299138.7:c.2291_2292delAG	16.37:g.46694485_46694486delCT	ENSP00000299138:p.Glu764fs	Somatic		WXS	Illumina GAIIx	Phase_IV	Q561W2|Q9H016|Q9H096|Q9H4P3|Q9H8J0|Q9NRS7|Q9NVG2|Q9NX80|Q9NZK2	Frame_Shift_Del	DEL	pfam_VPS35,superfamily_ARM-type_fold	p.E764fs	ENST00000299138.7	37	c.2292_2291	CCDS10721.1	16																																																																																			VPS35	-	superfamily_ARM-type_fold	ENSG00000069329		0.401	VPS35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS35	HGNC	protein_coding	OTTHUMT00000255742.3	127	0.00	0	CT			46694483	46694484	-1	no_errors	ENST00000299138	ensembl	human	known	69_37n	frame_shift_del	86	21.10	23	DEL	0.997:1.000	-
XIRP2	129446	genome.wustl.edu	37	2	168108454	168108454	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr2:168108454A>T	ENST00000409195.1	+	9	10641	c.10552A>T	c.(10552-10554)Agt>Tgt	p.S3518C	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409273.1_Missense_Mutation_p.S3296C|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000409756.2_Intron|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000295237.9_Missense_Mutation_p.S3518C	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	3343					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						TGCATTTATAAGTGGTAAATG	0.403																																						dbGAP											0													62.0	58.0	59.0					2																	168108454		1870	4090	5960	-	-	-	SO:0001583	missense	0			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.10552A>T	2.37:g.168108454A>T	ENSP00000386840:p.Ser3518Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Missense_Mutation	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.S3518C	ENST00000409195.1	37	c.10552	CCDS42769.1	2	.	.	.	.	.	.	.	.	.	.	A	15.35	2.807085	0.50421	.	.	ENSG00000163092	ENST00000409195;ENST00000295237;ENST00000409273;ENST00000413534	T;T;T	0.03330	3.97;3.97;3.97	5.96	0.655	0.17839	.	0.896679	0.09763	N	0.759060	T	0.14056	0.0340	M	0.61703	1.905	0.22066	N	0.99938	D;D;D	0.71674	0.994;0.998;0.998	P;P;D	0.63113	0.751;0.891;0.911	T	0.23833	-1.0177	10	0.72032	D	0.01	-0.0704	14.4725	0.67526	0.5204:0.4796:0.0:0.0	.	3343;3343;3296	A4UGR9;A4UGR9-3;A4UGR9-2	XIRP2_HUMAN;.;.	C	3518;3518;3296;932	ENSP00000386840:S3518C;ENSP00000295237:S3518C;ENSP00000387255:S3296C	ENSP00000295237:S3518C	S	+	1	0	XIRP2	167816700	0.564000	0.26602	0.015000	0.15790	0.937000	0.57800	1.081000	0.30791	-0.105000	0.12132	0.528000	0.53228	AGT	XIRP2	-	NULL	ENSG00000163092		0.403	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	36	0.00	0	A	NM_152381		168108454	168108454	+1	no_errors	ENST00000295237	ensembl	human	known	69_37n	missense	7	46.15	6	SNP	0.043	T
ZAN	7455	genome.wustl.edu	37	7	100349543	100349543	+	RNA	SNP	C	C	T			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr7:100349543C>T	ENST00000348028.3	+	0	1980				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			CAGAAAAACCCACCATTCCTT	0.468																																						dbGAP											0													229.0	260.0	250.0					7																	100349543		1868	4101	5969	-	-	-			0			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349543C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EGF-like,pfscan_EG-like_dom,pfscan_MAM_dom	p.P605	ENST00000348028.3	37	c.1815		7																																																																																			ZAN	-	NULL	ENSG00000146839		0.468	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	408	0.00	0	C	NM_003386		100349543	100349543	+1	no_errors	ENST00000546292	ensembl	human	known	69_37n	silent	336	19.33	81	SNP	0.000	T
ZIC3	7547	genome.wustl.edu	37	X	136651211	136651211	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chrX:136651211G>A	ENST00000287538.5	+	2	1761	c.1211G>A	c.(1210-1212)cGc>cAc	p.R404H	ZIC3_ENST00000370606.3_Missense_Mutation_p.R404H|ZIC3_ENST00000478471.1_3'UTR	NM_003413.3	NP_003404.1	O60481	ZIC3_HUMAN	Zic family member 3	404					anterior/posterior pattern specification (GO:0009952)|cell differentiation (GO:0030154)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of left/right asymmetry in nervous system (GO:0035545)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|heart looping (GO:0001947)|lung development (GO:0030324)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(3)|liver(1)|lung(18)|ovary(3)|soft_tissue(2)|urinary_tract(1)	37	Acute lymphoblastic leukemia(192;0.000127)					AGCTCCCTGCGCAAACACATG	0.577																																						dbGAP											0													147.0	126.0	133.0					X																	136651211		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF028706	CCDS14663.1	Xq24-q27.1	2013-01-08	2011-05-19		ENSG00000156925	ENSG00000156925		"""Zinc fingers, C2H2-type"""	12874	protein-coding gene	gene with protein product		300265	"""heterotaxy 1"", ""Zic family member 3 (odd-paired homolog, Drosophila)"""	HTX1		8298651, 7747776	Standard	NM_003413		Approved	HTX, ZNF203	uc004fak.3	O60481	OTTHUMG00000022525	ENST00000287538.5:c.1211G>A	X.37:g.136651211G>A	ENSP00000287538:p.Arg404His	Somatic		WXS	Illumina GAIIx	Phase_IV	B2CNW4|Q14DE5|Q5JY75	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R404H	ENST00000287538.5	37	c.1211	CCDS14663.1	X	.	.	.	.	.	.	.	.	.	.	G	35	5.517209	0.96416	.	.	ENSG00000156925	ENST00000287538;ENST00000370606	T;T	0.07688	3.17;3.17	5.74	5.74	0.90152	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.24005	0.0581	L	0.41961	1.31	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.00256	-1.1873	10	0.87932	D	0	.	17.7298	0.88374	0.0:0.0:1.0:0.0	.	404	O60481	ZIC3_HUMAN	H	404	ENSP00000287538:R404H;ENSP00000359638:R404H	ENSP00000287538:R404H	R	+	2	0	ZIC3	136478877	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.860000	0.99555	2.405000	0.81733	0.600000	0.82982	CGC	ZIC3	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000156925		0.577	ZIC3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIC3	HGNC	protein_coding	OTTHUMT00000058526.1	59	0.00	0	G			136651211	136651211	+1	no_errors	ENST00000287538	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	A
ZNF248	57209	genome.wustl.edu	37	10	38121863	38121863	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A26Z-01A-11D-A16D-09	TCGA-C8-A26Z-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	fa4f7af6-380f-4dbd-ba6a-8c0d22f56a9c	16215f35-017a-47a8-a0d4-1536a45430bb	g.chr10:38121863A>C	ENST00000395867.3	-	6	970	c.420T>G	c.(418-420)tgT>tgG	p.C140W	ZNF248_ENST00000494133.1_Intron|AL135791.1_ENST00000583461.1_RNA|ZNF248_ENST00000374648.3_Intron|ZNF248_ENST00000357328.4_Missense_Mutation_p.C140W	NM_001267605.1|NM_001267606.1|NM_001267607.1|NM_021045.2	NP_001254534.1|NP_001254535.1|NP_001254536.1|NP_066383.1	Q8NDW4	ZN248_HUMAN	zinc finger protein 248	140					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|urinary_tract(1)	20						CACATGAGTCACATATTTTAT	0.313																																						dbGAP											0													52.0	54.0	53.0					10																	38121863		2202	4298	6500	-	-	-	SO:0001583	missense	0			AJ491695	CCDS7194.1, CCDS58077.1, CCDS73087.1	10p11.21	2013-01-08			ENSG00000198105	ENSG00000198105		"""Zinc fingers, C2H2-type"", ""-"""	13041	protein-coding gene	gene with protein product						12566394	Standard	NM_021045		Approved	bA162G10.3	uc010qeu.2	Q8NDW4	OTTHUMG00000017980	ENST00000395867.3:c.420T>G	10.37:g.38121863A>C	ENSP00000379208:p.Cys140Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDV8|Q9UMP3	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C140W	ENST00000395867.3	37	c.420	CCDS7194.1	10	.	.	.	.	.	.	.	.	.	.	A	14.32	2.498766	0.44455	.	.	ENSG00000198105	ENST00000395867;ENST00000357328	T;T	0.06142	3.34;3.34	4.86	3.73	0.42828	.	0.000000	0.51477	D	0.000087	T	0.18130	0.0435	M	0.62723	1.935	0.53005	D	0.999965	D	0.76494	0.999	D	0.68192	0.956	T	0.00282	-1.1850	10	0.87932	D	0	.	8.8223	0.35034	0.9104:0.0:0.0896:0.0	.	140	Q8NDW4	ZN248_HUMAN	W	140	ENSP00000379208:C140W;ENSP00000349882:C140W	ENSP00000349882:C140W	C	-	3	2	ZNF248	38161869	0.950000	0.32346	1.000000	0.80357	0.994000	0.84299	1.687000	0.37680	1.005000	0.39183	0.460000	0.39030	TGT	ZNF248	-	NULL	ENSG00000198105		0.313	ZNF248-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF248	HGNC	protein_coding	OTTHUMT00000047609.1	84	0.00	0	A	NM_021045		38121863	38121863	-1	no_errors	ENST00000357328	ensembl	human	known	69_37n	missense	22	65.08	41	SNP	1.000	C
