#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCA5	23461	genome.wustl.edu	37	17	67286128	67286128	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:67286128C>T	ENST00000392676.3	-	13	1721	c.1657G>A	c.(1657-1659)Gaa>Aaa	p.E553K	ABCA5_ENST00000392677.2_Missense_Mutation_p.E553K|ABCA5_ENST00000588877.1_Missense_Mutation_p.E553K			Q8WWZ7	ABCA5_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 5	553	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				cholesterol efflux (GO:0033344)|high-density lipoprotein particle remodeling (GO:0034375)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|reverse cholesterol transport (GO:0043691)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(2)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(18)|lung(19)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	54	Breast(10;3.72e-11)				Tacrolimus(DB00864)	TTTCTTGCTTCAAACATTTCA	0.279																																						dbGAP											0													100.0	92.0	95.0					17																	67286128		2202	4294	6496	-	-	-	SO:0001583	missense	0			U66672	CCDS11685.1	17q24.3	2012-03-14			ENSG00000154265	ENSG00000154265		"""ATP binding cassette transporters / subfamily A"""	35	protein-coding gene	gene with protein product		612503				8894702	Standard	NM_172232		Approved	EST90625	uc002jig.2	Q8WWZ7		ENST00000392676.3:c.1657G>A	17.37:g.67286128C>T	ENSP00000376443:p.Glu553Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IVJ2|Q96LJ1|Q96MS4|Q96PZ9|Q9NY14	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.E553K	ENST00000392676.3	37	c.1657	CCDS11685.1	17	.	.	.	.	.	.	.	.	.	.	C	22.1	4.241238	0.79912	.	.	ENSG00000154265	ENST00000392677;ENST00000392676	T;T	0.38722	1.12;1.12	5.2	5.2	0.72013	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000007	T	0.51109	0.1655	L	0.29908	0.895	0.80722	D	1	D;D	0.59357	0.977;0.985	P;P	0.62885	0.801;0.908	T	0.43442	-0.9391	9	.	.	.	.	18.3803	0.90448	0.0:1.0:0.0:0.0	.	553;553	Q8WWZ7-2;Q8WWZ7	.;ABCA5_HUMAN	K	553	ENSP00000376444:E553K;ENSP00000376443:E553K	.	E	-	1	0	ABCA5	64797723	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.751000	0.74893	2.437000	0.82529	0.585000	0.79938	GAA	ABCA5	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	ENSG00000154265		0.279	ABCA5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ABCA5	HGNC	protein_coding	OTTHUMT00000450654.1	95	0.00	0	C	NM_018672		67286128	67286128	-1	no_errors	ENST00000392677	ensembl	human	known	69_37n	missense	86	31.20	39	SNP	1.000	T
ACP6	51205	genome.wustl.edu	37	1	147126421	147126421	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:147126421G>C	ENST00000369238.6	-	6	1115	c.668C>G	c.(667-669)tCt>tGt	p.S223C	ACP6_ENST00000392988.2_Missense_Mutation_p.S223C	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	223					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)			breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					TGGCTGTAAAGAGGCAGTCTG	0.418																																						dbGAP											0													118.0	100.0	106.0					1																	147126421		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.668C>G	1.37:g.147126421G>C	ENSP00000358241:p.Ser223Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.S223C	ENST00000369238.6	37	c.668	CCDS928.1	1	.	.	.	.	.	.	.	.	.	.	G	14.54	2.565884	0.45694	.	.	ENSG00000162836	ENST00000369238;ENST00000392988	T;T	0.44482	0.92;0.92	5.59	3.69	0.42338	.	0.410909	0.29486	N	0.012003	T	0.27524	0.0676	L	0.52759	1.655	0.09310	N	0.999999	D;B	0.57257	0.979;0.357	P;B	0.50378	0.639;0.186	T	0.08411	-1.0723	10	0.66056	D	0.02	.	8.1115	0.30917	0.077:0.0:0.5884:0.3345	.	223;223	Q9NPH0-2;Q9NPH0	.;PPA6_HUMAN	C	223	ENSP00000358241:S223C;ENSP00000376714:S223C	ENSP00000358241:S223C	S	-	2	0	ACP6	145593045	0.000000	0.05858	0.992000	0.48379	0.779000	0.44077	0.486000	0.22340	0.685000	0.31468	-0.169000	0.13324	TCT	ACP6	-	pfam_His_Pase_superF_clade-2	ENSG00000162836		0.418	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACP6	HGNC	protein_coding	OTTHUMT00000039420.2	34	0.00	0	G	NM_016361		147126421	147126421	-1	no_errors	ENST00000369238	ensembl	human	known	69_37n	missense	95	10.28	11	SNP	0.314	C
ACPP	55	genome.wustl.edu	37	3	132050535	132050535	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:132050535G>C	ENST00000336375.5	+	3	351	c.261G>C	c.(259-261)aaG>aaC	p.K87N	ACPP_ENST00000351273.7_Missense_Mutation_p.K87N|ACPP_ENST00000475741.1_Missense_Mutation_p.K87N|ACPP_ENST00000489084.1_3'UTR	NM_001099.4	NP_001090.2	P15309	PPAP_HUMAN	acid phosphatase, prostate	87					adenosine metabolic process (GO:0046085)|dephosphorylation (GO:0016311)|nucleotide metabolic process (GO:0009117)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|purine nucleobase metabolic process (GO:0006144)|regulation of sensory perception of pain (GO:0051930)|thiamine metabolic process (GO:0006772)	apical part of cell (GO:0045177)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|Golgi cisterna (GO:0031985)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|multivesicular body (GO:0005771)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|secretory granule (GO:0030141)|vesicle membrane (GO:0012506)	5'-nucleotidase activity (GO:0008253)|acid phosphatase activity (GO:0003993)|choline binding (GO:0033265)|identical protein binding (GO:0042802)|lysophosphatidic acid phosphatase activity (GO:0052642)|phosphatase activity (GO:0016791)|thiamine phosphate phosphatase activity (GO:0042131)			NS(1)|breast(1)|endometrium(2)|large_intestine(5)|lung(13)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	27						ATATAAGAAAGAGATATAGAA	0.328																																						dbGAP											0													48.0	53.0	52.0					3																	132050535		2199	4298	6497	-	-	-	SO:0001583	missense	0				CCDS3073.1, CCDS46916.1	3q22.1	2012-05-16			ENSG00000014257	ENSG00000014257	3.1.3.2		125	protein-coding gene	gene with protein product		171790					Standard	NM_001099		Approved	ACP3, ACP-3	uc003eop.4	P15309	OTTHUMG00000159650	ENST00000336375.5:c.261G>C	3.37:g.132050535G>C	ENSP00000337471:p.Lys87Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNC6|Q5FBY0|Q96KY0|Q96QK9|Q96QM0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.K87N	ENST00000336375.5	37	c.261	CCDS3073.1	3	.	.	.	.	.	.	.	.	.	.	G	9.581	1.123563	0.20959	.	.	ENSG00000014257	ENST00000336375;ENST00000475741;ENST00000351273	T;T;T	0.29917	1.55;1.55;1.55	5.72	-0.915	0.10494	.	0.237850	0.37219	N	0.002185	T	0.35038	0.0918	L	0.41079	1.255	0.32897	D	0.512674	D;D;D	0.71674	0.997;0.996;0.998	D;P;D	0.68353	0.927;0.88;0.957	T	0.42155	-0.9468	10	0.23891	T	0.37	.	7.4611	0.27296	0.3904:0.1408:0.4687:0.0	.	87;87;87	P15309;P15309-2;Q5FBY0	PPAP_HUMAN;.;.	N	87	ENSP00000337471:K87N;ENSP00000417744:K87N;ENSP00000323036:K87N	ENSP00000337471:K87N	K	+	3	2	ACPP	133533225	0.064000	0.20934	0.229000	0.23960	0.014000	0.08584	0.180000	0.16860	-0.072000	0.12864	-0.302000	0.09304	AAG	ACPP	-	pfam_His_Pase_superF_clade-2	ENSG00000014257		0.328	ACPP-001	KNOWN	basic|CCDS	protein_coding	ACPP	HGNC	protein_coding	OTTHUMT00000356699.2	49	0.00	0	G	NM_001099		132050535	132050535	+1	no_errors	ENST00000351273	ensembl	human	known	69_37n	missense	52	23.53	16	SNP	0.757	C
ACTA1	58	genome.wustl.edu	37	1	229567374	229567374	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:229567374C>T	ENST00000366684.3	-	7	1108	c.1006G>A	c.(1006-1008)Gag>Aag	p.E336K	ACTA1_ENST00000366683.2_Missense_Mutation_p.E248K	NM_001100.3	NP_001091.1	P68133	ACTS_HUMAN	actin, alpha 1, skeletal muscle	336			E -> A (in NEM3). {ECO:0000269|PubMed:15520409}.		cell growth (GO:0016049)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to extracellular stimulus (GO:0009991)|response to lithium ion (GO:0010226)|response to mechanical stimulus (GO:0009612)|response to steroid hormone (GO:0048545)|skeletal muscle fiber adaptation (GO:0043503)|skeletal muscle fiber development (GO:0048741)|skeletal muscle thin filament assembly (GO:0030240)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|blood microparticle (GO:0072562)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|striated muscle thin filament (GO:0005865)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|myosin binding (GO:0017022)|structural constituent of cytoskeleton (GO:0005200)			endometrium(4)|large_intestine(4)|lung(18)|prostate(1)|urinary_tract(1)	28	Breast(184;0.0858)|Ovarian(103;0.103)	Prostate(94;0.167)				TATTTGCGCTCCGGCGGGGCG	0.672																																						dbGAP											0													86.0	90.0	88.0					1																	229567374		2203	4300	6503	-	-	-	SO:0001583	missense	0			J00068	CCDS1578.1	1q42.13	2014-09-17			ENSG00000143632	ENSG00000143632			129	protein-coding gene	gene with protein product	"""nemaline myopathy type 3"""	102610		ACTA		10072583, 6865942	Standard	NM_001100		Approved	NEM3	uc001htm.3	P68133	OTTHUMG00000038006	ENST00000366684.3:c.1006G>A	1.37:g.229567374C>T	ENSP00000355645:p.Glu336Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P02568|P99020|Q5T8M9	Missense_Mutation	SNP	pfam_Actin-like,smart_Actin-like,prints_Actin-like	p.E336K	ENST00000366684.3	37	c.1006	CCDS1578.1	1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.810757	0.32053	.	.	ENSG00000143632	ENST00000366684;ENST00000308794;ENST00000366683;ENST00000366682;ENST00000342787	D;D	0.95412	-3.7;-3.7	3.75	2.83	0.33086	.	0.123302	0.53938	D	0.000058	D	0.97688	0.9242	M	0.89904	3.07	0.50171	D	0.999853	P	0.51351	0.944	D	0.72338	0.977	D	0.97767	1.0224	10	0.87932	D	0	.	11.1191	0.48277	0.0:0.9085:0.0:0.0915	.	336	P68133	ACTS_HUMAN	K	336;246;248;301;213	ENSP00000355645:E336K;ENSP00000355644:E248K	ENSP00000312351:E246K	E	-	1	0	ACTA1	227633997	1.000000	0.71417	0.705000	0.30386	0.283000	0.27025	5.833000	0.69349	0.908000	0.36671	0.563000	0.77884	GAG	ACTA1	-	pfam_Actin-like,smart_Actin-like	ENSG00000143632		0.672	ACTA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTA1	HGNC	protein_coding	OTTHUMT00000092781.1	40	0.00	0	C	NM_001100		229567374	229567374	-1	no_errors	ENST00000366684	ensembl	human	known	69_37n	missense	133	11.33	17	SNP	0.998	T
ACTN2	88	genome.wustl.edu	37	1	236914892	236914892	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:236914892C>T	ENST00000366578.4	+	15	1945	c.1779C>T	c.(1777-1779)atC>atT	p.I593I	ACTN2_ENST00000542672.1_Silent_p.I593I|ACTN2_ENST00000546208.1_Silent_p.I87I	NM_001103.2|NM_001278343.1	NP_001094.1|NP_001265272.1	P35609	ACTN2_HUMAN	actinin, alpha 2	593					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|focal adhesion assembly (GO:0048041)|microspike assembly (GO:0030035)|muscle filament sliding (GO:0030049)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of potassium ion transport (GO:0043267)|negative regulation of protein localization to cell surface (GO:2000009)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein homotetramerization (GO:0051289)|regulation of apoptotic process (GO:0042981)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	actin filament (GO:0005884)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|platelet alpha granule lumen (GO:0031093)|pseudopodium (GO:0031143)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|cytoskeletal protein binding (GO:0008092)|FATZ binding (GO:0051373)|identical protein binding (GO:0042802)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|protein dimerization activity (GO:0046983)|structural constituent of muscle (GO:0008307)|thyroid hormone receptor coactivator activity (GO:0030375)|titin binding (GO:0031432)|titin Z domain binding (GO:0070080)			endometrium(4)|kidney(2)|large_intestine(15)|lung(55)|ovary(4)|prostate(3)|skin(3)	86	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;0.00661)|Acute lymphoblastic leukemia(190;0.109)|Prostate(94;0.174)	OV - Ovarian serous cystadenocarcinoma(106;0.00168)			ACATCAGAATCAGCTCAAGCA	0.597																																						dbGAP											0													120.0	101.0	108.0					1																	236914892		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC047901	CCDS1613.1, CCDS60455.1, CCDS73053.1	1q42-q43	2014-09-17			ENSG00000077522	ENSG00000077522		"""EF-hand domain containing"""	164	protein-coding gene	gene with protein product		102573				1339456	Standard	NM_001103		Approved		uc001hyf.2	P35609	OTTHUMG00000040059	ENST00000366578.4:c.1779C>T	1.37:g.236914892C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANE4|B2RCS5|Q86TF4|Q86TI8	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.I593	ENST00000366578.4	37	c.1779	CCDS1613.1	1																																																																																			ACTN2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000077522		0.597	ACTN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACTN2	HGNC	protein_coding	OTTHUMT00000096628.1	39	0.00	0	C	NM_001103		236914892	236914892	+1	no_errors	ENST00000366578	ensembl	human	known	69_37n	silent	105	12.50	15	SNP	1.000	T
ADAM28	10863	genome.wustl.edu	37	8	24209527	24209527	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:24209527G>T	ENST00000265769.4	+	21	2316	c.2206G>T	c.(2206-2208)Gat>Tat	p.D736Y	ADAM28_ENST00000397649.3_Nonstop_Mutation_p.*484L|RP11-624C23.1_ENST00000519689.1_RNA|RP11-624C23.1_ENST00000518988.1_RNA|RP11-624C23.1_ENST00000523578.1_RNA|RP11-624C23.1_ENST00000523700.1_RNA	NM_014265.4	NP_055080.2	Q9UKQ2	ADA28_HUMAN	ADAM metallopeptidase domain 28	736					spermatogenesis (GO:0007283)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(10)|lung(7)|prostate(1)|skin(12)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	42		Prostate(55;0.0959)		Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0434)|BRCA - Breast invasive adenocarcinoma(99;0.175)		CCATGTGTATGATCTGCCAGT	0.378																																					NSCLC(193;488 2149 22258 34798 40734)	dbGAP											0													117.0	114.0	115.0					8																	24209527		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ242015	CCDS34865.1, CCDS47830.1	8p21.2	2005-11-29	2005-08-18		ENSG00000042980	ENSG00000042980		"""ADAM metallopeptidase domain containing"""	206	protein-coding gene	gene with protein product		606188	"""a disintegrin and metalloproteinase domain 28"""				Standard	XM_005273378		Approved	eMDCII, MDC-Lm, MDC-Ls, ADAM23	uc003xdy.3	Q9UKQ2	OTTHUMG00000163780	ENST00000265769.4:c.2206G>T	8.37:g.24209527G>T	ENSP00000265769:p.Asp736Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMV5|Q9Y339|Q9Y3S0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_Peptidase_M12B_N,pfam_ADAM_Cys-rich,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_EG-like_dom,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.D736Y	ENST00000265769.4	37	c.2206	CCDS34865.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	1.332|1.332	-0.596411|-0.596411	0.03771|0.03771	.|.	.|.	ENSG00000042980|ENSG00000042980	ENST00000265769|ENST00000397649;ENST00000521629	T|.	0.01548|.	4.78|.	4.14|4.14	2.25|2.25	0.28309|0.28309	.|.	.|.	.|.	.|.	.|.	T|.	0.41419|.	0.1158|.	L|L	0.53249|0.53249	1.67|1.67	0.09310|0.09310	N|N	1|1	P;P|.	0.50943|.	0.94;0.94|.	B;B|.	0.41723|.	0.365;0.365|.	T|.	0.27123|.	-1.0083|.	9|.	0.59425|.	D|.	0.04|.	.|.	7.0182|7.0182	0.24900|0.24900	0.0:0.1912:0.6111:0.1977|0.0:0.1912:0.6111:0.1977	.|.	736;736|.	B2RMV5;Q9UKQ2|.	.;ADA28_HUMAN|.	Y|L	736|484;368	ENSP00000265769:D736Y|.	ENSP00000265769:D736Y|.	D|X	+|+	1|2	0|2	ADAM28|ADAM28	24265472|24265472	0.780000|0.780000	0.28664|0.28664	0.032000|0.032000	0.17829|0.17829	0.100000|0.100000	0.18952|0.18952	1.429000|1.429000	0.34903|0.34903	0.644000|0.644000	0.30656|0.30656	0.591000|0.591000	0.81541|0.81541	GAT|TGA	ADAM28	-	NULL	ENSG00000042980		0.378	ADAM28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM28	HGNC	protein_coding	OTTHUMT00000375441.2	61	0.00	0	G	NM_021778		24209527	24209527	+1	no_errors	ENST00000265769	ensembl	human	known	69_37n	missense	67	29.90	29	SNP	0.039	T
PNKP	11284	genome.wustl.edu	37	19	50373175	50373175	+	5'Flank	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:50373175C>T	ENST00000322344.3	-	0	0				AKT1S1_ENST00000391834.2_Silent_p.*257*|AKT1S1_ENST00000391832.3_Silent_p.*257*|PNKP_ENST00000596014.1_5'Flank|PNKP_ENST00000600910.1_5'Flank|AKT1S1_ENST00000391835.1_Silent_p.*277*|AKT1S1_ENST00000344175.5_Silent_p.*257*|PNKP_ENST00000595792.1_5'Flank|AKT1S1_ENST00000391833.1_Silent_p.*257*|PNKP_ENST00000600573.1_5'Flank|AKT1S1_ENST00000391831.1_Silent_p.*257*	NM_007254.3	NP_009185.2	Q96T60	PNKP_HUMAN	polynucleotide kinase 3'-phosphatase						dephosphorylation (GO:0016311)|DNA damage response, detection of DNA damage (GO:0042769)|DNA repair (GO:0006281)|DNA-dependent DNA replication (GO:0006261)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide phosphorylation (GO:0046939)|nucleotide-excision repair, DNA damage removal (GO:0000718)|polynucleotide 3' dephosphorylation (GO:0098506)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent polydeoxyribonucleotide 5'-hydroxyl-kinase activity (GO:0046404)|damaged DNA binding (GO:0003684)|double-stranded DNA binding (GO:0003690)|endonuclease activity (GO:0004519)|nucleotide kinase activity (GO:0019201)|polynucleotide 3'-phosphatase activity (GO:0046403)|purine nucleotide binding (GO:0017076)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|urinary_tract(1)	19		all_lung(116;1.05e-05)|Lung NSC(112;3.77e-05)|all_neural(266;0.107)|Ovarian(192;0.231)		GBM - Glioblastoma multiforme(134;0.0118)|OV - Ovarian serous cystadenocarcinoma(262;0.0134)		CCCTGGACTTCAATATTTCCG	0.697								Other BER factors																														dbGAP											0													21.0	19.0	19.0					19																	50373175		2166	4257	6423	-	-	-	SO:0001631	upstream_gene_variant	0			AF126486	CCDS12783.1	19q13.3-q13.4	2008-02-05				ENSG00000039650			9154	protein-coding gene	gene with protein product		605610				10446192, 10446193	Standard	NM_007254		Approved	PNK	uc002pqj.3	Q96T60			19.37:g.50373175C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUL2|Q9P1V2|Q9UKU8|Q9UNF8|Q9UNI0	Silent	SNP	NULL	p.*257	ENST00000322344.3	37	c.770	CCDS12783.1	19																																																																																			AKT1S1	-	NULL	ENSG00000204673		0.697	PNKP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT1S1	HGNC	protein_coding	OTTHUMT00000465830.1	28	0.00	0	C	NM_007254		50373175	50373175	-1	no_errors	ENST00000344175	ensembl	human	known	69_37n	silent	25	19.35	6	SNP	1.000	T
ALS2CR11	151254	genome.wustl.edu	37	2	202356492	202356492	+	Intron	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:202356492C>T	ENST00000286195.3	-	15	1626				ALS2CR11_ENST00000439140.1_Missense_Mutation_p.M1524I|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						CAAGGGACTTCATTTTCAGTG	0.348																																						dbGAP											0													156.0	117.0	129.0					2																	202356492		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1582-3867G>A	2.37:g.202356492C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.M1524I	ENST00000286195.3	37	c.4572	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	C	1.588	-0.529878	0.04112	.	.	ENSG00000155754	ENST00000439140	T	0.41400	1.0	5.15	-0.595	0.11660	.	.	.	.	.	T	0.27967	0.0689	L	0.34521	1.04	0.09310	N	0.999999	B	0.21606	0.058	B	0.16289	0.015	T	0.24154	-1.0168	9	0.62326	D	0.03	.	5.8807	0.18854	0.0:0.4574:0.1445:0.3981	.	1524	E9PGG4	.	I	1524	ENSP00000409937:M1524I	ENSP00000409937:M1524I	M	-	3	0	ALS2CR11	202064737	0.001000	0.12720	0.000000	0.03702	0.025000	0.11179	-0.009000	0.12765	-0.020000	0.14032	0.557000	0.71058	ATG	ALS2CR11	-	NULL	ENSG00000155754		0.348	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	83	0.00	0	C	NM_152525		202356492	202356492	-1	no_errors	ENST00000439140	ensembl	human	novel	69_37n	missense	109	12.10	15	SNP	0.000	T
ALS2CR11	151254	genome.wustl.edu	37	2	202357912	202357912	+	Intron	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:202357912C>G	ENST00000286195.3	-	14	1626				ALS2CR11_ENST00000439140.1_Missense_Mutation_p.S1051T|ALS2CR11_ENST00000439802.1_Intron|ALS2CR11_ENST00000482942.1_Intron	NM_152525.5	NP_689738.3	Q53TS8	AL2SA_HUMAN	amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 11											NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(11)|ovary(1)|skin(5)|urinary_tract(3)	33						GTTAGTTAAACTTTCTAAAGT	0.254																																						dbGAP											0													35.0	29.0	31.0					2																	202357912		692	1582	2274	-	-	-	SO:0001627	intron_variant	0			AB053313	CCDS2349.1, CCDS54430.1, CCDS54428.1, CCDS54429.1	2q33	2007-12-07			ENSG00000155754	ENSG00000155754			14438	protein-coding gene	gene with protein product						11586298	Standard	NM_152525		Approved	FLJ25351	uc002uyf.3	Q53TS8	OTTHUMG00000132830	ENST00000286195.3:c.1581+2705G>C	2.37:g.202357912C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C9IZH7|E9PGG4|Q8NCN6|Q96LN4	Missense_Mutation	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.S1051T	ENST00000286195.3	37	c.3152	CCDS2349.1	2	.	.	.	.	.	.	.	.	.	.	C	11.45	1.642060	0.29157	.	.	ENSG00000155754	ENST00000439140	T	0.44881	0.91	5.69	-1.47	0.08772	.	.	.	.	.	T	0.23014	0.0556	L	0.29908	0.895	0.09310	N	1	B	0.21606	0.058	B	0.14023	0.01	T	0.19844	-1.0293	9	0.39692	T	0.17	.	0.5571	0.00673	0.2743:0.3003:0.1404:0.2851	.	1051	E9PGG4	.	T	1051	ENSP00000409937:S1051T	ENSP00000409937:S1051T	S	-	2	0	ALS2CR11	202066157	0.017000	0.18338	0.048000	0.18961	0.013000	0.08279	-0.366000	0.07563	-0.483000	0.06772	-0.484000	0.04775	AGT	ALS2CR11	-	NULL	ENSG00000155754		0.254	ALS2CR11-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ALS2CR11	HGNC	protein_coding	OTTHUMT00000256296.2	28	0.00	0	C	NM_152525		202357912	202357912	-1	no_errors	ENST00000439140	ensembl	human	novel	69_37n	missense	29	25.64	10	SNP	0.001	G
AMY2B	280	genome.wustl.edu	37	1	104116527	104116527	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:104116527C>T	ENST00000361355.4	+	6	1327	c.711C>T	c.(709-711)ttC>ttT	p.F237F	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	237					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		GTAACTGGTTCCCTGCAGGAA	0.363																																						dbGAP											0													144.0	144.0	144.0					1																	104116527		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.711C>T	1.37:g.104116527C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Silent	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.F237	ENST00000361355.4	37	c.711	CCDS782.1	1																																																																																			AMY2B	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom	ENSG00000240038		0.363	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	97	0.00	0	C	NM_020978		104116527	104116527	+1	no_errors	ENST00000361355	ensembl	human	known	69_37n	silent	72	35.40	40	SNP	0.993	T
ANAPC10	10393	genome.wustl.edu	37	4	145985831	145985831	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:145985831C>T	ENST00000507656.1	-	4	313	c.220G>A	c.(220-222)Gtg>Atg	p.V74M	ANAPC10_ENST00000512680.1_Missense_Mutation_p.V74M|ANAPC10_ENST00000309439.5_Missense_Mutation_p.V74M|ANAPC10_ENST00000451299.2_Missense_Mutation_p.V74M|ANAPC10_ENST00000510270.1_5'UTR	NM_001256706.1	NP_001243635.1	Q9UM13	APC10_HUMAN	anaphase promoting complex subunit 10	74	DOC. {ECO:0000255|PROSITE- ProRule:PRU00614}.				anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein K11-linked ubiquitination (GO:0070979)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)	anaphase-promoting complex (GO:0005680)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)				endometrium(1)|large_intestine(3)|lung(1)|skin(1)	6	all_hematologic(180;0.151)					AATGTCTTCACTGTTGTTTTT	0.299																																						dbGAP											0													106.0	98.0	101.0					4																	145985831		1815	4070	5885	-	-	-	SO:0001583	missense	0			AF132794	CCDS43273.1	4q31	2011-06-15			ENSG00000164162	ENSG00000164162		"""Anaphase promoting complex subunits"""	24077	protein-coding gene	gene with protein product		613745				10318877, 11230166	Standard	NM_001256706		Approved	APC10, DOC1, DKFZP564L0562	uc031shk.1	Q9UM13	OTTHUMG00000161477	ENST00000507656.1:c.220G>A	4.37:g.145985831C>T	ENSP00000423995:p.Val74Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DNZ7|Q2V500|Q9UG51|Q9Y5R0	Missense_Mutation	SNP	pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,pirsf_APC_su10	p.V74M	ENST00000507656.1	37	c.220	CCDS43273.1	4	.	.	.	.	.	.	.	.	.	.	C	28.2	4.901723	0.92035	.	.	ENSG00000164162	ENST00000507656;ENST00000309439;ENST00000451299;ENST00000514390;ENST00000513054;ENST00000512680;ENST00000504721	T;T;T;T;T;T;T	0.56941	0.43;0.43;0.43;0.43;0.43;0.43;0.43	5.36	5.36	0.76844	Anaphase-promoting complex, subunit 10/DOC domain (2);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.74283	0.3696	M	0.88570	2.965	0.80722	D	1	D	0.53312	0.959	P	0.56127	0.792	T	0.79885	-0.1614	10	0.87932	D	0	-10.4367	19.4318	0.94772	0.0:1.0:0.0:0.0	.	74	Q9UM13	APC10_HUMAN	M	74	ENSP00000423995:V74M;ENSP00000310071:V74M;ENSP00000403891:V74M;ENSP00000423043:V74M;ENSP00000421609:V74M;ENSP00000425459:V74M;ENSP00000423223:V74M	ENSP00000310071:V74M	V	-	1	0	ANAPC10	146205281	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.015000	0.70791	2.671000	0.90904	0.484000	0.47621	GTG	ANAPC10	-	pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,pirsf_APC_su10	ENSG00000164162		0.299	ANAPC10-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ANAPC10	HGNC	protein_coding	OTTHUMT00000365090.1	74	0.00	0	C	NM_014885		145985831	145985831	-1	no_errors	ENST00000309439	ensembl	human	known	69_37n	missense	70	38.05	43	SNP	1.000	T
ARHGEF7	8874	genome.wustl.edu	37	13	111955406	111955406	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr13:111955406G>A	ENST00000218789.5	+	21	2561	c.2064G>A	c.(2062-2064)gtG>gtA	p.V688V	ARHGEF7_ENST00000426073.2_Silent_p.V629V|ARHGEF7_ENST00000370623.3_Silent_p.V714V|ARHGEF7_ENST00000375736.4_Silent_p.V629V|ARHGEF7_ENST00000375737.5_Silent_p.V704V			Q14155	ARHG7_HUMAN	Rho guanine nucleotide exchange factor (GEF) 7	0					apoptotic signaling pathway (GO:0097190)|epidermal growth factor receptor signaling pathway (GO:0007173)|focal adhesion assembly (GO:0048041)|hematopoietic progenitor cell differentiation (GO:0002244)|lamellipodium assembly (GO:0030032)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of fibroblast migration (GO:0010763)|positive regulation of GTPase activity (GO:0043547)|positive regulation of lamellipodium morphogenesis (GO:2000394)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)	guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase binding (GO:0019901)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(16)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|soft_tissue(1)	41	all_lung(23;3.96e-05)|Lung NSC(43;0.00156)|Lung SC(71;0.0753)|all_neural(89;0.0804)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.188)			AGAAGCTGGTGAGGAAAGTCC	0.453																																						dbGAP											0													97.0	96.0	97.0					13																	111955406		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D63476	CCDS9521.1, CCDS32009.1, CCDS45068.1, CCDS45069.1	13q33.3	2013-01-10			ENSG00000102606	ENSG00000102606		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	15607	protein-coding gene	gene with protein product	"""SH3 domain-containing proline-rich protein"", ""PAK-interacting exchange factor beta"", ""rho"", ""guanine nucleotide exchange factor 7"""	605477				9207241, 9726964	Standard	NM_003899		Approved	KIAA0142, PIXB, DKFZp761K1021, Nbla10314, DKFZp686C12170, BETA-PIX, COOL1, P85SPR, P85, P85COOL1, P50BP, PAK3, P50	uc001vrs.2	Q14155	OTTHUMG00000017357	ENST00000218789.5:c.2064G>A	13.37:g.111955406G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALK6|B1ALK8|Q3LIA4|Q5W9H0|Q6P9G3|Q6PII2|Q86W63|Q8N3M1	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_CH-domain,superfamily_DH-domain,superfamily_SH3_domain,superfamily_CH-domain,smart_CH-domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain,prints_SH3_domain	p.V714	ENST00000218789.5	37	c.2142		13																																																																																			ARHGEF7	-	NULL	ENSG00000102606		0.453	ARHGEF7-001	NOVEL	basic	protein_coding	ARHGEF7	HGNC	protein_coding	OTTHUMT00000045805.3	44	0.00	0	G	NM_001113511		111955406	111955406	+1	no_errors	ENST00000370623	ensembl	human	known	69_37n	silent	32	42.86	24	SNP	1.000	A
ASB10	136371	genome.wustl.edu	37	7	150884267	150884268	+	5'Flank	DEL	AG	AG	-	rs372716545		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	AG	AG					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:150884267_150884268delAG	ENST00000420175.2	-	0	0				ASB10_ENST00000377867.3_Intron|ASB10_ENST00000422024.1_Frame_Shift_Del_p.L29fs|ASB10_ENST00000434669.1_Frame_Shift_Del_p.L29fs|ASB10_ENST00000275838.1_5'UTR			Q8WXI3	ASB10_HUMAN	ankyrin repeat and SOCS box containing 10						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|endometrium(2)|lung(7)|skin(2)	12			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		TGCCAAAGGCagagagagagag	0.594																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			AK055536	CCDS5921.2, CCDS47749.1, CCDS47750.1, CCDS47749.2, CCDS47750.2	7q35	2014-02-04	2011-01-25		ENSG00000146926	ENSG00000146926		"""Ankyrin repeat domain containing"""	17185	protein-coding gene	gene with protein product		615054	"""ankyrin repeat and SOCS box-containing 10"", ""glaucoma 1, open angle, F (adult-onset)"""	GLC1F		22156576	Standard	NM_080871		Approved		uc003wjm.1	Q8WXI3	OTTHUMG00000157013		7.37:g.150884277_150884278delAG	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AVH0|Q6ZUL6	Frame_Shift_Del	DEL	pfam_Ankyrin_rpt,pfam_SOCS_C,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_SOCS_C,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SOCS_C	p.L29fs	ENST00000420175.2	37	c.86_85	CCDS47750.2	7																																																																																			ASB10	-	NULL	ENSG00000146926		0.594	ASB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB10	HGNC	protein_coding	OTTHUMT00000347096.3	12	0.00	0	AG	NM_080871		150884267	150884268	-1	no_errors	ENST00000422024	ensembl	human	known	69_37n	frame_shift_del	17	22.73	5	DEL	0.003:0.000	-
ASH1L	55870	genome.wustl.edu	37	1	155531916	155531916	+	Intron	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:155531916G>C	ENST00000368346.3	-	1	541				ASH1L_ENST00000392403.3_Intron|ASH1L_ENST00000548830.1_Intron|ASH1L-AS1_ENST00000452809.1_RNA			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)						cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GCTTAGGCCCGAATGCCGGCC	0.622																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011	ENST00000368346.3:c.98+27C>G	1.37:g.155531916G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	RNA	SNP	-	NULL	ENST00000368346.3	37	NULL		1																																																																																			ASH1L-AS1	-	-	ENSG00000235919		0.622	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L-AS1	HGNC	protein_coding	OTTHUMT00000039400.1	27	0.00	0	G	NM_018489		155531916	155531916	+1	no_errors	ENST00000452809	ensembl	human	known	69_37n	rna	56	12.50	8	SNP	0.005	C
ASPM	259266	genome.wustl.edu	37	1	197113231	197113231	+	Splice_Site	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:197113231C>T	ENST00000367409.4	-	2	554		c.e2-1		ASPM_ENST00000294732.7_Splice_Site	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)						developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						TCTCTTTAGGCTATAATCAAA	0.284																																						dbGAP											0													41.0	43.0	42.0					1																	197113231		2202	4287	6489	-	-	-	SO:0001630	splice_region_variant	0			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.298-1G>A	1.37:g.197113231C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Splice_Site	SNP	-	e2-1	ENST00000367409.4	37	c.298-1	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	20.4	3.981605	0.74474	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367406	.	.	.	5.42	5.42	0.78866	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.1771	0.93607	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ASPM	195379854	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	2.381000	0.44336	2.699000	0.92147	0.637000	0.83480	.	ASPM	-	-	ENSG00000066279		0.284	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	37	0.00	0	C	NM_018136	Intron	197113231	197113231	-1	no_errors	ENST00000367409	ensembl	human	known	69_37n	splice_site	80	15.79	15	SNP	1.000	T
ATN1	1822	genome.wustl.edu	37	12	7043656	7043656	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr12:7043656C>T	ENST00000356654.4	+	4	431	c.194C>T	c.(193-195)cCa>cTa	p.P65L	ATN1_ENST00000396684.2_Missense_Mutation_p.P65L	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	65					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						GCCTCCACCCCAAAGGTCAAC	0.507																																						dbGAP											0													74.0	66.0	69.0					12																	7043656		2197	4299	6496	-	-	-	SO:0001583	missense	0			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.194C>T	12.37:g.7043656C>T	ENSP00000349076:p.Pro65Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.P65L	ENST00000356654.4	37	c.194	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	C	10.95	1.494620	0.26774	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	T;T;T	0.05139	3.49;3.49;3.49	5.1	5.1	0.69264	.	0.000000	0.33712	U	0.004636	T	0.10035	0.0246	N	0.08118	0	0.80722	D	1	D;P	0.63046	0.992;0.877	P;P	0.60415	0.874;0.675	T	0.49370	-0.8947	10	0.37606	T	0.19	.	18.8939	0.92416	0.0:1.0:0.0:0.0	.	65;65	Q86V38;P54259	.;ATN1_HUMAN	L	65	ENSP00000349076:P65L;ENSP00000379915:P65L;ENSP00000441744:P65L	ENSP00000349076:P65L	P	+	2	0	ATN1	6913917	0.993000	0.37304	1.000000	0.80357	0.996000	0.88848	2.832000	0.48152	2.537000	0.85549	0.591000	0.81541	CCA	ATN1	-	pfam_Atrophin-like,prints_Atrophin-1	ENSG00000111676		0.507	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	50	0.00	0	C	NM_001940		7043656	7043656	+1	no_errors	ENST00000356654	ensembl	human	known	69_37n	missense	28	50.00	28	SNP	1.000	T
ATP11C	286410	genome.wustl.edu	37	X	138878432	138878432	+	Splice_Site	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:138878432C>A	ENST00000327569.3	-	12	1313	c.1215G>T	c.(1213-1215)caG>caT	p.Q405H	ATP11C_ENST00000361648.2_Splice_Site_p.Q405H|ATP11C_ENST00000370557.1_Splice_Site_p.Q402H|ATP11C_ENST00000370543.1_Splice_Site_p.Q405H|ATP11C_ENST00000460773.1_5'UTR|ATP11C_ENST00000359686.2_Splice_Site_p.Q405H	NM_173694.4	NP_775965	Q8NB49	AT11C_HUMAN	ATPase, class VI, type 11C	405					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|positive regulation of B cell differentiation (GO:0045579)|pre-B cell differentiation (GO:0002329)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(2)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(31)|ovary(5)|prostate(1)|skin(3)	75	Acute lymphoblastic leukemia(192;0.000127)					ATGCTCTAACCTGACCAAGTT	0.353																																						dbGAP											0													41.0	36.0	38.0					X																	138878432		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AJ580094	CCDS14668.1, CCDS35410.1	Xq27.1	2011-06-09	2007-09-19		ENSG00000101974	ENSG00000101974		"""ATPases / P-type"""	13554	protein-coding gene	gene with protein product		300516	"""ATPase, Class VI, type 11C"""			11015572	Standard	NM_173694		Approved	ATPIG, ATPIQ	uc004faz.3	Q8NB49	OTTHUMG00000022538	ENST00000327569.3:c.1215+1G>T	X.37:g.138878432C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JT69|Q5JT70|Q5JT71|Q5JT72|Q5JT73|Q6ZND5|Q6ZU50|Q6ZUP7|Q70IJ9|Q70IK0|Q8WX24	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.Q405H	ENST00000327569.3	37	c.1215	CCDS14668.1	X	.	.	.	.	.	.	.	.	.	.	C	24.5	4.541396	0.85917	.	.	ENSG00000101974	ENST00000370557;ENST00000361648;ENST00000327569;ENST00000370543;ENST00000359686	T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41	5.88	5.88	0.94601	HAD-like domain (1);ATPase, P-type, cytoplasmic domain N (1);	0.000000	0.85682	D	0.000000	D	0.86973	0.6062	M	0.93854	3.465	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	D	0.90082	0.4171	9	.	.	.	.	17.9971	0.89187	0.0:1.0:0.0:0.0	.	405;405	Q8NB49-3;Q8NB49	.;AT11C_HUMAN	H	402;405;405;405;405	ENSP00000359588:Q402H;ENSP00000355165:Q405H;ENSP00000332756:Q405H;ENSP00000359574:Q405H;ENSP00000352715:Q405H	.	Q	-	3	2	ATP11C	138706098	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	7.818000	0.86416	2.471000	0.83476	0.600000	0.82982	CAG	ATP11C	-	superfamily_HAD-like_dom,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	ENSG00000101974		0.353	ATP11C-008	KNOWN	basic|CCDS	protein_coding	ATP11C	HGNC	protein_coding	OTTHUMT00000354945.1	27	0.00	0	C	NM_173694	Missense_Mutation	138878432	138878432	-1	no_errors	ENST00000327569	ensembl	human	known	69_37n	missense	52	25.71	18	SNP	1.000	A
CASC10	399726	genome.wustl.edu	37	10	21784544	21784544	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:21784544G>T	ENST00000377113.5	-	2	843	c.396C>A	c.(394-396)ttC>ttA	p.F132L	MIR1915_ENST00000410139.1_RNA	NM_001010911.2	NP_001010911.1	Q5T4H9	CSC10_HUMAN	cancer susceptibility candidate 10	132																	CTCGCCTGTCGAAATCGCTAG	0.517											OREG0020066	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													68.0	81.0	76.0					10																	21784544		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC040880	CCDS31163.1	10p12.31	2013-07-17	2013-07-17	2013-07-17	ENSG00000204682	ENSG00000204682			31448	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 114"""	C10orf114		21804547	Standard	NM_001010911		Approved	bA418C1.3	uc001iqn.4	Q5T4H9	OTTHUMG00000017795	ENST00000377113.5:c.396C>A	10.37:g.21784544G>T	ENSP00000366317:p.Phe132Leu	Somatic	751	WXS	Illumina GAIIx	Phase_IV	A1L4M3	Missense_Mutation	SNP	NULL	p.F132L	ENST00000377113.5	37	c.396	CCDS31163.1	10	.	.	.	.	.	.	.	.	.	.	G	11.49	1.654602	0.29425	.	.	ENSG00000204682	ENST00000377113	T	0.52057	0.68	3.21	1.04	0.20106	.	.	.	.	.	T	0.25306	0.0615	N	0.08118	0	0.09310	N	1	B	0.20368	0.044	B	0.21546	0.035	T	0.23154	-1.0196	9	0.87932	D	0	.	5.0286	0.14398	0.0:0.2621:0.5073:0.2305	.	132	Q5T4H9	CJ114_HUMAN	L	132	ENSP00000366317:F132L	ENSP00000366317:F132L	F	-	3	2	C10orf114	21824550	0.000000	0.05858	0.004000	0.12327	0.098000	0.18820	-0.152000	0.10159	0.663000	0.31027	0.305000	0.20034	TTC	C10orf114	-	NULL	ENSG00000204682		0.517	CASC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf114	HGNC	protein_coding	OTTHUMT00000047130.2	50	0.00	0	G	NM_001010911		21784544	21784544	-1	no_errors	ENST00000377113	ensembl	human	known	69_37n	missense	59	26.25	21	SNP	0.004	T
C1orf56	54964	genome.wustl.edu	37	1	151021205	151021205	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:151021205C>T	ENST00000368926.5	+	1	990	c.882C>T	c.(880-882)ctC>ctT	p.L294L	C1orf56_ENST00000465135.1_3'UTR	NM_017860.3	NP_060330.2	Q9BUN1	MENT_HUMAN	chromosome 1 open reading frame 56	294						cytoplasm (GO:0005737)|extracellular region (GO:0005576)|nucleus (GO:0005634)				endometrium(1)|kidney(1)|lung(3)|ovary(1)|prostate(1)	7	Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0486)|LUSC - Lung squamous cell carcinoma(543;0.211)			CCATCCACCTCAGAAGCAGTC	0.592											OREG0013793	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									GBM(146;891 3320 6873)	dbGAP											0													103.0	113.0	110.0					1																	151021205		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC002469	CCDS980.1	1q21.2	2013-09-20			ENSG00000143443	ENSG00000143443			26045	protein-coding gene	gene with protein product	"""methylated in normal thymocytes"""					12975309, 22133874	Standard	NM_017860		Approved	FLJ20519, MENT	uc001ewn.3	Q9BUN1	OTTHUMG00000035159	ENST00000368926.5:c.882C>T	1.37:g.151021205C>T		Somatic	1737	WXS	Illumina GAIIx	Phase_IV	B2RDU8|Q9NWZ4	Silent	SNP	superfamily_Thrombospondin_1_rpt	p.L294	ENST00000368926.5	37	c.882	CCDS980.1	1																																																																																			C1orf56	-	NULL	ENSG00000143443		0.592	C1orf56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf56	HGNC	protein_coding	OTTHUMT00000085101.1	65	0.00	0	C	NM_017860		151021205	151021205	+1	no_errors	ENST00000368926	ensembl	human	known	69_37n	silent	108	11.48	14	SNP	0.000	T
C1orf101	257044	genome.wustl.edu	37	1	244803299	244803299	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:244803299G>C	ENST00000366534.4	+	22	2826	c.2772G>C	c.(2770-2772)ttG>ttC	p.L924F	C1orf101_ENST00000366533.4_3'UTR|C1orf101_ENST00000366531.3_Missense_Mutation_p.L773F	NM_001130957.1	NP_001124429.1	Q5SY80	CA101_HUMAN	chromosome 1 open reading frame 101	924						CatSper complex (GO:0036128)				NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(8)|ovary(1)|prostate(2)|skin(2)|urinary_tract(3)	36	all_cancers(71;2.99e-05)|all_epithelial(71;0.00015)|all_neural(11;0.0269)|Breast(184;0.0654)|Glioma(6;0.0724)|Ovarian(71;0.0761)|all_lung(81;0.0874)|Lung NSC(105;0.121)		all cancers(7;1.22e-05)|OV - Ovarian serous cystadenocarcinoma(106;0.001)|GBM - Glioblastoma multiforme(7;0.0154)			TTCTTGTTTTGAGCTACTTTC	0.353																																						dbGAP											0													262.0	206.0	223.0					1																	244803299		692	1591	2283	-	-	-	SO:0001583	missense	0			BC032859	CCDS1625.1, CCDS44340.1, CCDS55693.1	1q44	2012-12-20			ENSG00000179397	ENSG00000179397			28491	protein-coding gene	gene with protein product						12477932	Standard	NM_173807		Approved	MGC33370	uc001iam.3	Q5SY80	OTTHUMG00000040103	ENST00000366534.4:c.2772G>C	1.37:g.244803299G>C	ENSP00000355492:p.Leu924Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZR4|B7Z7X5|E9PEA3|Q8IYZ6	Missense_Mutation	SNP	NULL	p.L924F	ENST00000366534.4	37	c.2772	CCDS44340.1	1	.	.	.	.	.	.	.	.	.	.	G	5.775	0.327378	0.10956	.	.	ENSG00000179397	ENST00000366534;ENST00000428042;ENST00000366531	T;T	0.34275	1.37;1.37	4.9	1.83	0.25207	.	0.367422	0.19489	N	0.113027	T	0.33265	0.0857	L	0.55481	1.735	0.25440	N	0.988109	B;B	0.33103	0.215;0.397	B;B	0.36808	0.105;0.233	T	0.23868	-1.0176	10	0.62326	D	0.03	.	8.2491	0.31706	0.0:0.3265:0.5048:0.1687	.	844;924	B1AQM6;Q5SY80	.;CA101_HUMAN	F	924;844;773	ENSP00000355492:L924F;ENSP00000395796:L844F	ENSP00000355489:L773F	L	+	3	2	C1orf101	242869922	0.998000	0.40836	0.880000	0.34516	0.017000	0.09413	1.622000	0.36997	0.292000	0.22492	0.591000	0.81541	TTG	C1orf101	-	NULL	ENSG00000179397		0.353	C1orf101-001	NOVEL	basic|appris_principal|CCDS	protein_coding	C1orf101	HGNC	protein_coding	OTTHUMT00000096701.1	122	0.00	0	G	NM_173807		244803299	244803299	+1	no_errors	ENST00000366534	ensembl	human	known	69_37n	missense	424	13.59	67	SNP	0.827	C
TMEM243	79161	genome.wustl.edu	37	7	86827187	86827187	+	Intron	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:86827187G>A	ENST00000433078.1	-	4	676				TMEM243_ENST00000257637.3_Intron|TMEM243_ENST00000481425.1_Intron|TMEM243_ENST00000423734.1_Nonsense_Mutation_p.Q102*			Q9BU79	TM243_HUMAN	transmembrane protein 243, mitochondrial							integral component of membrane (GO:0016021)											ACCCAAGGCTGAAAATTTTTG	0.358																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS5602.1	7q21.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000135185	ENSG00000135185			21707	protein-coding gene	gene with protein product	"""MDR1 and mitochondrial taxol resistance associated gene"""		"""chromosome 7 open reading frame 23"""	C7orf23			Standard	NM_024315		Approved	MGC4175, MM-TRAG	uc003uio.3	Q9BU79	OTTHUMG00000130823	ENST00000433078.1:c.234+69C>T	7.37:g.86827187G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1C6|B2R9I4|D6W5P1	Nonsense_Mutation	SNP	pfam_DUF2678	p.Q102*	ENST00000433078.1	37	c.304	CCDS5602.1	7	.	.	.	.	.	.	.	.	.	.	G	10.45	1.352580	0.24512	.	.	ENSG00000135185	ENST00000423734	.	.	.	4.09	-0.486	0.12064	.	.	.	.	.	.	.	.	.	.	.	0.27360	N	0.955994	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-7.4852	2.5638	0.04778	0.2487:0.0:0.3469:0.4044	.	.	.	.	X	102	.	ENSP00000407976:Q102X	Q	-	1	0	C7orf23	86665123	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.013000	0.12678	0.020000	0.15106	0.561000	0.74099	CAG	C7orf23	-	NULL	ENSG00000135185		0.358	TMEM243-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	C7orf23	HGNC	protein_coding	OTTHUMT00000334412.1	18	0.00	0	G	NM_024315		86827187	86827187	-1	no_errors	ENST00000423734	ensembl	human	putative	69_37n	nonsense	22	18.52	5	SNP	0.000	A
C9orf78	51759	genome.wustl.edu	37	9	132595746	132595746	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr9:132595746C>T	ENST00000372447.3	-	4	299	c.246G>A	c.(244-246)ctG>ctA	p.L82L	USP20_ENST00000372429.3_5'Flank|C9orf78_ENST00000461762.1_5'UTR|USP20_ENST00000358355.1_5'Flank|USP20_ENST00000315480.4_5'Flank	NM_016520.2	NP_057604.1	Q9NZ63	CI078_HUMAN	chromosome 9 open reading frame 78	82						cytoplasm (GO:0005737)|nucleus (GO:0005634)				kidney(2)|lung(7)|ovary(1)|prostate(1)|stomach(2)	13		Ovarian(14;0.00556)				CCCTTTCCTTCAGTTTCTTCA	0.463																																						dbGAP											0													205.0	171.0	182.0					9																	132595746		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC017570	CCDS6931.1	9q34.2	2012-03-16			ENSG00000136819	ENSG00000136819			24932	protein-coding gene	gene with protein product	"""Hepatocellular carcinoma-associated antigen 59"""					11042152, 12097419	Standard	NM_016520		Approved	HSPC220, HCA59	uc004byp.3	Q9NZ63	OTTHUMG00000020796	ENST00000372447.3:c.246G>A	9.37:g.132595746C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPX8|Q8WVU6|Q9NT39	Silent	SNP	pfam_Hep_59	p.L82	ENST00000372447.3	37	c.246	CCDS6931.1	9																																																																																			C9orf78	-	NULL	ENSG00000136819		0.463	C9orf78-007	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf78	HGNC	protein_coding	OTTHUMT00000054625.1	81	0.00	0	C	NM_016520		132595746	132595746	-1	no_errors	ENST00000372447	ensembl	human	known	69_37n	silent	115	25.32	39	SNP	0.996	T
CA14	23632	genome.wustl.edu	37	1	150235547	150235547	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:150235547G>C	ENST00000369111.4	+	7	1639	c.669G>C	c.(667-669)caG>caC	p.Q223H	snoU13_ENST00000458929.1_RNA	NM_012113.1	NP_036245.1	Q9ULX7	CAH14_HUMAN	carbonic anhydrase XIV	223					bicarbonate transport (GO:0015701)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbonate dehydratase activity (GO:0004089)|metal ion binding (GO:0046872)			central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)	18	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)		Acetazolamide(DB00819)|Zonisamide(DB00909)	CTTGCTACCAGAGTGTGCTCT	0.507																																						dbGAP											0													82.0	83.0	83.0					1																	150235547		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB025904	CCDS947.1	1q21	2008-02-05			ENSG00000118298	ENSG00000118298		"""Carbonic anhydrases"""	1372	protein-coding gene	gene with protein product		604832				10512682	Standard	XM_005245059		Approved		uc001etx.3	Q9ULX7	OTTHUMG00000012549	ENST00000369111.4:c.669G>C	1.37:g.150235547G>C	ENSP00000358107:p.Gln223His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TB24|Q8NCF4	Missense_Mutation	SNP	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	p.Q223H	ENST00000369111.4	37	c.669	CCDS947.1	1	.	.	.	.	.	.	.	.	.	.	G	19.84	3.901402	0.72754	.	.	ENSG00000118298	ENST00000369111	T	0.66995	-0.24	5.65	3.8	0.43715	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.054699	0.85682	D	0.000000	T	0.71567	0.3355	M	0.73372	2.23	0.47476	D	0.999437	D	0.89917	1.0	D	0.72625	0.978	T	0.74861	-0.3520	10	0.62326	D	0.03	.	10.4029	0.44239	0.1566:0.0:0.8434:0.0	.	223	Q9ULX7	CAH14_HUMAN	H	223	ENSP00000358107:Q223H	ENSP00000358107:Q223H	Q	+	3	2	CA14	148502171	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	2.724000	0.47285	0.951000	0.37770	-0.150000	0.13652	CAG	CA14	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000118298		0.507	CA14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CA14	HGNC	protein_coding	OTTHUMT00000035064.2	42	0.00	0	G	NM_012113		150235547	150235547	+1	no_errors	ENST00000369111	ensembl	human	known	69_37n	missense	70	15.48	13	SNP	1.000	C
CACNA1A	773	genome.wustl.edu	37	19	13370494	13370494	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:13370494C>G	ENST00000360228.5	-	27	4271	c.4272G>C	c.(4270-4272)gaG>gaC	p.E1424D	CACNA1A_ENST00000573710.2_Missense_Mutation_p.E1425D	NM_000068.3|NM_001127222.1|NM_001174080.1|NM_023035.2	NP_000059.3|NP_001120694.1|NP_001167551.1|NP_075461.2	O00555	CAC1A_HUMAN	calcium channel, voltage-dependent, P/Q type, alpha 1A subunit	1425					adult walking behavior (GO:0007628)|behavioral response to pain (GO:0048266)|calcium ion import (GO:0070509)|calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cell death (GO:0008219)|cell growth (GO:0016049)|cellular chloride ion homeostasis (GO:0030644)|cerebellar molecular layer development (GO:0021679)|cerebellar Purkinje cell differentiation (GO:0021702)|cerebellum maturation (GO:0021590)|dendrite morphogenesis (GO:0048813)|energy reserve metabolic process (GO:0006112)|gamma-aminobutyric acid secretion (GO:0014051)|gamma-aminobutyric acid signaling pathway (GO:0007214)|glucose metabolic process (GO:0006006)|hormone metabolic process (GO:0042445)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of hormone biosynthetic process (GO:0032353)|negative regulation of neuron apoptotic process (GO:0043524)|neuromuscular process controlling balance (GO:0050885)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter metabolic process (GO:0042133)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|receptor clustering (GO:0043113)|regulation of acetylcholine secretion, neurotransmission (GO:0014056)|regulation of axonogenesis (GO:0050770)|regulation of calcium ion-dependent exocytosis (GO:0017158)|regulation of insulin secretion (GO:0050796)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)|spinal cord motor neuron differentiation (GO:0021522)|sulfur amino acid metabolic process (GO:0000096)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transmission of nerve impulse (GO:0019226)|vestibular nucleus development (GO:0021750)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|syntaxin binding (GO:0019905)|voltage-gated calcium channel activity (GO:0005245)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(25)|prostate(2)|urinary_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(19;5.07e-21)		Bepridil(DB01244)|Loperamide(DB00836)|Pregabalin(DB00230)|Spironolactone(DB00421)|Verapamil(DB00661)	CCTCATTCTTCTCGTAGAGGA	0.522																																						dbGAP											0													54.0	55.0	54.0					19																	13370494		1975	4143	6118	-	-	-	SO:0001583	missense	0			U79666	CCDS45998.1, CCDS45999.1	19p13	2014-09-17			ENSG00000141837	ENSG00000141837		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1388	protein-coding gene	gene with protein product		601011		CACNL1A4, SCA6, MHP1, MHP		8825650, 16382099, 23827678	Standard	NM_000068		Approved	Cav2.1, EA2, APCA, HPCA, FHM	uc010xne.2	O00555	OTTHUMG00000044590	ENST00000360228.5:c.4272G>C	19.37:g.13370494C>G	ENSP00000353362:p.Glu1424Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	J3KP41|P78510|P78511|Q16290|Q92690|Q99790|Q99791|Q99792|Q99793|Q9NS88|Q9UDC4	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCCAlpha1,prints_VDCC_P/Q_a1su	p.E1424D	ENST00000360228.5	37	c.4272	CCDS45998.1	19	.	.	.	.	.	.	.	.	.	.	C	8.700	0.909616	0.17833	.	.	ENSG00000141837	ENST00000360228;ENST00000418012;ENST00000357018;ENST00000325084;ENST00000445042	D	0.95724	-3.79	4.88	3.82	0.43975	Ion transport (1);	0.258208	0.30593	N	0.009285	D	0.89273	0.6668	N	0.17838	0.53	0.37879	D	0.930322	B;B;B	0.16166	0.009;0.016;0.005	B;B;B	0.20384	0.029;0.017;0.005	D	0.85902	0.1435	10	0.36615	T	0.2	.	8.4177	0.32681	0.0:0.7599:0.1535:0.0866	.	1425;1428;1424	O00555;E9PD31;Q9NS88	CAC1A_HUMAN;.;.	D	1424;1428;1425;1425;41	ENSP00000353362:E1424D	ENSP00000317661:E1425D	E	-	3	2	CACNA1A	13231494	0.978000	0.34361	1.000000	0.80357	0.736000	0.42039	0.464000	0.21988	2.260000	0.74910	0.555000	0.69702	GAG	CACNA1A	-	pfam_Ion_trans_dom	ENSG00000141837		0.522	CACNA1A-001	KNOWN	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1A	HGNC	protein_coding	OTTHUMT00000104062.2	37	0.00	0	C	NM_000068		13370494	13370494	-1	no_errors	ENST00000360228	ensembl	human	known	69_37n	missense	55	25.33	19	SNP	0.995	G
CALML5	51806	genome.wustl.edu	37	10	5541299	5541299	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:5541299C>T	ENST00000380332.3	-	1	234	c.103G>A	c.(103-105)Gcg>Acg	p.A35T		NM_017422.4	NP_059118.2	Q9NZT1	CALL5_HUMAN	calmodulin-like 5	35	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				epidermis development (GO:0008544)|signal transduction (GO:0007165)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			biliary_tract(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)|stomach(1)	8						TTCAGCGCCGCGCCCAGCTCC	0.617																																					GBM(149;1055 3356 43077)	dbGAP											0													91.0	92.0	92.0					10																	5541299		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF172852	CCDS7068.1	10p15.1	2013-01-10			ENSG00000178372	ENSG00000178372		"""EF-hand domain containing"""	18180	protein-coding gene	gene with protein product	"""calmodulin-like skin protein"""	605183				10777582	Standard	NM_017422		Approved	CLSP	uc001iic.2	Q9NZT1	OTTHUMG00000017598	ENST00000380332.3:c.103G>A	10.37:g.5541299C>T	ENSP00000369689:p.Ala35Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SQI3|Q8IXU8	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.A35T	ENST00000380332.3	37	c.103	CCDS7068.1	10	.	.	.	.	.	.	.	.	.	.	C	2.565	-0.301051	0.05495	.	.	ENSG00000178372	ENST00000380332	T	0.72051	-0.62	4.49	0.513	0.17000	EF-hand-like domain (1);	1.666280	0.03594	N	0.232333	T	0.50205	0.1602	N	0.21373	0.66	0.09310	N	1	B	0.26041	0.14	B	0.25405	0.06	T	0.37596	-0.9699	10	0.02654	T	1	-5.3371	3.8386	0.08905	0.0:0.3837:0.2222:0.3942	.	35	Q9NZT1	CALL5_HUMAN	T	35	ENSP00000369689:A35T	ENSP00000369689:A35T	A	-	1	0	CALML5	5531299	0.129000	0.22400	0.000000	0.03702	0.002000	0.02628	0.706000	0.25690	0.208000	0.20626	-0.140000	0.14226	GCG	CALML5	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	ENSG00000178372		0.617	CALML5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CALML5	HGNC	protein_coding	OTTHUMT00000046556.1	41	0.00	0	C	NM_017422		5541299	5541299	-1	no_errors	ENST00000380332	ensembl	human	known	69_37n	missense	41	45.33	34	SNP	0.033	T
CASP8AP2	9994	genome.wustl.edu	37	6	90573267	90573267	+	RNA	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:90573267C>G	ENST00000551025.1	+	0	3276									caspase 8 associated protein 2											NS(1)|endometrium(7)|kidney(6)|large_intestine(12)|lung(21)|ovary(2)|urinary_tract(2)	51		all_cancers(76;3.64e-09)|Prostate(29;1.16e-10)|Acute lymphoblastic leukemia(125;1.45e-10)|all_hematologic(105;7.74e-07)|all_epithelial(107;4.69e-05)|Lung NSC(302;0.238)		BRCA - Breast invasive adenocarcinoma(108;0.0953)		GTGAACATATCTTGGGGGAAG	0.433																																					Colon(187;1656 2025 17045 31481 39901)	dbGAP											0													41.0	41.0	41.0					6																	90573267		1937	4126	6063	-	-	-			0			AB037736		6q15	2012-04-19	2008-10-30		ENSG00000118412	ENSG00000118412			1510	protein-coding gene	gene with protein product	"""FLICE-associated huge protein"""	606880	"""CASP8 associated protein 2"""			10235259, 17245429, 17003126	Standard	NM_001137668		Approved	FLASH, CED-4, RIP25, FLJ11208, KIAA1315	uc011dzz.2	Q9UKL3	OTTHUMG00000015212		6.37:g.90573267C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000551025.1	37	NULL		6																																																																																			CASP8AP2	-	-	ENSG00000118412		0.433	CASP8AP2-202	KNOWN	basic	processed_transcript	CASP8AP2	HGNC	processed_transcript		48	0.00	0	C	NM_001137667		90573267	90573267	+1	no_errors	ENST00000237177	ensembl	human	known	69_37n	rna	38	25.49	13	SNP	0.413	G
CCDC170	80129	genome.wustl.edu	37	6	151857537	151857537	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:151857537G>T	ENST00000239374.7	+	2	241	c.142G>T	c.(142-144)Gaa>Taa	p.E48*	CCDC170_ENST00000367290.5_Nonsense_Mutation_p.E48*|CCDC170_ENST00000544131.1_3'UTR	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	48																	TGCTCGAAGTGAACTTGCAGC	0.443																																						dbGAP											0													101.0	97.0	98.0					6																	151857537		1910	4124	6034	-	-	-	SO:0001587	stop_gained	0			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.142G>T	6.37:g.151857537G>T	ENSP00000239374:p.Glu48*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.E48*	ENST00000239374.7	37	c.142	CCDS43515.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.536426	0.96460	.	.	ENSG00000120262	ENST00000239374;ENST00000367290	.	.	.	5.95	5.95	0.96441	.	0.113759	0.56097	D	0.000023	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-5.1115	20.3812	0.98933	0.0:0.0:1.0:0.0	.	.	.	.	X	48	.	ENSP00000239374:E48X	E	+	1	0	C6orf97	151899230	1.000000	0.71417	0.962000	0.40283	0.295000	0.27426	5.450000	0.66626	2.821000	0.97095	0.650000	0.86243	GAA	CCDC170	-	NULL	ENSG00000120262		0.443	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	52	0.00	0	G	NM_025059		151857537	151857537	+1	no_errors	ENST00000367290	ensembl	human	known	69_37n	nonsense	58	27.50	22	SNP	1.000	T
CD300LF	146722	genome.wustl.edu	37	17	72700695	72700695	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:72700695C>T	ENST00000326165.6	-	2	415	c.304G>A	c.(304-306)Gat>Aat	p.D102N	CD300LF_ENST00000343125.4_Missense_Mutation_p.D105N|CD300LF_ENST00000361254.4_Missense_Mutation_p.D105N|CD300LF_ENST00000581500.1_Missense_Mutation_p.D105N|RAB37_ENST00000340415.3_Intron|CD300LF_ENST00000464910.1_Missense_Mutation_p.D105N|CD300LF_ENST00000469092.1_Missense_Mutation_p.D105N|RAB37_ENST00000402449.4_Intron|CD300LF_ENST00000583937.1_Missense_Mutation_p.D102N|CD300LF_ENST00000301573.9_Missense_Mutation_p.D102N	NM_139018.3	NP_620587.2	Q8TDQ1	CLM1_HUMAN	CD300 molecule-like family member f	102	Ig-like V-type.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|large_intestine(1)|lung(3)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	12						GTGTCAGCATCAGTTTTCATG	0.483																																						dbGAP											0													273.0	229.0	244.0					17																	72700695		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028199	CCDS11704.1, CCDS74148.1, CCDS74149.1, CCDS74150.1, CCDS74151.1, CCDS74152.1	17q25.2	2013-01-11	2006-03-29		ENSG00000186074	ENSG00000186074		"""Immunoglobulin superfamily / V-set domain containing"""	29883	protein-coding gene	gene with protein product		609807	"""CD300 antigen like family member F"""			12975309	Standard	NM_139018		Approved	IREM1, NKIR, IGSF13, CD300f, CLM1	uc002jlg.3	Q8TDQ1	OTTHUMG00000067609	ENST00000326165.6:c.304G>A	17.37:g.72700695C>T	ENSP00000327075:p.Asp102Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCL2|C9JDN3|Q3Y6P0|Q6UX24|Q7Z6A6|Q7Z7I4|Q7Z7I5|Q8N6D0|Q8NAF5	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.D102N	ENST00000326165.6	37	c.304	CCDS11704.1	17	.	.	.	.	.	.	.	.	.	.	C	25.8	4.678205	0.88542	.	.	ENSG00000186074	ENST00000301573;ENST00000361254;ENST00000343125;ENST00000326165	D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3	5.29	5.29	0.74685	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.117169	0.37809	N	0.001928	D	0.94089	0.8105	M	0.86573	2.825	0.31192	N	0.700788	D;D;D;D;D;D	0.89917	0.998;0.999;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.77557	0.98;0.967;0.99;0.962;0.987;0.99	D	0.93449	0.6800	10	0.87932	D	0	.	16.2031	0.82102	0.0:1.0:0.0:0.0	.	102;105;105;102;102;105	E7EME0;Q8TDQ1-2;Q8TDQ1-4;Q8TDQ1-5;Q8TDQ1;Q8TDQ1-6	.;.;.;.;CLM1_HUMAN;.	N	102;105;105;102	ENSP00000301573:D102N;ENSP00000355294:D105N;ENSP00000343751:D105N;ENSP00000327075:D102N	ENSP00000301573:D102N	D	-	1	0	CD300LF	70212290	0.962000	0.33011	0.067000	0.19924	0.304000	0.27724	4.248000	0.58760	2.630000	0.89119	0.655000	0.94253	GAT	CD300LF	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000186074		0.483	CD300LF-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD300LF	HGNC	protein_coding	OTTHUMT00000145085.1	76	0.00	0	C	NM_139018		72700695	72700695	-1	no_errors	ENST00000326165	ensembl	human	known	69_37n	missense	94	28.24	37	SNP	0.526	T
CDH1	999	genome.wustl.edu	37	16	68856067	68856068	+	Frame_Shift_Ins	INS	-	-	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr16:68856067_68856068insT	ENST00000261769.5	+	12	2066_2067	c.1875_1876insT	c.(1876-1878)ttcfs	p.F626fs	CDH1_ENST00000562836.1_3'UTR|RP11-354M1.2_ENST00000563916.1_RNA|CDH1_ENST00000422392.2_Frame_Shift_Ins_p.F565fs	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	626	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)			NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ATACATCTCCCTTCACAGCAGA	0.475			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	0			GRCh37	CM034950	CDH1	M																																				-	-	-	SO:0001589	frameshift_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.1877dupT	16.37:g.68856069_68856069dupT	ENSP00000261769:p.Phe626fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Frame_Shift_Ins	INS	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.T626fs	ENST00000261769.5	37	c.1875_1876	CCDS10869.1	16																																																																																			CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin	ENSG00000039068		0.475	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	43	0.00	0	-	NM_004360		68856067	68856068	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	frame_shift_ins	7	81.08	30	INS	0.997:0.999	T
CDH12	1010	genome.wustl.edu	37	5	21842404	21842404	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:21842404C>T	ENST00000382254.1	-	8	1766	c.680G>A	c.(679-681)aGa>aAa	p.R227K	CDH12_ENST00000521384.1_5'UTR|CDH12_ENST00000504376.2_Missense_Mutation_p.R227K|CDH12_ENST00000522262.1_Missense_Mutation_p.R187K	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	227	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						TTTGACTTCTCTGTCCATGTT	0.363										HNSCC(59;0.17)																												dbGAP											0													218.0	178.0	191.0					5																	21842404		2203	4300	6503	-	-	-	SO:0001583	missense	0			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.680G>A	5.37:g.21842404C>T	ENSP00000371689:p.Arg227Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.R227K	ENST00000382254.1	37	c.680	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.527264	0.96431	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.65178	0.28;0.28;-0.14	5.34	5.34	0.76211	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	D	0.84588	0.5505	M	0.92923	3.36	0.54753	D	0.999985	D;D	0.63046	0.989;0.992	D;D	0.80764	0.952;0.994	D	0.88342	0.2975	10	0.87932	D	0	.	19.0468	0.93022	0.0:1.0:0.0:0.0	.	187;227	B7Z2U6;P55289	.;CAD12_HUMAN	K	227;227;187	ENSP00000423577:R227K;ENSP00000371689:R227K;ENSP00000428786:R187K	ENSP00000371689:R227K	R	-	2	0	CDH12	21878161	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.666000	0.83877	2.480000	0.83734	0.655000	0.94253	AGA	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000154162		0.363	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	64	0.00	0	C	NM_004061		21842404	21842404	-1	no_errors	ENST00000382254	ensembl	human	known	69_37n	missense	78	29.73	33	SNP	1.000	T
CDH8	1006	genome.wustl.edu	37	16	61935368	61935368	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr16:61935368C>T	ENST00000577390.1	-	3	1216	c.262G>A	c.(262-264)Gac>Aac	p.D88N	CDH8_ENST00000584337.1_Missense_Mutation_p.D88N|CDH8_ENST00000299345.6_Missense_Mutation_p.D88N|CDH8_ENST00000577730.1_Missense_Mutation_p.D88N	NM_001796.4	NP_001787.2	P55286	CADH8_HUMAN	cadherin 8, type 2	88	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|response to cold (GO:0009409)|synaptic transmission, glutamatergic (GO:0035249)	axon terminus (GO:0043679)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synaptic cleft (GO:0043083)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(22)|liver(2)|lung(49)|ovary(6)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(4)	112		Ovarian(137;0.0799)|Melanoma(118;0.16)		UCEC - Uterine corpus endometrioid carcinoma (183;0.196)|Epithelial(162;0.0155)|all cancers(182;0.0305)|OV - Ovarian serous cystadenocarcinoma(108;0.0499)|BRCA - Breast invasive adenocarcinoma(181;0.249)		GGATCCAGGTCTGTGTGTAGC	0.348																																						dbGAP											0													70.0	64.0	66.0					16																	61935368		2203	4300	6503	-	-	-	SO:0001583	missense	0			L34060	CCDS10802.1	16q22.1	2010-01-26			ENSG00000150394	ENSG00000150394		"""Cadherins / Major cadherins"""	1767	protein-coding gene	gene with protein product		603008				9615235, 2059658	Standard	NM_001796		Approved		uc002eog.2	P55286	OTTHUMG00000137493	ENST00000577390.1:c.262G>A	16.37:g.61935368C>T	ENSP00000462701:p.Asp88Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWC1|Q14DC6|Q9ULB2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D88N	ENST00000577390.1	37	c.262	CCDS10802.1	16	.	.	.	.	.	.	.	.	.	.	C	28.1	4.890855	0.91889	.	.	ENSG00000150394	ENST00000299345	T	0.74002	-0.8	6.17	6.17	0.99709	Cadherin (4);Cadherin-like (1);	0.086330	0.85682	D	0.000000	T	0.80121	0.4565	M	0.73217	2.22	0.80722	D	1	P	0.35242	0.492	B	0.41571	0.36	T	0.77563	-0.2541	10	0.48119	T	0.1	.	20.8794	0.99867	0.0:1.0:0.0:0.0	.	88	P55286	CADH8_HUMAN	N	88	ENSP00000299345:D88N	ENSP00000299345:D88N	D	-	1	0	CDH8	60492869	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.487000	0.81328	2.941000	0.99782	0.655000	0.94253	GAC	CDH8	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000150394		0.348	CDH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH8	HGNC	protein_coding	OTTHUMT00000268754.3	69	0.00	0	C	NM_001796		61935368	61935368	-1	no_errors	ENST00000577390	ensembl	human	known	69_37n	missense	39	40.91	27	SNP	1.000	T
CDK18	5129	genome.wustl.edu	37	1	205499425	205499425	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:205499425G>A	ENST00000360066.2	+	14	1561	c.1260G>A	c.(1258-1260)ctG>ctA	p.L420L	CDK18_ENST00000509056.1_3'UTR|CDK18_ENST00000506784.1_Silent_p.L450L|CDK18_ENST00000429964.2_Silent_p.L420L	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18	418	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.						ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						AGGCTGCCCTGAGTCACTCCT	0.612																																					Pancreas(180;489 2072 28461 40831 44265)	dbGAP											0													78.0	79.0	79.0					1																	205499425		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.1260G>A	1.37:g.205499425G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L450	ENST00000360066.2	37	c.1350	CCDS44300.1	1																																																																																			CDK18	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000117266		0.612	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	46	0.00	0	G	NM_002596		205499425	205499425	+1	no_errors	ENST00000506784	ensembl	human	known	69_37n	silent	82	12.77	12	SNP	1.000	A
CENPF	1063	genome.wustl.edu	37	1	214815627	214815627	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:214815627G>A	ENST00000366955.3	+	12	4114	c.3946G>A	c.(3946-3948)Gaa>Aaa	p.E1316K		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	0					cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		TGAAAAGTATGAACTCGTAAC	0.378																																					Colon(80;575 1284 11000 14801 43496)	dbGAP											0													80.0	79.0	80.0					1																	214815627		2203	4300	6503	-	-	-	SO:0001583	missense	0			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.3946G>A	1.37:g.214815627G>A	ENSP00000355922:p.Glu1316Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13171|Q13246|Q5VVM7	Missense_Mutation	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.E1316K	ENST00000366955.3	37	c.3946	CCDS31023.1	1	.	.	.	.	.	.	.	.	.	.	G	3.202	-0.163490	0.06502	.	.	ENSG00000117724	ENST00000366955	T	0.22539	1.95	4.57	1.39	0.22231	.	.	.	.	.	T	0.14570	0.0352	.	.	.	0.09310	N	1	B	0.26483	0.15	B	0.19946	0.027	T	0.21415	-1.0246	8	0.25106	T	0.35	.	13.0803	0.59109	0.0:0.466:0.534:0.0	.	1316	P49454	CENPF_HUMAN	K	1316	ENSP00000355922:E1316K	ENSP00000355922:E1316K	E	+	1	0	CENPF	212882250	0.001000	0.12720	0.001000	0.08648	0.009000	0.06853	0.537000	0.23144	-0.013000	0.14199	0.511000	0.50034	GAA	CENPF	-	NULL	ENSG00000117724		0.378	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	26	0.00	0	G	NM_016343		214815627	214815627	+1	no_errors	ENST00000366955	ensembl	human	known	69_37n	missense	61	24.69	20	SNP	0.071	A
CERKL	375298	genome.wustl.edu	37	2	182403832	182403832	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:182403832C>T	ENST00000339098.5	-	13	1602	c.1603G>A	c.(1603-1605)Gag>Aag	p.E535K	CERKL_ENST00000409440.3_Missense_Mutation_p.E491K|CERKL_ENST00000410087.3_Missense_Mutation_p.E509K|CERKL_ENST00000374970.2_Missense_Mutation_p.E440K|CERKL_ENST00000374969.2_Missense_Mutation_p.E396K			Q49MI3	CERKL_HUMAN	ceramide kinase-like	535					negative regulation of apoptotic process (GO:0043066)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)	diacylglycerol kinase activity (GO:0004143)|NAD+ kinase activity (GO:0003951)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(13)|ovary(3)|skin(3)	32			OV - Ovarian serous cystadenocarcinoma(117;0.088)			ATATGGACCTCTGATGCAACT	0.363																																						dbGAP											0													140.0	134.0	136.0					2																	182403832		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC020465	CCDS33340.1, CCDS33341.1, CCDS42789.1, CCDS46466.1, CCDS54425.1	2q31.3	2005-01-04			ENSG00000188452	ENSG00000188452			21699	protein-coding gene	gene with protein product			"""retinitis pigmentosa 26 (autosomal recessive)"""	RP26		14681825	Standard	NR_027689		Approved		uc002uny.3	Q49MI3	OTTHUMG00000154315	ENST00000339098.5:c.1603G>A	2.37:g.182403832C>T	ENSP00000341159:p.Glu535Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPL2|B4DEY1|Q49MH9|Q49MI0|Q49MI1|Q49MI2|Q5DVJ2|Q5DVJ4|Q5DVJ5|Q6UZF6|Q6ZP59	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom	p.E535K	ENST00000339098.5	37	c.1603	CCDS42789.1	2	.	.	.	.	.	.	.	.	.	.	C	19.56	3.850449	0.71719	.	.	ENSG00000188452	ENST00000410087;ENST00000409440;ENST00000374969;ENST00000339098;ENST00000374970	T;T;T;T;T	0.14144	2.53;2.53;2.53;2.53;2.53	5.49	4.62	0.57501	.	0.160602	0.53938	D	0.000046	T	0.18425	0.0442	M	0.79123	2.44	0.41000	D	0.98492	P;P;B;P;P	0.49862	0.911;0.663;0.379;0.918;0.929	B;B;B;P;B	0.44732	0.376;0.242;0.077;0.459;0.408	T	0.16012	-1.0417	10	0.07482	T	0.82	.	11.6267	0.51149	0.0:0.8561:0.0:0.1439	.	491;396;440;509;535	B4DEY1;Q49MI3-4;Q49MI3-3;Q49MI3-2;Q49MI3	.;.;.;.;CERKL_HUMAN	K	509;491;396;535;440	ENSP00000386725:E509K;ENSP00000387080:E491K;ENSP00000364108:E396K;ENSP00000341159:E535K;ENSP00000364109:E440K	ENSP00000341159:E535K	E	-	1	0	CERKL	182112077	0.998000	0.40836	0.998000	0.56505	0.982000	0.71751	2.770000	0.47662	1.445000	0.47624	0.655000	0.94253	GAG	CERKL	-	NULL	ENSG00000188452		0.363	CERKL-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CERKL	HGNC	protein_coding	OTTHUMT00000334811.1	74	0.00	0	C			182403832	182403832	-1	no_errors	ENST00000339098	ensembl	human	known	69_37n	missense	115	15.33	21	SNP	0.999	T
CHD8	57680	genome.wustl.edu	37	14	21868712	21868712	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:21868712C>T	ENST00000557364.1	-	23	4693	c.4430G>A	c.(4429-4431)cGa>cAa	p.R1477Q	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.R1198Q|CHD8_ENST00000399982.2_Missense_Mutation_p.R1477Q			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	1477					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)			NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CTCCACATCTCGTTCAGTCAT	0.418																																						dbGAP											0													59.0	59.0	59.0					14																	21868712		1857	4102	5959	-	-	-	SO:0001583	missense	0			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.4430G>A	14.37:g.21868712C>T	ENSP00000451601:p.Arg1477Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R1477Q	ENST00000557364.1	37	c.4430	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	C	7.297	0.612165	0.14066	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	D;D;D	0.82167	-1.58;-1.58;-1.58	4.92	4.92	0.64577	.	0.150390	0.44688	D	0.000438	T	0.57829	0.2080	N	0.04335	-0.225	0.46725	D	0.99917	B;B	0.29716	0.165;0.255	B;B	0.21360	0.026;0.034	T	0.61992	-0.6948	10	0.02654	T	1	-12.3269	10.6212	0.45481	0.0:0.9113:0.0:0.0887	.	1477;1198	Q9HCK8;Q9HCK8-2	CHD8_HUMAN;.	Q	1198;1477;1197;1477	ENSP00000406288:R1198Q;ENSP00000382863:R1477Q;ENSP00000451601:R1477Q	ENSP00000262707:R1197Q	R	-	2	0	CHD8	20938552	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	2.564000	0.45931	2.546000	0.85860	0.650000	0.86243	CGA	CHD8	-	NULL	ENSG00000100888		0.418	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	57	0.00	0	C	NM_020920		21868712	21868712	-1	no_errors	ENST00000399982	ensembl	human	known	69_37n	missense	38	20.83	10	SNP	1.000	T
CLTC	1213	genome.wustl.edu	37	17	57697514	57697514	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:57697514C>T	ENST00000269122.3	+	1	296	c.22C>T	c.(22-24)Cgt>Tgt	p.R8C	CLTC_ENST00000579456.1_Missense_Mutation_p.R8C|CLTC_ENST00000393043.1_Missense_Mutation_p.R8C	NM_004859.3	NP_004850.1	Q00610	CLH1_HUMAN	clathrin, heavy chain (Hc)	8	Globular terminal domain.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|mitotic nuclear division (GO:0007067)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|negative regulation of protein localization to plasma membrane (GO:1903077)|osteoblast differentiation (GO:0001649)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|receptor-mediated endocytosis (GO:0006898)|transferrin transport (GO:0033572)	clathrin coat (GO:0030118)|clathrin coat of coated pit (GO:0030132)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin complex (GO:0071439)|clathrin-coated endocytic vesicle membrane (GO:0030669)|clathrin-coated vesicle (GO:0030136)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|spindle (GO:0005819)|trans-Golgi network membrane (GO:0032588)|vesicle (GO:0031982)	clathrin light chain binding (GO:0032051)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|structural molecule activity (GO:0005198)		CLTC/ALK(44)|CLTC/TFE3(2)	breast(2)|large_intestine(6)|ovary(1)	9	all_neural(34;0.0878)|Medulloblastoma(34;0.0922)					TCTGCCAATTCGTTTTCAGGA	0.652			T	"""ALK, TFE3"""	"""ALCL, renal """																																	dbGAP		Dom	yes		17	17q11-qter	1213	"""clathrin, heavy polypeptide (Hc)"""		L	0													57.0	54.0	55.0					17																	57697514		2203	4300	6503	-	-	-	SO:0001583	missense	0			X55878	CCDS32696.1, CCDS74115.1	17q23.1	2013-09-19	2006-09-29		ENSG00000141367	ENSG00000141367			2092	protein-coding gene	gene with protein product		118955	"""clathrin, heavy polypeptide (Hc)"", ""clathrin, heavy chain"", ""clathrin, heavy polypeptide-like 2"""	CLTCL2		1765375, 7584026	Standard	NM_004859		Approved	Hc	uc002ixq.1	Q00610	OTTHUMG00000134279	ENST00000269122.3:c.22C>T	17.37:g.57697514C>T	ENSP00000269122:p.Arg8Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DU00|Q6N0A0|Q86TF2	Missense_Mutation	SNP	pfam_Clathrin_H-chain/VPS_repeat,pfam_Clathrin_H-chain_propeller_rpt,pfam_Clathrin_H-chain_linker_core,superfamily_Clathrin_H-chain_propeller_N,superfamily_ARM-type_fold,smart_Clathrin_H-chain/VPS_repeat,pirsf_Clathrin_heavy_chain	p.R8C	ENST00000269122.3	37	c.22	CCDS32696.1	17	.	.	.	.	.	.	.	.	.	.	C	24.8	4.572123	0.86542	.	.	ENSG00000141367	ENST00000269122;ENST00000393043	T;T	0.23348	1.91;1.91	4.68	4.68	0.58851	Clathrin, heavy chain, propeller, N-terminal (1);Clathrin, heavy chain, linker/propeller domain (1);	0.000000	0.85682	D	0.000000	T	0.50650	0.1628	M	0.74881	2.28	0.39574	D	0.969329	D;D	0.76494	0.999;0.97	D;P	0.75484	0.986;0.808	T	0.55360	-0.8153	10	0.62326	D	0.03	.	14.9642	0.71179	0.0:1.0:0.0:0.0	.	8;8	Q00610;Q00610-2	CLH1_HUMAN;.	C	8	ENSP00000269122:R8C;ENSP00000376763:R8C	ENSP00000269122:R8C	R	+	1	0	CLTC	55052296	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.444000	0.60001	2.598000	0.87819	0.460000	0.39030	CGT	CLTC	-	superfamily_Clathrin_H-chain_propeller_N,pirsf_Clathrin_heavy_chain	ENSG00000141367		0.652	CLTC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLTC	HGNC	protein_coding	OTTHUMT00000258859.1	40	0.00	0	C	NM_004859		57697514	57697514	+1	no_errors	ENST00000269122	ensembl	human	known	69_37n	missense	52	16.13	10	SNP	1.000	T
CMYA5	202333	genome.wustl.edu	37	5	79057687	79057687	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:79057687G>A	ENST00000446378.2	+	8	11345	c.11314G>A	c.(11314-11316)Gat>Aat	p.D3772N	CMYA5_ENST00000505466.1_3'UTR	NM_153610.3	NP_705838.3	Q8N3K9	CMYA5_HUMAN	cardiomyopathy associated 5	3772	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of protein phosphatase type 2B activity (GO:0032513)|regulation of skeletal muscle adaptation (GO:0014733)	costamere (GO:0043034)				NS(2)|breast(4)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(37)|lung(34)|ovary(6)|pancreas(2)|prostate(5)|skin(5)|stomach(11)|upper_aerodigestive_tract(3)|urinary_tract(1)	128		Lung NSC(167;0.00296)|all_lung(232;0.00327)|Ovarian(174;0.0262)		OV - Ovarian serous cystadenocarcinoma(54;9.85e-46)|Epithelial(54;3.38e-40)|all cancers(79;3.43e-35)		CATTTTTGAAGATCTGGAACC	0.423																																						dbGAP											0													104.0	103.0	103.0					5																	79057687		1933	4140	6073	-	-	-	SO:0001583	missense	0			AW755254, AL831986	CCDS47238.1	5q14.1	2013-02-11			ENSG00000164309	ENSG00000164309		"""Tripartite motif containing / Tripartite motif containing"", ""A-kinase anchor proteins"", ""Fibronectin type III domain containing"""	14305	protein-coding gene	gene with protein product	"""genethonin-3"", ""tripartite motif-containing 76"""	612193	"""chromosome 5 open reading frame 10"""	C5orf10		14688250	Standard	NM_153610		Approved	myospryn, SPRYD2, DKFZp451G223, TRIM76	uc003kgc.3	Q8N3K9	OTTHUMG00000162548	ENST00000446378.2:c.11314G>A	5.37:g.79057687G>A	ENSP00000394770:p.Asp3772Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJB7|Q05CT4|Q2NKX1|Q2T9G9|Q69YQ8|Q69YQ9|Q6P517|Q6P5U3|Q7Z4I1|Q86T34|Q86T49|Q8N3S4|Q8N3S7|Q8NAG8|Q9UK88	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3	p.D3772N	ENST00000446378.2	37	c.11314	CCDS47238.1	5	.	.	.	.	.	.	.	.	.	.	G	24.0	4.479237	0.84747	.	.	ENSG00000164309	ENST00000446378	T	0.52754	0.65	5.45	5.45	0.79879	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.52435	0.1734	N	0.11427	0.14	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.60131	-0.7323	9	0.48119	T	0.1	.	18.9048	0.92456	0.0:0.0:1.0:0.0	.	3772	Q8N3K9	CMYA5_HUMAN	N	3772	ENSP00000394770:D3772N	ENSP00000394770:D3772N	D	+	1	0	CMYA5	79093443	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.132000	0.94455	2.561000	0.86390	0.655000	0.94253	GAT	CMYA5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000164309		0.423	CMYA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMYA5	HGNC	protein_coding	OTTHUMT00000369497.1	47	0.00	0	G	NM_153610		79057687	79057687	+1	no_errors	ENST00000446378	ensembl	human	known	69_37n	missense	64	33.33	32	SNP	1.000	A
CNPPD1	27013	genome.wustl.edu	37	2	220038163	220038163	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:220038163C>T	ENST00000409789.1	-	8	1026	c.599G>A	c.(598-600)cGa>cAa	p.R200Q	CNPPD1_ENST00000360507.5_Missense_Mutation_p.R200Q			Q9BV87	CNPD1_HUMAN	cyclin Pas1/PHO80 domain containing 1	200					regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)	integral component of membrane (GO:0016021)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)	12						GTACCAGCCTCGCCACCGTCC	0.617																																						dbGAP											0													44.0	43.0	43.0					2																	220038163		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF070638	CCDS2433.1	2q36	2011-03-23	2011-03-23	2011-03-23	ENSG00000115649	ENSG00000115649			25220	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 24"""	C2orf24		8619474, 9110174	Standard	NM_015680		Approved	CGI-57	uc002vju.4	Q9BV87	OTTHUMG00000133132	ENST00000409789.1:c.599G>A	2.37:g.220038163C>T	ENSP00000386277:p.Arg200Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC77|O75548|Q9H4N0|Q9UQN0	Missense_Mutation	SNP	pfam_Cyclin_PHO80-like,superfamily_Cyclin-like	p.R200Q	ENST00000409789.1	37	c.599	CCDS2433.1	2	.	.	.	.	.	.	.	.	.	.	C	29.1	4.973392	0.92919	.	.	ENSG00000115649	ENST00000360507;ENST00000409789;ENST00000453038;ENST00000451647	T;T;T	0.40225	2.02;2.02;1.04	5.03	5.03	0.67393	.	0.061993	0.64402	D	0.000004	T	0.54111	0.1838	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.69654	0.965	T	0.50668	-0.8801	10	0.41790	T	0.15	-18.4442	17.2851	0.87139	0.0:1.0:0.0:0.0	.	200	Q9BV87	CNPD1_HUMAN	Q	200;200;200;227	ENSP00000353698:R200Q;ENSP00000386277:R200Q;ENSP00000410109:R200Q	ENSP00000353698:R200Q	R	-	2	0	CNPPD1	219746407	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.538000	0.82048	2.607000	0.88179	0.591000	0.81541	CGA	CNPPD1	-	NULL	ENSG00000115649		0.617	CNPPD1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNPPD1	HGNC	protein_coding	OTTHUMT00000336220.1	12	0.00	0	C	NM_015680		220038163	220038163	-1	no_errors	ENST00000360507	ensembl	human	known	69_37n	missense	10	28.57	4	SNP	1.000	T
CNTN5	53942	genome.wustl.edu	37	11	100095465	100095465	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:100095465G>A	ENST00000524871.1	+	16	2216	c.1926G>A	c.(1924-1926)ctG>ctA	p.L642L	CNTN5_ENST00000528682.1_Silent_p.L642L|CNTN5_ENST00000279463.3_Silent_p.L642L|CNTN5_ENST00000418526.2_Silent_p.L568L|CNTN5_ENST00000527185.1_Silent_p.L642L|CNTN5_ENST00000524560.1_Intron	NM_014361.3	NP_055176.1	O94779	CNTN5_HUMAN	contactin 5	642	Ig-like C2-type 6.				cell adhesion (GO:0007155)|sensory perception of sound (GO:0007605)	anchored component of membrane (GO:0031225)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(12)|lung(38)|ovary(2)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(1)	81		all_hematologic(158;1.22e-05)|Acute lymphoblastic leukemia(157;3.81e-05)|Melanoma(852;0.219)		BRCA - Breast invasive adenocarcinoma(274;0.00146)|KIRC - Kidney renal clear cell carcinoma(183;0.156)|Kidney(183;0.196)		ACATCCTTCTGATGCATGCTG	0.468																																						dbGAP											0													119.0	112.0	114.0					11																	100095465		1975	4186	6161	-	-	-	SO:0001819	synonymous_variant	0			AB013802	CCDS53696.1, CCDS53697.1, CCDS58168.1	11q22.1	2013-02-11			ENSG00000149972	ENSG00000149972		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2175	protein-coding gene	gene with protein product		607219					Standard	NM_014361		Approved	NB-2, hNB-2	uc021qpb.1	O94779	OTTHUMG00000167579	ENST00000524871.1:c.1926G>A	11.37:g.100095465G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4P0|B7ZM07|E9PKE8|O94780|Q49AF3	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L642	ENST00000524871.1	37	c.1926	CCDS53696.1	11																																																																																			CNTN5	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000149972		0.468	CNTN5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNTN5	HGNC	protein_coding	OTTHUMT00000395148.2	65	0.00	0	G	NM_014361		100095465	100095465	+1	no_errors	ENST00000279463	ensembl	human	known	69_37n	silent	82	29.91	35	SNP	1.000	A
COMMD3	23412	genome.wustl.edu	37	10	22606826	22606826	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:22606826G>A	ENST00000376836.3	+	2	597	c.153G>A	c.(151-153)ttG>ttA	p.L51L	COMMD3_ENST00000483684.1_3'UTR|COMMD3-BMI1_ENST00000463409.2_3'UTR|COMMD3-BMI1_ENST00000602390.1_Silent_p.L51L	NM_012071.3	NP_036203.1	Q9UBI1	COMD3_HUMAN	COMM domain containing 3	51										kidney(2)|lung(2)|ovary(1)	5						ATCCAGACTTGAAACATATCG	0.358																																						dbGAP											0													85.0	93.0	91.0					10																	22606826		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY542159	CCDS7137.1	10p12.2	2012-09-20	2004-02-13	2004-02-18	ENSG00000148444	ENSG00000148444			23332	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 8"""	C10orf8		11042152, 15799966	Standard	NM_012071		Approved	BUP		Q9UBI1	OTTHUMG00000017806	ENST00000376836.3:c.153G>A	10.37:g.22606826G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DRU7|Q5T8Y9	Missense_Mutation	SNP	pfam_HCaRG	p.E51K	ENST00000376836.3	37	c.151	CCDS7137.1	10	.	.	.	.	.	.	.	.	.	.	G	6.714	0.500501	0.12822	.	.	ENSG00000148444	ENST00000456711;ENST00000444869	.	.	.	5.9	4.01	0.46588	.	.	.	.	.	T	0.62527	0.2435	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.58945	-0.7546	4	.	.	.	-21.7933	11.5492	0.50711	0.15:0.0:0.85:0.0	.	.	.	.	K	52;51	.	.	E	+	1	0	COMMD3	22646832	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.050000	0.57404	0.784000	0.33661	0.561000	0.74099	GAA	COMMD3	-	pfam_HCaRG	ENSG00000148444		0.358	COMMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COMMD3	HGNC	protein_coding	OTTHUMT00000047159.1	39	0.00	0	G	NM_012071		22606826	22606826	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444869	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	1.000	A
COL17A1	1308	genome.wustl.edu	37	10	105812868	105812868	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:105812868C>A	ENST00000353479.5	-	23	2150	c.1860G>T	c.(1858-1860)atG>atT	p.M620I	COL17A1_ENST00000480127.1_5'Flank|COL17A1_ENST00000369733.3_Missense_Mutation_p.M620I	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	620	Triple-helical region.				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CTCTCTGGCCCATGGGGCCTT	0.617																																						dbGAP											0													92.0	89.0	90.0					10																	105812868		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1860G>T	10.37:g.105812868C>A	ENSP00000340937:p.Met620Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.M620I	ENST00000353479.5	37	c.1860	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	C	13.64	2.297009	0.40594	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872	D;D	0.91295	-2.82;-2.82	5.5	4.58	0.56647	.	0.242198	0.28360	N	0.015622	D	0.84647	0.5518	L	0.44542	1.39	0.80722	D	1	B;B	0.10296	0.002;0.003	B;B	0.10450	0.003;0.005	T	0.77330	-0.2628	10	0.22109	T	0.4	-4.64	8.2126	0.31492	0.1558:0.7632:0.0:0.081	.	620;620	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	I	620;620;604	ENSP00000340937:M620I;ENSP00000358748:M620I	ENSP00000340937:M620I	M	-	3	0	COL17A1	105802858	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	0.489000	0.22387	1.302000	0.44855	0.462000	0.41574	ATG	COL17A1	-	pfam_Collagen	ENSG00000065618		0.617	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	21	0.00	0	C	NM_130778, NM_000494		105812868	105812868	-1	no_errors	ENST00000353479	ensembl	human	known	69_37n	missense	35	35.19	19	SNP	1.000	A
COPB1	1315	genome.wustl.edu	37	11	14486547	14486547	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:14486547G>A	ENST00000249923.3	-	18	2620	c.2320C>T	c.(2320-2322)Cct>Tct	p.P774S	COPB1_ENST00000439561.2_Missense_Mutation_p.P774S	NM_016451.4	NP_057535.1	P53618	COPB_HUMAN	coatomer protein complex, subunit beta 1	774					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|viral process (GO:0016032)	COPI vesicle coat (GO:0030126)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi-associated vesicle (GO:0005798)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	36						AGAGTCAAAGGAGACGGCTTT	0.388																																						dbGAP											0													92.0	90.0	91.0					11																	14486547		2200	4294	6494	-	-	-	SO:0001583	missense	0			BC037280	CCDS7815.1	11p15.2	2011-05-20	2006-06-30	2006-06-30	ENSG00000129083	ENSG00000129083			2231	protein-coding gene	gene with protein product		600959	"""coatomer protein complex, subunit beta"""	COPB		7982906	Standard	NM_016451		Approved		uc001mlg.2	P53618	OTTHUMG00000165824	ENST00000249923.3:c.2320C>T	11.37:g.14486547G>A	ENSP00000249923:p.Pro774Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQX0|Q6GTT7|Q9NTK2|Q9UNW7	Missense_Mutation	SNP	pfam_Coatomer_bsu_C,pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Coatomer_bsu	p.P774S	ENST00000249923.3	37	c.2320	CCDS7815.1	11	.	.	.	.	.	.	.	.	.	.	G	14.80	2.643119	0.47153	.	.	ENSG00000129083	ENST00000249923;ENST00000439561	T;T	0.42513	0.97;0.97	5.72	5.72	0.89469	Coatomer, beta subunit, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.40546	0.1121	L	0.40543	1.245	0.80722	D	1	B	0.23128	0.08	B	0.31390	0.129	T	0.17531	-1.0366	10	0.15952	T	0.53	.	19.879	0.96888	0.0:0.0:1.0:0.0	.	774	P53618	COPB_HUMAN	S	774	ENSP00000249923:P774S;ENSP00000397873:P774S	ENSP00000249923:P774S	P	-	1	0	COPB1	14443123	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.544000	0.98092	2.695000	0.91970	0.655000	0.94253	CCT	COPB1	-	pfam_Coatomer_bsu_C,pirsf_Coatomer_bsu	ENSG00000129083		0.388	COPB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPB1	HGNC	protein_coding	OTTHUMT00000386410.1	52	0.00	0	G	NM_016451		14486547	14486547	-1	no_errors	ENST00000249923	ensembl	human	known	69_37n	missense	56	23.29	17	SNP	1.000	A
CSMD2	114784	genome.wustl.edu	37	1	34090136	34090136	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:34090136C>T	ENST00000373380.1	-	14	2447	c.2227G>A	c.(2227-2229)Gaa>Aaa	p.E743K	CSMD2_ENST00000373377.1_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.E1870K|CSMD2_ENST00000373388.2_5'UTR			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1830	Sushi 4. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				CCAGCGCCTTCGGGGACCACG	0.647																																						dbGAP											0													115.0	96.0	102.0					1																	34090136		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.2227G>A	1.37:g.34090136C>T	ENSP00000362478:p.Glu743Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.E1870K	ENST00000373380.1	37	c.5608		1	.	.	.	.	.	.	.	.	.	.	C	36	5.926690	0.97110	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.17054	2.3;2.3	5.67	5.67	0.87782	CUB (5);	0.000000	0.85682	D	0.000000	T	0.33818	0.0876	L	0.53729	1.69	0.80722	D	1	P;D;D	0.59357	0.937;0.985;0.985	P;P;P	0.57057	0.468;0.812;0.812	T	0.00621	-1.1640	10	0.48119	T	0.1	.	18.3368	0.90291	0.0:1.0:0.0:0.0	.	743;1830;1870	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	K	1870;743	ENSP00000362479:E1870K;ENSP00000362478:E743K	ENSP00000241312:E1830K	E	-	1	0	CSMD2	33862723	1.000000	0.71417	0.956000	0.39512	0.941000	0.58515	7.695000	0.84257	2.677000	0.91161	0.655000	0.94253	GAA	CSMD2	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000121904		0.647	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	35	0.00	0	C	NM_052896		34090136	34090136	-1	no_errors	ENST00000373381	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113266484	113266484	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:113266484G>C	ENST00000297405.5	-	63	10352	c.10108C>G	c.(10108-10110)Caa>Gaa	p.Q3370E	CSMD3_ENST00000352409.3_Missense_Mutation_p.Q3300E|CSMD3_ENST00000343508.3_Missense_Mutation_p.Q3330E|CSMD3_ENST00000455883.2_Missense_Mutation_p.Q3201E	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	3370	Sushi 27. {ECO:0000255|PROSITE- ProRule:PRU00302}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GTACCCACTTGAAATCCGAAT	0.378										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																												dbGAP											0													185.0	182.0	183.0					8																	113266484		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.10108C>G	8.37:g.113266484G>C	ENSP00000297405:p.Gln3370Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.Q3370E	ENST00000297405.5	37	c.10108	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	7.224	0.597956	0.13939	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.64085	-0.08;-0.08;-0.08;-0.08;-0.08	4.96	4.96	0.65561	Complement control module (2);Sushi/SCR/CCP (3);	0.079029	0.51477	D	0.000081	T	0.50786	0.1636	N	0.21194	0.64	0.48341	D	0.999638	B;B;P	0.37122	0.168;0.31;0.583	B;B;B	0.42282	0.107;0.171;0.382	T	0.46978	-0.9152	10	0.02654	T	1	.	18.4061	0.90536	0.0:0.0:1.0:0.0	.	3201;3370;3330	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	E	3330;3370;2640;3201;3300	ENSP00000345799:Q3330E;ENSP00000297405:Q3370E;ENSP00000341558:Q2640E;ENSP00000412263:Q3201E;ENSP00000343124:Q3300E	ENSP00000297405:Q3370E	Q	-	1	0	CSMD3	113335660	1.000000	0.71417	1.000000	0.80357	0.300000	0.27592	5.126000	0.64721	2.575000	0.86900	0.655000	0.94253	CAA	CSMD3	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	ENSG00000164796		0.378	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	55	0.00	0	G	NM_052900		113266484	113266484	-1	no_errors	ENST00000297405	ensembl	human	known	69_37n	missense	55	25.68	19	SNP	1.000	C
CYP1B1-AS1	285154	genome.wustl.edu	37	2	38407627	38407627	+	RNA	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:38407627C>A	ENST00000413828.2	+	0	387					NR_027252.1				CYP1B1 antisense RNA 1																		GCCACTCTGGCACAGCGTTCT	0.517																																						dbGAP											0																																										-	-	-			0			BC031410		2p22.2	2012-10-12	2012-08-15	2011-04-28	ENSG00000232973	ENSG00000232973		"""Long non-coding RNAs"""	28543	non-coding RNA	RNA, long non-coding			"""chromosome 2 open reading frame 58"", ""CYP1B1 antisense RNA 1 (non-protein coding)"""	C2orf58		12477932	Standard	NR_027252		Approved	MGC34824	uc010faj.2		OTTHUMG00000128569		2.37:g.38407627C>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000413828.2	37	NULL		2																																																																																			CYP1B1-AS1	-	-	ENSG00000232973		0.517	CYP1B1-AS1-001	KNOWN	basic	antisense	CYP1B1-AS1	HGNC	antisense	OTTHUMT00000250420.2	28	0.00	0	C			38407627	38407627	+1	no_errors	ENST00000413828	ensembl	human	known	69_37n	rna	34	22.73	10	SNP	0.000	A
DCAF11	80344	genome.wustl.edu	37	14	24586891	24586891	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:24586891C>T	ENST00000446197.3	+	5	1153	c.426C>T	c.(424-426)ctC>ctT	p.L142L	DCAF11_ENST00000559115.1_Silent_p.L142L|NRL_ENST00000561028.1_5'Flank|DCAF11_ENST00000396936.1_Intron|DCAF11_ENST00000396941.4_Silent_p.L116L|DCAF11_ENST00000560171.1_Intron	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11	142					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											AACGGGGCCTCTGCCATCGGG	0.502																																						dbGAP											0													78.0	82.0	81.0					14																	24586891		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.426C>T	14.37:g.24586891C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	Missense_Mutation	SNP	NULL	p.S124F	ENST00000446197.3	37	c.371	CCDS9610.1	14																																																																																			DCAF11	-	NULL	ENSG00000100897		0.502	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	HGNC	protein_coding	OTTHUMT00000071907.4	38	0.00	0	C			24586891	24586891	+1	no_errors	ENST00000558914	ensembl	human	known	69_37n	missense	30	34.78	16	SNP	1.000	T
DCAF11	80344	genome.wustl.edu	37	14	24587304	24587304	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:24587304C>T	ENST00000446197.3	+	6	1244	c.517C>T	c.(517-519)Cag>Tag	p.Q173*	DCAF11_ENST00000559115.1_Nonsense_Mutation_p.Q173*|DCAF11_ENST00000396936.1_Nonsense_Mutation_p.Q73*|DCAF11_ENST00000396941.4_Nonsense_Mutation_p.Q147*|DCAF11_ENST00000560171.1_Intron	NM_025230.4	NP_079506.3	Q8TEB1	DCA11_HUMAN	DDB1 and CUL4 associated factor 11	173					protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)											TAGCTACTCTCAGAAGGCTTT	0.478																																						dbGAP											0													193.0	190.0	191.0					14																	24587304		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF130070	CCDS9610.1, CCDS41929.1	14q11.2	2013-01-09	2009-07-17	2009-07-17	ENSG00000100897	ENSG00000100897		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	20258	protein-coding gene	gene with protein product		613317	"""WD repeat domain 23"""	WDR23			Standard	NM_025230		Approved	PRO2389, GL014	uc001wlv.3	Q8TEB1	OTTHUMG00000028793	ENST00000446197.3:c.517C>T	14.37:g.24587304C>T	ENSP00000415556:p.Gln173*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ83|D3DS56|Q5D039|Q86U00|Q86U39|Q8NDN2|Q9H2J0|Q9H3A3|Q9H5C9	Nonsense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Q173*	ENST00000446197.3	37	c.517	CCDS9610.1	14	.	.	.	.	.	.	.	.	.	.	c	38	6.767458	0.97825	.	.	ENSG00000100897	ENST00000326009;ENST00000446197;ENST00000396936;ENST00000396941	.	.	.	5.39	5.39	0.77823	.	0.054992	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.17832	T	0.49	-16.3355	16.7046	0.85368	0.0:1.0:0.0:0.0	.	.	.	.	X	173;147;73;147	.	ENSP00000323680:Q173X	Q	+	1	0	DCAF11	23657144	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.583000	0.74053	2.804000	0.96469	0.655000	0.94253	CAG	DCAF11	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_WD_repeat_p23,pfscan_WD40_repeat_dom	ENSG00000100897		0.478	DCAF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF11	HGNC	protein_coding	OTTHUMT00000071907.4	50	0.00	0	C			24587304	24587304	+1	no_errors	ENST00000446197	ensembl	human	known	69_37n	nonsense	60	23.08	18	SNP	1.000	T
DACT1	51339	genome.wustl.edu	37	14	59112495	59112495	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:59112495C>T	ENST00000335867.4	+	4	1178	c.1154C>T	c.(1153-1155)tCa>tTa	p.S385L	DACT1_ENST00000395153.3_Missense_Mutation_p.S348L|DACT1_ENST00000556859.1_Missense_Mutation_p.S104L|DACT1_ENST00000541264.2_Missense_Mutation_p.S104L			Q9NYF0	DACT1_HUMAN	dishevelled-binding antagonist of beta-catenin 1	385					dendrite morphogenesis (GO:0048813)|embryonic hindgut morphogenesis (GO:0048619)|gastrulation with mouth forming second (GO:0001702)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of JNK cascade (GO:0046329)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of catenin import into nucleus (GO:0035412)|regulation of protein stability (GO:0031647)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|synapse organization (GO:0050808)|Wnt signaling pathway (GO:0016055)	beta-catenin destruction complex (GO:0030877)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|synapse (GO:0045202)	beta-catenin binding (GO:0008013)|delta-catenin binding (GO:0070097)|protein kinase A binding (GO:0051018)|protein kinase C binding (GO:0005080)			endometrium(7)|kidney(3)|large_intestine(11)|lung(27)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	53						GGCGGTGTCTCACAGGGCAAC	0.562																																						dbGAP											0													63.0	67.0	66.0					14																	59112495		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251079	CCDS9736.1, CCDS41961.1	14q22.3	2013-05-15	2013-05-15		ENSG00000165617	ENSG00000165617			17748	protein-coding gene	gene with protein product		607861	"""dapper homolog 1, antagonist of beta-catenin (xenopus)"", ""dapper, antagonist of beta-catenin, homolog 1 (Xenopus laevis)"""			11970895	Standard	NM_001079520		Approved	DAPPER1, THYEX3, HDPR1, DAPPER, FRODO	uc001xdw.3	Q9NYF0	OTTHUMG00000140324	ENST00000335867.4:c.1154C>T	14.37:g.59112495C>T	ENSP00000337439:p.Ser385Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYJ2|Q86TY0	Missense_Mutation	SNP	NULL	p.S385L	ENST00000335867.4	37	c.1154	CCDS9736.1	14	.	.	.	.	.	.	.	.	.	.	C	5.061	0.196922	0.09599	.	.	ENSG00000165617	ENST00000556859;ENST00000421793;ENST00000395151;ENST00000395153;ENST00000335867;ENST00000541264	T;T;T;T;T;T	0.44083	0.93;0.93;0.93;0.93;0.93;0.93	5.46	4.55	0.56014	.	0.748141	0.12594	N	0.455288	T	0.36963	0.0986	L	0.54323	1.7	0.09310	N	1	B;P	0.35872	0.33;0.525	B;B	0.34242	0.165;0.178	T	0.16129	-1.0413	10	0.26408	T	0.33	-1.0235	9.8234	0.40896	0.1408:0.7867:0.0:0.0725	.	348;385	A8MYJ2;Q9NYF0	.;DACT1_HUMAN	L	104;104;104;348;385;104	ENSP00000451598:S104L;ENSP00000404297:S104L;ENSP00000378581:S104L;ENSP00000378582:S348L;ENSP00000337439:S385L;ENSP00000442850:S104L	ENSP00000337439:S385L	S	+	2	0	DACT1	58182248	0.005000	0.15991	0.003000	0.11579	0.032000	0.12392	2.113000	0.41902	1.272000	0.44329	0.563000	0.77884	TCA	DACT1	-	NULL	ENSG00000165617		0.562	DACT1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACT1	HGNC	protein_coding	OTTHUMT00000325515.1	16	0.00	0	C	NM_016651		59112495	59112495	+1	no_errors	ENST00000335867	ensembl	human	known	69_37n	missense	20	20.00	5	SNP	0.001	T
DCAF4L1	285429	genome.wustl.edu	37	4	41984214	41984214	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:41984214G>A	ENST00000333141.5	+	1	502	c.405G>A	c.(403-405)ctG>ctA	p.L135L		NM_001029955.3	NP_001025126.2	Q3SXM0	DC4L1_HUMAN	DDB1 and CUL4 associated factor 4-like 1	135										breast(1)|endometrium(5)|kidney(6)|large_intestine(11)|lung(12)|prostate(1)|skin(1)	37						GGGCCTCGCTGAACCAGTTGG	0.562																																						dbGAP											0													107.0	101.0	103.0					4																	41984214		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC035027	CCDS33978.1	4p13	2013-01-09	2009-07-17	2009-07-17		ENSG00000182308		"""WD repeat domain containing"""	27723	protein-coding gene	gene with protein product			"""WD repeat domain 21B"""	WDR21B			Standard	NM_001029955		Approved		uc003gwk.2	Q3SXM0		ENST00000333141.5:c.405G>A	4.37:g.41984214G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KVI3|Q3ZCW8|Q499Y5|Q9UFI0	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L135	ENST00000333141.5	37	c.405	CCDS33978.1	4																																																																																			DCAF4L1	-	superfamily_WD40_repeat_dom	ENSG00000182308		0.562	DCAF4L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF4L1	HGNC	protein_coding	OTTHUMT00000360958.1	36	0.00	0	G	NM_001029955		41984214	41984214	+1	no_errors	ENST00000333141	ensembl	human	known	69_37n	silent	40	35.94	23	SNP	0.999	A
DCAF6	55827	genome.wustl.edu	37	1	168034923	168034923	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:168034923G>A	ENST00000312263.6	+	16	2466	c.2262G>A	c.(2260-2262)ttG>ttA	p.L754L	DCAF6_ENST00000432587.2_Silent_p.L814L|DCAF6_ENST00000367843.3_Silent_p.L774L|DCAF6_ENST00000367840.3_Silent_p.L845L	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	754					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						CTGAGCATTTGATGCTTCTGG	0.433																																						dbGAP											0													84.0	80.0	81.0					1																	168034923		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.2262G>A	1.37:g.168034923G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_IQ_motif_EF-hand-BS,pfscan_WD40_repeat_dom	p.L845	ENST00000312263.6	37	c.2535	CCDS30933.1	1																																																																																			DCAF6	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	ENSG00000143164		0.433	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCAF6	HGNC	protein_coding	OTTHUMT00000083661.2	81	0.00	0	G	NM_018442		168034923	168034923	+1	no_errors	ENST00000367840	ensembl	human	known	69_37n	silent	168	12.95	25	SNP	0.995	A
DENND5B	160518	genome.wustl.edu	37	12	31632974	31632974	+	Silent	SNP	A	A	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr12:31632974A>G	ENST00000389082.5	-	3	717	c.453T>C	c.(451-453)tcT>tcC	p.S151S	DENND5B_ENST00000354285.4_Silent_p.S173S|DENND5B_ENST00000536562.1_Silent_p.S186S|DENND5B_ENST00000306833.6_Silent_p.S186S|DENND5B_ENST00000545147.1_Intron	NM_144973.3	NP_659410.3	Q6ZUT9	DEN5B_HUMAN	DENN/MADD domain containing 5B	151					positive regulation of Rab GTPase activity (GO:0032851)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(8)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TACTGCAGGAAGATGAAGCAT	0.413																																						dbGAP											0													123.0	119.0	120.0					12																	31632974		2064	4220	6284	-	-	-	SO:0001819	synonymous_variant	0			AF086301	CCDS44857.1	12p11.21	2012-10-03			ENSG00000170456	ENSG00000170456		"""DENN/MADD domain containing"""	28338	protein-coding gene	gene with protein product						12477932	Standard	NM_144973		Approved	MGC24039	uc001rki.1	Q6ZUT9	OTTHUMG00000169034	ENST00000389082.5:c.453T>C	12.37:g.31632974A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B5ME75|Q59FW8|Q68CZ7|Q6NUJ0|Q7Z3F9|Q8N973|Q8WUC8	Silent	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.S186	ENST00000389082.5	37	c.558	CCDS44857.1	12																																																																																			DENND5B	-	NULL	ENSG00000170456		0.413	DENND5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5B	HGNC	protein_coding	OTTHUMT00000402040.1	56	0.00	0	A	NM_144973		31632974	31632974	-1	no_errors	ENST00000306833	ensembl	human	known	69_37n	silent	43	41.89	31	SNP	0.988	G
DIP2C	22982	genome.wustl.edu	37	10	375423	375423	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:375423C>T	ENST00000280886.6	-	30	3790	c.3703G>A	c.(3703-3705)Gtg>Atg	p.V1235M		NM_014974.2	NP_055789.1	Q9Y2E4	DIP2C_HUMAN	DIP2 disco-interacting protein 2 homolog C (Drosophila)	1235						nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(8)|endometrium(6)|kidney(10)|large_intestine(13)|lung(26)|ovary(3)|prostate(6)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(4)	81		all_cancers(4;0.00336)|all_lung(4;0.00732)|Lung NSC(4;0.00785)|all_epithelial(10;0.0159)|Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.136)	Epithelial(11;0.0123)|all cancers(11;0.0467)|Lung(33;0.0864)|OV - Ovarian serous cystadenocarcinoma(14;0.106)		AGCTCCATCACGGAGTAGGAG	0.597																																						dbGAP											0													59.0	50.0	53.0					10																	375423		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC035216	CCDS7054.1	10p15.3	2006-01-13	2006-01-13	2006-01-13	ENSG00000151240	ENSG00000151240			29150	protein-coding gene	gene with protein product		611380	"""KIAA0934"""	KIAA0934			Standard	NM_014974		Approved		uc001ifp.3	Q9Y2E4	OTTHUMG00000017532	ENST00000280886.6:c.3703G>A	10.37:g.375423C>T	ENSP00000280886:p.Val1235Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPI5|Q5SS78	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.V1235M	ENST00000280886.6	37	c.3703	CCDS7054.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.285994|5.285994	0.95517|0.95517	.|.	.|.	ENSG00000151240|ENSG00000151240	ENST00000434695|ENST00000280886;ENST00000535541;ENST00000381503	.|T	.|0.46063	.|0.88	5.84|5.84	5.84|5.84	0.93424|0.93424	.|AMP-dependent synthetase/ligase (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.62454|0.62454	0.2429|0.2429	M|M	0.63843|0.63843	1.955|1.955	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.79784	.|0.993	T|T	0.52193|0.52193	-0.8608|-0.8608	5|10	.|0.19147	.|T	.|0.46	-31.624|-31.624	20.1381|20.1381	0.98040|0.98040	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1235	.|Q9Y2E4	.|DIP2C_HUMAN	H|M	40|1235;160;84	.|ENSP00000280886:V1235M	.|ENSP00000280886:V1235M	R|V	-|-	2|1	0|0	DIP2C|DIP2C	365423|365423	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.982000|0.982000	0.71751|0.71751	7.818000|7.818000	0.86416|0.86416	2.763000|2.763000	0.94921|0.94921	0.650000|0.650000	0.86243|0.86243	CGT|GTG	DIP2C	-	pfam_AMP-dep_Synth/Lig	ENSG00000151240		0.597	DIP2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIP2C	HGNC	protein_coding	OTTHUMT00000046389.1	32	0.00	0	C	NM_014974		375423	375423	-1	no_errors	ENST00000280886	ensembl	human	known	69_37n	missense	40	25.93	14	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	31496247	31496247	+	Silent	SNP	G	G	C	rs398124078		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:31496247G>C	ENST00000357033.4	-	59	9119	c.8913C>G	c.(8911-8913)ctC>ctG	p.L2971L	DMD_ENST00000378707.3_Silent_p.L511L|DMD_ENST00000343523.2_Silent_p.L511L|DMD_ENST00000541735.1_Silent_p.L511L|DMD_ENST00000445312.1_5'Flank|DMD_ENST00000474231.1_Silent_p.L511L|DMD_ENST00000359836.1_Silent_p.L511L|DMD_ENST00000378677.2_Silent_p.L2967L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	2971					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GGTGATCTTGGAGAGAGTCAA	0.517																																						dbGAP											0													52.0	45.0	47.0					X																	31496247		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.8913C>G	X.37:g.31496247G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_Spectrin_repeat,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.P700A	ENST00000357033.4	37	c.2098	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	7.022	0.558958	0.13436	.	.	ENSG00000198947	ENST00000465285	.	.	.	5.4	-0.377	0.12501	.	.	.	.	.	T	0.54319	0.1851	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.46414	-0.9193	4	.	.	.	.	8.0763	0.30718	0.2573:0.5207:0.2221:0.0	.	.	.	.	A	700	.	.	P	-	1	0	DMD	31406168	0.998000	0.40836	0.997000	0.53966	0.942000	0.58702	0.589000	0.23939	-0.051000	0.13334	0.529000	0.55759	CCA	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin	ENSG00000198947		0.517	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	34	0.00	0	G	NM_004006		31496247	31496247	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000465285	ensembl	human	novel	69_37n	missense	39	11.11	5	SNP	1.000	C
DNAJC9	23234	genome.wustl.edu	37	10	75006522	75006522	+	Missense_Mutation	SNP	C	C	T	rs199703504		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:75006522C>T	ENST00000372950.4	-	2	1917	c.245G>A	c.(244-246)gGa>gAa	p.G82E	MRPS16_ENST00000479005.1_5'Flank|DNAJC9-AS1_ENST00000513954.1_RNA|MRPS16_ENST00000416782.2_3'UTR|DNAJC9-AS1_ENST00000440197.2_RNA	NM_015190.3	NP_056005.1	Q8WXX5	DNJC9_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 9	82	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				social behavior (GO:0035176)	nucleus (GO:0005634)				endometrium(2)|kidney(1)|large_intestine(2)|stomach(1)	6	Prostate(51;0.0119)					GTCCACTGTTCCCTGCTCATC	0.507													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17791	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													98.0	89.0	92.0					10																	75006522		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF327347	CCDS7322.1	10q22.3	2011-09-02			ENSG00000213551	ENSG00000213551		"""Heat shock proteins / DNAJ (HSP40)"""	19123	protein-coding gene	gene with protein product		611206					Standard	NM_015190		Approved	JDD1, SB73	uc001jtr.3	Q8WXX5	OTTHUMG00000018461	ENST00000372950.4:c.245G>A	10.37:g.75006522C>T	ENSP00000362041:p.Gly82Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RMW6	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	p.G82E	ENST00000372950.4	37	c.245	CCDS7322.1	10	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	36	5.668738	0.96754	.	.	ENSG00000213551	ENST00000372950	T	0.76060	-0.99	5.19	5.19	0.71726	Heat shock protein DnaJ, N-terminal (3);	0.000000	0.85682	D	0.000000	D	0.88317	0.6404	M	0.88450	2.955	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90344	0.4361	10	0.87932	D	0	.	16.5572	0.84488	0.0:1.0:0.0:0.0	.	82	Q8WXX5	DNJC9_HUMAN	E	82	ENSP00000362041:G82E	ENSP00000362041:G82E	G	-	2	0	DNAJC9	74676528	1.000000	0.71417	0.957000	0.39632	0.833000	0.47200	6.016000	0.70798	2.583000	0.87209	0.591000	0.81541	GGA	DNAJC9	-	superfamily_DnaJ_N,prints_Hsp_DnaJ,pfscan_DnaJ_N	ENSG00000213551		0.507	DNAJC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC9	HGNC	protein_coding	OTTHUMT00000048643.1	59	0.00	0	C	NM_015190		75006522	75006522	-1	no_errors	ENST00000372950	ensembl	human	known	69_37n	missense	79	23.30	24	SNP	1.000	T
DOCK2	1794	genome.wustl.edu	37	5	169461520	169461520	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:169461520G>C	ENST00000256935.8	+	35	3665	c.3585G>C	c.(3583-3585)gaG>gaC	p.E1195D	DOCK2_ENST00000520908.1_Missense_Mutation_p.E687D|DOCK2_ENST00000523351.1_3'UTR|DOCK2_ENST00000540750.1_Missense_Mutation_p.E256D	NM_004946.2	NP_004937.1	Q92608	DOCK2_HUMAN	dedicator of cytokinesis 2	1195	Interaction with CRKL.				actin cytoskeleton organization (GO:0030036)|alpha-beta T cell proliferation (GO:0046633)|chemotaxis (GO:0006935)|establishment of T cell polarity (GO:0001768)|immunological synapse formation (GO:0001771)|macropinocytosis (GO:0044351)|membrane raft polarization (GO:0001766)|myeloid dendritic cell activation involved in immune response (GO:0002277)|negative thymic T cell selection (GO:0045060)|positive regulation of phagocytosis (GO:0050766)|positive thymic T cell selection (GO:0045059)|regulation of defense response to virus by virus (GO:0050690)|small GTPase mediated signal transduction (GO:0007264)|viral process (GO:0016032)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|T cell receptor binding (GO:0042608)			NS(2)|breast(5)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(42)|liver(2)|lung(63)|ovary(5)|pancreas(3)|prostate(7)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	160	Renal(175;0.000159)|Lung NSC(126;0.0221)|all_lung(126;0.0337)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.53e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)			TGACAGATGAGAGCAAAGACA	0.597																																						dbGAP											0													101.0	98.0	99.0					5																	169461520		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC016996	CCDS4371.1	5q35.1	2008-02-05			ENSG00000134516	ENSG00000134516			2988	protein-coding gene	gene with protein product		603122	"""dedicator of cyto-kinesis 2"""				Standard	NM_004946		Approved	KIAA0209	uc003maf.3	Q92608	OTTHUMG00000130437	ENST00000256935.8:c.3585G>C	5.37:g.169461520G>C	ENSP00000256935:p.Glu1195Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M3I0|Q96AK7	Missense_Mutation	SNP	pfam_DOCK,pfam_SH3_2,superfamily_SH3_domain,superfamily_Cyt_c_dom,superfamily_ARM-type_fold,superfamily_Ferritin/RR-like,smart_SH3_domain,pfscan_SH3_domain	p.E1195D	ENST00000256935.8	37	c.3585	CCDS4371.1	5	.	.	.	.	.	.	.	.	.	.	G	17.40	3.379039	0.61735	.	.	ENSG00000134516	ENST00000256935;ENST00000520908;ENST00000540750	T;T;T	0.56275	0.47;0.47;0.47	5.63	4.76	0.60689	.	0.107028	0.64402	D	0.000008	T	0.53126	0.1777	M	0.82132	2.575	0.39685	D	0.97095	B;B	0.17465	0.006;0.022	B;B	0.14578	0.004;0.011	T	0.57159	-0.7859	10	0.62326	D	0.03	.	8.6567	0.34068	0.2301:0.0:0.7699:0.0	.	687;1195	E7ERW7;Q92608	.;DOCK2_HUMAN	D	1195;687;256	ENSP00000256935:E1195D;ENSP00000429283:E687D;ENSP00000438827:E256D	ENSP00000256935:E1195D	E	+	3	2	DOCK2	169394098	0.991000	0.36638	0.999000	0.59377	0.964000	0.63967	0.254000	0.18314	1.385000	0.46445	0.655000	0.94253	GAG	DOCK2	-	NULL	ENSG00000134516		0.597	DOCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK2	HGNC	protein_coding	OTTHUMT00000252828.2	45	0.00	0	G	NM_004946		169461520	169461520	+1	no_errors	ENST00000256935	ensembl	human	known	69_37n	missense	53	17.19	11	SNP	1.000	C
DOCK8	81704	genome.wustl.edu	37	9	376234	376234	+	Frame_Shift_Del	DEL	A	A	-			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr9:376234delA	ENST00000453981.1	+	19	2246	c.2134delA	c.(2134-2136)attfs	p.I712fs	DOCK8_ENST00000382331.1_Frame_Shift_Del_p.I14fs|DOCK8_ENST00000382329.1_Frame_Shift_Del_p.I179fs|DOCK8_ENST00000432829.2_Frame_Shift_Del_p.I644fs|DOCK8_ENST00000469391.1_Frame_Shift_Del_p.I644fs			Q8NF50	DOCK8_HUMAN	dedicator of cytokinesis 8	712	DHR-1.				blood coagulation (GO:0007596)|dendritic cell migration (GO:0036336)|immunological synapse formation (GO:0001771)|memory T cell proliferation (GO:0061485)|negative regulation of T cell apoptotic process (GO:0070233)|small GTPase mediated signal transduction (GO:0007264)	cell leading edge (GO:0031252)|cytosol (GO:0005829)|membrane (GO:0016020)	guanyl-nucleotide exchange factor activity (GO:0005085)			breast(1)|central_nervous_system(5)|endometrium(2)|kidney(6)|large_intestine(13)|lung(22)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(6)	65		all_cancers(5;2.13e-17)|all_epithelial(5;2.15e-12)|all_lung(10;6.69e-11)|Lung NSC(10;1.08e-10)|Acute lymphoblastic leukemia(5;0.000242)|all_hematologic(5;0.00317)|Breast(48;0.0151)|Prostate(43;0.128)		all cancers(5;9.3e-07)|GBM - Glioblastoma multiforme(5;2.41e-06)|Epithelial(6;0.00557)|Lung(218;0.00942)		GAATCCTCCCATTAAGTGGGC	0.378																																						dbGAP											0													129.0	128.0	128.0					9																	376234		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0			AK090429	CCDS6440.1, CCDS6440.2, CCDS55283.1, CCDS55284.1	9p24.3	2014-09-17			ENSG00000107099	ENSG00000107099			19191	protein-coding gene	gene with protein product		611432				11214971	Standard	NM_203447		Approved	FLJ00026, FLJ00152, ZIR8, FLJ00346	uc003zgf.2	Q8NF50	OTTHUMG00000078789	ENST00000453981.1:c.2134delA	9.37:g.376234delA	ENSP00000408464:p.Ile712fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A350|A2BDF2|A4FU78|B7ZLP0|E9PH09|Q3MV16|Q5JPJ1|Q8TEP1|Q8WUY2|Q9BYJ5|Q9H1Q2|Q9H1Q3|Q9H308|Q9H7P2	Frame_Shift_Del	DEL	pfam_DOCK,pfam_DUF3398,superfamily_ARM-type_fold	p.I712fs	ENST00000453981.1	37	c.2134	CCDS6440.2	9																																																																																			DOCK8	-	NULL	ENSG00000107099		0.378	DOCK8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK8	HGNC	protein_coding	OTTHUMT00000171792.5	48	0.00	0	A	XM_036307		376234	376234	+1	no_errors	ENST00000453981	ensembl	human	known	69_37n	frame_shift_del	57	11.76	8	DEL	0.986	-
DSE	29940	genome.wustl.edu	37	6	116757178	116757178	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:116757178A>G	ENST00000331677.3	+	7	1991	c.1547A>G	c.(1546-1548)gAc>gGc	p.D516G	DSE_ENST00000537543.1_Missense_Mutation_p.D535G|DSE_ENST00000359564.2_Missense_Mutation_p.D516G|DSE_ENST00000452085.3_Missense_Mutation_p.D516G			Q9UL01	DSE_HUMAN	dermatan sulfate epimerase	516					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	chondroitin-glucuronate 5-epimerase activity (GO:0047757)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	35		all_cancers(87;0.00019)|all_epithelial(87;0.000416)|Ovarian(999;0.133)|Colorectal(196;0.234)		Epithelial(106;0.00915)|OV - Ovarian serous cystadenocarcinoma(136;0.0149)|GBM - Glioblastoma multiforme(226;0.0189)|all cancers(137;0.0262)		TACAAGCATGACCTGGCAGCT	0.507																																						dbGAP											0													64.0	62.0	63.0					6																	116757178		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF098066	CCDS5107.1	6q22	2008-02-05	2007-01-29	2007-01-29	ENSG00000111817	ENSG00000111817	5.1.3.19		21144	protein-coding gene	gene with protein product		605942	"""squamous cell carcinoma antigen recognized by T cells 2"""	SART2		11920522, 16505484	Standard	NM_001080976		Approved	DSEPI	uc003pws.3	Q9UL01	OTTHUMG00000015434	ENST00000331677.3:c.1547A>G	6.37:g.116757178A>G	ENSP00000332151:p.Asp516Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5R3K6	Missense_Mutation	SNP	superfamily_Chondroitin_lyas	p.D535G	ENST00000331677.3	37	c.1604	CCDS5107.1	6	.	.	.	.	.	.	.	.	.	.	A	6.030	0.373821	0.11409	.	.	ENSG00000111817	ENST00000452085;ENST00000537543;ENST00000331677;ENST00000359564	T;T;T;T	0.17528	2.28;2.27;2.28;2.28	6.01	4.86	0.63082	.	0.094281	0.64402	D	0.000001	T	0.02119	0.0066	N	0.02391	-0.57	0.48452	D	0.999651	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.43212	-0.9405	10	0.16420	T	0.52	-27.5925	8.8124	0.34976	0.8605:0.0:0.1395:0.0	.	535;516	B7Z765;Q9UL01	.;DSE_HUMAN	G	516;535;516;516	ENSP00000404049:D516G;ENSP00000441152:D535G;ENSP00000332151:D516G;ENSP00000352567:D516G	ENSP00000332151:D516G	D	+	2	0	DSE	116863871	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.171000	0.64996	2.307000	0.77673	0.528000	0.53228	GAC	DSE	-	NULL	ENSG00000111817		0.507	DSE-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DSE	HGNC	protein_coding	OTTHUMT00000041940.2	15	0.00	0	A	NM_013352		116757178	116757178	+1	no_errors	ENST00000537543	ensembl	human	known	69_37n	missense	23	32.35	11	SNP	1.000	G
ERBB2	2064	genome.wustl.edu	37	17	37880257	37880257	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:37880257C>G	ENST00000269571.5	+	19	2460	c.2301C>G	c.(2299-2301)atC>atG	p.I767M	ERBB2_ENST00000584450.1_Missense_Mutation_p.I767M|ERBB2_ENST00000584601.1_Missense_Mutation_p.I737M|MIR4728_ENST00000580969.1_RNA|ERBB2_ENST00000541774.1_Missense_Mutation_p.I752M|ERBB2_ENST00000406381.2_Missense_Mutation_p.I737M|ERBB2_ENST00000540147.1_Missense_Mutation_p.I737M|ERBB2_ENST00000445658.2_Missense_Mutation_p.I491M			P04626	ERBB2_HUMAN	v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2	767	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|enzyme linked receptor protein signaling pathway (GO:0007167)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|heart development (GO:0007507)|innate immune response (GO:0045087)|motor neuron axon guidance (GO:0008045)|myelination (GO:0042552)|negative regulation of immature T cell proliferation in thymus (GO:0033088)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oligodendrocyte differentiation (GO:0048709)|peptidyl-tyrosine phosphorylation (GO:0018108)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase I promoter (GO:0045943)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of translation (GO:0045727)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of angiogenesis (GO:0045765)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of microtubule-based process (GO:0032886)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|transcription, DNA-templated (GO:0006351)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|ErbB-3 class receptor binding (GO:0043125)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|protein dimerization activity (GO:0046983)|protein heterodimerization activity (GO:0046982)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|RNA polymerase I core binding (GO:0001042)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)|transmembrane signaling receptor activity (GO:0004888)	p.I767M(2)		NS(1)|breast(16)|central_nervous_system(17)|endometrium(6)|haematopoietic_and_lymphoid_tissue(8)|kidney(4)|large_intestine(16)|liver(3)|lung(125)|ovary(18)|pancreas(1)|prostate(4)|skin(1)|stomach(14)|upper_aerodigestive_tract(9)|urinary_tract(4)	247	all_cancers(6;1.06e-93)|all_epithelial(6;2.33e-113)|Breast(7;9.37e-100)|Lung NSC(9;9.76e-10)|all_lung(9;5.34e-09)|Colorectal(19;0.000442)|Esophageal squamous(10;0.052)	Ovarian(249;0.0547)|Colorectal(1115;0.234)	UCEC - Uterine corpus endometrioid carcinoma (11;0.000126)|Epithelial(3;9.42e-64)|all cancers(3;5.61e-57)|BRCA - Breast invasive adenocarcinoma(8;2.5e-45)|STAD - Stomach adenocarcinoma(3;9.03e-13)|Colorectal(5;6.23e-08)|COAD - Colon adenocarcinoma(5;8.58e-06)|Lung(15;0.00193)|LUAD - Lung adenocarcinoma(14;0.0664)|OV - Ovarian serous cystadenocarcinoma(8;0.0917)|LUSC - Lung squamous cell carcinoma(15;0.171)	UCEC - Uterine corpus endometrioid carcinoma (308;0.0767)	ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Lapatinib(DB01259)|Pertuzumab(DB06366)|Trastuzumab(DB00072)	ACAAAGAAATCTTAGACGTAA	0.542		1	"""A, Mis, O"""		"""breast, ovarian, other tumour types, NSCLC, gastric"""					TCGA GBM(5;<1E-08)																												dbGAP		Dom	yes		17	17q21.1	2064	"""v-erb-b2 erythroblastic leukemia viral oncogene homolog 2, neuro/glioblastoma derived oncogene homolog (avian)"""		E	2	Substitution - Missense(2)	ovary(1)|breast(1)											97.0	85.0	89.0					17																	37880257		2203	4300	6503	-	-	-	SO:0001583	missense	0			X03363	CCDS32642.1, CCDS45667.1, CCDS74052.1	17q11.2-q12	2014-09-17	2013-07-09			ENSG00000141736		"""CD molecules"""	3430	protein-coding gene	gene with protein product	"""neuro/glioblastoma derived oncogene homolog"""	164870	"""v-erb-b2 avian erythroblastic leukemia viral oncogene homolog 2 (neuro/glioblastoma derived oncogene homolog)"""	NGL			Standard	XM_005257140		Approved	NEU, HER-2, CD340, HER2	uc002hso.3	P04626		ENST00000269571.5:c.2301C>G	17.37:g.37880257C>G	ENSP00000269571:p.Ile767Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RZG3|B4DHN3|Q14256|Q6LDV1|Q9UMK4|X5D2V5	Missense_Mutation	SNP	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.I767M	ENST00000269571.5	37	c.2301	CCDS32642.1	17	.	.	.	.	.	.	.	.	.	.	C	20.3	3.967983	0.74131	.	.	ENSG00000141736	ENST00000406381;ENST00000541774;ENST00000445658;ENST00000269571;ENST00000540147	D;D;D;D;D	0.82803	-1.65;-1.65;-1.65;-1.65;-1.65	5.02	4.03	0.46877	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	T	0.80369	0.4610	N	0.10629	0.01	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.87578	0.998;0.998;0.997	T	0.81996	-0.0676	9	0.87932	D	0	.	9.2517	0.37560	0.1439:0.778:0.0:0.0781	.	491;752;767	B4DTR1;P04626-4;P04626	.;.;ERBB2_HUMAN	M	737;752;491;767;737	ENSP00000385185:I737M;ENSP00000446466:I752M;ENSP00000404047:I491M;ENSP00000269571:I767M;ENSP00000443562:I737M	ENSP00000269571:I767M	I	+	3	3	ERBB2	35133783	0.003000	0.15002	0.999000	0.59377	0.961000	0.63080	-0.628000	0.05515	1.082000	0.41137	0.462000	0.41574	ATC	ERBB2	-	pirsf_Tyr_kinase_EGF/ERB/XmrK_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000141736		0.542	ERBB2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	ERBB2	HGNC	protein_coding	OTTHUMT00000445621.2	69	0.00	0	C			37880257	37880257	+1	no_errors	ENST00000269571	ensembl	human	known	69_37n	missense	54	31.65	25	SNP	1.000	G
EPX	8288	genome.wustl.edu	37	17	56272352	56272352	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:56272352C>T	ENST00000225371.5	+	6	732	c.622C>T	c.(622-624)Cgc>Tgc	p.R208C		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	208					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CCAGATTGTGCGCTTCCCCAA	0.587																																						dbGAP											0													70.0	59.0	63.0					17																	56272352		2203	4300	6503	-	-	-	SO:0001583	missense	0			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.622C>T	17.37:g.56272352C>T	ENSP00000225371:p.Arg208Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4TVP3	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R208C	ENST00000225371.5	37	c.622	CCDS11602.1	17	.	.	.	.	.	.	.	.	.	.	C	16.94	3.261650	0.59431	.	.	ENSG00000121053	ENST00000225371	T	0.70399	-0.48	5.02	3.97	0.46021	.	0.483471	0.25494	N	0.030288	D	0.85204	0.5643	M	0.91406	3.205	0.46981	D	0.999271	D	0.76494	0.999	D	0.66351	0.943	D	0.87603	0.2498	10	0.59425	D	0.04	-4.4245	12.9062	0.58154	0.0:0.8353:0.1647:0.0	.	208	P11678	PERE_HUMAN	C	208	ENSP00000225371:R208C	ENSP00000225371:R208C	R	+	1	0	EPX	53627351	0.004000	0.15560	0.977000	0.42913	0.813000	0.45954	0.955000	0.29188	2.486000	0.83907	0.561000	0.74099	CGC	EPX	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal	ENSG00000121053		0.587	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPX	HGNC	protein_coding	OTTHUMT00000443367.1	47	0.00	0	C	NM_000502		56272352	56272352	+1	no_errors	ENST00000225371	ensembl	human	known	69_37n	missense	35	30.00	15	SNP	0.883	T
EXOC7	23265	genome.wustl.edu	37	17	74079730	74079730	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:74079730C>T	ENST00000335146.7	-	20	2260	c.2207G>A	c.(2206-2208)tGa>tAa	p.*736*	EXOC7_ENST00000607838.1_Silent_p.*708*|EXOC7_ENST00000411744.2_Silent_p.*677*|EXOC7_ENST00000589210.1_Silent_p.*685*|EXOC7_ENST00000591724.1_5'Flank|EXOC7_ENST00000467929.2_Silent_p.*657*|EXOC7_ENST00000405575.4_Silent_p.*694*|EXOC7_ENST00000332065.5_Silent_p.*654*			Q9UPT5	EXOC7_HUMAN	exocyst complex component 7	0					cellular protein metabolic process (GO:0044267)|exocytosis (GO:0006887)|membrane organization (GO:0061024)|protein transport (GO:0015031)	centriolar satellite (GO:0034451)|exocyst (GO:0000145)|growth cone membrane (GO:0032584)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|plasma membrane (GO:0005886)				NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|skin(1)	14			LUSC - Lung squamous cell carcinoma(166;0.187)			GCAGCAGGCTCAGGCAGAGGT	0.572																																						dbGAP											0													141.0	116.0	124.0					17																	74079730		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC029432	CCDS11741.1, CCDS32738.1, CCDS45781.1, CCDS45782.1, CCDS45784.1, CCDS74164.1	17q25.3	2013-01-22			ENSG00000182473	ENSG00000182473			23214	protein-coding gene	gene with protein product		608163				12477932	Standard	NM_001013839		Approved	EXO70, KIAA1067, YJL085W, Exo70p	uc010wsw.2	Q9UPT5	OTTHUMG00000150720	ENST00000335146.7:c.2207G>A	17.37:g.74079730C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B5MC69|B8XXP2|Q8ND93|Q8WV91|Q96FF0|Q9H8C3|Q9H9X3|Q9HA32	Silent	SNP	pfam_Exo70,superfamily_Cullin_repeat-like_dom	p.*736	ENST00000335146.7	37	c.2207	CCDS45782.1	17																																																																																			EXOC7	-	NULL	ENSG00000182473		0.572	EXOC7-006	KNOWN	basic|CCDS	protein_coding	EXOC7	HGNC	protein_coding	OTTHUMT00000319768.2	34	0.00	0	C	NM_015219		74079730	74079730	-1	no_errors	ENST00000335146	ensembl	human	known	69_37n	silent	49	16.95	10	SNP	0.961	T
FAM208B	54906	genome.wustl.edu	37	10	5799561	5799561	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:5799561C>G	ENST00000328090.5	+	17	7436	c.6811C>G	c.(6811-6813)Cac>Gac	p.H2271D		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	2271																	TGTTCTTGATCACACCTACCA	0.433																																						dbGAP											0													238.0	223.0	228.0					10																	5799561		1905	4139	6044	-	-	-	SO:0001583	missense	0			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.6811C>G	10.37:g.5799561C>G	ENSP00000328426:p.His2271Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.H2271D	ENST00000328090.5	37	c.6811	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	C	6.377	0.437757	0.12104	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.49720	0.77	5.59	-5.71	0.02413	.	1.168090	0.06165	N	0.676573	T	0.28665	0.0710	L	0.47190	1.495	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.27673	-1.0067	10	0.12430	T	0.62	.	0.3784	0.00391	0.2809:0.2625:0.2328:0.2238	.	2271	Q5VWN6	F208B_HUMAN	D	2271;1466	ENSP00000328426:H2271D	ENSP00000328426:H2271D	H	+	1	0	C10orf18	5839567	0.000000	0.05858	0.008000	0.14137	0.645000	0.38454	-1.661000	0.01972	-0.398000	0.07679	0.655000	0.94253	CAC	FAM208B	-	NULL	ENSG00000108021		0.433	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	72	0.00	0	C	NM_017782		5799561	5799561	+1	no_errors	ENST00000328090	ensembl	human	known	69_37n	missense	86	21.10	23	SNP	0.000	G
FAM96A	84191	genome.wustl.edu	37	15	64385865	64385865	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr15:64385865C>G	ENST00000300030.3	-	1	352	c.103G>C	c.(103-105)Gag>Cag	p.E35Q	SNX1_ENST00000559844.1_5'Flank|SNX1_ENST00000560829.1_5'Flank|SNX1_ENST00000353874.4_5'Flank|FAM96A_ENST00000557835.1_Missense_Mutation_p.E35Q|SNX1_ENST00000561026.1_5'Flank|FAM96A_ENST00000380290.3_Missense_Mutation_p.E35Q|FAM96A_ENST00000559950.1_Missense_Mutation_p.E35Q|SNX1_ENST00000261889.5_5'Flank	NM_032231.4	NP_115607.1	Q9H5X1	FA96A_HUMAN	family with sequence similarity 96, member A	35					chromosome segregation (GO:0007059)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			kidney(1)|large_intestine(1)|lung(4)|prostate(1)|skin(1)|urinary_tract(1)	9						AGCGCTTTCTCTTCCATGATC	0.607																																						dbGAP											0													63.0	62.0	63.0					15																	64385865		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS10189.1, CCDS45278.1	15q22.31	2014-01-16			ENSG00000166797	ENSG00000166797			26235	protein-coding gene	gene with protein product						23891004	Standard	NM_032231		Approved	FLJ22875	uc002amt.1	Q9H5X1	OTTHUMG00000132961	ENST00000300030.3:c.103G>C	15.37:g.64385865C>G	ENSP00000300030:p.Glu35Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKS1|B2R5F8|B7Z8Z5	Missense_Mutation	SNP	pfam_DUF59	p.E35Q	ENST00000300030.3	37	c.103	CCDS10189.1	15	.	.	.	.	.	.	.	.	.	.	C	20.4	3.980235	0.74474	.	.	ENSG00000166797	ENST00000300030;ENST00000380290	.	.	.	5.84	5.84	0.93424	.	0.093868	0.46758	D	0.000268	T	0.48295	0.1492	N	0.19112	0.55	0.51012	D	0.999909	D;P	0.57899	0.981;0.856	P;B	0.52109	0.69;0.425	T	0.28933	-1.0028	9	0.13108	T	0.6	-27.4733	17.6471	0.88151	0.0:1.0:0.0:0.0	.	35;35	B7Z8Z5;Q9H5X1	.;FA96A_HUMAN	Q	35	.	ENSP00000300030:E35Q	E	-	1	0	FAM96A	62172918	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.049000	0.71053	2.758000	0.94735	0.655000	0.94253	GAG	FAM96A	-	NULL	ENSG00000166797		0.607	FAM96A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM96A	HGNC	protein_coding	OTTHUMT00000256520.1	42	0.00	0	C	NM_032231		64385865	64385865	-1	no_errors	ENST00000300030	ensembl	human	known	69_37n	missense	38	46.48	33	SNP	1.000	G
FANCD2	2177	genome.wustl.edu	37	3	10089640	10089640	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:10089640C>T	ENST00000419585.1	+	16	1479	c.1318C>T	c.(1318-1320)Cag>Tag	p.Q440*	FANCD2_ENST00000287647.3_Nonsense_Mutation_p.Q440*|FANCD2_ENST00000383806.1_Nonsense_Mutation_p.Q440*|FANCD2_ENST00000383807.1_Nonsense_Mutation_p.Q440*			Q9BXW9	FACD2_HUMAN	Fanconi anemia, complementation group D2	440					DNA repair (GO:0006281)|gamete generation (GO:0007276)|response to gamma radiation (GO:0010332)|synapsis (GO:0007129)	condensed chromosome (GO:0000793)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA polymerase binding (GO:0070182)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(3)	51				OV - Ovarian serous cystadenocarcinoma(96;0.148)		GTCGCTGGCTCAGAGTTTGCT	0.408			"""D, Mis, N, F"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																													dbGAP	yes	Rec		Fanconi anaemia D2	3	3p26	2177	"""Fanconi anemia, complementation group D2"""		L	0													168.0	171.0	170.0					3																	10089640		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	AF340183	CCDS2595.1, CCDS33696.1	3p25.3	2014-09-17		2001-10-05	ENSG00000144554	ENSG00000144554		"""Fanconi anemia, complementation groups"""	3585	protein-coding gene	gene with protein product		613984		FACD, FANCD		7581463, 11239453, 18475298	Standard	XM_005264946		Approved	FAD, FA-D2	uc003buw.3	Q9BXW9	OTTHUMG00000128670	ENST00000419585.1:c.1318C>T	3.37:g.10089640C>T	ENSP00000398754:p.Gln440*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2LA86|Q69YP9|Q6PJN7|Q9BQ06|Q9H9T9	Nonsense_Mutation	SNP	superfamily_ARM-type_fold	p.Q440*	ENST00000419585.1	37	c.1318	CCDS33696.1	3	.	.	.	.	.	.	.	.	.	.	C	37	6.358323	0.97502	.	.	ENSG00000144554	ENST00000287647;ENST00000383807;ENST00000383806;ENST00000419585	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	17.2216	0.86959	0.0:1.0:0.0:0.0	.	.	.	.	X	440	.	ENSP00000287647:Q440X	Q	+	1	0	FANCD2	10064640	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	4.757000	0.62213	2.656000	0.90262	0.591000	0.81541	CAG	FANCD2	-	superfamily_ARM-type_fold	ENSG00000144554		0.408	FANCD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCD2	HGNC	protein_coding	OTTHUMT00000339873.1	83	0.00	0	C			10089640	10089640	+1	no_errors	ENST00000287647	ensembl	human	known	69_37n	nonsense	76	28.30	30	SNP	1.000	T
FBXL5	26234	genome.wustl.edu	37	4	15640233	15640233	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:15640233G>C	ENST00000341285.3	-	4	605	c.481C>G	c.(481-483)Cag>Gag	p.Q161E	FBXL5_ENST00000412094.2_Missense_Mutation_p.Q144E|FBXL5_ENST00000382358.4_Missense_Mutation_p.Q35E	NM_001193534.1|NM_001193535.1|NM_012161.3	NP_001180463.1|NP_001180464.1|NP_036293.1	Q9UKA1	FBXL5_HUMAN	F-box and leucine-rich repeat protein 5	161					iron ion homeostasis (GO:0055072)|protein ubiquitination (GO:0016567)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)	perinuclear region of cytoplasm (GO:0048471)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	iron ion binding (GO:0005506)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(2)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	13						GTATCCTTCTGAGAGCAGTGT	0.348																																						dbGAP											0													90.0	80.0	83.0					4																	15640233		2201	4299	6500	-	-	-	SO:0001583	missense	0			AF174591	CCDS3415.1, CCDS54745.1	4p15.33	2011-06-09			ENSG00000118564	ENSG00000118564		"""F-boxes / Leucine-rich repeats"""	13602	protein-coding gene	gene with protein product		605655				10531035	Standard	NM_012161		Approved	FBL4, FBL5, FLR1	uc003goc.2	Q9UKA1	OTTHUMG00000097097	ENST00000341285.3:c.481C>G	4.37:g.15640233G>C	ENSP00000344866:p.Gln161Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSK4|B4DIB5|Q4W5A8|Q8NHP3|Q9NXN2|Q9P0I0|Q9P0X5|Q9UJT7|Q9UKC8	Nonsense_Mutation	SNP	pfam_F-box_dom_cyclin-like,pfam_Leu-rich_rpt,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_F-box_dom_cyclin-like	p.S81*	ENST00000341285.3	37	c.242	CCDS3415.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.01|16.01	3.001092|3.001092	0.54254|0.54254	.|.	.|.	ENSG00000118564|ENSG00000118564	ENST00000341285;ENST00000412094;ENST00000382358;ENST00000512066;ENST00000503196;ENST00000509314|ENST00000513163	T;T;T|.	0.32515|.	1.48;1.49;1.45|.	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	0.323823|.	0.38663|.	N|.	0.001602|.	T|.	0.61714|.	0.2369|.	L|L	0.29908|0.29908	0.895|0.895	0.58432|0.58432	D|D	0.999996|0.999996	B;B|.	0.22683|.	0.073;0.012|.	B;B|.	0.27380|.	0.079;0.022|.	T|.	0.59026|.	-0.7531|.	10|.	0.27785|0.44086	T|T	0.31|0.13	-2.9795|-2.9795	20.0371|20.0371	0.97565|0.97565	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	144;161|.	Q9UKA1-2;Q9UKA1|.	.;FBXL5_HUMAN|.	E|X	161;144;35;123;106;106|81	ENSP00000344866:Q161E;ENSP00000408679:Q144E;ENSP00000371795:Q35E|.	ENSP00000344866:Q161E|ENSP00000425472:S81X	Q|S	-|-	1|2	0|0	FBXL5|FBXL5	15249331|15249331	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	7.976000|7.976000	0.88070|0.88070	2.736000|2.736000	0.93811|0.93811	0.650000|0.650000	0.86243|0.86243	CAG|TCA	FBXL5	-	NULL	ENSG00000118564		0.348	FBXL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXL5	HGNC	protein_coding	OTTHUMT00000214235.2	85	0.00	0	G			15640233	15640233	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000513163	ensembl	human	novel	69_37n	nonsense	57	26.92	21	SNP	1.000	C
FGA	2243	genome.wustl.edu	37	4	155507948	155507948	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:155507948G>T	ENST00000302053.3	-	5	711	c.633C>A	c.(631-633)gaC>gaA	p.D211E	FGA_ENST00000403106.3_Missense_Mutation_p.D211E	NM_000508.3	NP_000499.1	P02671	FIBA_HUMAN	fibrinogen alpha chain	211					blood coagulation (GO:0007596)|blood coagulation, common pathway (GO:0072377)|cell-matrix adhesion (GO:0007160)|cellular protein complex assembly (GO:0043623)|extracellular matrix organization (GO:0030198)|negative regulation of blood coagulation, common pathway (GO:2000261)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of peptide hormone secretion (GO:0090277)|positive regulation of protein secretion (GO:0050714)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|positive regulation of vasoconstriction (GO:0045907)|protein polymerization (GO:0051258)|response to calcium ion (GO:0051592)|signal transduction (GO:0007165)	blood microparticle (GO:0072562)|cell cortex (GO:0005938)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|fibrinogen complex (GO:0005577)|plasma membrane (GO:0005886)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|vesicle (GO:0031982)	structural molecule activity (GO:0005198)			NS(1)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(14)|liver(2)|lung(20)|ovary(3)|pancreas(1)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(6)	73	all_hematologic(180;0.215)	Renal(120;0.0458)			Alteplase(DB00009)|Anistreplase(DB00029)|Reteplase(DB00015)|Sucralfate(DB00364)|Tenecteplase(DB00031)	AGGGAAGTAAGTCTTTGGCAA	0.443																																					NSCLC(143;340 1922 20892 22370 48145)	dbGAP											0													141.0	142.0	142.0					4																	155507948		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3787.1, CCDS47152.1	4q28	2014-09-17			ENSG00000171560	ENSG00000171560		"""Fibrinogen C domain containing"", ""Endogenous ligands"""	3661	protein-coding gene	gene with protein product		134820	"""fibrinogen, A alpha polypeptide"""				Standard	NM_000508		Approved		uc003iod.1	P02671	OTTHUMG00000150330	ENST00000302053.3:c.633C>A	4.37:g.155507948G>T	ENSP00000306361:p.Asp211Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3E4|D3DP14|D3DP15|Q4QQH7|Q9BX62|Q9UCH2	Missense_Mutation	SNP	pfam_Fibrinogen_a/b/g_C,pfam_Fibrinogen_a/b/g_coil_dom,pfam_Fibrinogen_aC,superfamily_Fibrinogen_a/b/g_C,smart_Fibrinogen_a/b/g_C	p.D211E	ENST00000302053.3	37	c.633	CCDS3787.1	4	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396134	0.25205	.	.	ENSG00000171560	ENST00000302053;ENST00000403106;ENST00000457487	D;D	0.84516	-1.86;-1.86	5.78	0.864	0.19068	Fibrinogen, alpha/beta/gamma chain, coiled coil domain (1);	0.821048	0.11731	N	0.534980	T	0.73953	0.3653	L	0.36672	1.1	0.09310	N	1	B;B	0.17268	0.021;0.002	B;B	0.15484	0.013;0.001	T	0.57740	-0.7759	10	0.30854	T	0.27	.	3.8986	0.09150	0.1937:0.2032:0.4979:0.1052	.	211;211	P02671-2;P02671	.;FIBA_HUMAN	E	211	ENSP00000306361:D211E;ENSP00000385981:D211E	ENSP00000306361:D211E	D	-	3	2	FGA	155727398	0.036000	0.19791	0.006000	0.13384	0.702000	0.40608	0.098000	0.15189	0.127000	0.18452	0.655000	0.94253	GAC	FGA	-	NULL	ENSG00000171560		0.443	FGA-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FGA	HGNC	protein_coding	OTTHUMT00000317593.1	67	0.00	0	G	NM_000508		155507948	155507948	-1	no_errors	ENST00000302053	ensembl	human	known	69_37n	missense	81	19.00	19	SNP	0.003	T
FNDC1	84624	genome.wustl.edu	37	6	159660685	159660685	+	Silent	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:159660685C>A	ENST00000297267.9	+	14	4517	c.4317C>A	c.(4315-4317)gtC>gtA	p.V1439V	FNDC1_ENST00000340366.6_Silent_p.V1376V|FNDC1-IT1_ENST00000419703.1_RNA	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	1439					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		GCTTGGAGGTCATCAAAAAAA	0.582																																						dbGAP											0													51.0	82.0	72.0					6																	159660685		2012	4092	6104	-	-	-	SO:0001819	synonymous_variant	0			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.4317C>A	6.37:g.159660685C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.H1335N	ENST00000297267.9	37	c.4003	CCDS47512.1	6	.	.	.	.	.	.	.	.	.	.	C	6.397	0.441420	0.12164	.	.	ENSG00000164694	ENST00000329629	.	.	.	4.91	-2.1	0.07210	.	.	.	.	.	T	0.07683	0.0193	.	.	.	0.27270	N	0.958382	.	.	.	.	.	.	T	0.33954	-0.9848	4	.	.	.	-23.5211	2.3569	0.04298	0.1018:0.2017:0.3409:0.3555	.	.	.	.	N	1335	.	.	H	+	1	0	FNDC1	159580675	0.012000	0.17670	0.019000	0.16419	0.863000	0.49368	-0.014000	0.12656	-0.080000	0.12685	0.655000	0.94253	CAT	FNDC1	-	NULL	ENSG00000164694		0.582	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	63	0.00	0	C	NM_032532		159660685	159660685	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000329629	ensembl	human	novel	69_37n	missense	48	28.99	20	SNP	0.014	A
GDAP1L1	78997	genome.wustl.edu	37	20	42907676	42907676	+	Silent	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr20:42907676C>G	ENST00000342560.5	+	6	928	c.840C>G	c.(838-840)ctC>ctG	p.L280L	GDAP1L1_ENST00000537864.1_Silent_p.L88L	NM_001256737.1|NM_024034.4	NP_001243666.1|NP_076939.3	Q96MZ0	GD1L1_HUMAN	ganglioside induced differentiation associated protein 1-like 1	280	GST C-terminal.									endometrium(1)|large_intestine(5)|lung(10)|pancreas(1)|prostate(1)	18		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			TGCACCGCCTCAAGTTCCTGG	0.582																																						dbGAP											0													75.0	73.0	74.0					20																	42907676		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS13328.1, CCDS74725.1, CCDS74726.1, CCDS74727.1	20q12	2012-02-09	2012-02-09		ENSG00000124194	ENSG00000124194			4213	protein-coding gene	gene with protein product							Standard	NM_024034		Approved		uc010zwl.3	Q96MZ0	OTTHUMG00000032530	ENST00000342560.5:c.840C>G	20.37:g.42907676C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z621|Q5TE60|Q68CW7|Q9BQJ7|Q9BQV4|Q9BWJ4|Q9H3Y2|Q9H4G5	Silent	SNP	pfam_Glutathione_S-Trfase_N,pfam_GST_C,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like	p.L280	ENST00000342560.5	37	c.840	CCDS13328.1	20																																																																																			GDAP1L1	-	pfam_GST_C,superfamily_Glutathione-S-Trfase_C-like	ENSG00000124194		0.582	GDAP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDAP1L1	HGNC	protein_coding	OTTHUMT00000079356.1	37	0.00	0	C	NM_024034		42907676	42907676	+1	no_errors	ENST00000342560	ensembl	human	known	69_37n	silent	28	27.50	11	SNP	1.000	G
GFM2	84340	genome.wustl.edu	37	5	74047198	74047198	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:74047198G>A	ENST00000296805.3	-	6	882	c.425C>T	c.(424-426)aCa>aTa	p.T142I	GFM2_ENST00000427854.2_Missense_Mutation_p.T142I|GFM2_ENST00000345239.2_Missense_Mutation_p.T142I|GFM2_ENST00000509430.1_Missense_Mutation_p.T142I	NM_032380.3	NP_115756.2			G elongation factor, mitochondrial 2											breast(2)|endometrium(2)|large_intestine(4)|lung(5)|prostate(1)	14		all_lung(232;0.00101)|Lung NSC(167;0.00278)|Ovarian(174;0.0129)|Breast(144;0.231)		OV - Ovarian serous cystadenocarcinoma(47;1.86e-56)		CATACCTGGTGTATCAATTAG	0.373																																						dbGAP											0													147.0	141.0	143.0					5																	74047198		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF111808	CCDS4023.1, CCDS4024.1, CCDS47232.1	5q13	2008-02-05			ENSG00000164347	ENSG00000164347			29682	protein-coding gene	gene with protein product		606544				11735030	Standard	NM_001281302		Approved	EFG2, FLJ21661	uc003kdh.1	Q969S9	OTTHUMG00000102058	ENST00000296805.3:c.425C>T	5.37:g.74047198G>A	ENSP00000296805:p.Thr142Ile	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ProtSyn_GTP-bd,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFG/EF2_IV,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,superfamily_Elongation_fac_G/III/V,superfamily_Ribosomal_S5_D2-typ_fold,smart_Transl_elong_EFG/EF2_IV,smart_Transl_elong_EFG/EF2_C,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	p.T142I	ENST00000296805.3	37	c.425	CCDS4023.1	5	.	.	.	.	.	.	.	.	.	.	G	34	5.376905	0.95945	.	.	ENSG00000164347	ENST00000296805;ENST00000345239;ENST00000546082;ENST00000509430;ENST00000427854	D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74	5.84	5.84	0.93424	Small GTP-binding protein domain (1);Protein synthesis factor, GTP-binding (2);	0.000000	0.85682	D	0.000000	D	0.94149	0.8123	H	0.94925	3.6	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	D	0.94978	0.8123	10	0.87932	D	0	-11.0223	20.1535	0.98095	0.0:0.0:1.0:0.0	.	142;142;142;142	Q969S9-3;Q969S9-5;Q969S9-2;Q969S9	.;.;.;RRF2M_HUMAN	I	142	ENSP00000296805:T142I;ENSP00000296804:T142I;ENSP00000427004:T142I;ENSP00000405808:T142I	ENSP00000296805:T142I	T	-	2	0	GFM2	74082954	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.701000	0.98710	2.764000	0.94973	0.650000	0.86243	ACA	GFM2	-	pfam_ProtSyn_GTP-bd,prints_ProtSyn_GTP-bd,tigrfam_Small_GTP-bd_dom	ENSG00000164347		0.373	GFM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GFM2	HGNC	protein_coding	OTTHUMT00000219860.2	59	0.00	0	G	NM_032380		74047198	74047198	-1	no_errors	ENST00000296805	ensembl	human	known	69_37n	missense	49	32.43	24	SNP	1.000	A
GON4L	54856	genome.wustl.edu	37	1	155735772	155735772	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:155735772G>C	ENST00000368331.1	-	21	3540	c.3492C>G	c.(3490-3492)atC>atG	p.I1164M	GON4L_ENST00000471341.1_5'UTR|GON4L_ENST00000271883.5_Missense_Mutation_p.I1164M|GON4L_ENST00000361040.5_Missense_Mutation_p.I1164M|GON4L_ENST00000437809.1_Missense_Mutation_p.I1164M	NM_001282858.1|NM_001282860.1	NP_001269787.1|NP_001269789.1	Q3T8J9	GON4L_HUMAN	gon-4-like (C. elegans)	1164					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(4)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(7)|lung(10)|ovary(3)|prostate(3)|skin(2)|stomach(1)|urinary_tract(1)	45	Hepatocellular(266;0.0997)|all_hematologic(923;0.145)|all_neural(408;0.195)					TGACAGGCTGGATCATGTTAC	0.532																																						dbGAP											0													101.0	98.0	99.0					1																	155735772		2203	4298	6501	-	-	-	SO:0001583	missense	0			AB046826	CCDS1121.1, CCDS44242.1, CCDS60296.1	1q22	2013-10-31	2006-11-08	2006-02-16	ENSG00000116580	ENSG00000116580			25973	protein-coding gene	gene with protein product		610393	"""gon-4 homolog (C.elegans)"""	GON4		16545939, 21454521	Standard	XM_005245283		Approved	FLJ20203, GON-4	uc001fly.1	Q3T8J9	OTTHUMG00000014106	ENST00000368331.1:c.3492C>G	1.37:g.155735772G>C	ENSP00000357315:p.Ile1164Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZBL4|Q14C93|Q3T8J8|Q5VYZ5|Q5W0D5|Q6AWA6|Q6P1Q6|Q7Z3L3|Q8IY79|Q9BQI1|Q9HCG6	Missense_Mutation	SNP	pfam_PAH,superfamily_PAH,superfamily_Homeodomain-like,pfscan_Myb-like_dom	p.I1164M	ENST00000368331.1	37	c.3492		1	.	.	.	.	.	.	.	.	.	.	G	13.30	2.194716	0.38806	.	.	ENSG00000116580	ENST00000437809;ENST00000368331;ENST00000271883;ENST00000361040	T;T;T;T	0.18657	2.4;2.4;2.4;2.2	5.27	0.0576	0.14324	.	0.292294	0.33023	N	0.005361	T	0.05731	0.0150	L	0.34521	1.04	0.35220	D	0.775987	B;B;B;B	0.29085	0.152;0.232;0.055;0.092	B;B;B;B	0.31614	0.133;0.063;0.063;0.133	T	0.18429	-1.0337	10	0.54805	T	0.06	.	6.0685	0.19875	0.2175:0.2526:0.5299:0.0	.	1164;360;1164;1164	Q3T8J9-2;Q1ED43;Q3T8J9;Q3T8J9-3	.;.;GON4L_HUMAN;.	M	1164	ENSP00000396117:I1164M;ENSP00000357315:I1164M;ENSP00000271883:I1164M;ENSP00000354322:I1164M	ENSP00000271883:I1164M	I	-	3	3	GON4L	154002396	0.233000	0.23772	0.994000	0.49952	0.989000	0.77384	-0.686000	0.05161	-0.121000	0.11787	0.650000	0.86243	ATC	GON4L	-	NULL	ENSG00000116580		0.532	GON4L-201	KNOWN	basic|appris_candidate_longest	protein_coding	GON4L	HGNC	protein_coding		75	0.00	0	G	NM_032292		155735772	155735772	-1	no_errors	ENST00000368331	ensembl	human	known	69_37n	missense	168	13.85	27	SNP	1.000	C
GPR143	4935	genome.wustl.edu	37	X	9693796	9693796	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:9693796C>A	ENST00000467482.1	-	9	1351	c.1205G>T	c.(1204-1206)gGa>gTa	p.G402V	GPR143_ENST00000380929.2_Missense_Mutation_p.G422V			P51810	GP143_HUMAN	G protein-coupled receptor 143	402					calcium-mediated signaling using intracellular calcium source (GO:0035584)|eye pigment biosynthetic process (GO:0006726)|G-protein coupled receptor signaling pathway (GO:0007186)|melanosome localization (GO:0032400)|melanosome organization (GO:0032438)|melanosome transport (GO:0032402)|neuropeptide signaling pathway (GO:0007218)|phosphatidylinositol-mediated signaling (GO:0048015)|regulation of calcium-mediated signaling (GO:0050848)|signal transduction (GO:0007165)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)|membrane (GO:0016020)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|G-protein coupled receptor activity (GO:0004930)|L-DOPA binding (GO:0072544)|L-DOPA receptor activity (GO:0035643)|tyrosine binding (GO:0072545)			endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15		Hepatocellular(5;0.000888)				TCATAGGTCTCCATGGGTTGG	0.483																																						dbGAP											0													154.0	116.0	129.0					X																	9693796		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z48804	CCDS14134.1, CCDS14134.2	Xp22.3	2013-09-27	2003-12-01		ENSG00000101850	ENSG00000101850		"""GPCR / Unclassified : 7TM orphan receptors"""	20145	protein-coding gene	gene with protein product	"""ocular albinism 1"""	300808	"""ocular albinism 1 (Nettleship-Falls)"""	OA1		7647783, 10471510	Standard	NM_000273		Approved		uc004cst.2	P51810	OTTHUMG00000021118	ENST00000467482.1:c.1205G>T	X.37:g.9693796C>A	ENSP00000417161:p.Gly402Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTI7	Missense_Mutation	SNP	pfam_Ocular_alb1,pfam_GPCR_2_secretin-like,prints_Ocular_alb1	p.G422V	ENST00000467482.1	37	c.1265	CCDS14134.2	X	.	.	.	.	.	.	.	.	.	.	C	14.58	2.579147	0.46006	.	.	ENSG00000101850	ENST00000467482;ENST00000380929	D;D	0.99523	-6.08;-6.08	4.27	3.37	0.38596	.	0.222920	0.37178	N	0.002210	D	0.99064	0.9679	L	0.59436	1.845	0.21325	N	0.999723	D	0.63880	0.993	P	0.61800	0.894	D	0.96859	0.9631	10	0.87932	D	0	-14.143	10.6139	0.45439	0.0:0.8081:0.1919:0.0	.	402	P51810	GP143_HUMAN	V	402;422	ENSP00000417161:G402V;ENSP00000370316:G422V	ENSP00000370316:G422V	G	-	2	0	GPR143	9653796	0.995000	0.38212	0.004000	0.12327	0.166000	0.22503	3.833000	0.55790	0.694000	0.31654	0.429000	0.28392	GGA	GPR143	-	pfam_Ocular_alb1	ENSG00000101850		0.483	GPR143-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR143	HGNC	protein_coding	OTTHUMT00000055714.2	83	0.00	0	C	NM_000273		9693796	9693796	-1	no_errors	ENST00000380929	ensembl	human	known	69_37n	missense	122	28.65	49	SNP	0.032	A
GTF3C1	2975	genome.wustl.edu	37	16	27499930	27499930	+	Silent	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr16:27499930G>C	ENST00000356183.4	-	22	3471	c.3456C>G	c.(3454-3456)ctC>ctG	p.L1152L	GTF3C1_ENST00000561623.1_Silent_p.L1152L	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	1152					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						GCCTCACTGTGAGTCCATTCT	0.537																																						dbGAP											0													125.0	117.0	120.0					16																	27499930		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.3456C>G	16.37:g.27499930G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Silent	SNP	pfam_TFIIIC_Bblock-bd	p.L1152	ENST00000356183.4	37	c.3456	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	G	5.590	0.293688	0.10567	.	.	ENSG00000077235	ENST00000388971	.	.	.	4.83	3.86	0.44501	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.0848	0.36574	0.1734:0.0:0.8266:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	GTF3C1	27407431	1.000000	0.71417	0.963000	0.40424	0.573000	0.36030	1.193000	0.32162	2.237000	0.73441	0.561000	0.74099	.	GTF3C1	-	NULL	ENSG00000077235		0.537	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	43	0.00	0	G	NM_001520		27499930	27499930	-1	no_errors	ENST00000356183	ensembl	human	known	69_37n	silent	67	17.28	14	SNP	1.000	C
HECTD1	25831	genome.wustl.edu	37	14	31604763	31604763	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:31604763C>T	ENST00000399332.1	-	21	3661	c.3173G>A	c.(3172-3174)aGa>aAa	p.R1058K	HECTD1_ENST00000553700.1_Missense_Mutation_p.R1058K	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	1058					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TTGTCCTTCTCTTAATTTTCG	0.318																																						dbGAP											0													78.0	74.0	75.0					14																	31604763		1821	4074	5895	-	-	-	SO:0001583	missense	0			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.3173G>A	14.37:g.31604763C>T	ENSP00000382269:p.Arg1058Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	pfam_HECT,pfam_Sad1_UNC_C,pfam_Mib_Herc2,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,superfamily_Galactose-bd-like,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT	p.R1058K	ENST00000399332.1	37	c.3173	CCDS41939.1	14	.	.	.	.	.	.	.	.	.	.	C	16.15	3.042325	0.55003	.	.	ENSG00000092148	ENST00000553700;ENST00000261312;ENST00000399332;ENST00000553957	T;T;T	0.37752	1.18;1.18;1.64	5.47	5.47	0.80525	.	0.000000	0.64402	U	0.000001	T	0.31071	0.0785	N	0.04787	-0.16	0.80722	D	1	B;P	0.44690	0.025;0.841	B;P	0.54210	0.012;0.745	T	0.04029	-1.0983	10	0.06236	T	0.91	-13.2103	19.7014	0.96054	0.0:1.0:0.0:0.0	.	1058;1058	D3DS86;Q9ULT8	.;HECD1_HUMAN	K	1058;1060;1058;532	ENSP00000450697:R1058K;ENSP00000382269:R1058K;ENSP00000451860:R532K	ENSP00000261312:R1060K	R	-	2	0	HECTD1	30674514	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.750000	0.85110	2.729000	0.93468	0.655000	0.94253	AGA	HECTD1	-	NULL	ENSG00000092148		0.318	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	HGNC	protein_coding	OTTHUMT00000409942.1	48	0.00	0	C			31604763	31604763	-1	no_errors	ENST00000399332	ensembl	human	known	69_37n	missense	55	24.66	18	SNP	1.000	T
HIST1H3B	8358	genome.wustl.edu	37	6	26032136	26032136	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:26032136C>T	ENST00000244661.2	-	1	152	c.153G>A	c.(151-153)gaG>gaA	p.E51E		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	51					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						AGCGGCGGATCTCGCGCAGAG	0.627																																						dbGAP											0													57.0	67.0	64.0					6																	26032136		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.153G>A	6.37:g.26032136C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E51	ENST00000244661.2	37	c.153	CCDS4573.1	6																																																																																			HIST1H3B	-	superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000124693		0.627	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	23	0.00	0	C	NM_003537		26032136	26032136	-1	no_errors	ENST00000244661	ensembl	human	known	69_37n	silent	13	23.53	4	SNP	1.000	T
HMGB2	3148	genome.wustl.edu	37	4	174254097	174254097	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:174254097C>T	ENST00000296503.5	-	4	1219	c.346G>A	c.(346-348)Gaa>Aaa	p.E116K	HMGB2_ENST00000438704.2_Missense_Mutation_p.E116K|HMGB2_ENST00000446922.2_Missense_Mutation_p.E116K			P26583	HMGB2_HUMAN	high mobility group box 2	116					apoptotic DNA fragmentation (GO:0006309)|apoptotic process (GO:0006915)|base-excision repair, DNA ligation (GO:0006288)|cell chemotaxis (GO:0060326)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to lipopolysaccharide (GO:0071222)|chromatin organization (GO:0006325)|DNA ligation involved in DNA repair (GO:0051103)|DNA topological change (GO:0006265)|male gonad development (GO:0008584)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive chemotaxis (GO:0050918)|positive regulation of DNA binding (GO:0043388)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of nuclease activity (GO:0032075)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to steroid hormone (GO:0048545)|spermatid nucleus differentiation (GO:0007289)|V(D)J recombination (GO:0033151)	condensed chromosome (GO:0000793)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|protein complex (GO:0043234)	chemoattractant activity (GO:0042056)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|RAGE receptor binding (GO:0050786)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription regulatory region DNA binding (GO:0044212)			endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|urinary_tract(3)	14		Prostate(90;0.0132)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_hematologic(60;0.107)|all_neural(102;0.122)		all cancers(43;9.58e-18)|Epithelial(43;3.75e-16)|OV - Ovarian serous cystadenocarcinoma(60;6.24e-09)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		CCAGGGTGTTCACTTTTGATC	0.428																																						dbGAP											0													138.0	143.0	141.0					4																	174254097		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3816.1	4q31	2011-07-01	2011-04-05	2002-08-16	ENSG00000164104	ENSG00000164104		"""High-mobility group / Canonical"""	5000	protein-coding gene	gene with protein product		163906	"""high-mobility group (nonhistone chromosomal) protein 2"", ""high-mobility group box 2"""	HMG2		1754403	Standard	NM_002129		Approved		uc011ckc.1	P26583	OTTHUMG00000160799	ENST00000296503.5:c.346G>A	4.37:g.174254097C>T	ENSP00000296503:p.Glu116Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R4K8|D3DP37|Q5U072	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E116K	ENST00000296503.5	37	c.346	CCDS3816.1	4	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129092	0.77549	.	.	ENSG00000164104	ENST00000296503;ENST00000446922;ENST00000438704;ENST00000506267	D;D;D;D	0.98474	-4.95;-4.95;-4.95;-4.95	5.06	5.06	0.68205	High mobility group, HMG1/HMG2, subgroup (1);High mobility group, superfamily (1);High mobility group, HMG1/HMG2 (4);	0.081400	0.51477	D	0.000093	D	0.97473	0.9173	L	0.56124	1.755	0.80722	D	1	B	0.25521	0.128	B	0.37239	0.244	D	0.96239	0.9174	10	0.45353	T	0.12	.	18.6138	0.91295	0.0:1.0:0.0:0.0	.	116	P26583	HMGB2_HUMAN	K	116	ENSP00000296503:E116K;ENSP00000393448:E116K;ENSP00000404912:E116K;ENSP00000423001:E116K	ENSP00000296503:E116K	E	-	1	0	HMGB2	174490672	1.000000	0.71417	0.998000	0.56505	0.530000	0.34684	7.416000	0.80143	2.626000	0.88956	0.563000	0.77884	GAA	HMGB2	-	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	ENSG00000164104		0.428	HMGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HMGB2	HGNC	protein_coding	OTTHUMT00000362362.1	88	0.00	0	C	NM_001130688		174254097	174254097	-1	no_errors	ENST00000296503	ensembl	human	known	69_37n	missense	94	27.69	36	SNP	1.000	T
IFIH1	64135	genome.wustl.edu	37	2	163174697	163174697	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:163174697C>G	ENST00000263642.2	-	1	516	c.121G>C	c.(121-123)Gag>Cag	p.E41Q	IFIH1_ENST00000421365.2_Missense_Mutation_p.E41Q|GCA_ENST00000429691.2_5'Flank	NM_022168.3	NP_071451.2	Q9BYX4	IFIH1_HUMAN	interferon induced with helicase C domain 1	41	CARD 1.				cytoplasmic pattern recognition receptor signaling pathway in response to virus (GO:0039528)|detection of virus (GO:0009597)|innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|protein sumoylation (GO:0016925)|regulation of apoptotic process (GO:0042981)|regulation of type III interferon production (GO:0034344)|response to virus (GO:0009615)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|ribonucleoprotein complex binding (GO:0043021)|single-stranded RNA binding (GO:0003727)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(2)|skin(3)|urinary_tract(1)	39						TCCTTCACCTCTGCAGGCAGA	0.557																																						dbGAP											0													79.0	73.0	75.0					2																	163174697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095844	CCDS2217.1	2q24.2	2010-02-09			ENSG00000115267	ENSG00000115267			18873	protein-coding gene	gene with protein product	"""helicard"""	606951					Standard	NM_022168		Approved	MDA-5, Hlcd, MDA5, IDDM19	uc002uce.4	Q9BYX4	OTTHUMG00000132055	ENST00000263642.2:c.121G>C	2.37:g.163174697C>G	ENSP00000263642:p.Glu41Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKL6|Q6DC96|Q86X56|Q96MX8|Q9H3G6	Missense_Mutation	SNP	pfam_RIG-I_C-RD,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_CARD,superfamily_DEATH-like,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E41Q	ENST00000263642.2	37	c.121	CCDS2217.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.899158	0.97081	.	.	ENSG00000115267	ENST00000263642;ENST00000543192;ENST00000421365	T	0.05447	3.44	5.73	5.73	0.89815	.	0.614583	0.17430	N	0.174485	T	0.20577	0.0495	M	0.69823	2.125	0.24168	N	0.995632	D;P	0.53885	0.963;0.716	P;B	0.52957	0.714;0.262	T	0.01405	-1.1363	10	0.72032	D	0.01	-0.359	19.8951	0.96955	0.0:1.0:0.0:0.0	.	41;41	Q9BYX4-2;Q9BYX4	.;IFIH1_HUMAN	Q	41	ENSP00000263642:E41Q	ENSP00000263642:E41Q	E	-	1	0	IFIH1	162882943	0.448000	0.25681	0.027000	0.17364	0.986000	0.74619	3.619000	0.54196	2.694000	0.91930	0.655000	0.94253	GAG	IFIH1	-	NULL	ENSG00000115267		0.557	IFIH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFIH1	HGNC	protein_coding	OTTHUMT00000255078.2	37	0.00	0	C	NM_022168		163174697	163174697	-1	no_errors	ENST00000263642	ensembl	human	known	69_37n	missense	49	12.50	7	SNP	0.385	G
IGSF10	285313	genome.wustl.edu	37	3	151165429	151165429	+	Silent	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:151165429G>T	ENST00000282466.3	-	4	2339	c.2340C>A	c.(2338-2340)ccC>ccA	p.P780P		NM_001178145.1|NM_001178146.1|NM_178822.4	NP_001171616.1|NP_001171617.1|NP_849144.2	Q6WRI0	IGS10_HUMAN	immunoglobulin superfamily, member 10	780					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)	extracellular region (GO:0005576)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(24)|liver(4)|lung(43)|ovary(8)|prostate(4)|skin(9)|stomach(1)|urinary_tract(3)	116			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0517)			TGACCACTGGGGGTGGGCTCA	0.502																																						dbGAP											0													79.0	73.0	75.0					3																	151165429		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY273815	CCDS3160.1	3q25.1	2013-01-11			ENSG00000152580	ENSG00000152580		"""Immunoglobulin superfamily / I-set domain containing"""	26384	protein-coding gene	gene with protein product						12477932	Standard	NM_178822		Approved	FLJ25972, CMF608	uc011bod.2	Q6WRI0	OTTHUMG00000159856	ENST00000282466.3:c.2340C>A	3.37:g.151165429G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86YJ9|Q8N772|Q8NA84	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like	p.P780	ENST00000282466.3	37	c.2340	CCDS3160.1	3																																																																																			IGSF10	-	NULL	ENSG00000152580		0.502	IGSF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF10	HGNC	protein_coding	OTTHUMT00000357782.1	69	0.00	0	G	NM_178822		151165429	151165429	-1	no_errors	ENST00000282466	ensembl	human	known	69_37n	silent	51	28.17	20	SNP	0.000	T
IMP3	55272	genome.wustl.edu	37	15	75932283	75932283	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr15:75932283G>A	ENST00000314852.2	-	2	1170	c.227C>T	c.(226-228)tCg>tTg	p.S76L	IMP3_ENST00000403490.1_Missense_Mutation_p.S76L|CTD-2026K11.2_ENST00000564683.1_RNA|IMP3_ENST00000565349.1_5'Flank			Q8TCT8	SPP2A_HUMAN	IMP3, U3 small nucleolar ribonucleoprotein	0	PA.				membrane protein ectodomain proteolysis (GO:0006509)|membrane protein intracellular domain proteolysis (GO:0031293)|regulation of immune response (GO:0050776)	extracellular vesicular exosome (GO:0070062)|Golgi-associated vesicle membrane (GO:0030660)|integral component of cytoplasmic side of endoplasmic reticulum membrane (GO:0071458)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	aspartic-type endopeptidase activity (GO:0004190)|protein homodimerization activity (GO:0042803)			large_intestine(1)	1						CAGCGCGGCCGAAGCGCGCAC	0.701																																						dbGAP											0													10.0	10.0	10.0					15																	75932283		2115	4169	6284	-	-	-	SO:0001583	missense	0			AB051628	CCDS10282.1	15q24	2014-02-19	2014-02-19	2005-07-14	ENSG00000177971	ENSG00000177971			14497	protein-coding gene	gene with protein product		612980	"""mitochondrial ribosomal protein S4"", ""chromosome 15 open reading frame 12"", ""IMP3, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""	MRPS4, C15orf12		11543634, 12655004	Standard	NM_018285		Approved	FLJ10968, BRMS2	uc010bkl.2	Q9NV31	OTTHUMG00000142840	ENST00000314852.2:c.227C>T	15.37:g.75932283G>A	ENSP00000326981:p.Ser76Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDS0|Q8TAW1|Q96SZ8	Missense_Mutation	SNP	pfam_S4_RNA-bd,pfam_Ribosomal_S4/S9_N,smart_S4_RNA-bd,pfscan_S4_RNA-bd	p.S76L	ENST00000314852.2	37	c.227	CCDS10282.1	15	.	.	.	.	.	.	.	.	.	.	G	21.5	4.160372	0.78226	.	.	ENSG00000177971	ENST00000314852;ENST00000403490	T;T	0.42131	0.98;0.98	6.17	4.31	0.51392	.	0.408745	0.26265	N	0.025367	T	0.26666	0.0652	L	0.29908	0.895	0.41392	D	0.987621	P	0.47253	0.892	B	0.37144	0.242	T	0.07139	-1.0788	10	0.49607	T	0.09	-24.079	8.4996	0.33150	0.1685:0.0:0.8315:0.0	.	76	Q9NV31	IMP3_HUMAN	L	76	ENSP00000326981:S76L;ENSP00000385217:S76L	ENSP00000326981:S76L	S	-	2	0	IMP3	73719338	0.577000	0.26708	0.994000	0.49952	0.918000	0.54935	2.825000	0.48096	1.636000	0.50526	-0.136000	0.14681	TCG	IMP3	-	pfam_Ribosomal_S4/S9_N	ENSG00000177971		0.701	IMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IMP3	HGNC	protein_coding	OTTHUMT00000286476.1	9	0.00	0	G	NM_018285		75932283	75932283	-1	no_errors	ENST00000314852	ensembl	human	known	69_37n	missense	4	55.56	5	SNP	0.975	A
INTS1	26173	genome.wustl.edu	37	7	1542644	1542644	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:1542644G>A	ENST00000404767.3	-	3	327	c.242C>T	c.(241-243)tCc>tTc	p.S81F	INTS1_ENST00000493531.1_5'Flank|INTS1_ENST00000389470.4_Missense_Mutation_p.S209F	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	81					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		GGGTGTGGAGGAGAGTTTGGG	0.647																																						dbGAP											0													75.0	90.0	85.0					7																	1542644		1992	4156	6148	-	-	-	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.242C>T	7.37:g.1542644G>A	ENSP00000385722:p.Ser81Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.S209F	ENST00000404767.3	37	c.626	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	G	24.1	4.493025	0.84962	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.47869	0.83;0.83	4.61	4.61	0.57282	.	0.066739	0.64402	D	0.000008	T	0.47857	0.1468	L	0.36672	1.1	0.49130	D	0.999754	P;P	0.47910	0.902;0.833	P;P	0.47430	0.547;0.45	T	0.53027	-0.8496	10	0.62326	D	0.03	.	17.2056	0.86917	0.0:0.0:1.0:0.0	.	209;81	A4D212;Q8N201	.;INT1_HUMAN	F	81;209	ENSP00000385722:S81F;ENSP00000374121:S209F	ENSP00000374121:S209F	S	-	2	0	INTS1	1509170	1.000000	0.71417	0.998000	0.56505	0.837000	0.47467	7.329000	0.79170	2.374000	0.81015	0.563000	0.77884	TCC	INTS1	-	NULL	ENSG00000164880		0.647	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	54	0.00	0	G			1542644	1542644	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	1.000	A
INTS1	26173	genome.wustl.edu	37	7	1542722	1542722	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:1542722G>C	ENST00000404767.3	-	3	249	c.164C>G	c.(163-165)tCt>tGt	p.S55C	INTS1_ENST00000493531.1_5'Flank|INTS1_ENST00000389470.4_Missense_Mutation_p.S183C	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	55					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CTTGCGCTCAGAAGGCAGGCC	0.647																																						dbGAP											0													57.0	68.0	65.0					7																	1542722		2005	4163	6168	-	-	-	SO:0001583	missense	0			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.164C>G	7.37:g.1542722G>C	ENSP00000385722:p.Ser55Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Missense_Mutation	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.S183C	ENST00000404767.3	37	c.548	CCDS47526.1	7	.	.	.	.	.	.	.	.	.	.	G	25.9	4.688970	0.88735	.	.	ENSG00000164880	ENST00000404767;ENST00000389470	T;T	0.55760	0.51;0.5	4.61	4.61	0.57282	.	0.309442	0.31301	N	0.007886	T	0.60805	0.2297	L	0.46157	1.445	0.44117	D	0.996891	D;D	0.65815	0.991;0.995	P;P	0.55785	0.784;0.619	T	0.65742	-0.6094	10	0.87932	D	0	.	16.3381	0.83073	0.0:0.0:1.0:0.0	.	183;55	A4D212;Q8N201	.;INT1_HUMAN	C	55;183	ENSP00000385722:S55C;ENSP00000374121:S183C	ENSP00000374121:S183C	S	-	2	0	INTS1	1509248	1.000000	0.71417	0.789000	0.31954	0.904000	0.53231	9.052000	0.93855	2.374000	0.81015	0.563000	0.77884	TCT	INTS1	-	NULL	ENSG00000164880		0.647	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	60	0.00	0	G			1542722	1542722	-1	no_errors	ENST00000389470	ensembl	human	known	69_37n	missense	70	18.39	16	SNP	0.914	C
KCNH5	27133	genome.wustl.edu	37	14	63174898	63174898	+	Silent	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:63174898C>A	ENST00000322893.7	-	11	2563	c.2295G>T	c.(2293-2295)ctG>ctT	p.L765L	KCNH5_ENST00000420622.2_3'UTR	NM_139318.3	NP_647479.2	Q8NCM2	KCNH5_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 5	765					potassium ion transmembrane transport (GO:0071805)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	phosphorelay sensor kinase activity (GO:0000155)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(33)|ovary(5)|prostate(2)|skin(17)|upper_aerodigestive_tract(4)|urinary_tract(2)	99				OV - Ovarian serous cystadenocarcinoma(108;0.00958)|BRCA - Breast invasive adenocarcinoma(234;0.168)		TCACATAGGCCAGAGACGTCT	0.512																																						dbGAP											0													110.0	99.0	103.0					14																	63174898		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U69185	CCDS9756.1, CCDS45122.1	14q23.1	2012-07-05			ENSG00000140015	ENSG00000140015		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6254	protein-coding gene	gene with protein product		605716				9738473, 16382104	Standard	NM_139318		Approved	Kv10.2, H-EAG2, eag2	uc001xfx.3	Q8NCM2	OTTHUMG00000029041	ENST00000322893.7:c.2295G>T	14.37:g.63174898C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JP98	Silent	SNP	pfam_Ion_trans_dom,pfam_Ion_trans_2,pfam_cNMP-bd_dom,pfam_PAS_fold,superfamily_cNMP-bd-like,smart_PAC,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,pfscan_PAS-assoc_C,tigrfam_PAS	p.L765	ENST00000322893.7	37	c.2295	CCDS9756.1	14																																																																																			KCNH5	-	NULL	ENSG00000140015		0.512	KCNH5-004	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH5	HGNC	protein_coding	OTTHUMT00000411747.1	60	0.00	0	C	NM_139318		63174898	63174898	-1	no_errors	ENST00000322893	ensembl	human	known	69_37n	silent	69	17.86	15	SNP	1.000	A
KCNQ5	56479	genome.wustl.edu	37	6	73904286	73904286	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:73904286G>A	ENST00000370398.1	+	14	2057	c.1948G>A	c.(1948-1950)Gaa>Aaa	p.E650K	KCNQ5_ENST00000402622.2_Missense_Mutation_p.E660K|KCNQ5_ENST00000355635.3_Missense_Mutation_p.E651K|KCNQ5_ENST00000414165.2_Missense_Mutation_p.E540K|KCNQ5_ENST00000355194.4_Missense_Mutation_p.E650K|KCNQ5_ENST00000342056.2_Missense_Mutation_p.E669K|KCNQ5_ENST00000403813.2_Missense_Mutation_p.E641K	NM_019842.3	NP_062816.2	Q9NR82	KCNQ5_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 5	650					protein complex assembly (GO:0006461)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|inward rectifier potassium channel activity (GO:0005242)			breast(1)|cervix(1)|endometrium(6)|kidney(7)|large_intestine(13)|lung(15)|ovary(4)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	57		all_epithelial(107;0.116)|Lung NSC(302;0.219)		COAD - Colon adenocarcinoma(1;0.0107)|Colorectal(1;0.0583)	Ezogabine(DB04953)	CCCACCTTTTGAATGTGAACA	0.483																																					GBM(142;1375 1859 14391 23261 44706)	dbGAP											0													91.0	87.0	88.0					6																	73904286		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF202977	CCDS4976.1, CCDS55034.1	6q14	2012-07-05			ENSG00000185760	ENSG00000185760		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6299	protein-coding gene	gene with protein product		607357				10787416, 10816588, 16382104	Standard	NM_019842		Approved	Kv7.5	uc011dyh.2	Q9NR82	OTTHUMG00000015020	ENST00000370398.1:c.1948G>A	6.37:g.73904286G>A	ENSP00000359425:p.Glu650Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKT6|A6PVT6|A8MSQ5|B4DS33|B5MC83|B7ZL37|F5GZV0|Q17RE1|Q5VVP3|Q86W40|Q9NRN0|Q9NYA6	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_KCNQ_C,pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl_volt-dep_KCNQ,prints_K_chnl	p.E660K	ENST00000370398.1	37	c.1978	CCDS4976.1	6	.	.	.	.	.	.	.	.	.	.	G	28.1	4.891280	0.91889	.	.	ENSG00000185760	ENST00000342056;ENST00000451840;ENST00000355194;ENST00000370398;ENST00000402622;ENST00000355635;ENST00000403813;ENST00000414165	D;D;D;D;D;D;D	0.99557	-5.92;-5.92;-5.92;-5.92;-5.92;-5.94;-6.16	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	D	0.99396	0.9787	L	0.55481	1.735	0.39807	D	0.972654	D;P;P;D;P	0.63046	0.992;0.935;0.892;0.967;0.946	D;P;P;P;P	0.65874	0.939;0.856;0.459;0.879;0.782	D	0.99683	1.0999	10	0.48119	T	0.1	.	19.3268	0.94265	0.0:0.0:1.0:0.0	.	540;660;669;641;650	F5GZV0;Q9NR82-3;A6PVT6;Q9NR82-2;Q9NR82	.;.;.;.;KCNQ5_HUMAN	K	669;669;650;650;660;651;641;540	ENSP00000345055:E669K;ENSP00000347326:E650K;ENSP00000359425:E650K;ENSP00000385501:E660K;ENSP00000347853:E651K;ENSP00000384453:E641K;ENSP00000409861:E540K	ENSP00000345055:E669K	E	+	1	0	KCNQ5	73961007	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	9.869000	0.99810	2.563000	0.86464	0.561000	0.74099	GAA	KCNQ5	-	NULL	ENSG00000185760		0.483	KCNQ5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KCNQ5	HGNC	protein_coding	OTTHUMT00000041198.3	44	0.00	0	G	NM_019842		73904286	73904286	+1	no_errors	ENST00000402622	ensembl	human	known	69_37n	missense	31	36.00	18	SNP	1.000	A
KIF1B	23095	genome.wustl.edu	37	1	10363841	10363841	+	Intron	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:10363841G>C	ENST00000377086.1	+	22	2317				RN7SL731P_ENST00000584329.1_RNA|KIF1B_ENST00000377083.1_Missense_Mutation_p.Q866H|KIF1B_ENST00000263934.6_Intron|KIF1B_ENST00000377081.1_Intron|KIF1B_ENST00000377093.4_Missense_Mutation_p.Q866H			O60333	KIF1B_HUMAN	kinesin family member 1B						anterograde axon cargo transport (GO:0008089)|apoptotic process (GO:0006915)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule-based movement (GO:0007018)|mitochondrion transport along microtubule (GO:0047497)|neuromuscular synaptic transmission (GO:0007274)|neuron-neuron synaptic transmission (GO:0007270)|vesicle-mediated transport (GO:0016192)	cytoplasmic vesicle (GO:0031410)|cytoplasmic vesicle membrane (GO:0030659)|kinesin complex (GO:0005871)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinesin binding (GO:0019894)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|endometrium(7)|kidney(8)|large_intestine(9)|lung(29)|ovary(3)|prostate(3)|skin(5)|stomach(3)|upper_aerodigestive_tract(2)	71	Ovarian(185;0.203)	all_lung(284;1.31e-05)|Lung NSC(185;2.2e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.0228)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0259)|Colorectal(212;9.79e-07)|COAD - Colon adenocarcinoma(227;0.000143)|BRCA - Breast invasive adenocarcinoma(304;0.000413)|Kidney(185;0.00134)|KIRC - Kidney renal clear cell carcinoma(229;0.0037)|STAD - Stomach adenocarcinoma(132;0.0113)|READ - Rectum adenocarcinoma(331;0.0642)		CTCAGGAACAGAAAAGCCCAG	0.398																																						dbGAP											0													40.0	44.0	43.0					1																	10363841		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF257176	CCDS111.1, CCDS112.1	1p36.22	2014-09-17			ENSG00000054523	ENSG00000054523		"""Kinesins"", ""Pleckstrin homology (PH) domain containing"""	16636	protein-coding gene	gene with protein product		605995		CMT2A, CMT2		11389829, 10762626	Standard	NM_015074		Approved	KIAA0591, KLP, HMSNII	uc001aqw.4	O60333	OTTHUMG00000001817	ENST00000377086.1:c.2115+6537G>C	1.37:g.10363841G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS8|A6NKQ4|Q4VXC3|Q4VXC4|Q4VXC5|Q4VXC6|Q96Q94|Q9BV80|Q9P280	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_Kinesin_motor_dom,smart_FHA_dom,pfscan_FHA_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q866H	ENST00000377086.1	37	c.2598		1	.	.	.	.	.	.	.	.	.	.	G	8.375	0.836159	0.16891	.	.	ENSG00000054523	ENST00000377093;ENST00000377083	T;T	0.75260	-0.92;-0.92	5.58	4.66	0.58398	.	.	.	.	.	T	0.67059	0.2853	.	.	.	0.80722	D	1	B	0.13145	0.007	B	0.10450	0.005	T	0.64769	-0.6329	8	0.62326	D	0.03	.	11.9053	0.52708	0.0837:0.0:0.9163:0.0	.	866	O60333-3	.	H	866	ENSP00000366297:Q866H;ENSP00000366287:Q866H	ENSP00000366287:Q866H	Q	+	3	2	KIF1B	10286428	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.305000	0.33493	1.348000	0.45733	0.655000	0.94253	CAG	KIF1B	-	NULL	ENSG00000054523		0.398	KIF1B-001	NOVEL	basic	protein_coding	KIF1B	HGNC	protein_coding	OTTHUMT00000005102.1	25	0.00	0	G			10363841	10363841	+1	no_errors	ENST00000377083	ensembl	human	known	69_37n	missense	10	41.18	7	SNP	1.000	C
KIF20B	9585	genome.wustl.edu	37	10	91503681	91503681	+	Silent	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:91503681C>G	ENST00000371728.3	+	22	4097	c.4032C>G	c.(4030-4032)ctC>ctG	p.L1344L	KIF20B_ENST00000260753.4_Silent_p.L1304L|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000394289.2_Silent_p.L1344L|KIF20B_ENST00000416354.1_Silent_p.L1374L	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1344					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						TTCAGCAACTCAAGGTAAACA	0.289																																						dbGAP											0													77.0	87.0	84.0					10																	91503681		2202	4298	6500	-	-	-	SO:0001819	synonymous_variant	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4032C>G	10.37:g.91503681C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L1374	ENST00000371728.3	37	c.4122		10																																																																																			KIF20B	-	NULL	ENSG00000138182		0.289	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	55	0.00	0	C	NM_016195		91503681	91503681	+1	no_errors	ENST00000416354	ensembl	human	known	69_37n	silent	61	14.08	10	SNP	0.975	G
KRT74	121391	genome.wustl.edu	37	12	52962061	52962061	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr12:52962061T>A	ENST00000305620.2	-	7	1294	c.1247A>T	c.(1246-1248)gAg>gTg	p.E416V	KRT74_ENST00000549343.1_Missense_Mutation_p.E430V	NM_175053.3	NP_778223.2	Q7RTS7	K2C74_HUMAN	keratin 74	416	Coil 2.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	keratin filament binding (GO:1990254)|structural molecule activity (GO:0005198)			kidney(2)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	28				BRCA - Breast invasive adenocarcinoma(357;0.191)		CGCCAGCTCCTCCTTGGCCTG	0.652																																						dbGAP											0													80.0	72.0	75.0					12																	52962061		2203	4298	6501	-	-	-	SO:0001583	missense	0			BK000977	CCDS8832.1	12q13.13	2013-06-25			ENSG00000170484	ENSG00000170484		"""-"", ""Intermediate filaments type II, keratins (basic)"""	28929	protein-coding gene	gene with protein product		608248				12648212, 16831889	Standard	NM_175053		Approved	K6IRS4, KRT5C, KRT6IRS4	uc001sap.1	Q7RTS7	OTTHUMG00000169658	ENST00000305620.2:c.1247A>T	12.37:g.52962061T>A	ENSP00000307240:p.Glu416Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MD61|Q86Y45	Missense_Mutation	SNP	pfam_F,prints_Keratin_II	p.E416V	ENST00000305620.2	37	c.1247	CCDS8832.1	12	.	.	.	.	.	.	.	.	.	.	T	23.1	4.379884	0.82682	.	.	ENSG00000170484	ENST00000549343;ENST00000305620	D;D	0.89552	-2.53;-2.53	4.57	3.42	0.39159	Filament (1);	0.220616	0.23219	N	0.050585	D	0.94719	0.8296	M	0.91663	3.23	0.44643	D	0.997628	D	0.71674	0.998	D	0.74674	0.984	D	0.94373	0.7597	10	0.87932	D	0	.	10.3776	0.44092	0.0:0.0793:0.0:0.9206	.	416	Q7RTS7	K2C74_HUMAN	V	430;416	ENSP00000447447:E430V;ENSP00000307240:E416V	ENSP00000307240:E416V	E	-	2	0	KRT74	51248328	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.154000	0.58125	0.856000	0.35383	0.533000	0.62120	GAG	KRT74	-	pfam_F	ENSG00000170484		0.652	KRT74-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT74	HGNC	protein_coding	OTTHUMT00000405324.1	57	0.00	0	T	NM_175053		52962061	52962061	-1	no_errors	ENST00000305620	ensembl	human	known	69_37n	missense	56	24.32	18	SNP	1.000	A
LILRA2	11027	genome.wustl.edu	37	19	55086371	55086371	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:55086371T>A	ENST00000251377.3	+	5	659	c.526T>A	c.(526-528)Tcc>Acc	p.S176T	LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000391738.3_Missense_Mutation_p.S176T|LILRA2_ENST00000495786.1_3'UTR|LILRA2_ENST00000391737.1_Missense_Mutation_p.S164T|LILRB1_ENST00000418536.2_Intron|LILRA2_ENST00000251376.3_Missense_Mutation_p.S176T|LILRB1_ENST00000448689.1_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	176	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCGTGGGTGGTCCTGGGCCAT	0.567																																						dbGAP											0													167.0	154.0	159.0					19																	55086371		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.526T>A	19.37:g.55086371T>A	ENSP00000251377:p.Ser176Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	O75020	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.S176T	ENST00000251377.3	37	c.526	CCDS46179.1	19	.	.	.	.	.	.	.	.	.	.	T	10.29	1.309938	0.23821	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	T;T;T;T;T	0.03330	3.97;3.97;3.97;3.97;3.97	2.4	-3.72	0.04411	Immunoglobulin-like fold (1);	2.625940	0.01171	N	0.006877	T	0.10294	0.0252	M	0.76002	2.32	0.09310	N	1	B;P;B;D	0.60160	0.005;0.58;0.053;0.987	B;B;B;P	0.57101	0.005;0.275;0.073;0.813	T	0.40496	-0.9560	10	0.22109	T	0.4	.	3.4974	0.07659	0.3411:0.0:0.334:0.3249	.	176;164;176;176	E9PDF4;A8MZH0;Q8N149;Q8N149-2	.;.;LIRA2_HUMAN;.	T	176;176;176;176;164	ENSP00000388131:S176T;ENSP00000251377:S176T;ENSP00000375618:S176T;ENSP00000251376:S176T;ENSP00000375617:S164T	ENSP00000251376:S176T	S	+	1	0	LILRA2	59778183	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-1.565000	0.02150	-1.039000	0.03275	0.416000	0.27883	TCC	LILRA2	-	smart_Ig_sub,pirsf_A1B_glyco/leuk_Ig-like_rcpt	ENSG00000239998		0.567	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	77	0.00	0	T			55086371	55086371	+1	no_errors	ENST00000251377	ensembl	human	known	69_37n	missense	113	19.86	28	SNP	0.000	A
LONRF3	79836	genome.wustl.edu	37	X	118123497	118123497	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:118123497G>C	ENST00000371628.3	+	4	1217	c.1186G>C	c.(1186-1188)Gaa>Caa	p.E396Q	LONRF3_ENST00000422289.2_Missense_Mutation_p.E140Q|LONRF3_ENST00000304778.7_Missense_Mutation_p.E355Q|LONRF3_ENST00000472173.1_3'UTR	NM_001031855.1	NP_001027026.1	Q496Y0	LONF3_HUMAN	LON peptidase N-terminal domain and ring finger 3	396							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	36						AGACCAGGAAGAAGAGGAGGA	0.512																																						dbGAP											0													97.0	72.0	81.0					X																	118123497		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026265	CCDS14575.1, CCDS35374.1, CCDS76014.1	Xq24	2013-01-09	2005-08-19	2005-08-19	ENSG00000175556	ENSG00000175556		"""RING-type (C3HC4) zinc fingers"""	21152	protein-coding gene	gene with protein product			"""ring finger protein 127"""	RNF127			Standard	XM_005262476		Approved	FLJ22612	uc004eqw.3	Q496Y0	OTTHUMG00000022262	ENST00000371628.3:c.1186G>C	X.37:g.118123497G>C	ENSP00000360690:p.Glu396Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JPN6|Q8NB00|Q9H647	Missense_Mutation	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_TPR_repeat,smart_Znf_RING,smart_Pept_S16_N,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.E396Q	ENST00000371628.3	37	c.1186	CCDS35374.1	X	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.078|9.078	0.998555|0.998555	0.19121|0.19121	.|.	.|.	ENSG00000175556|ENSG00000175556	ENST00000365713;ENST00000304778;ENST00000371628;ENST00000422289|ENST00000439603	D;D;T;D|.	0.84660|.	-1.5;-1.5;-1.27;-1.88|.	4.51|4.51	2.71|2.71	0.32032|0.32032	.|.	1.305430|.	0.05375|.	N|.	0.536170|.	T|T	0.22205|0.22205	0.0535|0.0535	N|N	0.19112|0.19112	0.55|0.55	0.09310|0.09310	N|N	1|1	B;B;B|.	0.19331|.	0.035;0.007;0.001|.	B;B;B|.	0.20955|.	0.032;0.012;0.004|.	T|T	0.19095|0.19095	-1.0316|-1.0316	10|5	0.18710|.	T|.	0.47|.	-5.1688|-5.1688	5.3241|5.3241	0.15896|0.15896	0.2588:0.0:0.7412:0.0|0.2588:0.0:0.7412:0.0	.|.	140;355;396|.	B3KUN7;Q496Y0-2;Q496Y0|.	.;.;LONF3_HUMAN|.	Q|T	355;355;396;140|161	ENSP00000360691:E355Q;ENSP00000307732:E355Q;ENSP00000360690:E396Q;ENSP00000408894:E140Q|.	ENSP00000307732:E355Q|.	E|R	+|+	1|2	0|0	LONRF3|LONRF3	118007525|118007525	0.000000|0.000000	0.05858|0.05858	0.001000|0.001000	0.08648|0.08648	0.016000|0.016000	0.09150|0.09150	0.273000|0.273000	0.18662|0.18662	0.980000|0.980000	0.38523|0.38523	0.513000|0.513000	0.50165|0.50165	GAA|AGA	LONRF3	-	NULL	ENSG00000175556		0.512	LONRF3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF3	HGNC	protein_coding	OTTHUMT00000355124.2	45	0.00	0	G	NM_024778		118123497	118123497	+1	no_errors	ENST00000371628	ensembl	human	known	69_37n	missense	57	17.39	12	SNP	0.000	C
LRRFIP2	9209	genome.wustl.edu	37	3	37114317	37114317	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:37114317G>A	ENST00000336686.4	-	21	1508	c.1428C>T	c.(1426-1428)ctC>ctT	p.L476L	LRRFIP2_ENST00000440230.1_Intron|LRRFIP2_ENST00000421307.1_Silent_p.L476L|LRRFIP2_ENST00000354379.4_Intron|LRRFIP2_ENST00000396428.2_Silent_p.L292L|LRRFIP2_ENST00000421276.2_Intron			Q9Y608	LRRF2_HUMAN	leucine rich repeat (in FLII) interacting protein 2	476					Wnt signaling pathway (GO:0016055)		LRR domain binding (GO:0030275)	p.0?(1)		breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(4)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	22						GTGTCTCCTGGAGGTCAAACA	0.408																																						dbGAP											1	Whole gene deletion(1)	ovary(1)											115.0	119.0	118.0					3																	37114317		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF115509	CCDS2664.1, CCDS2665.1, CCDS46791.1, CCDS63592.1	3p22.1	2008-07-18			ENSG00000093167	ENSG00000093167			6703	protein-coding gene	gene with protein product		614043				10366446	Standard	NM_017724		Approved	HUFI-2	uc003cgp.2	Q9Y608	OTTHUMG00000130796	ENST00000336686.4:c.1428C>T	3.37:g.37114317G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K649|A8MXR0|B4DY63|Q68CV3|Q9NXH5	Silent	SNP	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd,superfamily_Prefoldin	p.L476	ENST00000336686.4	37	c.1428	CCDS2664.1	3																																																																																			LRRFIP2	-	pfam_Leu-rich_rep_flightless-int_pr,superfamily_HLH_DNA-bd	ENSG00000093167		0.408	LRRFIP2-001	KNOWN	basic|CCDS	protein_coding	LRRFIP2	HGNC	protein_coding	OTTHUMT00000253335.3	93	0.00	0	G	NM_006309		37114317	37114317	-1	no_errors	ENST00000336686	ensembl	human	known	69_37n	silent	74	31.82	35	SNP	1.000	A
MADD	8567	genome.wustl.edu	37	11	47345270	47345270	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:47345270G>C	ENST00000311027.5	+	31	4591	c.4426G>C	c.(4426-4428)Gag>Cag	p.E1476Q	MADD_ENST00000407859.3_Missense_Mutation_p.E1394Q|MADD_ENST00000395336.3_Missense_Mutation_p.E1476Q|MADD_ENST00000349238.3_Missense_Mutation_p.E1437Q|MADD_ENST00000405573.2_Missense_Mutation_p.E286Q|MADD_ENST00000402799.1_Missense_Mutation_p.E1374Q|MADD_ENST00000402192.2_Missense_Mutation_p.E1416Q|MADD_ENST00000342922.4_Missense_Mutation_p.E1417Q|MADD_ENST00000406482.1_Missense_Mutation_p.E1374Q|MADD_ENST00000395344.3_Missense_Mutation_p.E1370Q	NM_003682.3	NP_003673.3			MAP-kinase activating death domain											breast(7)|central_nervous_system(2)|endometrium(9)|kidney(3)|large_intestine(19)|lung(26)|ovary(6)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	84				Lung(87;0.182)		AACAGTGTATGAGCGCTGGTG	0.527																																						dbGAP											0													235.0	174.0	194.0					11																	47345270		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB002356	CCDS7930.1, CCDS7931.1, CCDS7932.1, CCDS41642.1, CCDS44586.1, CCDS44587.1, CCDS44588.1, CCDS44589.1, CCDS44590.1	11p11.2	2012-10-04			ENSG00000110514	ENSG00000110514		"""DENN/MADD domain containing"""	6766	protein-coding gene	gene with protein product		603584				9115275, 9796103	Standard	NM_130476		Approved	DENN, KIAA0358, RAB3GEP	uc001ner.1	Q8WXG6	OTTHUMG00000150350	ENST00000311027.5:c.4426G>C	11.37:g.47345270G>C	ENSP00000310933:p.Glu1476Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.E1476Q	ENST00000311027.5	37	c.4426	CCDS7930.1	11	.	.	.	.	.	.	.	.	.	.	G	34	5.292184	0.95546	.	.	ENSG00000110514	ENST00000342922;ENST00000395342;ENST00000402799;ENST00000406482;ENST00000349238;ENST00000311027;ENST00000407859;ENST00000395344;ENST00000395336;ENST00000402192;ENST00000405573	T;T;T;T;T;T;T;T;T;T	0.52983	3.15;3.02;3.03;3.14;3.16;3.02;3.02;3.16;3.15;0.64	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.66317	0.2777	L	0.52573	1.65	0.80722	D	1	D;D;D;D;D;D;D;D;D;D;D	0.89917	0.999;1.0;1.0;0.999;1.0;1.0;1.0;0.998;0.999;0.998;0.998	D;D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.997;0.997;0.998;0.999;0.999;0.999;0.998;0.997;0.995;0.997	T	0.66937	-0.5797	10	0.87932	D	0	-23.2827	19.903	0.96995	0.0:0.0:1.0:0.0	.	286;1370;1370;1476;1374;1374;1374;1437;1394;1476;1417	F8W8U2;B5MEE5;A8K8S7;Q8WXG6-7;F8W9P9;Q8WXG6-6;Q8WXG6-5;Q8WXG6-2;Q8WXG6-4;Q8WXG6;Q8WXG6-3	.;.;.;.;.;.;.;.;.;MADD_HUMAN;.	Q	1417;1374;1374;1374;1437;1476;1394;1370;1476;1416;286	ENSP00000343902:E1417Q;ENSP00000385585:E1374Q;ENSP00000384435:E1374Q;ENSP00000304505:E1437Q;ENSP00000310933:E1476Q;ENSP00000384204:E1394Q;ENSP00000378753:E1370Q;ENSP00000378745:E1476Q;ENSP00000384287:E1416Q;ENSP00000384483:E286Q	ENSP00000310933:E1476Q	E	+	1	0	MADD	47301846	1.000000	0.71417	0.999000	0.59377	0.992000	0.81027	8.947000	0.93000	2.705000	0.92388	0.549000	0.68633	GAG	MADD	-	NULL	ENSG00000110514		0.527	MADD-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MADD	HGNC	protein_coding	OTTHUMT00000317746.1	40	0.00	0	G			47345270	47345270	+1	no_errors	ENST00000311027	ensembl	human	known	69_37n	missense	57	22.97	17	SNP	1.000	C
MAGEB16	139604	genome.wustl.edu	37	X	35820374	35820374	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:35820374G>A	ENST00000399989.1	+	2	340	c.61G>A	c.(61-63)Gag>Aag	p.E21K	MAGEB16_ENST00000399992.1_Missense_Mutation_p.E53K|MAGEB16_ENST00000399988.1_Missense_Mutation_p.E21K|MAGEB16_ENST00000399985.1_Missense_Mutation_p.E21K|MAGEB16_ENST00000399987.1_Missense_Mutation_p.E21K	NM_001099921.1	NP_001093391.1	A2A368	MAGBG_HUMAN	melanoma antigen family B, 16	21										breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(16)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31						GACCTTCAGTGAGACCCAGAG	0.567																																						dbGAP											0													46.0	47.0	47.0					X																	35820374		2084	4195	6279	-	-	-	SO:0001583	missense	0				CCDS43927.1	Xp21.1	2010-05-26	2005-11-07		ENSG00000189023	ENSG00000189023			21188	protein-coding gene	gene with protein product		300762	"""melanoma antigen family B, 16 (pseudogene)"""			11454705	Standard	NM_001099921		Approved		uc010ngt.1	A2A368	OTTHUMG00000021348	ENST00000399989.1:c.61G>A	X.37:g.35820374G>A	ENSP00000382871:p.Glu21Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MU30	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E53K	ENST00000399989.1	37	c.157	CCDS43927.1	X	.	.	.	.	.	.	.	.	.	.	G	10.60	1.396112	0.25205	.	.	ENSG00000189023	ENST00000399988;ENST00000399992;ENST00000399987;ENST00000399989;ENST00000399985	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	3.02	0.214	0.15249	Melanoma associated antigen, MAGE, N-terminal (1);	1.455540	0.04095	N	0.312002	T	0.23532	0.0569	M	0.73962	2.25	0.09310	N	1	P	0.38535	0.635	P	0.44811	0.461	T	0.24333	-1.0163	10	0.48119	T	0.1	.	5.3514	0.16038	0.4246:0.0:0.5754:0.0	.	21	A2A368	MAGBG_HUMAN	K	21;53;21;21;21	ENSP00000382870:E21K;ENSP00000382874:E53K;ENSP00000382869:E21K;ENSP00000382871:E21K;ENSP00000382867:E21K	ENSP00000382867:E21K	E	+	1	0	MAGEB16	35730295	0.000000	0.05858	0.001000	0.08648	0.032000	0.12392	-0.538000	0.06120	-0.061000	0.13110	-0.367000	0.07326	GAG	MAGEB16	-	pfam_Melanoma_ass_antigen_N	ENSG00000189023		0.567	MAGEB16-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB16	HGNC	protein_coding	OTTHUMT00000251034.1	19	0.00	0	G			35820374	35820374	+1	no_errors	ENST00000399992	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	0.001	A
MAP4K3	8491	genome.wustl.edu	37	2	39553347	39553347	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:39553347C>A	ENST00000263881.3	-	9	926	c.602G>T	c.(601-603)gGa>gTa	p.G201V	MAP4K3_ENST00000536018.1_5'Flank|RP11-449G16.1_ENST00000609671.1_RNA|MAP4K3_ENST00000341681.5_Missense_Mutation_p.G201V|MAP4K3_ENST00000437545.1_Missense_Mutation_p.G138V	NM_003618.3	NP_003609.2	Q8IVH8	M4K3_HUMAN	mitogen-activated protein kinase kinase kinase kinase 3	201	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)|JNK cascade (GO:0007254)|protein phosphorylation (GO:0006468)|response to tumor necrosis factor (GO:0034612)|response to UV (GO:0009411)		ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			NS(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	44		all_hematologic(82;0.211)				GGCAGTGATTCCCACTGCCCA	0.428																																						dbGAP											0													122.0	122.0	122.0					2																	39553347		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF000145	CCDS1803.1, CCDS58707.1	2p22.3	2011-06-09			ENSG00000011566	ENSG00000011566		"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6865	protein-coding gene	gene with protein product		604921		RAB8IPL1		9275185	Standard	NM_003618		Approved	GLK, MAPKKKK3	uc002rro.4	Q8IVH8	OTTHUMG00000102127	ENST00000263881.3:c.602G>T	2.37:g.39553347C>A	ENSP00000263881:p.Gly201Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IQ39|Q8IVH7|Q9UDM5|Q9Y6R5	Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.E128*	ENST00000263881.3	37	c.382	CCDS1803.1	2	.	.	.	.	.	.	.	.	.	.	C	37	6.479375	0.97598	.	.	ENSG00000011566	ENST00000263881;ENST00000437545;ENST00000341681	T;T;T	0.72725	-0.68;-0.65;-0.68	5.68	5.68	0.88126	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.92499	0.7618	H	0.99825	4.815	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.95753	0.8793	9	.	.	.	.	19.7775	0.96400	0.0:1.0:0.0:0.0	.	201;201	Q8IVH8-3;Q8IVH8	.;M4K3_HUMAN	V	201;138;201	ENSP00000263881:G201V;ENSP00000416958:G138V;ENSP00000345434:G201V	.	G	-	2	0	MAP4K3	39406851	1.000000	0.71417	0.958000	0.39756	0.950000	0.60333	7.631000	0.83237	2.668000	0.90789	0.585000	0.79938	GGA	MAP4K3	-	smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	ENSG00000011566		0.428	MAP4K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP4K3	HGNC	protein_coding	OTTHUMT00000219966.2	37	0.00	0	C	NM_003618		39553347	39553347	-1	no_errors	ENST00000429397	ensembl	human	known	69_37n	nonsense	56	27.27	21	SNP	1.000	A
MCM4	4173	genome.wustl.edu	37	8	48875562	48875562	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:48875562G>C	ENST00000262105.2	+	6	864	c.655G>C	c.(655-657)Gac>Cac	p.D219H	PRKDC_ENST00000523565.1_5'Flank|PRKDC_ENST00000338368.3_5'Flank|MCM4_ENST00000523944.1_Missense_Mutation_p.D219H|PRKDC_ENST00000314191.2_5'Flank	NM_005914.3	NP_005905.2	P33991	MCM4_HUMAN	minichromosome maintenance complex component 4	219					DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)	MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			biliary_tract(1)|breast(1)|endometrium(7)|kidney(4)|large_intestine(5)|lung(16)|ovary(2)|prostate(3)|skin(3)|urinary_tract(2)	44		all_cancers(86;0.026)|all_epithelial(80;0.000748)|Lung NSC(129;0.00327)|all_lung(136;0.00354)				CAAATCATTTGACAAAAATTT	0.289																																						dbGAP											0													56.0	61.0	60.0					8																	48875562		2202	4299	6501	-	-	-	SO:0001583	missense	0				CCDS6143.1	8q12-q13	2008-02-05	2007-04-04		ENSG00000104738	ENSG00000104738			6947	protein-coding gene	gene with protein product		602638	"""MCM4 minichromosome maintenance deficient 4 (S. cerevisiae)"""	CDC21		7601140	Standard	NM_005914		Approved	CDC54, hCdc21, P1-Cdc21, MGC33310	uc003xql.2	P33991	OTTHUMG00000164205	ENST00000262105.2:c.655G>C	8.37:g.48875562G>C	ENSP00000262105:p.Asp219His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NEH1|Q99658	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_4,prints_MCM_DNA-dep_ATPase	p.D219H	ENST00000262105.2	37	c.655	CCDS6143.1	8	.	.	.	.	.	.	.	.	.	.	G	17.14	3.314422	0.60524	.	.	ENSG00000104738	ENST00000523944;ENST00000262105;ENST00000396826;ENST00000429229;ENST00000519170	T;T;T	0.05580	3.42;3.42;3.42	5.64	4.76	0.60689	Nucleic acid-binding, OB-fold-like (1);	0.087518	0.85682	D	0.000000	T	0.19005	0.0456	H	0.94423	3.535	0.80722	D	1	B;B	0.26635	0.155;0.155	B;B	0.27262	0.078;0.078	T	0.03493	-1.1031	10	0.51188	T	0.08	-10.977	15.0111	0.71550	0.0695:0.0:0.9305:0.0	.	219;219	B3KMX0;P33991	.;MCM4_HUMAN	H	219;219;206;179;169	ENSP00000430194:D219H;ENSP00000262105:D219H;ENSP00000428833:D169H	ENSP00000262105:D219H	D	+	1	0	MCM4	49038115	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.976000	0.70484	1.368000	0.46115	0.462000	0.41574	GAC	MCM4	-	superfamily_NA-bd_OB-fold-like	ENSG00000104738		0.289	MCM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM4	HGNC	protein_coding	OTTHUMT00000377791.1	55	0.00	0	G	NM_005914		48875562	48875562	+1	no_errors	ENST00000262105	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	1.000	C
MCTP1	79772	genome.wustl.edu	37	5	94267685	94267685	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:94267685C>T	ENST00000515393.1	-	6	1184	c.1185G>A	c.(1183-1185)atG>atA	p.M395I	MCTP1_ENST00000505208.1_Missense_Mutation_p.M174I|MCTP1_ENST00000312216.8_Missense_Mutation_p.M174I|MCTP1_ENST00000505078.1_5'Flank|MCTP1_ENST00000429576.2_Missense_Mutation_p.M174I	NM_024717.4	NP_078993.4	Q6DN14	MCTP1_HUMAN	multiple C2 domains, transmembrane 1	395					calcium-mediated signaling (GO:0019722)	integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(13)|liver(2)|lung(13)|ovary(2)|skin(4)|stomach(2)|urinary_tract(1)	41		all_cancers(142;1.68e-05)|all_epithelial(76;1.51e-07)|all_lung(232;0.0167)|Lung NSC(167;0.0207)|Ovarian(225;0.0218)|Colorectal(57;0.207)		all cancers(79;9.1e-17)		AACTCTTCCTCATTAGCATTG	0.353																																						dbGAP											0													170.0	170.0	170.0					5																	94267685		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34203.1, CCDS47247.1, CCDS75275.1	5q15	2008-02-05			ENSG00000175471	ENSG00000175471			26183	protein-coding gene	gene with protein product						15528213	Standard	XM_005272082		Approved	FLJ22344	uc003kkx.2	Q6DN14	OTTHUMG00000162742	ENST00000515393.1:c.1185G>A	5.37:g.94267685C>T	ENSP00000424126:p.Met395Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6DN13|Q8N2W1|Q8NBA2|Q96LX0|Q9H6E8	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PRibTrfase_C,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.M395I	ENST00000515393.1	37	c.1185	CCDS34203.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.30|13.30	2.194963|2.194963	0.38806|0.38806	.|.	.|.	ENSG00000175471|ENSG00000175471	ENST00000503301|ENST00000515393;ENST00000429576;ENST00000312216;ENST00000512425;ENST00000505208;ENST00000415885;ENST00000514780	.|T;T;T;T;T;T	.|0.76968	.|-1.05;-0.7;-0.89;-0.83;-1.01;-1.06	5.76|5.76	5.76|5.76	0.90799|0.90799	.|.	.|0.091160	.|0.85682	.|D	.|0.000000	T|T	0.69052|0.69052	0.3068|0.3068	L|L	0.29908|0.29908	0.895|0.895	0.53688|0.53688	D|D	0.999974|0.999974	.|B;B;B	.|0.06786	.|0.001;0.0;0.0	.|B;B;B	.|0.06405	.|0.002;0.001;0.002	T|T	0.61222|0.61222	-0.7106|-0.7106	5|10	.|0.23891	.|T	.|0.37	-26.0761|-26.0761	18.5232|18.5232	0.90962|0.90962	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|395;174;174	.|Q6DN14;Q6DN14-3;Q6DN14-2	.|MCTP1_HUMAN;.;.	K|I	204|395;174;174;56;174;136;155	.|ENSP00000424126:M395I;ENSP00000391639:M174I;ENSP00000308957:M174I;ENSP00000431075:M56I;ENSP00000426438:M174I;ENSP00000421543:M155I	.|ENSP00000308957:M174I	E|M	-|-	1|3	0|0	MCTP1|MCTP1	94293441|94293441	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	6.130000|6.130000	0.71663|0.71663	2.880000|2.880000	0.98712|0.98712	0.650000|0.650000	0.86243|0.86243	GAG|ATG	MCTP1	-	NULL	ENSG00000175471		0.353	MCTP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MCTP1	HGNC	protein_coding	OTTHUMT00000370280.3	69	0.00	0	C	NM_024717		94267685	94267685	-1	no_errors	ENST00000515393	ensembl	human	known	69_37n	missense	69	26.60	25	SNP	1.000	T
SEPT6	23157	genome.wustl.edu	37	X	118780729	118780729	+	Intron	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:118780729G>A	ENST00000343984.5	-	5	955				SEPT6_ENST00000360156.7_Intron|SEPT6_ENST00000394616.4_Intron|SEPT6_ENST00000394610.1_Intron|SEPT6_ENST00000354228.4_Intron|MIR766_ENST00000390223.1_RNA|SEPT6_ENST00000354416.3_Intron|SEPT6_ENST00000394617.2_Intron|SEPT6_ENST00000489216.1_Intron	NM_015129.5	NP_055944.2	Q14141	SEPT6_HUMAN	septin 6						cytokinesis (GO:0000910)|viral process (GO:0016032)	axon terminus (GO:0043679)|kinetochore (GO:0000776)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)	GTP binding (GO:0005525)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(3)	17						TGGGGTGGCTGAGGCTGTGGG	0.527			T	MLL	AML																																	dbGAP		Dom	yes		X	Xq24	23157	septin 6		L	0													45.0	40.0	42.0					X																	118780729		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			D50918	CCDS14583.1, CCDS14584.1, CCDS14585.1	Xq24	2013-01-21			ENSG00000125354	ENSG00000125354		"""Septins"""	15848	protein-coding gene	gene with protein product		300683				8590280, 10744683	Standard	NM_015129		Approved	KIAA0128, SEP2, SEPT2, MGC16619, MGC20339	uc004erv.3	Q14141	OTTHUMG00000022280	ENST00000343984.5:c.690+3170C>T	X.37:g.118780729G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JTK0|Q969W5|Q96A13|Q96GR1|Q96P86|Q96P87	RNA	SNP	-	NULL	ENST00000343984.5	37	NULL	CCDS14584.1	X																																																																																			MIR766	-	-	ENSG00000211578		0.527	SEPT6-001	KNOWN	basic|CCDS	protein_coding	MIR766	HGNC	protein_coding	OTTHUMT00000058059.1	72	0.00	0	G	NM_145802		118780729	118780729	-1	no_errors	ENST00000390223	ensembl	human	known	69_37n	rna	79	23.30	24	SNP	0.016	A
MMRN1	22915	genome.wustl.edu	37	4	90857679	90857679	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:90857679A>G	ENST00000394980.1	+	7	3167	c.2848A>G	c.(2848-2850)Aaa>Gaa	p.K950E	MMRN1_ENST00000394981.1_Intron|MMRN1_ENST00000508372.1_Missense_Mutation_p.K692E|MMRN1_ENST00000264790.2_Missense_Mutation_p.K950E			Q13201	MMRN1_HUMAN	multimerin 1	950					blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|platelet alpha granule lumen (GO:0031093)				breast(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|liver(2)|lung(34)|ovary(5)|prostate(1)|skin(6)|stomach(1)|urinary_tract(2)	72		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;6.96e-05)		TAAGTGGATAAAACATTCCCT	0.363																																						dbGAP											0													66.0	66.0	66.0					4																	90857679		2203	4299	6502	-	-	-	SO:0001583	missense	0			U27109	CCDS3635.1	4q22	2008-02-05	2004-03-02	2004-03-02	ENSG00000138722	ENSG00000138722		"""EMI domain containing"""	7178	protein-coding gene	gene with protein product	"""glycoprotein Ia*"""	601456	"""multimerin"""	MMRN		7629143, 10828608	Standard	NM_007351		Approved	ECM, EMILIN4, GPIa*	uc003hst.3	Q13201	OTTHUMG00000130947	ENST00000394980.1:c.2848A>G	4.37:g.90857679A>G	ENSP00000378431:p.Lys950Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4W5L1|Q6P3T8|Q6ZUL9	Missense_Mutation	SNP	pfam_C1q,pfam_EMI_domain,pfam_EGF-like_dom,superfamily_Tumour_necrosis_fac-like,smart_EGF-like,smart_EGF-like_Ca-bd,smart_C1q,pfscan_C1q,pfscan_EG-like_dom,pfscan_EMI_domain,prints_C1q	p.K950E	ENST00000394980.1	37	c.2848	CCDS3635.1	4	.	.	.	.	.	.	.	.	.	.	A	4.450	0.083371	0.08533	.	.	ENSG00000138722	ENST00000394980;ENST00000264790;ENST00000508372	T;T;T	0.68181	0.05;0.05;-0.31	5.3	2.68	0.31781	.	0.270973	0.36740	N	0.002440	T	0.49457	0.1558	L	0.34521	1.04	0.43782	D	0.996316	B	0.32918	0.39	B	0.27380	0.079	T	0.50363	-0.8837	10	0.51188	T	0.08	.	8.3394	0.32235	0.7969:0.1325:0.0705:0.0	.	950	Q13201	MMRN1_HUMAN	E	950;950;692	ENSP00000378431:K950E;ENSP00000264790:K950E;ENSP00000426461:K692E	ENSP00000264790:K950E	K	+	1	0	MMRN1	91076702	0.989000	0.36119	0.125000	0.21846	0.074000	0.17049	1.011000	0.29911	1.094000	0.41399	0.533000	0.62120	AAA	MMRN1	-	NULL	ENSG00000138722		0.363	MMRN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMRN1	HGNC	protein_coding	OTTHUMT00000253546.2	34	0.00	0	A	NM_007351		90857679	90857679	+1	no_errors	ENST00000264790	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	0.514	G
MRPL2	51069	genome.wustl.edu	37	6	43022095	43022095	+	Missense_Mutation	SNP	C	C	T	rs201420185	byFrequency	TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:43022095C>T	ENST00000388752.3	-	7	1259	c.835G>A	c.(835-837)Ggg>Agg	p.G279R	MRPL2_ENST00000230413.5_3'UTR|CUL7_ENST00000535468.1_5'Flank|CUL7_ENST00000265348.3_5'Flank|MRPL2_ENST00000489623.1_3'UTR	NM_015950.3	NP_057034.2	Q5T653	RM02_HUMAN	mitochondrial ribosomal protein L2	279					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(2)	9		Ovarian(999;0.0014)	Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|all cancers(41;0.00708)|OV - Ovarian serous cystadenocarcinoma(102;0.0442)	BRCA - Breast invasive adenocarcinoma(397;0.0026)		GCCCAGCCCCCCTTGCGGTGC	0.572																																						dbGAP											0													55.0	54.0	55.0					6																	43022095		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051617	CCDS34454.1, CCDS75458.1	6p21.3	2012-09-13			ENSG00000112651	ENSG00000112651		"""Mitochondrial ribosomal proteins / large subunits"""	14056	protein-coding gene	gene with protein product		611822					Standard	XM_005249161		Approved	MRP-L14, RPML14, CGI-22	uc003ots.1	Q5T653	OTTHUMG00000014719	ENST00000388752.3:c.835G>A	6.37:g.43022095C>T	ENSP00000373404:p.Gly279Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC56|Q8WUL1|Q96Q56|Q9Y311	Missense_Mutation	SNP	pfam_Ribosomal_L2_C,pfam_Rbsml_prot_L2_RNA-bd_dom,superfamily_Translation_prot_SH3-like,superfamily_NA-bd_OB-fold-like	p.G279R	ENST00000388752.3	37	c.835	CCDS34454.1	6	.	.	.	.	.	.	.	.	.	.	C	36	5.815130	0.96982	.	.	ENSG00000112651	ENST00000388752	T	0.41400	1.0	5.53	5.53	0.82687	Translation protein SH3-like (1);	0.356366	0.31370	N	0.007769	T	0.49133	0.1539	L	0.38175	1.15	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.52358	-0.8586	10	0.87932	D	0	-4.3358	17.6447	0.88145	0.0:1.0:0.0:0.0	.	279	Q5T653	RM02_HUMAN	R	279	ENSP00000373404:G279R	ENSP00000373404:G279R	G	-	1	0	MRPL2	43130073	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.555000	0.67301	2.591000	0.87537	0.563000	0.77884	GGG	MRPL2	-	superfamily_Translation_prot_SH3-like	ENSG00000112651		0.572	MRPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL2	HGNC	protein_coding	OTTHUMT00000040577.2	27	0.00	0	C			43022095	43022095	-1	no_errors	ENST00000388752	ensembl	human	known	69_37n	missense	8	57.89	11	SNP	1.000	T
MRPL4	51073	genome.wustl.edu	37	19	10363300	10363300	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:10363300C>T	ENST00000253099.6	+	3	485	c.198C>T	c.(196-198)gtC>gtT	p.V66V	MRPL4_ENST00000590669.1_Silent_p.V66V|CTD-2369P2.5_ENST00000592893.1_RNA|MRPL4_ENST00000307422.5_Silent_p.V66V|MRPL4_ENST00000588502.1_Silent_p.V65V|MRPL4_ENST00000393733.2_Silent_p.V66V	NM_015956.2|NM_146388.1	NP_057040.2|NP_666500.1	Q9BYD3	RM04_HUMAN	mitochondrial ribosomal protein L4	66					translation (GO:0006412)	mitochondrion (GO:0005739)|ribosome (GO:0005840)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(2)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	11		Renal(1328;0.0112)	OV - Ovarian serous cystadenocarcinoma(20;1.39e-09)|Epithelial(33;1.99e-06)|all cancers(31;4.81e-06)	Lung(535;0.00705)		AGGCCTGGGTCGAGTCCTTGC	0.677																																						dbGAP											0													35.0	39.0	38.0					19																	10363300		2201	4299	6500	-	-	-	SO:0001819	synonymous_variant	0			AB049635	CCDS12230.1, CCDS42499.1	19p13.2	2012-11-14			ENSG00000105364	ENSG00000105364		"""Mitochondrial ribosomal proteins / large subunits"""	14276	protein-coding gene	gene with protein product		611823					Standard	NM_015956		Approved	CGI-28	uc002mnn.3	Q9BYD3	OTTHUMG00000180400	ENST00000253099.6:c.198C>T	19.37:g.10363300C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NNV7|Q9BW07|Q9H4N2|Q9Y317	Silent	SNP	pfam_Ribosomal_L4/L1e,superfamily_Ribosomal_L4_dom,tigrfam_Ribosomal_L4/L1e_bac-type	p.V66	ENST00000253099.6	37	c.198	CCDS12230.1	19																																																																																			MRPL4	-	superfamily_Ribosomal_L4_dom	ENSG00000105364		0.677	MRPL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL4	HGNC	protein_coding	OTTHUMT00000451197.1	15	0.00	0	C			10363300	10363300	+1	no_errors	ENST00000253099	ensembl	human	known	69_37n	silent	14	33.33	7	SNP	0.992	T
MYH7	4625	genome.wustl.edu	37	14	23885225	23885225	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:23885225C>T	ENST00000355349.3	-	34	5103	c.4941G>A	c.(4939-4941)caG>caA	p.Q1647Q	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1647					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TCAACAAGCTCTGGAGGCTCT	0.577																																						dbGAP											0													103.0	82.0	89.0					14																	23885225		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4941G>A	14.37:g.23885225C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q1647	ENST00000355349.3	37	c.4941	CCDS9601.1	14																																																																																			MYH7	-	pfam_Myosin_tail	ENSG00000092054		0.577	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	74	0.00	0	C	NM_000257		23885225	23885225	-1	no_errors	ENST00000355349	ensembl	human	known	69_37n	silent	102	26.09	36	SNP	1.000	T
MTHFD1	4522	genome.wustl.edu	37	14	64879239	64879239	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:64879239C>G	ENST00000545908.1	+	4	633	c.404C>G	c.(403-405)tCt>tGt	p.S135C	MTHFD1_ENST00000216605.8_Missense_Mutation_p.S79C			P11586	C1TC_HUMAN	methylenetetrahydrofolate dehydrogenase (NADP+ dependent) 1, methenyltetrahydrofolate cyclohydrolase, formyltetrahydrofolate synthetase	79	Methylenetetrahydrofolate dehydrogenase and cyclohydrolase.				folic acid metabolic process (GO:0046655)|folic acid-containing compound biosynthetic process (GO:0009396)|histidine biosynthetic process (GO:0000105)|methionine biosynthetic process (GO:0009086)|one-carbon metabolic process (GO:0006730)|purine nucleotide biosynthetic process (GO:0006164)|small molecule metabolic process (GO:0044281)|tetrahydrofolate interconversion (GO:0035999)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|formate-tetrahydrofolate ligase activity (GO:0004329)|methenyltetrahydrofolate cyclohydrolase activity (GO:0004477)|methylenetetrahydrofolate dehydrogenase (NADP+) activity (GO:0004488)|methylenetetrahydrofolate dehydrogenase [NAD(P)+] activity (GO:0004486)			endometrium(3)|kidney(2)|large_intestine(8)|lung(10)|ovary(2)|pancreas(1)|prostate(2)|skin(2)	30				OV - Ovarian serous cystadenocarcinoma(108;8.7e-12)|all cancers(60;3.29e-11)|BRCA - Breast invasive adenocarcinoma(234;0.0488)	Tetrahydrofolic acid(DB00116)	ACCACAGAATCTGAGGTGAGC	0.423																																					Colon(18;220 581 13419 18191 31512)|GBM(126;343 1658 28700 44425 52519)	dbGAP											0													145.0	133.0	137.0					14																	64879239		2203	4300	6503	-	-	-	SO:0001583	missense	0			J04031	CCDS9763.1	14q24	2004-12-13			ENSG00000100714	ENSG00000100714	1.5.1.15, 3.5.4.-		7432	protein-coding gene	gene with protein product		172460		MTHFC, MTHFD		3053686, 2786332	Standard	NM_005956		Approved		uc001xhb.3	P11586	OTTHUMG00000141309	ENST00000545908.1:c.404C>G	14.37:g.64879239C>G	ENSP00000438588:p.Ser135Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Y2|G3V2B8|Q86VC9|Q9BVP5	Missense_Mutation	SNP	pfam_Formate_THF_ligase,pfam_THF_DH/CycHdrlase_NAD-bd_dom,pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	p.S135C	ENST00000545908.1	37	c.404		14	.	.	.	.	.	.	.	.	.	.	C	12.60	1.986340	0.35036	.	.	ENSG00000100714	ENST00000545908;ENST00000555709;ENST00000216605;ENST00000555252	T;T;T;T	0.23950	2.68;2.68;2.68;1.88	4.91	3.06	0.35304	Tetrahydrofolate dehydrogenase/cyclohydrolase, conserved site (1);Tetrahydrofolate dehydrogenase/cyclohydrolase, catalytic domain (1);	0.590482	0.18426	N	0.141597	T	0.32406	0.0828	M	0.66439	2.03	0.32859	D	0.507703	P;B;B	0.40032	0.699;0.391;0.374	B;P;B	0.44673	0.446;0.457;0.396	T	0.44742	-0.9308	10	0.49607	T	0.09	-3.0381	9.7549	0.40498	0.1403:0.786:0.0:0.0737	.	135;79;79	F5H2F4;P11586;G3V2B8	.;C1TC_HUMAN;.	C	135;79;135;59	ENSP00000438588:S135C;ENSP00000450560:S79C;ENSP00000216605:S135C;ENSP00000451309:S59C	ENSP00000216605:S79C	S	+	2	0	MTHFD1	63948992	0.997000	0.39634	0.928000	0.36995	0.303000	0.27691	2.647000	0.46639	0.579000	0.29504	-0.314000	0.08810	TCT	MTHFD1	-	pfam_THF_DH/CycHdrlase_cat_dom,prints_THF_DH/CycHdrlase	ENSG00000100714		0.423	MTHFD1-002	NOVEL	basic|exp_conf	protein_coding	MTHFD1	HGNC	protein_coding	OTTHUMT00000412167.1	101	0.00	0	C			64879239	64879239	+1	no_errors	ENST00000216605	ensembl	human	known	69_37n	missense	108	23.40	33	SNP	0.971	G
NALCN	259232	genome.wustl.edu	37	13	102029101	102029101	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr13:102029101C>T	ENST00000251127.6	-	6	675	c.594G>A	c.(592-594)caG>caA	p.Q198Q	NALCN_ENST00000376196.3_Silent_p.Q198Q|NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376200.5_Silent_p.Q198Q	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	198					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)			NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					TTCCAAACATCTGAACTCCTA	0.318																																						dbGAP											0													108.0	122.0	117.0					13																	102029101		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.594G>A	13.37:g.102029101C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Silent	SNP	pfam_Ion_trans_dom	p.Q198	ENST00000251127.6	37	c.594	CCDS9498.1	13																																																																																			NALCN	-	pfam_Ion_trans_dom	ENSG00000102452		0.318	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	47	0.00	0	C	NM_052867		102029101	102029101	-1	no_errors	ENST00000251127	ensembl	human	known	69_37n	silent	17	46.88	15	SNP	0.996	T
NCOA3	8202	genome.wustl.edu	37	20	46255914	46255914	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr20:46255914T>C	ENST00000371998.3	+	6	717	c.526T>C	c.(526-528)Tct>Cct	p.S176P	NCOA3_ENST00000497292.1_3'UTR|NCOA3_ENST00000341724.6_Missense_Mutation_p.S176P|NCOA3_ENST00000371997.3_Missense_Mutation_p.S176P|NCOA3_ENST00000372004.3_Missense_Mutation_p.S176P			Q9Y6Q9	NCOA3_HUMAN	nuclear receptor coactivator 3	176	PAS. {ECO:0000255|PROSITE- ProRule:PRU00140}.				androgen receptor signaling pathway (GO:0030521)|developmental growth (GO:0048589)|histone acetylation (GO:0016573)|labyrinthine layer morphogenesis (GO:0060713)|mammary gland branching involved in thelarche (GO:0060744)|multicellular organism growth (GO:0035264)|positive regulation of gene expression (GO:0010628)|positive regulation of keratinocyte differentiation (GO:0045618)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|receptor transactivation (GO:0035624)|regulation of RNA biosynthetic process (GO:2001141)|transcription, DNA-templated (GO:0006351)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|protein N-terminus binding (GO:0047485)|signal transducer activity (GO:0004871)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			breast(3)|endometrium(3)|kidney(4)|large_intestine(12)|lung(19)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52						TTTACCAAAATCTACAGGTAG	0.303																																						dbGAP											0													57.0	57.0	57.0					20																	46255914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF012108	CCDS13406.1, CCDS13407.1, CCDS54472.1	20q12	2011-07-01			ENSG00000124151	ENSG00000124151		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7670	protein-coding gene	gene with protein product	"""receptor-associated coactivator 3"", ""thyroid hormone receptor activator molecule 1"""	601937				9252329, 9346901	Standard	NM_181659		Approved	RAC3, AIB1, ACTR, p/CIP, TRAM-1, CAGH16, TNRC16, KAT13B, bHLHe42, SRC-3, SRC3	uc002xtk.3	Q9Y6Q9	OTTHUMG00000033061	ENST00000371998.3:c.526T>C	20.37:g.46255914T>C	ENSP00000361066:p.Ser176Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	A4LAZ5|Q0VF45|Q5JYD9|Q5JYE0|Q9BR49|Q9UPC9|Q9UPG4|Q9UPG7	Missense_Mutation	SNP	pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_SRC-1,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.S176P	ENST00000371998.3	37	c.526	CCDS13407.1	20	.	.	.	.	.	.	.	.	.	.	T	19.22	3.785842	0.70337	.	.	ENSG00000124151	ENST00000340189;ENST00000341724;ENST00000372004;ENST00000371998;ENST00000371997	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	6.07	6.07	0.98685	PAS (2);	0.111529	0.64402	D	0.000009	T	0.32346	0.0826	M	0.69248	2.105	0.50632	D	0.999885	P;B;B;B;B	0.52170	0.951;0.31;0.201;0.167;0.201	P;B;B;B;B	0.50896	0.653;0.367;0.236;0.183;0.279	T	0.03374	-1.1043	10	0.87932	D	0	-21.2768	16.6277	0.84984	0.0:0.0:0.0:1.0	.	176;180;176;176;176	Q9Y6Q9-3;Q59EE8;Q0IIN7;Q9Y6Q9-5;Q9Y6Q9	.;.;.;.;NCOA3_HUMAN	P	176	ENSP00000342123:S176P;ENSP00000361073:S176P;ENSP00000361066:S176P;ENSP00000361065:S176P	ENSP00000345671:S176P	S	+	1	0	NCOA3	45689321	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.102000	0.41796	2.330000	0.79161	0.528000	0.53228	TCT	NCOA3	-	smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS	ENSG00000124151		0.303	NCOA3-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCOA3	HGNC	protein_coding	OTTHUMT00000080405.1	41	0.00	0	T	NM_006534		46255914	46255914	+1	no_errors	ENST00000371998	ensembl	human	known	69_37n	missense	64	20.99	17	SNP	1.000	C
NEB	4703	genome.wustl.edu	37	2	152520097	152520097	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:152520097C>G	ENST00000172853.10	-	45	5875	c.5728G>C	c.(5728-5730)Gaa>Caa	p.E1910Q	NEB_ENST00000427231.2_Missense_Mutation_p.E1910Q|NEB_ENST00000397345.3_Missense_Mutation_p.E1910Q|NEB_ENST00000603639.1_Missense_Mutation_p.E1910Q|NEB_ENST00000409198.1_Missense_Mutation_p.E1910Q|NEB_ENST00000604864.1_Missense_Mutation_p.E1910Q			P20929	NEBU_HUMAN	nebulin	1910					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		TTGGCCAATTCAAAGCTCATG	0.448																																						dbGAP											0													175.0	156.0	162.0					2																	152520097		2026	4180	6206	-	-	-	SO:0001583	missense	0			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.5728G>C	2.37:g.152520097C>G	ENSP00000172853:p.Glu1910Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,prints_Nebulin,pfscan_Nebulin_35r-motif,pfscan_SH3_domain	p.E1910Q	ENST00000172853.10	37	c.5728		2	.	.	.	.	.	.	.	.	.	.	C	16.96	3.265903	0.59540	.	.	ENSG00000183091	ENST00000409198;ENST00000397345;ENST00000427231;ENST00000172853	T;T;T;T	0.43294	0.95;0.95;0.95;0.95	5.61	5.61	0.85477	.	0.320771	0.34046	N	0.004302	T	0.49304	0.1549	L	0.41236	1.265	0.80722	D	1	P	0.45594	0.862	P	0.53809	0.735	T	0.12708	-1.0537	10	0.13853	T	0.58	.	20.0044	0.97430	0.0:1.0:0.0:0.0	.	1910	P20929	NEBU_HUMAN	Q	1910	ENSP00000386259:E1910Q;ENSP00000380505:E1910Q;ENSP00000416578:E1910Q;ENSP00000172853:E1910Q	ENSP00000172853:E1910Q	E	-	1	0	NEB	152228343	1.000000	0.71417	0.999000	0.59377	0.750000	0.42670	4.795000	0.62489	2.809000	0.96659	0.555000	0.69702	GAA	NEB	-	pfam_Nebulin_35r-motif,smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif	ENSG00000183091		0.448	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		63	0.00	0	C	NM_004543		152520097	152520097	-1	no_errors	ENST00000397345	ensembl	human	known	69_37n	missense	159	23.44	49	SNP	1.000	G
NES	10763	genome.wustl.edu	37	1	156642072	156642072	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:156642072C>T	ENST00000368223.3	-	4	2040	c.1908G>A	c.(1906-1908)atG>atA	p.M636I		NM_006617.1	NP_006608.1	P48681	NEST_HUMAN	nestin	636	Tail.				brain development (GO:0007420)|cell projection morphogenesis (GO:0048858)|central nervous system development (GO:0007417)|embryonic camera-type eye development (GO:0031076)|G2/M transition of mitotic cell cycle (GO:0000086)|negative regulation of catalytic activity (GO:0043086)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein binding (GO:0032091)|positive regulation of intermediate filament depolymerization (GO:0030844)|positive regulation of neural precursor cell proliferation (GO:2000179)|stem cell proliferation (GO:0072089)	cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)	intermediate filament binding (GO:0019215)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(30)|ovary(6)|prostate(1)|skin(3)|stomach(1)|urinary_tract(4)	64	all_hematologic(923;0.088)|Hepatocellular(266;0.158)					CAAGAGATTTCATTAGTTCTT	0.393																																						dbGAP											0													76.0	78.0	77.0					1																	156642072		2203	4300	6503	-	-	-	SO:0001583	missense	0			X65964	CCDS1151.1	1q23	2013-01-16			ENSG00000132688	ENSG00000132688		"""Intermediate filaments type IV"""	7756	protein-coding gene	gene with protein product		600915				1478958, 9104587	Standard	NM_006617		Approved	FLJ21841	uc001fpq.3	P48681	OTTHUMG00000034299	ENST00000368223.3:c.1908G>A	1.37:g.156642072C>T	ENSP00000357206:p.Met636Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	O00552|Q3LIF5|Q5SYZ6	Missense_Mutation	SNP	pfam_F	p.M636I	ENST00000368223.3	37	c.1908	CCDS1151.1	1	.	.	.	.	.	.	.	.	.	.	C	8.087	0.773570	0.16051	.	.	ENSG00000132688	ENST00000368223	D	0.84944	-1.92	5.15	3.27	0.37495	.	0.459511	0.16330	N	0.219159	T	0.66886	0.2835	L	0.60455	1.87	0.09310	N	1	B	0.06786	0.001	B	0.08055	0.003	T	0.62096	-0.6926	10	0.56958	D	0.05	.	5.5279	0.16968	0.0:0.6569:0.1637:0.1795	.	636	P48681	NEST_HUMAN	I	636	ENSP00000357206:M636I	ENSP00000357206:M636I	M	-	3	0	NES	154908696	0.001000	0.12720	0.000000	0.03702	0.075000	0.17131	0.175000	0.16762	0.568000	0.29311	0.467000	0.42956	ATG	NES	-	NULL	ENSG00000132688		0.393	NES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NES	HGNC	protein_coding	OTTHUMT00000082844.2	58	0.00	0	C	NM_006617		156642072	156642072	-1	no_errors	ENST00000368223	ensembl	human	known	69_37n	missense	78	19.59	19	SNP	0.009	T
NHLRC2	374354	genome.wustl.edu	37	10	115614776	115614776	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:115614776G>C	ENST00000369301.3	+	1	357	c.145G>C	c.(145-147)Gag>Cag	p.E49Q	DCLRE1A_ENST00000369305.1_5'Flank|DCLRE1A_ENST00000476112.1_5'Flank|DCLRE1A_ENST00000361384.2_5'Flank	NM_198514.3	NP_940916.2	Q8NBF2	NHLC2_HUMAN	NHL repeat containing 2	49	Thioredoxin. {ECO:0000255|PROSITE- ProRule:PRU00691}.									breast(1)|endometrium(2)|kidney(4)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	15				Epithelial(162;0.017)|all cancers(201;0.0187)		GGACGGCTGGGAGCAGGACTT	0.682																																						dbGAP											0													51.0	45.0	47.0					10																	115614776		2155	4184	6339	-	-	-	SO:0001583	missense	0			AK090631	CCDS7585.1	10q26.11	2006-03-31			ENSG00000196865	ENSG00000196865			24731	protein-coding gene	gene with protein product						12477932	Standard	NM_198514		Approved	FLJ25621, FLJ20147, FLJ33312, MGC45492, DKFZp779F115	uc001lax.2	Q8NBF2	OTTHUMG00000019078	ENST00000369301.3:c.145G>C	10.37:g.115614776G>C	ENSP00000358307:p.Glu49Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N1H1|Q8N5A6	Missense_Mutation	SNP	pfam_NHL_repeat,superfamily_Thioredoxin-like_fold,pfscan_NHL_repeat_subgr	p.E49Q	ENST00000369301.3	37	c.145	CCDS7585.1	10	.	.	.	.	.	.	.	.	.	.	G	24.5	4.536544	0.85812	.	.	ENSG00000196865	ENST00000369301	T	0.44881	0.91	5.21	4.3	0.51218	Thioredoxin-like fold (2);	0.166742	0.53938	D	0.000051	T	0.34135	0.0887	L	0.31294	0.92	0.49687	D	0.999811	P	0.49090	0.919	P	0.44647	0.456	T	0.03651	-1.1016	10	0.20519	T	0.43	-18.2484	14.1437	0.65336	0.0:0.15:0.85:0.0	.	49	Q8NBF2	NHLC2_HUMAN	Q	49	ENSP00000358307:E49Q	ENSP00000358307:E49Q	E	+	1	0	NHLRC2	115604766	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	3.604000	0.54081	1.164000	0.42652	0.561000	0.74099	GAG	NHLRC2	-	NULL	ENSG00000196865		0.682	NHLRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHLRC2	HGNC	protein_coding	OTTHUMT00000050446.1	34	0.00	0	G	NM_198514		115614776	115614776	+1	no_errors	ENST00000369301	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	C
NPC1	4864	genome.wustl.edu	37	18	21119419	21119419	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr18:21119419G>A	ENST00000269228.5	-	19	3365	c.2811C>T	c.(2809-2811)ttC>ttT	p.F937F	NPC1_ENST00000540608.1_5'Flank|NPC1_ENST00000412552.2_Silent_p.F619F	NM_000271.4	NP_000262.2	O15118	NPC1_HUMAN	Niemann-Pick disease, type C1	937					adult walking behavior (GO:0007628)|autophagy (GO:0006914)|bile acid metabolic process (GO:0008206)|cellular response to low-density lipoprotein particle stimulus (GO:0071404)|cellular response to steroid hormone stimulus (GO:0071383)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|endocytosis (GO:0006897)|establishment of protein localization to membrane (GO:0090150)|lysosomal transport (GO:0007041)|membrane raft organization (GO:0031579)|negative regulation of cell death (GO:0060548)|negative regulation of macroautophagy (GO:0016242)|protein glycosylation (GO:0006486)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|signal transduction (GO:0007165)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane (GO:0016020)|membrane raft (GO:0045121)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)	cholesterol binding (GO:0015485)|hedgehog receptor activity (GO:0008158)|receptor activity (GO:0004872)|sterol transporter activity (GO:0015248)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(10)|lung(13)|ovary(2)|stomach(1)	38	all_cancers(21;0.000106)|all_epithelial(16;6.57e-07)|Lung NSC(20;0.00166)|all_lung(20;0.00536)|Colorectal(14;0.0202)|Ovarian(20;0.127)					ACGAGGGGGCGAAGCCTATTC	0.488																																						dbGAP											0													59.0	49.0	52.0					18																	21119419		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF002020	CCDS11878.1	18q11.2	2014-06-17			ENSG00000141458	ENSG00000141458			7897	protein-coding gene	gene with protein product		607623				8446622	Standard	NM_000271		Approved		uc002kum.4	O15118	OTTHUMG00000131873	ENST00000269228.5:c.2811C>T	18.37:g.21119419G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DET3|Q9P130	Missense_Mutation	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD,tigrfam_NP_C_type	p.S630L	ENST00000269228.5	37	c.1889	CCDS11878.1	18																																																																																			NPC1	-	tigrfam_NP_C_type	ENSG00000141458		0.488	NPC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPC1	HGNC	protein_coding	OTTHUMT00000254823.2	21	0.00	0	G	NM_000271		21119419	21119419	-1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000591051	ensembl	human	putative	69_37n	missense	17	32.00	8	SNP	0.913	A
NPC1L1	29881	genome.wustl.edu	37	7	44553138	44553138	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:44553138C>G	ENST00000289547.4	-	20	4043	c.3988G>C	c.(3988-3990)Gac>Cac	p.D1330H	NPC1L1_ENST00000546276.1_Missense_Mutation_p.D1257H|NPC1L1_ENST00000381160.3_Missense_Mutation_p.D1303H	NM_013389.2	NP_037521.2	Q9UHC9	NPCL1_HUMAN	NPC1-like 1	1330					cholesterol biosynthetic process (GO:0006695)|cholesterol transport (GO:0030301)|intestinal cholesterol absorption (GO:0030299)|lipoprotein metabolic process (GO:0042157)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|sterol transport (GO:0015918)	brush border membrane (GO:0031526)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	drug binding (GO:0008144)|hedgehog receptor activity (GO:0008158)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(7)|lung(27)|ovary(6)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	57					Ezetimibe(DB00973)	TAGATGTTGTCAGCTGTGGAG	0.562																																						dbGAP											0													123.0	125.0	124.0					7																	44553138		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS5491.1, CCDS43575.1, CCDS75587.1	7p13	2012-11-15	2012-11-15		ENSG00000015520	ENSG00000015520			7898	protein-coding gene	gene with protein product		608010	"""NPC1 (Niemann-Pick disease, type C1, gene)-like 1"""			10783261	Standard	NM_013389		Approved		uc003tlb.3	Q9UHC9	OTTHUMG00000023691	ENST00000289547.4:c.3988G>C	7.37:g.44553138C>G	ENSP00000289547:p.Asp1330His	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2J7|B7ZLE6|D3DVK9|Q17RV5|Q6R3Q4|Q9UHC8	Missense_Mutation	SNP	pfam_Patched,pfscan_SSD	p.D1330H	ENST00000289547.4	37	c.3988	CCDS5491.1	7	.	.	.	.	.	.	.	.	.	.	C	6.488	0.458206	0.12342	.	.	ENSG00000015520	ENST00000289547;ENST00000381160;ENST00000546276	D;D;D	0.93366	-3.08;-3.12;-3.21	3.49	-3.95	0.04118	.	4.161420	0.00883	N	0.002142	T	0.81908	0.4922	N	0.08118	0	0.09310	N	1	B;B;B	0.32653	0.167;0.167;0.379	B;B;B	0.25405	0.026;0.026;0.06	T	0.75628	-0.3252	10	0.42905	T	0.14	.	3.2949	0.06963	0.3647:0.3442:0.0:0.2911	.	1257;1303;1330	B7ZLE6;Q17RV5;D3DVK9	.;.;.	H	1330;1303;1257	ENSP00000289547:D1330H;ENSP00000370552:D1303H;ENSP00000438033:D1257H	ENSP00000289547:D1330H	D	-	1	0	NPC1L1	44519663	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.558000	0.05978	-0.779000	0.04560	-0.379000	0.06801	GAC	NPC1L1	-	NULL	ENSG00000015520		0.562	NPC1L1-001	KNOWN	basic|CCDS	protein_coding	NPC1L1	HGNC	protein_coding	OTTHUMT00000251256.1	62	0.00	0	C	NM_013389		44553138	44553138	-1	no_errors	ENST00000289547	ensembl	human	known	69_37n	missense	27	44.90	22	SNP	0.000	G
NRXN2	9379	genome.wustl.edu	37	11	64457918	64457919	+	Frame_Shift_Ins	INS	-	-	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:64457918_64457919insC	ENST00000377551.1	-	4	1019_1020	c.808_809insG	c.(808-810)gccfs	p.A270fs	NRXN2_ENST00000377559.3_Intron|NRXN2_ENST00000409571.1_Frame_Shift_Ins_p.A270fs|NRXN2_ENST00000265459.6_Frame_Shift_Ins_p.A270fs			Q9P2S2	NRX2A_HUMAN	neurexin 2	270					adult behavior (GO:0030534)|gephyrin clustering (GO:0097116)|neuroligin clustering (GO:0097118)|neuron cell-cell adhesion (GO:0007158)|neurotransmitter secretion (GO:0007269)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)|vocal learning (GO:0042297)|vocalization behavior (GO:0071625)	integral component of membrane (GO:0016021)	calcium channel regulator activity (GO:0005246)|cell adhesion molecule binding (GO:0050839)|metal ion binding (GO:0046872)|neuroligin family protein binding (GO:0097109)	p.A270fs*27(1)		breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|liver(1)|lung(34)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	71						TCCTCTCCCGGCCCCCCCCTCG	0.634																																						dbGAP											1	Insertion - Frameshift(1)	central_nervous_system(1)							,	56,4208		0,56,2076					,	4.6	1.0			37	73,8181		0,73,4054	no	intron,frameshift	NRXN2	NM_138732.2,NM_015080.3	,	0,129,6130	A1A1,A1R,RR		0.8844,1.3133,1.0305	,	,		129,12389				-	-	-	SO:0001589	frameshift_variant	0				CCDS8077.1, CCDS31597.1, CCDS8078.1	11q13	2008-07-18			ENSG00000110076	ENSG00000110076			8009	protein-coding gene	gene with protein product	"""neurexin II"""	600566				1621094	Standard	NM_015080		Approved		uc021qkw.1	P58401	OTTHUMG00000045214	ENST00000377551.1:c.809dupG	11.37:g.64457926_64457926dupC	ENSP00000366774:p.Ala270fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2C1|Q9Y2D6	Frame_Shift_Ins	INS	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,smart_EGF-like,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Laminin_G	p.A270fs	ENST00000377551.1	37	c.809_808	CCDS8077.1	11																																																																																			NRXN2	-	NULL	ENSG00000110076		0.634	NRXN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NRXN2	HGNC	protein_coding	OTTHUMT00000104967.3	41	0.00	0	-	NM_015080		64457918	64457919	-1	no_errors	ENST00000265459	ensembl	human	known	69_37n	frame_shift_ins	32	23.81	10	INS	1.000:1.000	C
OCRL	4952	genome.wustl.edu	37	X	128723903	128723903	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:128723903G>A	ENST00000371113.4	+	23	2716	c.2551G>A	c.(2551-2553)Gaa>Aaa	p.E851K	OCRL_ENST00000357121.5_Missense_Mutation_p.E843K	NM_000276.3	NP_000267.2	Q01968	OCRL_HUMAN	oculocerebrorenal syndrome of Lowe	851	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cilium assembly (GO:0042384)|in utero embryonic development (GO:0001701)|inositol phosphate metabolic process (GO:0043647)|lipid metabolic process (GO:0006629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|Golgi stack (GO:0005795)|Golgi-associated vesicle (GO:0005798)|nucleus (GO:0005634)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	inositol phosphate phosphatase activity (GO:0052745)|phosphatidylinositol-4,5-bisphosphate 5-phosphatase activity (GO:0004439)|Rac GTPase activator activity (GO:0030675)|Rac GTPase binding (GO:0048365)			breast(1)|endometrium(3)|kidney(4)|large_intestine(11)|lung(24)|ovary(2)|upper_aerodigestive_tract(3)	48						AAAATTCTCTGAATACAATAG	0.413																																						dbGAP											0													136.0	123.0	128.0					X																	128723903		2203	4300	6503	-	-	-	SO:0001583	missense	0			U57627	CCDS35393.1, CCDS35394.1	Xq25	2014-06-18			ENSG00000122126	ENSG00000122126			8108	protein-coding gene	gene with protein product		300535					Standard	NM_001587		Approved	OCRL1	uc004euq.3	Q01968	OTTHUMG00000022706	ENST00000371113.4:c.2551G>A	X.37:g.128723903G>A	ENSP00000360154:p.Glu851Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKI1|A8KAP2|B7ZLX2|O60800|Q15684|Q15774|Q4VY09|Q4VY10|Q5JQF1|Q5JQF2|Q9UJG5|Q9UMA5	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_RhoGAP_dom,superfamily_Endo/exonuclease/phosphatase,superfamily_Rho_GTPase_activation_prot,smart_IPPc,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E851K	ENST00000371113.4	37	c.2551	CCDS35393.1	X	.	.	.	.	.	.	.	.	.	.	G	8.059	0.767728	0.15983	.	.	ENSG00000122126	ENST00000371113;ENST00000357121	T;T	0.44083	0.93;0.93	5.64	3.47	0.39725	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.403544	0.30011	N	0.010637	T	0.20170	0.0485	N	0.11201	0.11	0.29664	N	0.843001	B;B	0.02656	0.0;0.0	B;B	0.08055	0.001;0.003	T	0.17137	-1.0379	10	0.07175	T	0.84	.	11.061	0.47946	0.1931:0.0:0.8069:0.0	.	843;851	Q01968-2;Q01968	.;OCRL_HUMAN	K	851;843	ENSP00000360154:E851K;ENSP00000349635:E843K	ENSP00000349635:E843K	E	+	1	0	OCRL	128551584	0.964000	0.33143	0.990000	0.47175	0.944000	0.59088	2.035000	0.41155	1.082000	0.41137	0.597000	0.82753	GAA	OCRL	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	ENSG00000122126		0.413	OCRL-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	OCRL	HGNC	protein_coding	OTTHUMT00000058917.1	76	0.00	0	G	NM_000276		128723903	128723903	+1	no_errors	ENST00000371113	ensembl	human	known	69_37n	missense	96	25.00	32	SNP	0.943	A
OR10R2	343406	genome.wustl.edu	37	1	158449727	158449727	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:158449727G>T	ENST00000368152.1	+	1	60	c.60G>T	c.(58-60)caG>caT	p.Q20H	RP11-144L1.4_ENST00000426251.1_RNA|RP11-144L1.4_ENST00000419738.1_RNA	NM_001004472.1	NP_001004472.1	Q8NGX6	O10R2_HUMAN	olfactory receptor, family 10, subfamily R, member 2	20						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(26)|pancreas(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	41	all_hematologic(112;0.0378)					CCCCTTTGCAGATCTTGGCAG	0.423																																						dbGAP											0													184.0	178.0	180.0					1																	158449727		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065640	CCDS30898.1	1q23.1	2012-08-09			ENSG00000198965	ENSG00000198965		"""GPCR / Class A : Olfactory receptors"""	14820	protein-coding gene	gene with protein product							Standard	NM_001004472		Approved	OR10R2Q	uc010pik.2	Q8NGX6	OTTHUMG00000019632	ENST00000368152.1:c.60G>T	1.37:g.158449727G>T	ENSP00000357134:p.Gln20His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VWM8|Q6IFS1|Q96R61	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.Q20H	ENST00000368152.1	37	c.60	CCDS30898.1	1	.	.	.	.	.	.	.	.	.	.	g	10.66	1.411372	0.25465	.	.	ENSG00000198965	ENST00000368152	T	0.37058	1.22	4.09	3.18	0.36537	.	.	.	.	.	T	0.13756	0.0333	L	0.34521	1.04	0.09310	N	1	P	0.38642	0.641	B	0.38500	0.275	T	0.07424	-1.0773	9	0.66056	D	0.02	.	8.9818	0.35970	0.1073:0.0:0.8927:0.0	.	20	Q8NGX6	O10R2_HUMAN	H	20	ENSP00000357134:Q20H	ENSP00000357134:Q20H	Q	+	3	2	OR10R2	156716351	0.896000	0.30565	0.039000	0.18376	0.024000	0.10985	2.216000	0.42871	0.905000	0.36596	0.591000	0.81541	CAG	OR10R2	-	NULL	ENSG00000198965		0.423	OR10R2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10R2	HGNC	protein_coding	OTTHUMT00000051847.2	117	0.00	0	G	NM_001004472		158449727	158449727	+1	no_errors	ENST00000368152	ensembl	human	known	69_37n	missense	372	15.07	66	SNP	0.037	T
OR2AK2	391191	genome.wustl.edu	37	1	248128843	248128843	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:248128843C>T	ENST00000366480.3	+	1	309	c.210C>T	c.(208-210)ctC>ctT	p.L70L	OR2L13_ENST00000366478.2_Intron	NM_001004491.1	NP_001004491.1	Q8NG84	O2AK2_HUMAN	olfactory receptor, family 2, subfamily AK, member 2	70						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(25)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	36	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0152)			ACACCAGACTCCACACTCCAA	0.483																																					Melanoma(45;390 1181 23848 28461 41504)	dbGAP											0													201.0	183.0	189.0					1																	248128843		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BK004457	CCDS31102.1	1q44	2012-08-09			ENSG00000187080	ENSG00000187080		"""GPCR / Class A : Olfactory receptors"""	19569	protein-coding gene	gene with protein product				OR2AK1P			Standard	NM_001004491		Approved		uc010pzd.2	Q8NG84	OTTHUMG00000040201	ENST00000366480.3:c.210C>T	1.37:g.248128843C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RND1|Q6IF05	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L70	ENST00000366480.3	37	c.210	CCDS31102.1	1																																																																																			OR2AK2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000187080		0.483	OR2AK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2AK2	HGNC	protein_coding	OTTHUMT00000096858.2	80	0.00	0	C	NM_001004491		248128843	248128843	+1	no_errors	ENST00000366480	ensembl	human	known	69_37n	silent	233	14.65	40	SNP	0.989	T
OR2L3	391192	genome.wustl.edu	37	1	248224664	248224664	+	Missense_Mutation	SNP	G	G	A	rs267598495		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:248224664G>A	ENST00000359959.3	+	1	681	c.681G>A	c.(679-681)atG>atA	p.M227I	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	227						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TCTACCACATGAAATCTGCAG	0.468																																						dbGAP											0													152.0	145.0	147.0					1																	248224664		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.681G>A	1.37:g.248224664G>A	ENSP00000353044:p.Met227Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH44	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.M227I	ENST00000359959.3	37	c.681	CCDS31104.1	1	.	.	.	.	.	.	.	.	.	.	G	8.073	0.770663	0.15983	.	.	ENSG00000198128	ENST00000359959	T	0.00021	9.03	2.05	1.08	0.20341	GPCR, rhodopsin-like superfamily (1);	0.000000	0.37715	U	0.001974	T	0.00073	0.0002	N	0.20766	0.605	0.09310	N	1	B	0.22541	0.071	B	0.29785	0.107	T	0.27262	-1.0079	10	0.62326	D	0.03	.	3.6696	0.08269	0.2707:0.2094:0.5198:0.0	.	227	Q8NG85	OR2L3_HUMAN	I	227	ENSP00000353044:M227I	ENSP00000353044:M227I	M	+	3	0	OR2L3	246291287	0.000000	0.05858	0.004000	0.12327	0.049000	0.14656	-2.562000	0.00920	0.175000	0.19841	0.462000	0.41574	ATG	OR2L3	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000198128		0.468	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	HGNC	protein_coding	OTTHUMT00000096852.1	107	0.00	0	G	NM_001004687		248224664	248224664	+1	no_errors	ENST00000359959	ensembl	human	known	69_37n	missense	329	11.05	41	SNP	0.002	A
OR2T1	26696	genome.wustl.edu	37	1	248569793	248569793	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:248569793C>T	ENST00000366474.1	+	1	498	c.498C>T	c.(496-498)ggC>ggT	p.G166G		NM_030904.1	NP_112166.1	O43869	OR2T1_HUMAN	olfactory receptor, family 2, subfamily T, member 1	166						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(24)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	39	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			TCCTGCTGGGCCTCATGGCCT	0.517																																						dbGAP											0													145.0	142.0	143.0					1																	248569793		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U86215	CCDS31115.1	1q44	2012-08-09			ENSG00000175143	ENSG00000175143		"""GPCR / Class A : Olfactory receptors"""	8277	protein-coding gene	gene with protein product						9500546	Standard	NM_030904		Approved	OR1-25	uc010pzm.2	O43869	OTTHUMG00000040450	ENST00000366474.1:c.498C>T	1.37:g.248569793C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEZ9	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.G166	ENST00000366474.1	37	c.498	CCDS31115.1	1																																																																																			OR2T1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000175143		0.517	OR2T1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T1	HGNC	protein_coding	OTTHUMT00000097346.2	69	0.00	0	C			248569793	248569793	+1	no_errors	ENST00000366474	ensembl	human	known	69_37n	silent	203	11.30	26	SNP	0.026	T
OR52K2	119774	genome.wustl.edu	37	11	4470867	4470867	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:4470867C>G	ENST00000325719.4	+	1	343	c.298C>G	c.(298-300)Ctg>Gtg	p.L100V	AC010930.1_ENST00000408103.1_RNA	NM_001005172.2	NP_001005172.2	Q8NGK3	O52K2_HUMAN	olfactory receptor, family 52, subfamily K, member 2	100						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(2)|breast(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|skin(6)	25		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;1.48e-11)|BRCA - Breast invasive adenocarcinoma(625;0.0821)|LUSC - Lung squamous cell carcinoma(625;0.19)		CTTTGCCTGTCTGGCCCAGAT	0.532																																						dbGAP											0													99.0	80.0	87.0					11																	4470867		2201	4298	6499	-	-	-	SO:0001583	missense	0			AB065791	CCDS31351.1	11p15.4	2012-08-09			ENSG00000181963	ENSG00000181963		"""GPCR / Class A : Olfactory receptors"""	15223	protein-coding gene	gene with protein product							Standard	NM_001005172		Approved		uc001lyz.2	Q8NGK3	OTTHUMG00000165703	ENST00000325719.4:c.298C>G	11.37:g.4470867C>G	ENSP00000318956:p.Leu100Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MUY8|B2RP35|Q6IFK4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L100V	ENST00000325719.4	37	c.298	CCDS31351.1	11	.	.	.	.	.	.	.	.	.	.	C	10.46	1.356331	0.24598	.	.	ENSG00000181963	ENST00000325719	T	0.00414	7.52	4.16	4.16	0.48862	GPCR, rhodopsin-like superfamily (1);	0.231050	0.22997	N	0.053127	T	0.00637	0.0021	L	0.28115	0.83	0.28315	N	0.922494	D	0.71674	0.998	D	0.77557	0.99	T	0.68853	-0.5299	10	0.36615	T	0.2	.	15.2256	0.73348	0.0:1.0:0.0:0.0	.	100	Q8NGK3	O52K2_HUMAN	V	100	ENSP00000318956:L100V	ENSP00000318956:L100V	L	+	1	2	OR52K2	4427443	0.000000	0.05858	0.993000	0.49108	0.423000	0.31445	-1.094000	0.03359	2.159000	0.67721	0.479000	0.44913	CTG	OR52K2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000181963		0.532	OR52K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52K2	HGNC	protein_coding	OTTHUMT00000385844.1	61	0.00	0	C	NM_001005172		4470867	4470867	+1	no_errors	ENST00000325719	ensembl	human	known	69_37n	missense	77	29.09	32	SNP	0.933	G
OXLD1	339229	genome.wustl.edu	37	17	79632282	79632282	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:79632282G>A	ENST00000374741.3	-	2	403	c.393C>T	c.(391-393)ctC>ctT	p.L131L	PDE6G_ENST00000574777.1_5'Flank|PDE6G_ENST00000571224.1_5'Flank|OXLD1_ENST00000571503.1_3'UTR|OXLD1_ENST00000573786.1_5'UTR|CCDC137_ENST00000329214.8_5'Flank	NM_001039842.1	NP_001034931.1	Q5BKU9	OXLD1_HUMAN	oxidoreductase-like domain containing 1	131						mitochondrion (GO:0005739)											GGAAGGCCTTGAGGTTCTCAT	0.672																																						dbGAP											0													44.0	43.0	43.0					17																	79632282		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32766.1	17q25.3	2012-07-20	2012-07-20	2012-07-20	ENSG00000204237	ENSG00000204237			27901	protein-coding gene	gene with protein product			"""chromosome 17 open reading frame 90"""	C17orf90			Standard	NM_001039842		Approved	MGC104712	uc002kba.3	Q5BKU9	OTTHUMG00000178063	ENST00000374741.3:c.393C>T	17.37:g.79632282G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6ND24	Silent	SNP	pfam_Oxidoreductase-like_N	p.L131	ENST00000374741.3	37	c.393	CCDS32766.1	17																																																																																			OXLD1	-	NULL	ENSG00000204237		0.672	OXLD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OXLD1	HGNC	protein_coding	OTTHUMT00000440380.1	28	0.00	0	G	NM_001039842		79632282	79632282	-1	no_errors	ENST00000374741	ensembl	human	known	69_37n	silent	14	28.57	6	SNP	1.000	A
PALM2	114299	genome.wustl.edu	37	9	112705539	112705539	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr9:112705539C>T	ENST00000374531.2	+	7	1048	c.974C>T	c.(973-975)aCg>aTg	p.T325M	AKAP2_ENST00000510514.5_Intron|PALM2-AKAP2_ENST00000374530.3_Intron|PALM2_ENST00000448454.2_Missense_Mutation_p.T359M|AKAP2_ENST00000555236.1_Intron|PALM2_ENST00000314527.4_Missense_Mutation_p.T357M|PALM2_ENST00000483909.1_Missense_Mutation_p.T323M|PALM2-AKAP2_ENST00000302798.7_Intron	NM_001037293.2	NP_001032370.1	Q8IXS6	PALM2_HUMAN	paralemmin 2	325					regulation of cell shape (GO:0008360)	plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(5)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(1)	18						AAGACAGTGACGGACGTGTCC	0.532																																						dbGAP											0													169.0	156.0	160.0					9																	112705539		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ312216	CCDS35099.1, CCDS48002.1, CCDS48002.2	9q31.3	2009-10-16			ENSG00000243444	ENSG00000243444			15845	protein-coding gene	gene with protein product						11478809	Standard	NM_001037293		Approved			Q8IXS6	OTTHUMG00000020479	ENST00000374531.2:c.974C>T	9.37:g.112705539C>T	ENSP00000363656:p.Thr325Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A9Z1X9|Q8N9D5|Q96DU1	Missense_Mutation	SNP	pfam_Paralemmin	p.T359M	ENST00000374531.2	37	c.1076	CCDS35099.1	9	.	.	.	.	.	.	.	.	.	.	C	20.3	3.969813	0.74246	.	.	ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000243444;ENSG00000157654	ENST00000374531;ENST00000448454;ENST00000483909;ENST00000314527;ENST00000413420	T;T;T;T;T	0.17528	2.27;2.27;2.27;2.27;2.27	6.01	6.01	0.97437	.	.	.	.	.	T	0.43055	0.1230	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.09122	-1.0689	9	0.72032	D	0.01	.	19.5093	0.95135	0.0:1.0:0.0:0.0	.	325;359	Q8IXS6;D3YTA4	PALM2_HUMAN;.	M	325;359;323;357;357	ENSP00000363656:T325M;ENSP00000400206:T359M;ENSP00000417525:T323M;ENSP00000323805:T357M;ENSP00000397839:T357M	ENSP00000397839:T357M	T	+	2	0	PALM2-AKAP2;PALM2	111745360	1.000000	0.71417	0.989000	0.46669	0.986000	0.74619	7.487000	0.81328	2.861000	0.98227	0.650000	0.86243	ACG	PALM2	-	pfam_Paralemmin	ENSG00000243444		0.532	PALM2-002	KNOWN	basic|CCDS	protein_coding	PALM2	HGNC	protein_coding	OTTHUMT00000053604.1	39	0.00	0	C	NM_001037293		112705539	112705539	+1	no_errors	ENST00000448454	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	1.000	T
PCDHB18	54660	genome.wustl.edu	37	5	140615817	140615817	+	RNA	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:140615817C>T	ENST00000526308.1	+	0	1880					NR_001281.1		Q96TA0	PCDBI_HUMAN	protocadherin beta 18 pseudogene						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|lung(7)|ovary(1)|urinary_tract(1)	18						GTGCTGTACCCGCTGCAGAAC	0.726																																						dbGAP											0																																										-	-	-			0			AF152528		5q31.3	2014-03-20			ENSG00000146001	ENSG00000146001		"""Cadherins / Protocadherins : Clustered"""	14548	pseudogene	pseudogene						10380929	Standard	NR_001281		Approved	PCDH-psi2	uc003ljc.1	Q96TA0	OTTHUMG00000167484		5.37:g.140615817C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KTF8	RNA	SNP	-	NULL	ENST00000526308.1	37	NULL		5																																																																																			PCDHB18	-	-	ENSG00000146001		0.726	PCDHB18-002	KNOWN	basic	processed_transcript	PCDHB18	HGNC	pseudogene	OTTHUMT00000394776.1	19	0.00	0	C			140615817	140615817	+1	no_errors	ENST00000526308	ensembl	human	known	69_37n	rna	10	41.18	7	SNP	1.000	T
PDIA4	9601	genome.wustl.edu	37	7	148718177	148718177	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:148718177C>T	ENST00000286091.4	-	2	383	c.151G>A	c.(151-153)Gag>Aag	p.E51K		NM_004911.4	NP_004902.1	P13667	PDIA4_HUMAN	protein disulfide isomerase family A, member 4	51	Asp/Glu-rich (acidic).|Thioredoxin 1. {ECO:0000255|PROSITE- ProRule:PRU00691}.				cell redox homeostasis (GO:0045454)|chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein secretion (GO:0009306)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)	poly(A) RNA binding (GO:0044822)|protein disulfide isomerase activity (GO:0003756)			large_intestine(6)|lung(15)|ovary(2)|prostate(1)	24	Melanoma(164;0.15)		OV - Ovarian serous cystadenocarcinoma(82;0.00385)			tcttcttcctcatcatcatct	0.428																																						dbGAP											0													174.0	160.0	165.0					7																	148718177		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001928	CCDS5893.1	7q35	2009-11-20	2005-06-29		ENSG00000155660	ENSG00000155660	5.3.4.1	"""Protein disulfide isomerases"""	30167	protein-coding gene	gene with protein product			"""protein disulfide isomerase-associated 4"""			2549034, 2002068	Standard	NM_004911		Approved	ERP70, ERP72	uc003wff.2	P13667	OTTHUMG00000150248	ENST00000286091.4:c.151G>A	7.37:g.148718177C>T	ENSP00000286091:p.Glu51Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4K6|Q549T6	Missense_Mutation	SNP	pirsf_Protein_diS-isomerase_A4,pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin,prints_Calsequestrin,tigrfam_Prot_disulphide_isomerase,tigrfam_Disulphide_isomerase	p.E51K	ENST00000286091.4	37	c.151	CCDS5893.1	7	.	.	.	.	.	.	.	.	.	.	C	8.432	0.848915	0.17034	.	.	ENSG00000155660	ENST00000286091;ENST00000413966	T;T	0.24151	2.34;1.87	2.83	2.83	0.33086	Thioredoxin-like fold (1);	0.514245	0.20547	U	0.090182	T	0.20292	0.0488	L	0.57536	1.79	0.18873	N	0.999983	B	0.27498	0.18	B	0.19391	0.025	T	0.31223	-0.9951	10	0.02654	T	1	.	12.5209	0.56058	0.0:1.0:0.0:0.0	.	51	P13667	PDIA4_HUMAN	K	51;99	ENSP00000286091:E51K;ENSP00000408628:E99K	ENSP00000286091:E51K	E	-	1	0	PDIA4	148349110	1.000000	0.71417	0.003000	0.11579	0.570000	0.35934	7.441000	0.80485	1.190000	0.43042	0.454000	0.30748	GAG	PDIA4	-	pirsf_Protein_diS-isomerase_A4	ENSG00000155660		0.428	PDIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDIA4	HGNC	protein_coding	OTTHUMT00000317077.1	80	0.00	0	C	NM_004911		148718177	148718177	-1	no_errors	ENST00000286091	ensembl	human	known	69_37n	missense	135	21.97	38	SNP	0.274	T
PFKFB2	5208	genome.wustl.edu	37	1	207243670	207243670	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:207243670C>T	ENST00000367080.3	+	12	1262	c.1138C>T	c.(1138-1140)Ctg>Ttg	p.L380L	PFKFB2_ENST00000473310.1_Intron|PFKFB2_ENST00000545806.1_Silent_p.L347L|PFKFB2_ENST00000367079.2_Silent_p.L380L|PFKFB2_ENST00000411990.2_Silent_p.L282L|PFKFB2_ENST00000541914.1_Silent_p.L194L	NM_006212.2	NP_006203.2	O60825	F262_HUMAN	6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 2	380	Fructose-2,6-bisphosphatase.				carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose 2,6-bisphosphate metabolic process (GO:0006003)|fructose metabolic process (GO:0006000)|glucose catabolic process (GO:0006007)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|lactate metabolic process (GO:0006089)|positive regulation of glucokinase activity (GO:0033133)|positive regulation of insulin secretion (GO:0032024)|response to glucose (GO:0009749)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	6-phosphofructo-2-kinase activity (GO:0003873)|ATP binding (GO:0005524)|fructose-2,6-bisphosphate 2-phosphatase activity (GO:0004331)|protein kinase binding (GO:0019901)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(3)|liver(1)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	20	Prostate(682;0.19)					CATCATGGAGCTGGAACGTCA	0.617																																						dbGAP											0													88.0	64.0	72.0					1																	207243670		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31003.1, CCDS31004.1	1q31-q32.2	2012-07-13			ENSG00000123836	ENSG00000123836	2.7.1.105, 3.1.3.46		8873	protein-coding gene	gene with protein product		171835					Standard	XM_005273162		Approved		uc001hfg.3	O60825	OTTHUMG00000036033	ENST00000367080.3:c.1138C>T	1.37:g.207243670C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O60824|Q5VVQ3|Q5VVQ4|Q9H3P1	Silent	SNP	pfam_6Phosfructo_kin,pfam_His_Pase_superF_clade-1,pfam_Chromatin_KTI12,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase,prints_6Pfruct_kin	p.L380	ENST00000367080.3	37	c.1138	CCDS31004.1	1																																																																																			PFKFB2	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,pirsf_Bifunct_6PFK/fruc_bisP_Ptase	ENSG00000123836		0.617	PFKFB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFKFB2	HGNC	protein_coding	OTTHUMT00000087838.1	50	0.00	0	C			207243670	207243670	+1	no_errors	ENST00000367080	ensembl	human	known	69_37n	silent	99	17.36	21	SNP	1.000	T
PGRMC1	10857	genome.wustl.edu	37	X	118370396	118370396	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:118370396G>A	ENST00000217971.7	+	1	181	c.70G>A	c.(70-72)Gag>Aag	p.E24K	PGRMC1_ENST00000535419.1_Missense_Mutation_p.E24K	NM_006667.3	NP_006658.1	O00264	PGRC1_HUMAN	progesterone receptor membrane component 1	24					axon guidance (GO:0007411)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	heme binding (GO:0020037)|steroid binding (GO:0005496)			lung(6)	6					Dextromethorphan(DB00514)|Nortriptyline(DB00540)	GCTGCTGCATGAGATTTTCAC	0.647																																						dbGAP											0													34.0	27.0	29.0					X																	118370396		2198	4293	6491	-	-	-	SO:0001583	missense	0				CCDS14576.1, CCDS65313.1	Xq22-q24	2005-11-29			ENSG00000101856	ENSG00000101856			16090	protein-coding gene	gene with protein product		300435				9705155	Standard	NM_006667		Approved	HPR6.6	uc004erb.3	O00264	OTTHUMG00000022268	ENST00000217971.7:c.70G>A	X.37:g.118370396G>A	ENSP00000217971:p.Glu24Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z1L3|Q9UGJ9	Missense_Mutation	SNP	pfam_Cyt_B5,superfamily_Cyt_B5	p.E24K	ENST00000217971.7	37	c.70	CCDS14576.1	X	.	.	.	.	.	.	.	.	.	.	.	28.8	4.950409	0.92660	.	.	ENSG00000101856	ENST00000217971;ENST00000535419	T;T	0.79033	-1.18;-1.23	4.04	3.17	0.36434	.	0.000000	0.85682	D	0.000000	D	0.85013	0.5600	M	0.81614	2.55	0.58432	D	0.999999	D;P	0.67145	0.996;0.879	D;P	0.63381	0.914;0.625	D	0.84078	0.0383	10	0.45353	T	0.12	-4.2112	9.9993	0.41918	0.1059:0.0:0.8941:0.0	.	24;24	B7Z1L3;O00264	.;PGRC1_HUMAN	K	24	ENSP00000217971:E24K;ENSP00000442821:E24K	ENSP00000217971:E24K	E	+	1	0	PGRMC1	118254424	1.000000	0.71417	0.999000	0.59377	0.916000	0.54674	4.625000	0.61262	0.841000	0.35020	0.418000	0.28097	GAG	PGRMC1	-	NULL	ENSG00000101856		0.647	PGRMC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGRMC1	HGNC	protein_coding	OTTHUMT00000058024.1	25	0.00	0	G	NM_006667		118370396	118370396	+1	no_errors	ENST00000217971	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	A
PIGU	128869	genome.wustl.edu	37	20	33231980	33231980	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr20:33231980G>A	ENST00000374820.2	-	3	266	c.246C>T	c.(244-246)ttC>ttT	p.F82F	PIGU_ENST00000452740.2_Silent_p.F102F			Q9H490	PIGU_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class U	102					attachment of GPI anchor to protein (GO:0016255)|C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|GPI anchor biosynthetic process (GO:0006506)|post-translational protein modification (GO:0043687)|regulation of JAK-STAT cascade (GO:0046425)	endoplasmic reticulum membrane (GO:0005789)|GPI-anchor transamidase complex (GO:0042765)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(1)|lung(1)|skin(1)	9						CAACTTTATTGAAGTCCTGGA	0.373																																						dbGAP											0													116.0	111.0	113.0					20																	33231980		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL118520	CCDS13239.1	20q11.22	2013-02-26	2006-11-07	2006-11-07	ENSG00000101464	ENSG00000101464		"""Phosphatidylinositol glycan anchor biosynthesis"""	15791	protein-coding gene	gene with protein product	"""GPI transamidase subunit"""	608528	"""CDC91 (cell division cycle 91, S. cerevisiae, homolog)-like 1"", ""CDC91 cell division cycle 91-like 1 (S. cerevisiae)"""	CDC91L1		12802054, 15034568	Standard	NM_080476		Approved	bA346K17.2, GAB1	uc002xas.3	Q9H490	OTTHUMG00000032304	ENST00000374820.2:c.246C>T	20.37:g.33231980G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z489|Q8N2F2	Silent	SNP	pfam_PIG-U	p.F102	ENST00000374820.2	37	c.306		20																																																																																			PIGU	-	NULL	ENSG00000101464		0.373	PIGU-201	KNOWN	basic	protein_coding	PIGU	HGNC	protein_coding		55	0.00	0	G	NM_080476		33231980	33231980	-1	no_errors	ENST00000217446	ensembl	human	known	69_37n	silent	86	17.31	18	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178952085	178952085	+	Missense_Mutation	SNP	A	A	G	rs121913279		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:178952085A>G	ENST00000263967.3	+	21	3297	c.3140A>G	c.(3139-3141)cAt>cGt	p.H1047R	RP11-245C23.3_ENST00000609807.1_RNA	NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	1047	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.		H -> L (in BC; unknown pathological significance). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16353168}.|H -> R (in CLOVE, KERSEB, CRC, BC and OC; also found in an endometrial carcinoma sample; shows an increase in lipid kinase activity; oncogenic in vivo; requires binding to p85 regulatory subunit to induce cellular transformation but not interaction with RAS; may mimic the conformatitonal change triggered by the interaction with RAS; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells; increases lipid kinase activity; may alter the interaction of the PI3K/ PI4K kinase domain with the cell membrane). {ECO:0000269|PubMed:15016963, ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16114017, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22658544}.|H -> Y (in MCAP; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.H1047R(1387)|p.H1047L(194)|p.H1047P(1)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	AATGATGCACATCATGGTGGC	0.378	H1047L(EFM19_BREAST)|H1047R(BT20_BREAST)|H1047R(CAL29_URINARY_TRACT)|H1047R(CAL33_UPPER_AERODIGESTIVE_TRACT)|H1047R(DETROIT562_UPPER_AERODIGESTIVE_TRACT)|H1047R(HCC1954_BREAST)|H1047R(HCT116_LARGE_INTESTINE)|H1047R(HSC2_UPPER_AERODIGESTIVE_TRACT)|H1047R(LS180_LARGE_INTESTINE)|H1047R(MCAS_OVARY)|H1047R(MDAMB453_BREAST)|H1047R(NCIH1048_LUNG)|H1047R(RKO_LARGE_INTESTINE)|H1047R(SKOV3_OVARY)|H1047R(T47D_BREAST)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	1582	Substitution - Missense(1582)	breast(961)|large_intestine(245)|endometrium(114)|ovary(77)|urinary_tract(36)|upper_aerodigestive_tract(26)|lung(19)|central_nervous_system(19)|stomach(19)|haematopoietic_and_lymphoid_tissue(11)|thyroid(10)|NS(9)|liver(7)|kidney(6)|soft_tissue(6)|skin(4)|prostate(4)|pituitary(3)|pancreas(3)|meninges(1)|cervix(1)|bone(1)											99.0	89.0	92.0					3																	178952085		1912	4130	6042	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.3140A>G	3.37:g.178952085A>G	ENSP00000263967:p.His1047Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.H1047R	ENST00000263967.3	37	c.3140	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	A	14.34	2.506328	0.44558	.	.	ENSG00000121879	ENST00000263967	T	0.80214	-1.35	6.08	6.08	0.98989	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (3);	0.000000	0.85682	D	0.000000	T	0.62466	0.2430	N	0.08118	0	0.80722	D	1	P	0.38597	0.639	B	0.28011	0.085	T	0.67526	-0.5648	10	0.40728	T	0.16	-21.2893	16.6512	0.85203	1.0:0.0:0.0:0.0	.	1047	P42336	PK3CA_HUMAN	R	1047	ENSP00000263967:H1047R	ENSP00000263967:H1047R	H	+	2	0	PIK3CA	180434779	1.000000	0.71417	0.996000	0.52242	0.998000	0.95712	8.859000	0.92264	2.333000	0.79357	0.482000	0.46254	CAT	PIK3CA	-	superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	ENSG00000121879		0.378	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	33	0.00	0	A			178952085	178952085	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	23	60.34	35	SNP	1.000	G
PITRM1	10531	genome.wustl.edu	37	10	3191919	3191919	+	Missense_Mutation	SNP	C	C	T	rs368479367		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:3191919C>T	ENST00000224949.4	-	16	1799	c.1765G>A	c.(1765-1767)Gcc>Acc	p.A589T	PITRM1-AS1_ENST00000598280.1_RNA|PITRM1_ENST00000380989.2_Missense_Mutation_p.A589T|PITRM1_ENST00000451104.2_Missense_Mutation_p.A557T|PITRM1_ENST00000380994.1_Missense_Mutation_p.A147T|PITRM1-AS1_ENST00000601046.1_RNA|PITRM1_ENST00000464395.1_5'Flank			Q5JRX3	PREP_HUMAN	pitrilysin metallopeptidase 1	589					positive regulation of catalytic activity (GO:0043085)|proteolysis (GO:0006508)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	enzyme activator activity (GO:0008047)|metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			breast(2)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(5)|liver(1)|lung(5)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|urinary_tract(3)	33						GTGGGCTGGGCGCAGTACTGA	0.468																																						dbGAP											0													112.0	116.0	115.0					10																	3191919		1897	4128	6025	-	-	-	SO:0001583	missense	0			AB029027	CCDS55699.1, CCDS55700.1, CCDS59208.1	10p15.2	2008-07-30	2005-08-17		ENSG00000107959	ENSG00000107959			17663	protein-coding gene	gene with protein product	"""PreP peptidasome"""		"""pitrilysin metalloproteinase 1"""			1036083, 10470851, 16849325	Standard	NM_014889		Approved	MP1, KIAA1104, hMP1, PreP	uc009xhv.2	Q5JRX3	OTTHUMG00000017557	ENST00000224949.4:c.1765G>A	10.37:g.3191919C>T	ENSP00000224949:p.Ala589Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMJ6|B4E0J8|C9JSL2|E7ES23|O95204|Q2M2G6|Q4VBR1|Q5JRW7|Q7L5Z7|Q9BSI6|Q9BVJ5|Q9UPP8	Missense_Mutation	SNP	pfam_Peptidase_M16C_assoc,pfam_Peptidase_M16_C,pfam_Pept_M16_N,superfamily_Metalloenz_metal-bd	p.A589T	ENST00000224949.4	37	c.1765	CCDS59208.1	10	.	.	.	.	.	.	.	.	.	.	c	3.932	-0.015914	0.07681	.	.	ENSG00000107959	ENST00000224949;ENST00000380980;ENST00000380989;ENST00000380994;ENST00000451104	T;T;T;T	0.28895	1.59;1.59;1.59;1.59	5.66	1.53	0.23141	Peptidase M16C associated (1);Metalloenzyme, LuxS/M16 peptidase-like, metal-binding (1);	0.316998	0.38005	N	0.001850	T	0.19366	0.0465	L	0.39898	1.24	0.09310	N	0.999998	B;B;B;B;B	0.16603	0.0;0.018;0.014;0.014;0.004	B;B;B;B;B	0.16289	0.001;0.009;0.015;0.015;0.009	T	0.23797	-1.0178	10	0.18710	T	0.47	.	5.8538	0.18708	0.2212:0.4911:0.225:0.0626	.	582;557;589;589;582	E9PDX6;E7ES23;C9JSL2;Q5JRX3;B4DH07	.;.;.;PREP_HUMAN;.	T	589;582;589;147;557	ENSP00000224949:A589T;ENSP00000370377:A589T;ENSP00000370382:A147T;ENSP00000401201:A557T	ENSP00000224949:A589T	A	-	1	0	PITRM1	3181919	0.963000	0.33076	0.001000	0.08648	0.067000	0.16453	1.599000	0.36751	0.023000	0.15187	-0.268000	0.10319	GCC	PITRM1	-	pfam_Peptidase_M16C_assoc,superfamily_Metalloenz_metal-bd	ENSG00000107959		0.468	PITRM1-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PITRM1	HGNC	protein_coding	OTTHUMT00000046469.2	37	0.00	0	C			3191919	3191919	-1	no_errors	ENST00000380989	ensembl	human	known	69_37n	missense	27	28.95	11	SNP	0.387	T
PLK1	5347	genome.wustl.edu	37	16	23690577	23690577	+	Silent	SNP	C	C	G	rs143500319		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr16:23690577C>G	ENST00000300093.4	+	1	435	c.324C>G	c.(322-324)ctC>ctG	p.L108L	PLK1_ENST00000564202.1_3'UTR	NM_005030.3	NP_005021.2	P53350	PLK1_HUMAN	polo-like kinase 1	108	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of mitotic anaphase-promoting complex activity (GO:0007092)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|cell proliferation (GO:0008283)|centrosome organization (GO:0051297)|cytokinesis (GO:0000910)|establishment of protein localization (GO:0045184)|G2 DNA damage checkpoint (GO:0031572)|G2/M transition of mitotic cell cycle (GO:0000086)|metaphase/anaphase transition of mitotic cell cycle (GO:0007091)|microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic cytokinesis (GO:0000281)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-serine phosphorylation (GO:0018105)|polar body extrusion after meiotic divisions (GO:0040038)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of proteolysis (GO:0045862)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein destabilization (GO:0031648)|protein localization to chromatin (GO:0071168)|protein phosphorylation (GO:0006468)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|regulation of protein binding (GO:0043393)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|response to antibiotic (GO:0046677)	centrosome (GO:0005813)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)	anaphase-promoting complex binding (GO:0010997)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|microtubule binding (GO:0008017)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(10)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23				GBM - Glioblastoma multiforme(48;0.0156)		ACCGCAGCCTCGCCCACCAGC	0.582																																					Colon(12;240 564 27038 33155)	dbGAP											0													59.0	56.0	57.0					16																	23690577		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0				CCDS10616.1	16p	2013-01-17	2010-06-24	2004-01-28	ENSG00000166851	ENSG00000166851			9077	protein-coding gene	gene with protein product		602098	"""polo-like kinase (Drosophila)"""	PLK		8127874	Standard	NM_005030		Approved		uc002dlz.1	P53350	OTTHUMG00000096984	ENST00000300093.4:c.324C>G	16.37:g.23690577C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15153|Q99746	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_POLO_box_duplicated_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_POLO_box_duplicated_dom,pfscan_Prot_kinase_cat_dom	p.L108	ENST00000300093.4	37	c.324	CCDS10616.1	16																																																																																			PLK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000166851		0.582	PLK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK1	HGNC	protein_coding	OTTHUMT00000214057.2	37	0.00	0	C	NM_005030		23690577	23690577	+1	no_errors	ENST00000300093	ensembl	human	known	69_37n	silent	31	27.91	12	SNP	0.458	G
PMS1	5378	genome.wustl.edu	37	2	190742066	190742066	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:190742066C>G	ENST00000441310.2	+	13	2936	c.2703C>G	c.(2701-2703)atC>atG	p.I901M	PMS1_ENST00000409823.3_Missense_Mutation_p.I862M|PMS1_ENST00000418224.3_Missense_Mutation_p.I725M|PMS1_ENST00000432292.3_Missense_Mutation_p.I725M|PMS1_ENST00000447232.2_Missense_Mutation_p.I739M	NM_000534.4	NP_000525.1	P54277	PMS1_HUMAN	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)	901					ATP catabolic process (GO:0006200)|mismatch repair (GO:0006298)|response to drug (GO:0042493)	MutLalpha complex (GO:0032389)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|mismatched DNA binding (GO:0030983)|single-stranded DNA binding (GO:0003697)	p.I901M(1)		breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(16)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36			OV - Ovarian serous cystadenocarcinoma(117;0.0013)|Epithelial(96;0.0263)|all cancers(119;0.0751)			AAGACATTATCTACAGAATGA	0.378			"""Mis, N"""			"""colorectal, endometrial, ovarian"""		Direct reversal of damage;Mismatch excision repair (MMR)																														dbGAP	yes	Rec		Hereditary non-polyposis colorectal cancer	2	2q31-q33	5378	PMS1 postmeiotic segregation increased 1 (S. cerevisiae)		E	1	Substitution - Missense(1)	lung(1)											127.0	120.0	122.0					2																	190742066		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2302.1, CCDS46473.1, CCDS46474.1, CCDS74615.1	2q31-q33	2014-09-17	2001-11-28		ENSG00000064933	ENSG00000064933			9121	protein-coding gene	gene with protein product		600258	"""postmeiotic segregation increased (S. cerevisiae) 1"""	PMSL1		8072530	Standard	NM_000534		Approved		uc002urh.4	P54277	OTTHUMG00000132664	ENST00000441310.2:c.2703C>G	2.37:g.190742066C>G	ENSP00000406490:p.Ile901Met	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPI1|Q4VAL4|Q5FBZ3|Q5FBZ6|Q5FBZ8	Missense_Mutation	SNP	pfam_DNA_mismatch_repair_C,pfam_HMG_superfamily,pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily,tigrfam_DNA_mismatch_repair_N	p.I901M	ENST00000441310.2	37	c.2703	CCDS2302.1	2	.	.	.	.	.	.	.	.	.	.	C	10.32	1.316285	0.23908	.	.	ENSG00000064933	ENST00000441310;ENST00000418224;ENST00000409823;ENST00000447232;ENST00000432292;ENST00000409593	D;D;D;D;D;D	0.97279	-2.6;-2.34;-2.77;-3.12;-2.34;-4.32	5.76	0.514	0.17007	.	0.253669	0.46442	N	0.000291	D	0.91389	0.7283	N	0.25380	0.74	0.23325	N	0.997901	B;P;B;B;B	0.36753	0.009;0.568;0.201;0.077;0.058	B;B;B;B;B	0.38378	0.003;0.272;0.051;0.034;0.035	D	0.85375	0.1116	10	0.48119	T	0.1	-2.2883	2.6424	0.04975	0.2102:0.3483:0.3021:0.1394	.	217;524;862;739;901	Q5FBZ4;Q5FBZ6;Q5FBZ3;Q5FBZ8;P54277	.;.;.;.;PMS1_HUMAN	M	901;725;862;739;725;524	ENSP00000406490:I901M;ENSP00000404492:I725M;ENSP00000387125:I862M;ENSP00000401064:I739M;ENSP00000398378:I725M;ENSP00000387169:I524M	ENSP00000387169:I524M	I	+	3	3	PMS1	190450311	0.071000	0.21146	0.902000	0.35471	0.989000	0.77384	0.092000	0.15066	0.424000	0.26061	-0.150000	0.13652	ATC	PMS1	-	NULL	ENSG00000064933		0.378	PMS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMS1	HGNC	protein_coding	OTTHUMT00000255918.2	52	0.00	0	C			190742066	190742066	+1	no_errors	ENST00000441310	ensembl	human	known	69_37n	missense	120	11.76	16	SNP	0.296	G
PPARGC1A	10891	genome.wustl.edu	37	4	23814411	23814411	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:23814411C>G	ENST00000264867.2	-	10	2097	c.1978G>C	c.(1978-1980)Gag>Cag	p.E660Q	PPARGC1A_ENST00000509702.1_5'UTR	NM_013261.3	NP_037393.1	Q9UBK2	PRGC1_HUMAN	peroxisome proliferator-activated receptor gamma, coactivator 1 alpha	660	Mediates interaction with RNF34. {ECO:0000269|PubMed:22064484}.				androgen metabolic process (GO:0008209)|androgen receptor signaling pathway (GO:0030521)|brown fat cell differentiation (GO:0050873)|cellular glucose homeostasis (GO:0001678)|cellular respiration (GO:0045333)|cellular response to fatty acid (GO:0071398)|cellular response to hypoxia (GO:0071456)|cellular response to nitrite (GO:0071250)|cellular response to oxidative stress (GO:0034599)|cellular response to thyroid hormone stimulus (GO:0097067)|cellular response to tumor necrosis factor (GO:0071356)|circadian regulation of gene expression (GO:0032922)|digestion (GO:0007586)|fatty acid oxidation (GO:0019395)|flavone metabolic process (GO:0051552)|galactose metabolic process (GO:0006012)|gluconeogenesis (GO:0006094)|mitochondrion organization (GO:0007005)|mRNA processing (GO:0006397)|negative regulation of glycolytic process (GO:0045820)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of neuron death (GO:1901215)|negative regulation of receptor activity (GO:2000272)|positive regulation of ATP biosynthetic process (GO:2001171)|positive regulation of cellular respiration (GO:1901857)|positive regulation of energy homeostasis (GO:2000507)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of histone acetylation (GO:0035066)|positive regulation of mitochondrial DNA metabolic process (GO:1901860)|positive regulation of mitochondrion organization (GO:0010822)|positive regulation of muscle tissue development (GO:1901863)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein stabilization (GO:0050821)|regulation of circadian rhythm (GO:0042752)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of transcription, DNA-templated (GO:0006355)|respiratory electron transport chain (GO:0022904)|response to cold (GO:0009409)|response to epinephrine (GO:0071871)|response to leucine (GO:0043201)|response to muscle activity (GO:0014850)|response to norepinephrine (GO:0071873)|response to starvation (GO:0042594)|response to statin (GO:0036273)|RNA splicing (GO:0008380)|temperature homeostasis (GO:0001659)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytosol (GO:0005829)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|chromatin DNA binding (GO:0031490)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)|RNA polymerase II transcription cofactor activity (GO:0001104)|sequence-specific DNA binding (GO:0043565)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(7)|liver(1)|lung(24)|ovary(3)|skin(5)	51		Breast(46;0.0503)				TTGGCCCTCTCAGACTCTCGC	0.458																																					Esophageal Squamous(29;694 744 13796 34866 44181)	dbGAP											0													175.0	166.0	169.0					4																	23814411		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF106698	CCDS3429.1	4p15.1	2013-02-12	2006-10-17	2004-02-04	ENSG00000109819	ENSG00000109819		"""RNA binding motif (RRM) containing"""	9237	protein-coding gene	gene with protein product		604517	"""peroxisome proliferative activated receptor, gamma, coactivator 1"", ""peroxisome proliferative activated receptor, gamma, coactivator 1, alpha"""	PPARGC1		10585775	Standard	NM_013261		Approved	PGC1, PGC1A	uc003gqs.3	Q9UBK2	OTTHUMG00000097747	ENST00000264867.2:c.1978G>C	4.37:g.23814411C>G	ENSP00000264867:p.Glu660Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z406|G8DM16|I3RTT5|I3RTT6|I3RTT7|I3RTT8|I3RTT9|Q3LIG1|Q4W5M7|Q9UN32	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E660Q	ENST00000264867.2	37	c.1978	CCDS3429.1	4	.	.	.	.	.	.	.	.	.	.	C	14.35	2.508852	0.44660	.	.	ENSG00000109819	ENST00000264867	T	0.24350	1.86	5.34	5.34	0.76211	Nucleotide-binding, alpha-beta plait (1);	0.000000	0.85682	D	0.000000	T	0.33847	0.0877	M	0.66939	2.045	0.80722	D	1	B	0.29531	0.247	B	0.32805	0.153	T	0.08827	-1.0703	10	0.37606	T	0.19	-3.3535	19.0395	0.92992	0.0:1.0:0.0:0.0	.	660	Q9UBK2	PRGC1_HUMAN	Q	660	ENSP00000264867:E660Q	ENSP00000264867:E660Q	E	-	1	0	PPARGC1A	23423509	1.000000	0.71417	0.934000	0.37439	0.945000	0.59286	7.487000	0.81328	2.486000	0.83907	0.655000	0.94253	GAG	PPARGC1A	-	NULL	ENSG00000109819		0.458	PPARGC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPARGC1A	HGNC	protein_coding	OTTHUMT00000214976.1	125	0.00	0	C	NM_013261		23814411	23814411	-1	no_errors	ENST00000264867	ensembl	human	known	69_37n	missense	148	27.80	57	SNP	1.000	G
PPFIA1	8500	genome.wustl.edu	37	11	70202291	70202291	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:70202291C>T	ENST00000253925.7	+	19	2728	c.2513C>T	c.(2512-2514)tCa>tTa	p.S838L	AP000487.4_ENST00000324630.5_RNA|PPFIA1_ENST00000389547.3_Missense_Mutation_p.S838L|AP000487.6_ENST00000528607.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	838					cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			ACGGATAACTCATCTCAGGAT	0.403																																						dbGAP											0													139.0	145.0	143.0					11																	70202291		2200	4294	6494	-	-	-	SO:0001583	missense	0			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.2513C>T	11.37:g.70202291C>T	ENSP00000253925:p.Ser838Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NLE3|Q13135|Q14567|Q8N4I2	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.S838L	ENST00000253925.7	37	c.2513	CCDS31627.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.37|18.37	3.610145|3.610145	0.66558|0.66558	.|.	.|.	ENSG00000131626|ENSG00000131626	ENST00000528750|ENST00000253925;ENST00000389547;ENST00000544950	.|T;T	.|0.18657	.|2.2;2.2	5.15|5.15	3.22|3.22	0.36961|0.36961	.|.	.|0.228648	.|0.37623	.|N	.|0.002006	T|T	0.14917|0.14917	0.0360|0.0360	L|L	0.31420|0.31420	0.93|0.93	0.21579|0.21579	N|N	0.999635|0.999635	.|B;B	.|0.13145	.|0.004;0.007	.|B;B	.|0.17722	.|0.013;0.019	T|T	0.20075|0.20075	-1.0286|-1.0286	5|10	.|0.29301	.|T	.|0.29	.|.	10.7216|10.7216	0.46044|0.46044	0.0:0.7963:0.132:0.0718|0.0:0.7963:0.132:0.0718	.|.	.|838;838	.|Q13136;Q13136-2	.|LIPA1_HUMAN;.	Y|L	281|838;838;335	.|ENSP00000253925:S838L;ENSP00000374198:S838L	.|ENSP00000253925:S838L	H|S	+|+	1|2	0|0	PPFIA1|PPFIA1	69879939|69879939	0.562000|0.562000	0.26586|0.26586	0.007000|0.007000	0.13788|0.13788	0.463000|0.463000	0.32649|0.32649	3.645000|3.645000	0.54389|0.54389	0.641000|0.641000	0.30601|0.30601	0.655000|0.655000	0.94253|0.94253	CAT|TCA	PPFIA1	-	NULL	ENSG00000131626		0.403	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	48	0.00	0	C	NM_003626		70202291	70202291	+1	no_errors	ENST00000253925	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	0.213	T
PPIL2	23759	genome.wustl.edu	37	22	22041956	22041956	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr22:22041956A>T	ENST00000335025.8	+	13	1013	c.922A>T	c.(922-924)Atc>Ttc	p.I308F	PPIL2_ENST00000492445.2_Missense_Mutation_p.I308F|PPIL2_ENST00000456792.2_Missense_Mutation_p.I287F|PPIL2_ENST00000406385.1_Missense_Mutation_p.I308F|PPIL2_ENST00000446951.1_3'UTR|PPIL2_ENST00000398831.3_Missense_Mutation_p.I308F|PPIL2_ENST00000412327.1_Missense_Mutation_p.I308F					peptidylprolyl isomerase (cyclophilin)-like 2											endometrium(4)|kidney(2)|large_intestine(4)|lung(3)|ovary(2)|skin(2)	17	Colorectal(54;0.105)					CGAAAACTTCATCAGGCTTTG	0.493																																						dbGAP											0													104.0	104.0	104.0					22																	22041956		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13793.1	22q11.21	2013-01-29			ENSG00000100023	ENSG00000100023		"""U-box domain containing"""	9261	protein-coding gene	gene with protein product	"""U-box domain containing 7"""	607588				10591208	Standard	NM_014337		Approved	UBOX7, CYC4, Cyp-60	uc002zvh.4	Q13356	OTTHUMG00000030174	ENST00000335025.8:c.922A>T	22.37:g.22041956A>T	ENSP00000334553:p.Ile308Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,smart_Ubox_domain,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.I308F	ENST00000335025.8	37	c.922	CCDS13793.1	22	.	.	.	.	.	.	.	.	.	.	A	25.1	4.599380	0.87055	.	.	ENSG00000100023	ENST00000412327;ENST00000335025;ENST00000398831;ENST00000492445;ENST00000406385;ENST00000456792;ENST00000446951	T;T;T;T;T;T;T	0.24908	1.83;1.83;1.83;1.83;1.83;1.83;1.83	5.05	5.05	0.67936	Peptidyl-prolyl cis-trans isomerase, cyclophilin-type (4);Cyclophilin-like (1);	0.048951	0.85682	D	0.000000	T	0.48960	0.1529	M	0.80746	2.51	0.80722	D	1	D;P;D	0.76494	0.997;0.948;0.999	D;B;D	0.70016	0.967;0.344;0.967	T	0.53585	-0.8418	10	0.87932	D	0	.	8.7724	0.34740	0.913:0.0:0.087:0.0	.	287;308;308	E7EW80;Q13356-2;Q13356	.;.;PPIL2_HUMAN	F	308;308;308;308;308;287;88	ENSP00000390427:I308F;ENSP00000334553:I308F;ENSP00000381812:I308F;ENSP00000445312:I308F;ENSP00000384299:I308F;ENSP00000396228:I287F;ENSP00000405214:I88F	ENSP00000334553:I308F	I	+	1	0	PPIL2	20371956	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	4.967000	0.63722	2.034000	0.60081	0.459000	0.35465	ATC	PPIL2	-	pfam_Cyclophilin-like_PPIase_dom,superfamily_Cyclophilin-like_PPIase_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	ENSG00000100023		0.493	PPIL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIL2	HGNC	protein_coding	OTTHUMT00000075028.4	67	0.00	0	A			22041956	22041956	+1	no_errors	ENST00000412327	ensembl	human	known	69_37n	missense	39	27.27	15	SNP	1.000	T
PRKCA	5578	genome.wustl.edu	37	17	64685156	64685156	+	Frame_Shift_Del	DEL	G	G	-			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:64685156delG	ENST00000413366.3	+	8	935	c.909delG	c.(907-909)cagfs	p.Q303fs		NM_002737.2	NP_002728	P17252	KPCA_HUMAN	protein kinase C, alpha	303					activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|angiogenesis (GO:0001525)|apoptotic signaling pathway (GO:0097190)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|chondrocyte differentiation (GO:0002062)|desmosome assembly (GO:0002159)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|extracellular matrix organization (GO:0030198)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|histone H3-T6 phosphorylation (GO:0035408)|inactivation of MAPK activity (GO:0000188)|induction of positive chemotaxis (GO:0050930)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|mRNA metabolic process (GO:0016071)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of cell proliferation (GO:0008285)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of glucose import (GO:0046325)|negative regulation of insulin receptor signaling pathway (GO:0046627)|neurotrophin TRK receptor signaling pathway (GO:0048011)|neutrophil chemotaxis (GO:0030593)|peptidyl-serine autophosphorylation (GO:0036289)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell migration (GO:0030335)|positive regulation of dense core granule biogenesis (GO:2000707)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein phosphorylation (GO:0001934)|protein phosphorylation (GO:0006468)|regulation of insulin secretion (GO:0050796)|regulation of muscle contraction (GO:0006937)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|regulation of platelet aggregation (GO:0090330)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|regulation of the force of heart contraction (GO:0002026)|response to interleukin-1 (GO:0070555)|rhodopsin mediated signaling pathway (GO:0016056)|RNA metabolic process (GO:0016070)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium-dependent protein kinase C activity (GO:0004698)|enzyme binding (GO:0019899)|histone kinase activity (H3-T6 specific) (GO:0035403)|protein kinase activity (GO:0004672)|protein kinase C activity (GO:0004697)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(17)|ovary(1)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	38			BRCA - Breast invasive adenocarcinoma(6;4.68e-09)		Ingenol Mebutate(DB05013)|Phosphatidylserine(DB00144)|Tamoxifen(DB00675)|Vitamin E(DB00163)	AACTCAGGCAGAAATTCGAGG	0.468																																						dbGAP											0													85.0	72.0	77.0					17																	64685156		2203	4300	6503	-	-	-	SO:0001589	frameshift_variant	0				CCDS11664.1	17q22-q24	2009-07-10				ENSG00000154229	2.7.11.1		9393	protein-coding gene	gene with protein product		176960		PKCA			Standard	NM_002737		Approved		uc002jfp.1	P17252		ENST00000413366.3:c.909delG	17.37:g.64685156delG	ENSP00000408695:p.Gln303fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B5BU22|Q15137|Q32M72|Q96RE4	Frame_Shift_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd,prints_C2_dom	p.K304fs	ENST00000413366.3	37	c.909	CCDS11664.1	17																																																																																			PRKCA	-	pirsf_Protein_kinase_C_a/b/g	ENSG00000154229		0.468	PRKCA-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCA	HGNC	protein_coding	OTTHUMT00000446976.1	45	0.00	0	G			64685156	64685156	+1	no_errors	ENST00000413366	ensembl	human	known	69_37n	frame_shift_del	33	32.65	16	DEL	1.000	-
PRKCB	5579	genome.wustl.edu	37	16	24104239	24104239	+	Silent	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr16:24104239C>G	ENST00000321728.7	+	6	832	c.657C>G	c.(655-657)ctC>ctG	p.L219L	PRKCB_ENST00000482000.1_3'UTR|PRKCB_ENST00000303531.7_Silent_p.L219L	NM_212535.2	NP_997700.1	P05771	KPCB_HUMAN	protein kinase C, beta	219	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|B cell activation (GO:0042113)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|cellular calcium ion homeostasis (GO:0006874)|cellular response to carbohydrate stimulus (GO:0071322)|histone H3-T6 phosphorylation (GO:0035408)|intracellular signal transduction (GO:0035556)|lipoprotein transport (GO:0042953)|negative regulation of glucose transport (GO:0010829)|negative regulation of insulin receptor signaling pathway (GO:0046627)|platelet activation (GO:0030168)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|chromatin binding (GO:0003682)|histone binding (GO:0042393)|histone kinase activity (H3-T6 specific) (GO:0035403)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein kinase C activity (GO:0004697)|protein kinase C binding (GO:0005080)|protein serine/threonine kinase activity (GO:0004674)|zinc ion binding (GO:0008270)			central_nervous_system(3)|large_intestine(1)|lung(2)|ovary(3)	9					Tamoxifen(DB00675)|Vitamin E(DB00163)	AATGCTCCCTCAACCCTGAGT	0.473																																						dbGAP											0													150.0	124.0	133.0					16																	24104239		2197	4300	6497	-	-	-	SO:0001819	synonymous_variant	0			M13975	CCDS10618.1, CCDS10619.1	16p12	2009-07-10	2008-08-18	2008-08-18	ENSG00000166501	ENSG00000166501	2.7.11.1		9395	protein-coding gene	gene with protein product		176970	"""protein kinase C, beta 1"""	PRKCB2, PKCB, PRKCB1		3658678	Standard	NM_002738		Approved		uc002dme.3	P05771	OTTHUMG00000131615	ENST00000321728.7:c.657C>G	16.37:g.24104239C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	C5IFJ8|D3DWF5|O43744|P05127|Q15138|Q93060|Q9UE49|Q9UE50|Q9UEH8|Q9UJ30|Q9UJ33	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_C2_Ca-dep,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_C2_Ca-dep,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Protein_kinase_C_a/b/g,prints_DAG/PE-bd,prints_C2_dom,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.L219	ENST00000321728.7	37	c.657	CCDS10618.1	16																																																																																			PRKCB	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pirsf_Protein_kinase_C_a/b/g,prints_C2_dom,pfscan_C2_membr_targeting	ENSG00000166501		0.473	PRKCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKCB	HGNC	protein_coding	OTTHUMT00000254504.2	58	0.00	0	C	NM_212535		24104239	24104239	+1	no_errors	ENST00000303531	ensembl	human	known	69_37n	silent	89	18.35	20	SNP	0.997	G
PRR12	57479	genome.wustl.edu	37	19	50118164	50118164	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:50118164G>A	ENST00000418929.2	+	8	4934	c.4922G>A	c.(4921-4923)cGg>cAg	p.R1641Q		NM_020719.1	NP_065770.1	Q9ULL5	PRR12_HUMAN	proline rich 12	820							DNA binding (GO:0003677)			NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(2)|pancreas(1)|prostate(2)	11		all_lung(116;2.45e-07)|Lung NSC(112;1.24e-06)|Ovarian(192;0.0728)|all_neural(266;0.0887)		OV - Ovarian serous cystadenocarcinoma(262;0.00319)|GBM - Glioblastoma multiforme(134;0.0132)		GCAAAAAATCGGTACCAGCGC	0.522																																						dbGAP											0													64.0	63.0	63.0					19																	50118164		1889	4120	6009	-	-	-	SO:0001583	missense	0			AB033031	CCDS46143.1	19q13.33	2008-07-02	2006-02-06	2006-02-06		ENSG00000126464			29217	protein-coding gene	gene with protein product			"""KIAA1205"""	KIAA1205		10574462	Standard	NM_020719		Approved		uc002poo.4	Q9ULL5		ENST00000418929.2:c.4922G>A	19.37:g.50118164G>A	ENSP00000394510:p.Arg1641Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PB06|Q8N4J6	Missense_Mutation	SNP	NULL	p.R1641Q	ENST00000418929.2	37	c.4922	CCDS46143.1	19	.	.	.	.	.	.	.	.	.	.	G	19.23	3.788223	0.70337	.	.	ENSG00000126464	ENST00000418929;ENST00000246798;ENST00000314734	.	.	.	4.38	4.38	0.52667	.	0.000000	0.39475	N	0.001343	T	0.74458	0.3719	L	0.55481	1.735	0.50171	D	0.99985	D	0.89917	1.0	D	0.81914	0.995	T	0.75991	-0.3122	9	0.51188	T	0.08	-26.7978	15.874	0.79148	0.0:0.0:1.0:0.0	.	1641	Q9ULL5-3	.	Q	1641;821;821	.	ENSP00000246798:R821Q	R	+	2	0	PRR12	54809976	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	5.655000	0.67981	2.282000	0.76494	0.655000	0.94253	CGG	PRR12	-	NULL	ENSG00000126464		0.522	PRR12-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR12	HGNC	protein_coding	OTTHUMT00000465915.1	49	0.00	0	G	NM_020719		50118164	50118164	+1	no_errors	ENST00000418929	ensembl	human	known	69_37n	missense	74	10.84	9	SNP	1.000	A
PTPN13	5783	genome.wustl.edu	37	4	87691103	87691103	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:87691103G>A	ENST00000411767.2	+	29	4734	c.4671G>A	c.(4669-4671)gtG>gtA	p.V1557V	PTPN13_ENST00000511467.1_Silent_p.V1562V|PTPN13_ENST00000427191.2_Silent_p.V1538V|PTPN13_ENST00000436978.1_Silent_p.V1562V|PTPN13_ENST00000316707.6_Silent_p.V1366V			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1557	PDZ 3. {ECO:0000255|PROSITE- ProRule:PRU00143}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		TCTTGAAAGTGAATGGAGCCT	0.413																																						dbGAP											0													156.0	152.0	153.0					4																	87691103		1912	4125	6037	-	-	-	SO:0001819	synonymous_variant	0				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.4671G>A	4.37:g.87691103G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Silent	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.V1562	ENST00000411767.2	37	c.4686	CCDS47094.1	4																																																																																			PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000163629		0.413	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	57	0.00	0	G			87691103	87691103	+1	no_errors	ENST00000436978	ensembl	human	known	69_37n	silent	66	25.84	23	SNP	1.000	A
PTRF	284119	genome.wustl.edu	37	17	40556903	40556903	+	Silent	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:40556903G>C	ENST00000357037.5	-	2	1394	c.975C>G	c.(973-975)gtC>gtG	p.V325V		NM_012232.5	NP_036364.2			polymerase I and transcript release factor											breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(2)|urinary_tract(1)	17		all_cancers(22;0.00146)|Breast(137;0.00116)|all_epithelial(22;0.0134)		BRCA - Breast invasive adenocarcinoma(366;0.193)		GGATCTTCTTGACGTGGAAGG	0.677																																						dbGAP											0													85.0	74.0	78.0					17																	40556903		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF000421	CCDS11425.1	17q21.31	2011-04-20				ENSG00000177469			9688	protein-coding gene	gene with protein product		603198				9582279	Standard	NM_012232		Approved	cavin-1, CAVIN1	uc002hzo.3	Q6NZI2		ENST00000357037.5:c.975C>G	17.37:g.40556903G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.V325	ENST00000357037.5	37	c.975	CCDS11425.1	17																																																																																			PTRF	-	NULL	ENSG00000177469		0.677	PTRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTRF	HGNC	protein_coding	OTTHUMT00000449938.1	15	0.00	0	G	NM_012232		40556903	40556903	-1	no_errors	ENST00000357037	ensembl	human	known	69_37n	silent	22	29.03	9	SNP	1.000	C
RAPGEF1	2889	genome.wustl.edu	37	9	134503379	134503379	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr9:134503379G>A	ENST00000372189.3	-	9	1194	c.1071C>T	c.(1069-1071)ctC>ctT	p.L357L	RAPGEF1_ENST00000481260.1_5'UTR|RAPGEF1_ENST00000372190.3_Silent_p.L375L|RAPGEF1_ENST00000372195.1_Silent_p.L374L	NM_005312.2	NP_005303.2	Q13905	RPGF1_HUMAN	Rap guanine nucleotide exchange factor (GEF) 1	357					activation of MAPKK activity (GO:0000186)|blood vessel development (GO:0001568)|cellular response to cAMP (GO:0071320)|cellular response to nerve growth factor stimulus (GO:1990090)|establishment of endothelial barrier (GO:0061028)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of Ras protein signal transduction (GO:0046580)|nerve growth factor signaling pathway (GO:0038180)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of neuron projection development (GO:0010976)|positive regulation of Rap GTPase activity (GO:0032854)|Rap protein signal transduction (GO:0032486)|regulation of cell junction assembly (GO:1901888)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cytosol (GO:0005829)|early endosome (GO:0005769)|endosome (GO:0005768)	Rap guanyl-nucleotide exchange factor activity (GO:0017034)			NS(2)|breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(8)|lung(9)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	39		Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;2.19e-05)|Epithelial(140;0.000364)		CTGACTTGCTGAGCTTGCCTA	0.592																																						dbGAP											0													40.0	45.0	43.0					9																	134503379		2163	4252	6415	-	-	-	SO:0001819	synonymous_variant	0			BC041710	CCDS48047.1	9q34.3	2008-02-05	2004-03-01	2004-03-02	ENSG00000107263	ENSG00000107263			4568	protein-coding gene	gene with protein product		600303	"""guanine nucleotide-releasing factor 2 (specific for crk proto-oncogene)"""	GRF2		7959692, 7512734	Standard	NM_005312		Approved	C3G	uc022bos.1	Q13905	OTTHUMG00000020829	ENST00000372189.3:c.1071C>T	9.37:g.134503379G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JUE4|Q8IV73	Silent	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,superfamily_Ras_GEF_dom,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.L375	ENST00000372189.3	37	c.1125	CCDS48047.1	9																																																																																			RAPGEF1	-	NULL	ENSG00000107263		0.592	RAPGEF1-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	RAPGEF1	HGNC	protein_coding	OTTHUMT00000054759.2	26	0.00	0	G	NM_005312		134503379	134503379	-1	no_errors	ENST00000372190	ensembl	human	known	69_37n	silent	22	37.14	13	SNP	0.997	A
REV3L	5980	genome.wustl.edu	37	6	111696566	111696566	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:111696566C>T	ENST00000358835.3	-	14	3446	c.2992G>A	c.(2992-2994)Gac>Aac	p.D998N	REV3L_ENST00000368805.1_Missense_Mutation_p.D998N|REV3L_ENST00000368802.3_Missense_Mutation_p.D998N|REV3L_ENST00000435970.1_Missense_Mutation_p.D920N			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	998					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		TCTTTAGAGTCTATTTTTCCT	0.323								DNA polymerases (catalytic subunits)																														dbGAP											0													42.0	39.0	40.0					6																	111696566		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.2992G>A	6.37:g.111696566C>T	ENSP00000351697:p.Asp998Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.D998N	ENST00000358835.3	37	c.2992	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	17.51	3.406778	0.62399	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02974	4.17;4.17;4.17;4.09	6.02	6.02	0.97574	Ribonuclease H-like (1);	0.116521	0.64402	D	0.000020	T	0.03220	0.0094	M	0.71581	2.175	0.38186	D	0.939778	B	0.33549	0.417	B	0.28553	0.091	T	0.30621	-0.9972	10	0.87932	D	0	-24.0001	20.5407	0.99260	0.0:1.0:0.0:0.0	.	998	O60673	DPOLZ_HUMAN	N	998;998;998;920	ENSP00000357792:D998N;ENSP00000357795:D998N;ENSP00000351697:D998N;ENSP00000402003:D920N	ENSP00000351697:D998N	D	-	1	0	REV3L	111803259	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	4.399000	0.59703	2.865000	0.98341	0.655000	0.94253	GAC	REV3L	-	superfamily_RNaseH-like_dom	ENSG00000009413		0.323	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	51	0.00	0	C	NM_002912		111696566	111696566	-1	no_errors	ENST00000358835	ensembl	human	known	69_37n	missense	53	22.06	15	SNP	1.000	T
RFXANK	8625	genome.wustl.edu	37	19	19304852	19304852	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:19304852G>C	ENST00000303088.4	+	3	571	c.97G>C	c.(97-99)Gat>Cat	p.D33H	RFXANK_ENST00000407360.3_Missense_Mutation_p.D33H|MEF2BNB_ENST00000494489.2_5'Flank|MEF2B_ENST00000602424.2_5'Flank|RFXANK_ENST00000353145.1_Missense_Mutation_p.D33H|MEF2BNB_ENST00000477565.3_5'Flank|MEF2BNB_ENST00000585679.1_5'Flank|MEF2B_ENST00000162023.5_5'Flank|MEF2BNB-MEF2B_ENST00000514819.3_5'Flank|MEF2BNB-MEF2B_ENST00000444486.3_5'Flank|RFXANK_ENST00000392324.4_Missense_Mutation_p.D33H|MEF2BNB_ENST00000462790.3_5'Flank|RFXANK_ENST00000456252.3_Missense_Mutation_p.D33H	NM_003721.2	NP_003712.1	O14593	RFXK_HUMAN	regulatory factor X-associated ankyrin-containing protein	33					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Ras protein signal transduction (GO:0007265)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)			NS(1)|breast(1)|endometrium(1)|lung(8)|ovary(2)|prostate(1)	14			Epithelial(12;0.00228)			GGAGGCTGCAGATGGCTCAGA	0.597																																						dbGAP											0													146.0	130.0	135.0					19																	19304852		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF094760	CCDS12395.1, CCDS12396.1, CCDS62611.1	19p12	2014-09-17			ENSG00000064490	ENSG00000064490		"""Ankyrin repeat domain containing"""	9987	protein-coding gene	gene with protein product	"""ankyrin repeat-containing regulatory factor X-associated protein"", ""regulatory factor X subunit B"", ""RFX-Bdelta4"", ""DNA-binding protein RFXANK"""	603200				9806546, 10072068	Standard	NM_003721		Approved	BLS, RFX-B, ANKRA1, F14150_1, MGC138628	uc002nls.3	O14593	OTTHUMG00000169224	ENST00000303088.4:c.97G>C	19.37:g.19304852G>C	ENSP00000305071:p.Asp33His	Somatic		WXS	Illumina GAIIx	Phase_IV	O95839|Q24JQ1|Q6FGA8	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_DNA-bd_RFXANK,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.D33H	ENST00000303088.4	37	c.97	CCDS12395.1	19	.	.	.	.	.	.	.	.	.	.	G	13.35	2.210963	0.39102	.	.	ENSG00000064490	ENST00000353145;ENST00000421262;ENST00000456252;ENST00000303088;ENST00000407360;ENST00000543652;ENST00000540981;ENST00000541873;ENST00000392324	T;T;T;T;T;T;T;T	0.60920	0.99;0.15;1.06;0.82;0.74;1.5;1.53;0.99	4.41	4.41	0.53225	.	0.322546	0.29133	N	0.013042	T	0.59569	0.2203	L	0.29908	0.895	0.09310	N	0.999997	D;D;D;D	0.67145	0.995;0.994;0.996;0.995	P;P;D;P	0.63877	0.883;0.831;0.919;0.883	T	0.50792	-0.8786	10	0.21540	T	0.41	-12.0645	12.5174	0.56040	0.0:0.0:1.0:0.0	.	33;33;33;33	Q6IB23;Q24JQ1;O14593-2;O14593	.;.;.;RFXK_HUMAN	H	33	ENSP00000262804:D33H;ENSP00000393159:D33H;ENSP00000409138:D33H;ENSP00000305071:D33H;ENSP00000384572:D33H;ENSP00000439581:D33H;ENSP00000440325:D33H;ENSP00000376138:D33H	ENSP00000305071:D33H	D	+	1	0	RFXANK	19165852	0.972000	0.33761	0.062000	0.19696	0.261000	0.26267	4.289000	0.59013	2.018000	0.59344	0.462000	0.41574	GAT	RFXANK	-	pirsf_DNA-bd_RFXANK	ENSG00000064490		0.597	RFXANK-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	RFXANK	HGNC	protein_coding	OTTHUMT00000402923.2	56	0.00	0	G	NM_003721		19304852	19304852	+1	no_errors	ENST00000303088	ensembl	human	known	69_37n	missense	58	20.55	15	SNP	0.221	C
RHOBTB3	22836	genome.wustl.edu	37	5	95084070	95084070	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:95084070C>G	ENST00000379982.3	+	4	957	c.449C>G	c.(448-450)tCa>tGa	p.S150*		NM_014899.3	NP_055714.3	O94955	RHBT3_HUMAN	Rho-related BTB domain containing 3	150	Rho-like.				ATP catabolic process (GO:0006200)|retrograde transport, endosome to Golgi (GO:0042147)|small GTPase mediated signal transduction (GO:0007264)	Golgi apparatus (GO:0005794)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|GTP binding (GO:0005525)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|skin(1)	16		all_cancers(142;2.58e-06)|all_epithelial(76;4.19e-09)|all_lung(232;0.00307)|Lung NSC(167;0.00452)|Ovarian(225;0.0164)|Colorectal(57;0.0846)|Breast(839;0.198)		all cancers(79;8.79e-16)		CTATGTACCTCAGACAGAGGG	0.388																																						dbGAP											0													90.0	83.0	85.0					5																	95084070		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB020685	CCDS4077.1	5q15	2014-05-09			ENSG00000164292	ENSG00000164292		"""BTB/POZ domain containing"""	18757	protein-coding gene	gene with protein product		607353				11222756, 17035353	Standard	NM_014899		Approved	KIAA0878	uc003klm.3	O94955	OTTHUMG00000121171	ENST00000379982.3:c.449C>G	5.37:g.95084070C>G	ENSP00000369318:p.Ser150*	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJA4|A8K1W9|Q8IW06	Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_Small_GTPase,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pfscan_BTB/POZ-like	p.S150*	ENST00000379982.3	37	c.449	CCDS4077.1	5	.	.	.	.	.	.	.	.	.	.	C	16.69	3.193103	0.58017	.	.	ENSG00000164292	ENST00000506959;ENST00000379982	.	.	.	5.66	5.66	0.87406	.	0.066698	0.64402	D	0.000006	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-13.0141	13.9874	0.64343	0.0:0.9256:0.0:0.0744	.	.	.	.	X	156;150	.	ENSP00000369318:S150X	S	+	2	0	RHOBTB3	95109826	0.968000	0.33430	1.000000	0.80357	0.774000	0.43823	2.407000	0.44565	2.662000	0.90505	0.650000	0.86243	TCA	RHOBTB3	-	pfam_Small_GTPase	ENSG00000164292		0.388	RHOBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOBTB3	HGNC	protein_coding	OTTHUMT00000241658.1	63	0.00	0	C	NM_014899		95084070	95084070	+1	no_errors	ENST00000379982	ensembl	human	known	69_37n	nonsense	77	27.10	29	SNP	0.999	G
RHOJ	57381	genome.wustl.edu	37	14	63757697	63757697	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:63757697G>C	ENST00000316754.3	+	5	1062	c.600G>C	c.(598-600)aaG>aaC	p.K200N		NM_020663.4	NP_065714.1	Q9H4E5	RHOJ_HUMAN	ras homolog family member J	200					actin cytoskeleton organization (GO:0030036)|GTP catabolic process (GO:0006184)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			NS(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(10)|upper_aerodigestive_tract(1)	21				OV - Ovarian serous cystadenocarcinoma(108;0.00326)|all cancers(60;0.031)|BRCA - Breast invasive adenocarcinoma(234;0.119)		CCAAGAAAAAGAAGAAACGCT	0.493																																						dbGAP											0													119.0	114.0	116.0					14																	63757697		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK027351	CCDS9757.1	14q23.1	2012-02-27	2012-02-27	2004-03-24	ENSG00000126785	ENSG00000126785			688	protein-coding gene	gene with protein product		607653	"""RAS-like, family 7, member B"", ""ras homolog gene family, member J"""	RASL7B, ARHJ		10967094	Standard	NM_020663		Approved	FLJ14445, TCL	uc001xgb.2	Q9H4E5	OTTHUMG00000140342	ENST00000316754.3:c.600G>C	14.37:g.63757697G>C	ENSP00000316729:p.Lys200Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q96KC1	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.K200N	ENST00000316754.3	37	c.600	CCDS9757.1	14	.	.	.	.	.	.	.	.	.	.	G	16.02	3.005435	0.54254	.	.	ENSG00000126785	ENST00000316754	T	0.69685	-0.42	5.59	1.7	0.24286	.	0.147642	0.44483	D	0.000444	T	0.51873	0.1700	L	0.55103	1.725	0.80722	D	1	P	0.45044	0.849	B	0.32724	0.151	T	0.48422	-0.9037	10	0.41790	T	0.15	.	9.1675	0.37060	0.2965:0.0:0.7035:0.0	.	200	Q9H4E5	RHOJ_HUMAN	N	200	ENSP00000316729:K200N	ENSP00000316729:K200N	K	+	3	2	RHOJ	62827450	1.000000	0.71417	0.999000	0.59377	0.858000	0.48976	4.605000	0.61119	0.296000	0.22592	0.561000	0.74099	AAG	RHOJ	-	NULL	ENSG00000126785		0.493	RHOJ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOJ	HGNC	protein_coding	OTTHUMT00000276975.3	60	0.00	0	G			63757697	63757697	+1	no_errors	ENST00000316754	ensembl	human	known	69_37n	missense	63	29.21	26	SNP	1.000	C
RUNX1	861	genome.wustl.edu	37	21	36252880	36252881	+	Frame_Shift_Ins	INS	-	-	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr21:36252880_36252881insG	ENST00000344691.4	-	2	1977_1978	c.400_401insC	c.(400-402)ctcfs	p.L134fs	RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.L149fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.L134fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.L161fs|RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.L137fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.L161fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.L134fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	134	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)	p.N159fs*49(1)		breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						GACAAACCTGAGGTCATTAAAT	0.441			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	1	Deletion - Frameshift(1)	haematopoietic_and_lymphoid_tissue(1)																																								-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.401dupC	21.37:g.36252882_36252882dupG	ENSP00000340690:p.Leu134fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.L161fs	ENST00000344691.4	37	c.482_481	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.441	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	75	0.00	0	-			36252880	36252881	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	28	64.56	51	INS	1.000:1.000	G
RUNX1	861	genome.wustl.edu	37	21	36252994	36252995	+	Frame_Shift_Ins	INS	-	-	C	rs373498347		TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr21:36252994_36252995insC	ENST00000344691.4	-	2	1863_1864	c.286_287insG	c.(286-288)gatfs	p.D96fs	RUNX1_ENST00000325074.5_Frame_Shift_Ins_p.D111fs|RUNX1_ENST00000358356.5_Frame_Shift_Ins_p.D96fs|RUNX1_ENST00000300305.3_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000486278.2_Frame_Shift_Ins_p.D99fs|RUNX1_ENST00000437180.1_Frame_Shift_Ins_p.D123fs|RUNX1_ENST00000399240.1_Frame_Shift_Ins_p.D96fs	NM_001001890.2	NP_001001890.1	Q01196	RUNX1_HUMAN	runt-related transcription factor 1	96	Runt. {ECO:0000255|PROSITE- ProRule:PRU00399}.				behavioral response to pain (GO:0048266)|cellular response to transforming growth factor beta stimulus (GO:0071560)|central nervous system development (GO:0007417)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|hair follicle morphogenesis (GO:0031069)|hematopoietic stem cell proliferation (GO:0071425)|hemopoiesis (GO:0030097)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|myeloid cell differentiation (GO:0030099)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of granulocyte differentiation (GO:0030853)|peripheral nervous system neuron development (GO:0048935)|positive regulation of angiogenesis (GO:0045766)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of progesterone secretion (GO:2000872)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of hair follicle cell proliferation (GO:0071336)|regulation of signal transduction (GO:0009966)|skeletal system development (GO:0001501)|transcription, DNA-templated (GO:0006351)	basement membrane (GO:0005604)|nucleus (GO:0005634)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			breast(5)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(428)|large_intestine(3)|lung(6)|oesophagus(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	452						ATCTGGAACATCCCCTAGGGCC	0.46			T	"""RPL22, MDS1, EVI1, CBFA2T3, CBFA2T1, ETV6, LAF4"""	"""AML, preB- ALL, T-ALL"""																																	dbGAP		Dom	yes		21	21q22.3	861	runt-related transcription factor 1  (AML1)		L	0			GRCh37	CM086911	RUNX1	M																																				-	-	-	SO:0001589	frameshift_variant	0			X79549	CCDS13639.1, CCDS42922.1, CCDS46646.1	21q22.3	2014-09-17	2008-07-29		ENSG00000159216	ENSG00000159216			10471	protein-coding gene	gene with protein product	"""aml1 oncogene"""	151385	"""acute myeloid leukemia 1"""	AML1, CBFA2		1427868, 7835892	Standard	NM_001001890		Approved	PEBP2A2, AMLCR1	uc010gmv.3	Q01196	OTTHUMG00000086299	ENST00000344691.4:c.287dupG	21.37:g.36252998_36252998dupC	ENSP00000340690:p.Asp96fs	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MV94|B2RMS4|D3DSG1|O60472|O60473|O76047|O76089|Q13081|Q13755|Q13756|Q13757|Q13758|Q13759|Q15341|Q15343|Q16122|Q16284|Q16285|Q16286|Q16346|Q16347|Q92479	Frame_Shift_Ins	INS	pfam_AML1/Runt_N,pfam_RunxI,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	p.D123fs	ENST00000344691.4	37	c.368_367	CCDS42922.1	21																																																																																			RUNX1	-	pfam_AML1/Runt_N,superfamily_p53-like_TF_DNA-bd,pirsf_TF_Runt-rel_RUNX,pfscan_AML1/Runt_N,prints_AML1_Runt	ENSG00000159216		0.460	RUNX1-001	KNOWN	basic|CCDS	protein_coding	RUNX1	HGNC	protein_coding	OTTHUMT00000194230.1	64	0.00	0	-			36252994	36252995	-1	no_errors	ENST00000300305	ensembl	human	known	69_37n	frame_shift_ins	75	16.67	15	INS	0.999:1.000	C
RYR2	6262	genome.wustl.edu	37	1	237895411	237895411	+	Silent	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:237895411G>T	ENST00000366574.2	+	78	11318	c.11001G>T	c.(10999-11001)ctG>ctT	p.L3667L	RYR2_ENST00000542537.1_Silent_p.L3651L|RYR2_ENST00000360064.6_Silent_p.L3665L|RYR2_ENST00000609119.1_3'UTR	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	3667					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TACATCAGCTGATCCTTCTGT	0.423																																						dbGAP											0													103.0	103.0	103.0					1																	237895411		1861	4086	5947	-	-	-	SO:0001819	synonymous_variant	0			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.11001G>T	1.37:g.237895411G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15411|Q546N8|Q5T3P2	Silent	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,superfamily_ConA-like_lec_gl,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.L3665	ENST00000366574.2	37	c.10995	CCDS55691.1	1																																																																																			RYR2	-	NULL	ENSG00000198626		0.423	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	55	0.00	0	G	NM_001035		237895411	237895411	+1	no_errors	ENST00000360064	ensembl	human	known	69_37n	silent	161	12.50	23	SNP	0.991	T
SCGB2B2	284402	genome.wustl.edu	37	19	35085448	35085448	+	Silent	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:35085448G>T	ENST00000601241.1	-	2	2121	c.21C>A	c.(19-21)acC>acA	p.T7T	SCGB2B2_ENST00000379204.2_Silent_p.T7T|SCGB2B2_ENST00000595326.1_Intron			Q4G0G5	SC2B2_HUMAN	secretoglobin, family 2B, member 2	7						extracellular region (GO:0005576)											GAAGAGCACAGGTGGCGGATG	0.577																																						dbGAP											0													77.0	65.0	69.0					19																	35085448		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK093495	CCDS32989.1	19q13.12	2011-12-14	2011-12-14	2011-12-14	ENSG00000205209	ENSG00000205209		"""Secretoglobins"""	27616	protein-coding gene	gene with protein product		615063	"""secretoglobin-like"""	SCGBL		22155607	Standard	NM_001025591		Approved	SCGB4A2	uc002nvn.3	Q4G0G5		ENST00000601241.1:c.21C>A	19.37:g.35085448G>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Uteroglobin-like_superfam,pfam_Allergen_Fel_d_1_chain2,superfamily_Secretoglobin	p.T7	ENST00000601241.1	37	c.21	CCDS32989.1	19																																																																																			SCGB2B2	-	pfam_Uteroglobin-like_superfam	ENSG00000205209		0.577	SCGB2B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCGB2B2	HGNC	protein_coding	OTTHUMT00000461457.2	25	0.00	0	G	NM_001025591		35085448	35085448	-1	no_errors	ENST00000379204	ensembl	human	known	69_37n	silent	42	27.59	16	SNP	0.008	T
SCN11A	11280	genome.wustl.edu	37	3	38913709	38913709	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:38913709G>A	ENST00000302328.3	-	20	3668	c.3470C>T	c.(3469-3471)gCg>gTg	p.A1157V	SCN11A_ENST00000456224.3_Missense_Mutation_p.A1119V|SCN11A_ENST00000444237.2_Missense_Mutation_p.A1157V|SCN11A_ENST00000450244.1_Missense_Mutation_p.A1157V	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	1157					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)	p.A1157V(1)		NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CTGGGACAGCGCACGAAGAGG	0.473																																						dbGAP											1	Substitution - Missense(1)	biliary_tract(1)											163.0	158.0	159.0					3																	38913709		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.3470C>T	3.37:g.38913709G>A	ENSP00000307599:p.Ala1157Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.A1157V	ENST00000302328.3	37	c.3470	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	G	16.14	3.038270	0.54896	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98455	-4.94;-4.94;-4.94;-4.94	5.54	5.54	0.83059	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.98676	0.9556	M	0.69248	2.105	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.99032	1.0821	10	0.39692	T	0.17	.	18.0499	0.89344	0.0:0.0:1.0:0.0	.	1157	Q9UI33	SCNBA_HUMAN	V	1157;1157;1119;1157	ENSP00000307599:A1157V;ENSP00000400945:A1157V;ENSP00000416757:A1119V;ENSP00000408028:A1157V	ENSP00000307599:A1157V	A	-	2	0	SCN11A	38888713	1.000000	0.71417	0.149000	0.22428	0.247000	0.25773	9.751000	0.98889	2.596000	0.87737	0.561000	0.74099	GCG	SCN11A	-	pfam_Ion_trans_dom	ENSG00000168356		0.473	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	36	0.00	0	G	NM_014139		38913709	38913709	-1	no_errors	ENST00000302328	ensembl	human	known	69_37n	missense	26	27.78	10	SNP	1.000	A
SCUBE2	57758	genome.wustl.edu	37	11	9043489	9043489	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr11:9043489T>A	ENST00000309263.3	-	21	2853	c.2781A>T	c.(2779-2781)gaA>gaT	p.E927D	SCUBE2_ENST00000450649.2_Missense_Mutation_p.E735D|SCUBE2_ENST00000457346.2_Missense_Mutation_p.E956D|RP11-467K18.2_ENST00000531592.1_RNA|SCUBE2_ENST00000520467.1_Missense_Mutation_p.E899D			Q9NQ36	SCUB2_HUMAN	signal peptide, CUB domain, EGF-like 2	927						extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			breast(1)|endometrium(5)|kidney(3)|large_intestine(15)|liver(1)|lung(10)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42				all cancers(16;8.57e-09)|Epithelial(150;4.42e-08)|BRCA - Breast invasive adenocarcinoma(625;0.0116)		CTTCAATGAGTTCCTGGTAGT	0.408																																						dbGAP											0													193.0	148.0	163.0					11																	9043489		2201	4296	6497	-	-	-	SO:0001583	missense	0			AK131552	CCDS7797.1, CCDS7797.2, CCDS53599.1	11p15.4	2014-09-04			ENSG00000175356	ENSG00000175356			30425	protein-coding gene	gene with protein product		611747				12270931, 11528127	Standard	NM_020974		Approved	Cegf1, Cegb1, FLJ16792	uc001mhi.2	Q9NQ36	OTTHUMG00000163880	ENST00000309263.3:c.2781A>T	11.37:g.9043489T>A	ENSP00000310658:p.Glu927Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKQ8|Q6ZWI1	Missense_Mutation	SNP	pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EGF-like_Ca-bd,pfam_EGF-like_dom,pfam_CUB,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.E956D	ENST00000309263.3	37	c.2868		11	.	.	.	.	.	.	.	.	.	.	T	17.47	3.396470	0.62177	.	.	ENSG00000175356	ENST00000457346;ENST00000309263;ENST00000450649;ENST00000520467	T;T;D;T	0.84146	-1.26;-1.36;-1.81;-1.41	5.79	-4.65	0.03339	.	0.000000	0.85682	D	0.000000	D	0.85729	0.5764	.	.	.	0.51233	D	0.999919	B;B;D	0.55172	0.037;0.165;0.97	B;B;P	0.52343	0.024;0.131;0.696	D	0.84223	0.0462	9	0.30854	T	0.27	.	18.9241	0.92537	0.0:0.7087:0.0:0.2913	.	735;899;927	Q9NQ36-3;Q9NQ36-2;Q9NQ36	.;.;SCUB2_HUMAN	D	956;927;735;899	ENSP00000390481:E956D;ENSP00000310658:E927D;ENSP00000415187:E735D;ENSP00000429969:E899D	ENSP00000310658:E927D	E	-	3	2	SCUBE2	9000065	0.079000	0.21365	0.969000	0.41365	0.996000	0.88848	-0.569000	0.05902	-0.763000	0.04658	0.528000	0.53228	GAA	SCUBE2	-	NULL	ENSG00000175356		0.408	SCUBE2-005	KNOWN	basic|appris_candidate	protein_coding	SCUBE2	HGNC	protein_coding	OTTHUMT00000385812.2	67	0.00	0	T	NM_020974		9043489	9043489	-1	no_errors	ENST00000457346	ensembl	human	known	69_37n	missense	75	23.47	23	SNP	0.790	A
SDAD1	55153	genome.wustl.edu	37	4	76878697	76878697	+	Silent	SNP	A	A	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:76878697A>T	ENST00000356260.5	-	19	1861	c.1743T>A	c.(1741-1743)atT>atA	p.I581I	SDAD1_ENST00000395711.4_Silent_p.I544I|SDAD1_ENST00000513089.1_5'Flank	NM_018115.2	NP_060585.2	Q9NVU7	SDA1_HUMAN	SDA1 domain containing 1	581					actin cytoskeleton organization (GO:0030036)|protein transport (GO:0015031)|ribosomal large subunit biogenesis (GO:0042273)|ribosomal large subunit export from nucleus (GO:0000055)	nucleolus (GO:0005730)				breast(2)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(1)	19			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGTCTATTTCAATGTATTTCC	0.438																																						dbGAP											0													134.0	134.0	134.0					4																	76878697		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF132198	CCDS3573.2, CCDS75147.1	4q21.21	2010-11-24			ENSG00000198301	ENSG00000198301			25537	protein-coding gene	gene with protein product						11483580	Standard	NM_001288984		Approved	FLJ10498	uc003hje.4	Q9NVU7	OTTHUMG00000130111	ENST00000356260.5:c.1743T>A	4.37:g.76878697A>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q32Q11|Q68D52|Q7Z5U4|Q9H831|Q9H9P6	Silent	SNP	pfam_SDA1,pfam_Uncharacterised_NUC130/133_N,superfamily_ARM-type_fold	p.I581	ENST00000356260.5	37	c.1743	CCDS3573.2	4																																																																																			SDAD1	-	pfam_SDA1	ENSG00000198301		0.438	SDAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDAD1	HGNC	protein_coding	OTTHUMT00000252418.3	79	0.00	0	A	NM_018115		76878697	76878697	-1	no_errors	ENST00000356260	ensembl	human	known	69_37n	silent	96	29.20	40	SNP	0.163	T
SEMA4A	64218	genome.wustl.edu	37	1	156142776	156142776	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:156142776C>G	ENST00000368285.3	+	11	1561	c.1294C>G	c.(1294-1296)Ctt>Gtt	p.L432V	SEMA4A_ENST00000355014.2_Missense_Mutation_p.L432V|SEMA4A_ENST00000368284.1_Missense_Mutation_p.L300V|SEMA4A_ENST00000368286.2_Missense_Mutation_p.L300V|SEMA4A_ENST00000487358.1_3'UTR|SEMA4A_ENST00000368282.1_Missense_Mutation_p.L432V	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	432	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					GCACAGCCATCTTGTCATGTA	0.582																																						dbGAP											0													68.0	59.0	62.0					1																	156142776		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.1294C>G	1.37:g.156142776C>G	ENSP00000357268:p.Leu432Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.L432V	ENST00000368285.3	37	c.1294	CCDS1132.1	1	.	.	.	.	.	.	.	.	.	.	C	5.165	0.215968	0.09810	.	.	ENSG00000196189	ENST00000355014;ENST00000368285;ENST00000368284;ENST00000368283;ENST00000544376;ENST00000368286;ENST00000368282	T;T;T;T;T	0.22134	1.97;1.97;1.97;1.97;1.97	5.37	-0.993	0.10228	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.804538	0.10629	N	0.652384	T	0.05090	0.0136	L	0.32530	0.975	0.09310	N	0.999998	B;B	0.10296	0.001;0.003	B;B	0.12837	0.005;0.008	T	0.42292	-0.9460	10	0.52906	T	0.07	.	6.3383	0.21309	0.1151:0.3334:0.4682:0.0833	.	300;432	Q5TCJ6;Q9H3S1	.;SEM4A_HUMAN	V	432;432;300;394;394;300;432	ENSP00000347117:L432V;ENSP00000357268:L432V;ENSP00000357267:L300V;ENSP00000357269:L300V;ENSP00000357265:L432V	ENSP00000347117:L432V	L	+	1	0	SEMA4A	154409400	0.002000	0.14202	0.642000	0.29436	0.802000	0.45316	-0.546000	0.06062	-0.047000	0.13423	0.561000	0.74099	CTT	SEMA4A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag	ENSG00000196189		0.582	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4A	HGNC	protein_coding	OTTHUMT00000039484.2	28	0.00	0	C	NM_022367		156142776	156142776	+1	no_errors	ENST00000355014	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	0.049	G
SEMA4A	64218	genome.wustl.edu	37	1	156146369	156146369	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:156146369C>T	ENST00000368285.3	+	15	2134	c.1867C>T	c.(1867-1869)Cag>Tag	p.Q623*	SEMA4A_ENST00000355014.2_Nonsense_Mutation_p.Q623*|SEMA4A_ENST00000368284.1_Nonsense_Mutation_p.Q491*|SEMA4A_ENST00000368286.2_Nonsense_Mutation_p.Q491*|SEMA4A_ENST00000368282.1_Nonsense_Mutation_p.Q623*	NM_001193300.1|NM_022367.3	NP_001180229.1|NP_071762.2	Q9H3S1	SEM4A_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4A	623	Ig-like C2-type.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|negative regulation of angiogenesis (GO:0016525)|regulation of cell shape (GO:0008360)|regulation of endothelial cell migration (GO:0010594)|semaphorin-plexin signaling pathway (GO:0071526)|T-helper 1 cell differentiation (GO:0045063)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			breast(1)|ovary(2)|skin(2)	5	Hepatocellular(266;0.158)					GGGTCTCTACCAGTGCTGGGC	0.557																																						dbGAP											0													133.0	136.0	135.0					1																	156146369		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK022416	CCDS1132.1, CCDS53378.1	1q22	2014-01-28			ENSG00000196189	ENSG00000196189		"""Semaphorins"""	10729	protein-coding gene	gene with protein product		607292		SEMAB		7748561	Standard	NM_022367		Approved	SemB, FLJ12287, CORD10	uc009wrq.3	Q9H3S1	OTTHUMG00000014042	ENST00000368285.3:c.1867C>T	1.37:g.156146369C>T	ENSP00000357268:p.Gln623*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDH8|B3KR76|Q5TCI5|Q5TCJ6|Q8WUA9	Nonsense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.Q623*	ENST00000368285.3	37	c.1867	CCDS1132.1	1	.	.	.	.	.	.	.	.	.	.	C	37	5.990521	0.97179	.	.	ENSG00000196189	ENST00000355014;ENST00000368285;ENST00000368284;ENST00000368283;ENST00000544376;ENST00000368286;ENST00000368282	.	.	.	5.01	5.01	0.66863	.	0.320352	0.30177	N	0.010228	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	11.6723	0.51408	0.0:0.8207:0.1793:0.0	.	.	.	.	X	623;623;491;585;585;491;623	.	ENSP00000347117:Q623X	Q	+	1	0	SEMA4A	154412993	1.000000	0.71417	1.000000	0.80357	0.700000	0.40528	1.475000	0.35409	2.336000	0.79503	0.313000	0.20887	CAG	SEMA4A	-	NULL	ENSG00000196189		0.557	SEMA4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4A	HGNC	protein_coding	OTTHUMT00000039484.2	72	0.00	0	C	NM_022367		156146369	156146369	+1	no_errors	ENST00000355014	ensembl	human	known	69_37n	nonsense	191	14.35	32	SNP	1.000	T
SETD2	29072	genome.wustl.edu	37	3	47144879	47144879	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:47144879C>A	ENST00000409792.3	-	7	4916	c.4874G>T	c.(4873-4875)cGt>cTt	p.R1625L		NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	1625	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)	p.R1122H(1)|p.R1625H(1)		breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		ATTCATGAAACGAGAGCAATT	0.348			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	2	Substitution - Missense(2)	lung(2)											167.0	155.0	159.0					3																	47144879		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.4874G>T	3.37:g.47144879C>A	ENSP00000386759:p.Arg1625Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Missense_Mutation	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.R1625L	ENST00000409792.3	37	c.4874	CCDS2749.2	3	.	.	.	.	.	.	.	.	.	.	C	33	5.248937	0.95305	.	.	ENSG00000181555	ENST00000451092;ENST00000543224;ENST00000409792	D	0.86164	-2.08	5.83	5.83	0.93111	SET domain (3);	0.000000	0.53938	D	0.000046	D	0.96984	0.9015	H	0.99719	4.725	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	D	0.98545	1.0634	10	0.87932	D	0	.	18.2989	0.90157	0.0:1.0:0.0:0.0	.	1625;1625	F2Z317;Q9BYW2	.;SETD2_HUMAN	L	1625	ENSP00000386759:R1625L	ENSP00000386759:R1625L	R	-	2	0	SETD2	47119883	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.429000	0.80309	2.775000	0.95449	0.650000	0.86243	CGT	SETD2	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom	ENSG00000181555		0.348	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	98	0.00	0	C	NM_014159		47144879	47144879	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	missense	53	43.01	40	SNP	1.000	A
SLC26A3	1811	genome.wustl.edu	37	7	107431617	107431617	+	Missense_Mutation	SNP	A	A	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:107431617A>T	ENST00000340010.5	-	5	630	c.446T>A	c.(445-447)gTc>gAc	p.V149D	SLC26A3_ENST00000422236.2_Missense_Mutation_p.V114D	NM_000111.2	NP_000102.1	P40879	S26A3_HUMAN	solute carrier family 26 (anion exchanger), member 3	149					anion transport (GO:0006820)|cellular response to cAMP (GO:0071320)|excretion (GO:0007588)|intracellular pH elevation (GO:0051454)|ion transport (GO:0006811)|membrane hyperpolarization (GO:0060081)|regulation of RNA biosynthetic process (GO:2001141)|regulation of transcription, DNA-templated (GO:0006355)|sperm capacitation (GO:0048240)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)|sperm midpiece (GO:0097225)	anion:anion antiporter activity (GO:0015301)|bicarbonate transmembrane transporter activity (GO:0015106)|chloride transmembrane transporter activity (GO:0015108)|secondary active sulfate transmembrane transporter activity (GO:0008271)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(18)|ovary(4)|prostate(1)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	46						GCGATCTGGGACTGCTTTTGA	0.493																																						dbGAP											0													205.0	176.0	186.0					7																	107431617		2203	4300	6503	-	-	-	SO:0001583	missense	0			L02785	CCDS5748.1	7q31	2014-09-17	2013-07-18		ENSG00000091138	ENSG00000091138		"""Solute carriers"""	3018	protein-coding gene	gene with protein product		126650	"""congenital chloride diarrhea"", ""solute carrier family 26, member 3"""	DRA, CLD		8020951, 11087667	Standard	NM_000111		Approved		uc003ver.2	P40879	OTTHUMG00000154812	ENST00000340010.5:c.446T>A	7.37:g.107431617A>T	ENSP00000345873:p.Val149Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Sulph_transpt,pfam_STAS_dom,superfamily_STAS_dom,pfscan_STAS_dom,tigrfam_SulP_transpt	p.V149D	ENST00000340010.5	37	c.446	CCDS5748.1	7	.	.	.	.	.	.	.	.	.	.	A	13.56	2.273457	0.40194	.	.	ENSG00000091138	ENST00000422236;ENST00000340010	D;D	0.94138	-3.3;-3.36	3.64	-0.542	0.11854	.	7.793970	0.00166	N	0.000001	D	0.89832	0.6829	L	0.29908	0.895	0.20307	N	0.999911	P;P	0.44734	0.842;0.76	P;B	0.45428	0.48;0.273	T	0.80819	-0.1212	10	0.23302	T	0.38	.	7.4598	0.27287	0.6785:0.0:0.3215:0.0	.	114;149	G5E9U3;P40879	.;S26A3_HUMAN	D	114;149	ENSP00000415817:V114D;ENSP00000345873:V149D	ENSP00000345873:V149D	V	-	2	0	SLC26A3	107218853	0.000000	0.05858	0.001000	0.08648	0.008000	0.06430	-0.535000	0.06142	-0.013000	0.14199	0.432000	0.28606	GTC	SLC26A3	-	tigrfam_SulP_transpt	ENSG00000091138		0.493	SLC26A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC26A3	HGNC	protein_coding	OTTHUMT00000337190.1	107	0.00	0	A	NM_000111		107431617	107431617	-1	no_errors	ENST00000340010	ensembl	human	known	69_37n	missense	105	25.35	36	SNP	0.002	T
SLC35F4	341880	genome.wustl.edu	37	14	58063474	58063474	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:58063474C>T	ENST00000339762.6	-	1	141	c.142G>A	c.(142-144)Gaa>Aaa	p.E48K	SLC35F4_ENST00000554729.1_Intron|SLC35F4_ENST00000556826.1_Intron|SLC35F4_ENST00000557430.1_Intron			A4IF30	S35F4_HUMAN	solute carrier family 35, member F4	48					transport (GO:0006810)	integral component of membrane (GO:0016021)		p.E48K(1)		breast(1)|endometrium(4)|large_intestine(3)|lung(12)|ovary(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GATTTATCTTCCTTTCTCATT	0.418																																						dbGAP											1	Substitution - Missense(1)	NS(1)											146.0	146.0	146.0					14																	58063474		1919	4146	6065	-	-	-	SO:0001583	missense	0					14q22.3	2013-05-22		2003-11-28	ENSG00000151812	ENSG00000151812		"""Solute carriers"""	19845	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 36"""	C14orf36			Standard	NM_001206920		Approved	FLJ37712	uc021rtp.1	A4IF30	OTTHUMG00000171317	ENST00000339762.6:c.142G>A	14.37:g.58063474C>T	ENSP00000342518:p.Glu48Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NDQ3	Missense_Mutation	SNP	pfam_DMT,pfam_DUF914_euk	p.E48K	ENST00000339762.6	37	c.142		14	.	.	.	.	.	.	.	.	.	.	C	5.539	0.284265	0.10513	.	.	ENSG00000151812	ENST00000339762	T	0.42513	0.97	4.28	-4.9	0.03094	.	.	.	.	.	T	0.22475	0.0542	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26292	-1.0107	8	0.66056	D	0.02	.	0.2242	0.00172	0.2349:0.2244:0.2433:0.2974	.	48	A4IF30	S35F4_HUMAN	K	48	ENSP00000342518:E48K	ENSP00000342518:E48K	E	-	1	0	SLC35F4	57133227	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-2.115000	0.01328	-1.140000	0.02877	-0.841000	0.03054	GAA	SLC35F4	-	NULL	ENSG00000151812		0.418	SLC35F4-201	KNOWN	basic	protein_coding	SLC35F4	HGNC	protein_coding		77	0.00	0	C	XM_292260		58063474	58063474	-1	no_errors	ENST00000339762	ensembl	human	known	69_37n	missense	71	21.98	20	SNP	0.000	T
SLC39A10	57181	genome.wustl.edu	37	2	196545103	196545103	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:196545103G>T	ENST00000409086.3	+	2	612	c.337G>T	c.(337-339)Gat>Tat	p.D113Y	SLC39A10_ENST00000359634.5_Missense_Mutation_p.D113Y|SLC39A10_ENST00000541054.1_Intron	NM_001127257.1	NP_001120729.1	Q9ULF5	S39AA_HUMAN	solute carrier family 39 (zinc transporter), member 10	113	His-rich.				transmembrane transport (GO:0055085)|zinc ion transport (GO:0006829)	integral component of membrane (GO:0016021)	metal ion transmembrane transporter activity (GO:0046873)			breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(16)|pancreas(1)|prostate(1)|skin(2)	34			OV - Ovarian serous cystadenocarcinoma(117;0.221)			TTCTCATTTAGATATTTTGGC	0.368																																						dbGAP											0													73.0	71.0	71.0					2																	196545103		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS33353.1	2q33.1	2013-05-22			ENSG00000196950	ENSG00000196950		"""Solute carriers"""	20861	protein-coding gene	gene with protein product		608733	"""solute carrier family 39 (metal ion transporter), member 10"""			12659941	Standard	NM_020342		Approved	KIAA1265, FLJ90515, DKFZp564L2123	uc002utg.4	Q9ULF5	OTTHUMG00000154380	ENST00000409086.3:c.337G>T	2.37:g.196545103G>T	ENSP00000386766:p.Asp113Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5C6|B4DGU0|Q3MJA4|Q68CR5|Q6DKH6|Q9Y3Z1	Missense_Mutation	SNP	pfam_ZIP	p.D113Y	ENST00000409086.3	37	c.337	CCDS33353.1	2	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295131	0.40594	.	.	ENSG00000196950	ENST00000458054;ENST00000409086;ENST00000359634;ENST00000418005	T;T;T;T	0.33438	1.41;1.41;1.41;1.41	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	T	0.30262	0.0759	L	0.54323	1.7	0.80722	D	1	B	0.25390	0.125	B	0.22753	0.041	T	0.05273	-1.0895	10	0.37606	T	0.19	.	14.2054	0.65730	0.0:0.0:0.8412:0.1588	.	113	Q9ULF5	S39AA_HUMAN	Y	113	ENSP00000389640:D113Y;ENSP00000386766:D113Y;ENSP00000352655:D113Y;ENSP00000409272:D113Y	ENSP00000352655:D113Y	D	+	1	0	SLC39A10	196253348	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	6.792000	0.75125	2.557000	0.86248	0.655000	0.94253	GAT	SLC39A10	-	NULL	ENSG00000196950		0.368	SLC39A10-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC39A10	HGNC	protein_coding	OTTHUMT00000335186.1	24	0.00	0	G	XM_047707		196545103	196545103	+1	no_errors	ENST00000359634	ensembl	human	known	69_37n	missense	32	21.95	9	SNP	1.000	T
SLC4A11	83959	genome.wustl.edu	37	20	3211607	3211607	+	Silent	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr20:3211607G>C	ENST00000380056.3	-	9	1235	c.1188C>G	c.(1186-1188)ctC>ctG	p.L396L	SLC4A11_ENST00000539553.2_Silent_p.L380L|SLC4A11_ENST00000380059.3_Silent_p.L423L|SLC4A11_ENST00000488544.1_5'Flank	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	396	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						TCTCGTCATTGAGAGACCCGA	0.627																																					NSCLC(190;922 2139 10266 10292 38692)	dbGAP											0													138.0	129.0	132.0					20																	3211607		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1188C>G	20.37:g.3211607G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Silent	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.L423	ENST00000380056.3	37	c.1269	CCDS13052.1	20																																																																																			SLC4A11	-	pfam_HCO3_transpt_C,prints_HCO3_transpt_euk	ENSG00000088836		0.627	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	79	0.00	0	G			3211607	3211607	-1	no_errors	ENST00000380059	ensembl	human	known	69_37n	silent	125	16.67	25	SNP	1.000	C
SLC52A2	79581	genome.wustl.edu	37	8	145583494	145583494	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:145583494C>G	ENST00000532887.1	+	3	925	c.342C>G	c.(340-342)ttC>ttG	p.F114L	FBXL6_ENST00000455319.2_5'Flank|SLC52A2_ENST00000526752.1_Intron|FBXL6_ENST00000331890.5_5'Flank|SLC52A2_ENST00000329994.2_Missense_Mutation_p.F114L|FBXL6_ENST00000526524.1_5'Flank|SLC52A2_ENST00000402965.1_Missense_Mutation_p.F114L|SLC52A2_ENST00000527078.1_Missense_Mutation_p.F114L|SLC52A2_ENST00000530047.1_Missense_Mutation_p.F114L|SLC52A2_ENST00000540505.1_Missense_Mutation_p.F26L|SLC52A2_ENST00000526891.1_3'UTR			Q9HAB3	S52A2_HUMAN	solute carrier family 52 (riboflavin transporter), member 2	114					riboflavin transport (GO:0032218)	integral component of plasma membrane (GO:0005887)	riboflavin transporter activity (GO:0032217)|virus receptor activity (GO:0001618)									Gamma Hydroxybutyric Acid(DB01440)	CTGTGGCCTTCTTAGCACTGG	0.602																																						dbGAP											0													140.0	130.0	133.0					8																	145583494		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY070774	CCDS6423.1	8q24.3	2013-07-17	2013-07-17	2012-02-29		ENSG00000185803		"""Solute carriers"""	30224	protein-coding gene	gene with protein product		607882	"""G protein-coupled receptor 172A"""	GPR172A		12740431	Standard	NM_024531		Approved	FLJ11856, PAR1, GPCR41, D15Ertd747e, RFVT2, hRFT3	uc003zcd.2	Q9HAB3		ENST00000532887.1:c.342C>G	8.37:g.145583494C>G	ENSP00000436768:p.Phe114Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6B6|D3DWL8|G1UCY1|Q86UT1	Missense_Mutation	SNP	pfam_Endogenous_retrovirus_rcpt	p.F114L	ENST00000532887.1	37	c.342	CCDS6423.1	8	.	.	.	.	.	.	.	.	.	.	C	4.589	0.109446	0.08780	.	.	ENSG00000185803	ENST00000530047;ENST00000527078;ENST00000402965;ENST00000534725;ENST00000532887;ENST00000329994;ENST00000540505	T;T;T;T;T;T;T	0.61274	0.12;0.12;0.12;0.12;0.12;0.12;0.12	3.55	1.73	0.24493	.	0.058743	0.64402	D	0.000002	T	0.37100	0.0991	L	0.28115	0.83	0.44214	D	0.997048	B	0.09022	0.002	B	0.09377	0.004	T	0.06991	-1.0796	9	.	.	.	.	6.8674	0.24100	0.0:0.762:0.0:0.238	.	114	Q9HAB3	RFT3_HUMAN	L	114;114;114;114;114;114;26	ENSP00000435820:F114L;ENSP00000434728:F114L;ENSP00000385961:F114L;ENSP00000431965:F114L;ENSP00000436768:F114L;ENSP00000333638:F114L;ENSP00000440400:F26L	.	F	+	3	2	GPR172A	145554302	1.000000	0.71417	0.406000	0.26421	0.015000	0.08874	1.936000	0.40183	0.215000	0.20761	0.462000	0.41574	TTC	SLC52A2	-	NULL	ENSG00000185803		0.602	SLC52A2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC52A2	HGNC	protein_coding	OTTHUMT00000382405.1	51	0.00	0	C	NM_024531		145583494	145583494	+1	no_errors	ENST00000329994	ensembl	human	known	69_37n	missense	36	23.40	11	SNP	0.995	G
SMAD2	4087	genome.wustl.edu	37	18	45374910	45374910	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr18:45374910G>C	ENST00000402690.2	-	8	1327	c.933C>G	c.(931-933)ttC>ttG	p.F311L	SMAD2_ENST00000586040.1_Missense_Mutation_p.F281L|SMAD2_ENST00000356825.4_Missense_Mutation_p.F281L|SMAD2_ENST00000591214.1_Missense_Mutation_p.F281L|SMAD2_ENST00000262160.6_Missense_Mutation_p.F311L	NM_001003652.3	NP_001003652.1	Q15796	SMAD2_HUMAN	SMAD family member 2	311	MH2. {ECO:0000255|PROSITE- ProRule:PRU00439}.				activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|cell fate commitment (GO:0045165)|common-partner SMAD protein phosphorylation (GO:0007182)|developmental growth (GO:0048589)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic foregut morphogenesis (GO:0048617)|endoderm formation (GO:0001706)|gastrulation (GO:0007369)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|insulin secretion (GO:0030073)|intracellular signal transduction (GO:0035556)|lung development (GO:0030324)|mesoderm formation (GO:0001707)|negative regulation of cell proliferation (GO:0008285)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|nodal signaling pathway (GO:0038092)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|paraxial mesoderm morphogenesis (GO:0048340)|pericardium development (GO:0060039)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900224)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-embryonic development (GO:0009791)|primary miRNA processing (GO:0031053)|regulation of binding (GO:0051098)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|response to cholesterol (GO:0070723)|response to glucose (GO:0009749)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein complex assembly (GO:0007183)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ureteric bud development (GO:0001657)|zygotic specification of dorsal/ventral axis (GO:0007352)	activin responsive factor complex (GO:0032444)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SMAD protein complex (GO:0071141)|SMAD2-SMAD3 protein complex (GO:0071144)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|co-SMAD binding (GO:0070410)|double-stranded DNA binding (GO:0003690)|enhancer binding (GO:0035326)|I-SMAD binding (GO:0070411)|metal ion binding (GO:0046872)|phosphatase binding (GO:0019902)|R-SMAD binding (GO:0070412)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription factor binding (GO:0008134)|transforming growth factor beta receptor binding (GO:0005160)|transforming growth factor beta receptor, pathway-specific cytoplasmic mediator activity (GO:0030618)|type I transforming growth factor beta receptor binding (GO:0034713)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(21)|liver(1)|lung(8)|prostate(2)|urinary_tract(1)	43						AACCTAAGCAGAACCTCTCTG	0.388																																						dbGAP											0													131.0	120.0	124.0					18																	45374910		2203	4300	6503	-	-	-	SO:0001583	missense	0			U65019	CCDS11934.1	18q21	2006-11-06	2006-11-06	2004-05-26	ENSG00000175387	ENSG00000175387		"""SMADs"""	6768	protein-coding gene	gene with protein product		601366	"""MAD, mothers against decapentaplegic homolog 2 (Drosophila)"", ""SMAD, mothers against DPP homolog 2 (Drosophila)"""	MADH2		8752209, 8673135	Standard	NM_001003652		Approved	MADR2, JV18-1	uc002lcz.4	Q15796	OTTHUMG00000132652	ENST00000402690.2:c.933C>G	18.37:g.45374910G>C	ENSP00000384449:p.Phe311Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_SMAD_dom_Dwarfin-type,pfam_MAD_homology1_Dwarfin-type,pfam_Interferon_reg_factor-3,superfamily_SMAD_FHA_domain,superfamily_MAD_homology_MH1,smart_MAD_homology1_Dwarfin-type,smart_SMAD_dom_Dwarfin-type,pfscan_MAD_homology_MH1,pfscan_SMAD_dom_Dwarfin-type	p.F311L	ENST00000402690.2	37	c.933	CCDS11934.1	18	.	.	.	.	.	.	.	.	.	.	G	21.9	4.219056	0.79464	.	.	ENSG00000175387	ENST00000262160;ENST00000356825;ENST00000402690	D;D;D	0.97529	-4.42;-4.42;-4.42	5.81	3.72	0.42706	SMAD domain-like (1);SMAD/FHA domain (1);SMAD domain, Dwarfin-type (3);	0.000000	0.85682	D	0.000000	D	0.97832	0.9288	M	0.72576	2.205	0.80722	D	1	D;D;D	0.89917	1.0;0.997;1.0	D;D;D	0.97110	1.0;0.931;1.0	D	0.97950	1.0331	10	0.59425	D	0.04	.	11.9839	0.53135	0.2074:0.0:0.7926:0.0	.	281;281;311	B7Z5N5;Q15796-2;Q15796	.;.;SMAD2_HUMAN	L	311;281;311	ENSP00000262160:F311L;ENSP00000349282:F281L;ENSP00000384449:F311L	ENSP00000262160:F311L	F	-	3	2	SMAD2	43628908	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	3.918000	0.56432	1.467000	0.48044	-0.218000	0.12543	TTC	SMAD2	-	pfam_SMAD_dom_Dwarfin-type,superfamily_SMAD_FHA_domain,smart_SMAD_dom_Dwarfin-type,pfscan_SMAD_dom_Dwarfin-type	ENSG00000175387		0.388	SMAD2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMAD2	HGNC	protein_coding	OTTHUMT00000450571.1	64	0.00	0	G	NM_005901		45374910	45374910	-1	no_errors	ENST00000262160	ensembl	human	known	69_37n	missense	40	32.20	19	SNP	1.000	C
SMG7	9887	genome.wustl.edu	37	1	183511502	183511502	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:183511502G>A	ENST00000347615.2	+	14	1826	c.1707G>A	c.(1705-1707)gtG>gtA	p.V569V	SMG7_ENST00000507469.1_Intron|SMG7_ENST00000515829.2_Intron|SMG7_ENST00000367537.3_Intron|SMG7_ENST00000456731.2_Intron|SMG7_ENST00000508461.1_Silent_p.V527V	NM_173156.2	NP_775179.1	Q92540	SMG7_HUMAN	SMG7 nonsense mediated mRNA decay factor	569					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(16)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	46						CCAAAGAGGTGAGAAGGGACT	0.403																																						dbGAP											0													118.0	113.0	115.0					1																	183511502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D87437	CCDS1355.1, CCDS41445.1, CCDS41445.2, CCDS53444.1, CCDS53445.1	1q25	2013-07-02	2013-07-02	2006-02-16	ENSG00000116698	ENSG00000116698			16792	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog C (S. cerevisiae)"""	610964	"""chromosome 1 open reading frame 16"", ""smg-7 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C1orf16		14636577, 15721257	Standard	NM_173156		Approved	KIAA0250, EST1C, SGA56M, SMG-7	uc001gqf.3	Q92540	OTTHUMG00000035221	ENST00000347615.2:c.1707G>A	1.37:g.183511502G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DRB2|E9PCI0|E9PEH2|Q5T1Q0|Q6PIE0|Q7Z7H9|Q8IXC1|Q8IXC2	Silent	SNP	pfam_EST1	p.V569	ENST00000347615.2	37	c.1707	CCDS1355.1	1																																																																																			SMG7	-	NULL	ENSG00000116698		0.403	SMG7-002	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SMG7	HGNC	protein_coding	OTTHUMT00000085432.1	60	0.00	0	G	NM_014837		183511502	183511502	+1	no_errors	ENST00000347615	ensembl	human	known	69_37n	silent	132	13.64	21	SNP	1.000	A
SMURF1	57154	genome.wustl.edu	37	7	98648569	98648569	+	Missense_Mutation	SNP	A	A	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr7:98648569A>G	ENST00000361125.1	-	9	1172	c.853T>C	c.(853-855)Ttc>Ctc	p.F285L	SMURF1_ENST00000361368.2_Intron|AC004893.11_ENST00000482799.2_RNA|SMURF1_ENST00000480055.1_5'Flank|AC004893.11_ENST00000468960.2_RNA	NM_020429.2	NP_065162.1	Q9HCE7	SMUF1_HUMAN	SMAD specific E3 ubiquitin protein ligase 1	285					BMP signaling pathway (GO:0030509)|cell differentiation (GO:0030154)|ectoderm development (GO:0007398)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of ossification (GO:0030279)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein export from nucleus (GO:0006611)|protein localization to cell surface (GO:0034394)|protein polyubiquitination (GO:0000209)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|receptor catabolic process (GO:0032801)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	activin binding (GO:0048185)|I-SMAD binding (GO:0070411)|ligase activity (GO:0016874)|R-SMAD binding (GO:0070412)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(5)|lung(11)|ovary(1)|skin(2)|urinary_tract(1)	25	all_cancers(62;1.05e-08)|all_epithelial(64;4.34e-09)|Lung NSC(181;0.00902)|all_lung(186;0.0145)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)|Lung(104;0.224)			TGTAGAAGGAATTCGTATAGA	0.458																																						dbGAP											0													31.0	27.0	28.0					7																	98648569		1975	3728	5703	-	-	-	SO:0001583	missense	0			AB046845	CCDS34689.1, CCDS34690.1	7q21.1-q31.1	2004-07-29			ENSG00000198742	ENSG00000198742			16807	protein-coding gene	gene with protein product		605568				10458166	Standard	NM_020429		Approved	KIAA1625	uc003upu.2	Q9HCE7	OTTHUMG00000150272	ENST00000361125.1:c.853T>C	7.37:g.98648569A>G	ENSP00000354621:p.Phe285Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D279|B7ZMB6|B9EGV3|O75853|Q547Q3|Q9UJT8	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.F285L	ENST00000361125.1	37	c.853	CCDS34690.1	7	.	.	.	.	.	.	.	.	.	.	A	14.80	2.642718	0.47153	.	.	ENSG00000198742	ENST00000361125	T	0.39787	1.06	4.81	4.81	0.61882	.	1.388660	0.04356	N	0.356657	T	0.28234	0.0697	N	0.08118	0	0.27639	N	0.947786	B	0.06786	0.001	B	0.04013	0.001	T	0.11227	-1.0596	10	0.27785	T	0.31	.	11.0393	0.47820	1.0:0.0:0.0:0.0	.	285	Q9HCE7	SMUF1_HUMAN	L	285	ENSP00000354621:F285L	ENSP00000354621:F285L	F	-	1	0	SMURF1	98486505	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.368000	0.44222	1.920000	0.55613	0.455000	0.32223	TTC	SMURF1	-	NULL	ENSG00000198742		0.458	SMURF1-001	KNOWN	basic|CCDS	protein_coding	SMURF1	HGNC	protein_coding	OTTHUMT00000335001.2	24	0.00	0	A	NM_020429		98648569	98648569	-1	no_errors	ENST00000361125	ensembl	human	known	69_37n	missense	19	20.83	5	SNP	1.000	G
SNX2	6643	genome.wustl.edu	37	5	122153033	122153033	+	Missense_Mutation	SNP	A	A	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr5:122153033A>C	ENST00000379516.2	+	10	1079	c.971A>C	c.(970-972)cAt>cCt	p.H324P	SNX2_ENST00000510372.1_3'UTR|SNX2_ENST00000514949.1_Missense_Mutation_p.H207P	NM_003100.2	NP_003091.2	O60749	SNX2_HUMAN	sorting nexin 2	324					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|protein oligomerization (GO:0051259)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|protein complex (GO:0043234)|retromer complex (GO:0030904)	epidermal growth factor receptor binding (GO:0005154)|insulin receptor binding (GO:0005158)|leptin receptor binding (GO:1990460)|phosphatidylinositol binding (GO:0035091)|transferrin receptor binding (GO:1990459)			NS(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(2)|prostate(1)|skin(1)	19		all_cancers(142;1.14e-44)|all_lung(232;1.03e-13)|Lung NSC(810;2.5e-13)|Breast(839;0.000812)|Myeloproliferative disorder(839;0.0122)|Prostate(80;0.0235)|all_hematologic(541;0.0592)|all_neural(839;0.243)	KIRC - Kidney renal clear cell carcinoma(527;0.0897)|Kidney(363;0.137)	all cancers(49;2.13e-24)|Epithelial(69;6.15e-22)|OV - Ovarian serous cystadenocarcinoma(64;5.6e-11)|BRCA - Breast invasive adenocarcinoma(61;0.00013)|GBM - Glioblastoma multiforme(465;0.000357)|COAD - Colon adenocarcinoma(49;0.000887)|Lung(113;0.0109)		AGGAAACTTCATGTCAGTGTT	0.323																																						dbGAP											0													126.0	124.0	124.0					5																	122153033		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF043453	CCDS34217.1, CCDS64234.1	5q23.2	2011-05-03			ENSG00000205302	ENSG00000205302		"""Sorting nexins"""	11173	protein-coding gene	gene with protein product		605929				9819414	Standard	NM_003100		Approved		uc003kte.4	O60749	OTTHUMG00000163020	ENST00000379516.2:c.971A>C	5.37:g.122153033A>C	ENSP00000368831:p.His324Pro	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KN44|B4DEK4|B7Z408|O43650|P82862|Q53XK8|Q597H6|Q9BTS8	Missense_Mutation	SNP	pfam_Vps5_C,pfam_Sorting_nexin_N,pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.H324P	ENST00000379516.2	37	c.971	CCDS34217.1	5	.	.	.	.	.	.	.	.	.	.	A	16.78	3.218342	0.58560	.	.	ENSG00000205302	ENST00000379516;ENST00000514949	T;T	0.59502	0.26;0.26	5.22	4.07	0.47477	Vps5 C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.73877	0.3643	M	0.84846	2.72	0.80722	D	1	D	0.54207	0.965	P	0.60886	0.88	T	0.76580	-0.2907	10	0.87932	D	0	-15.2486	10.6777	0.45796	0.9251:0.0:0.0749:0.0	.	324	O60749	SNX2_HUMAN	P	324;207	ENSP00000368831:H324P;ENSP00000421663:H207P	ENSP00000368831:H324P	H	+	2	0	SNX2	122180932	1.000000	0.71417	0.979000	0.43373	0.881000	0.50899	9.169000	0.94788	0.837000	0.34925	0.528000	0.53228	CAT	SNX2	-	pfam_Vps5_C	ENSG00000205302		0.323	SNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX2	HGNC	protein_coding	OTTHUMT00000371392.1	78	0.00	0	A	NM_003100		122153033	122153033	+1	no_errors	ENST00000379516	ensembl	human	known	69_37n	missense	80	29.82	34	SNP	1.000	C
SRCAP	10847	genome.wustl.edu	37	16	30735726	30735726	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr16:30735726C>G	ENST00000262518.4	+	25	5366	c.4981C>G	c.(4981-4983)Caa>Gaa	p.Q1661E	SRCAP_ENST00000395059.2_Missense_Mutation_p.Q1599E|SRCAP_ENST00000344771.4_Missense_Mutation_p.Q1503E	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	1661	Pro-rich.				histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)	p.Q1661E(1)		NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			ATCATCAACTCAAACTATGCT	0.582																																						dbGAP											1	Substitution - Missense(1)	large_intestine(1)											143.0	147.0	146.0					16																	30735726		2197	4300	6497	-	-	-	SO:0001583	missense	0			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.4981C>G	16.37:g.30735726C>G	ENSP00000262518:p.Gln1661Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.Q1661E	ENST00000262518.4	37	c.4981	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	12.99	2.104470	0.37145	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.92048	-2.92;-2.88;-2.96	5.81	5.81	0.92471	.	0.119736	0.38005	N	0.001854	D	0.87176	0.6112	N	0.19112	0.55	0.31478	N	0.667529	P;P;P	0.40794	0.571;0.729;0.61	B;B;B	0.39027	0.21;0.288;0.15	D	0.88606	0.3153	10	0.59425	D	0.04	-3.8396	17.5674	0.87923	0.0:1.0:0.0:0.0	.	1503;1599;1661	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	E	1661;1599;1503	ENSP00000262518:Q1661E;ENSP00000378499:Q1599E;ENSP00000343042:Q1503E	ENSP00000262518:Q1661E	Q	+	1	0	SRCAP	30643227	0.993000	0.37304	1.000000	0.80357	0.995000	0.86356	1.393000	0.34497	2.741000	0.93983	0.650000	0.86243	CAA	SRCAP	-	NULL	ENSG00000080603		0.582	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	55	0.00	0	C	NM_006662		30735726	30735726	+1	no_errors	ENST00000262518	ensembl	human	known	69_37n	missense	48	26.15	17	SNP	1.000	G
SRCIN1	80725	genome.wustl.edu	37	17	36719665	36719665	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:36719665G>C	ENST00000264659.7	-	5	858	c.634C>G	c.(634-636)Cac>Gac	p.H212D	SRCIN1_ENST00000578925.1_Missense_Mutation_p.H246D|SRCIN1_ENST00000398579.4_5'UTR	NM_025248.2	NP_079524.2	Q9C0H9	SRCN1_HUMAN	SRC kinase signaling inhibitor 1	84					exocytosis (GO:0006887)|negative regulation of protein tyrosine kinase activity (GO:0061099)|positive regulation of protein tyrosine kinase activity (GO:0061098)|regulation of cell migration (GO:0030334)|regulation of dendritic spine morphogenesis (GO:0061001)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	protein kinase binding (GO:0019901)			endometrium(2)|kidney(1)|large_intestine(6)|lung(9)|prostate(1)	19						GGGAACATGTGCGCGATGAGT	0.607																																						dbGAP											0													47.0	52.0	50.0					17																	36719665		2185	4276	6461	-	-	-	SO:0001583	missense	0				CCDS45660.1	17q12	2009-12-14			ENSG00000017373	ENSG00000277363			29506	protein-coding gene	gene with protein product	"""p130Cas-associated protein"", ""SNAP-25-interacting protein"""	610786				11214970	Standard	NM_025248		Approved	SNIP, p140Cap, KIAA1684	uc002hqd.3	Q9C0H9		ENST00000264659.7:c.634C>G	17.37:g.36719665G>C	ENSP00000264659:p.His212Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75T46|Q8N4W8	Missense_Mutation	SNP	pfam_AIP3_C	p.H212D	ENST00000264659.7	37	c.634	CCDS45660.1	17	.	.	.	.	.	.	.	.	.	.	G	23.7	4.444906	0.83993	.	.	ENSG00000017373	ENST00000264659;ENST00000398579	T	0.54071	0.59	5.0	5.0	0.66597	.	0.103125	0.64402	D	0.000002	T	0.68650	0.3024	L	0.58101	1.795	0.52501	D	0.999955	P;D;D;D	0.89917	0.942;0.996;0.996;1.0	P;D;D;D	0.85130	0.819;0.979;0.979;0.997	T	0.65117	-0.6246	10	0.30854	T	0.27	-31.4233	17.4279	0.87531	0.0:0.0:1.0:0.0	.	66;84;84;212	B4DHC2;Q9C0H9-2;Q9C0H9;Q9C0H9-5	.;.;SRCN1_HUMAN;.	D	212;66	ENSP00000264659:H212D	ENSP00000264659:H212D	H	-	1	0	SRCIN1	33973191	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.619000	0.83057	2.477000	0.83638	0.650000	0.86243	CAC	SRCIN1	-	pfam_AIP3_C	ENSG00000017373		0.607	SRCIN1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SRCIN1	HGNC	protein_coding	OTTHUMT00000441878.4	24	0.00	0	G	NM_025248		36719665	36719665	-1	no_errors	ENST00000264659	ensembl	human	known	69_37n	missense	26	35.00	14	SNP	1.000	C
STEAP3	55240	genome.wustl.edu	37	2	120020658	120020658	+	Missense_Mutation	SNP	T	T	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:120020658T>C	ENST00000354888.5	+	6	1715	c.1211T>C	c.(1210-1212)gTg>gCg	p.V404A	STEAP3_ENST00000409811.1_3'UTR|STEAP3_ENST00000393110.2_Missense_Mutation_p.V414A|STEAP3_ENST00000393106.2_Missense_Mutation_p.V404A|STEAP3_ENST00000393107.2_Missense_Mutation_p.V404A|STEAP3_ENST00000393108.2_Missense_Mutation_p.V404A|STEAP3_ENST00000425223.2_Missense_Mutation_p.V404A	NM_182915.2	NP_878919.2	Q658P3	STEA3_HUMAN	STEAP family member 3, metalloreductase	404	Ferric oxidoreductase.				apoptotic process (GO:0006915)|cell cycle (GO:0007049)|cellular iron ion homeostasis (GO:0006879)|copper ion import (GO:0015677)|exosomal secretion (GO:1990182)|ferric iron import into cell (GO:0097461)|positive regulation of apoptotic process (GO:0043065)|positive regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902167)|protein secretion (GO:0009306)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|multivesicular body (GO:0005771)|plasma membrane (GO:0005886)	cupric reductase activity (GO:0008823)|ferric-chelate reductase (NADPH) activity (GO:0052851)|ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(2)|lung(4)|skin(1)	17						GTGGCCCTCGTGCTGAGCACA	0.607																																						dbGAP											0													101.0	105.0	104.0					2																	120020658		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY029585	CCDS2125.1, CCDS42738.1	2q14.2	2011-09-30	2011-09-30		ENSG00000115107	ENSG00000115107			24592	protein-coding gene	gene with protein product		609671				12606722	Standard	NM_182915		Approved	TSAP6, dudlin-2, STMP3	uc002tlr.3	Q658P3	OTTHUMG00000131402	ENST00000354888.5:c.1211T>C	2.37:g.120020658T>C	ENSP00000346961:p.Val404Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6E3|Q4VBR2|Q4ZG36|Q53SQ8|Q7Z389|Q86SF6|Q8NEW6|Q8TDP3|Q8TF03|Q9NVB5	Missense_Mutation	SNP	pfam_Fe3_Rdtase_TM_dom,pfam_NADP_OxRdtase_F420	p.V414A	ENST00000354888.5	37	c.1241	CCDS2125.1	2	.	.	.	.	.	.	.	.	.	.	T	14.85	2.657201	0.47467	.	.	ENSG00000115107	ENST00000393108;ENST00000354888;ENST00000393110;ENST00000393106;ENST00000393107;ENST00000425223;ENST00000546236	T;T;T;T;T;T	0.07216	3.22;3.22;3.21;3.22;3.22;3.22	4.82	4.82	0.62117	.	0.350989	0.26099	N	0.026355	T	0.05640	0.0148	N	0.14661	0.345	0.80722	D	1	B;B	0.14012	0.009;0.001	B;B	0.15484	0.013;0.002	T	0.41360	-0.9513	9	.	.	.	-15.1613	13.7159	0.62695	0.0:0.0:0.0:1.0	.	414;404	Q658P3-2;Q658P3	.;STEA3_HUMAN	A	404;404;414;404;404;404;48	ENSP00000376820:V404A;ENSP00000346961:V404A;ENSP00000376822:V414A;ENSP00000376818:V404A;ENSP00000376819:V404A;ENSP00000396214:V404A	.	V	+	2	0	STEAP3	119737128	0.999000	0.42202	1.000000	0.80357	0.983000	0.72400	3.405000	0.52630	2.044000	0.60594	0.459000	0.35465	GTG	STEAP3	-	NULL	ENSG00000115107		0.607	STEAP3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STEAP3	HGNC	protein_coding	OTTHUMT00000254193.1	17	0.00	0	T	NM_018234		120020658	120020658	+1	no_errors	ENST00000393110	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	1.000	C
STK40	83931	genome.wustl.edu	37	1	36814341	36814341	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:36814341C>G	ENST00000373129.3	-	8	1105	c.699G>C	c.(697-699)caG>caC	p.Q233H	STK40_ENST00000359297.2_Missense_Mutation_p.Q233H|STK40_ENST00000373130.3_Missense_Mutation_p.Q238H|STK40_ENST00000373132.3_Missense_Mutation_p.Q233H	NM_032017.1	NP_114406.1	Q8N2I9	STK40_HUMAN	serine/threonine kinase 40	233	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				glycogen metabolic process (GO:0005977)|lung alveolus development (GO:0048286)|lung morphogenesis (GO:0060425)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|regulation of gene expression (GO:0010468)|regulation of MAPK cascade (GO:0043408)|respiratory system process (GO:0003016)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)|stomach(1)	13		Myeloproliferative disorder(586;0.0393)				GGCTCCCTCTCTGGTCCTTCA	0.572																																						dbGAP											0													111.0	86.0	95.0					1																	36814341		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC008344	CCDS407.1, CCDS60089.1	1p34.3	2008-02-05			ENSG00000196182	ENSG00000196182			21373	protein-coding gene	gene with protein product		609437					Standard	NM_032017		Approved	MGC4796, SgK495	uc001cak.1	Q8N2I9	OTTHUMG00000008238	ENST00000373129.3:c.699G>C	1.37:g.36814341C>G	ENSP00000362221:p.Gln233His	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DPS8|Q5VTK8|Q5VTK9|Q6ZMN1|Q8N2J8|Q8N3I6|Q96HN6|Q96I44|Q9BSA3|Q9H7H6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Q238H	ENST00000373129.3	37	c.714	CCDS407.1	1	.	.	.	.	.	.	.	.	.	.	C	28.9	4.963092	0.92791	.	.	ENSG00000196182	ENST00000373129;ENST00000359297;ENST00000373130;ENST00000373132	T;T;T;T	0.65916	-0.18;1.98;1.98;-0.18	5.09	5.09	0.68999	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.105664	0.64402	D	0.000003	T	0.75280	0.3828	L	0.54323	1.7	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.69479	0.939;0.939;0.964	T	0.78117	-0.2329	10	0.87932	D	0	-24.5035	17.4927	0.87709	0.0:1.0:0.0:0.0	.	233;238;233	Q8N2I9-3;Q8N2I9-4;Q8N2I9	.;.;STK40_HUMAN	H	233;233;238;233	ENSP00000362221:Q233H;ENSP00000352245:Q233H;ENSP00000362222:Q238H;ENSP00000362224:Q233H	ENSP00000352245:Q233H	Q	-	3	2	STK40	36586928	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	7.452000	0.80683	2.351000	0.79841	0.655000	0.94253	CAG	STK40	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000196182		0.572	STK40-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STK40	HGNC	protein_coding	OTTHUMT00000022592.1	44	0.00	0	C	NM_032017		36814341	36814341	-1	no_errors	ENST00000373130	ensembl	human	known	69_37n	missense	14	51.72	15	SNP	1.000	G
SYNE1	23345	genome.wustl.edu	37	6	152804231	152804231	+	Missense_Mutation	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:152804231C>G	ENST00000367255.5	-	14	1940	c.1339G>C	c.(1339-1341)Gag>Cag	p.E447Q	SYNE1_ENST00000367248.3_Missense_Mutation_p.E437Q|SYNE1_ENST00000448038.1_Missense_Mutation_p.E454Q|SYNE1_ENST00000367253.4_Missense_Mutation_p.E447Q|SYNE1_ENST00000466159.2_Missense_Mutation_p.E447Q|SYNE1_ENST00000265368.4_Missense_Mutation_p.E447Q|SYNE1_ENST00000423061.1_Missense_Mutation_p.E454Q|SYNE1_ENST00000341594.5_Missense_Mutation_p.E447Q|SYNE1_ENST00000413186.2_Missense_Mutation_p.E447Q	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	447					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTATGTTGCTCAAGTTTCCGT	0.507										HNSCC(10;0.0054)																												dbGAP											0													353.0	344.0	347.0					6																	152804231		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.1339G>C	6.37:g.152804231C>G	ENSP00000356224:p.Glu447Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E447Q	ENST00000367255.5	37	c.1339	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	C	26.7	4.759487	0.89932	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000367253;ENST00000367248;ENST00000413186;ENST00000466159;ENST00000537750	T;T;T;T;T;D;D;D;D;D	0.92048	0.34;0.34;0.25;0.33;0.53;-2.41;-2.56;-2.54;-2.77;-2.96	5.87	5.87	0.94306	.	0.000000	0.56097	D	0.000026	D	0.95072	0.8404	M	0.68317	2.08	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;1.0;1.0;1.0	D;D;D;D;D	0.76575	0.982;0.974;0.979;0.974;0.988	D	0.92417	0.5942	10	0.33141	T	0.24	.	20.5827	0.99408	0.0:1.0:0.0:0.0	.	430;447;447;447;454	B3W695;Q8NF91;F5H4Q0;E7EQI5;Q8NF91-4	.;SYNE1_HUMAN;.;.;.	Q	447;454;447;454;447;447;437;447;447;430	ENSP00000356224:E447Q;ENSP00000396024:E454Q;ENSP00000265368:E447Q;ENSP00000390975:E454Q;ENSP00000341887:E447Q;ENSP00000356222:E447Q;ENSP00000356217:E437Q;ENSP00000414510:E447Q;ENSP00000446021:E447Q;ENSP00000441264:E430Q	ENSP00000265368:E447Q	E	-	1	0	SYNE1	152845924	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.445000	0.80570	2.941000	0.99782	0.655000	0.94253	GAG	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.507	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	132	0.00	0	C	NM_182961		152804231	152804231	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	167	22.22	48	SNP	1.000	G
SYNE2	23224	genome.wustl.edu	37	14	64496652	64496652	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:64496652G>A	ENST00000344113.4	+	44	6966	c.6754G>A	c.(6754-6756)Gat>Aat	p.D2252N	SYNE2_ENST00000554584.1_Missense_Mutation_p.D2252N|SYNE2_ENST00000358025.3_Missense_Mutation_p.D2252N|SYNE2_ENST00000357395.3_5'UTR	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	2252					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TCGAGAACATGATTCATACCA	0.378																																						dbGAP											0													87.0	84.0	85.0					14																	64496652		1829	4092	5921	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.6754G>A	14.37:g.64496652G>A	ENSP00000341781:p.Asp2252Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.D2252N	ENST00000344113.4	37	c.6754	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	6.846	0.525335	0.13066	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.34072	1.38;1.38;1.38	5.24	1.18	0.20946	.	0.894527	0.09595	N	0.781000	T	0.22898	0.0553	N	0.14661	0.345	0.80722	D	1	B;B	0.24721	0.067;0.11	B;B	0.22601	0.018;0.04	T	0.03394	-1.1041	10	0.52906	T	0.07	.	10.2666	0.43457	0.1366:0.4151:0.4483:0.0	.	2252;2252	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	N	2252	ENSP00000350719:D2252N;ENSP00000341781:D2252N;ENSP00000452570:D2252N	ENSP00000261678:D2252N	D	+	1	0	SYNE2	63566405	0.558000	0.26554	0.344000	0.25628	0.138000	0.21146	0.373000	0.20484	0.007000	0.14760	-0.165000	0.13383	GAT	SYNE2	-	smart_Spectrin/alpha-actinin	ENSG00000054654		0.378	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	103	0.00	0	G	NM_182914		64496652	64496652	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	96	18.64	22	SNP	0.843	A
SYNE2	23224	genome.wustl.edu	37	14	64595260	64595260	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:64595260G>C	ENST00000344113.4	+	74	14220	c.14008G>C	c.(14008-14010)Gaa>Caa	p.E4670Q	SYNE2_ENST00000554584.1_Intron|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.E1304Q|SYNE2_ENST00000358025.3_Missense_Mutation_p.E4670Q|SYNE2_ENST00000357395.3_Missense_Mutation_p.E1055Q|SYNE2_ENST00000394768.2_Missense_Mutation_p.E1055Q	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	4670					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)	p.E4670K(1)		NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GAGTGTTGCTGAACAGCTTCA	0.358																																						dbGAP											1	Substitution - Missense(1)	lung(1)											89.0	87.0	88.0					14																	64595260		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.14008G>C	14.37:g.64595260G>C	ENSP00000341781:p.Glu4670Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.E4670Q	ENST00000344113.4	37	c.14008	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	G	11.88	1.771435	0.31320	.	.	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000555002;ENST00000394768	T;T;T;T;T	0.34859	1.34;1.34;1.34;1.34;1.34	5.43	2.61	0.31194	.	0.334050	0.25047	N	0.033548	T	0.24353	0.0590	L	0.29908	0.895	0.58432	D	0.999998	B;B;P	0.41848	0.317;0.35;0.763	B;B;B	0.39185	0.198;0.129;0.293	T	0.01961	-1.1239	10	0.44086	T	0.13	.	8.34	0.32239	0.3069:0.0:0.6931:0.0	.	1055;4670;4670	Q8WXH0-7;Q8WXH0;Q8WXH0-2	.;SYNE2_HUMAN;.	Q	4670;1055;4670;1304;1055	ENSP00000350719:E4670Q;ENSP00000349969:E1055Q;ENSP00000341781:E4670Q;ENSP00000450831:E1304Q;ENSP00000378249:E1055Q	ENSP00000341781:E4670Q	E	+	1	0	SYNE2	63665013	1.000000	0.71417	0.576000	0.28549	0.567000	0.35839	2.913000	0.48790	0.352000	0.24053	-0.300000	0.09419	GAA	SYNE2	-	NULL	ENSG00000054654		0.358	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	34	0.00	0	G	NM_182914		64595260	64595260	+1	no_errors	ENST00000358025	ensembl	human	known	69_37n	missense	29	14.71	5	SNP	0.838	C
TAAR6	319100	genome.wustl.edu	37	6	132892456	132892456	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr6:132892456G>C	ENST00000275198.1	+	1	996	c.996G>C	c.(994-996)aaG>aaC	p.K332N		NM_175067.1	NP_778237.1	Q96RI8	TAAR6_HUMAN	trace amine associated receptor 6	332					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|trace-amine receptor activity (GO:0001594)			cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(19)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	41	Breast(56;0.112)			OV - Ovarian serous cystadenocarcinoma(155;0.006)|GBM - Glioblastoma multiforme(226;0.00792)		AGGTTTTAAAGAACAGTTCAG	0.318																																						dbGAP											0													54.0	56.0	56.0					6																	132892456		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF380192	CCDS5155.1	6q23.1	2012-08-08	2005-02-23	2005-02-24	ENSG00000146383	ENSG00000146383		"""GPCR / Class A : Trace amine associated receptors"""	20978	protein-coding gene	gene with protein product		608923	"""trace amine receptor 4"""	TRAR4		11459929, 15718104	Standard	NM_175067		Approved	TA4	uc011eck.2	Q96RI8	OTTHUMG00000015579	ENST00000275198.1:c.996G>C	6.37:g.132892456G>C	ENSP00000275198:p.Lys332Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VUQ4	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn,prints_Trace_amine_rcpt	p.K332N	ENST00000275198.1	37	c.996	CCDS5155.1	6	.	.	.	.	.	.	.	.	.	.	G	6.290	0.421535	0.11928	.	.	ENSG00000146383	ENST00000275198;ENST00000539228	T	0.38077	1.16	5.11	3.22	0.36961	.	0.574483	0.15428	N	0.262873	T	0.11367	0.0277	L	0.50333	1.59	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.28808	-1.0032	10	0.20519	T	0.43	-4.1396	5.7703	0.18249	0.2575:0.1401:0.6024:0.0	.	332	Q96RI8	TAAR6_HUMAN	N	332;307	ENSP00000275198:K332N	ENSP00000275198:K332N	K	+	3	2	TAAR6	132934149	0.000000	0.05858	0.003000	0.11579	0.947000	0.59692	-0.714000	0.05002	0.641000	0.30601	0.650000	0.86243	AAG	TAAR6	-	NULL	ENSG00000146383		0.318	TAAR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAAR6	HGNC	protein_coding	OTTHUMT00000042255.1	21	0.00	0	G	NM_175067		132892456	132892456	+1	no_errors	ENST00000275198	ensembl	human	known	69_37n	missense	19	29.63	8	SNP	0.000	C
TBC1D15	64786	genome.wustl.edu	37	12	72288506	72288506	+	Missense_Mutation	SNP	T	T	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr12:72288506T>A	ENST00000550746.1	+	8	813	c.749T>A	c.(748-750)tTt>tAt	p.F250Y	TBC1D15_ENST00000319106.8_Missense_Mutation_p.F241Y|TBC1D15_ENST00000393309.3_Missense_Mutation_p.F4Y|TBC1D15_ENST00000485960.2_Missense_Mutation_p.F233Y	NM_001146213.1|NM_022771.4	NP_001139685.2|NP_073608.4	Q8TC07	TBC15_HUMAN	TBC1 domain family, member 15	250					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	Rab GTPase activator activity (GO:0005097)			NS(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(8)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						ATGATAGGATTTTCCAAAGTC	0.353																																						dbGAP											0													71.0	72.0	72.0					12																	72288506		2202	4298	6500	-	-	-	SO:0001583	missense	0			AL157464	CCDS31858.1, CCDS53814.1, CCDS55849.1	12q15	2013-07-09			ENSG00000121749	ENSG00000121749			25694	protein-coding gene	gene with protein product		612662				16055087	Standard	NM_022771		Approved	FLJ12085, DKFZp761D0223	uc001swu.3	Q8TC07	OTTHUMG00000158553	ENST00000550746.1:c.749T>A	12.37:g.72288506T>A	ENSP00000448182:p.Phe250Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMT9|B9A6L6|J3KNI9|Q9HA83	Missense_Mutation	SNP	pfam_DUF3548,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.F250Y	ENST00000550746.1	37	c.749	CCDS31858.1	12	.	.	.	.	.	.	.	.	.	.	T	20.8	4.051837	0.75960	.	.	ENSG00000121749	ENST00000550746;ENST00000491063;ENST00000319106;ENST00000485960;ENST00000393309	T;T;T;T	0.11930	2.73;2.94;2.94;2.84	5.26	5.26	0.73747	.	0.051024	0.85682	D	0.000000	T	0.17450	0.0419	L	0.55103	1.725	0.53005	D	0.999962	B;B;B	0.19200	0.016;0.027;0.034	B;B;B	0.20577	0.013;0.03;0.007	T	0.01844	-1.1262	10	0.72032	D	0.01	0.1511	15.2064	0.73183	0.0:0.0:0.0:1.0	.	241;233;250	E9PH93;Q8TC07-2;Q8TC07	.;.;TBC15_HUMAN	Y	250;134;241;233;4	ENSP00000448182:F250Y;ENSP00000318262:F241Y;ENSP00000420678:F233Y;ENSP00000376986:F4Y	ENSP00000318262:F241Y	F	+	2	0	TBC1D15	70574773	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	8.037000	0.88933	1.999000	0.58509	0.473000	0.43528	TTT	TBC1D15	-	NULL	ENSG00000121749		0.353	TBC1D15-001	KNOWN	basic|CCDS	protein_coding	TBC1D15	HGNC	protein_coding	OTTHUMT00000351266.2	34	0.00	0	T	NM_022771		72288506	72288506	+1	no_errors	ENST00000550746	ensembl	human	known	69_37n	missense	42	27.12	16	SNP	1.000	A
TCF3	6929	genome.wustl.edu	37	19	1615425	1615425	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:1615425G>A	ENST00000262965.5	-	18	2025	c.1681C>T	c.(1681-1683)Cgg>Tgg	p.R561W	TCF3_ENST00000453954.2_Intron|RNU6-1223P_ENST00000517124.1_RNA|TCF3_ENST00000395423.3_Missense_Mutation_p.R565W|TCF3_ENST00000588136.1_Intron|TCF3_ENST00000344749.5_Intron	NM_003200.3	NP_003191.1	Q9HCS4	TF7L1_HUMAN	transcription factor 3	0					anterior/posterior axis specification, embryo (GO:0008595)|axial mesoderm morphogenesis (GO:0048319)|brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|chromatin organization (GO:0006325)|generation of neurons (GO:0048699)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter during mitosis (GO:0046022)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|skin development (GO:0043588)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(2)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	16		Acute lymphoblastic leukemia(61;5.94e-12)|all_hematologic(61;1.27e-07)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCACGGACCCGCAGCCGCTCC	0.642			T	"""PBX1, HLF, TFPT"""	pre B-ALL																																	dbGAP		Dom	yes		19	19p13.3	6929	transcription factor 3 (E2A immunoglobulin enhancer binding factors E12/E47)		L	0													82.0	85.0	84.0					19																	1615425		2203	4300	6503	-	-	-	SO:0001583	missense	0			M65214	CCDS12074.1, CCDS45899.1	19p13.3	2014-02-13	2013-02-26		ENSG00000071564	ENSG00000071564		"""Basic helix-loop-helix proteins"""	11633	protein-coding gene	gene with protein product	"""transcription factor E2-alpha"", ""immunoglobulin transcription factor 1"", ""kappa-E2-binding factor"", ""E2A immunoglobulin enhancer-binding factor E12/E47"", ""VDR interacting repressor"""	147141				2308859, 1967983	Standard	NM_003200		Approved	E2A, ITF1, MGC129647, MGC129648, bHLHb21, VDIR, E47	uc002ltt.4	P15923	OTTHUMG00000180031	ENST00000262965.5:c.1681C>T	19.37:g.1615425G>A	ENSP00000262965:p.Arg561Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53R97|Q6PD70|Q9NP00	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.R561W	ENST00000262965.5	37	c.1681	CCDS12074.1	19	.	.	.	.	.	.	.	.	.	.	G	19.88	3.909564	0.72868	.	.	ENSG00000071564	ENST00000262965;ENST00000395423	D;D	0.99722	-6.53;-6.53	4.34	3.27	0.37495	Helix-loop-helix DNA-binding (5);	0.000000	0.85682	D	0.000000	D	0.99722	0.9892	M	0.92923	3.36	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;1.0;1.0	D	0.97927	1.0318	10	0.87932	D	0	-23.5889	12.4543	0.55695	0.0:0.0:0.8307:0.1693	.	561;565;498	P15923;Q2TB39;Q6PJU3	TFE2_HUMAN;.;.	W	561;565	ENSP00000262965:R561W;ENSP00000378813:R565W	ENSP00000262965:R561W	R	-	1	2	TCF3	1566425	1.000000	0.71417	1.000000	0.80357	0.874000	0.50279	4.519000	0.60517	0.770000	0.33336	0.484000	0.47621	CGG	TCF3	-	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	ENSG00000071564		0.642	TCF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCF3	HGNC	protein_coding	OTTHUMT00000449367.1	37	0.00	0	G	NM_003200		1615425	1615425	-1	no_errors	ENST00000262965	ensembl	human	known	69_37n	missense	39	24.53	13	SNP	1.000	A
THOC1	9984	genome.wustl.edu	37	18	226824	226824	+	Silent	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr18:226824G>C	ENST00000261600.6	-	12	1003	c.996C>G	c.(994-996)ctC>ctG	p.L332L		NM_005131.2	NP_005122.2	Q96FV9	THOC1_HUMAN	THO complex 1	332					apoptotic process (GO:0006915)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|negative regulation of DNA damage checkpoint (GO:2000002)|negative regulation of isotype switching to IgA isotypes (GO:0048297)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|regulation of DNA recombination (GO:0000018)|regulation of DNA-templated transcription, elongation (GO:0032784)|replication fork processing (GO:0031297)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|viral mRNA export from host cell nucleus (GO:0046784)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|THO complex (GO:0000347)|THO complex part of transcription export complex (GO:0000445)|transcription export complex (GO:0000346)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	20		all_cancers(4;0.0896)|Myeloproliferative disorder(11;0.0412)				CCTGCCCCTTGAGATATTGGA	0.358																																						dbGAP											0													87.0	78.0	81.0					18																	226824		1852	4095	5947	-	-	-	SO:0001819	synonymous_variant	0			AK055354	CCDS45820.1	18p11.32	2013-02-11			ENSG00000079134	ENSG00000079134		"""THO complex subunits"""	19070	protein-coding gene	gene with protein product		606930				11979277	Standard	NM_005131		Approved	P84, HPR1	uc002kkj.4	Q96FV9		ENST00000261600.6:c.996C>G	18.37:g.226824G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBP6|Q15219|Q64I72|Q64I73	Silent	SNP	pfam_THO_THOC1,pfam_Death,superfamily_DEATH-like,smart_Death,pfscan_Death	p.L332	ENST00000261600.6	37	c.996	CCDS45820.1	18																																																																																			THOC1	-	pfam_THO_THOC1	ENSG00000079134		0.358	THOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOC1	HGNC	protein_coding	OTTHUMT00000440348.5	66	0.00	0	G	NM_005131		226824	226824	-1	no_errors	ENST00000261600	ensembl	human	known	69_37n	silent	49	35.53	27	SNP	1.000	C
TIGD4	201798	genome.wustl.edu	37	4	153691716	153691716	+	Silent	SNP	T	T	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:153691716T>C	ENST00000304337.2	-	2	1261	c.441A>G	c.(439-441)caA>caG	p.Q147Q		NM_145720.3	NP_663772.1	Q8IY51	TIGD4_HUMAN	tigger transposable element derived 4	147						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(2)|large_intestine(9)|lung(9)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(2)	26	all_hematologic(180;0.093)					CTTCTACAGGTTGAGCTCTGA	0.368																																						dbGAP											0													50.0	53.0	52.0					4																	153691716		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			AK058054	CCDS34079.1	4q31.23	2008-02-05							18335	protein-coding gene	gene with protein product							Standard	NM_145720		Approved		uc003imy.3	Q8IY51		ENST00000304337.2:c.441A>G	4.37:g.153691716T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96LP5	Silent	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,pfam_Centromere_CenpB_dimerisation,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.Q147	ENST00000304337.2	37	c.441	CCDS34079.1	4																																																																																			TIGD4	-	pfam_HTH_CenpB_DNA-bd_dom	ENSG00000169989		0.368	TIGD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD4	HGNC	protein_coding	OTTHUMT00000365028.1	26	0.00	0	T	NM_145720		153691716	153691716	-1	no_errors	ENST00000304337	ensembl	human	known	69_37n	silent	23	14.81	4	SNP	1.000	C
TM9SF1	10548	genome.wustl.edu	37	14	24659852	24659852	+	Silent	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:24659852G>A	ENST00000261789.4	-	5	1519	c.1161C>T	c.(1159-1161)ttC>ttT	p.F387F	IPO4_ENST00000354464.6_5'Flank|TM9SF1_ENST00000524835.1_Silent_p.F300F|TM9SF1_ENST00000556387.1_Silent_p.F596F|RP11-468E2.2_ENST00000561419.1_5'Flank|TM9SF1_ENST00000396854.4_Silent_p.F387F|TM9SF1_ENST00000528669.1_Silent_p.F387F|TM9SF1_ENST00000530611.1_Silent_p.F596F	NM_006405.5	NP_006396.2	O15321	TM9S1_HUMAN	transmembrane 9 superfamily member 1	387					autophagy (GO:0006914)	cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)				NS(1)|breast(4)|endometrium(3)|large_intestine(11)|lung(4)|ovary(1)	24				GBM - Glioblastoma multiforme(265;0.0183)		ACGTCAGGAAGAAAGGCACTG	0.587																																						dbGAP											0													49.0	45.0	46.0					14																	24659852		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U94831	CCDS9617.1, CCDS41934.1, CCDS73623.1	14q11.2	2005-10-11			ENSG00000100926	ENSG00000100926			11864	protein-coding gene	gene with protein product						9332367	Standard	NM_006405		Approved	MP70, HMP70	uc010tob.1	O15321	OTTHUMG00000029322	ENST00000261789.4:c.1161C>T	14.37:g.24659852G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DS65|Q86SZ6|Q96FI8	Silent	SNP	pfam_EMP70,pfam_Snf7	p.F596	ENST00000261789.4	37	c.1788	CCDS9617.1	14																																																																																			TM9SF1	-	pfam_EMP70	ENSG00000100926		0.587	TM9SF1-002	KNOWN	basic|CCDS	protein_coding	TM9SF1	HGNC	protein_coding	OTTHUMT00000073136.2	22	0.00	0	G	NM_006405		24659852	24659852	-1	no_errors	ENST00000556387	ensembl	human	known	69_37n	silent	28	24.32	9	SNP	1.000	A
TMEM31	203562	genome.wustl.edu	37	X	102968633	102968633	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chrX:102968633G>A	ENST00000319560.6	+	3	405	c.214G>A	c.(214-216)Gaa>Aaa	p.E72K	GLRA4_ENST00000372617.4_Intron	NM_182541.2	NP_872347.2	Q5JXX7	TMM31_HUMAN	transmembrane protein 31	72						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)|large_intestine(3)	7						CAACCTTCTTGAAGTCCTTCC	0.468																																						dbGAP											0													291.0	206.0	235.0					X																	102968633		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC029575	CCDS35359.1	Xq22.2	2008-02-05			ENSG00000179363	ENSG00000179363			28601	protein-coding gene	gene with protein product						12477932	Standard	NM_182541		Approved	MGC39655	uc004elh.3	Q5JXX7	OTTHUMG00000022109	ENST00000319560.6:c.214G>A	X.37:g.102968633G>A	ENSP00000316940:p.Glu72Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NHR4	Missense_Mutation	SNP	NULL	p.E72K	ENST00000319560.6	37	c.214	CCDS35359.1	X	.	.	.	.	.	.	.	.	.	.	G	8.262	0.811362	0.16537	.	.	ENSG00000179363	ENST00000319560	.	.	.	4.72	1.97	0.26223	.	1.562980	0.04170	N	0.324580	T	0.18425	0.0442	N	0.08118	0	0.09310	N	1	B	0.24426	0.103	B	0.21917	0.037	T	0.20706	-1.0267	9	0.16896	T	0.51	0.18	3.8605	0.08994	0.2082:0.0:0.6026:0.1892	.	72	Q5JXX7	TMM31_HUMAN	K	72	.	ENSP00000316940:E72K	E	+	1	0	TMEM31	102855289	0.028000	0.19301	0.000000	0.03702	0.007000	0.05969	1.243000	0.32767	0.163000	0.19507	-0.185000	0.12909	GAA	TMEM31	-	NULL	ENSG00000179363		0.468	TMEM31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM31	HGNC	protein_coding	OTTHUMT00000057741.1	67	0.00	0	G	NM_182541		102968633	102968633	+1	no_errors	ENST00000319560	ensembl	human	known	69_37n	missense	150	17.93	33	SNP	0.000	A
TMEM59L	25789	genome.wustl.edu	37	19	18726791	18726791	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:18726791G>T	ENST00000600490.1	+	5	600	c.415G>T	c.(415-417)Gtc>Ttc	p.V139F	TMEM59L_ENST00000262817.3_Missense_Mutation_p.V139F			Q9UK28	TM59L_HUMAN	transmembrane protein 59-like	139						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(2)	13						CCAGAGAAAGGTCCTGGAGGC	0.537																																						dbGAP											0													103.0	105.0	104.0					19																	18726791		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF186264	CCDS12383.1	19p12	2008-02-05	2007-03-14	2007-03-14		ENSG00000105696			13237	protein-coding gene	gene with protein product			"""chromosome 19 open reading frame 4"""	C19orf4		10527841	Standard	NM_012109		Approved	BSMAP	uc002njy.4	Q9UK28		ENST00000600490.1:c.415G>T	19.37:g.18726791G>T	ENSP00000470879:p.Val139Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Uncharacterised_TMEM59	p.V139F	ENST00000600490.1	37	c.415	CCDS12383.1	19	.	.	.	.	.	.	.	.	.	.	G	13.89	2.370900	0.42003	.	.	ENSG00000105696	ENST00000262817	T	0.42900	0.96	4.96	2.63	0.31362	.	0.505983	0.20817	N	0.085129	T	0.26593	0.0650	N	0.08118	0	0.09310	N	1	D	0.54601	0.967	P	0.50860	0.652	T	0.03597	-1.1021	10	0.44086	T	0.13	-24.2053	4.644	0.12563	0.1995:0.0:0.6077:0.1927	.	139	Q9UK28	TM59L_HUMAN	F	139	ENSP00000262817:V139F	ENSP00000262817:V139F	V	+	1	0	TMEM59L	18587791	0.993000	0.37304	0.976000	0.42696	0.660000	0.38997	2.600000	0.46240	1.086000	0.41228	0.491000	0.48974	GTC	TMEM59L	-	pfam_Uncharacterised_TMEM59	ENSG00000105696		0.537	TMEM59L-001	KNOWN	overlapping_uORF|basic|appris_principal|CCDS	protein_coding	TMEM59L	HGNC	protein_coding	OTTHUMT00000465143.2	51	0.00	0	G			18726791	18726791	+1	no_errors	ENST00000262817	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	0.002	T
TNFRSF1A	7132	genome.wustl.edu	37	12	6443376	6443376	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr12:6443376G>A	ENST00000162749.2	-	2	373	c.74C>T	c.(73-75)tCa>tTa	p.S25L	TNFRSF1A_ENST00000366159.4_Missense_Mutation_p.S25L|TNFRSF1A_ENST00000437813.3_5'UTR|TNFRSF1A_ENST00000540022.1_Missense_Mutation_p.S25L	NM_001065.3	NP_001056.1	P19438	TNR1A_HUMAN	tumor necrosis factor receptor superfamily, member 1A	25					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to estradiol stimulus (GO:0071392)|cellular response to mechanical stimulus (GO:0071260)|cytokine-mediated signaling pathway (GO:0019221)|defense response to bacterium (GO:0042742)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|inflammatory response (GO:0006954)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of apoptotic process (GO:0043066)|negative regulation of gene expression (GO:0010629)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-6 production (GO:0032715)|positive regulation of angiogenesis (GO:0045766)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of inflammatory response (GO:0050729)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|prostaglandin metabolic process (GO:0006693)|protein heterooligomerization (GO:0051291)|response to alkaloid (GO:0043279)|response to amino acid (GO:0043200)|response to ethanol (GO:0045471)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to wounding (GO:0009611)|tetrapyrrole metabolic process (GO:0033013)|viral process (GO:0016032)	axon (GO:0030424)|cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	tumor necrosis factor-activated receptor activity (GO:0005031)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(5)|ovary(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	19						AATAACCCCTGAGGGGTATAT	0.507																																						dbGAP											0													76.0	78.0	77.0					12																	6443376		2203	4300	6503	-	-	-	SO:0001583	missense	0			M75866	CCDS8542.1	12p13.2	2014-09-17			ENSG00000067182	ENSG00000067182		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11916	protein-coding gene	gene with protein product		191190		TNFR1		1655358, 2158863	Standard	NM_001065		Approved	TNF-R, TNFAR, TNFR60, TNF-R-I, CD120a, TNF-R55	uc001qnu.3	P19438	OTTHUMG00000168267	ENST00000162749.2:c.74C>T	12.37:g.6443376G>A	ENSP00000162749:p.Ser25Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4X3|B2RDE4|B3KPQ1|B4DQB7|B4E309|B5M0B5|D3DUR1|Q9UCA4	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,pfam_Death,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_1A	p.S25L	ENST00000162749.2	37	c.74	CCDS8542.1	12	.	.	.	.	.	.	.	.	.	.	G	4.218	0.039259	0.08148	.	.	ENSG00000067182	ENST00000162749;ENST00000540022;ENST00000539372;ENST00000366159;ENST00000440083;ENST00000536194	D;D;D;D;D;D	0.98762	-2.96;-3.06;-3.69;-4.13;-5.12;-5.06	4.0	-1.98	0.07480	.	3.847770	0.00397	N	0.000042	D	0.95050	0.8397	L	0.28274	0.84	0.09310	N	1	B;B;B	0.09022	0.001;0.002;0.001	B;B;B	0.08055	0.001;0.002;0.003	D	0.90851	0.4731	10	0.20046	T	0.44	2.4328	2.8045	0.05424	0.3294:0.0:0.3387:0.3319	.	25;25;25	B5M0B5;F5H061;P19438	.;.;TNR1A_HUMAN	L	25	ENSP00000162749:S25L;ENSP00000438343:S25L;ENSP00000442059:S25L;ENSP00000380389:S25L;ENSP00000413224:S25L;ENSP00000442919:S25L	ENSP00000162749:S25L	S	-	2	0	TNFRSF1A	6313637	0.000000	0.05858	0.001000	0.08648	0.706000	0.40770	0.121000	0.15667	-0.251000	0.09542	0.563000	0.77884	TCA	TNFRSF1A	-	prints_TNFR_1A	ENSG00000067182		0.507	TNFRSF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFRSF1A	HGNC	protein_coding	OTTHUMT00000399038.1	48	0.00	0	G	NM_001065		6443376	6443376	-1	no_errors	ENST00000162749	ensembl	human	known	69_37n	missense	26	33.33	13	SNP	0.000	A
TRAF3	7187	genome.wustl.edu	37	14	103363658	103363658	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:103363658C>T	ENST00000560371.1	+	9	1097	c.880C>T	c.(880-882)Cag>Tag	p.Q294*	TRAF3_ENST00000392745.2_Nonsense_Mutation_p.Q294*|TRAF3_ENST00000351691.5_Nonsense_Mutation_p.Q269*|TRAF3_ENST00000539721.1_Nonsense_Mutation_p.Q211*|TRAF3_ENST00000347662.4_Nonsense_Mutation_p.Q269*	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	294					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		TTTGCACAATCAGATATGTAG	0.308																																						dbGAP											0													59.0	56.0	57.0					14																	103363658		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		ENST00000560371.1:c.880C>T	14.37:g.103363658C>T	ENSP00000454207:p.Gln294*	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Nonsense_Mutation	SNP	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.Q294*	ENST00000560371.1	37	c.880	CCDS9975.1	14	.	.	.	.	.	.	.	.	.	.	C	37	6.291836	0.97449	.	.	ENSG00000131323	ENST00000392745;ENST00000347662;ENST00000351691;ENST00000539721	.	.	.	5.67	5.67	0.87782	.	0.118515	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07325	T	0.83	-43.1422	20.1243	0.97973	0.0:1.0:0.0:0.0	.	.	.	.	X	294;269;294;211	.	ENSP00000328003:Q269X	Q	+	1	0	TRAF3	102433411	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	5.250000	0.65432	2.823000	0.97156	0.591000	0.81541	CAG	TRAF3	-	pirsf_TNF_rcpt--assoc_TRAF	ENSG00000131323		0.308	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3	HGNC	protein_coding	OTTHUMT00000415735.1	46	0.00	0	C	NM_145725		103363658	103363658	+1	no_errors	ENST00000392745	ensembl	human	known	69_37n	nonsense	36	14.29	6	SNP	1.000	T
TRAF3	7187	genome.wustl.edu	37	14	103369680	103369681	+	Frame_Shift_Ins	INS	-	-	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr14:103369680_103369681insA	ENST00000560371.1	+	10	1266_1267	c.1049_1050insA	c.(1048-1053)atgaagfs	p.MK350fs	TRAF3_ENST00000392745.2_Frame_Shift_Ins_p.MK350fs|TRAF3_ENST00000351691.5_Frame_Shift_Ins_p.MK325fs|TRAF3_ENST00000539721.1_Frame_Shift_Ins_p.MK267fs|TRAF3_ENST00000347662.4_Frame_Shift_Ins_p.MK325fs	NM_003300.3|NM_145725.2	NP_003291.2|NP_663777.1	Q13114	TRAF3_HUMAN	TNF receptor-associated factor 3	350					apoptotic process (GO:0006915)|innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|regulation of apoptotic process (GO:0042981)|regulation of cytokine production (GO:0001817)|regulation of defense response to virus (GO:0050688)|regulation of interferon-beta production (GO:0032648)|regulation of proteolysis (GO:0030162)|signal transduction (GO:0007165)|Toll signaling pathway (GO:0008063)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|endosome (GO:0005768)|mitochondrion (GO:0005739)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(10)|liver(2)|lung(7)|ovary(1)|prostate(2)	30		all_cancers(154;7.87e-06)|all_epithelial(191;0.0024)		Epithelial(152;9.92e-24)|all cancers(159;2.23e-21)|OV - Ovarian serous cystadenocarcinoma(161;7.85e-12)|Colorectal(3;0.0971)		GCAGACAGCATGAAGAGCAGCG	0.604																																						dbGAP											0																																										-	-	-	SO:0001589	frameshift_variant	0			U21092	CCDS9975.1, CCDS9976.1, CCDS55946.1	14q32.32	2014-09-17				ENSG00000131323			12033	protein-coding gene	gene with protein product		601896				7530216, 7859281	Standard	NM_145725		Approved	CAP-1, CD40bp, CRAF1, LAP1	uc001ymd.2	Q13114		Exception_encountered	14.37:g.103369680_103369681insA	ENSP00000454207:p.Met350fs	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z8C4|Q12990|Q13076|Q13947|Q6AZX1|Q9UNL1	Frame_Shift_Ins	INS	pfam_MATH,superfamily_TRAF-like,smart_MATH,pirsf_TNF_rcpt--assoc_TRAF,pfscan_MATH,pfscan_Znf_RING,pfscan_Znf_TRAF	p.M350fs	ENST00000560371.1	37	c.1049_1050	CCDS9975.1	14																																																																																			TRAF3	-	pirsf_TNF_rcpt--assoc_TRAF	ENSG00000131323		0.604	TRAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF3	HGNC	protein_coding	OTTHUMT00000415735.1	32	0.00	0	-	NM_145725		103369680	103369681	+1	no_errors	ENST00000392745	ensembl	human	known	69_37n	frame_shift_ins	48	18.64	11	INS	1.000:1.000	A
TRANK1	9881	genome.wustl.edu	37	3	36872506	36872506	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:36872506C>T	ENST00000429976.2	-	21	8683	c.8436G>A	c.(8434-8436)gtG>gtA	p.V2812V	TRANK1_ENST00000428977.2_Silent_p.V2262V|TRANK1_ENST00000301807.6_Silent_p.V2262V	NM_014831.2	NP_055646.2	O15050	TRNK1_HUMAN	tetratricopeptide repeat and ankyrin repeat containing 1	2812							ATP binding (GO:0005524)|hydrolase activity (GO:0016787)			NS(2)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(20)|ovary(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	73						CGATGTCCTGCACCACCAGCT	0.537																																						dbGAP											0													258.0	253.0	255.0					3																	36872506		2110	4227	6337	-	-	-	SO:0001819	synonymous_variant	0			AK096678	CCDS46789.1, CCDS46789.2	3p22.2	2013-01-11			ENSG00000168016	ENSG00000168016		"""Ankyrin repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29011	protein-coding gene	gene with protein product	"""lupus brain antigen 1"", ""KIAA0342"""					9205841	Standard	NM_014831		Approved	LBA1, KIAA0342	uc003cgj.3	O15050	OTTHUMG00000155848	ENST00000429976.2:c.8436G>A	3.37:g.36872506C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N8K0	Silent	SNP	pfam_UvrD-like_ATP-bd,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom	p.V2812	ENST00000429976.2	37	c.8436	CCDS46789.2	3																																																																																			TRANK1	-	NULL	ENSG00000168016		0.537	TRANK1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	TRANK1	HGNC	protein_coding		81	0.00	0	C	NM_014831		36872506	36872506	-1	no_errors	ENST00000429976	ensembl	human	known	69_37n	silent	54	42.55	40	SNP	0.997	T
TRIM13	10206	genome.wustl.edu	37	13	50587116	50587116	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr13:50587116G>A	ENST00000378182.3	+	2	1778	c.1040G>A	c.(1039-1041)tGg>tAg	p.W347*	KCNRG_ENST00000312942.1_5'Flank|TRIM13_ENST00000457662.2_Nonsense_Mutation_p.W347*|TRIM13_ENST00000478111.1_Intron|TRIM13_ENST00000356017.4_Nonsense_Mutation_p.W350*|KCNRG_ENST00000360473.4_5'Flank|TRIM13_ENST00000298772.5_Nonsense_Mutation_p.W350*|TRIM13_ENST00000420995.2_Nonsense_Mutation_p.W347*	NM_001007278.1|NM_005798.3|NM_052811.2|NM_213590.1	NP_001007279.1|NP_005789.2|NP_434698.1|NP_998755.1	O60858	TRI13_HUMAN	tripartite motif containing 13	347					anatomical structure morphogenesis (GO:0009653)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|innate immune response (GO:0045087)|negative regulation of viral release from host cell (GO:1902187)|negative regulation of viral transcription (GO:0032897)|positive regulation of cell death (GO:0010942)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macroautophagy (GO:0016239)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein autoubiquitination (GO:0051865)|response to gamma radiation (GO:0010332)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|perinuclear endoplasmic reticulum (GO:0097038)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			large_intestine(5)|lung(2)|ovary(2)|upper_aerodigestive_tract(1)	10		Acute lymphoblastic leukemia(7;3.41e-06)|Lung NSC(96;3.08e-05)|Breast(56;9.7e-05)|Prostate(109;0.00174)|Hepatocellular(98;0.0207)|Myeloproliferative disorder(33;0.163)|Lung SC(185;0.187)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;1.53e-10)|COAD - Colon adenocarcinoma(199;0.205)		CTGGCAACTTGGAAAGGCTGT	0.383																																						dbGAP											0													147.0	152.0	151.0					13																	50587116		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF220127	CCDS9423.1, CCDS41888.1	13q14	2013-01-09	2011-01-25	2006-09-26	ENSG00000204977	ENSG00000204977		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	9976	protein-coding gene	gene with protein product		605661	"""ret finger protein 2"", ""tripartite motif-containing 13"""	RFP2		9599022	Standard	NM_213590		Approved	Leu5, RNF77, DLEU5	uc001vdp.1	O60858	OTTHUMG00000016926	ENST00000378182.3:c.1040G>A	13.37:g.50587116G>A	ENSP00000367424:p.Trp347*	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RB49|Q5UBW0|Q5W0U8|Q5W0U9|Q9BQ47|Q9C021	Nonsense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.W350*	ENST00000378182.3	37	c.1049	CCDS9423.1	13	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512598	0.85389	.	.	ENSG00000204977	ENST00000420995;ENST00000378182;ENST00000356017;ENST00000457662;ENST00000298772	.	.	.	5.81	5.81	0.92471	.	0.214788	0.42053	D	0.000780	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-3.6104	20.0782	0.97758	0.0:0.0:1.0:0.0	.	.	.	.	X	347;347;350;347;350	.	.	W	+	2	0	TRIM13	49485117	1.000000	0.71417	0.998000	0.56505	0.742000	0.42306	4.668000	0.61568	2.746000	0.94184	0.655000	0.94253	TGG	TRIM13	-	NULL	ENSG00000204977		0.383	TRIM13-005	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	TRIM13	HGNC	protein_coding	OTTHUMT00000354875.1	51	0.00	0	G	NM_001007278		50587116	50587116	+1	no_errors	ENST00000298772	ensembl	human	known	69_37n	nonsense	22	42.11	16	SNP	1.000	A
CFAP70	118491	genome.wustl.edu	37	10	75035266	75035266	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:75035266G>C	ENST00000310715.3	-	23	2941	c.2821C>G	c.(2821-2823)Ctt>Gtt	p.L941V	TTC18_ENST00000401621.2_Missense_Mutation_p.L941V|DNAJC9-AS1_ENST00000440197.2_RNA|TTC18_ENST00000493787.1_5'UTR|TTC18_ENST00000355577.3_Missense_Mutation_p.L410V|TTC18_ENST00000394865.1_Missense_Mutation_p.L941V|TTC18_ENST00000340329.3_Intron	NM_145170.3	NP_660153.3	Q5T0N1	TTC18_HUMAN		941						extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(13)|ovary(2)|prostate(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	Prostate(51;0.0119)					TTCTTCTTAAGAATGTGTGTT	0.478																																						dbGAP											0													222.0	212.0	215.0					10																	75035266		2203	4300	6503	-	-	-	SO:0001583	missense	0																														ENST00000310715.3:c.2821C>G	10.37:g.75035266G>C	ENSP00000310829:p.Leu941Val	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JIZ9|Q5T0M4|Q5T0M9|Q5T0N0|Q69YH9|Q8IYZ8|Q8N7D5|Q8NI30|Q8NI31	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L941V	ENST00000310715.3	37	c.2821	CCDS7324.3	10	.	.	.	.	.	.	.	.	.	.	G	14.35	2.508584	0.44660	.	.	ENSG00000156042	ENST00000310715;ENST00000401621;ENST00000355577;ENST00000433268;ENST00000394865	T;T;T;T	0.63096	-0.02;-0.02;0.19;0.19	5.73	4.83	0.62350	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.64402	D	0.000001	T	0.48059	0.1479	L	0.27053	0.805	0.43835	D	0.996412	P	0.34724	0.465	B	0.39027	0.288	T	0.41161	-0.9524	10	0.26408	T	0.33	-10.2224	7.5712	0.27909	0.0831:0.0:0.7534:0.1634	.	941	Q5T0N1	TTC18_HUMAN	V	941;941;941;348;941	ENSP00000310829:L941V;ENSP00000384479:L941V;ENSP00000409527:L348V;ENSP00000378334:L941V	ENSP00000310829:L941V	L	-	1	0	TTC18	74705272	1.000000	0.71417	1.000000	0.80357	0.697000	0.40408	3.563000	0.53784	1.427000	0.47276	-0.136000	0.14681	CTT	TTC18	-	smart_TPR_repeat,pfscan_TPR-contain_dom	ENSG00000156042		0.478	TTC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTC18	HGNC	protein_coding		84	0.00	0	G			75035266	75035266	-1	no_errors	ENST00000310715	ensembl	human	known	69_37n	missense	145	16.18	28	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179423171	179423171	+	Silent	SNP	C	C	G			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:179423171C>G	ENST00000591111.1	-	277	82316	c.82092G>C	c.(82090-82092)ctG>ctC	p.L27364L	TTN_ENST00000589042.1_Silent_p.L29005L|TTN-AS1_ENST00000592600.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Silent_p.L20065L|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN_ENST00000342992.6_Silent_p.L26437L|TTN_ENST00000342175.6_Silent_p.L20132L|TTN_ENST00000460472.2_Silent_p.L19940L			Q8WZ42	TITIN_HUMAN	titin	27364	Fibronectin type-III 99. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTCTCTCTCAGACCGGAAA	0.438																																						dbGAP											0													97.0	94.0	95.0					2																	179423171		1869	4117	5986	-	-	-	SO:0001819	synonymous_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.82092G>C	2.37:g.179423171C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L26437	ENST00000591111.1	37	c.79311		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	74	0.00	0	C	NM_133378		179423171	179423171	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	silent	133	16.88	27	SNP	1.000	G
TXNRD2	10587	genome.wustl.edu	37	22	19865914	19865914	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr22:19865914C>T	ENST00000400521.1	-	15	1328	c.1322G>A	c.(1321-1323)cGa>cAa	p.R441Q	TXNRD2_ENST00000535882.1_Missense_Mutation_p.R440Q|TXNRD2_ENST00000400518.1_Missense_Mutation_p.R411Q|TXNRD2_ENST00000542719.1_Missense_Mutation_p.R411Q|TXNRD2_ENST00000400519.1_Missense_Mutation_p.R440Q	NM_006440.3	NP_006431.2	Q9NNW7	TRXR2_HUMAN	thioredoxin reductase 2	441					cell redox homeostasis (GO:0045454)|heart development (GO:0007507)|hemopoiesis (GO:0030097)|response to oxygen radical (GO:0000305)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|thioredoxin-disulfide reductase activity (GO:0004791)			breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(12)|ovary(3)|urinary_tract(2)	30	Colorectal(54;0.0993)					GGATGCATCTCGTCCAGCCAC	0.562																																						dbGAP											0													182.0	196.0	191.0					22																	19865914		2119	4239	6358	-	-	-	SO:0001583	missense	0			AF106697	CCDS42981.1, CCDS63402.1	22q11.21	2014-09-17			ENSG00000184470	ENSG00000184470			18155	protein-coding gene	gene with protein product	"""thioredoxin reductase beta"", ""selenoprotein Z"""	606448				9923614, 10215850, 11012661	Standard	NM_006440		Approved	TR, TRXR2, TR3	uc021wlj.1	Q9NNW7	OTTHUMG00000149975	ENST00000400521.1:c.1322G>A	22.37:g.19865914C>T	ENSP00000383365:p.Arg441Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	O95840|Q96IJ2|Q9H2Z5|Q9NZV3|Q9NZV4|Q9P2Y0|Q9P2Y1|Q9UQU8	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_GIDA-rel,superfamily_FAD/NAD-linked_Rdtase_dimer,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,tigrfam_Thioredoxin/glutathione_Rdtase	p.R440Q	ENST00000400521.1	37	c.1319	CCDS42981.1	22	.	.	.	.	.	.	.	.	.	.	C	14.00	2.403863	0.42613	.	.	ENSG00000184470	ENST00000400518;ENST00000538798;ENST00000400521;ENST00000400525;ENST00000540474;ENST00000400519;ENST00000535882;ENST00000542719	D;D;D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04;-3.04;-3.04	5.21	4.18	0.49190	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.175326	0.47852	N	0.000212	D	0.87269	0.6135	L	0.46947	1.48	0.80722	D	1	P;P;P	0.50710	0.938;0.938;0.938	B;B;B	0.37888	0.26;0.26;0.26	D	0.85748	0.1341	10	0.33940	T	0.23	-22.4414	13.3266	0.60463	0.0:0.9206:0.0:0.0794	.	441;440;418	Q9NNW7;D3YTF9;D3YTF8	TRXR2_HUMAN;.;.	Q	411;441;441;418;345;440;440;411	ENSP00000383362:R411Q;ENSP00000383365:R441Q;ENSP00000383369:R418Q;ENSP00000383363:R440Q;ENSP00000439314:R440Q;ENSP00000439570:R411Q	ENSP00000383362:R411Q	R	-	2	0	TXNRD2	18245914	0.902000	0.30710	0.112000	0.21494	0.044000	0.14063	3.222000	0.51223	1.326000	0.45319	0.462000	0.41574	CGA	TXNRD2	-	pfam_Pyr_nucl-diS_OxRdtase_dimer,superfamily_FAD/NAD-linked_Rdtase_dimer,tigrfam_Thioredoxin/glutathione_Rdtase	ENSG00000184470		0.562	TXNRD2-003	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS|seleno	protein_coding	TXNRD2	HGNC	protein_coding	OTTHUMT00000314903.3	33	0.00	0	C	NM_006440		19865914	19865914	-1	no_errors	ENST00000535882	ensembl	human	known	69_37n	missense	14	41.67	10	SNP	0.897	T
UBE2J2	118424	genome.wustl.edu	37	1	1190722	1190722	+	Missense_Mutation	SNP	G	G	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:1190722G>T	ENST00000349431.6	-	7	860	c.641C>A	c.(640-642)cCa>cAa	p.P214Q	UBE2J2_ENST00000400930.4_Missense_Mutation_p.P230Q|UBE2J2_ENST00000491779.1_5'Flank|UBE2J2_ENST00000400929.2_Missense_Mutation_p.P162Q|UBE2J2_ENST00000347370.2_Missense_Mutation_p.P162Q|UBE2J2_ENST00000348298.7_Missense_Mutation_p.P162Q|UBE2J2_ENST00000360466.2_Missense_Mutation_p.P214Q|UBE2J2_ENST00000339385.6_Missense_Mutation_p.P179Q	NM_058167.2	NP_477515.2	Q8N2K1	UB2J2_HUMAN	ubiquitin-conjugating enzyme E2, J2	214				PNLAGLQQANRHHGLLGGALANLFV -> QTSQGSSRPTGT TDSGWRPGELVC (in Ref. 1; AAK52609). {ECO:0000305}.	protein ubiquitination (GO:0016567)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)			cervix(2)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.66e-35)|OV - Ovarian serous cystadenocarcinoma(86;3.53e-21)|Colorectal(212;0.00019)|COAD - Colon adenocarcinoma(227;0.000215)|Kidney(185;0.00255)|BRCA - Breast invasive adenocarcinoma(365;0.00266)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0371)|Lung(427;0.205)		TGCGAGGTTTGGGACGGCCCC	0.642																																						dbGAP											0													82.0	87.0	85.0					1																	1190722		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF296658	CCDS14.1, CCDS15.1, CCDS16.1	1p36.33	2011-05-19	2011-05-19		ENSG00000160087	ENSG00000160087		"""Ubiquitin-conjugating enzymes E2"""	19268	protein-coding gene	gene with protein product			"""ubiquitin-conjugating enzyme E2, J2 (UBC6 homolog, yeast)"""			11278356	Standard	NM_058167		Approved	Ubc6p, NCUBE2	uc001ado.3	Q8N2K1	OTTHUMG00000001911	ENST00000349431.6:c.641C>A	1.37:g.1190722G>T	ENSP00000305826:p.Pro214Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYC7|Q504T9|Q96N26|Q96T84	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.P230Q	ENST00000349431.6	37	c.689	CCDS14.1	1	.	.	.	.	.	.	.	.	.	.	G	12.75	2.031481	0.35797	.	.	ENSG00000160087	ENST00000347370;ENST00000349431;ENST00000339385;ENST00000348298;ENST00000400929;ENST00000360466;ENST00000400930	T;T;T;T;T;T;T	0.72051	0.9;-0.1;0.89;0.9;0.9;-0.1;-0.62	5.85	5.85	0.93711	.	0.213572	0.49305	D	0.000150	T	0.50394	0.1613	N	0.08118	0	0.48511	D	0.999661	B;P;B;P	0.45283	0.055;0.528;0.257;0.855	B;B;B;B	0.38327	0.029;0.189;0.062;0.271	T	0.53337	-0.8453	10	0.11182	T	0.66	-21.6922	19.1498	0.93483	0.0:0.0:1.0:0.0	.	162;230;214;247	A6NGS0;A8MYC7;Q8N2K1;B1AME9	.;.;UB2J2_HUMAN;.	Q	162;214;179;162;162;214;230	ENSP00000344857:P162Q;ENSP00000305826:P214Q;ENSP00000340197:P179Q;ENSP00000342541:P162Q;ENSP00000383718:P162Q;ENSP00000353653:P214Q;ENSP00000383719:P230Q	ENSP00000340197:P179Q	P	-	2	0	UBE2J2	1180585	1.000000	0.71417	0.130000	0.21974	0.008000	0.06430	6.207000	0.72159	2.772000	0.95346	0.655000	0.94253	CCA	UBE2J2	-	NULL	ENSG00000160087		0.642	UBE2J2-001	KNOWN	basic|CCDS	protein_coding	UBE2J2	HGNC	protein_coding	OTTHUMT00000005430.1	25	0.00	0	G	NM_058167		1190722	1190722	-1	no_errors	ENST00000400930	ensembl	human	known	69_37n	missense	11	35.29	6	SNP	0.972	T
VGLL4	9686	genome.wustl.edu	37	3	11623773	11623773	+	Start_Codon_SNP	SNP	T	T	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:11623773T>C	ENST00000451674.2	-	1	92	c.1A>G	c.(1-3)Atg>Gtg	p.M1V	VGLL4_ENST00000404339.1_Intron|VGLL4_ENST00000413604.1_Intron|VGLL4_ENST00000430365.2_Intron|VGLL4_ENST00000273038.3_Intron	NM_001128220.2	NP_001121692.1	Q14135	VGLL4_HUMAN	vestigial-like family member 4	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|endometrium(1)|large_intestine(1)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	10				LUSC - Lung squamous cell carcinoma(1;0.089)|Lung(1;0.111)		ACTTTAATCATTGCCAAAGAG	0.458																																						dbGAP											0													74.0	69.0	71.0					3																	11623773		1568	3581	5149	-	-	-	SO:0001582	initiator_codon_variant	0			D50911	CCDS2606.1, CCDS46754.1, CCDS46755.1, CCDS46756.1, CCDS68342.1, CCDS68343.1	3p25.2	2014-03-03	2014-03-03		ENSG00000144560	ENSG00000144560			28966	protein-coding gene	gene with protein product			"""vestigial like 4 (Drosophila)"""			8590280, 15140898	Standard	NM_001284390		Approved	KIAA0121	uc010hdx.1	Q14135	OTTHUMG00000129739	ENST00000451674.2:c.1A>G	3.37:g.11623773T>C	ENSP00000416615:p.Met1Val	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DTS7|J3KN68|Q7L5V0|Q9BQ78	Missense_Mutation	SNP	smart_TDU_repeat	p.M1V	ENST00000451674.2	37	c.1	CCDS46755.1	3	.	.	.	.	.	.	.	.	.	.	t	14.17	2.456901	0.43634	.	.	ENSG00000144560	ENST00000451674	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	T	0.57902	0.2085	.	.	.	0.80722	D	1	B	0.27140	0.169	B	0.28638	0.092	T	0.60551	-0.7241	7	0.87932	D	0	.	14.6581	0.68850	0.0:0.0:0.0:1.0	.	1	Q14135-6	.	V	1	.	ENSP00000416615:M1V	M	-	1	0	VGLL4	11598773	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.827000	0.55745	1.944000	0.56390	0.524000	0.50904	ATG	VGLL4	-	NULL	ENSG00000144560		0.458	VGLL4-005	PUTATIVE	basic|exp_conf|CCDS	protein_coding	VGLL4	HGNC	protein_coding	OTTHUMT00000339140.2	58	0.00	0	T	NM_014667	Missense_Mutation	11623773	11623773	-1	no_errors	ENST00000451674	ensembl	human	putative	69_37n	missense	22	47.62	20	SNP	1.000	C
VPS13D	55187	genome.wustl.edu	37	1	12389921	12389921	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr1:12389921G>A	ENST00000358136.3	+	37	8363	c.8233G>A	c.(8233-8235)Gaa>Aaa	p.E2745K	VPS13D_ENST00000356315.4_Missense_Mutation_p.E2745K	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		AACTAGCCCTGAAGGCTATGC	0.413																																						dbGAP											0													97.0	89.0	92.0					1																	12389921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.8233G>A	1.37:g.12389921G>A	ENSP00000350854:p.Glu2745Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.E2745K	ENST00000358136.3	37	c.8233	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	G	17.53	3.412497	0.62511	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.48201	0.82;0.82	5.76	5.76	0.90799	.	0.094070	0.64402	D	0.000001	T	0.42630	0.1211	L	0.58669	1.825	0.54753	D	0.999988	B;B;B	0.21606	0.058;0.0;0.0	B;B;B	0.23716	0.048;0.002;0.003	T	0.23368	-1.0190	10	0.09338	T	0.73	.	13.5426	0.61684	0.0712:0.0:0.9288:0.0	.	652;2745;2745	B1AJZ2;Q5THJ4-2;Q5THJ4	.;.;VP13D_HUMAN	K	2745	ENSP00000348666:E2745K;ENSP00000350854:E2745K	ENSP00000348666:E2745K	E	+	1	0	VPS13D	12312508	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.199000	0.77831	2.880000	0.98712	0.650000	0.86243	GAA	VPS13D	-	NULL	ENSG00000048707		0.413	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	54	0.00	0	G	NM_015378		12389921	12389921	+1	no_errors	ENST00000358136	ensembl	human	known	69_37n	missense	44	13.73	7	SNP	1.000	A
WDFY4	57705	genome.wustl.edu	37	10	49931543	49931543	+	Silent	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr10:49931543C>T	ENST00000325239.5	+	4	549	c.522C>T	c.(520-522)ttC>ttT	p.F174F	WDFY4_ENST00000413659.2_Silent_p.F174F|WDFY4_ENST00000360890.2_Silent_p.F174F	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	174						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TTTACCTCTTCTTTGTCTTTC	0.532																																						dbGAP											0													120.0	105.0	110.0					10																	49931543		692	1591	2283	-	-	-	SO:0001819	synonymous_variant	0			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.522C>T	10.37:g.49931543C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F174	ENST00000325239.5	37	c.522	CCDS44385.1	10																																																																																			WDFY4	-	superfamily_ARM-type_fold	ENSG00000128815		0.532	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		55	0.00	0	C	XM_033379		49931543	49931543	+1	no_errors	ENST00000325239	ensembl	human	known	69_37n	silent	53	36.47	31	SNP	0.973	T
WDR16	146845	genome.wustl.edu	37	17	9503393	9503393	+	Missense_Mutation	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr17:9503393G>A	ENST00000352665.5	+	6	715	c.646G>A	c.(646-648)Gat>Aat	p.D216N	WDR16_ENST00000396219.3_Missense_Mutation_p.D148N|WDR16_ENST00000299764.5_Missense_Mutation_p.D226N	NM_145054.4	NP_659491.4			WD repeat domain 16											NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	31						GGTGGATGATGATGATAGCTT	0.493																																						dbGAP											0													172.0	164.0	167.0					17																	9503393		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB065281	CCDS11149.2, CCDS42262.1	17p13.1	2014-08-01			ENSG00000166596	ENSG00000166596		"""WD repeat domain containing"""	16053	protein-coding gene	gene with protein product	"""WD40-repeat protein upregulated in HCC"""	609804				15967112	Standard	NM_001080556		Approved	WDRPUH, FLJ37528	uc002gly.3	Q8N1V2	OTTHUMG00000150149	ENST00000352665.5:c.646G>A	17.37:g.9503393G>A	ENSP00000339449:p.Asp216Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D226N	ENST00000352665.5	37	c.676	CCDS11149.2	17	.	.	.	.	.	.	.	.	.	.	G	13.56	2.274605	0.40194	.	.	ENSG00000166596	ENST00000352665;ENST00000396219;ENST00000299764	T;D;T	0.92911	2.12;-3.13;4.71	5.63	5.63	0.86233	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87505	0.6194	L	0.27053	0.805	0.54753	D	0.999985	P;B;B	0.35174	0.488;0.146;0.389	B;B;B	0.33254	0.126;0.079;0.16	D	0.86274	0.1663	10	0.41790	T	0.15	-28.4887	18.8105	0.92056	0.0:0.0:1.0:0.0	.	226;148;216	Q8N1V2-2;Q8N1V2-3;Q8N1V2	.;.;WDR16_HUMAN	N	216;148;226	ENSP00000339449:D216N;ENSP00000379521:D148N;ENSP00000299764:D226N	ENSP00000299764:D226N	D	+	1	0	WDR16	9444118	1.000000	0.71417	0.938000	0.37757	0.296000	0.27459	7.147000	0.77382	2.805000	0.96524	0.655000	0.94253	GAT	WDR16	-	superfamily_WD40_repeat_dom	ENSG00000166596		0.493	WDR16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR16	HGNC	protein_coding	OTTHUMT00000316569.2	93	0.00	0	G	NM_145054		9503393	9503393	+1	no_errors	ENST00000299764	ensembl	human	known	69_37n	missense	116	25.95	41	SNP	0.995	A
WWP1	11059	genome.wustl.edu	37	8	87437451	87437451	+	Splice_Site	SNP	G	G	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:87437451G>A	ENST00000517970.1	+	10	1368		c.e10-1		WWP1_ENST00000349423.2_Splice_Site|WWP1_ENST00000265428.4_Splice_Site|WWP1_ENST00000341922.2_Splice_Site	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1						central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						TTTTATTAAAGGTGGGAACAA	0.343																																						dbGAP											0													66.0	61.0	63.0					8																	87437451		2203	4299	6502	-	-	-	SO:0001630	splice_region_variant	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.1062-1G>A	8.37:g.87437451G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00307|Q5YLC1|Q96BP4	Splice_Site	SNP	-	e8-1	ENST00000517970.1	37	c.1062-1	CCDS6242.1	8	.	.	.	.	.	.	.	.	.	.	G	21.9	4.210594	0.79240	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	.	.	.	4.55	4.55	0.56014	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.1959	0.89822	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	WWP1	87506567	1.000000	0.71417	0.992000	0.48379	0.995000	0.86356	7.625000	0.83145	2.462000	0.83206	0.650000	0.86243	.	WWP1	-	-	ENSG00000123124		0.343	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1	40	0.00	0	G	NM_007013	Intron	87437451	87437451	+1	no_errors	ENST00000265428	ensembl	human	known	69_37n	splice_site	32	28.89	13	SNP	1.000	A
WWP1	11059	genome.wustl.edu	37	8	87464813	87464813	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:87464813C>T	ENST00000517970.1	+	21	2606	c.2299C>T	c.(2299-2301)Cga>Tga	p.R767*	WWP1_ENST00000349423.2_Nonsense_Mutation_p.R549*|WWP1_ENST00000265428.4_Nonsense_Mutation_p.R767*|WWP1_ENST00000341922.2_Nonsense_Mutation_p.R637*	NM_007013.3	NP_008944.1	Q9H0M0	WWP1_HUMAN	WW domain containing E3 ubiquitin protein ligase 1	767	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				central nervous system development (GO:0007417)|ion transmembrane transport (GO:0034220)|negative regulation of transcription, DNA-templated (GO:0045892)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(3)|kidney(2)|large_intestine(9)|liver(4)|lung(10)|prostate(2)|urinary_tract(1)	31						GCGTTTTTCTCGAGGAGTACA	0.323																																						dbGAP											0													100.0	97.0	98.0					8																	87464813		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AY043361	CCDS6242.1	8q21.3	2013-07-22			ENSG00000123124	ENSG00000123124			17004	protein-coding gene	gene with protein product		602307				9169421, 9647693	Standard	NM_007013		Approved	AIP5, DKFZP434D2111	uc003ydt.3	Q9H0M0	OTTHUMG00000163690	ENST00000517970.1:c.2299C>T	8.37:g.87464813C>T	ENSP00000427793:p.Arg767*	Somatic		WXS	Illumina GAIIx	Phase_IV	O00307|Q5YLC1|Q96BP4	Nonsense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.R767*	ENST00000517970.1	37	c.2299	CCDS6242.1	8	.	.	.	.	.	.	.	.	.	.	C	35	5.456136	0.96223	.	.	ENSG00000123124	ENST00000517970;ENST00000265428;ENST00000341922;ENST00000349423	.	.	.	5.24	5.24	0.73138	.	0.068056	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.1982	0.93698	0.0:1.0:0.0:0.0	.	.	.	.	X	767;767;637;549	.	ENSP00000265428:R767X	R	+	1	2	WWP1	87533929	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.766000	0.55280	2.613000	0.88420	0.650000	0.86243	CGA	WWP1	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT	ENSG00000123124		0.323	WWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WWP1	HGNC	protein_coding	OTTHUMT00000374755.1	88	0.00	0	C	NM_007013		87464813	87464813	+1	no_errors	ENST00000265428	ensembl	human	known	69_37n	nonsense	120	18.37	27	SNP	1.000	T
ZFP41	286128	genome.wustl.edu	37	8	144332515	144332515	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr8:144332515G>C	ENST00000330701.4	+	2	871	c.502G>C	c.(502-504)Gag>Cag	p.E168Q	ZFP41_ENST00000522452.1_Missense_Mutation_p.E168Q|ZFP41_ENST00000520584.1_Missense_Mutation_p.E168Q	NM_173832.4	NP_776193.1	Q8N8Y5	ZFP41_HUMAN	ZFP41 zinc finger protein	168					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|lung(4)|ovary(1)	8	all_cancers(97;1.01e-10)|all_epithelial(106;4.6e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000459)|Ovarian(258;0.0212)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.156)|Colorectal(110;0.173)			GCACACCGGGGAGAAGCCCTA	0.582																																						dbGAP											0													82.0	91.0	88.0					8																	144332515		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS6397.1	8q24.3	2013-01-08	2012-11-27		ENSG00000181638	ENSG00000181638		"""Zinc fingers, C2H2-type"""	26786	protein-coding gene	gene with protein product			"""zinc finger protein 41 homolog (mouse)"""			11214971	Standard	NM_173832		Approved	FLJ38705, FLJ00028, ZNF753	uc003yxw.4	Q8N8Y5	OTTHUMG00000164951	ENST00000330701.4:c.502G>C	8.37:g.144332515G>C	ENSP00000327427:p.Glu168Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DWJ5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E168Q	ENST00000330701.4	37	c.502	CCDS6397.1	8	.	.	.	.	.	.	.	.	.	.	G	19.82	3.898233	0.72639	.	.	ENSG00000181638	ENST00000520584;ENST00000330701;ENST00000522452	T;T;T	0.25912	1.77;1.77;1.77	3.3	3.3	0.37823	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45816	0.1361	M	0.63169	1.94	0.38772	D	0.954579	D	0.89917	1.0	D	0.79784	0.993	T	0.53222	-0.8469	9	0.72032	D	0.01	-26.9048	12.4584	0.55718	0.0:0.0:1.0:0.0	.	168	Q8N8Y5	ZFP41_HUMAN	Q	168	ENSP00000430465:E168Q;ENSP00000327427:E168Q;ENSP00000428966:E168Q	ENSP00000327427:E168Q	E	+	1	0	ZFP41	144403890	1.000000	0.71417	0.949000	0.38748	0.654000	0.38779	6.684000	0.74538	1.848000	0.53677	0.467000	0.42956	GAG	ZFP41	-	pfscan_Znf_C2H2	ENSG00000181638		0.582	ZFP41-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	ZFP41	Clone_based_vega_gene	protein_coding	OTTHUMT00000381114.2	23	0.00	0	G	NM_173832		144332515	144332515	+1	no_errors	ENST00000330701	ensembl	human	known	69_37n	missense	25	21.88	7	SNP	1.000	C
ZFP64	55734	genome.wustl.edu	37	20	50769283	50769283	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr20:50769283G>C	ENST00000216923.4	-	6	1797	c.1448C>G	c.(1447-1449)cCc>cGc	p.P483R	ZFP64_ENST00000346617.4_Missense_Mutation_p.P429R|ZFP64_ENST00000361387.2_Intron|ZFP64_ENST00000371515.4_Missense_Mutation_p.P481R|ZFP64_ENST00000477786.1_Intron|ZFP64_ENST00000371518.2_Intron	NM_018197.2|NM_199426.1	NP_060667.2|NP_955458.1	Q9NPA5	ZF64A_HUMAN	ZFP64 zinc finger protein	483					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(5)|large_intestine(8)|lung(11)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	33						GGGCTGGAGGGGCACCTGGAG	0.617																																						dbGAP											0													41.0	38.0	39.0					20																	50769283		2202	4296	6498	-	-	-	SO:0001583	missense	0			AK001596	CCDS13439.1, CCDS13440.1, CCDS13441.1, CCDS13442.1	20q13.11-q13.13	2013-01-08	2012-11-27		ENSG00000020256	ENSG00000020256		"""Zinc fingers, C2H2-type"""	15940	protein-coding gene	gene with protein product			"""zinc finger protein 338"", ""zinc finger protein 64 homolog (mouse)"", ""zinc finger protein 64"""	ZNF338		9034307	Standard	NM_199427		Approved	FLJ10734, dJ831D17.1, FLJ12628, dJ548G19.1	uc002xwl.3	Q9NPA5	OTTHUMG00000032756	ENST00000216923.4:c.1448C>G	20.37:g.50769283G>C	ENSP00000216923:p.Pro483Arg	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NTS7|Q9NVH4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P483R	ENST00000216923.4	37	c.1448	CCDS13440.1	20	.	.	.	.	.	.	.	.	.	.	G	15.69	2.908740	0.52439	.	.	ENSG00000020256	ENST00000216923;ENST00000346617;ENST00000371515;ENST00000546083;ENST00000371516	T;T;T	0.09911	2.93;3.07;3.03	5.57	5.57	0.84162	.	0.000000	0.64402	D	0.000014	T	0.25382	0.0617	L	0.32530	0.975	0.58432	D	0.999991	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.98;0.98	T	0.00579	-1.1661	10	0.48119	T	0.1	-23.8559	19.563	0.95380	0.0:0.0:1.0:0.0	.	429;481;483	Q9NPA5-2;Q5JWM1;Q9NPA5	.;.;ZF64A_HUMAN	R	483;429;481;325;636	ENSP00000216923:P483R;ENSP00000344615:P429R;ENSP00000360570:P481R	ENSP00000216923:P483R	P	-	2	0	ZFP64	50202690	1.000000	0.71417	0.997000	0.53966	0.117000	0.20001	9.397000	0.97276	2.619000	0.88677	0.650000	0.86243	CCC	ZFP64	-	NULL	ENSG00000020256		0.617	ZFP64-003	KNOWN	basic|CCDS	protein_coding	ZFP64	HGNC	protein_coding	OTTHUMT00000079744.1	15	0.00	0	G	NM_018197		50769283	50769283	-1	no_errors	ENST00000216923	ensembl	human	known	69_37n	missense	10	33.33	5	SNP	1.000	C
ZFYVE28	57732	genome.wustl.edu	37	4	2306914	2306914	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr4:2306914G>C	ENST00000290974.2	-	8	1492	c.1153C>G	c.(1153-1155)Cca>Gca	p.P385A	ZFYVE28_ENST00000511071.1_Missense_Mutation_p.P355A|ZFYVE28_ENST00000515312.1_Missense_Mutation_p.P315A|RP11-478C1.7_ENST00000510632.1_RNA	NM_020972.2	NP_066023.2	Q9HCC9	LST2_HUMAN	zinc finger, FYVE domain containing 28	385					negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)	metal ion binding (GO:0046872)|phosphatidylinositol-3-phosphate binding (GO:0032266)			NS(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(17)|ovary(1)|pancreas(1)|prostate(1)|skin(4)	31						GGTCTACCTGGAGAGGCCTCC	0.682																																						dbGAP											0													42.0	41.0	41.0					4																	2306914		2202	4298	6500	-	-	-	SO:0001583	missense	0			AK126692	CCDS33942.1, CCDS54708.1, CCDS54709.1, CCDS54710.1, CCDS54711.1, CCDS54712.1	4p16.3	2008-05-02			ENSG00000159733	ENSG00000159733		"""Zinc fingers, FYVE domain containing"""	29334	protein-coding gene	gene with protein product		614176				10997877	Standard	NM_020972		Approved	KIAA1643	uc003gex.2	Q9HCC9	OTTHUMG00000160292	ENST00000290974.2:c.1153C>G	4.37:g.2306914G>C	ENSP00000290974:p.Pro385Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RP83|B3KX50|B7Z1Q7|B7Z2G9|B7Z2M2|B7ZB19|E9PB54|E9PB64|E9PG77|Q7Z6J3	Missense_Mutation	SNP	pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel	p.P385A	ENST00000290974.2	37	c.1153	CCDS33942.1	4	.	.	.	.	.	.	.	.	.	.	G	17.35	3.367643	0.61513	.	.	ENSG00000159733	ENST00000290974;ENST00000511071;ENST00000515312	T;T;T	0.61040	0.22;0.14;0.21	5.35	5.35	0.76521	.	0.163418	0.56097	D	0.000032	T	0.74642	0.3743	M	0.64997	1.995	0.80722	D	1	D;D	0.89917	1.0;0.962	D;P	0.87578	0.998;0.687	T	0.76465	-0.2949	10	0.66056	D	0.02	.	18.097	0.89493	0.0:0.0:1.0:0.0	.	355;385	Q9HCC9-2;Q9HCC9	.;LST2_HUMAN	A	385;355;315	ENSP00000290974:P385A;ENSP00000425706:P355A;ENSP00000426299:P315A	ENSP00000290974:P385A	P	-	1	0	ZFYVE28	2276712	1.000000	0.71417	0.884000	0.34674	0.173000	0.22820	6.848000	0.75409	2.524000	0.85096	0.537000	0.68136	CCA	ZFYVE28	-	NULL	ENSG00000159733		0.682	ZFYVE28-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZFYVE28	HGNC	protein_coding	OTTHUMT00000360078.1	10	0.00	0	G	XM_035371		2306914	2306914	-1	no_errors	ENST00000290974	ensembl	human	known	69_37n	missense	14	26.32	5	SNP	1.000	C
ZKSCAN7	55888	genome.wustl.edu	37	3	44612804	44612804	+	Silent	SNP	T	T	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr3:44612804T>C	ENST00000273320.3	+	6	2631	c.2202T>C	c.(2200-2202)ttT>ttC	p.F734F	ZKSCAN7_ENST00000426540.1_Silent_p.F734F|RP11-944L7.5_ENST00000419137.1_Intron|ZKSCAN7_ENST00000431636.1_Intron|RP11-944L7.4_ENST00000457331.1_RNA|ZKSCAN7_ENST00000341840.3_Intron	NM_018651.2	NP_061121.2	Q9P0L1	ZKSC7_HUMAN	zinc finger with KRAB and SCAN domains 7	734					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)										GTTCCACTTTTAATCACCACC	0.473																																						dbGAP											0													96.0	94.0	94.0					3																	44612804		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L32164, AY280798	CCDS2714.1, CCDS2715.1, CCDS74924.1	3p21.32	2013-01-09	2013-01-09	2013-01-09	ENSG00000196345	ENSG00000196345		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	12955	protein-coding gene	gene with protein product			"""zinc finger protein 64"", ""zinc finger protein 448"", ""zinc finger protein 167"""	ZNF64, ZNF448, ZNF167		7814019, 1505991	Standard	XM_005265323		Approved	FLJ12738, ZSCAN39	uc003cnj.3	Q9P0L1	OTTHUMG00000133094	ENST00000273320.3:c.2202T>C	3.37:g.44612804T>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJV3|A8K5H0|Q6WL09|Q96FQ2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,pfam_Krueppel-associated_box,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box,pfscan_Tscrpt_reg_SCAN	p.F734	ENST00000273320.3	37	c.2202	CCDS2715.1	3																																																																																			ZNF167	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000196345		0.473	ZKSCAN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF167	HGNC	protein_coding	OTTHUMT00000256752.4	54	0.00	0	T	NM_018651		44612804	44612804	+1	no_errors	ENST00000273320	ensembl	human	known	69_37n	silent	41	29.31	17	SNP	0.010	C
ZNF17	7565	genome.wustl.edu	37	19	57931692	57931692	+	Missense_Mutation	SNP	G	G	C			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:57931692G>C	ENST00000601808.1	+	3	1045	c.832G>C	c.(832-834)Gaa>Caa	p.E278Q	AC004076.7_ENST00000597410.1_Intron|ZNF17_ENST00000307658.7_Missense_Mutation_p.E280Q	NM_006959.2	NP_008890.2	P17021	ZNF17_HUMAN	zinc finger protein 17	278					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Colorectal(82;5.46e-05)|all_neural(62;0.0218)|Ovarian(87;0.0694)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.0234)|GBM - Glioblastoma multiforme(193;0.000426)|Lung(386;0.176)		TGAGTGCAGTGAATGTGGGAA	0.443																																					Melanoma(149;1637 1853 29914 42869 44988)	dbGAP											0													75.0	80.0	78.0					19																	57931692		2203	4300	6503	-	-	-	SO:0001583	missense	0			X52341	CCDS42636.1	19q13.43	2013-01-08	2006-05-10			ENSG00000186272		"""Zinc fingers, C2H2-type"", ""-"""	12958	protein-coding gene	gene with protein product			"""zinc finger protein 17 (HPF3, KOX 10)"""			2115127, 2014798	Standard	NM_006959		Approved	HPF3, KOX10, KIAA1947, FLJ40864, FLJ46058, FLJ46615	uc002qoo.1	P17021		ENST00000601808.1:c.832G>C	19.37:g.57931692G>C	ENSP00000471905:p.Glu278Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXU2|B3KY20|Q8N7M1|Q8N893|Q8TF54	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E278Q	ENST00000601808.1	37	c.832	CCDS42636.1	19	.	.	.	.	.	.	.	.	.	.	G	5.076	0.199672	0.09652	.	.	ENSG00000186272	ENST00000307658	.	.	.	1.7	-1.83	0.07833	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.16085	0.0387	N	0.12831	0.26	0.09310	N	1	P;B	0.44627	0.839;0.095	B;B	0.42495	0.389;0.057	T	0.17653	-1.0362	8	0.37606	T	0.19	.	6.8287	0.23897	0.3962:0.0:0.6038:0.0	.	280;278	P17021-2;P17021	.;ZNF17_HUMAN	Q	278	.	ENSP00000302455:E278Q	E	+	1	0	ZNF17	62623504	0.000000	0.05858	0.005000	0.12908	0.024000	0.10985	-1.434000	0.02425	-0.457000	0.07033	-0.145000	0.13849	GAA	ZNF17	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000186272		0.443	ZNF17-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF17	HGNC	protein_coding	OTTHUMT00000466384.1	55	0.00	0	G	NM_006959		57931692	57931692	+1	no_errors	ENST00000307658	ensembl	human	known	69_37n	missense	93	18.42	21	SNP	0.012	C
ZNF2	7549	genome.wustl.edu	37	2	95847133	95847133	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr2:95847133C>T	ENST00000340539.5	+	5	1022	c.560C>T	c.(559-561)tCa>tTa	p.S187L	ZNF2_ENST00000425369.1_Missense_Mutation_p.S107L|ZNF2_ENST00000398107.2_Missense_Mutation_p.S145L|ZNF2_ENST00000453539.2_Missense_Mutation_p.S200L|ZNF2_ENST00000295210.6_Missense_Mutation_p.S149L	NM_021088.2	NP_066574	Q9BSG1	ZNF2_HUMAN	zinc finger protein 2	187					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(4)|lung(3)|upper_aerodigestive_tract(1)	12		Ovarian(717;0.00768)		READ - Rectum adenocarcinoma(193;0.0222)		TTTGACCACTCATCCCTCACC	0.572																																						dbGAP											0													55.0	64.0	61.0					2																	95847133		2194	4297	6491	-	-	-	SO:0001583	missense	0			X60152	CCDS42712.1, CCDS42713.1, CCDS62957.1	2q11.1	2013-09-24	2005-02-07		ENSG00000163067	ENSG00000275111		"""Zinc fingers, C2H2-type"", ""-"""	12991	protein-coding gene	gene with protein product		194500	"""zinc finger protein 2 (A1-5)"""			8183940, 1945843	Standard	NM_021088		Approved	A1-5, ZNF661, Zfp661	uc002suf.3	Q9BSG1	OTTHUMG00000155150	ENST00000340539.5:c.560C>T	2.37:g.95847133C>T	ENSP00000345392:p.Ser187Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MWV7|B4DIR4|Q4ZFY6|Q96G44|Q9UMC5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S187L	ENST00000340539.5	37	c.560	CCDS42712.1	2	.	.	.	.	.	.	.	.	.	.	C	11.85	1.763027	0.31228	.	.	ENSG00000163067	ENST00000398107;ENST00000340539;ENST00000425369;ENST00000295210;ENST00000453539	T;T;T;T;T	0.07444	3.19;3.19;3.19;3.19;3.19	5.53	5.53	0.82687	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42053	D	0.000778	T	0.14356	0.0347	M	0.80847	2.515	0.09310	N	1	B;B;P	0.35077	0.128;0.011;0.483	B;B;B	0.27887	0.03;0.015;0.084	T	0.13282	-1.0515	10	0.72032	D	0.01	-9.1568	17.004	0.86388	0.0:1.0:0.0:0.0	.	149;145;186	B4DIR4;A8MWV7;Q9BSG1	.;.;ZNF2_HUMAN	L	145;187;107;149;200	ENSP00000381178:S145L;ENSP00000345392:S187L;ENSP00000406017:S107L;ENSP00000295210:S149L;ENSP00000411051:S200L	ENSP00000295210:S149L	S	+	2	0	ZNF2	95210860	0.000000	0.05858	0.970000	0.41538	0.539000	0.34962	0.688000	0.25422	2.882000	0.98803	0.655000	0.94253	TCA	ZNF2	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000163067		0.572	ZNF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF2	HGNC	protein_coding	OTTHUMT00000338595.2	27	0.00	0	C	NM_021088		95847133	95847133	+1	no_errors	ENST00000340539	ensembl	human	known	69_37n	missense	32	20.00	8	SNP	0.007	T
ZNF675	171392	genome.wustl.edu	37	19	23844973	23844973	+	Missense_Mutation	SNP	C	C	T			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:23844973C>T	ENST00000359788.4	-	3	337	c.169G>A	c.(169-171)Gag>Aag	p.E57K	ZNF675_ENST00000601935.1_Missense_Mutation_p.E57K|ZNF675_ENST00000601010.1_Missense_Mutation_p.E57K|ZNF675_ENST00000596211.1_Missense_Mutation_p.E57K|ZNF675_ENST00000600313.1_Missense_Mutation_p.E57K|ZNF675_ENST00000599168.1_Missense_Mutation_p.E57K	NM_138330.2	NP_612203.2	Q8TD23	ZN675_HUMAN	zinc finger protein 675	57	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				bone resorption (GO:0045453)|cytokine-mediated signaling pathway (GO:0019221)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of interleukin-1-mediated signaling pathway (GO:2000660)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription regulatory region DNA binding (GO:2000678)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	DNA binding (GO:0003677)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(8)|lung(11)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	27		all_lung(12;0.11)|Lung NSC(12;0.163)|all_epithelial(12;0.206)				TTTTCTTGCTCCAGACAGGTG	0.378																																						dbGAP											0													124.0	124.0	124.0					19																	23844973		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS32981.1	19p12	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	30768	protein-coding gene	gene with protein product	"""TRAF6 inhibitory zinc finger"""					11751921	Standard	NM_138330		Approved	TIZ, TBZF	uc002nri.3	Q8TD23		ENST00000359788.4:c.169G>A	19.37:g.23844973C>T	ENSP00000352836:p.Glu57Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N211	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E57K	ENST00000359788.4	37	c.169	CCDS32981.1	19	.	.	.	.	.	.	.	.	.	.	.	8.763	0.924095	0.18056	.	.	ENSG00000197372	ENST00000359788	T	0.01068	5.38	0.916	0.916	0.19373	Krueppel-associated box (3);	.	.	.	.	T	0.01940	0.0061	M	0.77712	2.385	0.09310	N	1	B	0.24882	0.113	B	0.24006	0.05	T	0.36601	-0.9741	9	0.54805	T	0.06	.	4.9698	0.14110	0.0:1.0:0.0:0.0	.	57	Q8TD23	ZN675_HUMAN	K	57	ENSP00000352836:E57K	ENSP00000352836:E57K	E	-	1	0	ZNF675	23636813	0.697000	0.27767	0.067000	0.19924	0.068000	0.16541	0.280000	0.18790	0.300000	0.22699	0.305000	0.20034	GAG	ZNF675	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000197372		0.378	ZNF675-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF675	HGNC	protein_coding	OTTHUMT00000466433.1	118	0.00	0	C	NM_138330		23844973	23844973	-1	no_errors	ENST00000359788	ensembl	human	known	69_37n	missense	217	11.02	27	SNP	0.108	T
ZNF304	57343	genome.wustl.edu	37	19	57869175	57869175	+	Missense_Mutation	SNP	C	C	A			TCGA-C8-A274-01A-11D-A16D-09	TCGA-C8-A274-10A-01D-A16D-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	5e6e7c20-47b3-4f0e-a3c7-8293993e39cf	88dcd89c-7af1-48c2-9973-4ffee5c6ee50	g.chr19:57869175C>A	ENST00000282286.5	+	3	2111	c.1938C>A	c.(1936-1938)aaC>aaA	p.N646K	ZNF304_ENST00000391705.3_Missense_Mutation_p.N646K|ZNF304_ENST00000443917.2_Missense_Mutation_p.N693K|ZNF304_ENST00000598744.1_Missense_Mutation_p.N604K			Q9HCX3	ZN304_HUMAN	zinc finger protein 304	646					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(15)|ovary(1)	26		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0265)		ACGAGTGCAACAGTTTTGGTG	0.438																																						dbGAP											0													129.0	133.0	132.0					19																	57869175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ276316	CCDS12950.1, CCDS74462.1	19q13.4	2013-01-08				ENSG00000131845		"""Zinc fingers, C2H2-type"", ""-"""	13505	protein-coding gene	gene with protein product		613840					Standard	XM_005259090		Approved		uc010ygw.2	Q9HCX3		ENST00000282286.5:c.1938C>A	19.37:g.57869175C>A	ENSP00000282286:p.Asn646Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N693K	ENST00000282286.5	37	c.2079	CCDS12950.1	19	.	.	.	.	.	.	.	.	.	.	C	9.598	1.128058	0.20959	.	.	ENSG00000131845	ENST00000282286;ENST00000391705;ENST00000443917	T;T;T	0.27890	1.64;1.64;1.64	3.59	-4.32	0.03688	.	.	.	.	.	T	0.15782	0.0380	L	0.38649	1.16	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.004	T	0.38329	-0.9666	9	0.08381	T	0.77	.	4.3703	0.11244	0.241:0.3453:0.0:0.4137	.	646;693	Q9HCX3;E7EQD3	ZN304_HUMAN;.	K	646;646;693	ENSP00000282286:N646K;ENSP00000375586:N646K;ENSP00000401642:N693K	ENSP00000282286:N646K	N	+	3	2	ZNF304	62560987	.	.	0.000000	0.03702	0.104000	0.19210	.	.	-0.733000	0.04850	0.650000	0.86243	AAC	ZNF304	-	NULL	ENSG00000131845		0.438	ZNF304-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF304	HGNC	protein_coding	OTTHUMT00000465785.1	65	0.00	0	C			57869175	57869175	+1	no_errors	ENST00000443917	ensembl	human	known	69_37n	missense	52	35.00	28	SNP	0.000	A
